WorldWideScience

Sample records for promoter region modulates

  1. Photovoltaic module with adhesion promoter

    Science.gov (United States)

    Xavier, Grace

    2013-10-08

    Photovoltaic modules with adhesion promoters and methods for fabricating photovoltaic modules with adhesion promoters are described. A photovoltaic module includes a solar cell including a first surface and a second surface, the second surface including a plurality of interspaced back-side contacts. A first glass layer is coupled to the first surface by a first encapsulating layer. A second glass layer is coupled to the second surface by a second encapsulating layer. At least a portion of the second encapsulating layer is bonded directly to the plurality of interspaced back-side contacts by an adhesion promoter.

  2. Promoting regional mobility

    DEFF Research Database (Denmark)

    Jensen, Anne

    Pricing of transport has been part of EU's common transport policy since this gained momentum in the early 1990s. Since then, it has been closely connected to the trans-European transport network (TEN-T) and to rising demands of efficient mobility systems at a local, regional and Community scale....... Development of pricing policies is contested at Community level and has taken place in a clash between different policy rationalities. Significantly though, the effects of the pricing policies are closely related to regional mobility systems, e.g. through financing large trans-border infrastructure projects...... and establishing common technical charging systems thus changing the conditions for regional mobility. This paper explores how policies of infrastructure pricing shape new ways of governing mobility which influences trans-border, regional policy-making. The key findings are that there is a tendency to include...

  3. Mechanosensitive promoter region in the human HB-GAM gene

    DEFF Research Database (Denmark)

    Liedert, Astrid; Kassem, Moustapha; Claes, Lutz

    2009-01-01

    Mechanical loading is essential for maintaining bone mass in the adult skeleton. However, the underlying process of the transfer of the physical stimulus into a biochemical response, which is termed mechanotransduction is poorly understood. Mechanotransduction results in the modulation of gene...... cells. Analysis of the human HB-GAM gene upstream regulatory region with luciferase reporter gene assays revealed that the upregulation of HB-GAM expression occurred at the transcriptional level and was mainly dependent on the HB-GAM promoter region most upstream containing three potential AP-1 binding...

  4. Cosmic ray modulation and merged interaction regions

    International Nuclear Information System (INIS)

    Burlaga, L.F.; Goldstein, M.L.; Mcdonald, F.B.

    1985-01-01

    Beyond several AU, interactions among shocks and streams give rise to merged interaction regions in which the magnetic field is turbulent. The integral intensity of . 75 MeV/Nuc cosmic rays at Voyager is generally observed to decrease when a merged interaction region moves past the spacecraft and to increase during the passage of a rarefaction region. When the separation between interaction regions is relatively large, the cosmic ray intensity tends to increase on a scale of a few months. This was the case at Voyager 1 from July 1, 1983 to May 1, 1984, when the spacecraft moved from 16.7 to 19.6 AU. Changes in cosmic ray intensity were related to the magnetic field strength in a simple way. It is estimated that the diffusion coefficient in merged interaction regions at this distance is similar to 0.6 x 10 to the 22nd power sq cm/s

  5. Selective Androgen Receptor Modulators (SARMs) as Function Promoting Therapies

    Science.gov (United States)

    Bhasin, Shalender; Jasuja, Ravi

    2010-01-01

    Purpose of review The last decade has witnessed unprecedented discovery effort to develop selective androgen receptor modulators (SARMs) that improve physical function and bone health without adversely affecting the prostate and cardiovascular outcomes. This review describes the historical evolution, the rationale for SARM development, and the mechanisms of testosterone action and SARM selectivity. Recent Findings While steroidal SARMs have been around since the 1940s, a number of nonsteroidal SARMs that do not serve as substrates for CYP19 aromatase or 5α-reductase, act as full agonists in muscle and bone and as partial agonists in prostate are in development. The differing interactions of steroidal and nonsteroidal compounds with AR contribute to their unique pharmacologic actions. Ligand binding induces specific conformational changes in the ligand binding domain, which could modulate surface topology and protein-protein interactions between AR and coregulators, resulting in tissue-specific gene regulation. Preclinical studies have demonstrated the ability of SARMs to increase muscle and bone mass in preclinical rodent models with varying degree of prostate sparing. Phase I trials of SARMs in humans have reported modest increments in fat-free mass. Summary SARMs hold promise as a new class of function promoting anabolic therapies for a number of clinical indications, including functional limitations associated with aging and chronic disease, frailty, cancer cachexia, and osteoporosis. PMID:19357508

  6. Selective androgen receptor modulators as function promoting therapies.

    Science.gov (United States)

    Bhasin, Shalender; Jasuja, Ravi

    2009-05-01

    The past decade has witnessed an unprecedented discovery effort to develop selective androgen receptor modulators (SARMs) that improve physical function and bone health without adversely affecting the prostate and cardiovascular outcomes. This review describes the historical evolution, the rationale for SARM development, and the mechanisms of testosterone action and SARM selectivity. Although steroidal SARMs have been around since the 1940s, a number of nonsteroidal SARMs that do not serve as substrates for CYP19 aromatase or 5alpha-reductase, act as full agonists in muscle and bone and as partial agonists in prostate are in development. The differing interactions of steroidal and nonsteroidal compounds with androgen receptor (AR) contribute to their unique pharmacologic actions. Ligand binding induces specific conformational changes in the ligand-binding domain, which could modulate surface topology and protein-protein interactions between AR and coregulators, resulting in tissue-specific gene regulation. Preclinical studies have demonstrated the ability of SARMs to increase muscle and bone mass in preclinical rodent models with varying degree of prostate sparing. Phase I trials of SARMs in humans have reported modest increments in fat-free mass. SARMs hold promise as a new class of function promoting anabolic therapies for a number of clinical indications, including functional limitations associated with aging and chronic disease, frailty, cancer cachexia, and osteoporosis.

  7. Unveiling DNA structural properties of promoter regions of ...

    Indian Academy of Sciences (India)

    Aditya Kumar

    Unveiling DNA structural properties of promoter regions of prokaryotic transcriptome and their role in gene expression. Aditya Kumar. Assistant Professor. Molecular Biology & Biotechnology. Tezpur University. Tezpur – 784028, Assam ...

  8. Identification and annotation of promoter regions in microbial ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    2007-06-15

    Jun 15, 2007 ... It remains important, not only to detect rarely expressed genes but also for ... well as in identifying genes associated with rRNA, tRNA and ... DNA stability; free energy calculation; promoter; upstream and downstream region.

  9. Promoting tissue regeneration by modulating the immune system.

    Science.gov (United States)

    Julier, Ziad; Park, Anthony J; Briquez, Priscilla S; Martino, Mikaël M

    2017-04-15

    The immune system plays a central role in tissue repair and regeneration. Indeed, the immune response to tissue injury is crucial in determining the speed and the outcome of the healing process, including the extent of scarring and the restoration of organ function. Therefore, controlling immune components via biomaterials and drug delivery systems is becoming an attractive approach in regenerative medicine, since therapies based on stem cells and growth factors have not yet proven to be broadly effective in the clinic. To integrate the immune system into regenerative strategies, one of the first challenges is to understand the precise functions of the different immune components during the tissue healing process. While remarkable progress has been made, the immune mechanisms involved are still elusive, and there is indication for both negative and positive roles depending on the tissue type or organ and life stage. It is well recognized that the innate immune response comprising danger signals, neutrophils and macrophages modulates tissue healing. In addition, it is becoming evident that the adaptive immune response, in particular T cell subset activities, plays a critical role. In this review, we first present an overview of the basic immune mechanisms involved in tissue repair and regeneration. Then, we highlight various approaches based on biomaterials and drug delivery systems that aim at modulating these mechanisms to limit fibrosis and promote regeneration. We propose that the next generation of regenerative therapies may evolve from typical biomaterial-, stem cell-, or growth factor-centric approaches to an immune-centric approach. Most regenerative strategies have not yet proven to be safe or reasonably efficient in the clinic. In addition to stem cells and growth factors, the immune system plays a crucial role in the tissue healing process. Here, we propose that controlling the immune-mediated mechanisms of tissue repair and regeneration may support

  10. [Health-Promoting Schools Regional Initiative of the Americas].

    Science.gov (United States)

    Ippolito-Shepherd, Josefa; Cerqueira, Maria Teresa; Ortega, Diana Patricia

    2005-01-01

    In Latin America, comprehensive health promotion programmes and activities are being implemented in the school setting, which take into account the conceptual framework of the Health-Promoting Schools Regional Initiative of the Pan American Health Organization, Regional office of the World Health Organization (PAHO/WHO). These programmes help to strengthen the working relationships between the health and education sectors. The Health-Promoting Schools Regional Initiative, officially launched by PAHO/WHO in 1995, aims to form future generations to have the knowledge, abilities, and skills necessary for promoting and caring for their health and that of their family and community, as well as to create and maintain healthy environments and communities. The Initiative focuses on three main components: comprehensive health education, the creation and maintenance of healthy physical and psychosocial environments, and the access to health and nutrition services, mental health, and active life. In 2001, PAHO conducted a survey in 19 Latin American countries to assess the status and trends of Health-Promoting Schools in the Region, for the appropriate regional, subregional, and national planning of pertinent health promotion and health education programmes and activities. The results of this survey provided information about policies and national plans, multisectoral coordination mechanisms for the support of health promotion in the school settings, the formation and participation in national and international networks of Health-Promoting Schools and about the level of dissemination of the strategy. For the successful development of Health-Promoting Schools is essential to involve the society as a whole, in order to mobilise human resources and materials necessary for implementing health promotion in the school settings. Thus, the constitution and consolidation of networks has been a facilitating mechanism for the exchange of ideas, resources and experiences to strengthen

  11. Identification and annotation of promoter regions in microbial

    Indian Academy of Sciences (India)

    2007-06-15

    Jun 15, 2007 ... Analysis of various predicted structural properties of promoter regions in prokaryotic as well as eukaryotic genomes had earlier indicated that they have several common features, such as lower stability, higher curvature and less bendability, when compared with their neighboring regions. Based on the ...

  12. Perspectives on Promoting Regional Renewable Energy Research and Development

    International Nuclear Information System (INIS)

    Dresselhaus, M.

    2008-01-01

    Recent discussions at the Washington International Renewable Energy Conference (WIREC), hosted in March 2008 by the United States Government, with nearly 9000 participants including 103 ministers from 126 countries, concluded that a major acceleration in the adoption of renewable energy technologies was needed by mid-century. Because of different climatic conditions and societal preferences, regional cooperation is expected to play a major role in the efficient adoption of appropriate renewable energy technologies, and countries with special expertise in specific technologies seem eager to collaborate internationally to promote global goals in renewable energy. A review will be given of what we learned from this conference about renewable energy research and development strategies with a special focus given to using this basic knowledge base to promote the development of renewable energy technologies appropriate to specific regions of the world.(author)

  13. Crew Factors in Flight Operations XIV: Alertness Management in Regional Flight Operations Education Module

    Science.gov (United States)

    Rosekind, Mark R.; Co, Elizabeth L.; Neri, David F.; Oyung, Raymond L.; Mallis, Melissa M.

    2002-01-01

    Regional operations encompass a broad range of pilots and equipment. This module is intended to help all those involved in regional aviation, including pilots, schedulers, dispatchers, maintenance technicians, policy makers, and others, to understand the physiological factors underlying fatigue, how flight operations affect fatigue, and what can be done to counteract fatigue and maximize alertness and performance in their operations. The overall purpose of this module is to promote aviation safety, performance, and productivity. It is intended to meet three specific objectives: (1) to explain the current state of knowledge about the physiological mechanisms underlying fatigue; (2) to demonstrate how this knowledge can be applied to improving flight crew sleep, performance, and alertness; and (3) to offer strategies for alertness management. Aviation Safety Reporting System (ASRS) and National Transportation Safety Board (NISH) reports are used throughout this module to demonstrate that fatigue is a safety issue in the regional operations community. The appendices at the end of this module include the ASRS reports used for the examples contained in this publication, brief introductions to sleep disorders and relaxation techniques, summaries of relevant NASA publications, and a list of general readings on sleep, sleep disorders, and circadian rhythms.

  14. Nucleopolis for promoting the nuclear excellence of the Normandy region

    International Nuclear Information System (INIS)

    2016-01-01

    Nucleopolis is the Norman economic pole dedicated to nuclear energy, nuclear medicine and nuclear safety, it gathers about 70 enterprises whatever their sizes, research laboratories and teaching or training units. Nucleopolis was founded in 2009 with the economic development of the region as a unique purpose. Nucleopolis will ease the access of its members to local, national and international markets through actions of networking and by promoting innovations and skill development. Nucleopolis proposes to its members a series of services around 4 departments: Nucleo'Network to promote networking between the members themselves and between the members and major contractors; Nucleo'Business to propose assistance in national and international business; Nucleo'Competence to propose adequate training to its members to upgrade their skills and Nucleo'Innovation to foster collaborative work between its members on innovative projects. (A.C.)

  15. Selective AR Modulators that Distinguish Proliferative from Differentiative Gene Promoters

    Science.gov (United States)

    2016-08-01

    levels, and in some cases be useful in early stage disease or watchful waiting, and in other cases castration resistant prostate cancer (CRPC...dependent kinase inhibitor p21 gene through an androgen response element in the proximal promoter. Molecular endocrinology 13, 376 (Mar, 1999). 9...analyses and in mouse xenograft experiments, as planned. We will also continue to probe the molecular mechanism by which dox elicits these differential

  16. CD147 Promotes CXCL1 Expression and Modulates Liver Fibrogenesis

    Directory of Open Access Journals (Sweden)

    Wen-Pu Shi

    2018-04-01

    Full Text Available Activated hepatic stellate cells (HSCs release pro-inflammatory and pro-fibrogenic factors. CXC chemokine-ligand-1 (CXCL1 is expressed on HSCs. We previously found that the CD147 is overexpressed in activated HSCs. In this study, we showed an important role of CD147 in promoting liver fibrosis by activating HSCs and upregulating expression of chemokines. Specifically, we found that CD147 specific deletion in HSCs mice alleviated CCl4-induced liver fibrosis and inhibited HSCs activation. Overexpression of CD147 upregulated the secretion of CXCL1. Meanwhile, CXCL1 promoted HSCs activation through autocrine. Treating with PI3K/AKT inhibitor could effectively suppress CD147-induced CXCL1 expression. Taken together, these findings suggest that CD147 regulates CXCL1 release in HSCs by PI3K/AKT signaling. Inhibition of CD147 attenuates CCl4-induced liver fibrosis and inflammation. Therefore, administration of targeting CD147 could be a promising therapeutic strategy in liver fibrosis.

  17. Promotion and regional development. Implementation of regional productive development agencies. The case of Maule region, Chile

    Directory of Open Access Journals (Sweden)

    Enrique Yamil Alul González

    2010-12-01

    Full Text Available The Regional Productive Development Agencies implemented in Chile in 2006, were developed as a way to answer the longing desire to territorially decentralize, and that the own Regions be whom define their future. The Agencies have the responsibility to develop innovation and productive development Agendas in participative processes, which means with public, academic and private actors. Also, the Agencies have the mission to implement Competitive Improvement Plans-PMC (clusters in prioritized economic sectors by the own region. These PMC are leaded by private actors in each sector.

  18. Synthetic Promoter Library for Modulation of Actinorhodin Production in Streptomyces coelicolor A3(2)

    DEFF Research Database (Denmark)

    Sohoni, Sujata Vijay; Fazio, Alessandro; Workman, Christopher

    2014-01-01

    The objective of this study was the application of the synthetic promoter library (SPL) technology for modulation of actinorhodin production in Streptomyces coelicolor A3(2). The SPL technology was used to optimize the expression of a pathway specific positive transcriptional regulator Actll orf4...... constitutive promoter. ScoSPL20 demonstrated exceptional productivity despite having a comparatively weak expression from the promoter. Interestingly, the ScoSPL20 promoter was activated at a much earlier stage of growth compared to the wild type, demonstrating the advantage of fine-tuning and temporal tuning......, which activates the transcription of the S. coelicolor actinorhodin biosynthetic gene cluster. The native actll orf4 promoter was replaced with synthetic promoters, generating a S. coelicolor library with a broad range of expression levels of actll orf4. The resulting library was screened based...

  19. Genetic recombination is targeted towards gene promoter regions in dogs.

    Science.gov (United States)

    Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J Kim; Hayward, Jessica J; Cohen, Paula E; Greally, John M; Wang, Jun; Bustamante, Carlos D; Boyko, Adam R

    2013-01-01

    The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred.

  20. FY 1998 results of the regional consortium R and D project/the venture promotion type regional consortium R and D (small-/medium-size venture creation type). Development of a new X-ray wavelength-modulated diffraction system; 1998 nendo hacho henco kaisetsuho wo mochiita shin x sen kaisetsu hochi no kaihatsu seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-03-01

    In the wavelength-modulated X-ray diffraction method, noting that synchrotron radiation (SR) is a high luminance white light with the continuous wavelength distribution, the Blagg refection from crystals is recorded by continuously changing the wavelength. The paper described the results of the development. The camera distance/diameter were made variable in connection with the wavelength modulation. By expanding the area (enlargement of screen) of imaging plate (IP) by Weissenberg camera method, the number of diffraction dots increased, and the data on wavelength gradient were made exact. The camera was completed as designed by introducing X-ray beams, adjusting collimator, specimens, and position of IP. The concentrating mirror device is integrated into the beam line of the SR center, and mirror effects were confirmed through the actual synchrotron radiation. The function of wavelength modulation of double crystal spectrometer was also confirmed. Two kinds of ferrocene derivatives were synthesized of which the wavelength modulation effect is expected as specimen for functional test. Monocrystals were successfully raised, and measured by wavelength-modulated X-ray diffraction device. The validity of phase determination function of the developmental device was confirmed with the results of the existing structure analysis as reference. (NEDO)

  1. US-India Technical Collaboration to Promote Regional Stability

    International Nuclear Information System (INIS)

    Killinger, Mark H.; Griggs, James R.; Apt, Kenneth E.; Doyle, James E.

    2001-01-01

    Two US-India documents were signed in 2000 that provided new impetus for scientific and technical cooperation between the two countries. The first document is the US-India Science and Technology Agreement, which is aimed at 'promoting scientific and technological cooperation between the people of their two countries.' The second is the US-India Joint Statement on Energy and Environment, which states 'the United States and India believe that energy and environment could be one of the most important areas of cooperation between the two countries.' In addition to the work already underway as part of these two agreements, DOE has established a US-India Science and Technology Initiative to utilize the expertise of DOE national laboratories to conduct activities that support US policy objectives in South Asia. PNNL and LANL are working with US agencies and the Indian government and scientific communities to identify appropriate non-sensitive areas for US-Indian technical collaboration. The objectives of such collaboration are to address visible national/international problems, build trust between the United States and India, and contribute to regional stability in South Asia. This paper describes research done on the Indian scientific organization and infrastructure, potential areas for collaboration, the approach for this engagement, and current status of the initiative.

  2. US-INDIA TECHNICAL COLLABORATION TO PROMOTE REGIONAL STABILITY

    International Nuclear Information System (INIS)

    Killinger, M.H.; Griggs, J.R.; Apt, Kenneth E.; Doyle, J.E.

    2001-01-01

    Two US-India documents were signed in 2000 that provided new impetus for scientific and technical cooperation between the two countries. The first document is the US-India Science and Technology Agreement, which is aimed at 'promoting scientific and technological cooperation between the people of their two countries.' The second is the US-India Joint Statement on Energy and Environment, which states 'the United States and India believe that energy and environment could be one of the most important areas of cooperation between the two countries.' In addition to the work already underway as part of these two agreements, the US Department of Energy (DOE) has established a US-India Science and Technology Initiative to utilize the expertise of DOE national laboratories to conduct activities that support US policy objectives in South Asia. PNNL and LANL are working with US government agencies to identify appropriate non-sensitive, non-nuclear areas for US-Indian technical collaboration. The objectives of such collaboration are to address visible national and international problems, build trust between the United States and India, and contribute to regional stability in South Asia. This paper describes the approach for this engagement, the Indian scientific organization and infrastructure, potential areas for collaboration, and current status of the initiative.

  3. Promoter library-based module combination (PLMC) technology for optimization of threonine biosynthesis in Corynebacterium glutamicum.

    Science.gov (United States)

    Wei, Liang; Xu, Ning; Wang, Yiran; Zhou, Wei; Han, Guoqiang; Ma, Yanhe; Liu, Jun

    2018-05-01

    Due to the lack of efficient control elements and tools, the fine-tuning of gene expression in the multi-gene metabolic pathways is still a great challenge for engineering microbial cell factories, especially for the important industrial microorganism Corynebacterium glutamicum. In this study, the promoter library-based module combination (PLMC) technology was developed to efficiently optimize the expression of genes in C. glutamicum. A random promoter library was designed to contain the putative - 10 (NNTANANT) and - 35 (NNGNCN) consensus motifs, and refined through a three-step screening procedure to achieve numerous genetic control elements with different strength levels, including fluorescence-activated cell sorting (FACS) screening, agar plate screening, and 96-well plate screening. Multiple conventional strategies were employed for further precise characterizations of the promoter library, such as real-time quantitative PCR, sodium dodecyl sulfate polyacrylamide gel electrophoresis, FACS analysis, and the lacZ reporter system. These results suggested that the established promoter elements effectively regulated gene expression and showed varying strengths over a wide range. Subsequently, a multi-module combination technology was created based on the efficient promoter elements for combination and optimization of modules in the multi-gene pathways. Using this technology, the threonine biosynthesis pathway was reconstructed and optimized by predictable tuning expression of five modules in C. glutamicum. The threonine titer of the optimized strain was significantly improved to 12.8 g/L, an approximate 6.1-fold higher than that of the control strain. Overall, the PLMC technology presented in this study provides a rapid and effective method for combination and optimization of multi-gene pathways in C. glutamicum.

  4. Business networking for SMEs as a means to promote regional competitiveness: A Theoretical Framework

    OpenAIRE

    Vitor Braga

    2004-01-01

    The competitiveness of regions, as a means of promoting the competitiveness of a country as a whole, has been one of the main topics on the agenda of policy makers over the last decades. Several attempts at promoting competitiveness have been made with different degrees of success. In most cases, public investment in the regions was perceived as the solution to promote regional competitiveness and top-down policies were implemented. However, competitiveness also has an important dimension tha...

  5. Genome-wide occupancy profile of mediator and the Srb8-11 module reveals interactions with coding regions

    DEFF Research Database (Denmark)

    Zhu, Xuefeng; Wirén, Marianna; Sinha, Indranil

    2006-01-01

    Mediator exists in a free form containing the Med12, Med13, CDK8, and CycC subunits (the Srb8-11 module) and a smaller form, which lacks these four subunits and associates with RNA polymerase II (Pol II), forming a holoenzyme. We use chromatin immunoprecipitation (ChIP) and DNA microarrays...... to investigate genome-wide localization of Mediator and the Srb8-11 module in fission yeast. Mediator and the Srb8-11 module display similar binding patterns, and interactions with promoters and upstream activating sequences correlate with increased transcription activity. Unexpectedly, Mediator also interacts...... with the downstream coding region of many genes. These interactions display a negative bias for positions closer to the 5' ends of open reading frames (ORFs) and appear functionally important, because downregulation of transcription in a temperature-sensitive med17 mutant strain correlates with increased Mediator...

  6. MicroRNA modulation in complex regional pain syndrome

    Directory of Open Access Journals (Sweden)

    Orlova Irina A

    2011-11-01

    Full Text Available Abstract Background Aberrant expression of small noncoding RNAs called microRNAs (miRNAs is a common feature of several human diseases. The objective of the study was to identify miRNA modulation in patients with complex regional pain syndrome (CRPS a chronic pain condition resulting from dysfunction in the central and/or peripheral nervous systems. Due to a multitude of inciting pathologies, symptoms and treatment conditions, the CRPS patient population is very heterogeneous. Our goal was to identify differentially expressed miRNAs in blood and explore their utility in patient stratification. Methods We profiled miRNAs in whole blood from 41 patients with CRPS and 20 controls using TaqMan low density array cards. Since neurogenic inflammation is known to play a significant role in CRPS we measured inflammatory markers including chemokines, cytokines, and their soluble receptors in blood from the same individuals. Correlation analyses were performed for miRNAs, inflammatory markers and other parameters including disease symptoms, medication, and comorbid conditions. Results Three different groups emerged from miRNA profiling. One group was comprised of 60% of CRPS patients and contained no control subjects. miRNA profiles from the remaining patients were interspersed among control samples in the other two groups. We identified differential expression of 18 miRNAs in CRPS patients. Analysis of inflammatory markers showed that vascular endothelial growth factor (VEGF, interleukin1 receptor antagonist (IL1Ra and monocyte chemotactic protein-1 (MCP1 were significantly elevated in CRPS patients. VEGF and IL1Ra showed significant correlation with the patients reported pain levels. Analysis of the patients who were clustered according to their miRNA profile revealed correlations that were not significant in the total patient population. Correlation analysis of miRNAs detected in blood with additional parameters identified miRNAs associated with

  7. Constructing a State Policy To Promote Regionalism in School Government.

    Science.gov (United States)

    Zukowsky, Jerome; And Others.

    This paper defines regionalism, sets some tentative directions for the concept, and raises difficult questions related to its application in New York State. Regionalism, which offers an alternative to a State-local school governing system, is used to decentralize the planning and management of public services. A regional unit permits district…

  8. Reciprocal modulation of mesenchymal stem cells and tumor cells promotes lung cancer metastasis

    Directory of Open Access Journals (Sweden)

    Giulia Fregni

    2018-03-01

    Full Text Available Metastasis is a multi-step process in which direct crosstalk between cancer cells and their microenvironment plays a key role. Here, we assessed the effect of paired tumor-associated and normal lung tissue mesenchymal stem cells (MSCs on the growth and dissemination of primary human lung carcinoma cells isolated from the same patients. We show that the tumor microenvironment modulates MSC gene expression and identify a four-gene MSC signature that is functionally implicated in promoting metastasis. We also demonstrate that tumor-associated MSCs induce the expression of genes associated with an aggressive phenotype in primary lung cancer cells and selectively promote their dissemination rather than local growth. Our observations provide insight into mechanisms by which the stroma promotes lung cancer metastasis. Keywords: Tumor-associated MSCs, lung cancer, metastasis, GREM1, LOXL2, ADAMTS12, ITGA11

  9. Synthetic Promoter Library for Modulation of Actinorhodin Production in Streptomyces coelicolor A3(2)

    Science.gov (United States)

    Sohoni, Sujata Vijay; Fazio, Alessandro; Workman, Christopher T.; Mijakovic, Ivan; Lantz, Anna Eliasson

    2014-01-01

    The objective of this study was the application of the synthetic promoter library (SPL) technology for modulation of actinorhodin production in Streptomyces coelicolor A3(2). The SPL technology was used to optimize the expression of a pathway specific positive transcriptional regulator ActII orf4, which activates the transcription of the S. coelicolor actinorhodin biosynthetic gene cluster. The native actII orf4 promoter was replaced with synthetic promoters, generating a S. coelicolor library with a broad range of expression levels of actII orf4. The resulting library was screened based on the yield of actinorhodin. Selected strains were further physiologically characterized. One of the strains from the library, ScoSPL20, showed considerably higher yield of actinorhodin and final actinorhodin titer, compared to S. coelicolor wild type and S. coelicolor with actII orf4 expressed from a strong constitutive promoter. ScoSPL20 demonstrated exceptional productivity despite having a comparatively weak expression from the promoter. Interestingly, the ScoSPL20 promoter was activated at a much earlier stage of growth compared to the wild type, demonstrating the advantage of fine-tuning and temporal tuning of gene expression in metabolic engineering. Transcriptome studies were performed in exponential and actinorhodin-producing phase of growth to compare gene expression between ScoSPL20 and the wild type. To our knowledge, this is the first successful application of the SPL technology for secondary metabolite production in filamentous bacteria. PMID:24963940

  10. The cardiac calsequestrin gene transcription is modulated at the promoter by NFAT and MEF-2 transcription factors.

    Directory of Open Access Journals (Sweden)

    Rafael Estrada-Avilés

    Full Text Available Calsequestrin-2 (CASQ2 is the main Ca2+-binding protein inside the sarcoplasmic reticulum of cardiomyocytes. Previously, we demonstrated that MEF-2 and SRF binding sites within the human CASQ2 gene (hCASQ2 promoter region are functional in neonatal cardiomyocytes. In this work, we investigated if the calcineurin/NFAT pathway regulates hCASQ2 expression in neonatal cardiomyocytes. The inhibition of NFAT dephosphorylation with CsA or INCA-6, reduced both the luciferase activity of hCASQ2 promoter constructs (-3102/+176 bp and -288/+176 bp and the CASQ2 mRNA levels in neonatal rat cardiomyocytes. Additionally, NFATc1 and NFATc3 over-expressing neonatal cardiomyocytes showed a 2-3-fold increase in luciferase activity of both hCASQ2 promoter constructs, which was prevented by CsA treatment. Site-directed mutagenesis of the -133 bp MEF-2 binding site prevented trans-activation of hCASQ2 promoter constructs induced by NFAT overexpression. Chromatin Immunoprecipitation (ChIP assays revealed NFAT and MEF-2 enrichment within the -288 bp to +76 bp of the hCASQ2 gene promoter. Besides, a direct interaction between NFAT and MEF-2 proteins was demonstrated by protein co-immunoprecipitation experiments. Taken together, these data demonstrate that NFAT interacts with MEF-2 bound to the -133 bp binding site at the hCASQ2 gene promoter. In conclusion, in this work, we demonstrate that the Ca2+-calcineurin/NFAT pathway modulates the transcription of the hCASQ2 gene in neonatal cardiomyocytes.

  11. Energy-modulation spectroscopy in hard X-ray region

    CERN Document Server

    Suzuki, M; Ishikawa, T

    2001-01-01

    An energy-modulation technique has been developed for XAFS spectroscopies requiring high energy resolution and high precision. Fast energy switching at 40 Hz has been achieved by adopting a Si channel-cut crystal as a second monochromator together with a piezo-driven oscillation stage, and the resulting variation in sample absorption was detected using an amplifier locked to the energy-modulation frequency. An energy-derivative XAFS spectrum was directly obtained at the Mn K-edge, and illustrated the advantages of this technique in high energy resolution and noise reduction.

  12. DNA methylation of PTEN gene promoter region is not correlated ...

    African Journals Online (AJOL)

    Tumor suppressor gene PTEN plays an important role in cell cycle. Disorder of PTEN protein can cause cell growth and division in an uncontrolled way, which can lead to the formation of tumors. It has been proven that epigenetic mechanisms, such as promoter hypermethylation, may account for inactivation of PTEN in a ...

  13. Natural product derivative BIO promotes recovery after myocardial infarction via unique modulation of the cardiac microenvironment

    Science.gov (United States)

    Kim, Yong Sook; Jeong, Hye-yun; Kim, Ah Ra; Kim, Woong-Hee; Cho, Haaglim; Um, JungIn; Seo, Youngha; Kang, Wan Seok; Jin, Suk-Won; Kim, Min Chul; Kim, Yong-Chul; Jung, Da-Woon; Williams, Darren R.; Ahn, Youngkeun

    2016-01-01

    The cardiac microenvironment includes cardiomyocytes, fibroblasts and macrophages, which regulate remodeling after myocardial infarction (MI). Targeting this microenvironment is a novel therapeutic approach for MI. We found that the natural compound derivative, BIO ((2′Z,3′E)-6-Bromoindirubin-3′-oxime) modulated the cardiac microenvironment to exert a therapeutic effect on MI. Using a series of co-culture studies, BIO induced proliferation in cardiomyocytes and inhibited proliferation in cardiac fibroblasts. BIO produced multiple anti-fibrotic effects in cardiac fibroblasts. In macrophages, BIO inhibited the expression of pro-inflammatory factors. Significantly, BIO modulated the molecular crosstalk between cardiac fibroblasts and differentiating macrophages to induce polarization to the anti-inflammatory M2 phenotype. In the optically transparent zebrafish-based heart failure model, BIO induced cardiomyocyte proliferation and completely recovered survival rate. BIO is a known glycogen synthase kinase-3β inhibitor, but these effects could not be recapitulated using the classical inhibitor, lithium chloride; indicating novel therapeutic effects of BIO. We identified the mechanism of BIO as differential modulation of p27 protein expression and potent induction of anti-inflammatory interleukin-10. In a rat MI model, BIO reduced fibrosis and improved cardiac performance. Histological analysis revealed modulation of the cardiac microenvironment by BIO, with increased presence of anti-inflammatory M2 macrophages. Our results demonstrate that BIO produces unique effects in the cardiac microenvironment to promote recovery post-MI. PMID:27510556

  14. Promoting regional energy co-operation in South Asia

    International Nuclear Information System (INIS)

    Srivastava, Leena; Misra, Neha

    2007-01-01

    Energy is a key ingredient of the socio-economic development of any region. South Asia is not only one of the fastest growing regions in the world; it is also one of the poorest, which thus puts energy at the very heart of the development process in the region. This paper looks at the challenges faced by the South Asia sub-region for economic co-operation (SASEC) comprised of Bangladesh, Bhutan, India and Nepal, and also at the role of greater regional energy co-operation therein. The region is characterized by pressures of growing economies and increasing population. While the per capita energy consumption is one of the lowest in the world, energy intensity continues to be very high. A large portion of the population lacks access to modern sources of energy and depends on traditional sources that are not only inefficient but also have severe health and environmental problems associated with them. Increasing oil import dependency and huge investment needs for energy market development pose a further challenge. The region has a good resource potential and tremendous scope for energy co-operation, which can play a key role in addressing many of these energy security concerns and in putting it on the path of sustainable development. It is ironic that the record in the area has been so limited and that too in the most basic form of co-operation, i.e. bilateral arrangements between countries. This paper puts forth a multi-pronged strategy for sub-regional energy co-operation encompassing softer options aimed at confidence building to more substantial and larger scale co-operation efforts. Delays in decision making to ensure stronger and mutually beneficial co-operation efforts are associated with high costs not only to the energy sector but also for the entire development agenda. With the precarious energy situation in the region and unprecedented increases in international oil prices seen in recent times, it is high time for policy makers, financing institutions, NGOs

  15. Gelidium amansii promotes dendritic spine morphology and synaptogenesis, and modulates NMDA receptor-mediated postsynaptic current.

    Science.gov (United States)

    Hannan, Md Abdul; Mohibbullah, Md; Hong, Yong-Ki; Nam, Joo Hyun; Moon, Il Soo

    2014-01-01

    Neurotrophic factors are essential for the differentiation and maturation of developing neurons as well as providing survival support to the mature neurons. Moreover, therapeutically neurotrophic factors are promising to reconstruct partially damaged neuronal networks in neurodegenerative diseases. In the previous study, we reported that the ethanol extract of an edible marine alga, Gelidium amansii (GAE) had shown promising effects in the development and maturation of both axon and dendrites of hippocampal neurons. Here, we demonstrate that in primary culture of hippocampal neurons (1) GAE promotes a significant increase in the number of filopodia and dendritic spines; (2) promotes synaptogenesis; (3) enhances N-methyl-D-aspartic acid (NMDA) receptor recruitment; and (4) modulates NMDA-receptor-mediated postsynaptic current. Taken together these findings that GAE might be involved in both morphological and functional maturation of neurons suggest the possibility that GAE may constitute a promising candidate for novel compounds for the prevention and treatment of neurodegenerative diseases.

  16. Microbiota promote secretory cell determination in the intestinal epithelium by modulating host Notch signaling.

    Science.gov (United States)

    Troll, Joshua V; Hamilton, M Kristina; Abel, Melissa L; Ganz, Julia; Bates, Jennifer M; Stephens, W Zac; Melancon, Ellie; van der Vaart, Michiel; Meijer, Annemarie H; Distel, Martin; Eisen, Judith S; Guillemin, Karen

    2018-02-23

    Resident microbes promote many aspects of host development, although the mechanisms by which microbiota influence host tissues remain unclear. We showed previously that the microbiota is required for allocation of appropriate numbers of secretory cells in the zebrafish intestinal epithelium. Because Notch signaling is crucial for secretory fate determination, we conducted epistasis experiments to establish whether the microbiota modulates host Notch signaling. We also investigated whether innate immune signaling transduces microbiota cues via the Myd88 adaptor protein. We provide the first evidence that microbiota-induced, Myd88-dependent signaling inhibits host Notch signaling in the intestinal epithelium, thereby promoting secretory cell fate determination. These results connect microbiota activity via innate immune signaling to the Notch pathway, which also plays crucial roles in intestinal homeostasis throughout life and when impaired can result in chronic inflammation and cancer. © 2018. Published by The Company of Biologists Ltd.

  17. The Digital North Denmark Programme -Promoting Regional Change?

    DEFF Research Database (Denmark)

    Østergaard, Christian Richter

    2007-01-01

    The Digital North Denmark (DDN) was an IT programme running from 2000 to 2003 in the North Jutland County in Denmark with national government support of € 23 million. The Danish government initiated the programme with the aim of further strengthening regions with an already proven ICT capability...... (Dybkjær and Lindegaard, 1999, p.96-100). The declared approach was to build on the existing competencies in industry as well as at universities. The national government chose two regions – Ørestaden, a new concentration of knowledge-based institutions near Copenhagen Airport, and North Jutland......-offers within four themes. The participants - meant to be project consortia of ideally private firms, public or private organisations as well as regional and municipal government bodies - could get a maximum national government support of one third of the total project sum.This chapter investigates how...

  18. Cholinergic modulation of the hippocampal region and memory function.

    Science.gov (United States)

    Haam, Juhee; Yakel, Jerrel L

    2017-08-01

    Acetylcholine (ACh) plays an important role in memory function and has been implicated in aging-related dementia, in which the impairment of hippocampus-dependent learning strongly manifests. Cholinergic neurons densely innervate the hippocampus, mediating the formation of episodic as well as semantic memory. Here, we will review recent findings on acetylcholine's modulation of memory function, with a particular focus on hippocampus-dependent learning, and the circuits involved. In addition, we will discuss the complexity of ACh actions in memory function to better understand the physiological role of ACh in memory. This is an article for the special issue XVth International Symposium on Cholinergic Mechanisms. © 2017 International Society for Neurochemistry.

  19. Lithium modulation of the human inositol monophosphatase 2 (IMPA2) promoter

    International Nuclear Information System (INIS)

    Seelan, Ratnam S.; Parthasarathy, Latha K.; Parthasarathy, Ranga N.

    2004-01-01

    The inositol-signaling pathway is a therapeutic target for lithium in the treatment of bipolar disorder. Inositol monophosphatases (IMPases) play a key role in inositol signaling. Lithium's ability to inhibit IMPase 1 is well known, but its effect on IMPase 2 or on the transcriptional regulation of these genes has not been studied. Here, we report the identification and characterization of the minimal promoter of IMPA2 (encoding IMPase 2) in HeLa (epithelial) and SK-N-AS (neuronal) cells. IMPA2 promoter activity appears to be contributed by different elements in the 5' flanking region, suggesting that the gene is differentially regulated in neuronal and non-neuronal cells. Furthermore, IMPA2 promoter activity in both cell lines is downregulated, in a dose-dependent manner, by lithium after treatment for only 24 h. This effect is also observed in vivo. Our results suggest a possible role for IMPA2 in bipolar disorder

  20. A new polymorphism in goat β-lactoglobulin promoter region

    Directory of Open Access Journals (Sweden)

    Mirella Graziano

    2003-01-01

    Full Text Available An individual variability in β-lactoglobulin content has been previously observed in Girgentana goat milk by HPLC analysis. To identify eventual mutations affecting the transcription level of the gene, the prooter region was characterized in goats showing an anomalous phenotype, consisting in a reduced content of β-lactoglobulin respect to α-lactoalbumine. A single nucleotide substitution not previously reported has been detected. A PCR-RFLP procedure was developed for fast detection of the mutation in different goat breeds: Girgentana, Garganica, Sarda, Alpine, Montefalcone and Saanen. The Montefalcone goat showed the highest frequency of the mutation, confirming one more the peculiarity of this breed.

  1. Graduate Management Project (GMP) Retrospective Analysis of Promotional Mediums for Tricare Prime in Tricare Region 11

    National Research Council Canada - National Science Library

    Carpenter, Steven

    1997-01-01

    This study provides retrospective market research information about the population who enrolled in TRICARE Prime in TRICARE Region 11 and the advertising mediums used to promote enrollment in the TRICARE Prime program...

  2. TNF promoter polymorphisms and modulation of growth retardation and disease severity in pediatric Crohn's disease.

    Science.gov (United States)

    Levine, Arie; Shamir, Raanan; Wine, Eytan; Weiss, Batya; Karban, Amir; Shaoul, Ron R; Reif, Shimon S; Yakir, Benjamin; Friedlander, Marcello; Kaniel, Yael; Leshinsky-Silver, Esther

    2005-07-01

    Delayed growth is common in pediatric Crohn's disease (CD). Multiple factors have been shown to affect growth in this situation, the most prominent being the presence and severity of inflammation and inadequate nutritional intake. Inflammation, anorexia, and weight loss are all manifestations of circulating TNF-alpha, which is elevated in CD. The ability to secrete TNF-alpha may be affected by polymorphisms in the TNF-alpha promoter. The aim of our study was to determine whether growth retardation and disease severity in pediatric onset CD are affected by TNF promoter genotype. Genotyping for TNF-alpha and NOD2/CARD15 single nucleotide polymorphisms was performed in 87 patients with detailed growth records. Parameters including disease location and disease severity were recorded, and the effect of these polymorphisms on Z-scores for height and weight at disease onset and during follow-up were analyzed. Lower age of onset was linked to more height retardation, while the presence of colonic disease and the absence of ileal disease were more likely to predict the absence of growth retardation. The presence of two polymorphisms thought to decrease circulating TNF-alpha was associated with higher mean Z-scores for height and a trend toward less growth retardation. Two other polymorphisms were modestly associated with disease severity. Polymorphisms in the TNF-alpha promoter may independently modulate growth and disease severity in pediatric onset CD. The effect of these polymorphisms does not appear to be mediated via weight loss, and is relatively modest.

  3. Exogenous hydrogen sulfide promotes cell proliferation and differentiation by modulating autophagy in human keratinocytes

    International Nuclear Information System (INIS)

    Xie, Xin; Dai, Hui; Zhuang, Binyu; Chai, Li; Xie, Yanguang; Li, Yuzhen

    2016-01-01

    The effects and the underlying mechanisms of hydrogen sulfide (H 2 S) on keratinocyte proliferation and differentiation are still less known. In the current study, we investigated the effects and the underlying mechanisms of exogenous H 2 S on keratinocyte proliferation and differentiation. Human keratinocytes (HaCaT cells) were treated with various concentrations (0.05, 0.25, 0.5 and 1 mM) of sodium hydrosulfide (NaHS, a donor of H 2 S) for 24 h. A CCK-8 assay was used to assess cell viability. Western blot analysis was performed to determine the expression levels of proteins associated with differentiation and autophagy. Transmission electron microscopy was performed to observe autophagic vacuoles, and flow cytometry was applied to evaluate apoptosis. NaHS promoted the viability, induced the differentiation, and enhanced autophagic activity in a dose-dependent manner in HaCaT cells but had no effect on cell apoptosis. Blockage of autophagy by ATG5 siRNA inhibited NaHS-induced cell proliferation and differentiation. The current study demonstrated that autophagy in response to exogenous H 2 S treatment promoted keratinocyte proliferation and differentiation. Our results provide additional insights into the potential role of autophagy in keratinocyte proliferation and differentiation. - Highlights: • Exogenous H 2 S promotes keratinocyte proliferation and differentiation. • The effects of H 2 S on proliferation and differentiation is modulated by autophagy. • Exogenous H 2 S has no effect on keratinocyte apoptosis.

  4. Active sales promotion in urban regions; Aktive Verkaufsfoerderung in Verdichtungsgebieten

    Energy Technology Data Exchange (ETDEWEB)

    Becker, H.D. [Oeffentlichkeitsarbeit, Maingas AG, Frankfurt am Main (Germany)

    1995-03-01

    The first step in any worthwhile marketing strategy for urban regions is to make a survey of all real estates without a gas supply. The data stock thus obtained serves as a short, medium, and long-term basis for all further activity. It cal be used to set up yearly personnel and activity plans. The activities are rounded off by incentives in the form of conversion aids or financing offers and additional measures presented within a Full Service Package Defining clear aims makes it easier to evaluate the success of the activities. (orig.) [Deutsch] Der erste Schritt zu einer erfolgreichen Marktbearbeitung in Verdichtungsgebieten ist die Erhebung aller Liegenschaften ohne Gasversorgung. Der gewonnene Datenbestand dient kurz-, mittel- und langfristig als Grundlage aller Aktivitaeten. Eine Personal- und Aktivitaetenplanung kann jaehrlich daraus abgeleitet werden. Kaufanreize in Form von Umstellhilfen, Finanzierungsangeboten und zusaetzlichen Dienstleistungen im Rahmen eines Full-Service-Angebotes runden die Aktivitaeten ab. Die klare Vorgabe von Zielen erleichert die Erfolgskontrolle. (orig.)

  5. Social Media Marketing as a tool for promoting the regional investment portals

    Directory of Open Access Journals (Sweden)

    Alisa Yu. Fadeyeva

    2016-01-01

    Full Text Available Objective to investigate the potential of Social Media Marketing as a tool for promoting regional investment portals in the information environment to identify the most effective ways of its implementation and to determine the level of mastering of this tool by the Russian regions. Methods general scientific methods observation comparison analysis induction deduction analogy classification. Results the analysis showed that today Social Media Marketing is an essential tool for interaction with the investment community and one of the most effective ways to promote the regional portal which allows to increase the knowledge of and loyalty to the brand to increase the targeted website traffic to increase the awareness of investors about the specific features of the portal and the regional development agenciesrsquo functioning to promptly receive information about the investment environment and to establish contacts with investors. At the same time the study of SMMactivity in the Russian regions revealed a very low level of quality of communication with investors through social networks. Scientific novelty for the first time the article investigates the significance and makes the comparative analysis of the Social Media Marketing channels with regard to investment promotion agencies as well as the results of the regional structures functioning for effective communication through social networks. Practical significance the main results of the research can be used by the regional investment agencies in order to promote their websites increase the quality of communication with investors and promote the investment attractiveness of the region as a whole. nbsp

  6. Genome-wide analysis of regions similar to promoters of histone genes

    KAUST Repository

    Chowdhary, Rajesh

    2010-05-28

    Background: The purpose of this study is to: i) develop a computational model of promoters of human histone-encoding genes (shortly histone genes), an important class of genes that participate in various critical cellular processes, ii) use the model so developed to identify regions across the human genome that have similar structure as promoters of histone genes; such regions could represent potential genomic regulatory regions, e.g. promoters, of genes that may be coregulated with histone genes, and iii/ identify in this way genes that have high likelihood of being coregulated with the histone genes.Results: We successfully developed a histone promoter model using a comprehensive collection of histone genes. Based on leave-one-out cross-validation test, the model produced good prediction accuracy (94.1% sensitivity, 92.6% specificity, and 92.8% positive predictive value). We used this model to predict across the genome a number of genes that shared similar promoter structures with the histone gene promoters. We thus hypothesize that these predicted genes could be coregulated with histone genes. This hypothesis matches well with the available gene expression, gene ontology, and pathways data. Jointly with promoters of the above-mentioned genes, we found a large number of intergenic regions with similar structure as histone promoters.Conclusions: This study represents one of the most comprehensive computational analyses conducted thus far on a genome-wide scale of promoters of human histone genes. Our analysis suggests a number of other human genes that share a high similarity of promoter structure with the histone genes and thus are highly likely to be coregulated, and consequently coexpressed, with the histone genes. We also found that there are a large number of intergenic regions across the genome with their structures similar to promoters of histone genes. These regions may be promoters of yet unidentified genes, or may represent remote control regions that

  7. Assessing the early degradation of photovoltaic modules performance in the Saharan region

    International Nuclear Information System (INIS)

    Kahoul, Nabil; Houabes, Mourad; Sadok, Mohammed

    2014-01-01

    Highlights: • The study underlines the reliability of PV modules in South Algeria. • Early degradation of PV modules operating in the Saharan region for 11 years. • Performance analysis of these PV panels with suitable explanation of results. • Discovery of early degradation of PV modules performance and some PV defects. - Abstract: In this study, the electrical performance degradation of photovoltaic modules (UDTS-50) functioning for a period of 11 years in a region of the Sahara (URER-MS ADRAR) is analyzed. This paper is devoted to an experimental study of current–voltage characteristics of several PV modules exposed to the extreme weather conditions in desert area. The electrical performance degradation and failure modes are estimated from series of current–voltage characteristics performed in the field. Experimental results show that some PV modules degrade up to 12% compared to their initial state. The performance analysis of the others tested modules revealed some defects, such as cracked cells and physical material defects. The identification of the origin of degradation and failure modes and how they affect the photovoltaic modules is necessary to improve the reliability of photovoltaic installations

  8. How to promote the regional cooperation in Asia

    Energy Technology Data Exchange (ETDEWEB)

    Nakano, Masayuki [International Affairs and Safeguards Division, Atomic Energy Bureau, Science and Technology Agency, Tokyo (Japan)

    2000-12-01

    The Tenth International Conference for Nuclear Cooperation in Asia was held in Tokyo on March 10, 1999. Representatives participated from Australia, China, Indonesia, Japan, Korea, Malaysia, the Philippines, Thailand, and Vietnam as well as IAEA as an observer. The countries reflected on the positive achievements of the past ten years and affirmed the major goals for the future, the major theme of the meeting being the evolution of the framework. Some typical cooperative activities have result in: (a) new varieties of plants with greater productivity under a range of environmental conditions (b) development and adoptions of improved analytical procedures to track air pollution in major cities where the identification of the major sources will facilitate remediation measures (c) coordinated trials for radiation therapy of cervical cancer and the development of rigorous protocols (d) training of staff in research reactor operation and in the use of research reactors for the study of new materials. The participating countries have committed to reviewing the six existing sub-categories, namely (1) utilization of research reactors, (2,3) application of radiation and radioisotope in the agriculture and the medical fields, (4) public acceptance of nuclear energy, (5) radioactive waste management, and (6) nuclear safety culture. To share knowledge on human resources development within the region and to consider measures for the further development of human resources in relevant fields, a seminar for human resources development, sponsored by Japan, will be held in Japan. The conference will be renamed as (Forum for Nuclear Cooperation in Asia) beginning with the next conference. The Forum for Nuclear Cooperation in Asia will be held in Japan and in a participating country other than Japan in alternating years. To enhance the regional nuclear cooperation activities under this framework, each participating country will register a Coordinator and Project Leaders to facilitate

  9. How to promote the regional cooperation in Asia

    International Nuclear Information System (INIS)

    Nakano, Masayuki

    2000-01-01

    The Tenth International Conference for Nuclear Cooperation in Asia was held in Tokyo on March 10, 1999. Representatives participated from Australia, China, Indonesia, Japan, Korea, Malaysia, the Philippines, Thailand, and Vietnam as well as IAEA as an observer. The countries reflected on the positive achievements of the past ten years and affirmed the major goals for the future, the major theme of the meeting being the evolution of the framework. Some typical cooperative activities have result in: (a) new varieties of plants with greater productivity under a range of environmental conditions (b) development and adoptions of improved analytical procedures to track air pollution in major cities where the identification of the major sources will facilitate remediation measures (c) coordinated trials for radiation therapy of cervical cancer and the development of rigorous protocols (d) training of staff in research reactor operation and in the use of research reactors for the study of new materials. The participating countries have committed to reviewing the six existing sub-categories, namely (1) utilization of research reactors, (2,3) application of radiation and radioisotope in the agriculture and the medical fields, (4) public acceptance of nuclear energy, (5) radioactive waste management, and (6) nuclear safety culture. To share knowledge on human resources development within the region and to consider measures for the further development of human resources in relevant fields, a seminar for human resources development, sponsored by Japan, will be held in Japan. The conference will be renamed as (Forum for Nuclear Cooperation in Asia) beginning with the next conference. The Forum for Nuclear Cooperation in Asia will be held in Japan and in a participating country other than Japan in alternating years. To enhance the regional nuclear cooperation activities under this framework, each participating country will register a Coordinator and Project Leaders to facilitate

  10. Regional differences in gender promotion and scholarly productivity in otolaryngology.

    Science.gov (United States)

    Eloy, Jean Anderson; Mady, Leila J; Svider, Peter F; Mauro, Kevin M; Kalyoussef, Evelyne; Setzen, Michael; Baredes, Soly; Chandrasekhar, Sujana S

    2014-03-01

    To identify whether regional differences exist in gender disparities in scholarly productivity and faculty rank among academic otolaryngologists. Academic otolaryngologists' bibliometric data analyses. Online faculty listings from 98 otolaryngology departments were organized by gender, academic rank, fellowship training status, and institutional location. The Scopus database was used to assess bibliometrics of these otolaryngologists, including the h-index, number of publications, and publication experience. Analysis included 1127 otolaryngologists, 916 men (81.3%) and 211 women (18.7%). Female faculty comprised 15.4% in the Midwest, 18.8% in the Northeast, 21.3% in the South, and 19.0% in the West (P = .44). Overall, men obtained significantly higher senior academic ranks (associate professor or professor) compared to women (59.8% vs. 40.2%, P .05). Gender disparities in academic rank and scholarly productivity exist most notably in the Northeast, where women in otolaryngology are most underrepresented relative to men at senior academic ranks and in scholarly productivity.

  11. Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori

    Energy Technology Data Exchange (ETDEWEB)

    Yan, Liu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Lian, Yu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Zhejiang Province Key Laboratory of Preventive Veterinary Medicine, Institute of Preventive Veterinary Medicine, Zhejiang University, Hangzhou 310029 (China); Xiuyang, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Tingqing, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Shengpeng, Wang [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Changde, Lu [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China)

    2006-03-31

    The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.

  12. Epigenetic transgenerational actions of vinclozolin on promoter regions of the sperm epigenome.

    Directory of Open Access Journals (Sweden)

    Carlos Guerrero-Bosagna

    2010-09-01

    Full Text Available Previous observations have demonstrated that embryonic exposure to the endocrine disruptor vinclozolin during gonadal sex determination promotes transgenerational adult onset disease such as male infertility, kidney disease, prostate disease, immune abnormalities and tumor development. The current study investigates genome-wide promoter DNA methylation alterations in the sperm of F3 generation rats whose F0 generation mother was exposed to vinclozolin. A methylated DNA immunoprecipitation with methyl-cytosine antibody followed by a promoter tilling microarray (MeDIP-Chip procedure was used to identify 52 different regions with statistically significant altered methylation in the sperm promoter epigenome. Mass spectrometry bisulfite analysis was used to map the CpG DNA methylation and 16 differential DNA methylation regions were confirmed, while the remainder could not be analyzed due to bisulfite technical limitations. Analysis of these validated regions identified a consensus DNA sequence (motif that associated with 75% of the promoters. Interestingly, only 16.8% of a random set of 125 promoters contained this motif. One candidate promoter (Fam111a was found to be due to a copy number variation (CNV and not a methylation change, suggesting initial alterations in the germline epigenome may promote genetic abnormalities such as induced CNV in later generations. This study identifies differential DNA methylation sites in promoter regions three generations after the initial exposure and identifies common genome features present in these regions. In addition to primary epimutations, a potential indirect genetic abnormality was identified, and both are postulated to be involved in the epigenetic transgenerational inheritance observed. This study confirms that an environmental agent has the ability to induce epigenetic transgenerational changes in the sperm epigenome.

  13. Epigenetic transgenerational actions of vinclozolin on promoter regions of the sperm epigenome.

    Science.gov (United States)

    Guerrero-Bosagna, Carlos; Settles, Matthew; Lucker, Ben; Skinner, Michael K

    2010-09-30

    Previous observations have demonstrated that embryonic exposure to the endocrine disruptor vinclozolin during gonadal sex determination promotes transgenerational adult onset disease such as male infertility, kidney disease, prostate disease, immune abnormalities and tumor development. The current study investigates genome-wide promoter DNA methylation alterations in the sperm of F3 generation rats whose F0 generation mother was exposed to vinclozolin. A methylated DNA immunoprecipitation with methyl-cytosine antibody followed by a promoter tilling microarray (MeDIP-Chip) procedure was used to identify 52 different regions with statistically significant altered methylation in the sperm promoter epigenome. Mass spectrometry bisulfite analysis was used to map the CpG DNA methylation and 16 differential DNA methylation regions were confirmed, while the remainder could not be analyzed due to bisulfite technical limitations. Analysis of these validated regions identified a consensus DNA sequence (motif) that associated with 75% of the promoters. Interestingly, only 16.8% of a random set of 125 promoters contained this motif. One candidate promoter (Fam111a) was found to be due to a copy number variation (CNV) and not a methylation change, suggesting initial alterations in the germline epigenome may promote genetic abnormalities such as induced CNV in later generations. This study identifies differential DNA methylation sites in promoter regions three generations after the initial exposure and identifies common genome features present in these regions. In addition to primary epimutations, a potential indirect genetic abnormality was identified, and both are postulated to be involved in the epigenetic transgenerational inheritance observed. This study confirms that an environmental agent has the ability to induce epigenetic transgenerational changes in the sperm epigenome.

  14. Abort Region Determinator (ARD) module feasibility report. Mission planning, mission analysis and software formulation

    Science.gov (United States)

    Draeger, B. G.; Joyner, J. A.

    1976-01-01

    A detailed performance evaluation of the Abort Region Determinator (ARD) module design was provided in support of OFT-1 ascent and OFT-1 intact launch aborts. The evaluation method used compared ARD results against results obtained using the full-up Space Vehicle Dynamic Simulations program under the same conditions. Results were presented for each of the three major ARD math models: (1) the ascent numerical integrator; (2) the mass model, and (3) the second stage predictor as well as the total ARD module. These results demonstrate that the baselined ARD module meets all design objectives for mission control center orbital flight test launch/abort support.

  15. Identification of functional DNA variants in the constitutive promoter region of MDM2

    Directory of Open Access Journals (Sweden)

    Lalonde Marie-Eve

    2012-09-01

    Full Text Available Abstract Although mutations in the oncoprotein murine double minute 2 (MDM2 are rare, MDM2 gene overexpression has been observed in several human tumors. Given that even modest changes in MDM2 levels might influence the p53 tumor suppressor signaling pathway, we postulated that sequence variation in the promoter region of MDM2 could lead to disregulated expression and variation in gene dosage. Two promoters have been reported for MDM2; an internal promoter (P2, which is located near the end of intron 1 and is p53-responsive, and an upstream constitutive promoter (P1, which is p53-independent. Both promoter regions contain DNA variants that could influence the expression levels of MDM2, including the well-studied single nucleotide polymorphism (SNP SNP309, which is located in the promoter P2; i.e., upstream of exon 2. In this report, we screened the promoter P1 for DNA variants and assessed the functional impact of the corresponding SNPs. Using the dbSNP database and genotyping validation in individuals of European descent, we identified three common SNPs (−1494 G > A; indel 40 bp; and −182 C > G. Three major promoter haplotypes were inferred by using these three promoter SNPs together with rs2279744 (SNP309. Following subcloning into a gene reporter system, we found that two of the haplotypes significantly influenced MDM2 promoter activity in a haplotype-specific manner. Site-directed mutagenesis experiments indicated that the 40 bp insertion/deletion variation is causing the observed allelic promoter activity. This study suggests that part of the variability in the MDM2 expression levels could be explained by allelic p53-independent P1 promoter activity.

  16. Substance P promotes wound healing in diabetes by modulating inflammation and macrophage phenotype.

    Science.gov (United States)

    Leal, Ermelindo C; Carvalho, Eugénia; Tellechea, Ana; Kafanas, Antonios; Tecilazich, Francesco; Kearney, Cathal; Kuchibhotla, Sarada; Auster, Michael E; Kokkotou, Efi; Mooney, David J; LoGerfo, Frank W; Pradhan-Nabzdyk, Leena; Veves, Aristidis

    2015-06-01

    Diabetic foot ulceration is a major complication of diabetes. Substance P (SP) is involved in wound healing, but its effect in diabetic skin wounds is unclear. We examined the effect of exogenous SP delivery on diabetic mouse and rabbit wounds. We also studied the impact of deficiency in SP or its receptor, neurokinin-1 receptor, on wound healing in mouse models. SP treatment improved wound healing in mice and rabbits, whereas the absence of SP or its receptor impaired wound progression in mice. Moreover, SP bioavailability in diabetic skin was reduced as SP gene expression was decreased, whereas the gene expression and protein levels of the enzyme that degrades SP, neutral endopeptidase, were increased. Diabetes and SP deficiency were associated with absence of an acute inflammatory response important for wound healing progression and instead revealed a persistent inflammation throughout the healing process. SP treatment induced an acute inflammatory response, which enabled the progression to the proliferative phase and modulated macrophage activation toward the M2 phenotype that promotes wound healing. In conclusion, SP treatment reverses the chronic proinflammatory state in diabetic skin and promotes healing of diabetic wounds. Copyright © 2015 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  17. Exogenous hydrogen sulfide promotes cell proliferation and differentiation by modulating autophagy in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Xie, Xin [Department of Dermatology, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, Heilongjiang Province (China); Dai, Hui [Department of Cardiology, The First Affiliated Hospital of Harbin Medical University, Harbin, 150001, Heilongjiang Province (China); Zhuang, Binyu [Department of Dermatology, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, Heilongjiang Province (China); Chai, Li; Xie, Yanguang [Institute of Dermatology of Heilongjiang Province, Harbin, 150001, Heilongjiang Province (China); Li, Yuzhen, E-mail: liyuzhen@medmail.com.cn [Department of Dermatology, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, Heilongjiang Province (China)

    2016-04-08

    The effects and the underlying mechanisms of hydrogen sulfide (H{sub 2}S) on keratinocyte proliferation and differentiation are still less known. In the current study, we investigated the effects and the underlying mechanisms of exogenous H{sub 2}S on keratinocyte proliferation and differentiation. Human keratinocytes (HaCaT cells) were treated with various concentrations (0.05, 0.25, 0.5 and 1 mM) of sodium hydrosulfide (NaHS, a donor of H{sub 2}S) for 24 h. A CCK-8 assay was used to assess cell viability. Western blot analysis was performed to determine the expression levels of proteins associated with differentiation and autophagy. Transmission electron microscopy was performed to observe autophagic vacuoles, and flow cytometry was applied to evaluate apoptosis. NaHS promoted the viability, induced the differentiation, and enhanced autophagic activity in a dose-dependent manner in HaCaT cells but had no effect on cell apoptosis. Blockage of autophagy by ATG5 siRNA inhibited NaHS-induced cell proliferation and differentiation. The current study demonstrated that autophagy in response to exogenous H{sub 2}S treatment promoted keratinocyte proliferation and differentiation. Our results provide additional insights into the potential role of autophagy in keratinocyte proliferation and differentiation. - Highlights: • Exogenous H{sub 2}S promotes keratinocyte proliferation and differentiation. • The effects of H{sub 2}S on proliferation and differentiation is modulated by autophagy. • Exogenous H{sub 2}S has no effect on keratinocyte apoptosis.

  18. DNMT 1 maintains hypermethylation of CAG promoter specific region and prevents expression of exogenous gene in fat-1 transgenic sheep.

    Science.gov (United States)

    Yang, Chunrong; Shang, Xueying; Cheng, Lei; Yang, Lei; Liu, Xuefei; Bai, Chunling; Wei, Zhuying; Hua, Jinlian; Li, Guangpeng

    2017-01-01

    Methylation is an important issue in gene expression regulation and also in the fields of genetics and reproduction. In this study, we created fat-1 transgenic sheep, investigated the fine-mapping and the modulatory mechanisms of promoter methylation. Sheep fetal fibroblasts were transfected by pCAG-fat1-IRES-EGFP. Monoclonal cell line was screened as nuclear donor and carried out nuclear transfer (441 transgenic cloned embryos, 52 synchronism recipient sheep). Six offsprings were obtained. Expressions of exogenous genes fat-1 and EGFP were detectable in 10 examined tissues and upregulated omega-3 fatty acid content. Interestingly, more or less EGFP negative cells were detectable in the positive transgenic fetal skin cells. EGFP negative and positive cells were sorted by flow cytometry, and their methylation status in the whole promoter region (1701 nt) were investigated by bisulphate sequencing. The fine-mapping of methylation in CAG promoter were proposed. The results suggested that exogenous gene expression was determined by the methylation status from 721-1346 nt and modulated by methylation levels at 101, 108 and 115 nt sites in CAG promoter. To clarify the regulatory mechanism of methylation, examination of four DNA methyltransferases (DNMTs) demonstrated that hypermethylation of CAG promoter is mainly maintained by DNMT 1 in EGFP negative cells. Furthermore, investigation of the cell surface antigen CD34, CD45 and CD166 indicated that EGFP positive and negative cells belong to different types. The present study systematically clarified methylation status of CAG promoter in transgenic sheep and regulatory mechanism, which will provide research strategies for gene expression regulation in transgenic animals.

  19. Gap junctional communication modulates gene transcription by altering the recruitment of Sp1 and Sp3 to connexin-response elements in osteoblast promoters

    Science.gov (United States)

    Stains, Joseph P.; Lecanda, Fernando; Screen, Joanne; Towler, Dwight A.; Civitelli, Roberto

    2003-01-01

    Loss-of-function mutations of gap junction proteins, connexins, represent a mechanism of disease in a variety of tissues. We have shown that recessive (gene deletion) or dominant (connexin45 overexpression) disruption of connexin43 function results in osteoblast dysfunction and abnormal expression of osteoblast genes, including down-regulation of osteocalcin transcription. To elucidate the molecular mechanisms of gap junction-sensitive transcriptional regulation, we systematically analyzed the rat osteocalcin promoter for sensitivity to gap junctional intercellular communication. We identified an Sp1/Sp3 containing complex that assembles on a minimal element in the -70 to -57 region of the osteocalcin promoter in a gap junction-dependent manner. This CT-rich connexin-response element is necessary and sufficient to confer gap junction sensitivity to the osteocalcin proximal promoter. Repression of osteocalcin transcription occurs as a result of displacement of the stimulatory Sp1 by the inhibitory Sp3 on the promoter when gap junctional communication is perturbed. Modulation of Sp1/Sp3 recruitment also occurs on the collagen Ialpha1 promoter and translates into gap junction-sensitive transcriptional control of collagen Ialpha1 gene expression. Thus, regulation of Sp1/Sp3 recruitment to the promoter may represent a potential general mechanism for transcriptional control of target genes by signals passing through gap junctions.

  20. Growing Significance of EU Institutions in Promotion of Inter-regional policies

    Directory of Open Access Journals (Sweden)

    Ella V. Ermakova

    2014-01-01

    Full Text Available The article explores the variety of tools and vehicles applied within the EU to expand the prerogative of the regions of the EU member states. The author uses as an example the inter-regional policies in Belgium in respect of the Flemish Region and the Walloon Region. The author analyzes the mechanisms of promotion of external regional relations in Belgium as a means of addressing different problems both on national and all-European level, supporting the arguments and conclusions by examples of relevant EU initiatives. The article details the activities of the EU Regional Committee (RC, the EU advisory body with the powers of political initiative, upholding the principle ofsubsidarity in the implementation of the EU member states' regional policies. The involvement of the Flemish Region and the Walloon Region in the activities of EU RC is described and summarized. As a case study, the article deals with Belgium's rotating six months presidency in the EUin 2010 when the country, which was going through a severe political crisis with no federal government in place, was represented by the two regions. The special focus of the article is on the strategic EU program "Europe2020" and its implementation by the regions of Belgium. There is an account of the initiatives undertaken by the Flemish Region and the Walloon Region within the framework of this program outlining the interaction of the two regions. The author provides a comprehensive analysis of the involvement of the Flemish Region and the Walloon Region with various EU institutions describing how each party achieves the promotion of its regional interests. Within this context, it is a noteworthy development that the Flemish Region is participating in the international program "Pact 2020" on energy all by its own. The article features quotations by Flemish and Walloon political figures which serve as an illustration of the prevailing attitudes in the Belgian society to the process of

  1. Evaluation of Maxim Module-Integrated Electronics at the DOE Regional Test Centers: Preprint

    Energy Technology Data Exchange (ETDEWEB)

    Deline, C.; Sekulic, B.; Stein, J.; Barkaszi, S.; Yang, J.; Kahn, S.

    2014-07-01

    Module-embedded power electronics developed by Maxim Integrated are under evaluation through a partnership with the Department of Energy's Regional Test Center (RTC) program. Field deployments of both conventional modules and electronics-enhanced modules are designed to quantify the performance advantage of Maxim's products under different amounts of inter-row shading, and their ability to be deployed at a greater ground-coverage-ratio than conventional modules. Simulations in PVSYST have quantified the predicted performance difference between conventional modules and Maxim's modules from inter-row shading. Initial performance results have identified diffuse irradiance losses at tighter row spacing for both the Maxim and conventional modules. Comparisons with published models show good agreement with models predicting the greatest diffuse irradiance losses. At tighter row spacing, all of the strings equipped with embedded power electronics outperformed their conventional peers. An even greater performance advantage is predicted to occur in the winter months when the amount of inter-row shading mismatch is at a maximum.

  2. Characterization of a transcriptional promoter of human papillomavirus 18 and modulation of its expression by simian virus 40 and adenovirus early antigens

    International Nuclear Information System (INIS)

    Thierry, F.; Heard, J.M.; Dartmann, K.; Yaniv, M.

    1987-01-01

    RNA present in cells derived from cervical carcinoma that contained human papillomavirus 18 genomes was initiated in the 1.053-kilobase BamHI fragment that covered the complete noncoding region of this virus. When cloned upstream of the chloramphenicol acetyltransferase gene, this viral fragment directed the expression of the bacterial enzyme only in the sense orientation. Initiation sites were mapped around the ATG of open reading frame E6. This promoter was active in some human and simian cell lines, and its expression was modulated positively by simian virus 40 large T antigen and negatively by adenovirus type 5 E1a antigen

  3. MicroRNA-1185 Promotes Arterial Stiffness though Modulating VCAM-1 and E-Selectin Expression

    Directory of Open Access Journals (Sweden)

    Haoyuan Deng

    2017-04-01

    Full Text Available Background/Aims: Atherosclerosis is the primary cause of cardiovascular ischaemic events; arterial stiffness is a characteristic of the atherosclerotic process. MicroRNAs (miRNAs have been revealed as crucial modulators of atherosclerosis. However, the role of arterial stiffness-related miRNAs in the atherosclerotic process is still unclear. Methods: Four hundred six participants from Northern China were enrolled in this study. Circulating miR-1185 and adhesion molecule levels were measured. Multiple linear regression models were used to evaluate the association of miR-1185 levels with brachial-ankle pulse wave velocity (baPWV and adhesion molecule levels. A mediation analysis was also performed to examine the mediating effect. Cell adhesion molecule levels were measured in primary human umbilical vein endothelial cells (pHUVECs and human umbilical vein smooth cells (HUVSMCs transfected with miR-1185 or co-transfected with a miR-1185 inhibitor. Results: miR-1185 was independently correlated with arterial stiffness. A positive relationship between miR-1185 and vascular cell adhesion molecule-1 (VCAM-1 and E-selectin levels was observed. VCAM- 1 and E-selectin partially mediated the correlation between miR-1185 and arterial stiffness. miR-1185 induced a significant increase in the VCAM-1 and E-selectin levels in pHUVECs and HUVSMCs in vitro. According to our mechanistic analysis, VCAM-1 and E-selectin mediated miR-1185-induced arterial stiffening. Conclusions: miR-1185 modulated the expression of VCAM-1 and E-selectin to promote arterial stiffening, suggesting that miR-1185 plays a crucial role in the development of atherosclerosis and may serve as a novel therapeutic target for atherosclerosis.

  4. Evaluation of the optimum region for mammographic system using computer simulation to study modulation transfer functions

    International Nuclear Information System (INIS)

    Oliveira, Isaura N. Sombra; Schiable, Homero; Porcel, Naider T.; Frere, Annie F.; Marques, Paulo M.A.

    1996-01-01

    An investigation of the 'optimum region' of the radiation field considering mammographic systems is studied. Such a region was defined in previous works as the field range where the system has its best performance and sharpest images. This study is based on a correlation of two methods for evaluating radiologic imaging systems, both using computer simulation in order to determine modulation transfer functions (MTFs) due to the X-ray tube focal spot in several field orientation and locations

  5. Does FDI promote regional development? Evidence from local and regional productivity spillovers in Greece

    Directory of Open Access Journals (Sweden)

    Vassilis MONASTIRIOTIS

    2010-12-01

    Full Text Available Studies on the productivity spillovers of FDI have concentrated on the nationalsectoral level. As a result, little is known about the impact of FDI on absolute and relative regional economic performance. In this paper we examine this issue by relying on a unique dataset of over 20,000 Greek firms for the period 2002-2006 covering all sectors of economic activity. We examine the spatial distribution of foreign-owned firms in the country and analyse the effect that their presence – at the local, regional and national levels – has on the productivity of domestic firms. We find strong evidence suggesting that foreignowned firms self-select into regions and sectors of high productivity. Net of this selection effect, the impact of foreign presence on domestic productivity is negative – although at the very local level some positive spillover effects are identifiable. The bulk of the effects concentrate in non-manufacturing activities, high-tech sectors, and medium-sized high-productivity firms. Importantly, this effect is not constant across space however. Productivity spillovers tend to be negative in the regions hosting the main urban areas in the country but positive in smaller and more peripheral regions. In this way, despite the tendency of FDI to concentrate in a limited number of areas within the country – those of the highest level of development – the externalities that FDI activity generates to the local economies appear to be of a rather equilibrating character.

  6. Module discovery by exhaustive search for densely connected, co-expressed regions in biomolecular interaction networks.

    Directory of Open Access Journals (Sweden)

    Recep Colak

    2010-10-01

    Full Text Available Computational prediction of functionally related groups of genes (functional modules from large-scale data is an important issue in computational biology. Gene expression experiments and interaction networks are well studied large-scale data sources, available for many not yet exhaustively annotated organisms. It has been well established, when analyzing these two data sources jointly, modules are often reflected by highly interconnected (dense regions in the interaction networks whose participating genes are co-expressed. However, the tractability of the problem had remained unclear and methods by which to exhaustively search for such constellations had not been presented.We provide an algorithmic framework, referred to as Densely Connected Biclustering (DECOB, by which the aforementioned search problem becomes tractable. To benchmark the predictive power inherent to the approach, we computed all co-expressed, dense regions in physical protein and genetic interaction networks from human and yeast. An automatized filtering procedure reduces our output which results in smaller collections of modules, comparable to state-of-the-art approaches. Our results performed favorably in a fair benchmarking competition which adheres to standard criteria. We demonstrate the usefulness of an exhaustive module search, by using the unreduced output to more quickly perform GO term related function prediction tasks. We point out the advantages of our exhaustive output by predicting functional relationships using two examples.We demonstrate that the computation of all densely connected and co-expressed regions in interaction networks is an approach to module discovery of considerable value. Beyond confirming the well settled hypothesis that such co-expressed, densely connected interaction network regions reflect functional modules, we open up novel computational ways to comprehensively analyze the modular organization of an organism based on prevalent and largely

  7. Module discovery by exhaustive search for densely connected, co-expressed regions in biomolecular interaction networks.

    Science.gov (United States)

    Colak, Recep; Moser, Flavia; Chu, Jeffrey Shih-Chieh; Schönhuth, Alexander; Chen, Nansheng; Ester, Martin

    2010-10-25

    Computational prediction of functionally related groups of genes (functional modules) from large-scale data is an important issue in computational biology. Gene expression experiments and interaction networks are well studied large-scale data sources, available for many not yet exhaustively annotated organisms. It has been well established, when analyzing these two data sources jointly, modules are often reflected by highly interconnected (dense) regions in the interaction networks whose participating genes are co-expressed. However, the tractability of the problem had remained unclear and methods by which to exhaustively search for such constellations had not been presented. We provide an algorithmic framework, referred to as Densely Connected Biclustering (DECOB), by which the aforementioned search problem becomes tractable. To benchmark the predictive power inherent to the approach, we computed all co-expressed, dense regions in physical protein and genetic interaction networks from human and yeast. An automatized filtering procedure reduces our output which results in smaller collections of modules, comparable to state-of-the-art approaches. Our results performed favorably in a fair benchmarking competition which adheres to standard criteria. We demonstrate the usefulness of an exhaustive module search, by using the unreduced output to more quickly perform GO term related function prediction tasks. We point out the advantages of our exhaustive output by predicting functional relationships using two examples. We demonstrate that the computation of all densely connected and co-expressed regions in interaction networks is an approach to module discovery of considerable value. Beyond confirming the well settled hypothesis that such co-expressed, densely connected interaction network regions reflect functional modules, we open up novel computational ways to comprehensively analyze the modular organization of an organism based on prevalent and largely available large

  8. 20-Hydroxyecdysone (20E) Primary Response Gene E93 Modulates 20E Signaling to Promote Bombyx Larval-Pupal Metamorphosis.

    Science.gov (United States)

    Liu, Xi; Dai, Fangyin; Guo, Enen; Li, Kang; Ma, Li; Tian, Ling; Cao, Yang; Zhang, Guozheng; Palli, Subba R; Li, Sheng

    2015-11-06

    As revealed in a previous microarray study to identify genes regulated by 20-hydroxyecdysone (20E) and juvenile hormone (JH) in the silkworm, Bombyx mori, E93 expression in the fat body was markedly low prior to the wandering stage but abundant during larval-pupal metamorphosis. Induced by 20E and suppressed by JH, E93 expression follows this developmental profile in multiple silkworm alleles. The reduction of E93 expression by RNAi disrupted 20E signaling and the 20E-induced autophagy, caspase activity, and cell dissociation in the fat body. Reducing E93 expression also decreased the expression of the 20E-induced pupal-specific cuticle protein genes and prevented growth and differentiation of the wing discs. Importantly, the two HTH domains in E93 are critical for inducing the expression of a subset of 20E response genes, including EcR, USP, E74, Br-C, and Atg1. By contrast, the LLQHLL and PLDLSAK motifs in E93 inhibit its transcriptional activity. E93 binds to the EcR-USP complex via a physical association with USP through its LLQHLL motif; and this association is enhanced by 20E-induced EcR-USP interaction, which attenuates the transcriptional activity of E93. E93 acts through the two HTH domains to bind to GAGA-containing motifs present in the Atg1 promoter region for inducing gene expression. In conclusion, E93 transcriptionally modulates 20E signaling to promote Bombyx larval-pupal metamorphosis. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. 20-Hydroxyecdysone (20E) Primary Response Gene E93 Modulates 20E Signaling to Promote Bombyx Larval-Pupal Metamorphosis*

    Science.gov (United States)

    Liu, Xi; Dai, Fangyin; Guo, Enen; Li, Kang; Ma, Li; Tian, Ling; Cao, Yang; Zhang, Guozheng; Palli, Subba R.; Li, Sheng

    2015-01-01

    As revealed in a previous microarray study to identify genes regulated by 20-hydroxyecdysone (20E) and juvenile hormone (JH) in the silkworm, Bombyx mori, E93 expression in the fat body was markedly low prior to the wandering stage but abundant during larval-pupal metamorphosis. Induced by 20E and suppressed by JH, E93 expression follows this developmental profile in multiple silkworm alleles. The reduction of E93 expression by RNAi disrupted 20E signaling and the 20E-induced autophagy, caspase activity, and cell dissociation in the fat body. Reducing E93 expression also decreased the expression of the 20E-induced pupal-specific cuticle protein genes and prevented growth and differentiation of the wing discs. Importantly, the two HTH domains in E93 are critical for inducing the expression of a subset of 20E response genes, including EcR, USP, E74, Br-C, and Atg1. By contrast, the LLQHLL and PLDLSAK motifs in E93 inhibit its transcriptional activity. E93 binds to the EcR-USP complex via a physical association with USP through its LLQHLL motif; and this association is enhanced by 20E-induced EcR-USP interaction, which attenuates the transcriptional activity of E93. E93 acts through the two HTH domains to bind to GAGA-containing motifs present in the Atg1 promoter region for inducing gene expression. In conclusion, E93 transcriptionally modulates 20E signaling to promote Bombyx larval-pupal metamorphosis. PMID:26378227

  10. Lifestyle Modulators of Neuroplasticity: How Physical Activity, Mental Engagement, and Diet Promote Cognitive Health during Aging

    Directory of Open Access Journals (Sweden)

    Cristy Phillips

    2017-01-01

    Full Text Available The number of the elderly across the globe will approximate 2.1 billion by 2050. Juxtaposed against this burgeoning segment of the population is evidence that nonpathological aging is associated with an increased risk for cognitive decline in a variety of domains, changes that can cause mild disability even before the onset of dementia. Given that pharmacological treatments that mitigate dementia are still outstanding, alternative therapeutic options are being investigated increasingly. The results from translational studies have shown that modifiable lifestyle factors—including physical activity, cognitive engagement, and diet—are a key strategy for maintaining brain health during aging. Indeed, a multiplicity of studies has demonstrated relationships between lifestyle factors, brain structure and function, and cognitive function in aging adults. For example, physical activity and diet modulate common neuroplasticity substrates (neurotrophic signaling, neurogenesis, inflammation, stress response, and antioxidant defense in the brain whereas cognitive engagement enhances brain and cognitive reserve. The aims of this review are to evaluate the relationship between modifiable lifestyle factors, neuroplasticity, and optimal brain health during aging; to identify putative mechanisms that contribute positive brain aging; and to highlight future directions for scientists and clinicians. Undoubtedly, the translation of cutting-edge knowledge derived from the field of cognitive neuroscience will advance our understanding and enhance clinical treatment interventions as we endeavor to promote brain health during aging.

  11. Role of regional policies in promoting networking and innovation activity of firms

    OpenAIRE

    Kirsi Mukkala; Jari Ritsilä

    2004-01-01

    The success of firms and regions is increasingly defined by their innovation and learning capabilities. It has been emphasized in several studies that a local operational environment may have a positive impact on innovation activity of firms. From policy point of view, the relationship between firms and their local environment is an important research topic. The purpose of this paper is to explore whether there is a demand for regional policy makers in promoting innovative and networking acti...

  12. Characterization of the promoter region of the human c-erbB-2 protooncogene

    International Nuclear Information System (INIS)

    Ishii, S.; Imamoto, F.; Yamanashi, Y.; Toyoshima, K.; Yamamoto, T.

    1987-01-01

    Three overlapping genomic clones that contain the 5'-terminal portion of the human c-erbB-2 gene (ERBB2) were isolated. The promoter region was identified by nuclease S1 mapping with c-erbB-2 mRNA. Seven transcriptional start sites were identified. DNA sequence analysis showed that the promoter region contains a TATA box and a CAAT box about 30 and 80 base pairs (bp), respectively, upstream of the most downstream RNA initiation site. Two putative binding sites for transcription factor Sp1 were identified about 50 and 110 bp upstream of the CAAT box, and six GGA repeats were found between the CAAT box and the TATA box. This region had strong promoter activity when placed upstream of the bacterial chloramphenicol acetyltransferase gene and transfected into monkey CV-1 cells. These data indicate that the promoter of the human c-erbB-2 protooncogene is different from that of the protooncogene c-erbB-1 (epidermal growth factor receptor gene), which does not contain either a TATA box or a CAAT box. Comparison of the promoter sequences and activities of the two protooncogenes should be helpful in analysis of the regulatory mechanism of expression of their gene products, which are growth-factor receptors

  13. Modulating ectopic gene expression levels by using retroviral vectors equipped with synthetic promoters

    OpenAIRE

    Ferreira, Joshua P.; Peacock, Ryan W. S.; Lawhorn, Ingrid E. B.; Wang, Clifford L.

    2011-01-01

    The human cytomegalovirus and elongation factor 1α promoters are constitutive promoters commonly employed by mammalian expression vectors. These promoters generally produce high levels of expression in many types of cells and tissues. To generate a library of synthetic promoters capable of generating a range of low, intermediate, and high expression levels, the TATA and CAAT box elements of these promoters were mutated. Other promoter variants were also generated by random mutagenesis. Evalua...

  14. A study of the frequency of methylation of gene promoter regions in ...

    Indian Academy of Sciences (India)

    2013-04-02

    Apr 2, 2013 ... colorectal cancer in the Taiwanese population. CHANG-CHIEH WU1 ... hypermethylation of promoter-region CpG islands is an important ... mismatch repair gene MLH1 plays an important role in dele- ..... Asia Pac. J. Clin.

  15. Cytosine deletion at AP2-box region of HSP70 promoter and its ...

    Indian Academy of Sciences (India)

    Cytosine deletion at AP2-box region of HSP70 promoter and its influence on semen quality traits in crossbred bulls ... Laboratory, ICAR-Central Institute for Research on Cattle, Meerut 250 001, India; School of Atmospheric Stress Management, ICAR-National Institute of Abiotic Stress Management, Baramati 413 115, India ...

  16. Synchronisation of self-oscillations in a solid-state ring laser with pump modulation in the region of parametric resonance between self-modulation and relaxation oscillations

    International Nuclear Information System (INIS)

    Dudetskiy, V Yu; Lariontsev, E G; Chekina, S N

    2014-01-01

    The synchronisation of the self-modulation oscillation frequency in a Nd : YAG ring laser by an external periodic signal modulating the pump power in the region of parametric resonance between self-modulation and relaxation oscillations is studied theoretically and experimentally. The characteristic features of synchronisation processes in lasers operating in the self-modulation regime of the first kind and in the regime with a doubled self-modulation period are considered. Two bistable branches of synchronisation of self-modulation oscillations are found by numerical calculation. The experimental data agree well with the numerical simulation results for one of these branches, but the other branch of bistable self-modulation oscillations was not observed experimentally. (control of laser radiation parameters)

  17. Perceptually Salient Regions of the Modulation Power Spectrum for Musical Instrument Identification.

    Science.gov (United States)

    Thoret, Etienne; Depalle, Philippe; McAdams, Stephen

    2017-01-01

    The ability of a listener to recognize sound sources, and in particular musical instruments from the sounds they produce, raises the question of determining the acoustical information used to achieve such a task. It is now well known that the shapes of the temporal and spectral envelopes are crucial to the recognition of a musical instrument. More recently, Modulation Power Spectra (MPS) have been shown to be a representation that potentially explains the perception of musical instrument sounds. Nevertheless, the question of which specific regions of this representation characterize a musical instrument is still open. An identification task was applied to two subsets of musical instruments: tuba, trombone, cello, saxophone, and clarinet on the one hand, and marimba, vibraphone, guitar, harp, and viola pizzicato on the other. The sounds were processed with filtered spectrotemporal modulations with 2D Gaussian windows. The most relevant regions of this representation for instrument identification were determined for each instrument and reveal the regions essential for their identification. The method used here is based on a "molecular approach," the so-called bubbles method. Globally, the instruments were correctly identified and the lower values of spectrotemporal modulations are the most important regions of the MPS for recognizing instruments. Interestingly, instruments that were confused with each other led to non-overlapping regions and were confused when they were filtered in the most salient region of the other instrument. These results suggest that musical instrument timbres are characterized by specific spectrotemporal modulations, information which could contribute to music information retrieval tasks such as automatic source recognition.

  18. Identification and characterization of a liver stage-specific promoter region of the malaria parasite Plasmodium.

    Directory of Open Access Journals (Sweden)

    Susanne Helm

    Full Text Available During the blood meal of a Plasmodium-infected mosquito, 10 to 100 parasites are inoculated into the skin and a proportion of these migrate via the bloodstream to the liver where they infect hepatocytes. The Plasmodium liver stage, despite its clinical silence, represents a highly promising target for antimalarial drug and vaccine approaches. Successfully invaded parasites undergo a massive proliferation in hepatocytes, producing thousands of merozoites that are transported into a blood vessel to infect red blood cells. To successfully develop from the liver stage into infective merozoites, a tight regulation of gene expression is needed. Although this is a very interesting aspect in the biology of Plasmodium, little is known about gene regulation in Plasmodium parasites in general and in the liver stage in particular. We have functionally analyzed a novel promoter region of the rodent parasite Plasmodium berghei that is exclusively active during the liver stage of the parasite. To prove stage-specific activity of the promoter, GFP and luciferase reporter assays have been successfully established, allowing both qualitative and accurate quantitative analysis. To further characterize the promoter region, the transcription start site was mapped by rapid amplification of cDNA ends (5'-RACE. Using promoter truncation experiments and site-directed mutagenesis within potential transcription factor binding sites, we suggest that the minimal promoter contains more than one binding site for the recently identified parasite-specific ApiAP2 transcription factors. The identification of a liver stage-specific promoter in P. berghei confirms that the parasite is able to tightly regulate gene expression during its life cycle. The identified promoter region might now be used to study the biology of the Plasmodium liver stage, which has thus far proven problematic on a molecular level. Stage-specific expression of dominant-negative mutant proteins and

  19. Clinical significance of promoter region hypermethylation of microRNA-148a in gastrointestinal cancers

    Directory of Open Access Journals (Sweden)

    Sun JX

    2014-05-01

    Full Text Available Jingxu Sun,1,* Yongxi Song,1,* Zhenning Wang,1 Guoli Wang,2 Peng Gao,1 Xiaowan Chen,1 Zhaohua Gao,1 Huimian Xu1 1Department of Surgical Oncology and General Surgery, First Hospital of China Medical University, Shenyang, People’s Republic of China; 2Department of Biochemistry and Molecular Biology, China Medical University, Shenyang, People’s Republic of China *These authors contributed equally to this work Background: MicroRNAs are associated with tumor genesis and progression in various carcinomas. MicroRNA-148a (miR-148a was reported to have low expression in gastrointestinal cancers, and might be regulated by promoter region DNA methylation. Methods: Bisulfite-modified sequencing was used to determine the promoter region DNA methylation status of human gastrointestinal cancer cell lines. Expression levels of miR-148a in cell lines treated with 5-aza-2′-deoxycytidine were determined by quantitative real-time polymerase chain reaction. Total DNA was extracted from the tissues of 64 patients with gastric cancer and 51 patients with colorectal cancer. Methylation status was determined by methylation-specific polymerase chain reaction. All statistical analyses were performed with SPSS 17.0 software. Results: The promoter regions of genes in human gastrointestinal cancer cell lines were all hypermethylated, except for HT-29, and the expression of miR-148a tended to be higher than in controls after treatment with 5-aza-2′-deoxycytidine. The methylation-specific polymerase chain reaction results showed that 56.25% of gastric cancer tissues and 19.61% of colorectal cancer tissues were hypermethylated. A strong correlation was found between the expression of miR-148a and the methylation status of promoter regions (P<0.001, chi-square test and Pearson’s correlation. Furthermore, promoter region CpG site hypermethylation of miR-148a was correlated with increased tumor size (P=0.01 in gastric cancer after analyzing the correlation between

  20. The system of Regional Contact Offices for promoting GMES services and the use of Space Technologies in European Regions.

    Science.gov (United States)

    Carrara, Paola; Antoninetti, Massimo; Bacai, Hina; Basoni, Anna; Bosc, Christelle; Clave, Magali; Cornacchia, Carmela; L'Astorina, Alba; Monbet, Philippe; Mueller, Bastian; Nicolau, Sonia; Pergola, Nicola; Rampini, Anna; Tramutoli, Valerio; Schumacher, Volker; Wells, Alan; Zepeda Juarez, Jesus; Zolotikova, Svetlana

    2013-04-01

    which have significant impact on the economy, environment and the quality of life of the citizens To this aim since 2011 the system of Regional Contact Offices (RCOs) was promoted by the EU FP7 DORIS_Net (Downsteam Observatory organized by Regions Active in Space - Network, http://www.doris-net.eu/) project as the regional link to the services provided by the European GMES programme. Since then a first nucleus of 12 pilot European Regions were working together establishing 6 first RCOs around Europe. This paper will present RCOs network goals, achievements and perspectives as well as its planned actions devoted to improve quality of Space Technology products from one side, to promote awareness and use of them by potential end-users (and particularly LRAs), from the other side.

  1. DNA Methylation Analysis of BRD1 Promoter Regions and the Schizophrenia rs138880 Risk Allele.

    Directory of Open Access Journals (Sweden)

    Mads Dyrvig

    Full Text Available The bromodomain containing 1 gene, BRD1 is essential for embryogenesis and CNS development. It encodes a protein that participates in histone modifying complexes and thereby regulates the expression of a large number of genes. Genetic variants in the BRD1 locus show association with schizophrenia and bipolar disorder and risk alleles in the promoter region correlate with reduced BRD1 expression. Insights into the transcriptional regulation of BRD1 and the pathogenic mechanisms associated with BRD1 risk variants, however, remain sparse. By studying transcripts in human HeLa and SH-SY5Y cells we provide evidence for differences in relative expression of BRD1 transcripts with three alternative 5' UTRs (exon 1C, 1B, and 1A. We further show that expression of these transcript variants covaries negatively with DNA methylation proportions in their upstream promoter regions suggesting that promoter usage might be regulated by DNA methylation. In line with findings that the risk allele of the rs138880 SNP in the BRD1 promoter region correlates with reduced BRD1 expression, we find that it is also associated with moderate regional BRD1 promoter hypermethylation in both adipose tissue and blood. Importantly, we demonstrate by inspecting available DNA methylation and expression data that these regions undergo changes in methylation during fetal brain development and that differences in their methylation proportions in fetal compared to postnatal frontal cortex correlate significantly with BRD1 expression. These findings suggest that BRD1 may be dysregulated in both the developing and mature brain of risk allele carriers. Finally, we demonstrate that commonly used mood stabilizers Lithium, Valproate, and Carbamazepine affect the expression of BRD1 in SH-SY5Y cells. Altogether this study indicates a link between genetic risk and epigenetic dysregulation of BRD1 which raises interesting perspectives for targeting the mechanisms pharmacologically.

  2. A composite method based on formal grammar and DNA structural features in detecting human polymerase II promoter region.

    Directory of Open Access Journals (Sweden)

    Sutapa Datta

    Full Text Available An important step in understanding gene regulation is to identify the promoter regions where the transcription factor binding takes place. Predicting a promoter region de novo has been a theoretical goal for many researchers for a long time. There exists a number of in silico methods to predict the promoter region de novo but most of these methods are still suffering from various shortcomings, a major one being the selection of appropriate features of promoter region distinguishing them from non-promoters. In this communication, we have proposed a new composite method that predicts promoter sequences based on the interrelationship between structural profiles of DNA and primary sequence elements of the promoter regions. We have shown that a Context Free Grammar (CFG can formalize the relationships between different primary sequence features and by utilizing the CFG, we demonstrate that an efficient parser can be constructed for extracting these relationships from DNA sequences to distinguish the true promoter sequences from non-promoter sequences. Along with CFG, we have extracted the structural features of the promoter region to improve upon the efficiency of our prediction system. Extensive experiments performed on different datasets reveals that our method is effective in predicting promoter sequences on a genome-wide scale and performs satisfactorily as compared to other promoter prediction techniques.

  3. A Composite Method Based on Formal Grammar and DNA Structural Features in Detecting Human Polymerase II Promoter Region

    Science.gov (United States)

    Datta, Sutapa; Mukhopadhyay, Subhasis

    2013-01-01

    An important step in understanding gene regulation is to identify the promoter regions where the transcription factor binding takes place. Predicting a promoter region de novo has been a theoretical goal for many researchers for a long time. There exists a number of in silico methods to predict the promoter region de novo but most of these methods are still suffering from various shortcomings, a major one being the selection of appropriate features of promoter region distinguishing them from non-promoters. In this communication, we have proposed a new composite method that predicts promoter sequences based on the interrelationship between structural profiles of DNA and primary sequence elements of the promoter regions. We have shown that a Context Free Grammar (CFG) can formalize the relationships between different primary sequence features and by utilizing the CFG, we demonstrate that an efficient parser can be constructed for extracting these relationships from DNA sequences to distinguish the true promoter sequences from non-promoter sequences. Along with CFG, we have extracted the structural features of the promoter region to improve upon the efficiency of our prediction system. Extensive experiments performed on different datasets reveals that our method is effective in predicting promoter sequences on a genome-wide scale and performs satisfactorily as compared to other promoter prediction techniques. PMID:23437045

  4. Amino-termini isoforms of the Slack K+ channel, regulated by alternative promoters, differentially modulate rhythmic firing and adaptation.

    Science.gov (United States)

    Brown, Maile R; Kronengold, Jack; Gazula, Valeswara-Rao; Spilianakis, Charalampos G; Flavell, Richard A; von Hehn, Christian A A; Bhattacharjee, Arin; Kaczmarek, Leonard K

    2008-11-01

    The rates of activation and unitary properties of Na+-activated K+ (K(Na)) currents have been found to vary substantially in different types of neurones. One class of K(Na) channels is encoded by the Slack gene. We have now determined that alternative RNA splicing gives rise to at least five different transcripts for Slack, which produce Slack channels that differ in their predicted cytoplasmic amino-termini and in their kinetic properties. Two of these, termed Slack-A channels, contain an amino-terminus domain closely resembling that of another class of K(Na) channels encoded by the Slick gene. Neuronal expression of Slack-A channels and of the previously described Slack isoform, now called Slack-B, are driven by independent promoters. Slack-A mRNAs were enriched in the brainstem and olfactory bulb and detected at significant levels in four different brain regions. When expressed in CHO cells, Slack-A channels activate rapidly upon depolarization and, in single channel recordings in Xenopus oocytes, are characterized by multiple subconductance states with only brief transient openings to the fully open state. In contrast, Slack-B channels activate slowly over hundreds of milliseconds, with openings to the fully open state that are approximately 6-fold longer than those for Slack-A channels. In numerical simulations, neurones in which outward currents are dominated by a Slack-A-like conductance adapt very rapidly to repeated or maintained stimulation over a wide range of stimulus strengths. In contrast, Slack-B currents promote rhythmic firing during maintained stimulation, and allow adaptation rate to vary with stimulus strength. Using an antibody that recognizes all amino-termini isoforms of Slack, Slack immunoreactivity is present at locations that have no Slack-B-specific staining, including olfactory bulb glomeruli and the dendrites of hippocampal neurones, suggesting that Slack channels with alternate amino-termini such as Slack-A channels are present at

  5. A20 modulates lipid metabolism and energy production to promote liver regeneration.

    Directory of Open Access Journals (Sweden)

    Scott M Damrauer

    2011-03-01

    Full Text Available Liver regeneration is clinically of major importance in the setting of liver injury, resection or transplantation. We have demonstrated that the NF-κB inhibitory protein A20 significantly improves recovery of liver function and mass following extended liver resection (LR in mice. In this study, we explored the Systems Biology modulated by A20 following extended LR in mice.We performed transcriptional profiling using Affymetrix-Mouse 430.2 arrays on liver mRNA retrieved from recombinant adenovirus A20 (rAd.A20 and rAd.βgalactosidase treated livers, before and 24 hours after 78% LR. A20 overexpression impacted 1595 genes that were enriched for biological processes related to inflammatory and immune responses, cellular proliferation, energy production, oxidoreductase activity, and lipid and fatty acid metabolism. These pathways were modulated by A20 in a manner that favored decreased inflammation, heightened proliferation, and optimized metabolic control and energy production. Promoter analysis identified several transcriptional factors that implemented the effects of A20, including NF-κB, CEBPA, OCT-1, OCT-4 and EGR1. Interactive scale-free network analysis captured the key genes that delivered the specific functions of A20. Most of these genes were affected at basal level and after resection. We validated a number of A20's target genes by real-time PCR, including p21, the mitochondrial solute carriers SLC25a10 and SLC25a13, and the fatty acid metabolism regulator, peroxisome proliferator activated receptor alpha. This resulted in greater energy production in A20-expressing livers following LR, as demonstrated by increased enzymatic activity of cytochrome c oxidase, or mitochondrial complex IV.This Systems Biology-based analysis unravels novel mechanisms supporting the pro-regenerative function of A20 in the liver, by optimizing energy production through improved lipid/fatty acid metabolism, and down-regulated inflammation. These findings

  6. Endogenous salicylic acid is required for promoting cadmium tolerance of Arabidopsis by modulating glutathione metabolisms

    International Nuclear Information System (INIS)

    Guo, Bin; Liu, Chen; Li, Hua; Yi, Keke; Ding, Nengfei; Li, Ningyu; Lin, Yicheng; Fu, Qinglin

    2016-01-01

    Highlights: • The role of endogenous SA in mediating Cd tolerance was explored using sid2 mutants. • Cd stress induces SA accumulation in a SID2 dependent way. • Depletion of SA causes negative effects on Cd tolerance. • Endogenous SA is required for promoting Cd tolerance by modulating GSH metabolism. • Possible mode of SA signaling through GR/GSH pathway under Cd toxicity was discussed. - Abstract: A few studies with NahG transgenic lines of Arabidopsis show that depletion of SA enhances cadmium (Cd) tolerance. However, it remains some uncertainties that the defence signaling may be a result of catechol accumulation in NahG transgenic lines but not SA deficiency. Here, we conducted a set of hydroponic assays with another SA-deficient mutant sid2 to examine the endogenous roles of SA in Cd tolerance, especially focusing on the glutathione (GSH) cycling. Our results showed that reduced SA resulted in negative effects on Cd tolerance, including decreased Fe uptake and chlorophyll concentration, aggravation of oxidative damage and growth inhibition. Cd exposure significantly increased SA concentration in wild-type leaves, but did not affect it in sid2 mutants. Depletion of SA did not disturb the Cd uptake in either roots or shoots. The reduced Cd tolerance in sid2 mutants is due to the lowered GSH status, which is associated with the decreased expression of serine acetyltransferase along with a decline in contents of non-protein thiols, phytochelatins, and the lowered transcription and activities of glutathione reductase1 (GR1) which reduced GSH regeneration. Finally, the possible mode of SA signaling through the GR/GSH pathway during Cd exposure is discussed.

  7. Endogenous salicylic acid is required for promoting cadmium tolerance of Arabidopsis by modulating glutathione metabolisms

    Energy Technology Data Exchange (ETDEWEB)

    Guo, Bin, E-mail: ndgb@163.com [Institute of Environment, Resource, Soil and Fertilizer, Zhejiang Academy of Agricultural Sciences, Geological Research Center For Agricultural Applications, China Geological Survey, Hangzhou (China); Liu, Chen; Li, Hua [Institute of Environment, Resource, Soil and Fertilizer, Zhejiang Academy of Agricultural Sciences, Geological Research Center For Agricultural Applications, China Geological Survey, Hangzhou (China); Yi, Keke [Institute of Virology and Biotechnology, Zhejiang Academy of Agricultural Sciences, Hangzhou (China); Ding, Nengfei; Li, Ningyu; Lin, Yicheng [Institute of Environment, Resource, Soil and Fertilizer, Zhejiang Academy of Agricultural Sciences, Geological Research Center For Agricultural Applications, China Geological Survey, Hangzhou (China); Fu, Qinglin, E-mail: fuql161@yahoo.com.cn [Institute of Environment, Resource, Soil and Fertilizer, Zhejiang Academy of Agricultural Sciences, Geological Research Center For Agricultural Applications, China Geological Survey, Hangzhou (China)

    2016-10-05

    Highlights: • The role of endogenous SA in mediating Cd tolerance was explored using sid2 mutants. • Cd stress induces SA accumulation in a SID2 dependent way. • Depletion of SA causes negative effects on Cd tolerance. • Endogenous SA is required for promoting Cd tolerance by modulating GSH metabolism. • Possible mode of SA signaling through GR/GSH pathway under Cd toxicity was discussed. - Abstract: A few studies with NahG transgenic lines of Arabidopsis show that depletion of SA enhances cadmium (Cd) tolerance. However, it remains some uncertainties that the defence signaling may be a result of catechol accumulation in NahG transgenic lines but not SA deficiency. Here, we conducted a set of hydroponic assays with another SA-deficient mutant sid2 to examine the endogenous roles of SA in Cd tolerance, especially focusing on the glutathione (GSH) cycling. Our results showed that reduced SA resulted in negative effects on Cd tolerance, including decreased Fe uptake and chlorophyll concentration, aggravation of oxidative damage and growth inhibition. Cd exposure significantly increased SA concentration in wild-type leaves, but did not affect it in sid2 mutants. Depletion of SA did not disturb the Cd uptake in either roots or shoots. The reduced Cd tolerance in sid2 mutants is due to the lowered GSH status, which is associated with the decreased expression of serine acetyltransferase along with a decline in contents of non-protein thiols, phytochelatins, and the lowered transcription and activities of glutathione reductase1 (GR1) which reduced GSH regeneration. Finally, the possible mode of SA signaling through the GR/GSH pathway during Cd exposure is discussed.

  8. Regional Cooperation Efforts in the Mekong River Basin: Mitigating river-related security threats and promoting regional development

    Directory of Open Access Journals (Sweden)

    Susanne Schmeier

    2009-01-01

    Full Text Available The development of international rivers is often perceived as leading to conflicts or even water wars. However, as the development of the Mekong River shows, cooperation has not only prevailed in the last decades, but River Basin Organizations (RBOs, established to mitigate river-related conflicts and/or develop the river basin, have also contributed to the emergence of more general cooperation structures, mainly by creating spill-over effects in other issue-areas, bringing cooperation to policy fields beyond the river itself. This article assesses the contribution of the Mekong River Commission (MRC and the Greater Mekong Sub-Region (GMS to the sustainable development of the Mekong Region as well as to the promotion of regional cooperation in mainland South-East Asia in general. --- Die Entwicklung grenzüberschreitender Flüsse wird oft mit Konflikten oder gar Kriegen um Wasser assoziiert. Wie jedoch die Entwicklung im Mekong-Becken zeigt, waren die vergangenen Jahrzehnte nicht nur von Kooperation gezeichnet, sondern Flussbeckenorganisationen konnten außerdem dazu beitragen, weitreichendere Kooperationsstrukturen zu entwickeln, die sich auf andere Politikfelder ausdehnen. Dieser Artikel beschäftigt sich mit dem Beitrag der Mekong River Commission (MRC und der Greater Mekong Sub-Region (GMS zur nachhaltigen Entwicklung in der Mekong Region sowie zur Förderung allgemeiner regionaler Kooperation im Festländischen Südostasien.

  9. Regional differences in gene expression and promoter usage in aged human brains

    KAUST Repository

    Pardo, Luba M.

    2013-02-19

    To characterize the promoterome of caudate and putamen regions (striatum), frontal and temporal cortices, and hippocampi from aged human brains, we used high-throughput cap analysis of gene expression to profile the transcription start sites and to quantify the differences in gene expression across the 5 brain regions. We also analyzed the extent to which methylation influenced the observed expression profiles. We sequenced more than 71 million cap analysis of gene expression tags corresponding to 70,202 promoter regions and 16,888 genes. More than 7000 transcripts were differentially expressed, mainly because of differential alternative promoter usage. Unexpectedly, 7% of differentially expressed genes were neurodevelopmental transcription factors. Functional pathway analysis on the differentially expressed genes revealed an overrepresentation of several signaling pathways (e.g., fibroblast growth factor and wnt signaling) in hippocampus and striatum. We also found that although 73% of methylation signals mapped within genes, the influence of methylation on the expression profile was small. Our study underscores alternative promoter usage as an important mechanism for determining the regional differences in gene expression at old age.

  10. Current Sharing inside a High Power IGBT Module at the Negative Temperature Coefficient Operating Region

    CERN Document Server

    AUTHOR|(CDS)2084596; Papastergiou, Konstantinos; Bongiorno, M; Thiringer, T

    2016-01-01

    This work investigates the current sharing effect of a high power Soft Punch Through IGBT module in the Negative Temperature Coefficient region. The unbalanced current sharing between two of the substrates is demonstrated for different current and temperature levels and its impact on the thermal stressing of the device is evaluated. The results indicate that the current asymmetry does not lead to a significant thermal stressing unbalance between the substrates.

  11. Brand Products of Regional Cuisine in the Promotion of Tourism in Roztocze

    Directory of Open Access Journals (Sweden)

    Bekier-Jaworska Ewa

    2015-03-01

    Full Text Available Introduction. There has been a trend over the last few years of using specialties of regional cuisine as an independent tourist attraction. The creation of local brands is an important element in the promotion of a given region and it also influences the development of culinary tourism. The aim of the studies conducted was to identify regional dishes - a choice of dishes that could be described as 'brand dishes' and the use of those dishes as tourist attractions in Roztocze. Material and methods. Studies were conducted on a group of students studying tourism and recreation at State Higher School of Vocational Education (PWSZ in Zamość using a questionnaire. Results. The questionnaire provided an assessment of the levels of knowledge of regional cuisine among Polish and Ukrainian students, identified the most characteristic dishes and selected brand products, and helped to arrive at a suitable method of promotion. Conclusions. Nationality, family customs and selection of local restaurants highly influence knowledge of regional cuisine. Interviewees decided that the most outstanding products from Roztocze were Zwierzyniec beer, and Biłgoraj pie. Regional products should be used as a tourist attraction in Roztocze.

  12. Localization of a region in the fusion protein of avian metapneumovirus that modulates cell-cell fusion.

    Science.gov (United States)

    Wei, Yongwei; Feng, Kurtis; Yao, Xiangjie; Cai, Hui; Li, Junan; Mirza, Anne M; Iorio, Ronald M; Li, Jianrong

    2012-11-01

    The genus Metapneumovirus within the subfamily Pneumovirinae of the family Paramyxoviridae includes two members, human metapneumovirus (hMPV) and avian metapneumovirus (aMPV), causing respiratory tract infections in humans and birds, respectively. Paramyxoviruses enter host cells by fusing the viral envelope with a host cell membrane. Membrane fusion of hMPV appears to be unique, in that fusion of some hMPV strains requires low pH. Here, we show that the fusion (F) proteins of aMPV promote fusion in the absence of the attachment protein and low pH is not required. Furthermore, there are notable differences in cell-cell fusion among aMPV subtypes. Trypsin was required for cell-cell fusion induced by subtype B but not subtypes A and C. The F protein of aMPV subtype A was highly fusogenic, whereas those from subtypes B and C were not. By construction and evaluation of chimeric F proteins composed of domains from the F proteins of subtypes A and B, we localized a region composed of amino acid residues 170 to 338 in the F protein that is responsible for the hyperfusogenic phenotype of the F from subtype A. Further mutagenesis analysis revealed that residues R295, G297, and K323 in this region collectively contributed to the hyperfusogenicity. Taken together, we have identified a region in the aMPV F protein that modulates the extent of membrane fusion. A model for fusion consistent with these data is presented.

  13. Intestinal Alkaline Phosphatase: Potential Roles in Promoting Gut Health in Weanling Piglets and Its Modulation by Feed Additives - A Review.

    Science.gov (United States)

    Melo, A D B; Silveira, H; Luciano, F B; Andrade, C; Costa, L B; Rostagno, M H

    2016-01-01

    The intestinal environment plays a critical role in maintaining swine health. Many factors such as diet, microbiota, and host intestinal immune response influence the intestinal environment. Intestinal alkaline phosphatase (IAP) is an important apical brush border enzyme that is influenced by these factors. IAP dephosphorylates bacterial lipopolysaccharides (LPS), unmethylated cytosine-guanosine dinucleotides, and flagellin, reducing bacterial toxicity and consequently regulating toll-like receptors (TLRs) activation and inflammation. It also desphosphorylates extracellular nucleotides such as uridine diphosphate and adenosine triphosphate, consequently reducing inflammation, modulating, and preserving the homeostasis of the intestinal microbiota. The apical localization of IAP on the epithelial surface reveals its role on LPS (from luminal bacteria) detoxification. As the expression of IAP is reported to be downregulated in piglets at weaning, LPS from commensal and pathogenic gram-negative bacteria could increase inflammatory processes by TLR-4 activation, increasing diarrhea events during this phase. Although some studies had reported potential IAP roles to promote gut health, investigations about exogenous IAP effects or feed additives modulating IAP expression and activity yet are necessary. However, we discussed in this paper that the critical assessment reported can suggest that exogenous IAP or feed additives that could increase its expression could show beneficial effects to reduce diarrhea events during the post weaning phase. Therefore, the main goals of this review are to discuss IAP's role in intestinal inflammatory processes and present feed additives used as growth promoters that may modulate IAP expression and activity to promote gut health in piglets.

  14. Tumour MLH1 promoter region methylation testing is an effective prescreen for Lynch Syndrome (HNPCC).

    Science.gov (United States)

    Newton, K; Jorgensen, N M; Wallace, A J; Buchanan, D D; Lalloo, F; McMahon, R F T; Hill, J; Evans, D G

    2014-12-01

    Lynch syndrome (LS) patients have DNA mismatch repair deficiency and up to 80% lifetime risk of colorectal cancer (CRC). Screening of mutation carriers reduces CRC incidence and mortality. Selection for constitutional mutation testing relies on family history (Amsterdam and Bethesda Guidelines) and tumour-derived biomarkers. Initial biomarker analysis uses mismatch repair protein immunohistochemistry and microsatellite instability. Abnormalities in either identify mismatch repair deficiency but do not differentiate sporadic epigenetic defects, due to MLH1 promoter region methylation (13% of CRCs) from LS (4% of CRCs). A diagnostic biomarker capable of making this distinction would be valuable. This study compared two biomarkers in tumours with mismatch repair deficiency; quantification of methylation of the MLH1 promoter region using a novel assay and BRAF c.1799T>A, p.(Val600Glu) mutation status in the identification of constitutional mutations. Tumour DNA was extracted (formalin fixed, paraffin embedded, FFPE tissue) and pyrosequencing used to test for MLH1 promoter methylation and presence of the BRAF c.1799T>A, p.(Val600Glu) mutation 71 CRCs from individuals with pathogenic MLH1 mutations and 73 CRCs with sporadic MLH1 loss. Specificity and sensitivity was compared. Unmethylated MLH1 promoter: sensitivity 94.4% (95% CI 86.2% to 98.4%), specificity 87.7% (95% CI 77.9% to 94.2%), Wild-type BRAF (codon 600): sensitivity 65.8% (95% CI 53.7% to 76.5%), specificity 98.6% (95% CI 92.4% to 100.0%) for the identification of those with pathogenic MLH1 mutations. Quantitative MLH1 promoter region methylation using pyrosequencing is superior to BRAF codon 600 mutation status in identifying constitutional mutations in mismatch repair deficient tumours. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  15. Genome-wide function of H2B ubiquitylation in promoter and genic regions.

    Science.gov (United States)

    Batta, Kiran; Zhang, Zhenhai; Yen, Kuangyu; Goffman, David B; Pugh, B Franklin

    2011-11-01

    Nucleosomal organization in and around genes may contribute substantially to transcriptional regulation. The contribution of histone modifications to genome-wide nucleosomal organization has not been systematically evaluated. In the present study, we examine the role of H2BK123 ubiquitylation, a key regulator of several histone modifications, on nucleosomal organization at promoter, genic, and transcription termination regions in Saccharomyces cerevisiae. Using high-resolution MNase chromatin immunoprecipitation and sequencing (ChIP-seq), we map nucleosome positioning and occupancy in mutants of the H2BK123 ubiquitylation pathway. We found that H2B ubiquitylation-mediated nucleosome formation and/or stability inhibits the assembly of the transcription machinery at normally quiescent promoters, whereas ubiquitylation within highly active gene bodies promotes transcription elongation. This regulation does not proceed through ubiquitylation-regulated histone marks at H3K4, K36, and K79. Our findings suggest that mechanistically similar functions of H2B ubiquitylation (nucleosome assembly) elicit different functional outcomes on genes depending on its positional context in promoters (repressive) versus transcribed regions (activating).

  16. Discovery and Evaluation of Polymorphisms in the and Promoter Regions for Risk of Korean Lung Cancer

    Directory of Open Access Journals (Sweden)

    Jae Sook Sung

    2012-09-01

    Full Text Available AKT is a signal transduction protein that plays a central role in the tumorigenesis. There are 3 mammalian isoforms of this serine/threonine protein kinase-AKT1, AKT2, and AKT3-showing a broad tissue distribution. We first discovered 2 novel polymorphisms (AKT2 -9826 C/G and AKT3 -811 A/G, and we confirmed 6 known polymorphisms (AKT2 -9473 C/T, AKT2 -9151 C/T, AKT2 -9025 C/T, AKT2 -8618G/A, AKT3 -675 A/-, and AKT3 -244 C/T of the AKT2 and AKT3 promoter region in 24 blood samples of Korean lung cancer patients using direct sequencing. To evaluate the role of AKT2 and AKT3 polymorphisms in the risk of Korean lung cancer, genotypes of the AKT2 and AKT3 polymorphisms (AKT2 -9826 C/G, AKT2 -9473 C/T, AKT2 -9151 C/T, AKT2 -9025 C/T, AKT2 -8618G/A, and AKT3 -675 A/- were determined in 360 lung cancer patients and 360 normal controls. Statistical analyses revealed that the genotypes and haplotypes in the AKT2 and AKT3 promoter regions were not significantly associated with the risk of lung cancer in the Korean population. These results suggest that polymorphisms of the AKT2 and AKT3 promoter regions do not contribute to the genetic susceptibility to lung cancer in the Korean population.

  17. Restoration of CpG Methylation in The Egf Promoter Region during Rat Liver Regeneration

    Science.gov (United States)

    Deming, Li; Ziwei, Li; Xueqiang, Guo; Cunshuan, Xu

    2015-01-01

    Epidermal growth factor (EGF) is an important factor for healing after tissue damage in diverse experimental models. It plays an important role in liver regeneration (LR). The objective of this experiment is to investigate the methylation variation of 10 CpG sites in the Egf promoter region and their relevance to Egf expression during rat liver regenera- tion. As a follow up of our previous study, rat liver tissue was collected after rat 2/3 partial hepatectomy (PH) during the re-organization phase (from days 14 to days 28). Liver DNA was extracted and modified by sodium bisulfate. The methylation status of 10 CpG sites in Egf promoter region was determined using bisulfite sequencing polymerase chain reaction (PCR), as BSP method. The results showed that 3 (sites 3, 4 and 9) out of 10 CpG sites have strikingly methylation changes during the re-organization phase compared to the regeneration phase (from 2 hours to 168 hours, P=0.002, 0.048 and 0.018, respectively). Our results showed that methylation modification of CpGs in the Egf promoter region could be restored to the status before PH operation and changes of methylation didn’t affect Egf mRNA expression during the re-organization phase. PMID:26464832

  18. Patterns of local-regional failure after primary intensity modulated radiotherapy for nasopharyngeal carcinoma

    International Nuclear Information System (INIS)

    Kong, Fangfang; Ying, Hongmei; Du, Chengrun; Huang, Shuang; Zhou, Junjun; Chen, Junchao; Sun, Lining; Chen, Xiaohui; Hu, Chaosu

    2014-01-01

    To analyze patterns of local-regional failure after primary intensity modulated radiotherapy (IMRT) for nasopharyngeal carcinoma (NPC). A total of 370 non-metastatic NPC patients consecutively treated with IMRT (with or without chemotherapy) were analyzed. Radiotherapy was administered using a simultaneous integrated boost (SIB) technique at the total prescribed dose of 66-70.4Gy (2.0-2.2Gy per fraction). The location and extent of local-regional failures were transferred to the pretreatment planning computed tomography (CT) for dosimetric analysis. The dose of radiation received by V recur (volume of recurrence) was calculated and analyzed with dose-volume histogram (DVH). Failures were classified as: 'in field' if 95% of V recur was within the 95% isodose, 'marginal' if 20% to 95% of V recur was within the 95% isodose, or 'outside' if less than 20% of V recur was inside the 95% isodose. With a median follow up of 26 months, 25 local-regional failures were found in 18 patients. The 1- and 2-year actuarial local-regional control rates for all patients were 99.7% and 95.5% respectively. Among the 22 local–regional failures with available diagnostic images, 16 (64%) occurred within the 95% isodose lines and were considered in-field failures; 3 (12%) were marginal and 3 (12%) were outside-field failures. Intensity-modulated radiotherapy provides excellent local-regional control for NPC. In-field failures are the main patterns for local-regional recurrence. Reducing the coverage of critical adjacent tissues in CTV purposefully for potential subclinical diseases was worth of study. Great attention in all IMRT steps is necessary to reduce potential causes of marginal failures. More studies about radioresistance are needed to reduce in-field failures

  19. Task-dependent modulation of regions in the left temporal cortex during auditory sentence comprehension.

    Science.gov (United States)

    Zhang, Linjun; Yue, Qiuhai; Zhang, Yang; Shu, Hua; Li, Ping

    2015-01-01

    Numerous studies have revealed the essential role of the left lateral temporal cortex in auditory sentence comprehension along with evidence of the functional specialization of the anterior and posterior temporal sub-areas. However, it is unclear whether task demands (e.g., active vs. passive listening) modulate the functional specificity of these sub-areas. In the present functional magnetic resonance imaging (fMRI) study, we addressed this issue by applying both independent component analysis (ICA) and general linear model (GLM) methods. Consistent with previous studies, intelligible sentences elicited greater activity in the left lateral temporal cortex relative to unintelligible sentences. Moreover, responses to intelligibility in the sub-regions were differentially modulated by task demands. While the overall activation patterns of the anterior and posterior superior temporal sulcus and middle temporal gyrus (STS/MTG) were equivalent during both passive and active tasks, a middle portion of the STS/MTG was found to be selectively activated only during the active task under a refined analysis of sub-regional contributions. Our results not only confirm the critical role of the left lateral temporal cortex in auditory sentence comprehension but further demonstrate that task demands modulate functional specialization of the anterior-middle-posterior temporal sub-areas. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  20. Governmental promotion of the Information Society in the Spanish Region of Valencia

    Directory of Open Access Journals (Sweden)

    Emilio Feliu-García, Ph.D.

    2011-01-01

    Full Text Available Regional spheres are considered essential in the governmental promotion of the Information Society at the international level. The regional initiatives in Spain aim to strengthen and complement the initiatives promoted at the national level. This article analyses ICT penetration in the Valencian Community from 1996 to 2008. The objective is to identify which of the actions carried out by the Valencian Regional Government have had a positive effect on its society.The methodology employed in this study is benchmarking. The selection of indicators is based on the policies evaluation model proposed in the Plan Avanza (Spain’s national Information Society strategy. Data were collected from official statistical sources (like Spain’s National Statistics Institute, INE. Three statistical tests were applied to verify the hypotheses (Pearson’s r2, Chi-square and Student’s t.The results indicate that it is not possible to affirm that the actions implemented by the Valencian Regional Government have had a more positive effect on its society than those implemented by the Spanish Central Government. A reason for this may lie in the specific objectives of the political strategy implemented by the Valencian Government, which has focused primarily on e-Government and does not include enough projects centred on the implementation of new technologies in the private sector. Moreover, the integration of new technologies in everyday life is placed in a second level of importance despite citizens are central actors in the international agenda.

  1. The promotion of regional integration of electricity markets: Lessons for developing countries

    International Nuclear Information System (INIS)

    Oseni, Musiliu O.; Pollitt, Michael G.

    2016-01-01

    This paper focuses on how to promote regional cooperation in electricity. We begin by discussing the theory of international trade cooperation in electricity, with a view to discussing what preconditions might be important in facilitating wide area trading across national borders. We then develop lessons based on the comparison of four case studies. These include three regional developing country power pools – the Southern African Power pool (SAPP), West African Power pool (WAPP) and the Central American Power Market (MER). We contrast these with Northern Europe's Nord Pool. These cases highlight both the potential and difficulty of having cross-jurisdictional power pools. In the light of the theory and evidence we present, we draw key lessons in the areas of: preconditions for trading; necessary institutional arrangements; practicalities of timetabling; reasons to be hopeful about future prospects. - Highlights: • This paper focuses on how to promote regional electricity cooperation. • We develop lessons based on comparison of four international case studies. • The cases highlight both the potential and difficulty of power pools. • We identify preconditions, institutional arrangements and timetabling. • We conclude that the future prospects for regional power pools are good.

  2. Modulational instability for an induced field in the far-wake region of a space vehicle

    International Nuclear Information System (INIS)

    Liao Jingjing; Deng Qian; Qu Wen

    2012-01-01

    The behavior of the induced field and the generation of density cavitons in the far-wake region (|k 0 | → 0) of a space vehicle can be described by a set of nonlinear coupling equations. Modulational instability of the induced field is investigated on the basis of the nonlinear equations. The results show that the induced field is modulationally unstable and will collapse into spatial localized structures; meanwhile, density cavitons will be generated. The characteristic scale and the maximum growth rate of the induced field depend not only on the angle between the amplitude of pump waves E 0 and the perturbation wave vector k, but also on the energy density of pump waves |E 0 | 2 . (paper)

  3. Modulating ectopic gene expression levels by using retroviral vectors equipped with synthetic promoters.

    Science.gov (United States)

    Ferreira, Joshua P; Peacock, Ryan W S; Lawhorn, Ingrid E B; Wang, Clifford L

    2011-12-01

    The human cytomegalovirus and elongation factor 1α promoters are constitutive promoters commonly employed by mammalian expression vectors. These promoters generally produce high levels of expression in many types of cells and tissues. To generate a library of synthetic promoters capable of generating a range of low, intermediate, and high expression levels, the TATA and CAAT box elements of these promoters were mutated. Other promoter variants were also generated by random mutagenesis. Evaluation using plasmid vectors integrated at a single site in the genome revealed that these various synthetic promoters were capable of expression levels spanning a 40-fold range. Retroviral vectors were equipped with the synthetic promoters and evaluated for their ability to reproduce the graded expression demonstrated by plasmid integration. A vector with a self-inactivating long terminal repeat could neither reproduce the full range of expression levels nor produce stable expression. Using a second vector design, the different synthetic promoters enabled stable expression over a broad range of expression levels in different cell lines. The online version of this article (doi:10.1007/s11693-011-9089-0) contains supplementary material, which is available to authorized users.

  4. Quantifying Surface Coal-Mining Patterns to Promote Regional Sustainability in Ordos, Inner Mongolia

    Directory of Open Access Journals (Sweden)

    Xiaoji Zeng

    2018-04-01

    Full Text Available Ordos became the new “coal capital” of China within a few decades since the country’s economic reform in 1978, as large-scale surface coal mining dramatically propelled its per capita GDP from being one of the lowest to one of the highest in China, exceeding Hong Kong in 2009. Surface coal-mining areas (SCMAs have continued to expand in this region during recent decades, resulting in serious environmental and socioeconomic consequences. To understand these impacts and promote regional sustainability, quantifying the spatiotemporal patterns of SCMAs is urgently needed. Thus, the main objectives of this study were to quantify the spatiotemporal patterns of SCMAs in the Ordos region from 1990 to 2015, and to examine some of the major environmental and socioeconomic impacts in the study region. We extracted the SCMAs using remote-sensing data, and then quantified their spatiotemporal patterns using landscape metrics. The loss of natural habitat and several socioeconomic indicators were examined in relation to surface coal mining. Our results show that the area of SCMAs increased from 7.12 km2 to 355.95 km2, an increase of nearly 49 times from 1990 to 2015 in the Ordos region. The number of SCMAs in this region increased from 82 to 651, a nearly seven-fold increase. In particular, Zhungeer banner (an administrative division, Yijinhuoluo banner, Dongsheng District and Dalate banner in the north-eastern part of the Ordos region had higher growth rates of SCMAs. The income gap between urban and rural residents increased along with the growth in SCMAs, undermining social equity in the Ordos region. Moreover, the rapid increase in SCMAs resulted in natural habitat loss (including grasslands, forests, and deserts across this region. Thus, we suggest that regional sustainability in Ordos needs to emphasize effective measures to curb large-scale surface coal mining in order to reduce the urban–rural income gap, and to restore degraded natural

  5. Histamine from brain resident MAST cells promotes wakefulness and modulates behavioral states.

    Directory of Open Access Journals (Sweden)

    Sachiko Chikahisa

    Full Text Available Mast cell activation and degranulation can result in the release of various chemical mediators, such as histamine and cytokines, which significantly affect sleep. Mast cells also exist in the central nervous system (CNS. Since up to 50% of histamine contents in the brain are from brain mast cells, mediators from brain mast cells may significantly influence sleep and other behaviors. In this study, we examined potential involvement of brain mast cells in sleep/wake regulations, focusing especially on the histaminergic system, using mast cell deficient (W/W(v mice. No significant difference was found in the basal amount of sleep/wake between W/W(v mice and their wild-type littermates (WT, although W/W(v mice showed increased EEG delta power and attenuated rebound response after sleep deprivation. Intracerebroventricular injection of compound 48/80, a histamine releaser from mast cells, significantly increased histamine levels in the ventricular region and enhanced wakefulness in WT mice, while it had no effect in W/W(v mice. Injection of H1 antagonists (triprolidine and mepyramine significantly increased the amounts of slow-wave sleep in WT mice, but not in W/W(v mice. Most strikingly, the food-seeking behavior observed in WT mice during food deprivation was completely abolished in W/W(v mice. W/W(v mice also exhibited higher anxiety and depression levels compared to WT mice. Our findings suggest that histamine released from brain mast cells is wake-promoting, and emphasizes the physiological and pharmacological importance of brain mast cells in the regulation of sleep and fundamental neurobehavior.

  6. The sequence of spacers between the consensus sequences modulates the strength of procaryotic promoters

    DEFF Research Database (Denmark)

    Jensen, Peter Ruhdal; Hammer, Karin

    1998-01-01

    A library of synthetic promoters for Lactococcus lactis was constructed, in which the known consensus sequences were kept constant while the sequences of the separating spacers were randomized. The library consists of 38 promoters which differ in strength from 0.3 relative units, and up to more t......-reactors and cell factories....

  7. ERLIN2 promotes breast cancer cell survival by modulating endoplasmic reticulum stress pathways

    International Nuclear Information System (INIS)

    Wang, Guohui; Yang, Zeng-Quan; Liu, Gang; Wang, Xiaogang; Sethi, Seema; Ali-Fehmi, Rouba; Abrams, Judith; Zheng, Ze; Zhang, Kezhong; Ethier, Stephen

    2012-01-01

    Amplification of the 8p11-12 region has been found in approximately 15% of human breast cancer and is associated with poor prognosis. Previous genomic analysis has led us to identify the endoplasmic reticulum (ER) lipid raft-associated 2 (ERLIN2) gene as one of the candidate oncogenes within the 8p11-12 amplicon in human breast cancer, particularly in the luminal subtype. ERLIN2, an ER membrane protein, has recently been identified as a novel mediator of ER-associated degradation. Yet, the biological roles of ERLIN2 and molecular mechanisms by which ERLIN2 coordinates ER pathways in breast carcinogenesis remain unclear. We established the MCF10A-ERLIN2 cell line, which stably over expresses ERLIN2 in human nontransformed mammary epithelial cells (MCF10A) using the pLenti6/V5-ERLIN2 construct. ERLIN2 over expressing cells and their respective parental cell lines were assayed for in vitro transforming phenotypes. Next, we knocked down the ERLIN2 as well as the ER stress sensor IRE1α activity in the breast cancer cell lines to characterize the biological roles and molecular basis of the ERLIN2 in carcinogenesis. Finally, immunohistochemical staining was performed to detect ERLIN2 expression in normal and cancerous human breast tissues We found that amplification of the ERLIN2 gene and over expression of the ERLIN2 protein occurs in both luminal and Her2 subtypes of breast cancer. Gain- and loss-of-function approaches demonstrated that ERLIN2 is a novel oncogenic factor associated with the ER stress response pathway. The IRE1α/XBP1 axis in the ER stress pathway modulated expression of ERLIN2 protein levels in breast cancer cells. We also showed that over expression of ERLIN2 facilitated the adaptation of breast epithelial cells to ER stress by supporting cell growth and protecting the cells from ER stress-induced cell death. ERLIN2 may confer a selective growth advantage for breast cancer cells by facilitating a cytoprotective response to various cellular stresses

  8. ERLIN2 promotes breast cancer cell survival by modulating endoplasmic reticulum stress pathways

    Directory of Open Access Journals (Sweden)

    Wang Guohui

    2012-06-01

    Full Text Available Abstract Background Amplification of the 8p11-12 region has been found in approximately 15% of human breast cancer and is associated with poor prognosis. Previous genomic analysis has led us to identify the endoplasmic reticulum (ER lipid raft-associated 2 (ERLIN2 gene as one of the candidate oncogenes within the 8p11-12 amplicon in human breast cancer, particularly in the luminal subtype. ERLIN2, an ER membrane protein, has recently been identified as a novel mediator of ER-associated degradation. Yet, the biological roles of ERLIN2 and molecular mechanisms by which ERLIN2 coordinates ER pathways in breast carcinogenesis remain unclear. Methods We established the MCF10A-ERLIN2 cell line, which stably over expresses ERLIN2 in human nontransformed mammary epithelial cells (MCF10A using the pLenti6/V5-ERLIN2 construct. ERLIN2 over expressing cells and their respective parental cell lines were assayed for in vitro transforming phenotypes. Next, we knocked down the ERLIN2 as well as the ER stress sensor IRE1α activity in the breast cancer cell lines to characterize the biological roles and molecular basis of the ERLIN2 in carcinogenesis. Finally, immunohistochemical staining was performed to detect ERLIN2 expression in normal and cancerous human breast tissues Results We found that amplification of the ERLIN2 gene and over expression of the ERLIN2 protein occurs in both luminal and Her2 subtypes of breast cancer. Gain- and loss-of-function approaches demonstrated that ERLIN2 is a novel oncogenic factor associated with the ER stress response pathway. The IRE1α/XBP1 axis in the ER stress pathway modulated expression of ERLIN2 protein levels in breast cancer cells. We also showed that over expression of ERLIN2 facilitated the adaptation of breast epithelial cells to ER stress by supporting cell growth and protecting the cells from ER stress-induced cell death. Conclusions ERLIN2 may confer a selective growth advantage for breast cancer cells by

  9. Boundary Dpp promotes growth of medial and lateral regions of the Drosophila wing.

    Science.gov (United States)

    Barrio, Lara; Milán, Marco

    2017-07-04

    The gradient of Decapentaplegic (Dpp) in the Drosophila wing has served as a paradigm to characterize the role of morphogens in regulating patterning. However, the role of this gradient in regulating tissue size is a topic of intense debate as proliferative growth is homogenous. Here, we combined the Gal4/UAS system and a temperature-sensitive Gal80 molecule to induce RNAi-mediated depletion of dpp and characterise the spatial and temporal requirement of Dpp in promoting growth. We show that Dpp emanating from the AP compartment boundary is required throughout development to promote growth by regulating cell proliferation and tissue size. Dpp regulates growth and proliferation rates equally in central and lateral regions of the developing wing appendage and reduced levels of Dpp affects similarly the width and length of the resulting wing. We also present evidence supporting the proposal that graded activity of Dpp is not an absolute requirement for wing growth.

  10. Association between VNTR polymorphism in promoter region of prodynorphin (PDYN) gene and heroin dependence.

    Science.gov (United States)

    Saify, Khyber; Saadat, Iraj; Saadat, Mostafa

    2014-11-30

    Within the core promoter region of prodynorphin (PDYN), a 68-bp sequence was found to occur as a polymorphism element, either singular or as tandemly repeated two, three or four times. We report the sequence of a novel allele (5-repeats). Our study revealed the existence of an ancestral nucleotide (A) at 29th position of the VNTR in human. In total, 442 heroin addicts and 799 controls were included in this study. The present findings revealed a male-limited association between VNTR polymorphism and heroin dependence risk. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  11. Implementation of a module to promote competency in adverse drug reaction reporting in undergraduate medical students.

    Science.gov (United States)

    Tripathi, Raakhi Kaliprasad; Jalgaonkar, Sharmila Vinayak; Sarkate, Pankaj V; Rege, Nirmala Narayan

    2016-10-01

    Underreporting and poor quality of adverse drug reaction (ADR) reports pose a challenge for the Pharmacovigilance Program of India. A module to impart knowledge and skills of ADR reporting to MBBS students was developed and evaluated. The module consisted of (a) e-mailing an ADR narrative and online filling of the "suspected ADR reporting form" (SARF) and (b) a week later, practical on ADR reporting was conducted followed by online filling of SARF postpractical at 1 and 6 months. SARF was an 18-item form with a total score of 36. The module was implemented in the year 2012-2013. Feedback from students and faculty was taken using 15-item prevalidated feedback questionnaires. The module was modified based on the feedback and implemented for the subsequent batch in the year 2013-2014. The evaluation consisted of recording the number of students responding and the scores achieved. A total of 171 students in 2012-2013 batch and 179 in 2013-2014 batch participated. In the 2012-2013 batch, the number of students filling the SARF decreased from basal: 171; 1 month: 122; 6 months: 17. The average scores showed improvement from basal 16.2 (45%) to 26.4 (73%) at 1 month and to 27.3 (76%) at 6 months. For the 2013-2014 batch, the number ( n = 179) remained constant throughout and the average score progressively increased from basal 10.5 (30%) to 27.8 (77%) at 1 month and 30.3 (84%) at 6 months. This module improved the accuracy of filling SARF by students and this subsequently will led to better ADR reporting. Hence, this module can be used to inculcate better ADR reporting practices in budding physicians.

  12. What Factors Promote Student Resilience on a Level 1 Distance Learning Module?

    Science.gov (United States)

    Simons, Joan; Beaumont, Kythe; Holland, Lesley

    2018-01-01

    Resilience is understood to be the ability to adapt positively in the face of adversity. In relation to new students on a distance learning module, this can mean how they adapt and make sense of the demands of their chosen study to enable them to persist in their studies. This article reports a small-scale study involving semi-structured telephone…

  13. Promoting Food Safety Awareness for Older Adults by Using Online Education Modules

    Science.gov (United States)

    Roy, Amber; Francis, Sarah L.; Shaw, Angela; Rajagopal, Lakshman

    2016-01-01

    Older adults are susceptible to and at greater risk for food-borne illness in comparison to those in other adult age groups. Online education is an underused method for the delivery of food safety information to this population. Three online mini-modules, based on social marketing theory (SMT), were created for and pilot-tested with older adults.…

  14. Promoting Evidence-Based Practices: New Teaching Module for Early Childhood Teacher Educators

    Science.gov (United States)

    Young Children, 2009

    2009-01-01

    Linda Halgunseth, head of NAEYC's Office of Applied Research (OAR), tells readers about Child Care and Early Education Research Connections, a Web site (www.researchconnections.org/teaching_modules) to help teacher educators integrate knowledge about evidence-based practices into teacher education programs. In addition, the article touts the…

  15. Considering healthiness promotes healthier choices but modulates medial prefrontal cortex differently in children compared with adults

    NARCIS (Netherlands)

    Meer, van Floor; Laan, van der Laura N.; Viergever, Max A.; Adan, Roger A.H.; Smeets, Paul A.M.

    2017-01-01

    Childhood obesity is a rising problem worldwide mainly caused by overconsumption, which is driven by food choices. In adults, food choices are based on a value signal encoded in the medial prefrontal cortex (mPFC). This signal is modulated by the dorsolateral prefrontal cortex (dlPFC), which is

  16. Localization of a Region in the Fusion Protein of Avian Metapneumovirus That Modulates Cell-Cell Fusion

    Science.gov (United States)

    Wei, Yongwei; Feng, Kurtis; Yao, Xiangjie; Cai, Hui; Li, Junan; Mirza, Anne M.; Iorio, Ronald M.

    2012-01-01

    The genus Metapneumovirus within the subfamily Pneumovirinae of the family Paramyxoviridae includes two members, human metapneumovirus (hMPV) and avian metapneumovirus (aMPV), causing respiratory tract infections in humans and birds, respectively. Paramyxoviruses enter host cells by fusing the viral envelope with a host cell membrane. Membrane fusion of hMPV appears to be unique, in that fusion of some hMPV strains requires low pH. Here, we show that the fusion (F) proteins of aMPV promote fusion in the absence of the attachment protein and low pH is not required. Furthermore, there are notable differences in cell-cell fusion among aMPV subtypes. Trypsin was required for cell-cell fusion induced by subtype B but not subtypes A and C. The F protein of aMPV subtype A was highly fusogenic, whereas those from subtypes B and C were not. By construction and evaluation of chimeric F proteins composed of domains from the F proteins of subtypes A and B, we localized a region composed of amino acid residues 170 to 338 in the F protein that is responsible for the hyperfusogenic phenotype of the F from subtype A. Further mutagenesis analysis revealed that residues R295, G297, and K323 in this region collectively contributed to the hyperfusogenicity. Taken together, we have identified a region in the aMPV F protein that modulates the extent of membrane fusion. A model for fusion consistent with these data is presented. PMID:22915815

  17. PROMOTING PSYCHO-SOCIAL-SPIRITUAL RESPONSE IN PATIENTS WITH TYPE 2 DIABETES MELLITUS THROUGH APLICATION ON SELF CARE MANAGEMENT MODUL

    Directory of Open Access Journals (Sweden)

    Kusnanto Kusnanto

    2017-04-01

    Full Text Available Introduction: Diabetes mellitus was a kind of incurable chronic disease that actually manageable. The global prevalence tends to increase due to less self management of the disease and the impact of it was severe health condition. There were so many interventions implemented but failed to give optimal improvement in patient’s condition and there are so many DM patients have insufficient ability to manage their own disease. Patients need to have knowledge, skills, and self confident to be able to manage their disease. Patient’s self-management depends on patient’s education, empowerment, and self monitoring in evaluating their self-care management. The purpose of this research was promoting patient’s psychological, social, and spiritual conditions through Self Care Management. Improvement in psychological, social, and spiritual conditions in patients with DM will lead to better level of blood glucose and HbA1C. Method: Patient newly diagnose with Type 2 DM at Puskesmas Kebonsari was selected with purposive sampling and divided into two groups. Each group contains 25 patients. Intervention group was given Self Diabetes Management Module. Before and after intervention patient was given Questionnaire. The data then analyzed using Student-T test, McNemar and Chi-Square. Result: The result of this research showed patient have constructive coping, increase interpersonal relation. Patients also have better acceptance about the disease and involve in its management. Discussion: Self Care Management Module promotes psychological, social, and spiritual conditions in patients with type 2 DM.

  18. CRE promoter sites modulate alternative splicing via p300-mediated histone acetylation

    Czech Academy of Sciences Publication Activity Database

    Dušková, Eva; Hnilicová, Jarmila; Staněk, David

    2014-01-01

    Roč. 11, č. 7 (2014), s. 865-874 ISSN 1547-6286 R&D Projects: GA ČR(CZ) GBP305/12/G034 Institutional support: RVO:68378050 Keywords : alternative splicing * fibronectin * p300 * histone acetylation * promoter Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.974, year: 2014

  19. Metabolic engineering of the L-valine biosynthesis pathway in Corynebacterium glutamicum using promoter activity modulation

    Czech Academy of Sciences Publication Activity Database

    Holátko, Jiří; Elišáková, Veronika; Prouza, Marek; Sobotka, Miroslav; Nešvera, Jan; Pátek, Miroslav

    2009-01-01

    Roč. 139, č. 3 (2009), s. 203-210 ISSN 0168-1656 R&D Projects: GA ČR GA204/06/0330 Institutional research plan: CEZ:AV0Z50200510 Keywords : corynebacterium glutamicum * valine production * promoters Subject RIV: EE - Microbiology, Virology Impact factor: 2.881, year: 2009

  20. Curcumin and Turmeric Modulate the Tumor-Promoting Effects of Iron In Vitro.

    Science.gov (United States)

    Messner, Donald J; Robinson, Todd; Kowdley, Kris V

    2017-04-01

    Free or loosely chelated iron has tumor-promoting properties in vitro. Curcumin, a polyphenol derived from the food spice turmeric (Curcuma longa), is a potent antioxidant that binds iron. The primary aim of this study was to investigate whether curcuminoids prevent tumor-promoting effects of iron in T51B cells, a non-neoplastic rat liver epithelial cell line. Purified curcuminoids (curcumin) or a standardized turmeric extract similarly reduced oxidative stress and cytotoxicity associated with iron overload (IC 50 values near 10 μM, P turmeric for 16 wk in culture; subsequently assayed by soft agar colony formation) was nearly complete at 20 μM of total curcuminoids (P turmeric extract were taken up better by cells, had a longer half-life, and appeared more effective in blocking tumor promotion (P < 0.01), suggesting enhanced curcuminoid delivery to cells in culture. The primary finding that curcuminoids can inhibit tumor promotion caused by iron in T51B cells is tempered by evidence for an underlying increase in neoplastic transformation at lower concentrations.

  1. Improvement of dose distributions in abutment regions of intensity modulated radiation therapy and electron fields

    International Nuclear Information System (INIS)

    Dogan, Nesrin; Leybovich, Leonid B.; Sethi, Anil; Emami, Bahman

    2002-01-01

    In recent years, intensity modulated radiation therapy (IMRT) is used to radiate tumors that are in close proximity to vital organs. Targets consisting of a deep-seated region followed by a superficial one may be treated with abutting photon and electron fields. However, no systematic study regarding matching of IMRT and electron beams was reported. In this work, a study of dose distributions in the abutment region between tomographic and step-and-shoot IMRT and electron fields was carried out. A method that significantly improves dose homogeneity between abutting tomographic IMRT and electron fields was developed and tested. In this method, a target region that is covered by IMRT was extended into the superficial target area by ∼2.0 cm. The length and shape of IMRT target extension was chosen such that high isodose lines bent away from the region treated by the electrons. This reduced the magnitude of hot spots caused by the 'bulging effect' of electron field penumbra. To account for the uncertainties in positioning of the IMRT and electron fields, electron field penumbra was modified using conventional (photon) multileaf collimator (MLC). The electron beam was delivered in two steps: half of the dose delivered with MLCs in retracted position and another half with MLCs extended to the edge of electron field that abuts tomographic IMRT field. The experimental testing of this method using film dosimetry has demonstrated that the magnitude of the hot spots was reduced from ∼45% to ∼5% of the prescription dose. When an error of ±1.5 mm in field positioning was introduced, the dose inhomogeneity in the abutment region did not exceed ±15% of the prescription dose. With step-and-shoot IMRT, the most homogeneous dose distribution was achieved when there was a 3 mm gap between the IMRT and electron fields

  2. On the Capacity Region of the Intensity-Modulation Direct-Detection Optical Broadcast Channel

    KAUST Repository

    Chaaban, Anas

    2015-08-11

    The capacity of the intensity-modulation direct-detection free-space optical broadcast channel (OBC) is investigated. The Gaussian model with input-independent Gaussian noise is used, with both average and peak intensity constraints. An outer bound on the capacity region is derived by adapting Bergmans\\' approach to the OBC. Inner bounds are derived by using superposition coding with either truncated-Gaussian distributions or discrete distributions. While the discrete input distribution achieves higher rates than the truncated-Gaussian distribution, the latter allows expressing the achievable rate region in a closed form. At high signal-to-noise ratio (SNR), it is shown that the truncated-Gaussian distribution is nearly optimal. It achieves the symmetric-capacity within a constant gap (independent of SNR), which approaches half a bit as the number of users grows large. It also achieves the capacity region within a constant gap, which depends on the number of users. At low SNR, it is shown that on-off keying with time-division multiple-access (TDMA) is optimal, as it achieves any point on the boundary of the developed outer bound. This is interesting in practice since both OOK and TDMA have low complexity. At moderate SNR (typically [0,8] dB), a discrete distribution with a small alphabet size achieves a fairly good performance in terms of symmetric rate.

  3. White noise improves learning by modulating activity in dopaminergic midbrain regions and right superior temporal sulcus.

    Science.gov (United States)

    Rausch, Vanessa H; Bauch, Eva M; Bunzeck, Nico

    2014-07-01

    In neural systems, information processing can be facilitated by adding an optimal level of white noise. Although this phenomenon, the so-called stochastic resonance, has traditionally been linked with perception, recent evidence indicates that white noise may also exert positive effects on cognitive functions, such as learning and memory. The underlying neural mechanisms, however, remain unclear. Here, on the basis of recent theories, we tested the hypothesis that auditory white noise, when presented during the encoding of scene images, enhances subsequent recognition memory performance and modulates activity within the dopaminergic midbrain (i.e., substantia nigra/ventral tegmental area, SN/VTA). Indeed, in a behavioral experiment, we can show in healthy humans that auditory white noise-but not control sounds, such as a sinus tone-slightly improves recognition memory. In an fMRI experiment, white noise selectively enhances stimulus-driven phasic activity in the SN/VTA and auditory cortex. Moreover, it induces stronger connectivity between SN/VTA and right STS, which, in addition, exhibited a positive correlation with subsequent memory improvement by white noise. Our results suggest that the beneficial effects of auditory white noise on learning depend on dopaminergic neuromodulation and enhanced connectivity between midbrain regions and the STS-a key player in attention modulation. Moreover, they indicate that white noise could be particularly useful to facilitate learning in conditions where changes of the mesolimbic system are causally related to memory deficits including healthy and pathological aging.

  4. The role of COMESA in promoting intra-regional agricultural trade: Case study of Sudan

    Directory of Open Access Journals (Sweden)

    Azharia Abdelbagi Elbushra

    2011-06-01

    Full Text Available African countries have created many regional trade agreements with the economic objectives of reducing trade barriers and encouraging economic growth. The COMESA is an example of regional integration singed on 1993 by 19 African countries including Sudan. COMESA represents a chance for member countries to enhance their economic and social relations through increasing intra-trade. The objective of this paper is to assess the role of COMESA in promoting intra-regional agricultural trade between Sudan and COMESA countries. A multi-market model with Armington non-linear specification was applied. The paper results showed that there is a great potential for Sudan to increase its agricultural exports to other COMESA countries. The domestic agricultural markets are expected to be hampered by imports surge and increase in competition, while the producers of agricultural export commodities will be better off. In order to compete and benefit from potential in the COMESA markets, the paper recommended improving efficiency in the Sudanese agricultural sector through increasing productivity, lowering cost of production, enhancing marketing services, attaining economies of scale and attracting foreign investment.

  5. INTERDISCIPLINARY MODULE IN PREVENTION AND HEALTH PROMOTION IN POPULATION HEALTH FOR OCCUPATIONAL THERAPY AND PHYSIOTHERAPY STUDENTS

    DEFF Research Database (Denmark)

    Brandt, Jørgen

    -operate towards appropriate solutions. The groups suggest and present preventive and health promotion solutions and strategies especially designed for this particular situation. The groups are supervised by an interdisciplinary team of occupational therapy and physiotherapy lecturers. In addition......PURPOSE: The purpose is to provide physiotherapy and occupational therapy students at the University College Cvu vita in Holstebro, Denmark, the opportunity to develop competences for interdisciplinary working situations concerning promotion of population health. RELEVANCE: The Danish Ministry...... of the Interior and Health participates in co-operation within the European Union on health areas, which focuses on efforts with respect to public health (Article 152 of the Treaty on EU). The curricula for both educations underline the importance of preparing the students for interdisciplinary co...

  6. Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.

    Science.gov (United States)

    Wyszyńska-Koko, J; Kurył, J

    2004-01-01

    MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.

  7. An Inquiry-Based Laboratory Module to Promote Understanding of the Scientific Method and Bacterial Conjugation

    Directory of Open Access Journals (Sweden)

    Melanie B. Berkmen

    2014-08-01

    Full Text Available Students are engaged and improve their critical thinking skills in laboratory courses when they have the opportunity to design and conduct inquiry-based experiments that generate novel results. A discovery-driven project for a microbiology, genetics, or multidisciplinary research laboratory course was developed to familiarize students with the scientific method. In this multi-lab module, students determine whether their chosen stress conditions induce conjugation and/or cell death of the model BSL-1 Gram-positive bacterium Bacillus subtilis. Through consultation of the primary literature, students identify conditions or chemicals that can elicit DNA damage, the SOS response, and/or cellular stress.  In groups, students discuss their selected conditions, develop their hypotheses and experimental plans, and formulate their positive and negative controls. Students then subject the B. subtilis donor cells to the stress conditions, mix donors with recipients to allow mating, and plate serial dilutions of the mixtures on selective plates to measure how the treatments affect conjugation frequency and donor cell viability.  Finally, students analyze and discuss their collective data in light of their controls. The goals of this module are to encourage students to be actively involved in the scientific process while contributing to our understanding of the conditions that stimulate horizontal gene transfer in bacteria.

  8. Absence of mutation at the 5'-upstream promoter region of the TPM4 gene from cardiac mutant axolotl (Ambystoma mexicanum).

    Science.gov (United States)

    Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K

    2011-09-01

    Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.

  9. Allelic polymorphisms in the repeat and promoter regions of the interleukin-4 gene and malaria severity in Ghanaian children

    DEFF Research Database (Denmark)

    Gyan, B A; Goka, B; Cvetkovic, J T

    2004-01-01

    Immunoglobulin E has been associated with severe malaria suggesting a regulatory role for interleukin (IL)-4 and/or IgE in the pathogenesis of severe malaria. We have investigated possible associations between polymorphisms in the IL-4 repeat region (intron 3) and promoter regions (IL-4 +33CT and...

  10. The feasibility of a regional CTDIvol to estimate organ dose from tube current modulated CT exams

    International Nuclear Information System (INIS)

    Khatonabadi, Maryam; Kim, Hyun J.; Lu, Peiyun; McMillan, Kyle L.; Cagnon, Chris H.; McNitt-Gray, Michael F.; DeMarco, John J.

    2013-01-01

    Purpose: In AAPM Task Group 204, the size-specific dose estimate (SSDE) was developed by providing size adjustment factors which are applied to the Computed Tomography (CT) standardized dose metric, CTDI vol . However, that work focused on fixed tube current scans and did not specifically address tube current modulation (TCM) scans, which are currently the majority of clinical scans performed. The purpose of this study was to extend the SSDE concept to account for TCM by investigating the feasibility of using anatomic and organ specific regions of scanner output to improve accuracy of dose estimates. Methods: Thirty-nine adult abdomen/pelvis and 32 chest scans from clinically indicated CT exams acquired on a multidetector CT using TCM were obtained with Institutional Review Board approval for generating voxelized models. Along with image data, raw projection data were obtained to extract TCM functions for use in Monte Carlo simulations. Patient size was calculated using the effective diameter described in TG 204. In addition, the scanner-reported CTDI vol (CTDI vol,global ) was obtained for each patient, which is based on the average tube current across the entire scan. For the abdomen/pelvis scans, liver, spleen, and kidneys were manually segmented from the patient datasets; for the chest scans, lungs and for female models only, glandular breast tissue were segmented. For each patient organ doses were estimated using Monte Carlo Methods. To investigate the utility of regional measures of scanner output, regional and organ anatomic boundaries were identified from image data and used to calculate regional and organ-specific average tube current values. From these regional and organ-specific averages, CTDI vol values, referred to as regional and organ-specific CTDI vol , were calculated for each patient. Using an approach similar to TG 204, all CTDI vol values were used to normalize simulated organ doses; and the ability of each normalized dose to correlate with

  11. Cloning and characterization of the promoter regions from the parent and paralogous creatine transporter genes.

    Science.gov (United States)

    Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S

    2014-01-10

    Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first

  12. Salmonella modulation of host cell gene expression promotes its intracellular growth.

    Directory of Open Access Journals (Sweden)

    Sebastian Hannemann

    Full Text Available Salmonella Typhimurium has evolved a complex functional interface with its host cell largely determined by two type III secretion systems (T3SS, which through the delivery of bacterial effector proteins modulate a variety of cellular processes. We show here that Salmonella Typhimurium infection of epithelial cells results in a profound transcriptional reprogramming that changes over time. This response is triggered by Salmonella T3SS effector proteins, which stimulate unique signal transduction pathways leading to STAT3 activation. We found that the Salmonella-stimulated changes in host cell gene expression are required for the formation of its specialized vesicular compartment that is permissive for its intracellular replication. This study uncovers a cell-autonomous process required for Salmonella pathogenesis potentially opening up new avenues for the development of anti-infective strategies that target relevant host pathways.

  13. Salmonella modulation of host cell gene expression promotes its intracellular growth.

    Science.gov (United States)

    Hannemann, Sebastian; Gao, Beile; Galán, Jorge E

    2013-01-01

    Salmonella Typhimurium has evolved a complex functional interface with its host cell largely determined by two type III secretion systems (T3SS), which through the delivery of bacterial effector proteins modulate a variety of cellular processes. We show here that Salmonella Typhimurium infection of epithelial cells results in a profound transcriptional reprogramming that changes over time. This response is triggered by Salmonella T3SS effector proteins, which stimulate unique signal transduction pathways leading to STAT3 activation. We found that the Salmonella-stimulated changes in host cell gene expression are required for the formation of its specialized vesicular compartment that is permissive for its intracellular replication. This study uncovers a cell-autonomous process required for Salmonella pathogenesis potentially opening up new avenues for the development of anti-infective strategies that target relevant host pathways.

  14. Communicative Signals Promote Object Recognition Memory and Modulate the Right Posterior STS.

    Science.gov (United States)

    Redcay, Elizabeth; Ludlum, Ruth S; Velnoskey, Kayla R; Kanwal, Simren

    2016-01-01

    Detection of communicative signals is thought to facilitate knowledge acquisition early in life, but less is known about the role these signals play in adult learning or about the brain systems supporting sensitivity to communicative intent. The current study examined how ostensive gaze cues and communicative actions affect adult recognition memory and modulate neural activity as measured by fMRI. For both the behavioral and fMRI experiments, participants viewed a series of videos of an actress acting on one of two objects in front of her. Communicative context in the videos was manipulated in a 2 × 2 design in which the actress either had direct gaze (Gaze) or wore a visor (NoGaze) and either pointed at (Point) or reached for (Reach) one of the objects (target) in front of her. Participants then completed a recognition memory task with old (target and nontarget) objects and novel objects. Recognition memory for target objects in the Gaze conditions was greater than NoGaze, but no effects of gesture type were seen. Similarly, the fMRI video-viewing task revealed a significant effect of Gaze within right posterior STS (pSTS), but no significant effects of Gesture. Furthermore, pSTS sensitivity to Gaze conditions was related to greater memory for objects viewed in Gaze, as compared with NoGaze, conditions. Taken together, these results demonstrate that the ostensive, communicative signal of direct gaze preceding an object-directed action enhances recognition memory for attended items and modulates the pSTS response to object-directed actions. Thus, establishment of a communicative context through ostensive signals remains an important component of learning and memory into adulthood, and the pSTS may play a role in facilitating this type of social learning.

  15. Piliation of Lactobacillus rhamnosus GG Promotes Adhesion, Phagocytosis, and Cytokine Modulation in Macrophages

    Science.gov (United States)

    Vargas García, Cynthia E.; Petrova, Mariya; Claes, Ingmar J. J.; De Boeck, Ilke; Verhoeven, Tine L. A.; Dilissen, Ellen; von Ossowski, Ingemar; Palva, Airi; Bullens, Dominique M.; Vanderleyden, Jos

    2015-01-01

    Recently, spaCBA-encoded pili on the cell surface of Lactobacillus rhamnosus GG were identified to be key molecules for binding to human intestinal mucus and Caco-2 intestinal epithelial cells. Here, we investigated the role of the SpaCBA pilus of L. rhamnosus GG in the interaction with macrophages in vitro by comparing the wild type with surface mutants. Our results show that SpaCBA pili play a significant role in the capacity for adhesion to macrophages and also promote bacterial uptake by these phagocytic cells. Interestingly, our data suggest that SpaCBA pili also mediate anti-inflammatory effects by induction of interleukin-10 (IL-10) mRNA and reduction of interleukin-6 (IL-6) mRNA in a murine RAW 264.7 macrophage cell line. These pili appear to mediate these effects indirectly by promoting close contact with the macrophages, facilitating the exertion of anti-inflammatory effects by other surface molecules via yet unknown mechanisms. Blockage of complement receptor 3 (CR3), previously identified to be a receptor for streptococcal pili, significantly decreased the uptake of pilus-expressing strains in RAW 264.7 cells, while the expression of IL-10 and IL-6 mRNA by these macrophages was not affected by this blocking. On the other hand, blockage of Toll-like receptor 2 (TLR2) significantly reduced the expression of IL-6 mRNA irrespective of the presence of pili. PMID:25576613

  16. Identification of a single-nucleotide insertion in the promoter region affecting the sodC promoter activity in Brucella neotomae.

    Directory of Open Access Journals (Sweden)

    Dina A Moustafa

    Full Text Available Brucella neotomae is not known to be associated with clinical disease in any host species. Previous research suggested that B. neotomae might not express detectable levels of Cu/Zn superoxide dismutase (SOD, a periplasmic enzyme known to be involved in protecting Brucella from oxidative bactericidal effects of host phagocytes. This study was undertaken to investigate the genetic basis for the disparity in SOD expression in B. neotomae. Our Western blot and SOD enzyme assay analyses indicated that B. neotomae does express SOD, but at a substantially reduced level. Nucleotide sequence analysis of region upstream to the sodC gene identified a single-nucleotide insertion in the potential promoter region. The same single-nucleotide insertion was also detected in the sodC promoter of B. suis strain Thomsen, belonging to biovar 2 in which SOD expression was undetectable previously. Examination of the sodC promoter activities using translational fusion constructs with E. coli β-galactosidase demonstrated that the B. neotomae and B. suis biovar 2 promoters were very weak in driving gene expression. Site-directed mutation studies indicated that the insertion of A in the B. neotomae sodC promoter reduced the promoter activity. Increasing the level of SOD expression in B. neotomae through complementation with B. abortus sodC gene did not alter the bacterial survival in J774A.1 macrophage-like cells and in tissues of BALB/c and C57BL/6 mice. These results for the first time demonstrate the occurrence of a single-nucleotide polymorphism affecting promoter function and gene expression in Brucella.

  17. Assessing the effects of data selection and representation on the development of reliable E. coli sigma 70 promoter region predictors.

    Directory of Open Access Journals (Sweden)

    Mostafa M Abbas

    Full Text Available As the number of sequenced bacterial genomes increases, the need for rapid and reliable tools for the annotation of functional elements (e.g., transcriptional regulatory elements becomes more desirable. Promoters are the key regulatory elements, which recruit the transcriptional machinery through binding to a variety of regulatory proteins (known as sigma factors. The identification of the promoter regions is very challenging because these regions do not adhere to specific sequence patterns or motifs and are difficult to determine experimentally. Machine learning represents a promising and cost-effective approach for computational identification of prokaryotic promoter regions. However, the quality of the predictors depends on several factors including: i training data; ii data representation; iii classification algorithms; iv evaluation procedures. In this work, we create several variants of E. coli promoter data sets and utilize them to experimentally examine the effect of these factors on the predictive performance of E. coli σ70 promoter models. Our results suggest that under some combinations of the first three criteria, a prediction model might perform very well on cross-validation experiments while its performance on independent test data is drastically very poor. This emphasizes the importance of evaluating promoter region predictors using independent test data, which corrects for the over-optimistic performance that might be estimated using the cross-validation procedure. Our analysis of the tested models shows that good prediction models often perform well despite how the non-promoter data was obtained. On the other hand, poor prediction models seems to be more sensitive to the choice of non-promoter sequences. Interestingly, the best performing sequence-based classifiers outperform the best performing structure-based classifiers on both cross-validation and independent test performance evaluation experiments. Finally, we propose a

  18. Public health and health promotion capacity at national and regional level: a review of conceptual frameworks

    Directory of Open Access Journals (Sweden)

    Christoph Aluttis

    2014-04-01

    Full Text Available The concept of capacity building for public health has gained much attention during the last decade. National as well as international organizations increasingly focus their efforts on capacity building to improve performance in the health sector. During the past two decades, a variety of conceptual frameworks have been developed which describe relevant dimensions for public health capacity. Notably, these frameworks differ in design and conceptualization. This paper therefore reviews the existing conceptual frameworks and integrates them into one framework, which contains the most relevant dimensions for public health capacity at the country or regional level. A comprehensive literature search was performed to identify frameworks addressing public health capacity building at the national or regional level. We content-analysed these frameworks to identify the core dimensions of public health capacity. The dimensions were subsequently synthesized into a set of thematic areas to construct a conceptual framework which describes the most relevant dimensions for capacities at the national or regional level. The systematic review resulted in the identification of seven core domains for public health capacity: resources, organizational structures, workforce, partnerships, leadership and governance, knowledge development and country specific context. Accordingly, these dimensions were used to construct a framework, which describes these core domains more in detail. Our research shows that although there is no generally agreed upon model of public health capacity, a number of key domains for public health and health promotion capacity are consistently recurring in existing frameworks, regardless of their geographical location or thematic area. As only little work on the core concepts of public health capacities has yet taken place, this study adds value to the discourse by identifying these consistencies across existing frameworks and by synthesising

  19. Mutational analysis of the promoter and the coding region of the 5-HT1A gene

    Energy Technology Data Exchange (ETDEWEB)

    Erdmann, J.; Noethen, M.M.; Shimron-Abarbanell, D. [Univ. of Bonn (Germany)] [and others

    1994-09-01

    Disturbances of serotonergic pathways have been implicated in many neuropsychiatric disorders. Serotonin (5HT) receptors can be subdivided into at least three major families (5HT1, 5HT2, and 5HT3). Five human 5HT1 receptor subtypes have been cloned, namely 1A, 1D{alpha}, 1D{beta}, 1E, and 1F. Of these, the 5HT1A receptor is the best characterized subtype. In the present study we sought to identify genetic variation in the 5HT1A receptor gene which through alteration of protein function or level of expression might contribute to the genetics of neuropsychiatric diseases. The coding region and the 5{prime} promoter region of the 5HT1A gene from 159 unrelated subjects (45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 controls) were analyzed using SSCA. SSCA revealed the presence of two mutations both located in the coding region of the 5HT1A receptor gene. The first mutation is a rare silent C{r_arrow}T substitution at nucleotide position 549. The second mutation is characterized by a base pair substitution (A{r_arrow}G) at the first position of codon 28 and results in an amino acid exchange (Ile{r_arrow}Val). Since Val28 was found only in a single schizophrenic patient and in none of the other patients or controls, we decided to extend our samples and to use a restriction assay for screening a further 74 schizophrenic, 95 bipolar affective, and 49 patients with Tourette`s syndrome, as well as 185 controls, for the presence of the mutation. In total, the mutation was found in 2 schizophrenic patients, in 3 bipolars, in 1 Tourette patient, and in 5 controls. To our knowledge the Ile-28-Val substitution reported here is the first natural occuring molecular variant which has been identified for a serotonin receptor so far.

  20. Study on the binding sites of radiosensitivity associated transcription factor in the promoter region of Ier5 gene

    International Nuclear Information System (INIS)

    Cui Wei; Yin Lingling; Dong Lingyue

    2012-01-01

    Objective: To clarify the mechanism of immediate early response gene 5 (Ier5) transcription induced by radiation. Methods: Deletant construction, site-specific mutagenesis,electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) were used to forecast the promoter region, binding sites and transcription factors of Ier5 gene in HeLa cells. Results: The promoter region of Ier5 gene might be in the region of Ier5 -8 deletant (-408 - -238 bp). The Ier5 gene had two transcription factors of GCF and NFI, and GCF had two binding sites located in the region of -388 - -382 bp and -274 - -270 bp of Ier5 promoter. The binding site of NFI was located in -362 - -357 bp of Ier5 promoter. GCF could inhibit the expression of Ier5 gene and this inhibition was diminished when the radiation dose increased. In contrast, NFI increased the expression of Ier5. Conclusions: The most possible region of Ier5 promoter is from -408 to -238 bp which has two binding sites for the radiosensitivity transcription factors of GCF and NFI that could negatively and positively regulate the expression of Ier5 respectively. (authors)

  1. NOR1 promotes hepatocellular carcinoma cell proliferation and migration through modulating the Notch signaling pathway

    Energy Technology Data Exchange (ETDEWEB)

    You, Kun; Sun, Peisheng; Yue, Zhongyi; Li, Jian; Xiong, Wancheng; Wang, Jianguo, E-mail: jianguowangjgw@163.com

    2017-03-15

    Hepatocellular carcinoma (HCC) is one of the most common malignant tumors worldwide. Previous studies have reported that the oxidored-nitro domain containing protein 1 (NOR1) is a novel tumor suppressor in several tumors. Recent evidence suggests that NOR1 is strongly expressed in HCC cells. However, its role and mechanism in HCC are unclear. In the current study, Western blot and qPCR detected strong NOR1 mRNA and protein expression in HepG2 and Hep3B cells. After transfection with NOR1 siRNA or pcDNA3.1-myc-his-NOR1, the proliferation and migration of HepG2 and Hep3B cells were analyzed in vitro. HepG2 or Hep3B cells overexpressing NOR1 showed an increased proliferation and migration, whereas siRNA-mediated silencing of NOR1 showed the opposite effect. Furthermore, NOR1 activated the Notch signaling pathway, indicated by increased levels of Notch1, NICD, Hes1, and Hey1 in protein. Importantly, the Notch inhibitor DAPT downregulated Notch activation and further enhanced siNOR1-induced reduction of cell proliferation and migration in HepG2 and Hep3B cells, whereas DAPT reversed the effect of NOR1 overexpression on cell proliferation and migration. In conclusion, these results indicate that NOR1 may be involved in the progression of HCC and thus may be a potential target for the treatment of liver cancer. - Highlights: • NOR1 expression is up-regulated in HCC cells. • NOR1 promotes the proliferation and migration of HCC cells. • NOR1 promotes the progression of HCC cells by activating Notch pathway.

  2. Selection for Unequal Densities of Sigma70 Promoter-like Signalsin Different Regions of Large Bacterial Genomes

    Energy Technology Data Exchange (ETDEWEB)

    Huerta, Araceli M.; Francino, M. Pilar; Morett, Enrique; Collado-Vides, Julio

    2006-03-01

    The evolutionary processes operating in the DNA regions that participate in the regulation of gene expression are poorly understood. In Escherichia coli, we have established a sequence pattern that distinguishes regulatory from nonregulatory regions. The density of promoter-like sequences, that are recognizable by RNA polymerase and may function as potential promoters, is high within regulatory regions, in contrast to coding regions and regions located between convergently-transcribed genes. Moreover, functional promoter sites identified experimentally are often found in the subregions of highest density of promoter-like signals, even when individual sites with higher binding affinity for RNA polymerase exist elsewhere within the regulatory region. In order to investigate the generality of this pattern, we have used position weight matrices describing the -35 and -10 promoter boxes of E. coli to search for these motifs in 43 additional genomes belonging to most established bacterial phyla, after specific calibration of the matrices according to the base composition of the noncoding regions of each genome. We have found that all bacterial species analyzed contain similar promoter-like motifs, and that, in most cases, these motifs follow the same genomic distribution observed in E. coli. Differential densities between regulatory and nonregulatory regions are detectable in most bacterial genomes, with the exception of those that have experienced evolutionary extreme genome reduction. Thus, the phylogenetic distribution of this pattern mirrors that of genes and other genomic features that require weak selection to be effective in order to persist. On this basis, we suggest that the loss of differential densities in the reduced genomes of host-restricted pathogens and symbionts is the outcome of a process of genome degradation resulting from the decreased efficiency of purifying selection in highly structured small populations. This implies that the differential

  3. Rhubarb Supplementation Promotes Intestinal Mucosal Innate Immune Homeostasis through Modulating Intestinal Epithelial Microbiota in Goat Kids.

    Science.gov (United States)

    Jiao, Jinzhen; Wu, Jian; Wang, Min; Zhou, Chuanshe; Zhong, Rongzhen; Tan, Zhiliang

    2018-01-31

    The abuse and misuse of antibiotics in livestock production pose a potential health risk globally. Rhubarb can serve as a potential alternative to antibiotics, and several studies have looked into its anticancer, antitumor, and anti-inflammatory properties. The aim of this study was to test the effects of rhubarb supplementation to the diet of young ruminants on innate immune function and epithelial microbiota in the small intestine. Goat kids were fed with a control diet supplemented with or without rhubarb (1.25% DM) and were slaughtered at days 50 and 60 of age. Results showed that the supplementation of rhubarb increased ileal villus height (P = 0.036), increased jejujal and ileal anti-inflammatory IL-10 production (P immune function were accompanied by shifts in ileal epithelial bacterial ecosystem in favor of Blautia, Clostridium, Lactobacillus, and Pseudomonas, and with a decline in the relative abundance of Staphylococcus (P immune homeostasis by modulating intestinal epithelial microbiota during the early stages of animal development.

  4. Helminth Products Potently Modulate Experimental Autoimmune Encephalomyelitis by Downregulating Neuroinflammation and Promoting a Suppressive Microenvironment

    Directory of Open Access Journals (Sweden)

    Alberto N. Peón

    2017-01-01

    Full Text Available A negative correlation between the geographical distribution of autoimmune diseases and helminth infections has been largely associated in the last few years with a possible role for such type of parasites in the regulation of inflammatory diseases, suggesting new pathways for drug development. However, few helminth-derived immunomodulators have been tested in experimental autoimmune encephalomyelitis (EAE, an animal model of the human disease multiple sclerosis (MS. The immunomodulatory activities of Taenia crassiceps excreted/secreted products (TcES that may suppress EAE development were sought for. Interestingly, it was discovered that TcES was able to suppress EAE development with more potency than dexamethasone; moreover, TcES treatment was still effective even when inoculated at later stages after the onset of EAE. Importantly, the TcES treatment was able to induce a range of Th2-type cytokines, while suppressing Th1 and Th17 responses. Both the polyclonal and the antigen-specific proliferative responses of lymphocytes were also inhibited in EAE-ill mice receiving TcES in association with a potent recruitment of suppressor cell populations. Peritoneal inoculation of TcES was able to direct the normal inflammatory cell traffic to the site of injection, thus modulating CNS infiltration, which may work along with Th2 immune polarization and lymphocyte activation impairment to downregulate EAE development.

  5. AtWRKY22 promotes susceptibility to aphids and modulates salicylic acid and jasmonic acid signalling.

    Science.gov (United States)

    Kloth, Karen J; Wiegers, Gerrie L; Busscher-Lange, Jacqueline; van Haarst, Jan C; Kruijer, Willem; Bouwmeester, Harro J; Dicke, Marcel; Jongsma, Maarten A

    2016-05-01

    Aphids induce many transcriptional perturbations in their host plants, but the signalling cascades responsible and the effects on plant resistance are largely unknown. Through a genome-wide association (GWA) mapping study in Arabidopsis thaliana, we identified WRKY22 as a candidate gene associated with feeding behaviour of the green peach aphid, Myzus persicae The transcription factor WRKY22 is known to be involved in pathogen-triggered immunity, and WRKY22 gene expression has been shown to be induced by aphids. Assessment of aphid population development and feeding behaviour on knockout mutants and overexpression lines showed that WRKY22 increases susceptibility to M. persicae via a mesophyll-located mechanism. mRNA sequencing analysis of aphid-infested wrky22 knockout plants revealed the up-regulation of genes involved in salicylic acid (SA) signalling and down-regulation of genes involved in plant growth and cell-wall loosening. In addition, mechanostimulation of knockout plants by clip cages up-regulated jasmonic acid (JA)-responsive genes, resulting in substantial negative JA-SA crosstalk. Based on this and previous studies, WRKY22 is considered to modulate the interplay between the SA and JA pathways in response to a wide range of biotic and abiotic stimuli. Its induction by aphids and its role in suppressing SA and JA signalling make WRKY22 a potential target for aphids to manipulate host plant defences. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  6. Dietary Polysaccharide from Enteromorpha Clathrata Modulates Gut Microbiota and Promotes the Growth of Akkermansia muciniphila, Bifidobacterium spp. and Lactobacillus spp.

    Science.gov (United States)

    Shang, Qingsen; Wang, Ya; Pan, Lin; Niu, Qingfeng; Li, Chao; Jiang, Hao; Cai, Chao; Hao, Jiejie; Li, Guoyun; Yu, Guangli

    2018-05-17

    Recently, accumulating evidence has suggested that Enteromorpha clathrata polysaccharide (ECP) could contribute to the treatment of diseases. However, as a promising candidate for marine drug development, although ECP has been extensively studied, less consideration has been given to exploring its effect on gut microbiota. In this light, given the critical role of gut microbiota in health and disease, we investigated here the effect of ECP on gut microbiota using 16S rRNA high-throughput sequencing. As revealed by bioinformatic analyses, ECP considerably changed the structure of the gut microbiota and significantly promoted the growth of probiotic bacteria in C57BL/6J mice. However, interestingly, ECP exerted different effects on male and female microbiota. In females, ECP increased the abundances of Bifidobacterium spp. and Akkermansia muciniphila , a next-generation probiotic bacterium, whereas in males, ECP increased the population of Lactobacillus spp. Moreover, by shaping a more balanced structure of the microbiota, ECP remarkably reduced the antigen load from the gut in females. Altogether, our study demonstrates for the first time a prebiotic effect of ECP on gut microbiota and forms the basis for the development of ECP as a novel gut microbiota modulator for health promotion and disease management.

  7. Two negative cis-regulatory regions involved in fruit-specific promoter activity from watermelon (Citrullus vulgaris S.).

    Science.gov (United States)

    Yin, Tao; Wu, Hanying; Zhang, Shanglong; Lu, Hongyu; Zhang, Lingxiao; Xu, Yong; Chen, Daming; Liu, Jingmei

    2009-01-01

    A 1.8 kb 5'-flanking region of the large subunit of ADP-glucose pyrophosphorylase, isolated from watermelon (Citrullus vulgaris S.), has fruit-specific promoter activity in transgenic tomato plants. Two negative regulatory regions, from -986 to -959 and from -472 to -424, were identified in this promoter region by fine deletion analyses. Removal of both regions led to constitutive expression in epidermal cells. Gain-of-function experiments showed that these two regions were sufficient to inhibit RFP (red fluorescent protein) expression in transformed epidermal cells when fused to the cauliflower mosaic virus (CaMV) 35S minimal promoter. Gel mobility shift experiments demonstrated the presence of leaf nuclear factors that interact with these two elements. A TCCAAAA motif was identified in these two regions, as well as one in the reverse orientation, which was confirmed to be a novel specific cis-element. A quantitative beta-glucuronidase (GUS) activity assay of stable transgenic tomato plants showed that the activities of chimeric promoters harbouring only one of the two cis-elements, or both, were approximately 10-fold higher in fruits than in leaves. These data confirm that the TCCAAAA motif functions as a fruit-specific element by inhibiting gene expression in leaves.

  8. Small Molecules Modulate Chromatin Accessibility to Promote NEUROG2-Mediated Fibroblast-to-Neuron Reprogramming

    Directory of Open Access Journals (Sweden)

    Derek K. Smith

    2016-11-01

    Full Text Available Pro-neural transcription factors and small molecules can induce the reprogramming of fibroblasts into functional neurons; however, the immediate-early molecular events that catalyze this conversion have not been well defined. We previously demonstrated that neurogenin 2 (NEUROG2, forskolin (F, and dorsomorphin (D can reprogram fibroblasts into functional neurons with high efficiency. Here, we used this model to define the genetic and epigenetic events that initiate an acquisition of neuronal identity. We demonstrate that NEUROG2 is a pioneer factor, FD enhances chromatin accessibility and H3K27 acetylation, and synergistic transcription activated by these factors is essential to successful reprogramming. CREB1 promotes neuron survival and acts with NEUROG2 to upregulate SOX4, which co-activates NEUROD1 and NEUROD4. In addition, SOX4 targets SWI/SNF subunits and SOX4 knockdown results in extensive loss of open chromatin and abolishes reprogramming. Applying these insights, adult human glioblastoma cell and skin fibroblast reprogramming can be improved using SOX4 or chromatin-modifying chemicals.

  9. USP7 Attenuates Hepatic Gluconeogenesis Through Modulation of FoxO1 Gene Promoter Occupancy

    Science.gov (United States)

    Hall, Jessica A.; Tabata, Mitsuhisa; Rodgers, Joseph T.

    2014-01-01

    Hepatic forkhead protein FoxO1 is a key component of systemic glucose homeostasis via its ability to regulate the transcription of rate-limiting enzymes in gluconeogenesis. Important in the regulation of FoxO1 transcriptional activity are the modifying/demodifying enzymes that lead to posttranslational modification. Here, we demonstrate the functional interaction and regulation of FoxO1 by herpesvirus-associated ubiquitin-specific protease 7 (USP7; also known as herpesvirus-associated ubiquitin-specific protease, HAUSP), a deubiquitinating enzyme. We show that USP7-mediated mono-deubiquitination of FoxO1 results in suppression of FoxO1 transcriptional activity through decreased FoxO1 occupancy on the promoters of gluconeogenic genes. Knockdown of USP7 in primary hepatocytes leads to increased expression of FoxO1-target gluconeogenic genes and elevated glucose production. Consistent with this, USP7 gain-of-function suppresses the fasting/cAMP-induced activation of gluconeogenic genes in hepatocyte cells and in mouse liver, resulting in decreased hepatic glucose production. Notably, we show that the effects of USP7 on hepatic glucose metabolism depend on FoxO1. Together, these results place FoxO1 under the intimate regulation of deubiquitination and glucose metabolic control with important implication in diseases such as diabetes. PMID:24694308

  10. Bovine glycomacropeptide promotes the growth of Bifidobacterium longum ssp. infantis and modulates its gene expression.

    Science.gov (United States)

    O'Riordan, N; O'Callaghan, J; Buttò, L F; Kilcoyne, M; Joshi, L; Hickey, R M

    2018-05-23

    Bovine milk glycomacropeptide (GMP) is derived from κ-casein, with exclusively o-linked glycosylation. Glycomacropeptide promoted the growth of Bifidobacterium longum ssp. infantis in a concentration-dependent manner, and this activity was lost following periodate treatment of the GMP (GMP-P), which disables biological recognition of the conjugated oligosaccharides. Transcriptional analysis of B. longum ssp. infantis following exposure to GMP revealed a substantial response to GMP relative to bacteria treated with GMP-P, with a greater number of differentially expressed transcripts and larger fold changes versus the control. Therefore, stimulation of B. longum ssp. infantis growth by GMP is intrinsically linked to the peptide's O-linked glycosylation. The pool of differentially expressed transcripts included 2 glycoside hydrolase (family 25) genes, which were substantially upregulated following exposure to GMP, but not GMP-P. These GH25 genes were present in duplicated genomic islands that also contained genes encoding fibronectin type III binding domain proteins and numerous phage-related proteins, all of which were also upregulated. Homologs of this genomic arrangement were present in other Bifidobacterium species, which suggest it may be a conserved domain for the utilization of glycosylated peptides. This study provides insights into the molecular basis for the prebiotic effect of bovine milk GMP on B. longum ssp. infantis. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  11. Geoheritage promotion of Thonon-les-Bains (Fr) region by the development of a geotourism product

    Science.gov (United States)

    Fanguin, Pauline

    2014-05-01

    Since 2012, the Chablais region (only in France) has acquired the Geopark label. This Geopark contributes to sustainable economic development of the region through geotourism. Moreover, the three Chablais (figure 1) are concerned by an Interreg IV program since 2009 (program of cooperation between European countries). The main objective of this program is to enhance the heritage resources (nature, culture and lifestyle of the region) (www.interreg-francesuisse.org). Therefore, the geotourism offer in this area just waiting to expand. The geodidactics models like the simplification of the scientific content are essential for geoheritage promotion, because this content must be available to a wide audience, allowing thereby the geoheritage recognition. The geotourism permits to apply different models (Cayla et al. 2010, Sellier, 2009) through a wide range of geotourism products, like guide, educational panels, thematic hikes and recently developed, new medias (website, smartphone applications). A geotourism product is based on four areas of questioning and was developed by Martin et al. (2010): (1) site (choice of sites to be valued), (2) public (a family public, good example of heterogeneous public), (3) contents (reasoning on geodidactics models) and (4) support (smartphone application). These four areas are very fundamental before the creation of any geotourism product. These reflexions aim to obtain a mediation product that integrates into geotourism offer of a region and contributes to its development and meets public expectations. New media, such as digital media - smartphone, tablets, website - become geotourism products more and more attractive. In addition, the necessary technologies to develop new media help to integrate a high interactivity potential with the public and thus get their attention. The architecture of this geotourism product is based on the new application developed by the Institute of Geography and sustainability, and the Bureau Relief. One

  12. Different regions of the newcastle disease virus fusion protein modulate pathogenicity.

    Directory of Open Access Journals (Sweden)

    Sandra Heiden

    Full Text Available Newcastle disease virus (NDV, also designated as Avian paramyxovirus type 1 (APMV-1, is the causative agent of a notifiable disease of poultry but it exhibits different pathogenicity dependent on the virus strain. The molecular basis for this variability is not fully understood. The efficiency of activation of the fusion protein (F is determined by presence or absence of a polybasic amino acid sequence at an internal proteolytic cleavage site which is a major determinant of NDV virulence. However, other determinants of pathogenicity must exist since APMV-1 of high (velogenic, intermediate (mesogenic and low (lentogenic virulence specify a polybasic F cleavage site. We aimed at elucidation of additional virulence determinants by constructing a recombinant virus that consists of a lentogenic NDV Clone 30 backbone and the F protein gene from a mesogenic pigeon paramyxovirus-1 (PPMV-1 isolate with an intracerebral pathogenicity index (ICPI of 1.1 specifying the polybasic sequence R-R-K-K-R*F motif at the cleavage site. The resulting virus was characterized by an ICPI of 0.6, indicating a lentogenic pathotype. In contrast, alteration of the cleavage site G-R-Q-G-R*L of the lentogenic Clone 30 to R-R-K-K-R*F resulted in a recombinant virus with an ICPI of 1.36 which was higher than that of parental PPMV-1. Substitution of different regions of the F protein of Clone 30 by those of PPMV-1, while maintaining the polybasic amino acid sequence at the F cleavage site, resulted in recombinant viruses with ICPIs ranging from 0.59 to 1.36 suggesting that virulence is modulated by regions of the F protein other than the polybasic cleavage site.

  13. Alternative Growth Promoters Modulate Broiler Gut Microbiome and Enhance Body Weight Gain

    Science.gov (United States)

    Salaheen, Serajus; Kim, Seon-Woo; Haley, Bradd J.; Van Kessel, Jo Ann S.; Biswas, Debabrata

    2017-01-01

    Antibiotic growth promoters (AGPs) are frequently used to enhance weight-gain in poultry production. However, there has been increasing concern over the impact of AGP on the emergence of antibiotic resistance in zoonotic bacterial pathogens in the microbial community of the poultry gut. In this study, we adopted mass-spectrophotometric, phylogenetic, and shotgun-metagenomic approaches to evaluate bioactive phenolic extracts (BPE) from blueberry (Vaccinium corymbosum) and blackberry (Rubus fruticosus) pomaces as AGP alternatives in broilers. We conducted two trials with 100 Cobb-500 broiler chicks (in each trial) in four equal groups that were provided water with no supplementation, supplemented with AGP (tylosin, neomycin sulfate, bacitracin, erythromycin, and oxytetracycline), or supplemented with 0.1 g Gallic acid equivalent (GAE)/L or 1.0 g GAE/L (during the last 72 h before euthanasia) of BPE for 6 weeks. When compared with the control group (water only), the chickens supplemented with AGP and 0.1 g GAE/L of BPE gained 9.5 and 5.8% more body weight, respectively. The microbiomes of both the AGP- and BPE-treated chickens had higher Firmicutes to Bacteroidetes ratios. AGP supplementation appeared to be associated with higher relative abundance of bacteriophages and unique cecal resistomes compared with BPE supplementation or control. Functional characterization of cecal microbiomes revealed significant animal-to-animal variation in the relative abundance of genes involved in energy and carbohydrate metabolism. These findings established a baseline upon which mechanisms of plant-based performance enhancers in regulation of animal growth can be investigated. In addition, the data will aid in designing alternate strategies to improve animal growth performance and consequently production. PMID:29123512

  14. Alternative Growth Promoters Modulate Broiler Gut Microbiome and Enhance Body Weight Gain

    Directory of Open Access Journals (Sweden)

    Serajus Salaheen

    2017-10-01

    Full Text Available Antibiotic growth promoters (AGPs are frequently used to enhance weight-gain in poultry production. However, there has been increasing concern over the impact of AGP on the emergence of antibiotic resistance in zoonotic bacterial pathogens in the microbial community of the poultry gut. In this study, we adopted mass-spectrophotometric, phylogenetic, and shotgun-metagenomic approaches to evaluate bioactive phenolic extracts (BPE from blueberry (Vaccinium corymbosum and blackberry (Rubus fruticosus pomaces as AGP alternatives in broilers. We conducted two trials with 100 Cobb-500 broiler chicks (in each trial in four equal groups that were provided water with no supplementation, supplemented with AGP (tylosin, neomycin sulfate, bacitracin, erythromycin, and oxytetracycline, or supplemented with 0.1 g Gallic acid equivalent (GAE/L or 1.0 g GAE/L (during the last 72 h before euthanasia of BPE for 6 weeks. When compared with the control group (water only, the chickens supplemented with AGP and 0.1 g GAE/L of BPE gained 9.5 and 5.8% more body weight, respectively. The microbiomes of both the AGP- and BPE-treated chickens had higher Firmicutes to Bacteroidetes ratios. AGP supplementation appeared to be associated with higher relative abundance of bacteriophages and unique cecal resistomes compared with BPE supplementation or control. Functional characterization of cecal microbiomes revealed significant animal-to-animal variation in the relative abundance of genes involved in energy and carbohydrate metabolism. These findings established a baseline upon which mechanisms of plant-based performance enhancers in regulation of animal growth can be investigated. In addition, the data will aid in designing alternate strategies to improve animal growth performance and consequently production.

  15. Asian Values and Democratic Citizenship: Exploring Attitudes among South Korean Eighth Graders Using Data from the ICCS Asian Regional Module

    Science.gov (United States)

    Knowles, Ryan Thomas

    2015-01-01

    Utilizing data from the 2009 IEA International Civic and Citizenship Study Asian Regional Module, this secondary analysis explores the relationship between traditional Asian values and democratic citizenship. Findings identify two dimensions of Asian values: Asian civic values and obedience to authority. Among South Korean students, Asian civic…

  16. Gel shift analysis of the empA promoter region in Vibrio anguillarum

    Directory of Open Access Journals (Sweden)

    Denkin Steven M

    2004-10-01

    Full Text Available Abstract Background The induction of metalloprotease encoded by empA in Vibrio anguillarum occurs at high cell density in salmon intestinal mucus. Previously we have shown that there are significant differences in empA expression in two strains of V. anguillarum, M93Sm and NB10. It is hypothesized that differences in empA regulation are due to differences in binding of regulatory elements. Results Two strains of V. anguillarum, M93Sm and NB10, were examined and compared for the presence of DNA regulatory proteins that bind to and control the empA promoter region. Gel mobility shift assays, using a digoxigenin (DIG-labeled oligomer containing a lux box-like element and the promoter for empA, were done to demonstrate the presence of a DNA-binding protein. Protein extracts from NB10 cells incubated in Luria Bertani broth + 2% NaCl (LB20, nine salts solution + 200 μg/ml mucus (NSSM, 3M (marine minimal medium, or NSS resulted in a gel mobility shift. No gel mobility shift was seen when protein extracts from either LB20- or NSSM-grown M93Sm cells were mixed with the DIG-labeled empA oligomer. The azocasein assay detected protease activity in all incubation conditions for NB10 culture supernatants. In contrast, protease activity was detected in M93Sm culture supernatants only when incubated in NSSM. Since the luxR homologue in V. anguillarum, vanT, has been cloned, sequenced, and shown to be required for protease activity, we wanted to determine if vanT mutants of NB10 exhibit the same gel shift observed in the wild-type. Site-directed mutagenesis was used to create vanT mutants in V. anguillarum M93Sm and NB10 to test whether VanT is involved with the gel mobility shift. Both vanT mutants, M02 and NB02, did not produce protease activity in any conditions. However, protein extracts from NB02 incubated in each condition still exhibited a gel shift when mixed with the DIG-labeled empA oligomer. Conclusions The data demonstrate that protein extracts of V

  17. “Fear or Love Thy Neighbour”? The EU Framework for Promoting Regional Cooperation in the South Caucasus

    Directory of Open Access Journals (Sweden)

    Nelli Babayan

    2011-12-01

    Full Text Available Building on the model of the enlargement policy, the European Union (EU designed the European Neighbourhood Policy and the Eastern Partnership to further promote its norms and principles. One of the goals of its new policies has been to foster regional cooperation among partner countries and their neighbours. This article specifies the EU’s framework for promoting regional cooperation through the aforementioned policies and discusses its potential impact on the example of the South Caucasus republics of Armenia, Azerbaijan, and Georgia. The South Caucasus has not only been an arena of intraregional conflicts, but has also often been troubled by disputes between its neighbours. This article argues that, due to a lack of proactive and consistent engagement, the EU’s framework risks leaving regional conflicts in the current state of stagnation and without advancement in regional cooperation.

  18. Regional Differences in Correlates of Daily Walking among Middle Age and Older Australian Rural Adults: Implications for Health Promotion

    Directory of Open Access Journals (Sweden)

    James Dollman

    2016-01-01

    Full Text Available Rural Australians are less physically active than their metropolitan counterparts, and yet very little is known of the candidate intervention targets for promoting physical activity in rural populations. As rural regions are economically, socially and environmentally diverse, drivers of regular physical activity are likely to vary between regions. This study explored the region-specific correlates of daily walking among middle age and older adults in rural regions with contrasting dominant primary industries. Participants were recruited through print and electronic media, primary care settings and community organisations. Pedometers were worn by 153 adults for at least four days, including a weekend day. A questionnaire identified potential intra-personal, social and environmental correlates of physical activity, according to a social ecological framework. Regression modelling identified independent correlates of daily walking separately in the two study regions. In one region, there were independent correlates of walking from all levels of the social ecological framework. In the other region, significant correlates of daily walking were almost all demographic (age, education and marital status. Participants living alone were less likely to be physically active regardless of region. This study highlights the importance of considering region-specific factors when designing strategies for promoting regular walking among rural adults.

  19. Genomic organization and identification of promoter regions for the BDNF gene in the pond turtle Trachemys scripta elegans.

    Science.gov (United States)

    Ambigapathy, Ganesh; Zheng, Zhaoqing; Keifer, Joyce

    2014-08-01

    Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I-III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI-III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression.

  20. Bioinformatics Identification of Modules of Transcription Factor Binding Sites in Alzheimer's Disease-Related Genes by In Silico Promoter Analysis and Microarrays

    Directory of Open Access Journals (Sweden)

    Regina Augustin

    2011-01-01

    Full Text Available The molecular mechanisms and genetic risk factors underlying Alzheimer's disease (AD pathogenesis are only partly understood. To identify new factors, which may contribute to AD, different approaches are taken including proteomics, genetics, and functional genomics. Here, we used a bioinformatics approach and found that distinct AD-related genes share modules of transcription factor binding sites, suggesting a transcriptional coregulation. To detect additional coregulated genes, which may potentially contribute to AD, we established a new bioinformatics workflow with known multivariate methods like support vector machines, biclustering, and predicted transcription factor binding site modules by using in silico analysis and over 400 expression arrays from human and mouse. Two significant modules are composed of three transcription factor families: CTCF, SP1F, and EGRF/ZBPF, which are conserved between human and mouse APP promoter sequences. The specific combination of in silico promoter and multivariate analysis can identify regulation mechanisms of genes involved in multifactorial diseases.

  1. Interplay between chromatin modulators and histone acetylation regulates the formation of accessible chromatin in the upstream regulatory region of fission yeast fbp1.

    Science.gov (United States)

    Adachi, Akira; Senmatsu, Satoshi; Asada, Ryuta; Abe, Takuya; Hoffman, Charles S; Ohta, Kunihiro; Hirota, Kouji

    2018-05-03

    Numerous noncoding RNA transcripts are detected in eukaryotic cells. Noncoding RNAs transcribed across gene promoters are involved in the regulation of mRNA transcription via chromatin modulation. This function of noncoding RNA transcription was first demonstrated for the fission yeast fbp1 gene, where a cascade of noncoding RNA transcription events induces chromatin remodeling to facilitate transcription factor binding. We recently demonstrated that the noncoding RNAs from the fbp1 upstream region facilitate binding of the transcription activator Atf1 and thereby promote histone acetylation. Histone acetylation by histone acetyl transferases (HATs) and ATP-dependent chromatin remodelers (ADCRs) are implicated in chromatin remodeling, but the interplay between HATs and ADCRs in this process has not been fully elucidated. Here, we examine the roles played by two distinct ADCRs, Snf22 and Hrp3, and by the HAT Gcn5 in the transcriptional activation of fbp1. Snf22 and Hrp3 redundantly promote disassembly of chromatin in the fbp1 upstream region. Gcn5 critically contributes to nucleosome eviction in the absence of either Snf22 or Hrp3, presumably by recruiting Hrp3 in snf22∆ cells and Snf22 in hrp3∆ cells. Conversely, Gcn5-dependent histone H3 acetylation is impaired in snf22∆/hrp3∆ cells, suggesting that both redundant ADCRs induce recruitment of Gcn5 to the chromatin array in the fbp1 upstream region. These results reveal a previously unappreciated interplay between ADCRs and histone acetylation in which histone acetylation facilitates recruitment of ADCRs, while ADCRs are required for histone acetylation.

  2. Reconstruction of metabolic module with improved promoter strength increases the productivity of 2-phenylethanol in Saccharomyces cerevisiae.

    Science.gov (United States)

    Wang, Zhaoyue; Jiang, Mingyue; Guo, Xuena; Liu, Zhaozheng; He, Xiuping

    2018-04-11

    2-phenylethanol (2-PE) is an important aromatic compound with a lovely rose-like scent. Saccharomyces cerevisiae is a desirable microbe for 2-PE production but its natural yield is not high, and one or two crucial genes' over-expression in S. cerevisiae did not improve 2-PE greatly. A new metabolic module was established here, in which, permease Gap1p for L-phenylalanine transportation, catalytic enzymes Aro8p, Aro10p and Adh2p in Ehrlich pathway respectively responsible for transamination, decarboxylation and reduction were assembled, besides, glutamate dehydrogenase Gdh2p was harbored for re-supplying another substrate 2-oxoglutarate, relieving product glutamate repression and regenerating cofactor NADH. Due to different promoter strengths, GAP1, ARO8, ARO9, ARO10, ADH2 and GDH2 in the new modularized YS58(G1-A8-A10-A2)-GDH strain enhanced 11.6-, 15.4-, 3.6-, 17.7-, 12.4- and 7.5-folds respectively, and crucial enzyme activities of aromatic aminotransferases and phenylpyruvate decarboxylase were 4.8- and 7-folds respectively higher than that of the control. Under the optimum medium and cell density, YS58(G1-A8-A10-A2)-GDH presented efficient 2-PE synthesis ability with ~ 6.3 g L -1 of 2-PE titer in 5-L fermenter reaching 95% of conversation ratio. Under fed-batch fermentation, 2-PE productivity at 24 h increased 29% than that of single-batch fermentation. Metabolic modularization with promoter strategy provides a new prospective for efficient 2-PE production.

  3. Carcass and meat quality determination as a tool to promote local meat consumption in outermost regions of Europe

    DEFF Research Database (Denmark)

    Hernandez Castellano, Lorenzo E; Morales-delaNuez, Antonio; Moreno-Indias, Isabel

    2013-01-01

    of this study, therefore, was to evaluate local and imported carcasses and meat quality in order to promote the consumption of local breeds, using the Canary Islands (Spain) as a model for other subtropical outermost regions. For this study 20 half-carcasses from Palmera breed and 20 imported half...

  4. Relationship of interleukin-1B gene promoter region polymorphism with Helicobacter pylori infection and gastritis.

    Science.gov (United States)

    Ramis, Ivy Bastos; Vianna, Júlia Silveira; Halicki, Priscila Cristina Bartolomeu; Lara, Caroline; Tadiotto, Thássia Fernanda; da Silva Maciel, João Batista; Gonçalves, Carla Vitola; von Groll, Andrea; Dellagostin, Odir Antônio; da Silva, Pedro Eduardo Almeida

    2015-09-29

    Helicobacter pylori infection is associated with gastritis, peptic ulcer disease and gastric carcinoma. The severity of damage is determined by the interplay between environmental/behavioral factors, bacterial pathogenicity genes and host genetic polymorphisms that can influence the secretion levels of inflammatory cytokines. Accordingly, this study aimed to identify polymorphisms in the IL-1B and IL-1RN genes and their associations with H. pylori infection, cagA gene of H. pylori, and gastroduodenal diseases. Gastric biopsy samples from 151 patients infected with H. pylori and 76 uninfected individuals were analyzed. H. pylori infection was diagnosed by histology and PCR. Polymorphisms at positions -511, -31 and +3954 of the IL-1B gene were detected by PCR-RFLP, and an analysis of the VNTR polymorphism of the IL-1RN gene was performed by PCR. It was observed that the presence of the T/T genotype at position -511 and the C/C genotype at position -31 were associated with H. pylori infection and with an increased risk of gastritis in H. pylori-positive patients. Additionally, strains from patients H. pylori-positive carrying the cagA gene was significantly related with the T/T genotype at position -511 of IL-1B.  No association of polymorphisms at position +3954 of IL-1B and in the IL-1RN with H. pylori infection and with risk of severe gastric diseases was found. We demonstrated that polymorphisms in the promoter region of the IL-1B gene (at positions -511 and -31) are associated with an enhanced risk of H. pylori infection as well as gastritis in H. pylori-positive patients.

  5. CD4+ T Cell-derived IL-10 Promotes Brucella abortus Persistence via Modulation of Macrophage Function

    Science.gov (United States)

    Xavier, Mariana N.; Winter, Maria G.; Spees, Alanna M.; Nguyen, Kim; Atluri, Vidya L.; Silva, Teane M. A.; Bäumler, Andreas J.; Müller, Werner; Santos, Renato L.; Tsolis, Renée M.

    2013-01-01

    Evasion of host immune responses is a prerequisite for chronic bacterial diseases; however, the underlying mechanisms are not fully understood. Here, we show that the persistent intracellular pathogen Brucella abortus prevents immune activation of macrophages by inducing CD4+CD25+ T cells to produce the anti-inflammatory cytokine interleukin-10 (IL-10) early during infection. IL-10 receptor (IL-10R) blockage in macrophages resulted in significantly higher NF-kB activation as well as decreased bacterial intracellular survival associated with an inability of B. abortus to escape the late endosome compartment in vitro. Moreover, either a lack of IL-10 production by T cells or a lack of macrophage responsiveness to this cytokine resulted in an increased ability of mice to control B. abortus infection, while inducing elevated production of pro-inflammatory cytokines, which led to severe pathology in liver and spleen of infected mice. Collectively, our results suggest that early IL-10 production by CD25+CD4+ T cells modulates macrophage function and contributes to an initial balance between pro-inflammatory and anti-inflammatory cytokines that is beneficial to the pathogen, thereby promoting enhanced bacterial survival and persistent infection. PMID:23818855

  6. The Role of Indian Ocean SST Anomalies in Modulating Regional Rainfall Variability and Long-term Change

    Science.gov (United States)

    Ummenhofer, C. C.; Sen Gupta, A.; England, M. H.

    2008-12-01

    In a series of atmospheric general circulation model simulations, the potential impact of Indian Ocean sea surface temperature (SST) anomalies in modulating low- to mid-latitude precipitation around the Indian Ocean rim countries is explored. The relative importance of various characteristic tropical and subtropical Indian Ocean SST poles, both individually and in combination, to regional precipitation changes is quantified. A mechanism for the rainfall modulation is proposed, by which the SST anomalies induce changes in the thermal properties of the atmosphere, resulting in a reorganization of the large-scale atmospheric circulation across the Indian Ocean basin. Across western and southern regions of Australia, rainfall anomalies are found to be due to modulations in the meridional thickness gradient, thermal wind, and baroclinicity, leading to changes in the moisture flux onto the continent. The pattern of large-scale circulation changes over the tropical Indian Ocean and adjacent land masses is consistent with an anomalous strengthening of the Walker cell, leading to variations in precipitation of opposite sign across western and eastern regions of the basin. Links between long-term changes in Indian Ocean surface properties and regional precipitation changes in Indian Ocean rim countries are also discussed in a broader context with implications for water management and seasonal forecasting.

  7. Modulation of extremes in the Atlantic region by modes of climate variability/change: A mechanistic coupled regional model study

    Energy Technology Data Exchange (ETDEWEB)

    Saravanan, Ramalingam [Texas A & M Univ., College Station, TX (United States)

    2015-01-09

    During the course of this project, we have accomplished the following: 1) Explored the parameter space of component models to minimize regional model bias 2) Assessed the impact of air-sea interaction on hurricanes, focusing in particular on the role of the oceanic barrier layer 3) Contributed to the activities of the U.S. CLIVAR Hurricane Working Group 4) Assessed the impact of lateral and lower boundary conditions on extreme flooding events in the U.S. Midwest in regional model simulations 5) Analyzed the concurrent impact of El Niño-Southern Oscillation and Atlantic Meridional Mode on Atlantic Hurricane activity using observations and regional model simulations

  8. New PAH gene promoter KLF1 and 3'-region C/EBPalpha motifs influence transcription in vitro.

    Science.gov (United States)

    Klaassen, Kristel; Stankovic, Biljana; Kotur, Nikola; Djordjevic, Maja; Zukic, Branka; Nikcevic, Gordana; Ugrin, Milena; Spasovski, Vesna; Srzentic, Sanja; Pavlovic, Sonja; Stojiljkovic, Maja

    2017-02-01

    Phenylketonuria (PKU) is a metabolic disease caused by mutations in the phenylalanine hydroxylase (PAH) gene. Although the PAH genotype remains the main determinant of PKU phenotype severity, genotype-phenotype inconsistencies have been reported. In this study, we focused on unanalysed sequences in non-coding PAH gene regions to assess their possible influence on the PKU phenotype. We transiently transfected HepG2 cells with various chloramphenicol acetyl transferase (CAT) reporter constructs which included PAH gene non-coding regions. Selected non-coding regions were indicated by in silico prediction to contain transcription factor binding sites. Furthermore, electrophoretic mobility shift assay (EMSA) and supershift assays were performed to identify which transcriptional factors were engaged in the interaction. We found novel KLF1 motif in the PAH promoter, which decreases CAT activity by 50 % in comparison to basal transcription in vitro. The cytosine at the c.-170 promoter position creates an additional binding site for the protein complex involving KLF1 transcription factor. Moreover, we assessed for the first time the role of a multivariant variable number tandem repeat (VNTR) region located in the 3'-region of the PAH gene. We found that the VNTR3, VNTR7 and VNTR8 constructs had approximately 60 % of CAT activity. The regulation is mediated by the C/EBPalpha transcription factor, present in protein complex binding to VNTR3. Our study highlighted two novel promoter KLF1 and 3'-region C/EBPalpha motifs in the PAH gene which decrease transcription in vitro and, thus, could be considered as PAH expression modifiers. New transcription motifs in non-coding regions will contribute to better understanding of the PKU phenotype complexity and may become important for the optimisation of PKU treatment.

  9. A prospective evaluation of first people's health promotion program design in the goulburn-murray rivers region.

    Science.gov (United States)

    Doyle, Joyce; Atkinson-Briggs, Sharon; Atkinson, Petah; Firebrace, Bradley; Calleja, Julie; Reilly, Rachel; Cargo, Margaret; Riley, Therese; Crumpen, Tui; Rowley, Kevin

    2016-11-10

    Aboriginal Community Controlled Organisations (ACCOs) provide community-focussed and culturally safe services for First Peoples in Australia, including crisis intervention and health promotion activities, in a holistic manner. The ecological model of health promotion goes some way towards describing the complexity of such health programs. The aims of this project were to: 1) identify the aims and purpose of existing health promotion programs conducted by an alliance of ACCOs in northern Victoria, Australia; and 2) evaluate the extent to which these programs are consistent with an ecological model of health promotion, addressing both individual and environmental determinants of health. The project arose from a long history of collaborative research. Three ACCOs and a university formed the Health Promotion Alliance to evaluate their health promotion programs. Local community members were trained in, and contributed to developing culturally sensitive methods for, data collection. Information on the aims and design of 88 health promotion activities making up 12 different programs across the ACCOs was systematically and prospectively collected. There was a wide range of activities addressing environmental and social determinants of health, as well as physical activity, nutrition and weight loss. The design of the great majority of activities had a minimal Western influence and were designed within a local Aboriginal cultural framework. The most common focus of the activities was social connectedness (76 %). Physical activity was represented in two thirds of the activities, and nutrition, weight loss and culture were each a focus of about half of the activities. A modified coding procedure designed to assess the ecological nature of these programs showed that they recruited from multiple settings; targeted a range of individual, social and environmental determinants; and used numerous and innovative strategies to achieve change. First Peoples' health promotion in the

  10. A prospective evaluation of first people’s health promotion program design in the goulburn-murray rivers region

    Directory of Open Access Journals (Sweden)

    Joyce Doyle

    2016-11-01

    achieve change. Conclusion First Peoples’ health promotion in the Goulburn-Murray Rivers region encompasses a broad range of social, cultural, lifestyle and community development activities, including reclaiming and strengthening cultural identity and social connectedness as a response to colonisation.

  11. Exploring DNA methylation changes in promoter, intragenic, and intergenic regions as early and late events in breast cancer formation

    International Nuclear Information System (INIS)

    Rauscher, Garth H.; Kresovich, Jacob K.; Poulin, Matthew; Yan, Liying; Macias, Virgilia; Mahmoud, Abeer M.; Al-Alem, Umaima; Kajdacsy-Balla, Andre; Wiley, Elizabeth L.; Tonetti, Debra; Ehrlich, Melanie

    2015-01-01

    Breast cancer formation is associated with frequent changes in DNA methylation but the extent of very early alterations in DNA methylation and the biological significance of cancer-associated epigenetic changes need further elucidation. Pyrosequencing was done on bisulfite-treated DNA from formalin-fixed, paraffin-embedded sections containing invasive tumor and paired samples of histologically normal tissue adjacent to the cancers as well as control reduction mammoplasty samples from unaffected women. The DNA regions studied were promoters (BRCA1, CD44, ESR1, GSTM2, GSTP1, MAGEA1, MSI1, NFE2L3, RASSF1A, RUNX3, SIX3 and TFF1), far-upstream regions (EN1, PAX3, PITX2, and SGK1), introns (APC, EGFR, LHX2, RFX1 and SOX9) and the LINE-1 and satellite 2 DNA repeats. These choices were based upon previous literature or publicly available DNA methylome profiles. The percent methylation was averaged across neighboring CpG sites. Most of the assayed gene regions displayed hypermethylation in cancer vs. adjacent tissue but the TFF1 and MAGEA1 regions were significantly hypomethylated (p ≤0.001). Importantly, six of the 16 regions examined in a large collection of patients (105 – 129) and in 15-18 reduction mammoplasty samples were already aberrantly methylated in adjacent, histologically normal tissue vs. non-cancerous mammoplasty samples (p ≤0.01). In addition, examination of transcriptome and DNA methylation databases indicated that methylation at three non-promoter regions (far-upstream EN1 and PITX2 and intronic LHX2) was associated with higher gene expression, unlike the inverse associations between cancer DNA hypermethylation and cancer-altered gene expression usually reported. These three non-promoter regions also exhibited normal tissue-specific hypermethylation positively associated with differentiation-related gene expression (in muscle progenitor cells vs. many other types of normal cells). The importance of considering the exact DNA region analyzed and the

  12. A5 region modulation of the cardiorespiratory responses evoked from parabrachial cell bodies in the anaesthetised rat.

    Science.gov (United States)

    Dawid Milner, M S; Lara, J P; López de Miguel, M P; López-González, M V; Spyer, K M; González-Barón, S

    2003-08-22

    We have examined the importance of the A5 region modulating cardiorespiratory responses evoked from the parabrachial complex (PB) in spontaneously breathing rats. Cardiorespiratory changes were analyzed in response to electrical stimulation and glutamate microinjections into the PB (10-20 nl, 1-2 nmol) before and after ipsilateral microinjection of muscimol (50 nl, 0.25 nmol) or lidocaine (50 nl, 0.5 nmol) within the A5 region. Stimulation of medial parabrachial and Kölliker-Fuse nuclei (mPB-KF) evoked a decrease in respiratory rate (Pinteractions between A5 and PB, extracellular recordings of putative A5 neurones were obtained during PB stimulation. Eighty-three A5 cells were recorded, 35 were activated from the mPB-KF (42%). The results indicate that neurones of the A5 region participate in the cardiorespiratory response evoked from the different regions of the PB complex. The possible mechanisms involved in these interactions are discussed.

  13. Deoxycholic acid promotes development of gastroesophageal reflux disease and Barrett's oesophagus by modulating integrin-αv trafficking.

    Science.gov (United States)

    Prichard, David O; Byrne, Anne Marie; Murphy, James O; Reynolds, John V; O'Sullivan, Jacintha; Feighery, Ronan; Doyle, Brendan; Eldin, Osama Sharaf; Finn, Stephen P; Maguire, Aoife; Duff, Deirdre; Kelleher, Dermot P; Long, Aideen

    2017-12-01

    The fundamental mechanisms underlying erosive oesophagitis and subsequent development of Barrett's oesophagus (BO) are poorly understood. Here, we investigated the contribution of specific components of the gastric refluxate on adhesion molecules involved in epithelial barrier maintenance. Cell line models of squamous epithelium (HET-1A) and BO (QH) were used to examine the effects of bile acids on cell adhesion to extracellular matrix proteins (Collagen, laminin, vitronectin, fibronectin) and expression of integrin ligands (α 3 , α 4, α 5 , α 6 and α ν ). Experimental findings were validated in human explant oesophageal biopsies, a rat model of gastroesophageal reflux disease (GORD) and in patient tissue microarrays. The bile acid deoxycholic acid (DCA) specifically reduced adhesion of HET-1A cells to vitronectin and reduced cell-surface expression of integrin-α ν via effects on endocytic recycling processes. Increased expression of integrin-α v was observed in ulcerated tissue in a rat model of GORD and in oesophagitis and Barrett's intestinal metaplasia patient tissue compared to normal squamous epithelium. Increased expression of integrin-α ν was observed in QH BO cells compared to HET-1A cells. QH cells were resistant to DCA-mediated loss of adhesion and reduction in cell-surface expression of integrin-α ν . We demonstrated that a specific component of the gastric refluxate, DCA, affects the epithelial barrier through modulation of integrin α ν expression, providing a novel mechanism for bile acid-mediated erosion of oesophageal squamous epithelium and promotion of BO. Strategies aimed at preventing bile acid-mediated erosion should be considered in the clinical management of patients with GORD. © 2017 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  14. Natural selection in a population of Drosophila melanogaster explained by changes in gene expression caused by sequence variation in core promoter regions.

    Science.gov (United States)

    Sato, Mitsuhiko P; Makino, Takashi; Kawata, Masakado

    2016-02-09

    Understanding the evolutionary forces that influence variation in gene regulatory regions in natural populations is an important challenge for evolutionary biology because natural selection for such variations could promote adaptive phenotypic evolution. Recently, whole-genome sequence analyses have identified regulatory regions subject to natural selection. However, these studies could not identify the relationship between sequence variation in the detected regions and change in gene expression levels. We analyzed sequence variations in core promoter regions, which are critical regions for gene regulation in higher eukaryotes, in a natural population of Drosophila melanogaster, and identified core promoter sequence variations associated with differences in gene expression levels subjected to natural selection. Among the core promoter regions whose sequence variation could change transcription factor binding sites and explain differences in expression levels, three core promoter regions were detected as candidates associated with purifying selection or selective sweep and seven as candidates associated with balancing selection, excluding the possibility of linkage between these regions and core promoter regions. CHKov1, which confers resistance to the sigma virus and related insecticides, was identified as core promoter regions that has been subject to selective sweep, although it could not be denied that selection for variation in core promoter regions was due to linked single nucleotide polymorphisms in the regulatory region outside core promoter regions. Nucleotide changes in core promoter regions of CHKov1 caused the loss of two basal transcription factor binding sites and acquisition of one transcription factor binding site, resulting in decreased gene expression levels. Of nine core promoter regions regions associated with balancing selection, brat, and CG9044 are associated with neuromuscular junction development, and Nmda1 are associated with learning

  15. Tumour MLH1 promoter region methylation testing is an effective pre-screen for Lynch Syndrome (HNPCC)

    Science.gov (United States)

    Newton, K; Jorgensen, NM; Wallace, AJ; Buchanan, DD; Lalloo, F; McMahon, RFT; Hill, J; Evans, DG

    2016-01-01

    Background & Aims Lynch syndrome patients have DNA mismatch repair deficiency and up to 80% life-time risk of colorectal cancer. Screening of mutation carriers reduces colorectal cancer incidence and mortality. Selection for constitutional mutation testing relies on family history (Amsterdam and Bethesda Guidelines) and tumour derived biomarkers. Initial biomarker analysis uses mismatch repair protein immunohistochemistry and microsatellite instability. Abnormalities in either identify mismatch repair deficiency but do not differentiate sporadic epigenetic defects, due to MLH1 promoter region methylation (13% of CRCs) from Lynch Syndrome (4% of CRCs). A diagnostic biomarker capable of making this distinction would be valuable. This study compared two biomarkers in tumours with mismatch repair deficiency; quantification of methylation of the MLH1 promoter region using a novel assay and BRAF c.1799T>A, p.(Val600Glu) mutation status in the identification of constitutional mutations. Methods Tumour DNA was extracted (FFPE tissue) and pyrosequencing used to test for MLH1 promoter methylation and presence of the BRAF c.1799T>A, p.(Val600Glu) mutation 71 CRCs from individuals with pathogenic MLH1 mutations and 73 CRCs with sporadic MLH1 loss. Specificity and sensitivity was compared. Findings Unmethylated MLH1 promoter: sensitivity 94.4% (95% CI 86.2–98.4%), specificity 87.7% (95% CI 77.9–94.2%), Wild-type BRAF (codon 600): sensitivity 65.8% (95% CI 53.7–76.5%), specificity 98.6% (95% CI 92.4–100.0%) for the identification of those with pathogenic MLH1 mutations. Conclusions Quantitative MLH1 promoter region methylation using pyrosequencing is superior to BRAF codon 600 mutation status in identifying constitutional mutations in mismatch repair deficient tumours. PMID:25280751

  16. Hypermethylation of the DPYD promoter region is not a major predictor of severe toxicity in 5-fluorouracil based chemotherapy

    Directory of Open Access Journals (Sweden)

    Aebi Stefan

    2008-10-01

    Full Text Available Abstract Background The activity of dihydropyrimidine dehydrogenase (DPD, the key enzyme of pyrimidine catabolism, is thought to be an important determinant for the occurrence of severe toxic reactions to 5-fluorouracil (5-FU, which is one of the most commonly prescribed chemotherapeutic agents for the treatment of solid cancers. Genetic variation in the DPD gene (DPYD has been proposed as a main factor for variation in DPD activity in the population. However, only a small proportion of severe toxicities in 5-FU based chemotherapy can be explained with such rare deleterious DPYD mutations resulting in severe enzyme deficiencies. Recently, hypermethylation of the DPYD promoter region has been proposed as an alternative mechanism for DPD deficiency and thus as a major cause of severe 5-FU toxicity. Methods Here, the prognostic significance of this epigenetic marker with respect to severe 5-FU toxicity was assessed in 27 cancer patients receiving 5-FU based chemotherapy, including 17 patients experiencing severe toxic side effects following drug administration, none of which were carriers of a known deleterious DPYD mutation, and ten control patients. The methylation status of the DPYD promoter region in peripheral blood mononuclear cells was evaluated by analysing for each patient between 19 and 30 different clones of a PCR-amplified 209 base pair fragment of the bisulfite-modified DPYD promoter region. The fragments were sequenced to detect bisulfite-induced, methylation-dependent sequence differences. Results No evidence of DPYD promoter methylation was observed in any of the investigated patient samples, whereas in a control experiment, as little as 10% methylated genomic DNA could be detected. Conclusion Our results indicate that DYPD promoter hypermethylation is not of major importance as a prognostic factor for severe toxicity in 5-FU based chemotherapy.

  17. Targets of DNA-binding proteins in bacterial promoter regions present enhanced probabilities for spontaneous thermal openings

    International Nuclear Information System (INIS)

    Apostolaki, Angeliki; Kalosakas, George

    2011-01-01

    We mapped promoter regions of double-stranded DNA with respect to the probabilities of appearance of relatively large bubble openings exclusively due to thermal fluctuations at physiological temperatures. We analyzed five well-studied promoter regions of procaryotic type and found a spatial correlation between the binding sites of transcription factors and the position of peaks in the probability pattern of large thermal openings. Other distinct peaks of the calculated patterns correlate with potential binding sites of DNA-binding proteins. These results suggest that a DNA molecule would more frequently expose the bases that participate in contacts with proteins, which would probably enhance the probability of the latter to reach their targets. It also stands for using this method as a means to analyze DNA sequences based on their intrinsic thermal properties

  18. Similarities in transcription factor IIIC subunits that bind to the posterior regions of internal promoters for RNA polymerase III

    OpenAIRE

    Matsutani Sachiko

    2004-01-01

    Abstract Background In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFII...

  19. Promoting effect of ethanol on dewetting transition in the confined region of melittin tetramer

    International Nuclear Information System (INIS)

    Ren Xiuping; Zhou Bo; Wang Chunlei

    2012-01-01

    To study the influence of ethanol molecules on the melittin tetramer folding, we investigated the dewetting transition of the melittin tetramer immersed in pure water and 8% aqueous ethanol solution (mass fraction) by the molecular dynamics simulations. We found that the marked dewetting transitions occurred inside a nanoscale channel of the melittin tetramer both in pure water and in aqueous ethanol solution. Also, ethanol molecules promoted this dewetting transition. We attributed this promoting effect to ethanol molecules which prefer to locate at the liquid-vapor interface and decrease the liquid-vapor surface energy. The results provide insight into the effect of ethanol on the water dewetting phenomena. (authors)

  20. A Participatory Regional Partnership Approach to Promote Nutrition and Physical Activity Through Environmental and Policy Change in Rural Missouri.

    Science.gov (United States)

    Barnidge, Ellen K; Baker, Elizabeth A; Estlund, Amy; Motton, Freda; Hipp, Pamela R; Brownson, Ross C

    2015-06-11

    Rural residents are less likely than urban and suburban residents to meet recommendations for nutrition and physical activity. Interventions at the environmental and policy level create environments that support healthy eating and physical activity. Healthier Missouri Communities (Healthier MO) is a community-based research project conducted by the Prevention Research Center in St. Louis with community partners from 12 counties in rural southeast Missouri. We created a regional partnership to leverage resources and enhance environmental and policy interventions to improve nutrition and physical activity in rural southeast Missouri. Partners were engaged in a participatory action planning process that included prioritizing, implementing, and evaluating promising evidence-based interventions to promote nutrition and physical activity. Group interviews were conducted with Healthier MO community partners post intervention to evaluate resource sharing and sustainability efforts of the regional partnership. Community partners identified the benefits and challenges of resource sharing within the regional partnership as well as the opportunities and threats to long-term partnership sustainability. The partners noted that the regional participatory process was difficult, but the benefits outweighed the challenges. Regional rural partnerships may be an effective way to leverage relationships to increase the capacity of rural communities to implement environmental and policy interventions to promote nutrition and physical activity.

  1. Influence of promoter/enhancer region haplotypes on MGMT transcriptional regulation: a potential biomarker for human sensitivity to alkylating agents.

    Science.gov (United States)

    Xu, Meixiang; Nekhayeva, Ilona; Cross, Courtney E; Rondelli, Catherine M; Wickliffe, Jeffrey K; Abdel-Rahman, Sherif Z

    2014-03-01

    The O6-methylguanine-DNA methyltransferase gene (MGMT) encodes the direct reversal DNA repair protein that removes alkyl adducts from the O6 position of guanine. Several single-nucleotide polymorphisms (SNPs) exist in the MGMT promoter/enhancer (P/E) region. However, the haplotype structure encompassing these SNPs and their functional/biological significance are currently unknown. We hypothesized that MGMT P/E haplotypes, rather than individual SNPs, alter MGMT transcription and can thus alter human sensitivity to alkylating agents. To identify the haplotype structure encompassing the MGMT P/E region SNPs, we sequenced 104 DNA samples from healthy individuals and inferred the haplotypes using the data generated. We identified eight SNPs in this region, namely T7C (rs180989103), T135G (rs1711646), G290A (rs61859810), C485A (rs1625649), C575A (rs113813075), G666A (rs34180180), C777A (rs34138162) and C1099T (rs16906252). Phylogenetics and Sequence Evolution analysis predicted 21 potential haplotypes that encompass these SNPs ranging in frequencies from 0.000048 to 0.39. Of these, 10 were identified in our study population as 20 paired haplotype combinations. To determine the functional significance of these haplotypes, luciferase reporter constructs representing these haplotypes were transfected into glioblastoma cells and their effect on MGMT promoter activity was determined. Compared with the most common (reference) haplotype 1, seven haplotypes significantly upregulated MGMT promoter activity (18-119% increase; P alkylating agents.

  2. Module discovery by exhaustive search for densely connected, co-expressed regions in biomolecular networks

    NARCIS (Netherlands)

    R. Colak; F. Moser; J. Shu; A. Schönhuth (Alexander); N. Chen; M. Ester

    2010-01-01

    htmlabstractBackground Computational prediction of functionally related groups of genes (functional modules) from large-scale data is an important issue in computational biology. Gene expression experiments and interaction networks are well studied large-scale data sources, available for many not

  3. The Cascade Drift Module: a GIS-based study on regional pesticide deposition

    NARCIS (Netherlands)

    Holterman, H.J.; Zande, van de J.C.

    2008-01-01

    The Cascade Project describes the modelling of spray drift and pesticide fate for a network of interconnected water bodies in a rural area. The present study concerns the first part of the proj ect, the Cascade Drift Module, which models the spatial and temporal distribution of deposits of spray

  4. Association of polymorphisms of interleukin-18 gene promoter region with polycystic ovary syndrome in chinese population

    Directory of Open Access Journals (Sweden)

    Li Mei-zhi

    2010-10-01

    Full Text Available Abstract Background Recent research shows that polycystic ovary syndrome (PCOS may have an association with low-grade chronic inflammation, and that PCOS may induce an increase in serum interleukin-18 (IL-18 levels. Methods To investigate the polymorphisms of the IL-18 gene promoters with PCOS, two single nucleotide polymorphisms (SNPs in the promoter of the IL-18 gene (at positions -607C/A and -137G/C in 118 Chinese women with PCOS and 79 controls were evaluated using polymerase chain reaction (PCR. Results No significant differences were found in the genotype distribution, allele frequency and haplotype frequency between the PCOS and control groups. Further analysis demonstrated a relationship between IL-18 gene promoter polymorphisms and PCOS insulin resistance (IR. Regarding the -137 allele frequency, G and C allele frequencies were 93.5% and 6.5%, respectively, in the PCOS with IR patients; G and C allele frequencies were 85.4% and 14.6%, respectively, in PCOS patients without IR (chi2 = 3.601, P = 0.048. Conclusions The presence of a polymorphism in the IL-18 gene was found to have no correlation with the occurrence of PCOS. Carriage of the C allele at position -137 in the promoter of the IL-18 gene may play a protective role from the development of PCOS IR.

  5. Evaluation of methylation pattern in promoter region of E-cadherin ...

    African Journals Online (AJOL)

    user

    2011-03-07

    Mar 7, 2011 ... promoter methylation in CDH1 gene inactivation in breast cancer, the CpG methylation status of E- ..... 5'CpG island of CDH1 in prostate, lung, liver, bladder, .... and estrogen receptor alpha from Sp1 sites to induce cell cycle.

  6. The effect of mutations in the AmpC promoter region on β-lactam ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-08-04

    Aug 4, 2008 ... between the -10 and -35 boxes affects the resistance of bacteria to β-lactam antibiotics. .... The chromosomal cephalosporinase gene, ampC, of E. .... mutation in the ampC promoter increasing resistance to β-lactams in.

  7. A distal region of the human TGM1 promoter is required for expression in transgenic mice and cultured keratinocytes

    Directory of Open Access Journals (Sweden)

    Lu Ying

    2004-04-01

    Full Text Available Abstract Background TGM1(transglutaminase 1 is an enzyme that crosslinks the cornified envelope of mature keratinocytes. Appropriate expression of the TGM1 gene is crucial for proper keratinocyte function as inactivating mutations lead to the debilitating skin disease, lamellar ichthyosis. TGM1 is also expressed in squamous metaplasia, a consequence in some epithelia of vitamin A deficiency or toxic insult that can lead to neoplasia. An understanding of the regulation of this gene in normal and abnormal differentiation states may contribute to better disease diagnosis and treatment. Methods In vivo requirements for expression of the TGM1 gene were studied by fusing various lengths of promoter DNA to a reporter and injecting the DNA into mouse embryos to generate transgenic animals. Expression of the reporter was ascertained by Western blotting and immunohistochemistry. Further delineation of a transcriptionally important distal region was determined by transfections of progressively shortened or mutated promoter DNA into cultured keratinocytes. Results In vivo analysis of a reporter transgene driven by the TGM1 promoter revealed that 1.6 kilobases, but not 1.1 kilobases, of DNA was sufficient to confer tissue-specific and cell layer-specific expression. This same region was responsible for reporter expression in tissues undergoing squamous metaplasia as a response to vitamin A deprivation. Mutation of a distal promoter AP1 site or proximal promoter CRE site, both identified as important transcriptional elements in transfection assays, did not prevent appropriate expression. Further searching for transcriptional elements using electrophoretic mobility shift (EMSA and transfection assays in cultured keratinocytes identified two Sp1 elements in a transcriptionally active region between -1.6 and -1.4 kilobases. While mutation of either Sp1 site or the AP1 site singly had only a small effect, mutation of all three sites eliminated nearly all the

  8. Promoting University and Industry Links at the Regional Level: Comparing China's Reform and International Experience

    Science.gov (United States)

    Po, Yang; Cai, Yuzhuo; Lyytinen, Anu; Hölttä, Seppo

    2016-01-01

    This paper intends to learn from international experiences in order to facilitating China's ongoing regional university transformation with an ultimate goal to enhance the role of university in regional economic development and innovation. In so doing, this paper compares major models of universities of applied sciences (UAS) around the world from…

  9. Murine leukemia virus vector integration favors promoter regions and regional hot spots in a human T-cell line

    International Nuclear Information System (INIS)

    Tsukahara, Tomonori; Agawa, Hideyuki; Matsumoto, Sayori; Matsuda, Mizuho; Ueno, Shuichi; Yamashita, Yuki; Yamada, Koichiro; Tanaka, Nobuyuki; Kojima, Katsuhiko; Takeshita, Toshikazu

    2006-01-01

    Genomic analysis of integration will be important in evaluating the safety of human gene therapy with retroviral vectors. Here, we investigated MLV vector integration sites in human T-cells, since they are amenable to gene transfer studies, and have been used therapeutically in clinical trials. We mapped 340 MLV vector integration sites in the infected human T-cell clones we established. The data showed that MLV preferred integration near the transcription start sites (±5 kb), near CpG islands (±1 kb), and within the first intron of RefSeq genes. We also identified MLV integration hot spots that contained three or more integrations within a 100 kb region. RT-PCR revealed that mRNA-levels of T-cell clones that contained MLV integrations near transcription start sites or introns were dysregulated compared to the uninfected cells. These studies help define the profile of MLV integration in T-cells and the risks associated with MLV-based gene therapy

  10. Promoting survival: A grounded theory study of consequences of modern health practices in Ouramanat region of Iranian Kurdistan.

    Science.gov (United States)

    Mohammadpur, Ahmad; Rezaei, Mehdi; Sadeghi, Rasoul

    2010-05-14

    The aim of this qualitative study is to explore the way people using modern health care perceive its consequences in Ouraman-e-Takht region of Iranian Kurdistan. Ouraman-e-Takht is a rural, highly mountainous and dry region located in the southwest Kurdistan province of Iran. Recently, modern health practices have been introduced to the region. The purpose of this study was to investigate, from the Ouramains' point of view, the impact that modern health services and practices have had on the Ouraman traditional way of life. Interview data from respondents were analyzed by using grounded theory. Promoting survival was the core category that explained the impact that modern health practices have had on the Ouraman region. The people of Ouraman interpreted modern health practices as increasing their quality of life and promoting their survival. Results are organized around this core category in a paradigm model consisting of conditions, interactions, and consequences. This model can be used to understand the impact of change from the introduction of modern health on a traditional society.

  11. Promoting survival: A grounded theory study of consequences of modern health practices in Ouramanat region of Iranian Kurdistan

    Science.gov (United States)

    Mohammadpur, Ahmad; Rezaei, Mehdi; Sadeghi, Rasoul

    2010-01-01

    The aim of this qualitative study is to explore the way people using modern health care perceive its consequences in Ouraman-e-Takht region of Iranian Kurdistan. Ouraman-e-Takht is a rural, highly mountainous and dry region located in the southwest Kurdistan province of Iran. Recently, modern health practices have been introduced to the region. The purpose of this study was to investigate, from the Ouramains' point of view, the impact that modern health services and practices have had on the Ouraman traditional way of life. Interview data from respondents were analyzed by using grounded theory. Promoting survival was the core category that explained the impact that modern health practices have had on the Ouraman region. The people of Ouraman interpreted modern health practices as increasing their quality of life and promoting their survival. Results are organized around this core category in a paradigm model consisting of conditions, interactions, and consequences. This model can be used to understand the impact of change from the introduction of modern health on a traditional society. PMID:20640020

  12. Promotion of physical activity in the European region: content analysis of 27 national policy documents

    DEFF Research Database (Denmark)

    Daugbjerg, Signe B; Kahlmeier, Sonja; Racioppi, Francesca

    2009-01-01

    . Population groups most in need such as people with low levels of physical activity were rarely specifically targeted. Most policies emphasized the importance of an evaluation. However, only about half of them indicated a related intention or requirement. CONCLUSION: In recent years there has been......BACKGROUND: Over the past years there has been increasing interest in physical activity promotion and the development of appropriate policy. So far, there has been no comprehensive overview of the activities taking place in Europe in this area of public health policy. METHODS: Using different...... search methods, 49 national policy documents on physical activity promotion were identified. An analysis grid covering key features was developed for the analysis of the 27 documents published in English. RESULTS: Analysis showed that many general recommendations for policy developments are being...

  13. Analysis of the Impact of the Flow of Migrant Workers on Regional Economy: Based on the Thought about the Promotion of Jiangxi Regional Economic Competitiveness

    Directory of Open Access Journals (Sweden)

    Sun Yuping

    2016-03-01

    Full Text Available Labor resource is the necessary productive factor in regional economic development, and one of important indexes to evaluate regional economic competitiveness. The great economic achievement brought by the 30-year reform and opening up of China is due to the fact that China brought the backward advantage of “demographic dividend” into play, promoted the fast development of industrialization and urbanization, and became the second largest economy in the world. The entity of “demographic dividend” is the non-agricultural migrant population, i.e., migrant workers. The transfer employment of migrant workers has typical regional liquidity, and the imbalance of regional economy causes the flow of many migrant workers. In order to achieve harmonious development and coordinated development, underdeveloped areas must understand the character and regulation, adopt positive industrial policy and supportive policy, guide the reasonable flow of migrant workers, and realize the transfer of local employment and citizenization of migrant workers, which can enhance regional economic competitiveness

  14. Finding Combination of Features from Promoter Regions for Ovarian Cancer-related Gene Group Classification

    KAUST Repository

    Olayan, Rawan S.

    2012-12-01

    In classification problems, it is always important to use the suitable combination of features that will be employed by classifiers. Generating the right combination of features usually results in good classifiers. In the situation when the problem is not well understood, data items are usually described by many features in the hope that some of these may be the relevant or most relevant ones. In this study, we focus on one such problem related to genes implicated in ovarian cancer (OC). We try to recognize two important OC-related gene groups: oncogenes, which support the development and progression of OC, and oncosuppressors, which oppose such tendencies. For this, we use the properties of promoters of these genes. We identified potential “regulatory features” that characterize OC-related oncogenes and oncosuppressors promoters. In our study, we used 211 oncogenes and 39 oncosuppressors. For these, we identified 538 characteristic sequence motifs from their promoters. Promoters are annotated by these motifs and derived feature vectors used to develop classification models. We made a comparison of a number of classification models in their ability to distinguish oncogenes from oncosuppressors. Based on 10-fold cross-validation, the resultant model was able to separate the two classes with sensitivity of 96% and specificity of 100% with the complete set of features. Moreover, we developed another recognition model where we attempted to distinguish oncogenes and oncosuppressors as one group from other OC-related genes. That model achieved accuracy of 82%. We believe that the results of this study will help in discovering other OC-related oncogenes and oncosuppressors not identified as yet.

  15. Finding Combination of Features from Promoter Regions for Ovarian Cancer-related Gene Group Classification

    KAUST Repository

    Olayan, Rawan S.

    2012-01-01

    In classification problems, it is always important to use the suitable combination of features that will be employed by classifiers. Generating the right combination of features usually results in good classifiers. In the situation when the problem is not well understood, data items are usually described by many features in the hope that some of these may be the relevant or most relevant ones. In this study, we focus on one such problem related to genes implicated in ovarian cancer (OC). We try to recognize two important OC-related gene groups: oncogenes, which support the development and progression of OC, and oncosuppressors, which oppose such tendencies. For this, we use the properties of promoters of these genes. We identified potential “regulatory features” that characterize OC-related oncogenes and oncosuppressors promoters. In our study, we used 211 oncogenes and 39 oncosuppressors. For these, we identified 538 characteristic sequence motifs from their promoters. Promoters are annotated by these motifs and derived feature vectors used to develop classification models. We made a comparison of a number of classification models in their ability to distinguish oncogenes from oncosuppressors. Based on 10-fold cross-validation, the resultant model was able to separate the two classes with sensitivity of 96% and specificity of 100% with the complete set of features. Moreover, we developed another recognition model where we attempted to distinguish oncogenes and oncosuppressors as one group from other OC-related genes. That model achieved accuracy of 82%. We believe that the results of this study will help in discovering other OC-related oncogenes and oncosuppressors not identified as yet.

  16. Association of a Human FABP1 Gene Promoter Region Polymorphism with Altered Serum Triglyceride Levels.

    Directory of Open Access Journals (Sweden)

    Xian-E Peng

    Full Text Available Liver fatty acid-binding protein (L-FABP, also known as fatty acid-binding protein 1 (FABP1, is a key regulator of hepatic lipid metabolism. Elevated FABP1 levels are associated with an increased risk of cardiovascular disease (CVD and metabolic syndromes. In this study, we examine the association of FABP1 gene promoter variants with serum FABP1 and lipid levels in a Chinese population. Four promoter single-nucleotide polymorphisms (SNPs of FABP1 gene were genotyped in a cross-sectional survey of healthy volunteers (n = 1,182 from Fuzhou city of China. Results showed that only the rs2919872 G>A variant was significantly associated with serum TG concentration(P = 0.032.Compared with the rs2919872 G allele, rs2919872 A allele contributed significantly to reduced serum TG concentration, and this allele dramatically decreased the FABP1 promoter activity(P < 0.05. The rs2919872 A allele carriers had considerably lower serum FABP1 levels than G allele carriers (P < 0.01. In the multivariable linear regression analysis, the rs2919872 A allele was negatively associated with serum FABP1 levels (β = -0.320, P = 0.003, while serum TG levels were positively associated with serum FABP1 levels (β = 0.487, P = 0.014. Our data suggest that compared with the rs2919872 G allele, the rs2919872 A allele reduces the transcriptional activity of FABP1 promoter, and thereby may link FABP1 gene variation to TG level in humans.

  17. Association of the Resistin Gene Promoter Region Polymorphism with Kawasaki Disease in Chinese Children

    Directory of Open Access Journals (Sweden)

    Ruixi Liu

    2012-01-01

    Full Text Available Objectives. The −420C>G polymorphism located in the resistin gene (RETN promoter has recently been suggested to play a potential role in proinflammatory conditions and cardiovascular disease. This study investigated the association of the RETN promoter polymorphism with Kawasaki disease (KD and its clinical parameters in Chinese children. Methods. We compared patients with complete KD to incomplete KD children. Genotyping of the RETN promoter polymorphism was performed using MassARRAY system, and serum resistin levels were estimated using the sandwich enzyme immunoassay method. Results. There was no significant difference in RETN (−420C>G genotypes between KD and control groups. However, the frequency of the G allele was higher in iKD patients than in cKD children due to a significantly increased frequency of the GG genotypes. Serum levels of resistin were significantly higher in KD patients than in controls regardless of the presence of coronary artery lesions (CALs. Conclusion. The present findings suggest that while resistin may play a role in the pathogenesis of KD, there is no apparent association between CAL and the RETN (−420C>G gene polymorphism in KD children. However, the diagnosis of iKD is challenging but can be supported by the presence of the G allele and the GG genotypes.

  18. Objects but not concepts modulate the size of the attended region.

    Science.gov (United States)

    Goodhew, Stephanie C; Edwards, Mark

    2017-07-01

    Here we investigated the types of stimuli that modulate the size of the attentional spotlight. In particular, it has been previously shown that conceptual cues that either directly refer to or are semantically related to particular spatial locations can shift attention to that location (known as "conceptual cueing"). For example, reading the word sun or joy can shift attention upward whereas the word boot or hostile can shift attention downward. Here, therefore, we tested whether words could modulate the size of the attended area. Across five experiments, we found that words that either directly referred to, or were abstractly associated with, particular sizes (small versus large) did not change the size of the attentional spotlight, whereas the presence of differently sized stimuli did, as evidenced by faster responses to targets when the spotlight is small than when it is large. This suggests that physical but not conceptual inducers can modulate the size of the attentional spotlight. This highlights an important difference between the regulation of spotlight size and shifts of attention, supporting the notion that they are subserved by distinct mechanisms.

  19. Down-regulation of human topoisomerase IIα expression correlates with relative amounts of specificity factors Sp1 and Sp3 bound at proximal and distal promoter regions

    Directory of Open Access Journals (Sweden)

    Isaacs Richard J

    2007-05-01

    Full Text Available Abstract Background Topoisomerase IIα has been shown to be down-regulated in doxorubicin-resistant cell lines. The specificity proteins Sp1 and Sp3 have been implicated in regulation of topoisomerase IIα transcription, although the mechanism by which they regulate expression is not fully understood. Sp1 has been shown to bind specifically to both proximal and distal GC elements of the human topoisomerase IIα promoter in vitro, while Sp3 binds only to the distal GC element unless additional flanking sequences are included. While Sp1 is thought to be an activator of human topoisomerase IIα, the functional significance of Sp3 binding is not known. Therefore, we sought to determine the functional relationship between Sp1 and Sp3 binding to the topoisomerase IIα promoter in vivo. We investigated endogenous levels of Sp1, Sp3 and topoisomerase IIα as well as binding of both Sp1 and Sp3 to the GC boxes of the topoisomerase IIα promoter in breast cancer cell lines in vivo after short term doxorubicin exposure. Results Functional effects of Sp1 and Sp3 were studied using transient cotransfection assays using a topoisomerase IIα promoter reporter construct. The in vivo interactions of Sp1 and Sp3 with the GC elements of the topoisomerase IIα promoter were studied in doxorubicin-treated breast cancer cell lines using chromatin immunoprecipitation assays. Relative amounts of endogenous proteins were measured using immunoblotting. In vivo DNA looping mediated by proteins bound at the GC1 and GC2 elements was studied using the chromatin conformation capture assay. Both Sp1 and Sp3 bound to the GC1 and GC2 regions. Sp1 and Sp3 were transcriptional activators and repressors respectively, with Sp3 repression being dominant over Sp1-mediated activation. The GC1 and GC2 elements are linked in vivo to form a loop, thus bringing distal regulatory elements and their cognate transcription factors into close proximity with the transcription start site

  20. Developing regionally specific grazing practices to promote production, profitability, and environmental quality

    Science.gov (United States)

    Rangelands are valued for their capacity to provide diverse suites of ecosystem services, from food production to carbon storage to biological diversity. Although rangelands worldwide share common characteristics, differences among biogeographic regions result in differences in the types of opportun...

  1. Cytosine deletion at AP2-box region of HSP70 promoter and its ...

    Indian Academy of Sciences (India)

    of thermotolerance in cells (Leung et al. 1996). ... region of HSP70 significantly affected cellular thermotol- erance ... The double PCR-RFLP using ScrFI confirmed the occur- ... suade of HSP70 on defense of proteins related to respiration.

  2. Regional differences in gene expression and promoter usage in aged human brains

    KAUST Repository

    Pardo, Luba M.; Rizzu, Patrizia; Francescatto, Margherita; Vitezic, Morana; Leday, Gwenaë l G.R.; Sanchez, Javier Simon; Khamis, Abdullah M.; Takahashi, Hazuki; van de Berg, Wilma D.J.; Medvedeva, Yulia A.; van de Wiel, Mark A.; Daub, Carsten O.; Carninci, Piero; Heutink, Peter

    2013-01-01

    To characterize the promoterome of caudate and putamen regions (striatum), frontal and temporal cortices, and hippocampi from aged human brains, we used high-throughput cap analysis of gene expression to profile the transcription start sites

  3. An integrated framework to address climate change (ESCAPE) and further developments of the global and regional climate modules (MAGICC)

    International Nuclear Information System (INIS)

    Hulme, M.; Raper, S.C.B.

    1995-01-01

    ESCAPE (the Evaluation of Strategies to address Climate change by Adapting to and Preventing Emissions) is an integrated climate change assessment model constructed between 1990 and 1992 for DG XI of the Commission of the European Community by a consortium of research institutes headed by the Climatic Research Unit (CRU). It has been designed to enable the user to generate future scenarios of greenhouse gas emissions (through an energy-economic model), examine their impact on global climate and sea level (through two independent global climate models), and illustrate some of the consequences of this global climate change at a regional scale for the European Community (through a regional climate scenario generator and impact models). We provide a very brief overview of the ESCAPE model which, although innovative, suffers from a number of major limitations. Subsequent work in the CRU has concentrated on improvements to the global climate module and work has also commenced on an improved regional climate scenario generating module. These improvements will lead to a new integrated climate change assessment model, MAGICC (Model for the Assessment of Greenhouse gas Induced Climate Change) which can easily be incorporated into new larger integrated frameworks developed by other institutes. (Author)

  4. Development of model for studies on momentum transfer in electrochemical cells with entry region coil as turbulence promoter

    Science.gov (United States)

    Penta Rao, Tamarba; Rajendra Prasad, P.

    2018-04-01

    Entry region swirl promoters gain importance in industry because of its effectiveness in augmentation of mass and heat transfer augmentation. Design of equipment needs momentum transfer data along with mass or heat transfer data. Hence an experimental investigation was carried out with coaxially placed entry region spiral coil as turbulence promoters on momentum transfer in forced convection flow of electrolyte in circular conduits. Aqueous solution of sodium hydroxide and 0.01 M equimolal Ferri-ferro cyanide system was chosen for the study. The study covered parameters like effect of pitch of the coil, effect of length of the coil, diameter of the coil, diameter of the coil wire, diameter of the annular rod. The promoter is measured by limiting current technique using diffusion controlled electrochemical reactions. The study comprises of evaluation of momentum transfer rates at the outer wall of the electrochemical cell. Pressure drop measurements were also made to obtain the energy consumption pattern. Within the range of variables covered. The results are correlated by the momentum transfer similarity function. Momentum transfer coefficients were evaluated from measured limiting currents. Effect of each parameter was studied in terms of friction factor. A model was developed for momentum transfer. The experimental data on momentum transfer was modeled in terms of momentum transfer function and Reynolds number, geometric parameters.

  5. No evidence for promoter region methylation of the succinate dehydrogenase and fumarate hydratase tumour suppressor genes in breast cancer

    Directory of Open Access Journals (Sweden)

    Dobrovic Alexander

    2009-09-01

    Full Text Available Abstract Background Succinate dehydrogenase (SDH and fumarate hydratase (FH are tricarboxylic acid (TCA cycle enzymes that are also known to act as tumour suppressor genes. Increased succinate or fumarate levels as a consequence of SDH and FH deficiency inhibit hypoxia inducible factor-1α (HIF-1α prolyl hydroxylases leading to sustained HIF-1α expression in tumours. Since HIF-1α is frequently expressed in breast carcinomas, DNA methylation at the promoter regions of the SDHA, SDHB, SDHC and SDHD and FH genes was evaluated as a possible mechanism in silencing of SDH and FH expression in breast carcinomas. Findings No DNA methylation was identified in the promoter regions of the SDHA, SDHB, SDHC, SDHD and FH genes in 72 breast carcinomas and 10 breast cancer cell lines using methylation-sensitive high resolution melting which detects both homogeneous and heterogeneous methylation. Conclusion These results show that inactivation via DNA methylation of the promoter CpG islands of SDH and FH is unlikely to play a major role in sporadic breast carcinomas.

  6. Similarities in transcription factor IIIC subunits that bind to the posterior regions of internal promoters for RNA polymerase III

    Directory of Open Access Journals (Sweden)

    Matsutani Sachiko

    2004-08-01

    Full Text Available Abstract Background In eukaryotes, RNA polymerase III (RNAP III transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs. The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Results Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Conclusion Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and α-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants

  7. Similarities in transcription factor IIIC subunits that bind to the posterior regions of internal promoters for RNA polymerase III.

    Science.gov (United States)

    Matsutani, Sachiko

    2004-08-09

    In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and alpha-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants than to fungi.

  8. Perceptions of health promoters about health promotion programmes for families with adolescents orphaned as a result of AIDS in the rural Hammanskraal region in South Africa

    Directory of Open Access Journals (Sweden)

    Maseapo P. Mthobeni

    2013-02-01

    Full Text Available South African communities are still greatly affected by the high rate of infection with HIV or who are living with AIDS, mirrored in the 2008 overall national HIV prevalence of 29.3%(UNAIDS 2010:10. In addressing the challenge, the health system is dependent on community care level workers such as caregivers to render health promotion and education in the homes and communities. The caregivers based in the communities are the ones with first-hand information on what is needed for the success of health promotion programmes. This study, aimed at exploring the challenges faced by the health promoters, described their perceptions regarding a health promotion programme for families with adolescents orphaned as a result of AIDS. Data were collected on the purposively selected participants at the rural Hammanskraal region in South Africa and the research question: ‘What is your perception regarding health promotion programmes for families with adolescents orphaned as a result of AIDS’ was asked and discussed by participants in a focus group interview. Data were analysed using the adapted Tesch method to organize and isolate the main categories, sub-categories and themes. The following main categories were isolated: attitudes of adolescents, effectiveness of home visits, need for health education and limited resources. Based on the findings, it was therefore recommended that health care planners assist in the improvement of health promotion and education by using the community and national media, providing information material and providing access to the internet in order to allow more people, including young people, to access the information.Suid-Afrikaanse gemeenskappe word steeds grootliks beïnvloed deur die hoë vlak van MIV en vigs, soos weerspieël in die algehele nasionale MIV-syfer in 2008 van 29.3% (UNAIDS 2010:10. In die aanspreek van hierdie uitdaging is die gesondheidstelsel afhanklik van gemeenskapsorgwerkers om gesondheidsbevordering

  9. Perceptions of health promoters about health promotion programmes for families with adolescents orphaned as a result of AIDS in the rural Hammanskraal region in South Africa

    Directory of Open Access Journals (Sweden)

    Maseapo P. Mthobeni

    2013-02-01

    Full Text Available South African communities are still greatly affected by the high rate of infection with HIV or who are living with AIDS, mirrored in the 2008 overall national HIV prevalence of 29.3%(UNAIDS 2010:10. In addressing the challenge, the health system is dependent on community care level workers such as caregivers to render health promotion and education in the homes and communities. The caregivers based in the communities are the ones with first-hand information on what is needed for the success of health promotion programmes. This study, aimed at exploring the challenges faced by the health promoters, described their perceptions regarding a health promotion programme for families with adolescents orphaned as a result of AIDS. Data were collected on the purposively selected participants at the rural Hammanskraal region in South Africa and the research question: ‘What is your perception regarding health promotion programmes for families with adolescents orphaned as a result of AIDS’ was asked and discussed by participants in a focus group interview. Data were analysed using the adapted Tesch method to organize and isolate the main categories, sub-categories and themes. The following main categories were isolated: attitudes of adolescents, effectiveness of home visits, need for health education and limited resources. Based on the findings, it was therefore recommended that health care planners assist in the improvement of health promotion and education by using the community and national media, providing information material and providing access to the internet in order to allow more people, including young people, to access the information. Suid-Afrikaanse gemeenskappe word steeds grootliks beïnvloed deur die hoë vlak van MIV en vigs, soos weerspieël in die algehele nasionale MIV-syfer in 2008 van 29.3% (UNAIDS 2010:10. In die aanspreek van hierdie uitdaging is die gesondheidstelsel afhanklik van gemeenskapsorgwerkers om gesondheidsbevordering

  10. MICB gene diversity and balancing selection on its promoter region in Yao population in southern China.

    Science.gov (United States)

    Chen, Xiang; Liu, Xuexiang; Wei, Xiaomou; Meng, Yuming; Liu, Limin; Qin, Shini; Liu, Yanyu; Dai, Shengming

    2016-12-01

    To comprehensively examine the MICB gene polymorphism and identify its differences in Chinese Yao population from other ethnic groups, we investigated the polymorphism in the 5'-upstream regulation region (5'-URR), coding region (exons 2-4), and the 3'-untranslated region (3'-UTR) of MICB gene by using PCR-SBT method in 125 healthy unrelated Yao individuals in Guangxi Zhuang Autonomous Region. Higher polymorphism was observed in the 5'-URR, nine single nucleotide polymorphisms (SNPs) and a two base pairs deletion at position -139/-138 were found in our study. Only five different variation sites, however, were detected in exons 2-4 and three were observed in the 3'-UTR. The minor allele frequencies of all variants were greater than 5%, except for rs3828916, rs3131639, rs45627734, rs113620316, rs779737471, and the variation at position +11803 in the 3'-UTR. The first nine SNPs of 5'-URR and rs1065075, rs1051788 of the coding region showed significant linkage disequilibrium with each other. Ten different MICB extended haplotypes (EH) encompassing the 5'-URR, exons 2-4, and 3'-UTR were found in this population, and the most frequent was EH1 (23.2%). We provided several evidences for balancing selection effect on the 5'-URR of MICB gene in Yao population. Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  11. Hypermethylation of the FANCC and FANCL Promoter Regions in Sporadic Acute Leukaemia

    Directory of Open Access Journals (Sweden)

    C. J. Hess

    2008-01-01

    Full Text Available Objective: Inactivation of the FA-BRCA pathway results in chromosomal instability. Fanconi anaemia (FA patients have an inherited defect in this pathway and are strongly predisposed to the development of acute myeloid leukaemia (AML. Studies in sporadic cancers have shown promoter methylation of the FANCF gene in a significant proportion of various solid tumours. However, only a single leukaemic case with methylation of one of the FA-BRCA genes has been described to date, i.e. methylation of FANCF in cell line CHRF-288. We investigated the presence of aberrant methylation in 11 FA-BRCA genes in sporadic cases of leukaemia.

  12. CAGE-defined promoter regions of the genes implicated in Rett Syndrome

    DEFF Research Database (Denmark)

    Vitezic, Morana; Bertin, Nicolas; Andersson, Robin

    2014-01-01

    BACKGROUND: Mutations in three functionally diverse genes cause Rett Syndrome. Although the functions of Forkhead box G1 (FOXG1), Methyl CpG binding protein 2 (MECP2) and Cyclin-dependent kinase-like 5 (CDKL5) have been studied individually, not much is known about their relation to each other...... reveal the predominantly used transcription start sites (TSSs) for each gene including novel transcription start sites for FOXG1. We show that FOXG1 expression is poorly correlated with the expression of MECP2 and CDKL5. We identify promoter shapes for each TSS, the predicted location of enhancers...

  13. Fish farming as an innovative strategy for promoting food security in drought risk regions of Zimbabwe

    Directory of Open Access Journals (Sweden)

    Elvin Shava

    2017-11-01

    Full Text Available This article examines the implementation of fish farming as an innovative and economic strategy for promoting food security and dietary diversities among vulnerable households in drought risk areas of Zimbabwe. The declining climatic conditions and lack of economic opportunities in Mwenezi district of Zimbabwe attracted the attention of three nongovernmental organisations (NGOs to implement fish farming as an innovative mechanism to stimulate food security and generate employment in the district. The article used a qualitative research approach that includes semi-structured interviews and secondary data. The purposive sampling technique was adopted to interview participants in Mwenezi district who were involved in fish farming to assess and explore the experiences and benefits they derive from such development projects. Results for the article revealed that fish farming was well embraced by local communities as it led to improvements in food security, household income and employment regeneration. The local government including traditional leadership (Chiefs and Headmen’s supported the NGO activities as they benefited local communities. The article concludes that although fish farming was instrumental in regenerating employment, some participants still fail to participate because of laziness and desire to maintain dependency syndrome. The article recommends the NGOs to launch awareness campaigns in rural communities and increase networking with the donor community which is fundamental in attracting sustainable funding. The government can also promote fish farming in vulnerable rural communities by providing funding and capacity building programmes.

  14. Hepatitis C Virus core+1/ARF Protein Modulates the Cyclin D1/pRb Pathway and Promotes Carcinogenesis.

    Science.gov (United States)

    Moustafa, Savvina; Karakasiliotis, Ioannis; Mavromara, Penelope

    2018-05-01

    Viruses often encompass overlapping reading frames and unconventional translation mechanisms in order to maximize the output from a minimum genome and to orchestrate their timely gene expression. Hepatitis C virus (HCV) possesses such an unconventional open reading frame (ORF) within the core-coding region, encoding an additional protein, initially designated ARFP, F, or core+1. Two predominant isoforms of core+1/ARFP have been reported, core+1/L, initiating from codon 26, and core+1/S, initiating from codons 85/87 of the polyprotein coding region. The biological significance of core+1/ARFP expression remains elusive. The aim of the present study was to gain insight into the functional and pathological properties of core+1/ARFP through its interaction with the host cell, combining in vitro and in vivo approaches. Our data provide strong evidence that the core+1/ARFP of HCV-1a stimulates cell proliferation in Huh7-based cell lines expressing either core+1/S or core+1/L isoforms and in transgenic liver disease mouse models expressing core+1/S protein in a liver-specific manner. Both isoforms of core+1/ARFP increase the levels of cyclin D1 and phosphorylated Rb, thus promoting the cell cycle. In addition, core+1/S was found to enhance liver regeneration and oncogenesis in transgenic mice. The induction of the cell cycle together with increased mRNA levels of cell proliferation-related oncogenes in cells expressing the core+1/ARFP proteins argue for an oncogenic potential of these proteins and an important role in HCV-associated pathogenesis. IMPORTANCE This study sheds light on the biological importance of a unique HCV protein. We show here that core+1/ARFP of HCV-1a interacts with the host machinery, leading to acceleration of the cell cycle and enhancement of liver carcinogenesis. This pathological mechanism(s) may complement the action of other viral proteins with oncogenic properties, leading to the development of hepatocellular carcinoma. In addition, given that

  15. On the Capacity Region of the Intensity-Modulation Direct-Detection Optical Broadcast Channel

    KAUST Repository

    Chaaban, Anas; Rezki, Zouheir; Alouini, Mohamed-Slim

    2015-01-01

    on the capacity region is derived by adapting Bergmans' approach to the OBC. Inner bounds are derived by using superposition coding with either truncated-Gaussian distributions or discrete distributions. While the discrete input distribution achieves higher rates

  16. Polymorphism in the oxytocin promoter region in patients with lactase non-persistence is not related to symptoms

    Directory of Open Access Journals (Sweden)

    Simrén Magnus

    2009-11-01

    Full Text Available Abstract Background Oxytocin and the oxytocin receptor have been demonstrated in the gastrointestinal (GI tract and have been shown to exert physiological effects on gut motility. The role for oxytocin in the pathophysiology of GI complaints is unknown. The aim of this study was to examine genetic variations or polymorphism of oxytocin (OXT and its receptor (OXTR genes in patients with GI complaints without visible organic abnormalities. Methods Genetic variants in the OXT promoter region, and in the OXTR gene in DNA samples from 131 rigorously evaluated patients with Irritable Bowel Syndrome (IBS, 408 homozygous subjects referred for lactase (LCT-13910 C>T, rs4988235 genotyping, and 299 asymptomatic blood donors were compared. One polymorphism related to the OXT gene (rs6133010 A>G and 4 related to the OXTR gene (rs1465386 G>T, rs3806675 G>A, rs968389 A>G, rs1042778 G>T were selected for genotyping using Applied Biosystems 7900 HT allele discrimination assays. Results There were no statistically significant differences in the genotype or allele frequencies in any of the SNPs when IBS patients were compared to healthy controls. Among subjects referred for lactase genotyping, the rs6133010 A>G OXT promoter A/G genotype tended to be more common in the 154 non-persistent (27.3% subjects than in the 254 lactase persistant (18.1% subjects and in the healthy controls (19.4% (p = 0.08. When direct comparing, the A/G genotype was less common in the OXT promoter region in controls (p = 0.09 and in subjects with lactase persistence (p = 0.03 compared to subjects with lactase non-persistence. When healthy controls were viewed according to their own LCT-13910 genotypes, the C/C lactase non-persistent controls had a higher frequency for the OXT promoter A/G genotype than LCT-13910 T/T lactase persistent controls (41.2% vs 13.1%. No significant differences in frequencies of the investigated OXTR SNPs were noted in this study. Conclusion The results suggest

  17. Genetic polymorphisms within tumor necrosis factor gene promoter region: a role for susceptibility to ventilator-associated pneumonia.

    Science.gov (United States)

    Kotsaki, Antigoni; Raftogiannis, Maria; Routsi, Christina; Baziaka, Fotini; Kotanidou, Anastasia; Antonopoulou, Anastasia; Orfanos, Stylianos E; Katsenos, Chrisostomos; Koutoukas, Pantelis; Plachouras, Diamantis; Mandragos, Konstantinos; Giamarellos-Bourboulis, Evangelos J

    2012-08-01

    Debatable findings exist among various studies regarding the impact of single nucleotide polymorphisms (SNPs) within the promoter region of the tumor necrosis factor (TNF) gene for susceptibility to infections. Their impact was investigated in a cohort of mechanically ventilated patients who developed ventilator-associated pneumonia (VAP). Two-hundred and thirteen mechanically ventilated patients who developed VAP were enrolled. Genomic DNA was extracted and SNPs at the -376, -308 and -238 position of the promoter region of the TNF gene were assessed by restriction fragment length polymorphisms. Monocytes were isolated from 47 patients when they developed sepsis and stimulated by bacterial endotoxin for the production of TNFα and of interleukin-6 (IL-6). Patients were divided into two groups; 166 patients bearing only wild-type alleles of all three studied polymorphisms; and 47 patients carrying at least one A allele of the three studied SNPs. Time between start of mechanical ventilation and advent of VAP was significantly shorter in the second group than in the first group (log-rank: 4.416, p: 0.041). When VAP supervened, disease severity did not differ between groups. Stimulation of TNFα and of IL-6 was much greater by monocytes for patients carrying A alleles. Carriage of at least one A allele of the three studied SNPs at the promoter region of the TNF-gene is associated with shorter time to development of VAP but it is not associated with disease severity. Findings may be related with a role of the studied SNPs in the production of pro-inflammatory cytokines. Copyright © 2012 Elsevier Ltd. All rights reserved.

  18. Regional efforts to promote forestry best management practices: a southern success story

    Science.gov (United States)

    Herb Nicholson; John Colberg; Hughes Simpson; Tom Gerow; Wib Owen

    2016-01-01

    The Southern Group of State Foresters has a long history of water resource protection efforts, providing leadership in BMP development, improvement, and implementation, enhancing state BMP programs, establishing effective partnerships, and standardizing an approach to consistently monitor implementation across the region.

  19. Evaluation of methylation pattern in promoter region of E-cadherin ...

    African Journals Online (AJOL)

    The epithelial cadherin gene (CDH1) has been identified as a tumor suppressor gene located within the 16q22.1 region. The CDH1 gene encodes a transmembrane glycoprotein involved in cell to cell adhesion and loss of CDH1 expression contributes to increased proliferation, invasion and metastasis in breast carcinoma.

  20. Expression of Versican 3′-Untranslated Region Modulates Endogenous MicroRNA Functions

    Science.gov (United States)

    Lee, Daniel Y.; Jeyapalan, Zina; Fang, Ling; Yang, Jennifer; Zhang, Yaou; Yee, Albert Y.; Li, Minhui; Du, William W.; Shatseva, Tatiana; Yang, Burton B.

    2010-01-01

    Background Mature microRNAs (miRNAs) are single-stranded RNAs that regulate post-transcriptional gene expression. In our previous study, we have shown that versican 3′UTR, a fragment of non-coding transcript, has the ability to antagonize miR-199a-3p function thereby regulating expression of the matrix proteins versican and fibronectin, and thus resulting in enhanced cell-cell adhesion and organ adhesion. However, the impact of this non-coding fragment on tumorigenesis is yet to be determined. Methods and Findings Using computational prediction confirmed with in vitro and in vivo experiments, we report that the expression of versican 3′UTR not only antagonizes miR-199a-3p but can also lower its steady state expression. We found that expression of versican 3′UTR in a mouse breast carcinoma cell line, 4T1, decreased miR-199a-3p levels. The decrease in miRNA activity consequently translated into differences in tumor growth. Computational analysis indicated that both miR-199a-3p and miR-144 targeted a cell cycle regulator, Rb1. In addition, miR-144 and miR-136, which have also been shown to interact with versican 3′UTR, was found to target PTEN. Expression of Rb1 and PTEN were up-regulated synergistically in vitro and in vivo, suggesting that the 3′UTR binds and modulates miRNA activities, freeing Rb1 and PTEN mRNAs for translation. In tumor formation assays, cells transfected with the 3′UTR formed smaller tumors compared with cells transfected with a control vector. Conclusion Our results demonstrated that a 3′UTR fragment can be used to modulate miRNA functions. Our study also suggests that miRNAs in the cancer cells are more susceptible to degradation, due to its interaction with a non-coding 3′UTR. This non-coding component of mRNA may be used retrospectively to modulate miRNA activities. PMID:21049042

  1. Expression of versican 3'-untranslated region modulates endogenous microRNA functions.

    Science.gov (United States)

    Lee, Daniel Y; Jeyapalan, Zina; Fang, Ling; Yang, Jennifer; Zhang, Yaou; Yee, Albert Y; Li, Minhui; Du, William W; Shatseva, Tatiana; Yang, Burton B

    2010-10-25

    Mature microRNAs (miRNAs) are single-stranded RNAs that regulate post-transcriptional gene expression. In our previous study, we have shown that versican 3'UTR, a fragment of non-coding transcript, has the ability to antagonize miR-199a-3p function thereby regulating expression of the matrix proteins versican and fibronectin, and thus resulting in enhanced cell-cell adhesion and organ adhesion. However, the impact of this non-coding fragment on tumorigenesis is yet to be determined. Using computational prediction confirmed with in vitro and in vivo experiments, we report that the expression of versican 3'UTR not only antagonizes miR-199a-3p but can also lower its steady state expression. We found that expression of versican 3'UTR in a mouse breast carcinoma cell line, 4T1, decreased miR-199a-3p levels. The decrease in miRNA activity consequently translated into differences in tumor growth. Computational analysis indicated that both miR-199a-3p and miR-144 targeted a cell cycle regulator, Rb1. In addition, miR-144 and miR-136, which have also been shown to interact with versican 3'UTR, was found to target PTEN. Expression of Rb1 and PTEN were up-regulated synergistically in vitro and in vivo, suggesting that the 3'UTR binds and modulates miRNA activities, freeing Rb1 and PTEN mRNAs for translation. In tumor formation assays, cells transfected with the 3'UTR formed smaller tumors compared with cells transfected with a control vector. Our results demonstrated that a 3'UTR fragment can be used to modulate miRNA functions. Our study also suggests that miRNAs in the cancer cells are more susceptible to degradation, due to its interaction with a non-coding 3'UTR. This non-coding component of mRNA may be used retrospectively to modulate miRNA activities.

  2. Expression of versican 3'-untranslated region modulates endogenous microRNA functions.

    Directory of Open Access Journals (Sweden)

    Daniel Y Lee

    Full Text Available BACKGROUND: Mature microRNAs (miRNAs are single-stranded RNAs that regulate post-transcriptional gene expression. In our previous study, we have shown that versican 3'UTR, a fragment of non-coding transcript, has the ability to antagonize miR-199a-3p function thereby regulating expression of the matrix proteins versican and fibronectin, and thus resulting in enhanced cell-cell adhesion and organ adhesion. However, the impact of this non-coding fragment on tumorigenesis is yet to be determined. METHODS AND FINDINGS: Using computational prediction confirmed with in vitro and in vivo experiments, we report that the expression of versican 3'UTR not only antagonizes miR-199a-3p but can also lower its steady state expression. We found that expression of versican 3'UTR in a mouse breast carcinoma cell line, 4T1, decreased miR-199a-3p levels. The decrease in miRNA activity consequently translated into differences in tumor growth. Computational analysis indicated that both miR-199a-3p and miR-144 targeted a cell cycle regulator, Rb1. In addition, miR-144 and miR-136, which have also been shown to interact with versican 3'UTR, was found to target PTEN. Expression of Rb1 and PTEN were up-regulated synergistically in vitro and in vivo, suggesting that the 3'UTR binds and modulates miRNA activities, freeing Rb1 and PTEN mRNAs for translation. In tumor formation assays, cells transfected with the 3'UTR formed smaller tumors compared with cells transfected with a control vector. CONCLUSION: Our results demonstrated that a 3'UTR fragment can be used to modulate miRNA functions. Our study also suggests that miRNAs in the cancer cells are more susceptible to degradation, due to its interaction with a non-coding 3'UTR. This non-coding component of mRNA may be used retrospectively to modulate miRNA activities.

  3. Temperature-dependent modulation of regional lymphatic contraction frequency and flow.

    Science.gov (United States)

    Solari, Eleonora; Marcozzi, Cristiana; Negrini, Daniela; Moriondo, Andrea

    2017-11-01

    Lymph drainage and propulsion are sustained by an extrinsic mechanism, based on mechanical forces acting from the surrounding tissues against the wall of lymphatic vessels, and by an intrinsic mechanism attributable to active spontaneous contractions of the lymphatic vessel muscle. Despite being heterogeneous, the mechanisms underlying the generation of spontaneous contractions share a common biochemical nature and are thus modulated by temperature. In this study, we challenged excised tissues from rat diaphragm and hindpaw, endowed with spontaneously contracting lymphatic vessels, to temperatures from 24°C (hindpaw) or 33°C (diaphragmatic vessels) to 40°C while measuring lymphatic contraction frequency ( f c ) and amplitude. Both vessel populations displayed a sigmoidal relationship between f c and temperature, each centered around the average temperature of surrounding tissue (36.7 diaphragmatic and 32.1 hindpaw lymphatics). Although the slope factor of the sigmoidal fit to the f c change of hindpaw vessels was 2.3°C·cycles -1 ·min -1 , a value within the normal range displayed by simple biochemical reactions, the slope factor of the diaphragmatic lymphatics was 0.62°C·cycles -1 ·min -1 , suggesting the added involvement of temperature-sensing mechanisms. Lymph flow calculated as a function of temperature confirmed the relationship observed on f c data alone and showed that none of the two lymphatic vessel populations would be able to adapt to the optimal working temperature of the other tissue district. This poses a novel question whether lymphatic vessels might not adapt their function to accommodate the change if exposed to a surrounding temperature, which is different from their normal condition. NEW & NOTEWORTHY This study demonstrates to what extent lymphatic vessel intrinsic contractility and lymph flow are modulated by temperature and that this modulation is dependent on the body district that the vessels belong to, suggesting a possible

  4. Value-based modulation of memory encoding involves strategic engagement of fronto-temporal semantic processing regions.

    Science.gov (United States)

    Cohen, Michael S; Rissman, Jesse; Suthana, Nanthia A; Castel, Alan D; Knowlton, Barbara J

    2014-06-01

    A number of prior fMRI studies have focused on the ways in which the midbrain dopaminergic reward system coactivates with hippocampus to potentiate memory for valuable items. However, another means by which people could selectively remember more valuable to-be-remembered items is to be selective in their use of effective but effortful encoding strategies. To broadly examine the neural mechanisms of value on subsequent memory, we used fMRI to assess how differences in brain activity at encoding as a function of value relate to subsequent free recall for words. Each word was preceded by an arbitrarily assigned point value, and participants went through multiple study-test cycles with feedback on their point total at the end of each list, allowing for sculpting of cognitive strategies. We examined the correlation between value-related modulation of brain activity and participants' selectivity index, which measures how close participants were to their optimal point total, given the number of items recalled. Greater selectivity scores were associated with greater differences in the activation of semantic processing regions, including left inferior frontal gyrus and left posterior lateral temporal cortex, during the encoding of high-value words relative to low-value words. Although we also observed value-related modulation within midbrain and ventral striatal reward regions, our fronto-temporal findings suggest that strategic engagement of deep semantic processing may be an important mechanism for selectively encoding valuable items.

  5. Value-based modulation of memory encoding involves strategic engagement of fronto-temporal semantic processing regions

    Science.gov (United States)

    Cohen, Michael S.; Rissman, Jesse; Suthana, Nanthia A.; Castel, Alan D.; Knowlton, Barbara J.

    2014-01-01

    A number of prior fMRI studies have focused on the ways in which the midbrain dopaminergic reward system co-activates with hippocampus to potentiate memory for valuable items. However, another means by which people could selectively remember more valuable to-be-remembered items is to be selective in their use of effective but effortful encoding strategies. To broadly examine the neural mechanisms of value on subsequent memory, we used fMRI to examine how differences in brain activity at encoding as a function of value relate to subsequent free recall for words. Each word was preceded by an arbitrarily assigned point value, and participants went through multiple study-test cycles with feedback on their point total at the end of each list, allowing for sculpting of cognitive strategies. We examined the correlation between value-related modulation of brain activity and participants’ selectivity index, a measure of how close participants were to their optimal point total given the number of items recalled. Greater selectivity scores were associated with greater differences in activation of semantic processing regions, including left inferior frontal gyrus and left posterior lateral temporal cortex, during encoding of high-value words relative to low-value words. Although we also observed value-related modulation within midbrain and ventral striatal reward regions, our fronto-temporal findings suggest that strategic engagement of deep semantic processing may be an important mechanism for selectively encoding valuable items. PMID:24683066

  6. Modulation of local field potentials by high-frequency stimulation of afferent axons in the hippocampal CA1 region.

    Science.gov (United States)

    Yu, Ying; Feng, Zhouyan; Cao, Jiayue; Guo, Zheshan; Wang, Zhaoxiang; Hu, Na; Wei, Xuefeng

    2016-03-01

    Modulation of the rhythmic activity of local field potentials (LFP) in neuronal networks could be a mechanism of deep brain stimulation (DBS). However, exact changes of LFP during the periods of high-frequency stimulation (HFS) of DBS are unclear because of the interference of dense stimulation artifacts with high amplitudes. In the present study, we investigated LFP changes induced by HFS of afferent axons in the hippocampal CA1 region of urethane-anesthetized rats by using a proper algorithm of artifact removal. Afterward, the LFP changes in the frequency bands of [Formula: see text], [Formula: see text], [Formula: see text], [Formula: see text] and [Formula: see text] rhythms were studied by power spectrum analysis and coherence analysis for the recorded signals collected in the pyramidal layer and in the stratum radiatum of CA1 region before, during and after 1-min long 100 and 200[Formula: see text]Hz HFS. Results showed that the power of LFP rhythms in higher-frequency band ([Formula: see text] rhythm) increased in the pyramidal layer and the power of LFP rhythms in lower-frequency bands ([Formula: see text], [Formula: see text] and [Formula: see text] rhythms) decreased in the stratum radiatum during HFS. The synchronization of [Formula: see text] rhythm decreased and the synchronization of [Formula: see text] rhythm increased during HFS in the stratum radiatum. These results suggest that axonal HFS could modulate LFP rhythms in the downstream brain areas with a plausible underlying mechanism of partial axonal blockage induced by HFS. The study provides new evidence to support the mechanism of DBS modulating rhythmic activity of neuronal populations.

  7. Epigenetic changes within the promoter region of the HLA-G gene in ovarian tumors

    Directory of Open Access Journals (Sweden)

    Matyunina Lilya V

    2008-05-01

    Full Text Available Abstract Background Previous findings have suggested that epigenetic-mediated HLA-G expression in tumor cells may be associated with resistance to host immunosurveillance. To explore the potential role of DNA methylation on HLA-G expression in ovarian cancer, we correlated differences in HLA-G expression with methylation changes within the HLA-G regulatory region in an ovarian cancer cell line treated with 5-aza-deoxycytidine (5-aza-dC and in malignant and benign ovarian tumor samples and ovarian surface epithelial cells (OSE isolated from patients with normal ovaries. Results A region containing an intact hypoxia response element (HRE remained completely methylated in the cell line after treatment with 5-aza-dC and was completely methylated in all of the ovarian tumor (malignant and benign samples examined, but only variably methylated in normal OSE samples. HLA-G expression was significantly increased in the 5-aza-dC treated cell line but no significant difference was detected between the tumor and OSE samples examined. Conclusion Since HRE is the binding site of a known repressor of HLA-G expression (HIF-1, we hypothesize that methylation of the region surrounding the HRE may help maintain the potential for expression of HLA-G in ovarian tumors. The fact that no correlation exists between methylation and HLA-G gene expression between ovarian tumor samples and OSE, suggests that changes in methylation may be necessary but not sufficient for HLA-G expression in ovarian cancer.

  8. Nuclear proteins interacting with the promoter region of the human granulocyte/macrophage colony-stimulating factor gene

    International Nuclear Information System (INIS)

    Shannon, M.F.; Gamble, J.R.; Vadas, M.A.

    1988-01-01

    The gene for human granulocyte/macrophage colony-stimulating factor (GM-CSF) is expressed in a tissue-specific as well as an activation-dependent manner. The interaction of nuclear proteins with the promoter region of the GM-CSF gene that is likely to be responsible for this pattern of GM-CSF expression was investigated. The authors show that nuclear proteins interact with DNA fragments from the GM-CSF promoter in a cell-specific manner. A region spanning two cytokine-specific sequences, cytokine 1 (CK-1, 5', GAGATTCCAC 3') and cytokine 2 (CK-2, 5' TCAGGTA 3') bound two nuclear proteins from GM-CSF-expressing cells in gel retardation assays. NF-GMb was inducible with phorbol 12-myristate 13-acetate and accompanied induction of GM-CSF message. NF-GMb was absent in cell lines not producing GM-CSF, some of which had other distinct binding proteins. NF-GMa and NF-GMb eluted from a heparin-Sepharose column at 0.3 and 0.6 M KCl, respectively. They hypothesize that the sequences CK-1 and CK-2 bind specific proteins and regulate GM-CSF transcription

  9. Inter-organizational relations for regional development: an expansion policy promoted by the federal network of professional education, science & technology

    Directory of Open Access Journals (Sweden)

    Cleidson Nogueira Dias

    2014-12-01

    Full Text Available This research paper examines the importance of inter-organizational network management as a government policy tool to promote regional development. This pattern requires Federal Government intervention so as to compensate for the imbalance that this causes and to guarantee that economic growth resulting from government actions leads to development in all regions of the country, thereby avoiding the traditional mechanisms of wealth concentration. For this, a methodology of content analysis was used based on a relevant public policy aimed at promoting development within Brazil and by analyzing the data collected in relation to the current theory related to strategy, local development and inter-organizational networks in general.  The analysis results show that, when the policy studied in this work, applied in the federal network of professional education, science & technology, was implemented the networks had a positive influence on the outcome of the policy objectives and represented an extremely powerful support tool, being one of the most important factors to boost development.

  10. Nucleotide sequence of the promoter region of the gene encoding chicken Calbindin D28K

    Energy Technology Data Exchange (ETDEWEB)

    Ferrari, S; Drusiani, E; Battini, R; Fregni, M

    1988-01-11

    Calbindin D28K (formerly Vitamin D-Dependent Calcium Binding Protein) is a protein induced by 1,25-dihydroxycholecalciferol in several chicken tissues. A chicken genomic DNA library was screened with a synthetic oligonucleotide representing the sequence of Calbindin D18K cDNA from nt 146 to nt 176. The positive clone CBAl extends the 5'-end of the first exon by 451 bp. The sequence of a BamHI-SacII restriction fragment with coordinates -451 + 50 is shown. The BamHI-SacII fragment was subcloned 5' to the CAT gene of pUCCAT. The result is shown of a CAT assay on mouse fibroblasts 3T6 transiently transfected with pUCCAT, pUCCAT containing the BamHI-SacII fragment in the correct or opposite orientation or the SV40 promoter. /sup 14/C-chloramphenicol and its acetyl derivatives generated by purified CAT are also shown. The expression of CAT appears to be constitutive since the enzyme activity is not influenced by the presence (+) or absence (-) of 1,25-dihydroxycholecalciferol in the culture medium.

  11. Export Promotion Aims and Reality: A Comparison of the Iberian, Baltic and Central European Region

    Directory of Open Access Journals (Sweden)

    Éltető Andrea

    2017-06-01

    Full Text Available As a consequence of the international crisis in 2008-2009, the role of exports in economic growth came into focus in most countries. Exports of EU Member States gained momentum from 2010 onward but with certain changes in their structure and direction. In several countries, the turn towards non-EU areas, such as China or Latin America was part of the state export strategy. On the one hand, our article describes these foreign trade strategies and their institutional framework of the Iberian, Baltic and Central European governments, detecting possible similarities. On the other hand, we analyse recent export data. This way we can get a picture on the structure and direction of exports of periphery economies and this can be compared to the aims of the given states. Our hypothesis is that there is a gap between the reality and the intentions of the governments. The size of this gap varies and is influenced by certain factors such as the different involvement of multinational companies in foreign trade or the different economic structure of these countries. In our paper we list which countries adopted a government strategy and with what aim. We provide a short literature review on state trade promotion policies and discuss these policies and their institutions in the Baltic, Visegrád and Iberian countries.

  12. Methylation of Promoter Regions of Genes of the Human Intrauterine Renin Angiotensin System and Their Expression

    Directory of Open Access Journals (Sweden)

    Shane D. Sykes

    2015-01-01

    Full Text Available The intrauterine renin angiotensin system (RAS is implicated in placentation and labour onset. Here we investigate whether promoter methylation of RAS genes changes with gestation or labour and if it affects gene expression. Early gestation amnion and placenta were studied, as were term amnion, decidua, and placenta collected before labour (at elective caesarean section or after spontaneous labour and delivery. The expression and degree of methylation of the prorenin receptor (ATP6AP2, angiotensin converting enzyme (ACE, angiotensin II type 1 receptor (AGTR1, and two proteases that can activate prorenin (kallikrein, KLK1, and cathepsin D, CTSD were measured by qPCR and a DNA methylation array. There was no effect of gestation or labour on the methylation of RAS genes and CTSD. Amnion and decidua displayed strong correlations between the percent hypermethylation of RAS genes and CTSD, suggestive of global methylation. There were no correlations between the degree of methylation and mRNA abundance of any genes studied. KLK1 was the most methylated gene and the proportion of hypermethylated KLK1 alleles was lower in placenta than decidua. The presence of intermediate methylated alleles of KLK1 in early gestation placenta and in amnion after labour suggests that KLK1 methylation is uniquely dynamic in these tissues.

  13. Trithorax dependent changes in chromatin landscape at enhancer and promoter regions drive female puberty.

    Science.gov (United States)

    Toro, Carlos A; Wright, Hollis; Aylwin, Carlos F; Ojeda, Sergio R; Lomniczi, Alejandro

    2018-01-04

    Polycomb group (PcG) proteins control the timing of puberty by repressing the Kiss1 gene in hypothalamic arcuate nucleus (ARC) neurons. Here we identify two members of the Trithorax group (TrxG) of modifiers, mixed-lineage leukemia 1 (MLL1), and 3 (MLL3), as central components of an activating epigenetic machinery that dynamically counteracts PcG repression. Preceding puberty, MLL1 changes the chromatin configuration at the promoters of Kiss1 and Tac3, two genes required for puberty to occur, from repressive to permissive. Concomitantly, MLL3 institutes a chromatin structure that changes the functional status of a Kiss1 enhancer from poised to active. RNAi-mediated, ARC-specific Mll1 knockdown reduced Kiss1 and Tac3 expression, whereas CRISPR-Cas9-directed epigenome silencing of the Kiss1 enhancer selectively reduced Kiss1 activity. Both interventions delay puberty and disrupt reproductive cyclicity. Our results demonstrate that an epigenetic switch from transcriptional repression to activation is crucial to the regulatory mechanism controlling the timing of mammalian puberty.

  14. Tobacco advertising, promotion and sponsorship in entertainment media: a phenomenon requiring stronger controls in the Eastern Mediterranean Region.

    Science.gov (United States)

    El-Awa, Fatimah M S; El Naga, Randa Abou; Labib, Sahar; Latif, Nisreen Abdel

    2018-04-05

    Tobacco use and placement of tobacco products in television (TV) productions and movies is a way to promote tobacco use while avoiding tobacco advertising bans that exist in most countries. The fact that such productions are broadcast widely and viewed by millions, including children and young people, is of concern. This paper reviews the evidence on the use of tobacco advertising, promotion and sponsorship (TAPS) in TV and films in the Eastern Mediterranean Region and the ways to combat it. Evidence from Egypt shows considerable and increasing use of tobacco products by actors on screen, including female actors, in programmes aired during Ramadan in 2015-2017. A study of Iranian movies in 2015 showed that tobacco scenes in Iranian movies were increasing. In 2014, the WHO Regional Office for the Eastern Mediterranean held a consultative meeting on TAPS in drama. The consultation recommended regulating the tobacco presence in movies and TV through complete implementation of Article 13 of the WHO FCTC, and raising the issue to the WHO FCTC Conference of the Parties. In 2016, the Conference of the Parties called on parties to consider scaling up the implementation of WHO FCTC Article 13 and monitoring the use of TAPS in entertainment media in accordance with national legislation. A comprehensive approach is essential to end the tobacco industry's use of TV productions and movies to promote their products. Copyright © World Health Organization (WHO) 2018. Some rights reserved. This work is available under the CC BY-NC-SA 3.0 IGO license (https://creativecommons.org/licenses/by-nc-sa/3.0/igo).

  15. Cloning and analysis of the promoter region of the human fibronectin gene

    International Nuclear Information System (INIS)

    Dean, D.C.; Bowlus, C.L.; Bourgeois, S.

    1987-01-01

    Human fibronectin (FN) genomic clones were isolated by screening a human genomic library with a 75-base oligonucleotide. The sequence of the oligonucleotide corresponds to a region near the 5' end of the human FN cDNA clone pFH6 that contains the amino-terminal coding sequences but does not extend to the 5' end of the mRNA. The 5' end of the FN gene is found on a 3.7-kilobase-pair EcoRI fragment that contains about 2.7 kilobase pairs of flanking sequence. The first exon is 414 base pairs long, with a 5' untranslated region of 267 base pairs. As deduced on the basis of the position of the initiation codon, FN is synthesized with a 31-residue amino acid extension on the amion terminus that is not present in the mature polypeptide. This amino-terminal extension appears to contain both a signal peptide and a propeptide. The first 200 base pairs of 5'-flanking sequence is very G+C rich. Upstream of this the sequence becomes relatively A+T rich. The sequence ATATAA is found at -25 and the sequence CAAT is present at -150. The sequence GGGGCGGGGC at -102 exhibits homology to the binding site for the transcription factor SP1, and the sequence TGACGTCA at -173 exhibits homology to 5'-flanking sequences important for induction by cAMP

  16. Frequency-Dependent Modulation of Regional Synchrony in the Human Brain by Eyes Open and Eyes Closed Resting-States.

    Science.gov (United States)

    Song, Xiaopeng; Zhou, Shuqin; Zhang, Yi; Liu, Yijun; Zhu, Huaiqiu; Gao, Jia-Hong

    2015-01-01

    The eyes-open (EO) and eyes-closed (EC) states have differential effects on BOLD-fMRI signal dynamics, affecting both the BOLD oscillation frequency of a single voxel and the regional homogeneity (ReHo) of several neighboring voxels. To explore how the two resting-states modulate the local synchrony through different frequency bands, we decomposed the time series of each voxel into several components that fell into distinct frequency bands. The ReHo in each of the bands was calculated and compared between the EO and EC conditions. The cross-voxel correlations between the mean frequency and the overall ReHo of each voxel's original BOLD series in different brain areas were also calculated and compared between the two states. Compared with the EC state, ReHo decreased with EO in a wide frequency band of 0.01-0.25 Hz in the bilateral thalamus, sensorimotor network, and superior temporal gyrus, while ReHo increased significantly in the band of 0-0.01 Hz in the primary visual cortex, and in a higher frequency band of 0.02-0.1 Hz in the higher order visual areas. The cross-voxel correlations between the frequency and overall ReHo were negative in all the brain areas but varied from region to region. These correlations were stronger with EO in the visual network and the default mode network. Our results suggested that different frequency bands of ReHo showed different sensitivity to the modulation of EO-EC states. The better spatial consistency between the frequency and overall ReHo maps indicated that the brain might adopt a stricter frequency-dependent configuration with EO than with EC.

  17. Anxiety type modulates immediate versus delayed engagement of attention-related brain regions.

    Science.gov (United States)

    Spielberg, Jeffrey M; De Leon, Angeline A; Bredemeier, Keith; Heller, Wendy; Engels, Anna S; Warren, Stacie L; Crocker, Laura D; Sutton, Bradley P; Miller, Gregory A

    2013-09-01

    Background Habituation of the fear response, critical for the treatment of anxiety, is inconsistently observed during exposure to threatening stimuli. One potential explanation for this inconsistency is differential attentional engagement with negatively valenced stimuli as a function of anxiety type. Methods The present study tested this hypothesis by examining patterns of neural habituation associated with anxious arousal, characterized by panic symptoms and immediate engagement with negatively valenced stimuli, versus anxious apprehension, characterized by engagement in worry to distract from negatively valenced stimuli. Results As predicted, the two anxiety types evidenced distinct patterns of attentional engagement. Anxious arousal was associated with immediate activation in attention-related brain regions that habituated over time, whereas anxious apprehension was associated with delayed activation in attention-related brain regions that occurred only after habituation in a worry-related brain region. Conclusions Results further elucidate mechanisms involved in attention to negatively valenced stimuli and indicate that anxiety is a heterogeneous construct with regard to attention to such stimuli.

  18. Evidence for cosmic ray modulation in temperature records from the South Atlantic Magnetic Anomaly region

    Energy Technology Data Exchange (ETDEWEB)

    Frigo, E. [Sao Paulo Univ. (Brazil). Dept. de Geofisica; Federal do Pampa Univ., Cacapava do Sul (Brazil); Pacca, I.G. [Sao Paulo Univ. (Brazil). Dept. de Geofisica; Pereira-Filho, A.J. [Sao Paulo Univ. (Brazil). Dept. de Ciencias Atmosfericas; Rampelloto, P.H. [Federal do Pampa Univ., Sao Gabriel (Brazil); Rigozo, N.R. [Instituto Nacional de Pesquisas Espaciais, Sao Jose dos Campos (Brazil). Div. de Geofisica Espacial

    2013-11-01

    Possible direct or indirect climatic effects related to solar variability and El Nino-Southern Oscillation (ENSO) were investigated in the southern Brazil region by means of the annual mean temperatures from four weather stations 2 degrees of latitude apart over the South Atlantic Magnetic Anomaly (SAMA) region. Four maximum temperature peaks are evident at all stations in 1940, 1958, 1977 and 2002. A spectral analysis indicates the occurrence of periodicities between 2 and 7 yr, most likely associated with ENSO, and periodicities of approximately 11 and 22 yr, normally associated with solar variability. Cross-wavelet analysis indicated that the signal associated with the 22 yr solar magnetic cycle was more persistent in the last decades, while the 11 yr sunspot cycle and ENSO periodicities were intermittent. Phase-angle analysis revealed that temperature variations and the 22 yr solar cycle were in anti-phase near the SAMA center. Results show an indirect indication of possible relationships between the variability of galactic cosmic rays and climate change on a regional scale.

  19. A piece of the action: modulation of sensory-motor regions by action idioms and metaphors.

    Science.gov (United States)

    Desai, Rutvik H; Conant, Lisa L; Binder, Jeffrey R; Park, Haeil; Seidenberg, Mark S

    2013-12-01

    The idea that the conceptual system draws on sensory and motor systems has received considerable experimental support in recent years. Whether the tight coupling between sensory-motor and conceptual systems is modulated by factors such as context or task demands is a matter of controversy. Here, we tested the context sensitivity of this coupling by using action verbs in three different types of sentences in an fMRI study: literal action, apt but non-idiomatic action metaphors, and action idioms. Abstract sentences served as a baseline. The result showed involvement of sensory-motor areas for literal and metaphoric action sentences, but not for idiomatic ones. A trend of increasing sensory-motor activation from abstract to idiomatic to metaphoric to literal sentences was seen. These results support a gradual abstraction process whereby the reliance on sensory-motor systems is reduced as the abstractness of meaning as well as conventionalization is increased, highlighting the context sensitive nature of semantic processing. © 2013.

  20. Efforts to promote regional security dialogue and cooperation in the North Pacific

    International Nuclear Information System (INIS)

    Mason, P.

    1994-01-01

    Indifference to the new realities of the post-cold war era does nothing to preserve the traditional priorities laid down in the Final Document of the first special session on disarmament. On the contrary, such attitudes directly contribute to the trend towards marginalization which began when publics no longer feared the threat of a nuclear holocaust. It is believed that the expertise of forty years of multilateral arms control and disarmament efforts is directly relevant to the broader efforts of the international community to restore, maintain and promote international peace and security. Who can deny that confidence-building is central to preventive diplomacy? Or that the arms control component-from disarming to demobilization-is not equally central to peace operations whether they be traditional peace-keeping or post-conflict peace-building? Indeed the success or failure of the disarmament aspect of a peace operation is often critical to its overall success-Somalia surely being one recent sad example. The multilateral disarmament community must apply itself more directly and systematically to these broader problems - just as the United Nations Secretariat has increasingly begun to do - or risk indifference from Governments forced to make tough choices against a range of competing priorities. It is undeniably true that the post-cold war has significantly increased the potential for the international community to negotiate historic new multilateral disarmament treaties. And this window of opportunity must be utilized to the fullest. At the same time, due account must be taken of the hard fact that, for an increasing number of countries, expensive obligations in relation to advanced unconventional weapons which neither they nor their neighbours seek to possess may count for less than practical assistance in finding solutions to more parochial, but no less urgent, problems

  1. Clinicopathologic Risk Factor Distributions for MLH1 Promoter Region Methylation in CIMP-Positive Tumors.

    Science.gov (United States)

    Levine, A Joan; Phipps, Amanda I; Baron, John A; Buchanan, Daniel D; Ahnen, Dennis J; Cohen, Stacey A; Lindor, Noralane M; Newcomb, Polly A; Rosty, Christophe; Haile, Robert W; Laird, Peter W; Weisenberger, Daniel J

    2016-01-01

    The CpG island methylator phenotype (CIMP) is a major molecular pathway in colorectal cancer. Approximately 25% to 60% of CIMP tumors are microsatellite unstable (MSI-H) due to DNA hypermethylation of the MLH1 gene promoter. Our aim was to determine if the distributions of clinicopathologic factors in CIMP-positive tumors with MLH1 DNA methylation differed from those in CIMP-positive tumors without DNA methylation of MLH1. We assessed the associations between age, sex, tumor-site, MSI status BRAF and KRAS mutations, and family colorectal cancer history with MLH1 methylation status in a large population-based sample of CIMP-positive colorectal cancers defined by a 5-marker panel using unconditional logistic regression to assess the odds of MLH1 methylation by study variables. Subjects with CIMP-positive tumors without MLH1 methylation were significantly younger, more likely to be male, and more likely to have distal colon or rectal primaries and the MSI-L phenotype. CIMP-positive MLH1-unmethylated tumors were significantly less likely than CIMP-positive MLH1-methylated tumors to harbor a BRAF V600E mutation and significantly more likely to harbor a KRAS mutation. MLH1 methylation was associated with significantly better overall survival (HR, 0.50; 95% confidence interval, 0.31-0.82). These data suggest that MLH1 methylation in CIMP-positive tumors is not a completely random event and implies that there are environmental or genetic determinants that modify the probability that MLH1 will become methylated during CIMP pathogenesis. MLH1 DNA methylation status should be taken into account in etiologic studies. ©2015 American Association for Cancer Research.

  2. Clinicopathological risk factor distributions for MLH1 promoter region methylation in CIMP positive tumors

    Science.gov (United States)

    Levine, A. Joan; Phipps, Amanda I.; Baron, John A.; Buchanan, Daniel D.; Ahnen, Dennis J.; Cohen, Stacey A.; Lindor, Noralane M.; Newcomb, Polly A.; Rosty, Christophe; Haile, Robert W.; Laird, Peter W.; Weisenberger, Daniel J.

    2015-01-01

    Background The CpG Island Methylator Phenotype (CIMP) is a major molecular pathway in colorectal cancer (CRC). Approximately 25% to 60% of CIMP tumors are microsatellite unstable (MSI-H) due to DNA hypermethylation of the MLH1 gene promoter. Our aim was to determine if the distributions of clinicopathologic factors in CIMP-positive tumors with MLH1 DNA methylation differed from those in CIMP-positive tumors without DNA methylation of MLH1. Methods We assessed the associations between age, sex, tumor-site, MSI status BRAF and KRAS mutations and family CRC history with MLH1 methylation status in a large population-based sample of CIMP-positive CRCs defined by a 5-marker panel using unconditional logistic regression to assess the odds of MLH1 methylation by study variables. Results Subjects with CIMP-positive tumors without MLH1 methylation were significantly younger, more likely to be male, more likely to have distal colon or rectal primaries and the MSI-L phenotype. CIMP-positive MLH1-unmethylated tumors were significantly less likely than CIMP-positive MLH1-methylated tumors to harbor a BRAF V600E mutation and significantly more likely to harbor a KRAS mutation. MLH1 methylation was associated with significantly better overall survival (HR=0.50; 95% Confidence Interval (0.31, 0.82)). Conclusions These data suggest that MLH1 methylation in CIMP-positive tumors is not a completely random event and implies that there are environmental or genetic determinants that modify the probability that MLH1 will become methylated during CIMP pathogenesis. Impact MLH1 DNA methylation status should be taken into account in etiologic studies. PMID:26512054

  3. Promoting Vehicle to Grid (V2G) in the Nordic Region

    DEFF Research Database (Denmark)

    Kester, Johannes; Noel, Lance; Zarazua de Rubens, Gerardo

    2018-01-01

    Vehicle to Grid (V2G) holds the promise of cheap, flexible, and fast-responding storage through the use of electric vehicle batteries. Unfortunately, infrastructure, battery degradation and consumer awareness are only some of the challenges to a faster development of this technology. This paper...... offers a qualitative comparative analysis that draws on a subsample of 227 semistructured interviews on electric vehicles with both transportation and electricity experts from 201 institutions and 17 cities within the Nordic region to discuss the reasoning and arguments behind V2G incentives and policy...... mechanisms. A frequency analysis of the most coded V2G responses favoured an update of the electricity market regulation – in particular in relation to electricity taxation and aggregator markets – and support for pilot projects. However, the analysis overall implies that V2G, in contrast to EVs...

  4. Cis-acting elements in the promoter region of the human aldolase C gene.

    Science.gov (United States)

    Buono, P; de Conciliis, L; Olivetta, E; Izzo, P; Salvatore, F

    1993-08-16

    We investigated the cis-acting sequences involved in the expression of the human aldolase C gene by transient transfections into human neuroblastoma cells (SKNBE). We demonstrate that 420 bp of the 5'-flanking DNA direct at high efficiency the transcription of the CAT reporter gene. A deletion between -420 bp and -164 bp causes a 60% decrease of CAT activity. Gel shift and DNase I footprinting analyses revealed four protected elements: A, B, C and D. Competition analyses indicate that Sp1 or factors sharing a similar sequence specificity bind to elements A and B, but not to elements C and D. Sequence analysis shows a half palindromic ERE motif (GGTCA), in elements B and D. Region D binds a transactivating factor which appears also essential to stabilize the initiation complex.

  5. Promoting Educational Equity through School Libraries. Module 2: Sexism and Sex-Role Stereotyping in School Materials.

    Science.gov (United States)

    Nilsen, Alleen Pace; Tyler, Karen Beyard

    The second learning module in a continuing education program for inservice school media specialists focuses on sex stereotyping and ways in which inaccurate ideas about sex differences are transmitted through instructional materials in exploring the following questions: (1) Why do school materials communicate sexist ideas and sex-role stereotypes?…

  6. Supernatants from oral epithelial cells and gingival fibroblasts modulate human immunodeficiency virus type 1 promoter activation induced by periodontopathogens in monocytes/macrophages.

    Science.gov (United States)

    González, O A; Ebersole, J L; Huang, C B

    2010-04-01

    Bacterial and host cell products during coinfections of Human Immunodeficiency Virus type 1-positive (HIV-1(+)) patients regulate HIV-1 recrudescence in latently infected cells (e.g. T cells, monocytes/macrophages), impacting highly active antiretroviral therapy (HAART) failure and progression of acquired immunodeficiency syndrome. A high frequency of oral opportunistic infections (e.g. periodontitis) in HIV-1(+) patients has been demonstrated; however, their potential to impact HIV-1 exacerbation is unclear. We sought to determine the ability of supernatants derived from oral epithelial cells (OKF4) and human gingival fibroblasts (Gin-4) challenged with periodontal pathogens, to modulate the HIV-1 promoter activation in monocytes/macrophages. BF24 monocytes/macrophages transfected with the HIV-1 promoter driving the expression of chloramphenicol acetyltransferase (CAT) were stimulated with Porphyromonas gingivalis, Fusobacterium nucleatum, or Treponema denticola in the presence of supernatants from OKF4 or Gin4 cells either unstimulated or previously pulsed with bacteria. CAT levels were determined by enzyme-linked immunosorbent assay and cytokine production was evaluated by Luminex beadlyte assays. OKF4 and Gin4 supernatants enhanced HIV-1 promoter activation particularly related to F. nucleatum challenge. An additive effect was observed in HIV-1 promoter activation when monocytes/macrophages were simultaneously stimulated with gingival cell supernatants and bacterial extracts. OKF4 cells produced higher levels of granulocyte-macrophage colony-stimulating factor (GM-CSF) and interleukins -6 and -8 in response to F. nucleatum and P. gingivalis. Preincubation of OKF4 supernatants with anti-GM-CSF reduced the additive effect in periodontopathogen-induced HIV-1 promoter activation. These results suggest that soluble mediators produced by gingival resident cells in response to periodontopathogens could contribute to HIV-1 promoter activation in monocytes

  7. Steroid modulation of the chloride ionophore in rat brain: structure-activity requirements, regional dependence and mechanism of action

    Energy Technology Data Exchange (ETDEWEB)

    Gee, K.W.; Bolger, M.B.; Brinton, R.E.; Coirini, H.; McEwen, B.S.

    1988-08-01

    Further in vitro studies of steroids active at the gamma-aminobutyric acidA (GABAA) receptor regulated Cl- channel labeled by (35S)-t-butylbicyclophosphorothionate ((35S)TBPS) reveal additional structural requirements necessary for activity. Evaluation of selected steroids for activity against TBPS-induced convulsions show similar requirements for activity. Interestingly, steroids (e.g., 5 alpha-pregnan-3 alpha, 20 alpha-diol) were identified that have high potency but limited efficacy as modulators of (35S)TBPS binding. These characteristics are reminiscent of the clinically useful benzodiazepines (BZs) such as clonazepam. However, interactions between the prototypical anesthetic-barbiturate, sodium pentobarbital, and steroids active at the Cl- channel suggest that they do not share a common site of action as allosteric modulators of (35S)TBPS and BZ receptor binding. The most potent steroid evaluated, 5 alpha-pregnan-3 alpha-ol-20-one, modulates (35S)TBPS binding at low concentrations (IC50 approximately 17 nM) in a regionally dependent manner. All (35S)TBPS binding sites appear to be functionally coupled to a steroid modulatory site. Because several of the active steroids are metabolites of progesterone, their ability to inhibit the binding of (3H)promegestrone to the cytosolic progestin receptor in rat uterus was evaluated. Those steroids showing potent activity at the GABAA receptor-Cl- ionophore were inactive at the intracellular progestin receptor. Such specificity coupled with their high potency provide additional support for the hypothesis that some of these steroids may be involved in the homeostatic regulation of brain excitability via the GABAA-BZ receptor complex.

  8. Revolutionising engineering education in the Middle East region to promote earthquake-disaster mitigation

    Science.gov (United States)

    Baytiyeh, Hoda; Naja, Mohamad K.

    2014-09-01

    Due to the high market demands for professional engineers in the Arab oil-producing countries, the appetite of Middle Eastern students for high-paying jobs and challenging careers in engineering has sharply increased. As a result, engineering programmes are providing opportunities for more students to enrol on engineering courses through lenient admission policies that do not compromise academic standards. This strategy has generated an influx of students who must be carefully educated to enhance their professional knowledge and social capital to assist in future earthquake-disaster risk-reduction efforts. However, the majority of Middle Eastern engineering students are unaware of the valuable acquired engineering skills and knowledge in building the resilience of their communities to earthquake disasters. As the majority of the countries in the Middle East are exposed to seismic hazards and are vulnerable to destructive earthquakes, engineers have become indispensable assets and the first line of defence against earthquake threats. This article highlights the contributions of some of the engineering innovations in advancing technologies and techniques for effective disaster mitigation and it calls for the incorporation of earthquake-disaster-mitigation education into academic engineering programmes in the Eastern Mediterranean region.

  9. Possible association between serotonin transporter promoter region polymorphism and extremely violent crime in Chinese males.

    Science.gov (United States)

    Liao, Ding-Lieh; Hong, Chen-Jee; Shih, Hao-Ling; Tsai, Shih-Jen

    2004-01-01

    The neurotransmitter, serotonin, has been implicated in aggressive behavior. The serotonin transporter (5-HTT), which reuptakes serotonin into the nerve terminal, plays a critical role in the regulation of serotonergic function. Previous western reports have demonstrated that the low-activity short (S) allele of the 5-HTT gene-linked polymorphic-region (5-HTTLPR) polymorphism is associated with aggressive behavior and associated personality traits. In the present study, we investigated this 5-HTTLPR genetic polymorphism in a group of Chinese males who had been convicted for extremely violent crime (n = 135) and a normal control group (n = 111). The proportion of S-allele carriers was significantly higher in the criminal group than in the controls (p = 0.006). A significant association was not demonstrated for the relationship between the 5-HTTLPR polymorphism and antisocial personality disorder, substance abuse or alcohol abuse in the criminal group. Our findings demonstrate that carriage of the low-activity S allele is associated with extremely violent criminal behavior in Chinese males, and suggests that the 5-HTT may be implicated in the mechanisms underlying violent behaviors.

  10. E-Cigarettes: Implications for Health Promotion in the Asian Pacific Region.

    Science.gov (United States)

    Jancey, Jonine; Maycock, Bruce; McCausland, Kahlia; Howat, Peter

    2018-03-01

    Since their introduction to the United States in 2007, electronic cigarettes (e-cigarettes) use has grown exponentially. This rapid growth in e-cigarette use has been heralded by some as a potential important public health measure that could ultimately replace tobacco cigarettes, while others recommend a cautionary approach until there is clear evidence they will not become "new tobacco" bringing a possible myriad of other problems. E-cigarettes may have real benefits, however they do expose users and those nearby to organic compounds, solvents and particulate matter, with there being limited data relating to their health impact. It is unclear as to whether this relatively new device has the potential to exacerbate nicotine addictions, or play a part in reducing harm and smoking cessation. The fundamental requirement of public health practice is to do no harm and from the inconclusive evidence we have to date on e-cigarettes, it appears a cautious approach is warranted. This commentary reviews evidence that supports a cautious approach to e-cigarette availability in Australia and the Asian Pacific region.

  11. Genetic variants in promoters and coding regions of the muscle glycogen synthase and the insulin-responsive GLUT4 genes in NIDDM

    DEFF Research Database (Denmark)

    Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P

    1994-01-01

    To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter...... volunteers. By applying inverse polymerase chain reaction and direct DNA sequencing, 532 base pairs (bp) of the GS promoter were identified and the transcriptional start site determined by primer extension. SSCP scanning of the promoter region detected five single nucleotide substitutions, positioned at 42......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...

  12. Identification of a 450-bp region of human papillomavirus type 1 that promotes episomal replication in Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Chattopadhyay, Anasuya; Schmidt, Martin C.; Khan, Saleem A.

    2005-01-01

    Human papillomaviruses (HPVs) replicate as nuclear plasmids in infected cells. Since the DNA replication machinery is generally conserved between humans and Saccharomyces cerevisiae, we studied whether HPV-1 DNA can replicate in yeast. Plasmids containing a selectable marker (with or without a yeast centromere) and either the full-length HPV-1 genome or various regions of the viral long control region (LCR) and the 3' end of the L1 gene were introduced into S. cerevisiae and their ability to replicate episomally was investigated. Our results show that HPV-1 sequences promote episomal replication of plasmids although the yeast centromere is required for plasmid retention. We have mapped the autonomously replicating sequence activity of HPV-1 DNA to a 450 base-pair sequence (HPV-1 nt 6783-7232) that includes 293 nucleotides from the 5' region of the viral LCR and 157 nucleotides from the 3' end of the L1 gene. The HPV-1 ARS does not include the binding sites for the viral E1 and E2 proteins, and these proteins are dispensable for replication in S. cerevisiae

  13. Analysis of upstream promoter region and corresponding 5’ UTR of glucokinase (GCK gene in horse breeds

    Directory of Open Access Journals (Sweden)

    L. Minieri

    2010-04-01

    Full Text Available A region of glucokinase (GCK gene was sequenced in 14 horses of 14 different breeds. The resulting GCK nucleotide sequence (GenBank number EF136885 showed 77% homology with human GCK gene portion containing the upstream promoter region and the corresponding 5’ UTR of the exon 1. Conserved regulatory sequences near the putative transcriptional start site were identified. The obtained sequences were aligned to detect polymorphism. A new C>T transition within the 5’ UTR of exon 1 was found. Allele frequencies of this polymorphism were studied by PCR-RFLP in 193 horses of 14 breeds (Bardigiano, 21; Esperia Pony, 5; Haflinger, 10; Italian Heavy Draught Horse, 28; Italian Saddle, 25; Italian Trotter, 16; Lipizzan, 12; Maremmano, 15; Murgese, 14; Norico, 10; Salernitano, 12; Thoroughbred, 10; Tolfetano, 7 and Ventasso Horse, 8. The polymorphism was found in all breeds and differences in allelic frequencies among the breeds were observed. The new SNP identified within a regulative region of GCK gene, which plays an important role in insulin secretion and feeding behaviour, could be used for association studies with performance traits of the horses.

  14. Nonrandom community assembly and high temporal turnover promote regional coexistence in tropics but not temperate zone.

    Science.gov (United States)

    Freestone, Amy L; Inouye, Brian D

    2015-01-01

    A persistent challenge for ecologists is understanding the ecological mechanisms that maintain global patterns of biodiversity, particularly the latitudinal diversity gradient of peak species richness in the tropics. Spatial and temporal variation in community composition contribute to these patterns of biodiversity, but how this variation and its underlying processes change across latitude remains unresolved. Using a model system of sessile marine invertebrates across 25 degrees of latitude, from the temperate zone to the tropics, we tested the prediction that spatial and temporal patterns of taxonomic richness and composition, and the community assembly processes underlying these patterns, will differ across latitude. Specifically, we predicted that high beta diversity (spatial variation in composition) and high temporal turnover contribute to the high species richness of the tropics. Using a standardized experimental approach that controls for several confounding factors that hinder interpretation of prior studies, we present results that support our predictions. In the temperate zone, communities were more similar across spatial scales from centimeters to tens of kilometers and temporal scales up to one year than at lower latitudes. Since the patterns at northern latitudes were congruent with a null model, stochastic assembly processes are implicated. In contrast, the communities in the tropics were a dynamic spatial and temporal mosaic, with low similarity even across small spatial scales and high temporal turnover at both local and regional scales. Unlike the temperate zone, deterministic community assembly processes such as predation likely contributed to the high beta diversity in the tropics. Our results suggest that community assembly processes and temporal dynamics vary across latitude and help structure and maintain latitudinal patterns of diversity.

  15. Cancer associated fibroblasts promote tumor growth and metastasis by modulating the tumor immune microenvironment in a 4T1 murine breast cancer model.

    Directory of Open Access Journals (Sweden)

    Debbie Liao

    2009-11-01

    Full Text Available Local inflammation associated with solid tumors commonly results from factors released by tumor cells and the tumor stroma, and promotes tumor progression. Cancer associated fibroblasts comprise a majority of the cells found in tumor stroma and are appealing targets for cancer therapy. Here, our aim was to determine the efficacy of targeting cancer associated fibroblasts for the treatment of metastatic breast cancer.We demonstrate that cancer associated fibroblasts are key modulators of immune polarization in the tumor microenvironment of a 4T1 murine model of metastatic breast cancer. Elimination of cancer associated fibroblasts in vivo by a DNA vaccine targeted to fibroblast activation protein results in a shift of the immune microenvironment from a Th2 to Th1 polarization. This shift is characterized by increased protein expression of IL-2 and IL-7, suppressed recruitment of tumor-associated macrophages, myeloid derived suppressor cells, T regulatory cells, and decreased tumor angiogenesis and lymphangiogenesis. Additionally, the vaccine improved anti-metastatic effects of doxorubicin chemotherapy and enhanced suppression of IL-6 and IL-4 protein expression while increasing recruitment of dendritic cells and CD8(+ T cells. Treatment with the combination therapy also reduced tumor-associated Vegf, Pdgfc, and GM-CSF mRNA and protein expression.Our findings demonstrate that cancer associated fibroblasts promote tumor growth and metastasis through their role as key modulators of immune polarization in the tumor microenvironment and are valid targets for therapy of metastatic breast cancer.

  16. Cancer associated fibroblasts promote tumor growth and metastasis by modulating the tumor immune microenvironment in a 4T1 murine breast cancer model.

    Science.gov (United States)

    Liao, Debbie; Luo, Yunping; Markowitz, Dorothy; Xiang, Rong; Reisfeld, Ralph A

    2009-11-23

    Local inflammation associated with solid tumors commonly results from factors released by tumor cells and the tumor stroma, and promotes tumor progression. Cancer associated fibroblasts comprise a majority of the cells found in tumor stroma and are appealing targets for cancer therapy. Here, our aim was to determine the efficacy of targeting cancer associated fibroblasts for the treatment of metastatic breast cancer. We demonstrate that cancer associated fibroblasts are key modulators of immune polarization in the tumor microenvironment of a 4T1 murine model of metastatic breast cancer. Elimination of cancer associated fibroblasts in vivo by a DNA vaccine targeted to fibroblast activation protein results in a shift of the immune microenvironment from a Th2 to Th1 polarization. This shift is characterized by increased protein expression of IL-2 and IL-7, suppressed recruitment of tumor-associated macrophages, myeloid derived suppressor cells, T regulatory cells, and decreased tumor angiogenesis and lymphangiogenesis. Additionally, the vaccine improved anti-metastatic effects of doxorubicin chemotherapy and enhanced suppression of IL-6 and IL-4 protein expression while increasing recruitment of dendritic cells and CD8(+) T cells. Treatment with the combination therapy also reduced tumor-associated Vegf, Pdgfc, and GM-CSF mRNA and protein expression. Our findings demonstrate that cancer associated fibroblasts promote tumor growth and metastasis through their role as key modulators of immune polarization in the tumor microenvironment and are valid targets for therapy of metastatic breast cancer.

  17. The effect of phenobarbital on the methylation level of the p16 promoter region in rat liver

    International Nuclear Information System (INIS)

    Kostka, Grazyna; Urbanek, Katarzyna; Ludwicki, Jan K.

    2007-01-01

    It has been suggested that non-genotoxic carcinogens (NGCs) may cause modification of the DNA methylation status. We studied the effects of phenobarbital (PB) - a non-genotoxic rodent liver carcinogen - on the methylation level of the promoter region of the p16 suppressor gene, as well as on hepatomegaly, DNA synthesis, and DNA-methyltransferase (DNMTs) activity in the rat liver. Male Wistar rats received PB in 1, 3 or 14 daily oral doses (at 24-h intervals), each equivalent to 1/10 of the LD 50 value. The study showed that PB has caused persistent elevation in relative liver weight (RLW) as well as a transient increase in DNA synthesis. This suggests that the PB-induced increase in RLW was due to a combination of both hyperplasia and hypertrophy of liver cells. The effect of PB on DNA synthesis corresponded to an increase in the methylation pattern of the p16 promoter sequence. Methylation of cytosine in the analyzed CpG sites of the p16 gene was found after short exposure of the animals to PB. Treatment of rats with PB for 1 and 3 days also produced an increase in nuclear DNMTs activity. After prolonged administration (14 days), DNA synthesis declined, returning to the control level. No changes in methylation of the p16 gene nor in DNMTs activity were observed. The reversibility of early induced changes in target tissues is a mark characteristic of tumor promoters. Thus, transient changes in methylation of the p16 gene, although their direct role in the mechanisms of PB toxicity, including its carcinogenic action, remains doubtful, may therefore be a significant element of such processes

  18. THE ANALYSIS OF THE ASYMMETRICAL RISK IN TOURISM FOR THE DEVELOPMENT AND PROMOTION OF A LASTING REGIONAL TOURISM IDENTITY

    Directory of Open Access Journals (Sweden)

    Alexandru NEDELEA

    2009-06-01

    Full Text Available In order to establish an adequate balance between tourists' welfare, the needs of the natural and cultural environment, as well as to develop tourist destinations and organizations' competitiveness, it is necessary to carry out a global and integrated approach, where all interested parties share the same goals regarding the durability of tourism and the approached challenges. The purpose of this work is to identify the factors of reduced risk having a major impact over the sustainability of the tourist region under analysis and to highlight the risk factors' connections and impact in order to minimize and eliminate them, with direct effects over the awareness of tourist industry's values. The identification of lasting development's indicators will take into account all these three aspects of the durable development of tourism, namely ecological, economical and social factors, that play a part in highlighting the real performance of a tourist destination. All these aspects are absolutely necessary for the promotion of the Danube's tourist potential, achievable through the emphasis of the relevant values from the tourist patrimony of the county of Galati. The promotion of the Danube' tourist potential presupposes a series of objectives that are subordinated to the general direction that is marked at the national level, respectively Romania's transformation into a qualitative tourist destination based on its natural and cultural patrimony, in order to correspond to the European Union standards. The new policy regarding tourism proposed by the European Commission aims at offering constant support for this industry to be able to face different challenges, by promoting also competitiveness in general.

  19. Combgap Promotes Ovarian Niche Development and Chromatin Association of EcR-Binding Regions in BR-C.

    Science.gov (United States)

    Hitrik, Anna; Popliker, Malka; Gancz, Dana; Mukamel, Zohar; Lifshitz, Aviezer; Schwartzman, Omer; Tanay, Amos; Gilboa, Lilach

    2016-11-01

    The development of niches for tissue-specific stem cells is an important aspect of stem cell biology. Determination of niche size and niche numbers during organogenesis involves precise control of gene expression. How this is achieved in the context of a complex chromatin landscape is largely unknown. Here we show that the nuclear protein Combgap (Cg) supports correct ovarian niche formation in Drosophila by controlling ecdysone-Receptor (EcR)- mediated transcription and long-range chromatin contacts in the broad locus (BR-C). Both cg and BR-C promote ovarian growth and the development of niches for germ line stem cells. BR-C levels were lower when Combgap was either reduced or over-expressed, indicating an intricate regulation of the BR-C locus by Combgap. Polytene chromosome stains showed that Cg co-localizes with EcR, the major regulator of BR-C, at the BR-C locus and that EcR binding to chromatin was sensitive to changes in Cg levels. Proximity ligation assay indicated that the two proteins could reside in the same complex. Finally, chromatin conformation analysis revealed that EcR-bound regions within BR-C, which span ~30 KBs, contacted each other. Significantly, these contacts were stabilized in an ecdysone- and Combgap-dependent manner. Together, these results highlight Combgap as a novel regulator of chromatin structure that promotes transcription of ecdysone target genes and ovarian niche formation.

  20. Evaluation of surface and build-up region dose for intensity-modulated radiation therapy in head and neck cancer

    International Nuclear Information System (INIS)

    Chung, Heeteak; Jin, Hosang; Dempsey, James F.; Liu, Chihray; Palta, Jatinder; Suh, Tae-Suk; Kim, Siyong

    2005-01-01

    Despite much development, there remains dosimetric uncertainty in the surface and build-up regions in intensity-modulated radiation therapy treatment plans for head and neck cancers. Experiments were performed to determine the dosimetric discrepancies in the surface and build-up region between the treatment planning system (TPS) prediction and experimental measurement using radiochromic film. A head and neck compression film phantom was constructed from two semicylindrical solid water slabs. Treatment plans were generated using two commercial TPSs (PINNACLE3 and CORVUS) for two cases, one with a shallow (∼0.5 cm depth) target and another with a deep (∼6 cm depth) target. The plans were evaluated for a 54 Gy prescribed dose. For each case, two pieces of radiochromic film were used for dose measurement. A small piece of film strip was placed on the surface and another was inserted within the phantom. Overall, both TPSs showed good agreement with the measurement. For the shallow target case, the dose differences were within ±300 cGy (5.6% with respect to the prescribed dose) for PINNACLE3 and ±240 cGy (4.4%) for CORVUS in 90% of the region of interest. For the deep target case, the dose differences were ±350 (6.5%) for PINNACLE3 and ±260 cGy (4.8%) for CORVUS in 90% of the region of interest. However, it was found that there were significant discrepancies from the surface to about 0.2 cm in depth for both the shallow and deep target cases. It was concluded that both TPSs overestimated the surface dose for both shallow and deep target cases. The amount of overestimation ranges from 400 to 1000 cGy (∼7.4% to 18.5% with respect to the prescribed dose, 5400 cGy)

  1. Mitogen-activated protein kinase phosphatase-1 modulates regional effects of injurious mechanical ventilation in rodent lungs.

    Science.gov (United States)

    Park, Moo Suk; He, Qianbin; Edwards, Michael G; Sergew, Amen; Riches, David W H; Albert, Richard K; Douglas, Ivor S

    2012-07-01

    Mechanical ventilation induces heterogeneous lung injury by mitogen-activated protein kinase (MAPK) and nuclear factor-κB. Mechanisms regulating regional injury and protective effects of prone positioning are unclear. To determine the key regulators of the lung regional protective effects of prone positioning in rodent lungs exposed to injurious ventilation. Adult rats were ventilated with high (18 ml/kg, positive end-expiratory pressure [PEEP] 0) or low Vt (6 ml/kg; PEEP 3 cm H(2)O; 3 h) in supine or prone position. Dorsal-caudal lung mRNA was analyzed by microarray and MAPK phosphatases (MKP)-1 quantitative polymerase chain reaction. MKP-1(-/-) or wild-type mice were ventilated with very high (24 ml/kg; PEEP 0) or low Vt (6-7 ml/kg; PEEP 3 cm H(2)O). The MKP-1 regulator PG490-88 (MRx-108; 0.75 mg/kg) or phosphate-buffered saline was administered preventilation. Injury was assessed by lung mechanics, bronchioalveolar lavage cell counts, protein content, and lung injury scoring. Immunoblotting for MKP-1, and IκBα and cytokine ELISAs were performed on lung lysates. Prone positioning was protective against injurious ventilation in rats. Expression profiling demonstrated MKP-1 20-fold higher in rats ventilated prone rather than supine and regional reduction in p38 and c-jun N-terminal kinase activation. MKP-1(-/-) mice experienced amplified injury. PG490-88 improved static lung compliance and injury scores, reduced bronchioalveolar lavage cell counts and cytokine levels, and induced MKP-1 and IκBα. Injurious ventilation induces MAPK in an MKP-1-dependent fashion. Prone positioning is protective and induces MKP-1. PG490-88 induced MKP-1 and was protective against high Vt in a nuclear factor-κB-dependent manner. MKP-1 is a potential target for modulating regional effects of injurious ventilation.

  2. High fructose consumption induces DNA methylation at PPARα and CPT1A promoter regions in the rat liver

    Energy Technology Data Exchange (ETDEWEB)

    Ohashi, Koji [Department of Clinical Biochemistry, Fujita Health University School of Health Sciences, Toyoake (Japan); Munetsuna, Eiji [Department of Biochemistry, Fujita Health University School of Medicine, Toyoake (Japan); Yamada, Hiroya, E-mail: hyamada@fujita-hu.ac.jp [Department of Hygiene, Fujita Health University School of Medicine, Toyoake (Japan); Ando, Yoshitaka [Department of Joint Research Laboratory of Clinical Medicine, Fujita Health University Hospital, Toyoake (Japan); Yamazaki, Mirai; Taromaru, Nao; Nagura, Ayuri; Ishikawa, Hiroaki [Department of Clinical Biochemistry, Fujita Health University School of Health Sciences, Toyoake (Japan); Suzuki, Koji [Department of Public Health, Fujita Health University School of Health Sciences, Toyoake (Japan); Teradaira, Ryoji [Department of Clinical Biochemistry, Fujita Health University School of Health Sciences, Toyoake (Japan); Hashimoto, Shuji [Department of Hygiene, Fujita Health University School of Medicine, Toyoake (Japan)

    2015-12-04

    DNA methylation status is affected by environmental factors, including nutrition. Fructose consumption is considered a risk factor for the conditions that make up metabolic syndrome such as dyslipidemia. However, the pathogenetic mechanism by which fructose consumption leads to metabolic syndrome is unclear. Based on observations that epigenetic modifications are closely related to induction of metabolic syndrome, we hypothesized that fructose-induced metabolic syndrome is caused by epigenetic alterations. Male SD rats were designated to receive water or 20% fructose solution for 14 weeks. mRNA levels for peroxisome proliferator-activated receptor alpha (PPARα) and carnitine palmitoyltransferase 1A (CPT1A) was analyzed using Real-time PCR. Restriction digestion and real-time PCR (qAMP) was used for the analysis of DNA methylation status. Hepatic lipid accumulation was also observed by fructose intake. Fructose feeding also significantly decreased mRNA levels for PPARα and CPT1A. qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status, and pathogenesis of metabolic syndrome induced by fructose relates to DNA methylation status. - Highlights: • No general consensus has been reached regarding the molecular mechanisms of the pathogenesis of fructose-induced diseases. • Significant increase in hepatic total methylation level was observed after fructose-supplemented feeding. • Fructose feeding significantly decreased mRNA levels for PPARα and CPT1A. • qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. • Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status in rat liver.

  3. Competitive Promoter-Associated Matrix Attachment Region Binding of the Arid3a and Cux1 Transcription Factors

    Directory of Open Access Journals (Sweden)

    Dongkyoon Kim

    2017-12-01

    Full Text Available Arid3a/Bright/Dril1 is a B cell-specific transactivator that regulates immunoglobulin heavy chain (IgH gene transcription by binding promoter and enhancer-associated matrix attachment regions (MARs within the IgH gene locus. Promoter MAR-mediated Arid3a transactivation is antagonized by direct competition of MAR binding by Cux1/CDP—a ubiquitously expressed repressor originally termed NF-μNR. We report that the NF-μNR complex includes Arid3a in B cells but not in non-B cells through mobility shift assays. The binding activity of NF-μNR and Arid3a in B cells is reciprocally altered during the cell division cycle and by the B cell mitogen lipopolysaccharide LPS. LPS treatment had no effect on Arid3a localization but increased its total abundance within the nucleus and cytoplasm. We show that this increased level of Arid3a is capable of displacing Cux from the MARs to facilitate IgH gene transcription. Finally, we showed that the MARs (termed Bf150 and Tx125 associated with the VH1 rearranged variable region expressed in the S107 murine plasmacytoma, can repress reporter gene transcription in non-B cells and that they can relieve the repression mediated by Eμ enhancer in B cells. These results have significant implications for early human development and demonstrate that MARs in IgH locus, NF-µNR and Arid3a regulate IgH gene expression in a concerted fashion. This paves the way for future studies examining the misregulation of this pathway in pediatric disease.

  4. High fructose consumption induces DNA methylation at PPARα and CPT1A promoter regions in the rat liver

    International Nuclear Information System (INIS)

    Ohashi, Koji; Munetsuna, Eiji; Yamada, Hiroya; Ando, Yoshitaka; Yamazaki, Mirai; Taromaru, Nao; Nagura, Ayuri; Ishikawa, Hiroaki; Suzuki, Koji; Teradaira, Ryoji; Hashimoto, Shuji

    2015-01-01

    DNA methylation status is affected by environmental factors, including nutrition. Fructose consumption is considered a risk factor for the conditions that make up metabolic syndrome such as dyslipidemia. However, the pathogenetic mechanism by which fructose consumption leads to metabolic syndrome is unclear. Based on observations that epigenetic modifications are closely related to induction of metabolic syndrome, we hypothesized that fructose-induced metabolic syndrome is caused by epigenetic alterations. Male SD rats were designated to receive water or 20% fructose solution for 14 weeks. mRNA levels for peroxisome proliferator-activated receptor alpha (PPARα) and carnitine palmitoyltransferase 1A (CPT1A) was analyzed using Real-time PCR. Restriction digestion and real-time PCR (qAMP) was used for the analysis of DNA methylation status. Hepatic lipid accumulation was also observed by fructose intake. Fructose feeding also significantly decreased mRNA levels for PPARα and CPT1A. qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status, and pathogenesis of metabolic syndrome induced by fructose relates to DNA methylation status. - Highlights: • No general consensus has been reached regarding the molecular mechanisms of the pathogenesis of fructose-induced diseases. • Significant increase in hepatic total methylation level was observed after fructose-supplemented feeding. • Fructose feeding significantly decreased mRNA levels for PPARα and CPT1A. • qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. • Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status in rat liver.

  5. A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3' untranslated region and intronic cis-elements.

    Science.gov (United States)

    Muhle, Rebecca A; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J; Muhle, Michael E; Fidock, David A

    2009-11-01

    Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitised erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilising the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var subtelomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronised parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may result from the integrated UpsA promoter being largely silenced by the neighbouring cg6 promoter. Our analyses also revealed that the DownsA 3' untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA-promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyse promoter activity of Group A var genes, which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of var

  6. Modulation of neurotransmitter release in the region of the caudate nucleus by diet and neurotoxins

    Energy Technology Data Exchange (ETDEWEB)

    Kurstjens, N P

    1987-01-01

    In this thesis the effects of dietary manipulation, ethanol and neurotoxins on the basal and electrically evoked release of dopamine and acetylcholine from the caudate nucleus of mature animals are presented together with an evaluation of the presynaptic acetylcholine and dopamine receptors controlling acetylcholine and dopamine release. A standardised superfusion technique was used to monitor the effect of apomorphine, in the presence of (R-S)- sulpiride or haloperidol, on the electrically induced release of (/sup 3/ H)-acetylcholine in slices of rat corpus striatum. The effect of ethanol and dietary manipulation on the basal and electrically evoke release of (/sup 3/H)-acetylfholine from rat striatal slices, in the presence of specific agonists and antagonists was evaluated. From this study it is possible to deduce that diet and neurotoxins exerted a measurable effect on the mechanisms controlling release of neurotransmitters in the region of the caudate nucleus. These changes were determined in mature animals previously considered to have cerebral activity, which was not subject to dietary fluctuaations. No changes in the activity of the presynaptic dopamine receptor of the acetylcholine nerve terminals of the striatal slice could be measured.

  7. GALACTIC COSMIC-RAY INTENSITY MODULATION BY COROTATING INTERACTION REGION STREAM INTERFACES AT 1 au

    Energy Technology Data Exchange (ETDEWEB)

    Guo, X. [State Key Laboratory of Space Weather, National Space Science Center, Chinese Academy of Sciences, Beijing, 100190 (China); Florinski, V. [Center for Space Plasma and Aeronomic Research, University of Alabama, Huntsville, AL 35899 (United States)

    2016-07-20

    We present a new model that couples galactic cosmic-ray (GCR) propagation with magnetic turbulence transport and the MHD background evolution in the heliosphere. The model is applied to the problem of the formation of corotating interaction regions (CIRs) during the last solar minimum from the period between 2007 and 2009. The numerical model simultaneously calculates the large-scale supersonic solar wind properties and its small-scale turbulent content from 0.3 au to the termination shock. Cosmic rays are then transported through the background, and thus computed, with diffusion coefficients derived from the solar wind turbulent properties, using a stochastic Parker approach. Our results demonstrate that GCR variations depend on the ratio of diffusion coefficients in the fast and slow solar winds. Stream interfaces inside the CIRs always lead to depressions of the GCR intensity. On the other hand, heliospheric current sheet (HCS) crossings do not appreciably affect GCR intensities in the model, which is consistent with the two observations under quiet solar wind conditions. Therefore, variations in diffusion coefficients associated with CIR stream interfaces are more important for GCR propagation than the drift effects of the HCS during a negative solar minimum.

  8. GALACTIC COSMIC-RAY INTENSITY MODULATION BY COROTATING INTERACTION REGION STREAM INTERFACES AT 1 au

    International Nuclear Information System (INIS)

    Guo, X.; Florinski, V.

    2016-01-01

    We present a new model that couples galactic cosmic-ray (GCR) propagation with magnetic turbulence transport and the MHD background evolution in the heliosphere. The model is applied to the problem of the formation of corotating interaction regions (CIRs) during the last solar minimum from the period between 2007 and 2009. The numerical model simultaneously calculates the large-scale supersonic solar wind properties and its small-scale turbulent content from 0.3 au to the termination shock. Cosmic rays are then transported through the background, and thus computed, with diffusion coefficients derived from the solar wind turbulent properties, using a stochastic Parker approach. Our results demonstrate that GCR variations depend on the ratio of diffusion coefficients in the fast and slow solar winds. Stream interfaces inside the CIRs always lead to depressions of the GCR intensity. On the other hand, heliospheric current sheet (HCS) crossings do not appreciably affect GCR intensities in the model, which is consistent with the two observations under quiet solar wind conditions. Therefore, variations in diffusion coefficients associated with CIR stream interfaces are more important for GCR propagation than the drift effects of the HCS during a negative solar minimum.

  9. Functional modulation of cardiac form through regionally confined cell shape changes.

    Directory of Open Access Journals (Sweden)

    Heidi J Auman

    2007-03-01

    Full Text Available Developing organs acquire a specific three-dimensional form that ensures their normal function. Cardiac function, for example, depends upon properly shaped chambers that emerge from a primitive heart tube. The cellular mechanisms that control chamber shape are not yet understood. Here, we demonstrate that chamber morphology develops via changes in cell morphology, and we determine key regulatory influences on this process. Focusing on the development of the ventricular chamber in zebrafish, we show that cardiomyocyte cell shape changes underlie the formation of characteristic chamber curvatures. In particular, cardiomyocyte elongation occurs within a confined area that forms the ventricular outer curvature. Because cardiac contractility and blood flow begin before chambers emerge, cardiac function has the potential to influence chamber curvature formation. Employing zebrafish mutants with functional deficiencies, we find that blood flow and contractility independently regulate cell shape changes in the emerging ventricle. Reduction of circulation limits the extent of cardiomyocyte elongation; in contrast, disruption of sarcomere formation releases limitations on cardiomyocyte dimensions. Thus, the acquisition of normal cardiomyocyte morphology requires a balance between extrinsic and intrinsic physical forces. Together, these data establish regionally confined cell shape change as a cellular mechanism for chamber emergence and as a link in the relationship between form and function during organ morphogenesis.

  10. Green Tourism in Mountain Regions - Reducing Vulnerability and Promoting People and Place Centric Development in the Himalayas

    Institute of Scientific and Technical Information of China (English)

    R. B. Singh; D. K. Mishra

    2004-01-01

    In recent years, mountain regions are attracting great attention to Indian tourists in general and foreign tourists in particular. The potential mountain resources for promoting green tourism are enormous in the form of natural and cultural heritage such as biosphere reserves, flora and fauna, lakes and rivers and traditional rural resources. In order to utilise tourism industry market, uncontrolled numbers of tourists and related haphazard infrastructural facilities in the vulnerable mountain regions pose serious environmental implications. The ecological pressures are threatening land, water and wild life resources through direct and indirect environmental impacts together with generation of solid and liquid wastes, so green tourism is emerging as an important task in order to develop new relationship between communities, government agencies and private sectors. The strategy focuses on ecological understanding, environmental protection and ecodevelopment. The major attributes of the green tourism include environmental conservation and education and distribution of income to local people based on strong partnership. Various knowledge systems go a long way for achieving the goals of the green tourism, which creates awareness about the value of environmental resources.Mountains have ecological, recreational, educational and scientific values, which need to be utilised in sustainable way. Various tourist activities and facilities need to be diversified in order to achieve multiple benefits including scientific field excursion,recreation in natural and cultural areas, community festivals and sport tourisms. Green tourism considers tourism development as an integral part of a national and regional development. The paper discusses the social, economic and environmental dimensions of the green tourism with particular reference to village tourism development programme taking empirical evidences from the Himalaya. Such programme also minimises biophysical and human

  11. Functional Analysis of Promoter Region from Eel Cytochrome P450 1A1 Gene in Transgenic Medaka.

    Science.gov (United States)

    Ogino; Itakura; Kato; Aoki; Sato

    1999-07-01

    : Transcription of the CYP1A1 genes in mammals and fish is stimulated by polyaromatic hydrocarbons. DNA sequencing analysis revealed that CYP1A1 gene in eel (Anguilla japonica) contains two kinds of putative cis-acting regulatory elements, XRE (xenobiotic-responsive element) and ERE (estrogen-responsive element). XRE is known as the enhancer that is responsible for the inducibility of the genes of CYP1A1 and some other drug-metabolizing enzymes. In the eel CYP1A1 gene, XRE motifs are distributed as follows: five times in the region from -2136 to -1125 bp, XRE(-6) to (-2); once in the proximal basal promoter region, XRE(-1); and once in the first intron, XRE(+1). The region between XRE(-2) and XRE(-1) contains three ERE motifs. To investigate the function of the cis-acting regulatory elements in the eel CYP1A1 gene, recombinant plasmids prepared with its 5' upstream sequence and the structural gene for luciferase were microinjected into fertilized eggs of medaka at the one-cell stage. Hatched fry were treated with 3-methylcholanthrene, and the transcription efficiency was assayed using competitive polymerase chain reaction analysis. Deletion of the region containing the five XREs, XRE(-6) to XRE(-2), and the point mutation of XRE(-1) reduced the inducible expressions by 75% and 56%, respectively, showing apparent dependency of the drug induction on the XREs. Constitutive expression, however, was not significantly affected by deletion or disruption of the XREs. When the region between XRE(-2) and XRE(-1) containing no XREs but three ERE motifs was internally deleted, the inducible expression and the constitutive expression were reduced by 88% and 75%, respectively. Replacement of this region with a partial fragment of eel CYP1A1 complementary DNA, with slight alteration of the distance between the five XREs and XRE(-1), reduced the inducible expression and the constitutive expression by 91% and 60%, respectively. These results strongly suggest that not only XRE but

  12. Cholera Toxin Promotes Th17 Cell Differentiation by Modulating Expression of Polarizing Cytokines and the Antigen-Presenting Potential of Dendritic Cells.

    Science.gov (United States)

    Kang, Jung-Ok; Lee, Jee-Boong; Chang, Jun

    2016-01-01

    Cholera toxin (CT), an exotoxin produced by Vibrio cholera, acts as a mucosal adjuvant. In a previous study, we showed that CT skews differentiation of CD4 T cells to IL-17-producing Th17 cells. Here, we found that intranasal administration of CT induced migration of migratory dendritic cell (DC) populations, CD103+ DCs and CD11bhi DCs, to the lung draining mediastinal lymph nodes (medLN). Among those DC subsets, CD11bhi DCs that were relatively immature had a major role in Th17 cell differentiation after administration of CT. CT-treated BMDCs showed reduced expression of MHC class II and CD86, similar to CD11bhi DCs in medLN, and these BMDCs promoted Th17 cell differentiation more potently than other BMDCs expressing higher levels of MHC class II and CD86. By analyzing the expression of activation markers such as CD25 and CD69, proliferation and IL-2 production, we determined that CT-treated BMDCs showed diminished antigen-presenting potential to CD4+ T cells compared with normal BMDCs. We also found that CT-stimulated BMDCs promote activin A expression as well as IL-6 and IL-1β, and activin A had a synergic role with TGF-β1 in CT-mediated Th17 cell differentiation. Taken together, our results suggest that CT-stimulated DCs promote Th17 cell differentiation by not only modulating antigen-presenting potential but also inducing Th polarizing cytokines.

  13. DNA methylation in Cosmc promoter region and aberrantly glycosylated IgA1 associated with pediatric IgA nephropathy.

    Directory of Open Access Journals (Sweden)

    Qiang Sun

    Full Text Available IgA nephropathy (IgAN is one of the most common glomerular diseases leading to end-stage renal failure. Elevation of aberrantly glycosylated IgA1 is a key feature of it. The expression of the specific molecular chaperone of core1ß1, 3galactosyl transferase (Cosmc is known to be reduced in IgAN. We aimed to investigate whether the methylation of CpG islands of Cosmc gene promoter region could act as a possible mechanism responsible for down-regulation of Cosmc and related higher secretion of aberrantly glycosylated IgA1in lymphocytes from children with IgA nephropathy. Three groups were included: IgAN children (n = 26, other renal diseases (n = 11 and healthy children (n = 13. B-lymphocytes were isolated and cultured, treated or not with IL-4 or 5-Aza-2'-deoxycytidine (AZA. The levels of DNA methylation of Cosmc promotor region were not significantly different between the lymphocytes of the three children populations (P = 0.113, but there were significant differences between IgAN lymphocytes and lymphocytes of the other two children populations after IL-4 (P<0.0001 or AZA (P<0.0001. Cosmc mRNA expression was low in IgAN lymphocytes compared to the other two groups (P<0.0001. The level of aberrantly glycosylated IgA1 was markedly higher in IgAN group compared to the other groups (P<0.0001. After treatment with IL-4, the levels of Cosmc DNA methylation and aberrantly glycosylated IgA1 in IgAN lymphocytes were remarkably higher than the other two groups (P<0.0001 with more markedly decreased Cosmc mRNA content (P<0.0001. After treatment with AZA, the levels in IgAN lymphocytes were decreased, but was still remarkably higher than the other two groups (P<0.0001, while Cosmc mRNA content in IgAN lymphocytes were more markedly increased than the other two groups (P<0.0001. The alteration of DNA methylation by IL-4 or AZA specifically correlates in IgAN lymphocytes with alterations in Cosmc mRNA expression and with the level of aberrantly glycosylated

  14. Characteristics of three-grid type modulated Bayard-Alpert ionization gauge in ultra high vacuum region

    International Nuclear Information System (INIS)

    Kanaji, Toru; Urano, Toshio

    1981-01-01

    In Bayard-Alpert (B-A) ionization gauges widely used as total pressure-measuring gauges, the collector current is expressed as the sum of ion current Ii and soft X-ray photoelectron current Ix, if noise current is composed of only Ix. Ii and Ix are proportional to emission current Ie, respectively, and the pressure Px = α/S at which Ie is equal to Ix is called X-ray limit pressure, where α is X-ray current generating rate, and S is sensitivity coefficient. Therefore, it is necessary to make α smaller, and at the same time, to make S larger in order to reduce Px. But actually, the noise current is not composed of Ix only. Thereupon, the collector current other than true ion current in the lump is expressed as In, then the measuring limit pressure can be improved by epsilon n/kappa fold, where epsilon n and kappa are modulation coefficients of In and Ii, respectively. The authors have studied the three concentric cylindrical grid type modulated B-A gauge, and presently are working to try to make epsilon n smaller, putting the emphasis on holding the electric field around the collector constant. By the detailed consideration on the noise current of this gauge, it can be expected that the gauge holds linearity down to considerably low pressure region, but there are many problems to verify it. Thus this gauge is expected to be developed further as the gauges for ultra-high vacuum application. (Wakatsuki, Y.)

  15. Systematic screening for mutations in the promoter and the coding region of the 5-HT{sub 1A} gene

    Energy Technology Data Exchange (ETDEWEB)

    Erdmann, J.; Shimron-Abarbanell, D.; Cichon, S. [Univ. of Bonn (Germany)] [and others

    1995-10-09

    In the present study we sought to identify genetic variation in the 5-HT{sub 1A} receptor gene which through alteration of protein function or level of expression might contribute to the genetic predisposition to neuropsychiatric diseases. Genomic DNA samples from 159 unrelated subjects (including 45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 healthy controls) were investigated by single-strand conformation analysis. Overlapping PCR (polymerase chain reaction) fragments covered the whole coding sequence as well as the 5{prime} untranslated region of the 5-HT{sub 1A} gene. The region upstream to the coding sequence we investigated contains a functional promoter. We found two rare nucleotide sequence variants. Both mutations are located in the coding region of the gene: a coding mutation (A{yields}G) in nucleotide position 82 which leads to an amino acid exchange (Ile{yields}Val) in position 28 of the receptor protein and a silent mutation (C{yields}T) in nucleotide position 549. The occurrence of the Ile-28-Val substitution was studied in an extended sample of patients (n = 352) and controls (n = 210) but was found in similar frequencies in all groups. Thus, this mutation is unlikely to play a significant role in the genetic predisposition to the diseases investigated. In conclusion, our study does not provide evidence that the 5-HT{sub 1A} gene plays either a major or a minor role in the genetic predisposition to schizophrenia, bipolar affective disorder, or Tourette`s syndrome. 29 refs., 4 figs., 1 tab.

  16. Increased fire frequency promotes stronger spatial genetic structure and natural selection at regional and local scales in Pinus halepensis Mill.

    Science.gov (United States)

    Budde, Katharina B; González-Martínez, Santiago C; Navascués, Miguel; Burgarella, Concetta; Mosca, Elena; Lorenzo, Zaida; Zabal-Aguirre, Mario; Vendramin, Giovanni G; Verdú, Miguel; Pausas, Juli G; Heuertz, Myriam

    2017-04-01

    The recurrence of wildfires is predicted to increase due to global climate change, resulting in severe impacts on biodiversity and ecosystem functioning. Recurrent fires can drive plant adaptation and reduce genetic diversity; however, the underlying population genetic processes have not been studied in detail. In this study, the neutral and adaptive evolutionary effects of contrasting fire regimes were examined in the keystone tree species Pinus halepensis Mill. (Aleppo pine), a fire-adapted conifer. The genetic diversity, demographic history and spatial genetic structure were assessed at local (within-population) and regional scales for populations exposed to different crown fire frequencies. Eight natural P. halepensis stands were sampled in the east of the Iberian Peninsula, five of them in a region exposed to frequent crown fires (HiFi) and three of them in an adjacent region with a low frequency of crown fires (LoFi). Samples were genotyped at nine neutral simple sequence repeats (SSRs) and at 251 single nucleotide polymorphisms (SNPs) from coding regions, some of them potentially important for fire adaptation. Fire regime had no effects on genetic diversity or demographic history. Three high-differentiation outlier SNPs were identified between HiFi and LoFi stands, suggesting fire-related selection at the regional scale. At the local scale, fine-scale spatial genetic structure (SGS) was overall weak as expected for a wind-pollinated and wind-dispersed tree species. HiFi stands displayed a stronger SGS than LoFi stands at SNPs, which probably reflected the simultaneous post-fire recruitment of co-dispersed related seeds. SNPs with exceptionally strong SGS, a proxy for microenvironmental selection, were only reliably identified under the HiFi regime. An increasing fire frequency as predicted due to global change can promote increased SGS with stronger family structures and alter natural selection in P. halepensis and in plants with similar life history traits

  17. A NAP-AAO3 Regulatory Module Promotes Chlorophyll Degradation via ABA Biosynthesis in Arabidopsis Leaves[W][OPEN

    Science.gov (United States)

    Yang, Jiading; Worley, Eric

    2014-01-01

    Chlorophyll degradation is an important part of leaf senescence, but the underlying regulatory mechanisms are largely unknown. Excised leaves of an Arabidopsis thaliana NAC-LIKE, ACTIVATED BY AP3/PI (NAP) transcription factor mutant (nap) exhibited lower transcript levels of known chlorophyll degradation genes, STAY-GREEN1 (SGR1), NON-YELLOW COLORING1 (NYC1), PHEOPHYTINASE (PPH), and PHEIDE a OXYGENASE (PaO), and higher chlorophyll retention than the wild type during dark-induced senescence. Transcriptome coexpression analysis revealed that abscisic acid (ABA) metabolism/signaling genes were disproportionately represented among those positively correlated with NAP expression. ABA levels were abnormally low in nap leaves during extended darkness. The ABA biosynthetic genes 9-CIS-EPOXYCAROTENOID DIOXYGENASE2, ABA DEFICIENT3, and ABSCISIC ALDEHYDE OXIDASE3 (AAO3) exhibited abnormally low transcript levels in dark-treated nap leaves. NAP transactivated the promoter of AAO3 in mesophyll cell protoplasts, and electrophoretic mobility shift assays showed that NAP can bind directly to a segment (−196 to −162 relative to the ATG start codon) of the AAO3 promoter. Exogenous application of ABA increased the transcript levels of SGR1, NYC1, PPH, and PaO and suppressed the stay-green phenotype of nap leaves during extended darkness. Overexpression of AAO3 in nap leaves also suppressed the stay-green phenotype under extended darkness. Collectively, the results show that NAP promotes chlorophyll degradation by enhancing transcription of AAO3, which leads to increased levels of the senescence-inducing hormone ABA. PMID:25516602

  18. MAT2B promotes adipogenesis by modulating SAMe levels and activating AKT/ERK pathway during porcine intramuscular preadipocyte differentiation

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Cunzhen; Chen, Xiaochang; Wu, Wenjing; Wang, Wusu; Pang, Weijun; Yang, Gongshe, E-mail: gsyang999@hotmail.com

    2016-05-15

    Intramuscular fat (IMF) has been demonstrated as one of the crucial factors of livestock meat quality. The MAT2B protein with MAT2α catalyzes the formation of methyl donor S- adenosylmethionine (SAMe) to mediate cell metabolism including proliferation and apoptosis. However, the regulatory effect of MAT2B on IMF deposition is still unclear. In this study, the effect of MAT2B on adipogenesis and its potential mechanism during porcine intramuscular preadipocyte differentiation was studied. The results showed that overexpression of MAT2B promoted adipogenesis and significantly up-regulated the mRNA and protein levels of adipogenic marker genes including FASN, PPARγ and aP2, consistently, knockdown of MAT2B inhibited lipid accumulation and down-regulated the mRNA and protein levels of the above genes. Furthermore, flow cytometry and EdU-labeling assay indicated that MAT2B regulate adipogenesis was partly due to influence intracellular SAMe levels and further affect cell clonal expansion. Also, increased expression of MAT2B activated the phosphorylations of AKT and ERK1/2, whereas knockdown of MAT2B blocked AKT signaling and repressed the phosphorylation of ERK1/2. Moreover, the inhibitory effect of LY294002 (a specific PI3K inhibitor) on the activities of AKT and ERK1/2 was partially recovered by overexpression of MAT2B in porcine intramuscular adipocytes. Finally, Co-IP experiments showed that MAT2B can directly interact with AKT. Taken together, our findings suggested that MAT2B acted as a positive regulator through modifying SAMe levels as well as activating AKT/ERK signaling pathway to promote porcine intramuscular adipocyte differentiation. - Highlights: • MAT2B up-regulates the expression of adipogenic marker genes and promotes porcine intramuscular preadipocyte differentiation. • MAT2B influences intracellular SAMe levels and further affects cell clonal expansion. • MAT2B interacts with AKT and activates AKT/ERK signaling pathway.

  19. Analysis of polymorphisms in the promoter region and protein levels of interleukin-6 gene among gout patients.

    Science.gov (United States)

    Tsai, P-C; Chen, C-J; Lai, H-M; Chang, S-J

    2008-01-01

    To explore the associations between the polymorphisms and protein levels of interleukin-6 (IL-6) gene and gout disease. A total of 120 male gout patients and 184 healthy controls were enrolled. Each patient was matched with 1-2 gout-free controls by age within three years. Four polymorphisms in the promoter of IL-6 gene, including -597G/A, -572C/G, -373A(m)T(n), and -174G/C, and the IL-6 levels were analyzed. The clinical characteristics and biochemical markers in plasma were measured, including age of gout onset, duration of gout history, tophus number, gout attack frequency, uric acid, total cholesterol, triglycerides and creatinine. The mean IL-6 level for gout patients was 9.80 (+/-11.76 pg/ml) which showed no significant difference from the controls (7.06+/-7.58 pg/ml, p=0.230). When the IL-6 levels were dichotomized according to the median value (5 pg/ml), there were significantly higher proportions of the gout patients (59.66%) than controls (44%) with high IL-6 levels (OR=1.88, 95% CI=1.17-3.02, p=0.008). Unique genotype was found at polymorphisms -174G/C and -597G/A. Neither the polymorphisms -572C/G nor -373A(m)T(n) in the genotype or allele distributions showed a significant association related to clinical characteristics, biochemical markers, IL-6 levels or gout disease (all p>0.05). Those with gout disease have greater proportions of high IL-6 levels in plasma than controls, and there is no significant association between the four polymorphisms in the promoter region of IL-6 gene and gout disease.

  20. Tumor-promoting phorbol ester transiently down-modulates the p53 level and blocks the cell cycle

    DEFF Research Database (Denmark)

    Skouv, J.; Jensen, P O; Forchhammer, J

    1994-01-01

    Activation of the protein kinase C signaling pathway by tumor-promoting phorbol esters, such as 4 beta-phorbol 12-myristate 13-acetate (PMA), induced a decrease in the level of p53 mRNA in several serum-starved human cell lines. Also, the tumor-promoting phosphatase inhibitor okadaic acid induced...... a decrease in the p53 mRNA level in the cell lines. Normal diploid as well as various tumor cell lines were tested. Two tumor cell lines, HeLa and A549, both containing the wild-type p53 gene, but very different levels of p53 protein, were studied in detail. In both cell lines, the level of p53 m......RNA was minimal after 9 h of exposure to PMA. After approximately 120 h, the p53 mRNA level was similar to the pretreatment level. PMA induced a similar transient decrease in the level of p53 protein in the A549 cell line. The decrease in the p53 mRNA level could not be explained by changes in the transcriptional...

  1. Developing effective web-based regional anesthesia education: a randomized study evaluating case-based versus non-case-based module design.

    Science.gov (United States)

    Kopp, Sandra L; Smith, Hugh M

    2011-01-01

    Little is known about the use of Web-based education in regional anesthesia training. Benefits of Web-based education include the ability to standardize learning material quality and content, build appropriate learning progressions, use interactive multimedia technologies, and individualize delivery of course materials. The goals of this investigation were (1) to determine whether module design influences regional anesthesia knowledge acquisition, (2) to characterize learner preference patterns among anesthesia residents, and (3) to determine whether learner preferences play a role in knowledge acquisition. Direct comparison of knowledge assessments, learning styles, and learner preferences will be made between an interactive case-based and a traditional textbook-style module design. Forty-three Mayo Clinic anesthesiology residents completed 2 online modules, a knowledge pretest, posttest, an Index of Learning Styles assessment, and a participant satisfaction survey. Interscalene and lumbar plexus regional techniques were selected as the learning content for 4 Web modules constructed using the Blackboard Vista coursework application. One traditional textbook-style module and 1 interactive case-based module were designed for each of the interscalene and lumbar plexus techniques. Participants scored higher on the postmodule knowledge assessment for both of the interscalene and lumbar plexus modules. Postmodule knowledge performance scores were independent of both module design (interactive case-based versus traditional textbook style) and learning style preferences. However, nearly all participants reported a preference for Web-based learning and believe that it should be used in anesthesia resident education. Participants did not feel that Web-base learning should replace the current lecture-based curriculum. All residents scored higher on the postmodule knowledge assessment, but this improvement was independent of the module design and individual learning styles

  2. Effect of Promoter Region Mutations and mgrA Overexpression on Transcription of norA, Which Encodes a Staphylococcus aureus Multidrug Efflux Transporter

    OpenAIRE

    Kaatz, Glenn W.; Thyagarajan, Rama V.; Seo, Susan M.

    2005-01-01

    NorA is a Staphylococcus aureus multidrug transporter that confers resistance to structurally distinct compounds. The MgrA global regulatory protein is reported to augment norA expression when mgrA is overexpressed from an undefined plasmid-based promoter. Further details about norA regulatory mechanisms are scant. A chromosomal norA::lacZ transcriptional fusion was constructed in different S. aureus strains, and allele replacement was used to define the relevance of promoter region sequences...

  3. The bZIP transcription factor HY5 interacts with the promoter of the monoterpene synthase gene QH6 in modulating its rhythmic expression.

    Science.gov (United States)

    Zhou, Fei; Sun, Tian-Hu; Zhao, Lei; Pan, Xi-Wu; Lu, Shan

    2015-01-01

    The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site) which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA), we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS) transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD) and constant dark (DD) conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC) driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.

  4. The bZIP transcription factor HY5 interacts with the promoter of the monoterpene synthase gene QH6 in modulating its rhythmic expression

    Directory of Open Access Journals (Sweden)

    Fei eZhou

    2015-04-01

    Full Text Available The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA, we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD and constant dark (DD conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.

  5. Oral Probiotic VSL#3 Prevents Autoimmune Diabetes by Modulating Microbiota and Promoting Indoleamine 2,3-Dioxygenase-Enriched Tolerogenic Intestinal Environment

    Directory of Open Access Journals (Sweden)

    Jayashree Dolpady

    2016-01-01

    Full Text Available The gut microbiota modulates the autoimmune pathogenesis of type 1 diabetes (T1D via mechanisms that remain largely unknown. The inflammasome components are innate immune sensors that are highly influenced by the gut environment and play pivotal roles in maintaining intestinal immune homeostasis. In this study we show that modifications of the gut microbiota induced by oral treatment with Lactobacillaceae-enriched probiotic VSL#3, alone or in combination with retinoic acid (RA, protect NOD mice from T1D by affecting inflammasome at the intestinal level. In particular, we show that VSL#3 treatment inhibits IL-1β expression while enhancing release of protolerogenic components of the inflammasome, such as indoleamine 2,3-dioxygenase (IDO and IL-33. Those modifications of the intestinal microenvironment in VSL#3-treated NOD mice modulate gut immunity by promoting differentiation of tolerogenic CD103+ DCs and reducing differentiation/expansion of Th1 and Th17 cells in the intestinal mucosa and at the sites of autoimmunity, that is, within the pancreatic lymph nodes (PLN of VSL#3-treated NOD mice. Our data provide a link between dietary factors, microbiota composition, intestinal inflammation, and immune homeostasis in autoimmune diabetes and could pave the way for new therapeutic approaches aimed at changing the intestinal microenvironment with probiotics to counterregulate autoimmunity and prevent T1D.

  6. NO2 inhalation promotes Alzheimer’s disease-like progression: cyclooxygenase-2-derived prostaglandin E2 modulation and monoacylglycerol lipase inhibition-targeted medication

    Science.gov (United States)

    Yan, Wei; Yun, Yang; Ku, Tingting; Li, Guangke; Sang, Nan

    2016-03-01

    Air pollution has been reported to be associated with increased risks of cognitive impairment and neurodegenerative diseases. Because NO2 is a typical primary air pollutant and an important contributor to secondary aerosols, NO2-induced neuronal functional abnormalities have attracted greater attention, but the available experimental evidence, modulating mechanisms, and targeting medications remain ambiguous. In this study, we exposed C57BL/6J and APP/PS1 mice to dynamic NO2 inhalation and found for the first time that NO2 inhalation caused deterioration of spatial learning and memory, aggravated amyloid β42 (Aβ42) accumulation, and promoted pathological abnormalities and cognitive defects related to Alzheimer’s disease (AD). The microarray and bioinformation data showed that the cyclooxygenase-2 (COX-2)-mediated arachidonic acid (AA) metabolism of prostaglandin E2 (PGE2) played a key role in modulating this aggravation. Furthermore, increasing endocannabinoid 2-arachidonoylglycerol (2-AG) by inhibiting monoacylglycerol lipase (MAGL) prevented PGE2 production, neuroinflammation-associated Aβ42 accumulation, and neurodegeneration, indicating a therapeutic target for relieving cognitive impairment caused by NO2 exposure.

  7. Adiponectin haploinsufficiency promotes mammary tumor development in MMTV-PyVT mice by modulation of phosphatase and tensin homolog activities.

    Directory of Open Access Journals (Sweden)

    Janice B B Lam

    Full Text Available Adiponectin is an adipokine possessing beneficial effects on obesity-related medical complications. A negative association of adiponectin levels with breast cancer development has been demonstrated. However, the precise role of adiponectin deficiency in mammary carcinogenesis remains elusive.In the present study, MMTV-polyomavirus middle T antigen (MMTV-PyVT transgenic mice with reduced adiponectin expressions were established and the stromal effects of adiponectin haploinsufficiency on mammary tumor development evaluated. In mice from both FVB/N and C57BL/6J backgrounds, insufficient adiponectin production promoted mammary tumor onset and development. A distinctive basal-like subtype of tumors, with a more aggressive phenotype, was derived from adiponectin haplodeficient MMTV-PyVT mice. Comparing with those from control MMTV-PyVT mice, the isolated mammary tumor cells showed enhanced tumor progression in re-implanted nude mice, accelerated proliferation in primary cultures, and hyperactivated phosphatidylinositol-3-kinase (PI3K/Akt/beta-catenin signaling, which at least partly attributed to the decreased phosphatase and tensin homolog (PTEN activities. Further analysis revealed that PTEN was inactivated by a redox-regulated mechanism. Increased association of PTEN-thioredoxin complexes was detected in tumors derived from mice with reduced adiponectin levels. The activities of thioredoxin (Trx1 and thioredoxin reductase (TrxR1 were significantly elevated, whereas treatment with either curcumin, an irreversible inhibitor of TrxR1, or adiponectin largely attenuated their activities and resulted in the re-activation of PTEN in these tumor cells. Moreover, adiponectin could inhibit TrxR1 promoter-mediated transcription and restore the mRNA expressions of TrxR1.Adiponectin haploinsufficiency facilitated mammary tumorigenesis by down-regulation of PTEN activity and activation of PI3K/Akt signalling pathway through a mechanism involving Trx1/TrxR1

  8. Small molecule kaempferol modulates PDX-1 protein expression and subsequently promotes pancreatic β-cell survival and function via CREB

    Science.gov (United States)

    Zhang, Yanling.; Zhen, Wei.; Maechler, Pierre; Liu, Dongmin

    2013-01-01

    Chronic hyperlipidemia causes β-cell apoptosis and dysfunction, thereby contributing to the pathogenesis of T2D. Thus, searching for agents to promote pancreatic β-cell survival and improve its function could be a promising strategy to prevent and treat T2D. We investigated the effects of kaempferol, a small molecule isolated from ginkgo biloba, on apoptosis and function of β-cells and further determined the mechanism underlying its actions. Kaempferol treatment promoted viability, inhibited apoptosis, and reduced caspase-3 activity in INS-1E cells and human islets chronically exposed to palmitate. In addition, kaempferol prevented the lipotoxicity-induced down-regulation of anti-apoptotic proteins Akt and Bcl-2. The cytoprotective effects of kaempferol were associated with improved insulin secretion, synthesis, and PDX-1 expression. Chronic hyperlipidemia significantly diminished cAMP production, PKA activation, and CREB phosphorylation and its regulated transcriptional activity in β-cells, all of which were restored by kaempferol treatment. Disruption of CREB expression by transfection of CREB siRNA in INS-1E cells or adenoviral transfer of dominant-negative forms of CREB in human islets ablated kaempferol protection of β-cell apoptosis and dysfunction caused by palmitate. Incubation of INS-1E cells or human islets with kaempferol for 48 h induced PDX-1 expression. This effect of kaempferol on PDX-1 expression was not shared by a host of structurally related flavonoid compounds. PDX-1 gene knockdown reduced kaempferol–stimulated cAMP generation and CREB activation in INS-1E cells. These findings demonstrate that kaempferol is a novel survivor factor for pancreatic β-cells via up-regulating the PDX-1/cAMP/PKA/CREB signaling cascade. PMID:22819546

  9. Recurrence in Region of Spared Parotid Gland After Definitive Intensity-Modulated Radiotherapy for Head and Neck Cancer

    International Nuclear Information System (INIS)

    Cannon, Donald M.; Lee, Nancy Y.

    2008-01-01

    Purpose: To discuss the implications of three examples of periparotid recurrence after definitive intensity-modulated radiotherapy (IMRT) for head and neck cancer (HNC). Methods and Materials: We present 3 patients with HNC who underwent definitive IMRT with concurrent chemotherapy and later had treatment failure in or near a spared parotid gland. Two patients had bilateral multilevel nodal disease, and all had Level II nodal disease ipsilateral to the site of recurrence. The patients were treated using dose-painting IMRT with a dose of 70 Gy to the gross tumor volume and 59.4 Gy or 54 Gy to the high-risk or low-risk clinical tumor volume, respectively. The parotid glands were spared bilaterally. The patients had not undergone any surgical treatment for HNC before radiotherapy. Results: All patients had treatment failure in the region of a spared parotid gland. Failure in the 2 patients with bilateral multilevel nodal involvement occurred in the periparotid lymph nodes. The third patient developed a dermal metastasis near the tail of a spared parotid gland. On pretreatment imaging, the 2 patients with nodal failure had small nonspecific periparotid nodules that showed no hypermetabolic activity on positron emission tomography. Conclusion: For HNC patients receiving definitive IMRT, nonspecific positron emission tomography-negative periparotid nodules on pretreatment imaging should raise the index of suspicion for subclinical disease in the presence of multilevel or Level II nodal metastases. Additional evaluation of such nodules might be indicated before sparing the ipsilateral parotid gland

  10. Polymorphism of the promoter region and exon 1 of the CTLA4 gene in endemic pemphigus foliaceus (fogo selvagem

    Directory of Open Access Journals (Sweden)

    D.P. Pavoni

    2006-09-01

    Full Text Available Endemic pemphigus foliaceus (EPF is an autoimmune bullous skin disease characterized by acantholysis and antibodies against a desmosomal protein, desmoglein 1. Genetic and environmental factors contribute to development of this multifactorial disease. HLA class II and some cytokine gene polymorphisms are the only genetic markers thus far known to be associated with susceptibility to or protection from EPF. The cytotoxic T-lymphocyte antigen-4 gene (CTLA4 encodes a key immunoreceptor molecule that regulates and inhibits T-cell proliferation. It participates in the regulatory process controlling autoreactivity and therefore has been considered a strong candidate gene in autoimmune diseases. In the search for genes that might influence EPF pathogenesis, we analyzed variants of the CTLA4 gene in a sample of 118 patients and 291 controls from a Brazilian population. This is the first study investigating the possible role of polymorphisms of the 2q33 chromosomal region in differential susceptibility to pemphigus foliaceus. Promoter region and exon 1 single nucleotide polymorphisms -318 (C,T and 49 (A,G were genotyped using sequence-specific oligonucleotide probes after amplification by the polymerase chain reaction. The allelic and genotypic frequencies did not differ significantly between the patient and the control groups (-318T: 9.8 and 10.9%, 49G: 33.0 and 35.2% were the allelic frequencies in patients and controls, respectively. In addition, no significant difference was found when the patient and control population samples were stratified by the presence of HLA-DRB1 alleles. We conclude that the CTLA4 -318 (C,T and 49 (A,G polymorphisms do not play a major role in EPF development.

  11. Low intraprostatic DHT promotes the infiltration of CD8+ T cells in BPH tissues via modulation of CCL5 secretion.

    Science.gov (United States)

    Fan, Yu; Hu, Shuai; Liu, Jie; Xiao, Fei; Li, Xin; Yu, Wei; Cui, Yun; Sun, Mengkui; Lv, Tianjing; He, Qun; Jin, Jie

    2014-01-01

    Clinical studies suggested thatandrogen might be associated with infiltrating T cells in prostate of benign prostatic hyperplasia (BPH) patients, but detail of T-cell subset and mechanism still remained unclear. The present study tested the hypothesis that intraprostatic 5 α -dihydrotestosterone (DHT) exerts effects on T cells recruitment by BPH epithelial cells. Prostate tissues from 64 cases of BPH patients after transurethral resection of prostate (TURP) were divided into 2 groups: (1) no medication history; (2) administration of 5 α -reductase type II inhibitor-finasteride 5 mg daily for at least 6 months before surgery. Group 2 presented significantly higher CD8+ T cells infiltration than group 1, but no changes in CD4+ T cells (immunohistochemistry and flow cytometry). In vitro study more CD8+ T cell migrated to the prostate tissue lysates from group 2 and BPH-1 cells in low DHT condition. Transcription of chemokine (C-C motif) Ligand 5 (CCL5) mRNA in BPH-1 cells and chemokine (C-C motif) receptor 5 (CCR5) mRNA in CD8+ T cells were upregulated in low DHT condition (q-PCR). CCL5 expression was also identified to be higher in group 2 prostate tissues by IHC. This study suggested that intraprostatic DHT may participate in regulating inflammatory response which was induced by human prostatic epithelial cell, via modulating CCL5 secretion.

  12. Low Intraprostatic DHT Promotes the Infiltration of CD8+ T Cells in BPH Tissues via Modulation of CCL5 Secretion

    Directory of Open Access Journals (Sweden)

    Yu Fan

    2014-01-01

    Full Text Available Clinical studies suggested thatandrogen might be associated with infiltrating T cells in prostate of benign prostatic hyperplasia (BPH patients, but detail of T-cell subset and mechanism still remained unclear. The present study tested the hypothesis that intraprostatic 5α-dihydrotestosterone (DHT exerts effects on T cells recruitment by BPH epithelial cells. Prostate tissues from 64 cases of BPH patients after transurethral resection of prostate (TURP were divided into 2 groups: (1 no medication history; (2 administration of 5α-reductase type II inhibitor-finasteride 5 mg daily for at least 6 months before surgery. Group 2 presented significantly higher CD8+ T cells infiltration than group 1, but no changes in CD4+ T cells (immunohistochemistry and flow cytometry. In vitro study more CD8+ T cell migrated to the prostate tissue lysates from group 2 and BPH-1 cells in low DHT condition. Transcription of chemokine (C-C motif Ligand 5 (CCL5 mRNA in BPH-1 cells and chemokine (C-C motif receptor 5 (CCR5 mRNA in CD8+ T cells were upregulated in low DHT condition (q-PCR. CCL5 expression was also identified to be higher in group 2 prostate tissues by IHC. This study suggested that intraprostatic DHT may participate in regulating inflammatory response which was induced by human prostatic epithelial cell, via modulating CCL5 secretion.

  13. Kefir fermented milk and kefiran promote growth of Bifidobacterium bifidum PRL2010 and modulate its gene expression.

    Science.gov (United States)

    Serafini, Fausta; Turroni, Francesca; Ruas-Madiedo, Patricia; Lugli, Gabriele Andrea; Milani, Christian; Duranti, Sabrina; Zamboni, Nicole; Bottacini, Francesca; van Sinderen, Douwe; Margolles, Abelardo; Ventura, Marco

    2014-05-16

    Bifidobacteria constitute one of the dominant groups of microorganisms colonizing the human gut of infants. Their ability to utilize various host-derived glycans as well as dietary carbohydrates has received considerable scientific attention. However, very little is known about the role of fermented foods, such as kefir, or their constituent glycans, such as kefiran, as substrates for bifidobacterial growth and for the modulation of the expression of bifidobacterial host-effector molecules. Here, we show that Bifidobacterium bifidum PRL2010 exhibits high growth performance among the bifidobacterial strains tested when cultivated on kefir and/or kefiran polymer. Furthermore, a 16S rRNA metagenomic approach revealed that the microbiota of kefir is modified upon the addition of PRL2010 cells to the kefir matrix. Finally, our results show that kefir and kefiran are able to influence the transcriptome of B. bifidum PRL2010 causing increased transcription of genes involved in the metabolism of dietary glycans as well as genes that act as host-microbe effector molecules such as pili. Altogether, these data support the use of kefir as a valuable means for the delivery of effective microbial cells in probiotic therapy. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Heme-Induced Biomarkers Associated with Red Meat Promotion of colon Cancer Are Not Modulated by the Intake of Nitrite

    Science.gov (United States)

    Chenni, Fatima Z; Taché, Sylviane; Naud, Nathalie; Guéraud, Françoise; Hobbs, Ditte A; Kunhle, Gunter G C; Pierre, Fabrice H; Corpet, Denis E

    2013-01-01

    Red and processed meat consumption is associated with the risk of colorectal cancer. Three hypotheses are proposed to explain this association, via heme/alcenal, heterocyclic amines or N-nitroso compounds. Rats have often been used to study these hypotheses, but the lack of enterosalivary cycle of nitrate in rats casts doubt on the relevance of this animal model to predict nitroso- and heme-associated human colon carcinogenesis. The present study was thus designed to clarify whether a nitrite intake that mimics the enterosalivary cycle can modulate heme-induced nitrosation and fat peroxidation. This study shows that, in contrast with the starting hypothesis, salivary nitrite did not change the effect of hemoglobin on biochemical markers linked to colon carcinogenesis, notably lipid peroxidation and cytotoxic activity in the colon of rat. However, ingested sodium nitrite increased fecal nitroso-compounds level, but their fecal concentration and their nature (iron-nitrosyl) would not be associated with an increased risk of cancer. The rat model could thus be relevant to study the effect of red meat on colon carcinogenesis in spite of the lack of nitrite recycling in rat’s saliva. PMID:23441609

  15. RNA polymerase II interacts with the promoter region of the noninduced hsp70 gene in Drosophila melanogaster cells

    International Nuclear Information System (INIS)

    Gilmour, D.S.; Lis, J.T.

    1986-01-01

    By using a protein-DNA cross-linking method, we examined the in vivo distribution of RNA polymerase II on the hsp70 heat shock gene in Drosophila melanogaster Schneider line 2 cells. In heat shock-induced cells, a high level of RNA polymerase II was detected on the entire gene, while in noninduced cells, the RNA polymerase II was confined to the 5' end of the hsp70 gene, predominantly between nucleotides -12 and +65 relative to the start of transcription. This association of RNA polymerase II was apparent whether the cross-linking was performed by a 10-min UV irradiation of chilled cells with mercury vapor lamps or by a 40-microsecond irradiation of cells with a high-energy xenon flash lamp. We hypothesize that RNA polymerase II has access to, and a high affinity for, the promoter region of this gene before induction, and this poised RNA polymerase II may be critical in the mechanism of transcription activation

  16. The hepcidin gene promoter nc.-1010C > T; -582A > G haplotype modulates serum ferritin in individuals carrying the common H63D mutation in HFE gene.

    Science.gov (United States)

    Silva, Bruno; Pita, Lina; Gomes, Susana; Gonçalves, João; Faustino, Paula

    2014-12-01

    Hereditary hemochromatosis is an autosomal recessive disorder characterized by severe iron overload. It is usually associated with homozygosity for the HFE gene mutation c.845G > A; p.C282Y. However, in some cases, another HFE mutation (c.187C > G; p.H63D) seems to be associated with the disease. Its penetrance is very low, suggesting the possibility of other iron genetic modulators being involved. In this work, we have screened for HAMP promoter polymorphisms in 409 individuals presenting normal or increased serum ferritin levels together with normal or H63D-mutated HFE genotypes. Our results show that the hepcidin gene promoter TG haplotype, originated by linkage of the nc.-1010C > T and nc.-582A > G polymorphisms, is more frequent in the HFE_H63D individuals presenting serum ferritin levels higher than 300 μg/L than in those presenting the HFE_H63D mutation but with normal serum ferritin levels or in the normal control group.Moreover, it was observed that the TG haplotype was associated to increased serum ferritin levels in the overall pool of HFE_H63D individuals. Thus, our data suggest that screening for these polymorphisms could be of interest in order to explain the phenotype. However, this genetic condition seems to have no clinical significance.

  17. Multiple 5' ends of human cytomegalovirus UL57 transcripts identify a complex, cycloheximide-resistant promoter region that activates oriLyt

    International Nuclear Information System (INIS)

    Kiehl, Anita; Huang, Lili; Franchi, David; Anders, David G.

    2003-01-01

    The human cytomegalovirus (HCMV) UL57 gene lies adjacent to HCMV oriLyt, from which it is separated by an organizationally conserved, mostly noncoding region that is thought to both regulate UL57 expression and activate oriLyt function. However, the UL57 promoter has not been studied. We determined the 5' ends of UL57 transcripts toward an understanding of the potential relationship between UL57 expression and oriLyt activation. The results presented here identified three distinct 5' ends spread over 800 bp, at nt 90302, 90530, and 91138; use of these sites exhibited differential sensitivity to phosphonoformic acid treatment. Interestingly, a 10-kb UL57 transcript accumulated in cycloheximide-treated infected cells, even though other early transcripts were not detectable. However, the 10-kb transcript did not accumulate in cells treated with the more stringent translation inhibitor anisomycin. Consistent with the notion that the identified 5' ends arise from distinct transcription start sites, the sequences upstream of sites I and II functioned as promoters responsive to HCMV infection in transient assays. However, the origin-proximal promoter region III required downstream sequences for transcriptional activity. Mutation of candidate core promoter elements suggested that promoter III is regulated by an initiator region (Inr) and a downstream promoter element. Finally, a 42-bp sequence containing the candidate Inr activated a minimal oriLyt core construct in transient replication assays. Thus, these studies showed that a large, complex promoter region with novel features controls UL57 expression, and identified a sequence that regulates both UL57 transcription and oriLyt activation

  18. CHIR99021 promotes self-renewal of mouse embryonic stem cells by modulation of protein-encoding gene and long intergenic non-coding RNA expression

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Yongyan [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); Ai, Zhiying [Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); College of Life Sciences, Northwest A and F University, Yangling 712100, Shaanxi (China); Yao, Kezhen [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); Cao, Lixia; Du, Juan; Shi, Xiaoyan [Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); College of Life Sciences, Northwest A and F University, Yangling 712100, Shaanxi (China); Guo, Zekun, E-mail: gzk@nwsuaf.edu.cn [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); Zhang, Yong, E-mail: zhylab@hotmail.com [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China)

    2013-10-15

    Embryonic stem cells (ESCs) can proliferate indefinitely in vitro and differentiate into cells of all three germ layers. These unique properties make them exceptionally valuable for drug discovery and regenerative medicine. However, the practical application of ESCs is limited because it is difficult to derive and culture ESCs. It has been demonstrated that CHIR99021 (CHIR) promotes self-renewal and enhances the derivation efficiency of mouse (m)ESCs. However, the downstream targets of CHIR are not fully understood. In this study, we identified CHIR-regulated genes in mESCs using microarray analysis. Our microarray data demonstrated that CHIR not only influenced the Wnt/β-catenin pathway by stabilizing β-catenin, but also modulated several other pluripotency-related signaling pathways such as TGF-β, Notch and MAPK signaling pathways. More detailed analysis demonstrated that CHIR inhibited Nodal signaling, while activating bone morphogenetic protein signaling in mESCs. In addition, we found that pluripotency-maintaining transcription factors were up-regulated by CHIR, while several developmental-related genes were down-regulated. Furthermore, we found that CHIR altered the expression of epigenetic regulatory genes and long intergenic non-coding RNAs. Quantitative real-time PCR results were consistent with microarray data, suggesting that CHIR alters the expression pattern of protein-encoding genes (especially transcription factors), epigenetic regulatory genes and non-coding RNAs to establish a relatively stable pluripotency-maintaining network. - Highlights: • Combined use of CHIR with LIF promotes self-renewal of J1 mESCs. • CHIR-regulated genes are involved in multiple pathways. • CHIR inhibits Nodal signaling and promotes Bmp4 expression to activate BMP signaling. • Expression of epigenetic regulatory genes and lincRNAs is altered by CHIR.

  19. CHIR99021 promotes self-renewal of mouse embryonic stem cells by modulation of protein-encoding gene and long intergenic non-coding RNA expression

    International Nuclear Information System (INIS)

    Wu, Yongyan; Ai, Zhiying; Yao, Kezhen; Cao, Lixia; Du, Juan; Shi, Xiaoyan; Guo, Zekun; Zhang, Yong

    2013-01-01

    Embryonic stem cells (ESCs) can proliferate indefinitely in vitro and differentiate into cells of all three germ layers. These unique properties make them exceptionally valuable for drug discovery and regenerative medicine. However, the practical application of ESCs is limited because it is difficult to derive and culture ESCs. It has been demonstrated that CHIR99021 (CHIR) promotes self-renewal and enhances the derivation efficiency of mouse (m)ESCs. However, the downstream targets of CHIR are not fully understood. In this study, we identified CHIR-regulated genes in mESCs using microarray analysis. Our microarray data demonstrated that CHIR not only influenced the Wnt/β-catenin pathway by stabilizing β-catenin, but also modulated several other pluripotency-related signaling pathways such as TGF-β, Notch and MAPK signaling pathways. More detailed analysis demonstrated that CHIR inhibited Nodal signaling, while activating bone morphogenetic protein signaling in mESCs. In addition, we found that pluripotency-maintaining transcription factors were up-regulated by CHIR, while several developmental-related genes were down-regulated. Furthermore, we found that CHIR altered the expression of epigenetic regulatory genes and long intergenic non-coding RNAs. Quantitative real-time PCR results were consistent with microarray data, suggesting that CHIR alters the expression pattern of protein-encoding genes (especially transcription factors), epigenetic regulatory genes and non-coding RNAs to establish a relatively stable pluripotency-maintaining network. - Highlights: • Combined use of CHIR with LIF promotes self-renewal of J1 mESCs. • CHIR-regulated genes are involved in multiple pathways. • CHIR inhibits Nodal signaling and promotes Bmp4 expression to activate BMP signaling. • Expression of epigenetic regulatory genes and lincRNAs is altered by CHIR

  20. Elastin-derived peptides promote abdominal aortic aneurysm formation by modulating M1/M2 macrophage polarization1

    Science.gov (United States)

    Dale, Matthew A; Xiong, Wanfen; Carson, Jeffrey S; Suh, Melissa K; Karpisek, Andrew D.; Meisinger, Trevor M.; Casale, George P.; Baxter, B. Timothy

    2016-01-01

    Abdominal aortic aneurysm (AAA) is a dynamic vascular disease characterized by inflammatory cell invasion and extracellular matrix (ECM) degradation. Damage to elastin in the ECM results in release of elastin-derived peptides (EDPs), which are chemotactic for inflammatory cells such as monocytes. Their effect on macrophage polarization is less well known. Pro-inflammatory M1 macrophages initially are recruited to sites of injury but, if their effects are prolonged, they can lead to chronic inflammation that prevents normal tissue repair. Conversely, anti-inflammatory M2 macrophages reduce inflammation and aid in wound healing. Thus, a proper M1/M2 ratio is vital for tissue homeostasis. AAA tissue reveals a high M1/M2 ratio where pro-inflammatory cells and their associated markers dominate. In the present study, in vitro treatment of bone marrow-derived macrophages with EDPs induced M1 macrophage polarization. By using C57Bl/6 mice, antibody-mediated neutralization of EDPs reduced aortic dilation, matrix metalloproteinase activity, and pro-inflammatory cytokine expression at early and late time points after aneurysm induction. Furthermore, direct manipulation of the M1/M2 balance altered aortic dilation. Injection of M2 polarized macrophages reduced aortic dilation after aneurysm induction. EDPs promoted a pro-inflammatory environment in aortic tissue by inducing M1 polarization and neutralization of EDPs attenuated aortic dilation. The M1/M2 imbalance is vital to aneurysm formation. PMID:27183603

  1. Carpobrotus edulis methanol extract inhibits the MDR efflux pumps, enhances killing of phagocytosed S. aureus and promotes immune modulation.

    Science.gov (United States)

    Ordway, Diane; Hohmann, Judit; Viveiros, Miguel; Viveiros, Antonio; Molnar, Joseph; Leandro, Clara; Arroz, Maria Jorge; Gracio, Maria Amelia; Amaral, Leonard

    2003-05-01

    Although alkaloids from the family Aizoaceae have anticancer activity, species of this family have received little attention. Because these alkaloids also exhibit properties normally associated with compounds that have activity at the level of the plasma membrane, a methanol extract of Carpobrotus edulis, a common plant found along the Portuguese coast, was studied for properties normally associated with plasma membrane active compounds. The results of this study show that the extract is non-toxic at concentrations that inhibit a verapamil sensitive efflux pump of L5178 mouse T cell lymphoma cell line thereby rendering these multi-drug resistant cells susceptible to anticancer drugs. These non-toxic concentrations also prime THP-1 human monocyte-derived macrophages to kill ingested Staphylococcus aureus and to promote the release of lymphokines associated with cellular immune functions. The extract also induces the proliferation of THP-1 cells within 1 day of exposure to quantities normally associated with phytohaemagglutinin. The potential role of the compound(s) isolated from this plant in cancer biology is intriguing and is currently under investigation. It is supposed that the resistance modifier and immunomodulatory effect of this plant extract can be exploited in the experimental chemotherapy of cancer and bacterial or viral infections. Copyright 2003 John Wiley & Sons, Ltd.

  2. Adaptable Web Modules to Stimulate Active Learning in Engineering Hydrology using Data and Model Simulations of Three Regional Hydrologic Systems

    Science.gov (United States)

    Habib, E. H.; Tarboton, D. G.; Lall, U.; Bodin, M.; Rahill-Marier, B.; Chimmula, S.; Meselhe, E. A.; Ali, A.; Williams, D.; Ma, Y.

    2013-12-01

    server-based system. Open source web technologies and community-based tools are used to facilitate wide dissemination and adaptation by diverse, independent institutions. The new hydrologic learning modules are based on recent developments in hydrologic modeling, data, and resources. The modules are embedded in three regional-scale ecosystems, Coastal Louisiana, Florida Everglades, and Utah Great Salt Lake Basin. These sites provide a wealth of hydrologic concepts and scenarios that can be used in most water resource and hydrology curricula. The study develops several learning modules based on the three hydro-systems covering subjects such as: water-budget analysis, effects of human and natural changes, climate-hydrology teleconnections, and water-resource management scenarios. The new developments include an instructional interface to give critical guidance and support to the learner and an instructor's guide containing adaptation and implementation procedures to assist instructors in adopting and integrating the material into courses and provide a consistent experience. The design of the new hydrologic education developments will be transferable to independent institutions and adaptable both instructionally and technically through a server system capable of supporting additional developments by the educational community.

  3. Performance Comparison of Four SolarWorld Module Technologies at the US DOE Regional Test Center in New Mexico: November 2016 - March 2017.

    Energy Technology Data Exchange (ETDEWEB)

    Burnham, Laurie [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Lave, Matthew Samuel [Sandia National Lab. (SNL-CA), Livermore, CA (United States); Stein, Joshua [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2017-07-01

    This report provides a preliminary (three month) analysis for the SolarWorld system installed at the New Mexico Regional Test Center (RTC.) The 8.7kW, four-string system consists of four module types): bifacial, mono-crystalline, mono-crystalline glass-glass and polycrystalline. Overall, the SolarWorld system has performed well to date: most strings closely match their specification-sheet module temperature coefficients and Sandia 's f lash tests show that Pmax values are well within expectations. Although the polycrystalline modules underperformed, the results may be a function of light exposure, as well as mismatch within the string, and not a production flaw. The instantaneous bifacial gains for SolarWorld 's Bisun modules were modest but it should be noted that the RTC racking is not optimized for bifacial modules, nor is albedo optimized at the site. Additional analysis, not only of the SolarWorld installation in New Mexico but of the SolarWorld installations at the Vermont and Florida RTCs will be provide much more information regarding the comparative performance of the four module types.

  4. Hydrogen Sulphide modulating mitochondrial morphology to promote mitophagy in endothelial cells under high-glucose and high-palmitate.

    Science.gov (United States)

    Liu, Ning; Wu, Jichao; Zhang, Linxue; Gao, Zhaopeng; Sun, Yu; Yu, Miao; Zhao, Yajun; Dong, Shiyun; Lu, Fanghao; Zhang, Weihua

    2017-12-01

    Endothelial cell dysfunction is one of the main reasons for type II diabetes vascular complications. Hydrogen sulphide (H 2 S) has antioxidative effect, but its regulation on mitochondrial dynamics and mitophagy in aortic endothelial cells under hyperglycaemia and hyperlipidaemia is unclear. Rat aortic endothelial cells (RAECs) were treated with 40 mM glucose and 200 μM palmitate to imitate endothelium under hyperglycaemia and hyperlipidaemia, and 100 μM NaHS was used as an exogenous H 2 S donor. Firstly, we demonstrated that high glucose and palmitate decreased H 2 S production and CSE expression in RAECs. Then, the antioxidative effect of H 2 S was proved in RAECs under high glucose and palmitate to reduce mitochondrial ROS level. We also showed that exogenous H 2 S inhibited mitochondrial apoptosis in RAECs under high glucose and palmitate. Using Mito Tracker and transmission electron microscopy assay, we revealed that exogenous H 2 S decreased mitochondrial fragments and significantly reduced the expression of p-Drp-1/Drp-1 and Fis1 compared to high-glucose and high-palmitate group, whereas it increased mitophagy by transmission electron microscopy assay. We demonstrated that exogenous H 2 S facilitated Parkin recruited by PINK1 by immunoprecipitation and immunostaining assays and then ubiquitylated mitofusin 2 (Mfn2), which illuminated the mechanism of exogenous H 2 S on mitophagy. Parkin siRNA suppressed the expression of Mfn2, Nix and LC3B, which revealed that it eliminated mitophagy. In summary, exogenous H 2 S could protect RAECs against apoptosis under high glucose and palmitate by suppressing oxidative stress, decreasing mitochondrial fragments and promoting mitophagy. Based on these results, we proposed a new mechanism of H 2 S on protecting endothelium, which might provide a new strategy for type II diabetes vascular complication. © 2017 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for

  5. Outer membrane vesicles from Brucella abortus promote bacterial internalization by human monocytes and modulate their innate immune response.

    Directory of Open Access Journals (Sweden)

    Cora N Pollak

    Full Text Available Outer membrane vesicles (OMVs released by some gram-negative bacteria have been shown to exert immunomodulatory effects that favor the establishment of the infection. The aim of the present study was to assess the interaction of OMVs from Brucella abortus with human epithelial cells (HeLa and monocytes (THP-1, and the potential immunomodulatory effects they may exert. Using confocal microscopy and flow cytometry, FITC-labeled OMVs were shown to be internalized by both cell types. Internalization was shown to be partially mediated by clathrin-mediated endocytosis. Pretreatment of THP-1 cells with Brucella OMVs inhibited some cytokine responses (TNF-α and IL-8 to E. coli LPS, Pam3Cys or flagellin (TLR4, TLR2 and TLR5 agonists, respectively. Similarly, pretreatment with Brucella OMVs inhibited the cytokine response of THP-1 cells to B. abortus infection. Treatment of THP-1 cells with OMVs during IFN-γ stimulation reduced significantly the inducing effect of this cytokine on MHC-II expression. OMVs induced a dose-dependent increase of ICAM-1 expression on THP-1 cells and an increased adhesion of these cells to human endothelial cells. The addition of OMVs to THP-1 cultures before the incubation with live B. abortus resulted in increased numbers of adhered and internalized bacteria as compared to cells not treated with OMVs. Overall, these results suggest that OMVs from B. abortus exert cellular effects that promote the internalization of these bacteria by human monocytes, but also downregulate the innate immune response of these cells to Brucella infection. These effects may favor the persistence of Brucella within host cells.

  6. Endothelial Regulator of Calcineurin 1 Promotes Barrier Integrity and Modulates Histamine-Induced Barrier Dysfunction in Anaphylaxis

    Directory of Open Access Journals (Sweden)

    Constanza Ballesteros-Martinez

    2017-10-01

    Full Text Available Anaphylaxis, the most serious and life-threatening allergic reaction, produces the release of inflammatory mediators by mast cells and basophils. Regulator of calcineurin 1 (Rcan1 is a negative regulator of mast-cell degranulation. The action of mediators leads to vasodilation and an increase in vascular permeability, causing great loss of intravascular volume in a short time. Nevertheless, the molecular basis remains unexplored on the vascular level. We investigated Rcan1 expression induced by histamine, platelet-activating factor (PAF, and epinephrine in primary human vein (HV-/artery (HA-derived endothelial cells (ECs and human dermal microvascular ECs (HMVEC-D. Vascular permeability was analyzed in vitro in human ECs with forced Rcan1 expression using Transwell migration assays and in vivo using Rcan1 knockout mice. Histamine, but neither PAF nor epinephrine, induced Rcan1-4 mRNA and protein expression in primary HV-ECs, HA-ECs, and HMVEC-D through histamine receptor 1 (H1R. These effects were prevented by pharmacological inhibition of calcineurin with cyclosporine A. Moreover, intravenous histamine administration increased Rcan1 expression in lung tissues of mice undergoing experimental anaphylaxis. Functional in vitro assays showed that overexpression of Rcan1 promotes barrier integrity, suggesting a role played by this molecule in vascular permeability. Consistent with these findings, in vivo models of subcutaneous and intravenous histamine-mediated fluid extravasation showed increased response in skin, aorta, and lungs of Rcan1-deficient mice compared with wild-type animals. These findings reveal that endothelial Rcan1 is synthesized in response to histamine through a calcineurin-sensitive pathway and may reduce barrier breakdown, thus contributing to the strengthening of the endothelium and resistance to anaphylaxis. These new insights underscore its potential role as a regulator of sensitivity to anaphylaxis in humans.

  7. MiR529a modulates panicle architecture through regulating SQUAMOSA PROMOTER BINDING-LIKE genes in rice (Oryza sativa).

    Science.gov (United States)

    Yue, Erkui; Li, Chao; Li, Yu; Liu, Zhen; Xu, Jian-Hong

    2017-07-01

    MiR529a affects rice panicle architecture by targeting OsSPL2,OsSPL14 and OsSPL17 genes that could regulate their downstream panicle related genes. The panicle architecture determines the grain yield and quality of rice, which could be regulated by many transcriptional factors. The SQUAMOSA PROMOTER BINDING-LIKE (SPL) transcription factors are involved in the regulation of panicle development, which are targeted by miR156 and miR529. The expression profile demonstrated that miR529a is preferentially expressed in the early panicle of rice and it might regulate panicle development in rice. However, the regulation mechanism of miR529-SPL is still not clear. In this study, we predicted five miR529a putative target genes, OsSPL2, OsSPL14, OsSPL16, OsSPL17 and OsSPL18, while only the expression of OsSPL2, OsSPL14, and OsSPL17 was regulated by miR529a in the rice panicle. Overexpression of miR529a dramatically affected panicle architecture, which was regulated by OsSPL2, OsSPL14, and OsSPL17. Furthermore, the 117, 35, and 25 pathway genes associated with OsSPL2, OsSPL14 and OsSPL17, respectively, were predicted, and they shared 20 putative pathway genes. Our results revealed that miR529a could play a vital role in the regulation of panicle architecture through regulating OsSPL2, OsSPL14, OsSPL17 and the complex networks formed by their pathway and downstream genes. These findings will provide new genetic resources for reshaping ideal plant architecture and breeding high yield rice varieties.

  8. Modulation of ambient temperature promotes inflammation and initiates atherosclerosis in wild type C57BL/6 mice

    Directory of Open Access Journals (Sweden)

    Daniel A. Giles

    2016-11-01

    related to adverse cardiovascular outcome. Conclusions: In sum, our novel data in WT C57Bl/6 mice suggest that modulation of a single environmental variable, temperature, dramatically alters mouse physiology, metabolism, and inflammation, allowing for an improved mouse model of atherosclerosis. Thus, thermoneutral housing of mice shows promise in yielding a better understanding of the cellular and molecular pathways underlying the pathogenesis of diverse diseases. Keywords: Atherosclerosis, Thermoneutrality, Inflammation

  9. Sniffer patch laser uncaging response (SPLURgE): an assay of regional differences in allosteric receptor modulation and neurotransmitter clearance.

    Science.gov (United States)

    Christian, Catherine A; Huguenard, John R

    2013-10-01

    Allosteric modulators exert actions on neurotransmitter receptors by positively or negatively altering the effective response of these receptors to their respective neurotransmitter. γ-Aminobutyric acid (GABA) type A ionotropic receptors (GABAARs) are major targets for allosteric modulators such as benzodiazepines, neurosteroids, and barbiturates. Analysis of substances that produce similar effects has been hampered by the lack of techniques to assess the localization and function of such agents in brain slices. Here we describe measurement of the sniffer patch laser uncaging response (SPLURgE), which combines the sniffer patch recording configuration with laser photolysis of caged GABA. This methodology enables the detection of allosteric GABAAR modulators endogenously present in discrete areas of the brain slice and allows for the application of exogenous GABA with spatiotemporal control without altering the release and localization of endogenous modulators within the slice. Here we demonstrate the development and use of this technique for the measurement of allosteric modulation in different areas of the thalamus. Application of this technique will be useful in determining whether a lack of modulatory effect on a particular category of neurons or receptors is due to insensitivity to allosteric modulation or a lack of local release of endogenous ligand. We also demonstrate that this technique can be used to investigate GABA diffusion and uptake. This method thus provides a biosensor assay for rapid detection of endogenous GABAAR modulators and has the potential to aid studies of allosteric modulators that exert effects on other classes of neurotransmitter receptors, such as glutamate, acetylcholine, or glycine receptors.

  10. Determination of single-nucleotide polymorphism in the proximal promoter region of apolipoprotein M gene in coronary artery diseases

    Directory of Open Access Journals (Sweden)

    Lu Zheng

    2009-09-01

    Full Text Available Lu Zheng1, Guanghua Luo1, Xiaoying Zhang1, Jun Zhang1, Jiang Zhu1, Jiang Wei1, Qinfeng Mu1, Lujun Chen1, Peter Nilsson-Ehle2, Ning Xu21Comprehensive Laboratory, The Third Affiliated Hospital, Suzhou University, Changzhou China; 2Division of Clinical Chemistry and Pharmacology, Department of Laboratory Medicine, Lund University, Lund, SwedenObjective: It has been reported that single-nucleotide polymorphism (SNP in the proximal promoter region of apolipoprotein M (apoM gene may confer the risk in the development of type 2 diabetes (T2D and coronary artery disease (CAD in the Han Chinese. However, in a recent study demonstrated that plasma apoM level did not correlated to the coronary heart disease. In the present studies, we investigated the SNP T-778C of apoM gene in CAD patients and controls in the Han Chinese population. Moreover we examined whether serum apoM levels could be influenced by this promoter mutation.Material and methods: One hundred twenty-six CAD patients and 118 non-CAD patients were subjected in the present study. All patients were confirmed by the angiography. The genotyping of polymorphisms T-778C in apoM promoter was determined by real-time polymerase chain reaction. Serum apoM levels were semi-quantitatively determined by the dot-blotting analysis. Results: Distribution of apoM T-778C genotype in non-CAD patients was as following: 84.7% were T/T, 15.3% were T/C and 0.0% was C/C. T allele frequencies were 92.4% and C allele, 7.6%. In the CAD patients, 99 patients (78.6% had the T/T genotype, 25 patients (19.8% with T/C genotype and 2 patients (1.6% with C/C genotype. The allele frequency was 88.5% for the T allele and 11.5% for the C allele. There was no statistical significant difference of serum apoM levels found in these three genotypes.Conclusions: There was no significant difference in allele or genotype frequencies between CAD patients and non-CAD patients. Binary logistic regression analysis with adjustments for age

  11. A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3’ untranslated region and intronic cis-elements

    Science.gov (United States)

    Muhle, Rebecca A.; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J.; Muhle, Michael E.; Fidock, David A.

    2009-01-01

    Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitized erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilizing the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var sub-telomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronized parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may well result from the integrated UpsA promoter being largely silenced by the neighboring cg6 promoter. Our analyses also revealed that the DownsA 3’ untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyze promoter activity of Group A var genes which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of

  12. The relationship in Japanese infants between a genetic polymorphism in the promoter region of the insulin-like growth factor I gene and the plasma level.

    Science.gov (United States)

    Kinoshita, Yumiko; Kizaki, Zenro; Ishihara, Yasunori; Nakajima, Hisakazu; Adachi, Shinsuke; Kosaka, Kitaro; Kinugasa, Akihiko; Sugimoto, Tohru

    2007-01-01

    Evidence is accumulating that the promoter region of the insulin-like growth factor I (IGF-I) gene polymorphism and low levels of IGF-I are associated with type 2 diabetes, cardiovascular disease and birth weight; however, the number of wild-type alleles is different in each country. This study aimed to examine the 737/738 marker, a cytosine-adenine repeat in the promoter region of the IGF-I gene polymorphism, and plasma IGF-I levels in Japanese infants and analyze the genetic background. Data were collected for 15 months in Kyoto Prefectural University of Medicine. The body composition parameters of all infants were determined at birth. At 5 days after birth, we took blood samples to measure the product size of the promoter region of the IGF-I gene polymorphism and plasma IGF-I. In a population-based sample of 160 subjects, 6 different alleles and 16 genotypes were identified in the promoter region of the IGF-I gene polymorphism. The existence of a 196-bp allele has proved to result in a low plasma IGF-I level, a small head and chest circumference (p body composition parameters in Japanese infants. Our results suggest genetical influence on prenatal growth and serum IGF-I levels.

  13. ARCAL. Regional co-operative arrangements for the promotion of nuclear science and technology in Latin America, Phase I (1985-1990)

    International Nuclear Information System (INIS)

    Gillen, V.A.

    1990-09-01

    The Regional Co-operative Arrangement for the Promotion of Nuclear Science and Technology in Latin America, ARCAL, has completed its first five-year phase (1985-1989). This booklet summarizes the first phase of the ARCAL programme and contains descriptions of projects in the fields of agriculture, medicine, industry and energy

  14. Serotonin Transporter Promoter Region (5-HTTLPR) Polymorphism Is Not Associated With Paroxetine-Induced Ejaculation Delay in Dutch Men With Lifelong Premature Ejaculation

    NARCIS (Netherlands)

    Janssen, Paddy K. C.; Zwinderman, Aeilko H.; Olivier, Berend; Waldinger, Marcel D.

    2014-01-01

    To investigate the association between the 5-HT-transporter-gene-linked promoter region (5-HTTLPR) polymorphism and 20-mg paroxetine-induced ejaculation delay in men with lifelong premature ejaculation (LPE). This was a prospective study of 10 weeks of paroxetine treatment in 54 men with LPE.

  15. Serotonin Transporter Promoter Region (5-HTTLPR) Polymorphism Is Not Associated With Paroxetine-Induced Ejaculation Delay in Dutch Men With Lifelong Premature Ejaculation

    NARCIS (Netherlands)

    Janssen, Paddy K C; Zwinderman, Aeilko H; Olivier, Berend; Waldinger, Marcel D

    PURPOSE: To investigate the association between the 5-HT-transporter-gene-linked promoter region (5-HTTLPR) polymorphism and 20-mg paroxetine-induced ejaculation delay in men with lifelong premature ejaculation (LPE). MATERIALS AND METHODS: This was a prospective study of 10 weeks of paroxetine

  16. Insulin VNTR and IGF-1 promoter region polymorphisms are not associated with body composition in early childhood: The generation R study

    NARCIS (Netherlands)

    J.A.J.B.M. Maas (Janneke); D.O. Mook-Kanamori (Dennis); L. Ay (Lamise); R.P.M. Steegers-Theunissen (Régine); P. Tikka-Kleemola (Päivi); A. Hofman (Albert); A.C.S. Hokken-Koelega (Anita); V.W.V. Jaddoe (Vincent)

    2010-01-01

    textabstractObjective: The objective of this study was to examine the associations between insulin gene variable number of tandem repeats (INS VNTR) and insulin-like growth factor 1 (IGF1) gene promoter region polymorphisms with body composition in early childhood. Methods: This study was embedded

  17. Association of human liver bilirubin UDP-glucuronyltransferase activity with a polymorphism in the promoter region of the UGT1A1 gene

    NARCIS (Netherlands)

    Raijmakers, MTM; Jansen, PLM; Steegers, EAP; Peters, WHM

    Background/Aims: Gilbert's syndrome is a benign form of a deficiency in bilirubin glucuronidation. It is associated with a homozygous polymorphism, A(TA)(7)TAA instead of A(TA)(6)TAA, in the TATA-box of the promoter region of the bilirubin UDP-glucuronyltransferase gene. In this study the

  18. Noradrenergic stimulation modulates activation of extinction-related brain regions and enhances contextual extinction learning without affecting renewal

    Directory of Open Access Journals (Sweden)

    Silke eLissek

    2015-02-01

    Full Text Available Renewal in extinction learning describes the recovery of an extinguished response if the extinction context differs from the context present during acquisition and recall. Attention may have a role in contextual modulation of behavior and contribute to the renewal effect, while noradrenaline is involved in attentional processing. In this functional magnetic resonance imaging (fMRI study we investigated the role of the noradrenergic system for behavioral and brain activation correlates of contextual extinction and renewal, with a particular focus upon hippocampus and ventromedial PFC, which have crucial roles in processing of renewal. Healthy human volunteers received a single dose of the NA reuptake inhibitor atomoxetine prior to extinction learning. During extinction of previously acquired cue-outcome associations, cues were presented in a novel context (ABA or in the acquisition context (AAA. In recall, all cues were again presented in the acquisition context. Atomoxetine participants (ATO showed significantly faster extinction compared to placebo (PLAC. However, atomoxetine did not affect renewal. Hippocampal activation was higher in ATO during extinction and recall, as was ventromedial PFC activation, except for ABA recall. Moreover, ATO showed stronger recruitment of insula, anterior cingulate, and dorsolateral/orbitofrontal PFC. Across groups, cingulate, hippocampus and vmPFC activity during ABA extinction correlated with recall performance, suggesting high relevance of these regions for processing the renewal effect. In summary, the noradrenergic system appears to be involved in the modification of established associations during extinction learning and thus has a role in behavioral flexibility. The assignment of an association to a context and the subsequent decision on an adequate response, however, presumably operate largely independently of noradrenergic mechanisms.

  19. Modulation of phosducin-like protein 3 (PhLP3 levels promotes cytoskeletal remodelling in a MAPK and RhoA-dependent manner.

    Directory of Open Access Journals (Sweden)

    Nandini V L Hayes

    Full Text Available Phosducin-like protein 3 (PhLP3 forms a ternary complex with the ATP-dependent molecular chaperone CCT and its folding client tubulin. In vitro studies suggest PhLP3 plays an inhibitory role in β-tubulin folding while conversely in vivo genetic studies suggest PhLP3 is required for the correct folding of β-tubulin. We have a particular interest in the cytoskeleton, its chaperones and their role in determining cellular phenotypes associated with high level recombinant protein expression from mammalian cell expression systems.As studies into PhLP3 function have been largely carried out in non mammalian systems, we examined the effect of human PhLP3 over-expression and siRNA silencing using a single murine siRNA on both tubulin and actin systems in mammalian Chinese hamster ovary (CHO cell lines. We show that over-expression of PhLP3 promotes an imbalance of α and β tubulin subunits, microtubule disassembly and cell death. In contrast, β-actin levels are not obviously perturbed. On-the-other-hand, RNA silencing of PhLP3 increases RhoA-dependent actin filament formation and focal adhesion formation and promotes a dramatic elongated fibroblast-like change in morphology. This was accompanied by an increase in phosphorylated MAPK which has been associated with promoting focal adhesion assembly and maturation. Transient overexpression of PhLP3 in knockdown experiments rescues cells from the morphological change observed during PhLP3 silencing but mitosis is perturbed, probably reflecting a tipping back of the balance of PhLP3 levels towards the overexpression state.Our results support the hypothesis that PhLP3 is important for the maintenance of β-tubulin levels in mammalian cells but also that its modulation can promote actin-based cytoskeletal remodelling by a mechanism linked with MAPK phosphorylation and RhoA-dependent changes. PhLP3 levels in mammalian cells are thus finely poised and represents a novel target for engineering industrially

  20. Engineered Promoters for Potent Transient Overexpression.

    Directory of Open Access Journals (Sweden)

    Dan Y Even

    Full Text Available The core promoter, which is generally defined as the region to which RNA Polymerase II is recruited to initiate transcription, plays a pivotal role in the regulation of gene expression. The core promoter consists of different combinations of several short DNA sequences, termed core promoter elements or motifs, which confer specific functional properties to each promoter. Earlier studies that examined the ability to modulate gene expression levels via the core promoter, led to the design of strong synthetic core promoters, which combine different core elements into a single core promoter. Here, we designed a new core promoter, termed super core promoter 3 (SCP3, which combines four core promoter elements (the TATA box, Inr, MTE and DPE into a single promoter that drives prolonged and potent gene expression. We analyzed the effect of core promoter architecture on the temporal dynamics of reporter gene expression by engineering EGFP expression vectors that are driven by distinct core promoters. We used live cell imaging and flow cytometric analyses in different human cell lines to demonstrate that SCPs, particularly the novel SCP3, drive unusually strong long-term EGFP expression. Importantly, this is the first demonstration of long-term expression in transiently transfected mammalian cells, indicating that engineered core promoters can provide a novel non-viral strategy for biotechnological as well as gene-therapy-related applications that require potent expression for extended time periods.

  1. Automatic exposure control in CT: the effect of patient size, anatomical region and prescribed modulation strength on tube current and image quality.

    Science.gov (United States)

    Papadakis, Antonios E; Perisinakis, Kostas; Damilakis, John

    2014-10-01

    To study the effect of patient size, body region and modulation strength on tube current and image quality on CT examinations that use automatic tube current modulation (ATCM). Ten physical anthropomorphic phantoms that simulate an individual as neonate, 1-, 5-, 10-year-old and adult at various body habitus were employed. CT acquisition of head, neck, thorax and abdomen/pelvis was performed with ATCM activated at weak, average and strong modulation strength. The mean modulated mAs (mAsmod) values were recorded. Image noise was measured at selected anatomical sites. The mAsmod recorded for neonate compared to 10-year-old increased by 30 %, 14 %, 6 % and 53 % for head, neck, thorax and abdomen/pelvis, respectively, (P < 0.05). The mAsmod was lower than the preselected mAs with the exception of the 10-year-old phantom. In paediatric and adult phantoms, the mAsmod ranged from 44 and 53 for weak to 117 and 93 for strong modulation strength, respectively. At the same exposure parameters image noise increased with body size (P < 0.05). The ATCM system studied here may affect dose differently for different patient habitus. Dose may decrease for overweight adults but increase for children older than 5 years old. Care should be taken when implementing ATCM protocols to ensure that image quality is maintained. • ATCM efficiency is related to the size of the patient's body. • ATCM should be activated without caution in overweight adult individuals. • ATCM may increase radiation dose in children older than 5 years old. • ATCM efficiency depends on the protocol selected for a specific anatomical region. • Modulation strength may be appropriately tuned to enhance ATCM efficiency.

  2. Novel function of the chromosome 7 open reading frame 41 gene to promote leukemic megakaryocyte differentiation by modulating TPA-induced signaling.

    Science.gov (United States)

    Sun, X; Lu, B; Hu, B; Xiao, W; Li, W; Huang, Z

    2014-03-28

    12-O-tetradecanoylphorbol-13-acetate (TPA) activates multiple signaling pathways, alters gene expression and causes leukemic cell differentiation. How TPA-induced genes contribute to leukemic cell differentiation remains elusive. We noticed that chromosome 7 open reading frame 41 (C7ORF41) was a TPA-responsive gene and its upregulation concurred with human megakaryocyte differentiation. In K562 cells, ectopic expression of C7ORF41 significantly increased CD61 expression, enhanced ERK and JNK signaling, and upregulated RUNX1 and FLI1, whereas C7ORF41 knockdown caused an opposite phenotype. These observations suggest that C7ORF41 may promote megakaryocyte differentiation partially through modulating ERK and JNK signaling that leads to upregulation of RUNX1 and FLI1. In supporting this, C7ORF41 overexpression rescued megakaryocyte differentiation blocked by ERK inhibition while JNK inhibition abrogated the upregulation of FLI1 by C7ORF41. Furthermore, we found that Y34F mutant C7ORF41 inhibited megakaryocyte differentiation. nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) was the major activator of C7ORF41 that in turn repressed NF-κB activity by inhibiting its phosphorylation at serine 536, while MAPK/ERK was the potent repressor of C7ORF41. Finally, we showed that C7ORF41 knockdown in mouse fetal liver cells impaired megakaryocyte differentiation. Taken together, we have identified the function of a novel gene C7ORF41 that forms interplaying regulatory network in TPA-induced signaling and promotes leukemic and normal megakaryocyte differentiation.

  3. Novel function of the chromosome 7 open reading frame 41 gene to promote leukemic megakaryocyte differentiation by modulating TPA-induced signaling

    International Nuclear Information System (INIS)

    Sun, X; Lu, B; Hu, B; Xiao, W; Li, W; Huang, Z

    2014-01-01

    12-O-tetradecanoylphorbol-13-acetate (TPA) activates multiple signaling pathways, alters gene expression and causes leukemic cell differentiation. How TPA-induced genes contribute to leukemic cell differentiation remains elusive. We noticed that chromosome 7 open reading frame 41 (C7ORF41) was a TPA-responsive gene and its upregulation concurred with human megakaryocyte differentiation. In K562 cells, ectopic expression of C7ORF41 significantly increased CD61 expression, enhanced ERK and JNK signaling, and upregulated RUNX1 and FLI1, whereas C7ORF41 knockdown caused an opposite phenotype. These observations suggest that C7ORF41 may promote megakaryocyte differentiation partially through modulating ERK and JNK signaling that leads to upregulation of RUNX1 and FLI1. In supporting this, C7ORF41 overexpression rescued megakaryocyte differentiation blocked by ERK inhibition while JNK inhibition abrogated the upregulation of FLI1 by C7ORF41. Furthermore, we found that Y34F mutant C7ORF41 inhibited megakaryocyte differentiation. nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) was the major activator of C7ORF41 that in turn repressed NF-κB activity by inhibiting its phosphorylation at serine 536, while MAPK/ERK was the potent repressor of C7ORF41. Finally, we showed that C7ORF41 knockdown in mouse fetal liver cells impaired megakaryocyte differentiation. Taken together, we have identified the function of a novel gene C7ORF41 that forms interplaying regulatory network in TPA-induced signaling and promotes leukemic and normal megakaryocyte differentiation

  4. Automatic exposure control in CT: the effect of patient size, anatomical region and prescribed modulation strength on tube current and image quality

    International Nuclear Information System (INIS)

    Papadakis, Antonios E.; Perisinakis, Kostas; Damilakis, John

    2014-01-01

    To study the effect of patient size, body region and modulation strength on tube current and image quality on CT examinations that use automatic tube current modulation (ATCM). Ten physical anthropomorphic phantoms that simulate an individual as neonate, 1-, 5-, 10-year-old and adult at various body habitus were employed. CT acquisition of head, neck, thorax and abdomen/pelvis was performed with ATCM activated at weak, average and strong modulation strength. The mean modulated mAs (mAs mod ) values were recorded. Image noise was measured at selected anatomical sites. The mAs mod recorded for neonate compared to 10-year-old increased by 30 %, 14 %, 6 % and 53 % for head, neck, thorax and abdomen/pelvis, respectively, (P mod was lower than the preselected mAs with the exception of the 10-year-old phantom. In paediatric and adult phantoms, the mAs mod ranged from 44 and 53 for weak to 117 and 93 for strong modulation strength, respectively. At the same exposure parameters image noise increased with body size (P < 0.05). The ATCM system studied here may affect dose differently for different patient habitus. Dose may decrease for overweight adults but increase for children older than 5 years old. Care should be taken when implementing ATCM protocols to ensure that image quality is maintained. circle ATCM efficiency is related to the size of the patient's body. (orig.)

  5. Automatic exposure control in CT: the effect of patient size, anatomical region and prescribed modulation strength on tube current and image quality

    Energy Technology Data Exchange (ETDEWEB)

    Papadakis, Antonios E. [University Hospital of Heraklion, Department of Medical Physics, Stavrakia, P.O. Box 1352, Heraklion, Crete (Greece); Perisinakis, Kostas; Damilakis, John [University of Crete, Faculty of Medicine, Department of Medical Physics, P.O. Box 2208, Heraklion, Crete (Greece)

    2014-10-15

    To study the effect of patient size, body region and modulation strength on tube current and image quality on CT examinations that use automatic tube current modulation (ATCM). Ten physical anthropomorphic phantoms that simulate an individual as neonate, 1-, 5-, 10-year-old and adult at various body habitus were employed. CT acquisition of head, neck, thorax and abdomen/pelvis was performed with ATCM activated at weak, average and strong modulation strength. The mean modulated mAs (mAs{sub mod}) values were recorded. Image noise was measured at selected anatomical sites. The mAs{sub mod} recorded for neonate compared to 10-year-old increased by 30 %, 14 %, 6 % and 53 % for head, neck, thorax and abdomen/pelvis, respectively, (P < 0.05). The mAs{sub mod} was lower than the preselected mAs with the exception of the 10-year-old phantom. In paediatric and adult phantoms, the mAs{sub mod} ranged from 44 and 53 for weak to 117 and 93 for strong modulation strength, respectively. At the same exposure parameters image noise increased with body size (P < 0.05). The ATCM system studied here may affect dose differently for different patient habitus. Dose may decrease for overweight adults but increase for children older than 5 years old. Care should be taken when implementing ATCM protocols to ensure that image quality is maintained. circle ATCM efficiency is related to the size of the patient's body. (orig.)

  6. TSA-induced DNMT1 down-regulation represses hTERT expression via recruiting CTCF into demethylated core promoter region of hTERT in HCT116.

    Science.gov (United States)

    Choi, Jee-Hye; Min, Na Young; Park, Jina; Kim, Jin Hong; Park, Soo Hyun; Ko, Young Jong; Kang, Yoonsung; Moon, Young Joon; Rhee, Sangmyung; Ham, Seung Wook; Park, Ae Ja; Lee, Kwang-Ho

    2010-01-01

    Trichostatin A (TSA), an inhibitor of histone deacetylase, is a well-known antitumor agent that effectively and selectively induces tumor growth arrest and apoptosis. Recently, it was reported that hTERT is one of the primary targets for TSA-induced apoptosis in cancer cells but the mechanism of which has not yet been elucidated. In the present study, to better understand the epigenetic regulation mechanism responsible for the repression of hTERT by TSA, we examined expression of hTERT in the HCT116 colon cancer cell line after treatment with TSA and performed site-specific CpG methylation analysis of the hTERT promoter. We found that TSA-induced the demethylation of site-specific CpGs on the promoter of hTERT, which was caused by down-regulation of DNA methyltransferase 1 (DNMT1). Among the demethylated region, the 31st-33rd CpGs contained a binding site for CTCF, an inhibitor of hTERT transcription. ChIP analysis revealed that TSA-induced demethylation of the 31st-33rd CpGs promoted CTCF binding on hTERT promoter, leading to repression of hTERT. Taken together, down-regulation of DNMT1 by TSA caused demethylation of a CTCF binding site on the hTERT promoter, the result of which was repression of hTERT via recruitment of CTCF to the promoter. Copyright 2009 Elsevier Inc. All rights reserved.

  7. IkappaBalpha polymorphism at promoter region (rs2233408) influences the susceptibility of gastric cancer in Chinese.

    Science.gov (United States)

    Wang, Shiyan; Tian, Linwei; Zeng, Zhirong; Zhang, Mingdong; Wu, Kaichun; Chen, Minhu; Fan, Daiming; Hu, Pinjin; Sung, Joseph J Y; Yu, Jun

    2010-02-05

    Nuclear factor of kappa B inhibitor alpha (I kappaB alpha) protein is implicated in regulating a variety of cellular process from inflammation to tumorigenesis. The objective of this study was to investigate the susceptibility of rs2233408 T/C genotype in the promoter region of I kappaB alpha to gastric cancer and the association of this polymorphism with clinicopathologic variables in gastric cancer patients. A population-based case-control study was conducted between 1999 and 2006 in Guangdong Province, China. A total of 564 gastric cancer patients and 566 healthy controls were enrolled in this study. rs2233408 genotypes in I kappaB alpha were analyzed by TaqMan SNP genotyping assay. Both rs2233408 T homozygote (TT) and T heterozygotes (TC and TT) had significantly reduced gastric cancer risk (TT: OR = 0.250, 95% CI = 0.069-0.909, P = 0.035; TC and TT: OR = 0.721, 95% CI = 0.530-0.981, P = 0.037), compared with rs2233408 C homozygote (CC). rs2233408 T heterozygotes were significantly associated with reduced risk of intestinal-type gastric cancer with ORs of 0.648 (95% CI = 0.459-0.916, P = 0.014), but not with the diffuse or mix type of gastric cancer. The association between rs2233408 T heterozygotes and gastric cancer appeared more apparent in the older patients (age>40) (OR = 0.674, 95% CI = 0.484-0.939, P = 0.02). rs2233408 T heterozygotes was associated with non-cardiac gastric cancer (OR = 0.594, 95% CI = 0.411-0.859, P = 0.006), but not with cardiac gastric cancer. However, rs2233408 polymorphism was not associated with the prognosis of gastric cancer patients. I kappaB alpha rs2233408 T heterozygotes were associated with reduced risk of gastric cancer, especially for the development of certain subtypes of gastric cancer in Chinese population.

  8. Variability in the precore and core promoter regions of HBV strains in Morocco: characterization and impact on liver disease progression.

    Directory of Open Access Journals (Sweden)

    Bouchra Kitab

    Full Text Available BACKGROUND: Hepatitis B virus (HBV is one of the most common human pathogens that cause aggressive hepatitis and advanced liver disease (AdLD, including liver cirrhosis and Hepatocellular Carcinoma. The persistence of active HBV replication and liver damage after the loss of hepatitis B e antigen (HBeAg has been frequently associated with mutations in the pre-core (pre-C and core promoter (CP regions of HBV genome that abolish or reduce HBeAg expression. The purpose of this study was to assess the prevalence of pre-C and CP mutations and their impact on the subsequent course of liver disease in Morocco. METHODS/PRINCIPAL FINDINGS: A cohort of 186 patients with HBeAg-negative chronic HBV infection was studied (81 inactive carriers, 69 with active chronic hepatitis, 36 with AdLD. Pre-C and CP mutations were analyzed by PCR-direct sequencing method. The pre-C stop codon G1896A mutation was the most frequent (83.9% and was associated with a lower risk of AdLD development (OR, 0.4; 95% CI, 0.15-1.04; p = 0.04. HBV-DNA levels in patients with G1896A were not significantly different from the other patients carrying wild-type strains (p = 0.84. CP mutations C1653T, T1753V, A1762T/G1764A, and C1766T/T1768A were associated with higher HBV-DNA level and increased liver disease severity. Multiple logistic regression analysis showed that older age (≥ 40 years, male sex, high viral load (>4.3 log(10 IU/mL and CP mutations C1653T, T1753V, A1762T/G1764A, and C1766T/T1768A were independent risk factors for AdLD development. Combination of these mutations was significantly associated with AdLD (OR, 7.52; 95% CI, 4.8-8; p<0.0001. CONCLUSIONS: This study shows for the first time the association of HBV viral load and CP mutations with the severity of liver disease in Moroccan HBV chronic carriers. The examination of CP mutations alone or in combination could be helpful for prediction of the clinical outcome.

  9. IκBα polymorphism at promoter region (rs2233408 influences the susceptibility of gastric cancer in Chinese

    Directory of Open Access Journals (Sweden)

    Sung Joseph JY

    2010-02-01

    Full Text Available Abstract Background Nuclear factor of kappa B inhibitor alpha (IκBα protein is implicated in regulating a variety of cellular process from inflammation to tumorigenesis. The objective of this study was to investigate the susceptibility of rs2233408 T/C genotype in the promoter region of IκBα to gastric cancer and the association of this polymorphism with clinicopathologic variables in gastric cancer patients. Methods A population-based case-control study was conducted between 1999 and 2006 in Guangdong Province, China. A total of 564 gastric cancer patients and 566 healthy controls were enrolled in this study. rs2233408 genotypes in IκBα were analyzed by TaqMan SNP genotyping assay. Results Both rs2233408 T homozygote (TT and T heterozygotes (TC and TT had significantly reduced gastric cancer risk (TT: OR = 0.250, 95% CI = 0.069-0.909, P = 0.035; TC and TT: OR = 0.721, 95% CI = 0.530-0.981, P = 0.037, compared with rs2233408 C homozygote (CC. rs2233408 T heterozygotes were significantly associated with reduced risk of intestinal-type gastric cancer with ORs of 0.648 (95% CI = 0.459-0.916, P = 0.014, but not with the diffuse or mix type of gastric cancer. The association between rs2233408 T heterozygotes and gastric cancer appeared more apparent in the older patients (age>40 (OR = 0.674, 95% CI = 0.484-0.939, P = 0.02. rs2233408 T heterozygotes was associated with non-cardiac gastric cancer (OR = 0.594, 95% CI = 0.411-0.859, P = 0.006, but not with cardiac gastric cancer. However, rs2233408 polymorphism was not associated with the prognosis of gastric cancer patients. Conclusions IκBα rs2233408 T heterozygotes were associated with reduced risk of gastric cancer, especially for the development of certain subtypes of gastric cancer in Chinese population.

  10. Dosimetric complication probability and acoustic analysis of vocal cord region in oropharyngeal carcinoma treated with voice-sparing intensity modulated radiotherapy

    International Nuclear Information System (INIS)

    Jain, S.; Gupta, T.; Agarwal, J.P.; Baccher, G.; Shrivastava, S.K.; Reenadevi; Master, J.

    2008-01-01

    Radiation to larynx has long been associated with speech and voice dysfunction. The objective is to study dosimetric parameters and complication probability of vocal cord region (VCR) and the effect of voice-sparing (VS) in the patients treated with intensity modulated radiotherapy (IMRT). The secondary objective is to describe the post-radiation acoustic voice characteristics and correlate them with the dosimetric parameters. (author)

  11. miRNA let-7b modulates macrophage polarization and enhances tumor-associated macrophages to promote angiogenesis and mobility in prostate cancer.

    Science.gov (United States)

    Wang, Zhigang; Xu, Lu; Hu, Yinying; Huang, Yanqin; Zhang, Yujuan; Zheng, Xiufen; Wang, Shanshan; Wang, Yifan; Yu, Yanrong; Zhang, Meng; Yuan, Keng; Min, Weiping

    2016-05-09

    Macrophage polarization is a highly plastic physiological process that responds to a variety of environmental factors by changing macrophage phenotype and function. Tumor-associated macrophages (TAMs) are generally recognized as promoting tumor progression. As universal regulators, microRNAs (miRNAs) are functionally involved in numerous critical cellular processes including macrophage polarization. Let-7b, a miRNA, has differential expression patterns in inflamed tissues compared with healthy controls. However, whether and how miRNA let-7b regulates macrophage phenotype and function is unclear. In this report, we find that up-regulation of let-7b is characteristic of prostatic TAMs, and down-regulation of let-7b in TAMs leads to changes in expression profiles of inflammatory cytokines, such as IL-12, IL-23, IL-10 and TNF-α. As a result, TAMs treated with let-7b inhibitors reduce angiogenesis and prostate carcinoma (PCa) cell mobility. Let-7b may play a vital role in regulating macrophage polarization, thus modulating the prognosis of prostate cancer.

  12. Monoclonal Antibodies Directed toward the Hepatitis C Virus Glycoprotein E2 Detect Antigenic Differences Modulated by the N-Terminal Hypervariable Region 1 (HVR1), HVR2, and Intergenotypic Variable Region.

    Science.gov (United States)

    Alhammad, Yousef; Gu, Jun; Boo, Irene; Harrison, David; McCaffrey, Kathleen; Vietheer, Patricia T; Edwards, Stirling; Quinn, Charles; Coulibaly, Fásseli; Poumbourios, Pantelis; Drummer, Heidi E

    2015-12-01

    Hepatitis C virus (HCV) envelope glycoproteins E1 and E2 form a heterodimer and mediate receptor interactions and viral fusion. Both E1 and E2 are targets of the neutralizing antibody (NAb) response and are candidates for the production of vaccines that generate humoral immunity. Previous studies demonstrated that N-terminal hypervariable region 1 (HVR1) can modulate the neutralization potential of monoclonal antibodies (MAbs), but no information is available on the influence of HVR2 or the intergenotypic variable region (igVR) on antigenicity. In this study, we examined how the variable regions influence the antigenicity of the receptor binding domain of E2 spanning HCV polyprotein residues 384 to 661 (E2661) using a panel of MAbs raised against E2661 and E2661 lacking HVR1, HVR2, and the igVR (Δ123) and well-characterized MAbs isolated from infected humans. We show for a subset of both neutralizing and nonneutralizing MAbs that all three variable regions decrease the ability of MAbs to bind E2661 and reduce the ability of MAbs to inhibit E2-CD81 interactions. In addition, we describe a new MAb directed toward the region spanning residues 411 to 428 of E2 (MAb24) that demonstrates broad neutralization against all 7 genotypes of HCV. The ability of MAb24 to inhibit E2-CD81 interactions is strongly influenced by the three variable regions. Our data suggest that HVR1, HVR2, and the igVR modulate exposure of epitopes on the core domain of E2 and their ability to prevent E2-CD81 interactions. These studies suggest that the function of HVR2 and the igVR is to modulate antibody recognition of glycoprotein E2 and may contribute to immune evasion. This study reveals conformational and antigenic differences between the Δ123 and intact E2661 glycoproteins and provides new structural and functional data about the three variable regions and their role in occluding neutralizing and nonneutralizing epitopes on the E2 core domain. The variable regions may therefore function to

  13. The first year experience of occupational therapy students at an Australian regional university: Promoting student retention and developing a regional and remote workforce.

    Science.gov (United States)

    Boehm, Jackie; Cordier, Reinie; Thomas, Yvonne; Tanner, Bronwyn; Salata, Karen

    2017-02-01

    Student retention at regional universities is important in addressing regional and remote workforce shortages. Students attending regional universities are more likely to work in regional areas. First year experience at university plays a key role in student retention. This study aimed to explore factors influencing the first year experience of occupational therapy students at a regional Australian university. Surveys were administered to 58 second year occupational therapy students in the first week of second year. Data were analysed using descriptive statistics, inferential statistics (Pearson χ 2 ; Spearman rho) and summarising descriptive responses. An Australian regional university. Second year undergraduate occupational therapy students. Factors influencing students' decisions to study and continue studying occupational therapy; factors enhancing first year experience of university. Fifty-four students completed the survey (93.1%). A quarter (25.9%) of students considered leaving the course during the first year. The primary influence for continuing was the teaching and learning experience. Most valued supports were orientation week (36.7%) and the first year coordinator (36.7%). The importance of the first year experience in retaining occupational therapy students is highlighted. Engagement with other students and staff and academic support are important factors in facilitating student retention. It is important to understand the unique factors influencing students' decisions, particularly those from regional and remote areas, to enter and continue in tertiary education to assist in implementing supports and strategies to improve student retention. © 2015 National Rural Health Alliance Inc.

  14. Regional differences in awareness of tobacco advertising and promotion in China: findings from the ITC China Survey.

    Science.gov (United States)

    Yang, Yan; Li, Lin; Yong, Hua-Hie; Borland, Ron; Wu, Xi; Li, Qiang; Wu, Changbao; Foong, Kin

    2010-04-01

    To examine whether levels of, and factors related to, awareness of tobacco advertising and promotion differ across six cities in China. Data from wave 1 of the International Tobacco Control (ITC) China Survey (April to August 2006) were analysed. The ITC China Survey employed a multistage sampling design in Beijing, Shenyang, Shanghai, Changsha, Guangzhou and Yinchuan. Face-to-face interviews were conducted with a total of 4763 smokers and 1259 non-smokers. Multivariate logistic regression models were used to identify factors associated with awareness of tobacco advertising and promotion. The overall levels of noticing advertisements varied considerably by city. Cities reporting lower levels of advertising tended to report higher levels of point of sale activity. Noticing tobacco industry promotions was associated with more positive attitudes to tobacco companies. The awareness of tobacco advertising and promotional activities was not homogeneous across the six Chinese cities, suggesting variations in the tobacco industry's activities and the diversity of implementing a central set of laws to restrict tobacco promotion. This study clearly demonstrates the need to work with the implementation agencies if national laws are to be properly enforced.

  15. Identification of the promoter region required for human adiponectin gene transcription: Association with CCAAT/enhancer binding protein-β and tumor necrosis factor-α

    International Nuclear Information System (INIS)

    Kita, Atsushi; Yamasaki, Hironori; Kuwahara, Hironaga; Moriuchi, Akie; Fukushima, Keiko; Kobayashi, Masakazu; Fukushima, Tetsuya; Takahashi, Ryoko; Abiru, Norio; Uotani, Shigeo; Kawasaki, Eiji; Eguchi, Katsumi

    2005-01-01

    Adiponectin, an adipose tissue-specific plasma protein, is involved in insulin sensitizing and has anti-atherosclerotic properties. Plasma levels of adiponectin are decreased in obese individuals and patients with type 2 diabetes with insulin resistance. Tumor necrosis factor-α (TNF-α) decreases the expression of adiponectin in adipocytes. The aims of the present study were: (1) to identify the promoter region responsible for basal transcription of the human adiponectin gene, and (2) to investigate the mechanism by which adiponectin was regulated by TNF-α. The human adiponectin promoter (2.1 kb) was isolated and used for luciferase reporter analysis by transient transfection into 3T3-L1 adipocytes. Deletion analysis demonstrated that the promoter region from -676 to +41 was sufficient for basal transcriptional activity. Mutation analysis of putative response elements for sterol regulatory element binding protein (SREBP) (-431 to -423) and CCAAT/enhancer binding protein (C/EBP) (-230 to -224) showed that both elements were required for basal promoter activity. Adiponectin transcription was increased 3-fold in cells that over-expressed constitutively active C/EBP-β. Electrophoretic mobility shift assay, using nuclear extract from 3T3-L1 cells and the -258 to -199 region as a probe, demonstrated specific DNA-protein binding, which was abolished by TNF-α treatment. The present data indicate that the putative response elements for SREBP and C/EBP are required for human adiponectin promoter activity, and that suppression by TNF-α may, at least in part, be associated with inactivation of C/EBP-β

  16. Promoter-region hypermethylation and expression downregulation of Yy1 (Yin yang 1) in preneoplastic liver lesions in a thioacetamide rat hepatocarcinogenesis model

    International Nuclear Information System (INIS)

    Abe, Hajime; Ogawa, Takashi; Wang, Liyun; Kimura, Masayuki; Tanaka, Takeshi; Morita, Reiko; Yoshida, Toshinori; Shibutani, Makoto

    2014-01-01

    Thioacetamide (TAA) has been used to develop a rodent model for hepatocarcinogenesis. To determine the genes with epigenetic modifications in early hepatocarcinogenesis, we did a genome-wide scan for hypermethylated promoter regions using CpG island microarrays in TAA-promoted rat liver tissue. Eight genes were selected based on the microarray profile; of these, Yy1 and Wdr45b were confirmed to be hypermethylated by methylation-specific polymerase chain reaction (PCR) and pyrosequencing and downregulated by real-time reverse transcription PCR. Non-neoplastic liver cells had nuclear Yy1 immunoreactivity, while preneoplastic foci with glutathione S-transferase placental form (GST-P) immunoreactivity had decreased Yy1 immunoreactivity. The incidence of these foci was proportional to the dose of TAA administered. Co-expression analysis of gene products downstream of Yy1 revealed increased nuclear phospho-c-Myc + foci as well as nuclear and cytoplasmic p21 Cip1+ foci in Yy1 − or GST-P + foci in response to TAA-promotion dose. Although the absolute number of cells was low, the incidence of death receptor 5 − foci was increased in Yy1 − foci in proportion to the TAA dose. Yy1 − /GST-P + foci revealed a higher number of proliferating cell nuclear antigen (PCNA)-immunoreactive cells than Yy1 + /GST-P + foci, while cleaved caspase-3 + cells were unchanged between Yy1 – /GST-P + and Yy1 + /GST-P + foci. In the case of Wdr45b, most GST-P + foci were Wdr45b – and were not increased by TAA promotion. These results suggest involvement of Yy1 in the epigenetic gene regulation at the early stages of TAA promoted cell proliferation and concomitant cell cycle arrest in preneoplastic lesions. - Highlights: • Epigenetically downregulated genes were searched in TAA-promnoted rat livers. • Yy1 and Wdr45b showed promoter-region hypermethylation and mRNA downregulation. • TAA promoted increase of preneoplastic Yy1 – /GST-P + foci showing high proliferation. • TAA

  17. A shared promoter region suggests a common ancestor for the human VCX/Y, SPANX, and CSAG gene families and the murine CYPT family

    DEFF Research Database (Denmark)

    Hansen, Martin A; Nielsen, John E; Retelska, Dorota

    2008-01-01

    , sequences corresponding to the shared promoter region of the CYPT family were identified at 39 loci. Most loci were located immediately upstream of genes belonging to the VCX/Y, SPANX, or CSAG gene families. Sequence comparison of the loci revealed a conserved CYPT promoter-like (CPL) element featuring TATA...... cell types. The genomic regions harboring the gene families were rich in direct and inverted segmental duplications (SD), which may facilitate gene conversion and rapid evolution. The conserved CPL and the common expression profiles suggest that the human VCX/Y, SPANX, and CSAG2 gene families together......Many testis-specific genes from the sex chromosomes are subject to rapid evolution, which can make it difficult to identify murine genes in the human genome. The murine CYPT gene family includes 15 members, but orthologs were undetectable in the human genome. However, using refined homology search...

  18. PTSD and DNA Methylation in Select Immune Function Gene Promoter Regions: A Repeated Measures Case-control Study of U.S. Military Service Members

    Science.gov (United States)

    2013-06-24

    other relevant exposures which may influ- ence DNA methylation , such as dietary factors ( folate , vitamin B12 intake) (Fenech, 2001; Piyathilake and...ARTICLE published: 24 June 2013 doi: 10.3389/fpsyt.2013.00056 PTSD and DNA methylation in select immune function gene promoter regions: a repeated measures...largely unknown. Dis- tinct expression signatures for PTSD have been found, in particular for immune activation transcripts. DNA methylation may be

  19. Regional economic impacts of the unconventional promotion of natural gas (Hydraulic Fracturing). Preliminary study; Regionaloekonomische Auswirkungen der unkonventionellen Erdgasfoerderung (Hydraulic Fracturing). Vorstudie

    Energy Technology Data Exchange (ETDEWEB)

    Bizer, Kilian; Bossmeyer, Christoph

    2012-07-01

    Actually, there is a controversial public discussion on the exploitation of conventional natural gas by means of hydraulic fracturing (Fracking). The contribution under consideration examines the geologic, toxicological or technical as well as legal points of contact with respect to the different effects for the actor groups. Based on the existing scientific realizations, the regional economic effects of the fracking technology and the subsequent promotion of unconventional natural gas deposits have to be worked out.

  20. Genetic basis of olfactory cognition: extremely high level of DNA sequence polymorphism in promoter regions of the human olfactory receptor genes revealed using the 1000 Genomes Project dataset.

    Science.gov (United States)

    Ignatieva, Elena V; Levitsky, Victor G; Yudin, Nikolay S; Moshkin, Mikhail P; Kolchanov, Nikolay A

    2014-01-01

    The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors), which are activated by olfactory stimuli (ligands). Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter [a region of DNA about 100-1000 base pairs long located upstream of the transcription start site (TSS)]. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.). In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli.

  1. Genetic basis of olfactory cognition: extremely high level of DNA sequence polymorphism in promoter regions of the human olfactory receptor genes revealed using the 1000 Genomes Project dataset

    Directory of Open Access Journals (Sweden)

    Elena V. Ignatieva

    2014-03-01

    Full Text Available The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors, which are activated by olfactory stimuli (ligands. Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter (a region of DNA about 100–1000 base pairs long located upstream of the transcription start site. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.. In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli.

  2. Identification, occurrence, and validation of DRE and ABRE Cis-regulatory motifs in the promoter regions of genes of Arabidopsis thaliana.

    Science.gov (United States)

    Mishra, Sonal; Shukla, Aparna; Upadhyay, Swati; Sanchita; Sharma, Pooja; Singh, Seema; Phukan, Ujjal J; Meena, Abha; Khan, Feroz; Tripathi, Vineeta; Shukla, Rakesh Kumar; Shrama, Ashok

    2014-04-01

    Plants posses a complex co-regulatory network which helps them to elicit a response under diverse adverse conditions. We used an in silico approach to identify the genes with both DRE and ABRE motifs in their promoter regions in Arabidopsis thaliana. Our results showed that Arabidopsis contains a set of 2,052 genes with ABRE and DRE motifs in their promoter regions. Approximately 72% or more of the total predicted 2,052 genes had a gap distance of less than 400 bp between DRE and ABRE motifs. For positional orientation of the DRE and ABRE motifs, we found that the DR form (one in direct and the other one in reverse orientation) was more prevalent than other forms. These predicted 2,052 genes include 155 transcription factors. Using microarray data from The Arabidopsis Information Resource (TAIR) database, we present 44 transcription factors out of 155 which are upregulated by more than twofold in response to osmotic stress and ABA treatment. Fifty-one transcripts from the one predicted above were validated using semiquantitative expression analysis to support the microarray data in TAIR. Taken together, we report a set of genes containing both DRE and ABRE motifs in their promoter regions in A. thaliana, which can be useful to understand the role of ABA under osmotic stress condition. © 2013 Institute of Botany, Chinese Academy of Sciences.

  3. DNA cytosine methylation in the bovine leukemia virus promoter is associated with latency in a lymphoma-derived B-cell line: potential involvement of direct inhibition of cAMP-responsive element (CRE)-binding protein/CRE modulator/activation transcription factor binding.

    Science.gov (United States)

    Pierard, Valérie; Guiguen, Allan; Colin, Laurence; Wijmeersch, Gaëlle; Vanhulle, Caroline; Van Driessche, Benoît; Dekoninck, Ann; Blazkova, Jana; Cardona, Christelle; Merimi, Makram; Vierendeel, Valérie; Calomme, Claire; Nguyên, Thi Liên-Anh; Nuttinck, Michèle; Twizere, Jean-Claude; Kettmann, Richard; Portetelle, Daniel; Burny, Arsène; Hirsch, Ivan; Rohr, Olivier; Van Lint, Carine

    2010-06-18

    Bovine leukemia virus (BLV) proviral latency represents a viral strategy to escape the host immune system and allow tumor development. Besides the previously demonstrated role of histone deacetylation in the epigenetic repression of BLV expression, we showed here that BLV promoter activity was induced by several DNA methylation inhibitors (such as 5-aza-2'-deoxycytidine) and that overexpressed DNMT1 and DNMT3A, but not DNMT3B, down-regulated BLV promoter activity. Importantly, cytosine hypermethylation in the 5'-long terminal repeat (LTR) U3 and R regions was associated with true latency in the lymphoma-derived B-cell line L267 but not with defective latency in YR2 cells. Moreover, the virus-encoded transactivator Tax(BLV) decreased DNA methyltransferase expression levels, which could explain the lower level of cytosine methylation observed in the L267(LTaxSN) 5'-LTR compared with the L267 5'-LTR. Interestingly, DNA methylation inhibitors and Tax(BLV) synergistically activated BLV promoter transcriptional activity in a cAMP-responsive element (CRE)-dependent manner. Mechanistically, methylation at the -154 or -129 CpG position (relative to the transcription start site) impaired in vitro binding of CRE-binding protein (CREB) transcription factors to their respective CRE sites. Methylation at -129 CpG alone was sufficient to decrease BLV promoter-driven reporter gene expression by 2-fold. We demonstrated in vivo the recruitment of CREB/CRE modulator (CREM) and to a lesser extent activating transcription factor-1 (ATF-1) to the hypomethylated CRE region of the YR2 5'-LTR, whereas we detected no CREB/CREM/ATF recruitment to the hypermethylated corresponding region in the L267 cells. Altogether, these findings suggest that site-specific DNA methylation of the BLV promoter represses viral transcription by directly inhibiting transcription factor binding, thereby contributing to true proviral latency.

  4. Numerical study of the generation and propagation of ultralow-frequency waves by artificial ionospheric F region modulation at different latitudes

    Directory of Open Access Journals (Sweden)

    X. Xu

    2016-09-01

    Full Text Available Powerful high-frequency (HF radio waves can be used to efficiently modify the upper-ionospheric plasmas of the F region. The pressure gradient induced by modulated electron heating at ultralow-frequency (ULF drives a local oscillating diamagnetic ring current source perpendicular to the ambient magnetic field, which can act as an antenna radiating ULF waves. In this paper, utilizing the HF heating model and the model of ULF wave generation and propagation, we investigate the effects of both the background ionospheric profiles at different latitudes in the daytime and nighttime ionosphere and the modulation frequency on the process of the HF modulated heating and the subsequent generation and propagation of artificial ULF waves. Firstly, based on a relation among the radiation efficiency of the ring current source, the size of the spatial distribution of the modulated electron temperature and the wavelength of ULF waves, we discuss the possibility of the effects of the background ionospheric parameters and the modulation frequency. Then the numerical simulations with both models are performed to demonstrate the prediction. Six different background parameters are used in the simulation, and they are from the International Reference Ionosphere (IRI-2012 model and the neutral atmosphere model (NRLMSISE-00, including the High Frequency Active Auroral Research Program (HAARP; 62.39° N, 145.15° W, Wuhan (30.52° N, 114.32° E and Jicamarca (11.95° S, 76.87° W at 02:00 and 14:00 LT. A modulation frequency sweep is also used in the simulation. Finally, by analyzing the numerical results, we come to the following conclusions: in the nighttime ionosphere, the size of the spatial distribution of the modulated electron temperature and the ground magnitude of the magnetic field of ULF wave are larger, while the propagation loss due to Joule heating is smaller compared to the daytime ionosphere; the amplitude of the electron temperature

  5. Isolation and analysis of a multifunctional triterpene synthase KcMS promoter region from mangrove plant kandelia candel

    Science.gov (United States)

    Basyuni, M.; Wati, R.; Sulistiyono, N.; Sumardi; Oku, H.; Baba, S.; Sagami, H.

    2018-03-01

    Molecular cloning of Kandelia candel KcMS gene has previously been cloned and encoded a multifunctional triterpene synthase. In this study, the KcMS gene promoter was cloned through Genome walking, sequenced, and analyzed. A 1,358 bp genomic DNA fragment of KcMS promoter was obtained. PLACE and PlantCARE analysis of the KcMS promoter revealed that there was some regulatory elements in response to environmental signals and involved in the regulation of gene expression. Results showed that four kinds of elements are regulated by hormone binding, namely 2 MeJA-responsiveness elements (CGTCA-motif and TGACG-motif), the ABRE (TACGTG) involved in abscisic acid responsiveness, gibberellin-related GARE-motif (AAACAGA), and the TGA-element (AACGAC) as an auxin-responsive element. Several elements in the KcMS have been shown in other plants to be responsive to abiotic stress. These motifs were MBS (CAACTG), TC-rich repeats, and eight light responsive elements. The KcMS promoter was also involved in the activation of defense genes in plants such as HSE (AAAAAATTC) and four circadian control elements (CAANNNNATC). The presence of multipotential regulatory motifs suggested that KcMS may be involved in regulation of plant tolerance to several types of stresses.

  6. Promoting sustainable potato agriculture in the Andean region by supplemental calcium nutrition and breeding for frost tolerance

    Science.gov (United States)

    Collaborative research in Peru sought to promote sustainable potato production and, mitigate adverse impacts of climate change through two approaches: first calcium amendments to increase crop yield and, second to enhance frost tolerance in native potatoes. All the multi-year, multi-location experim...

  7. Regulatory elements in the promoter region of the rat gene encoding the acyl-CoA-binding protein

    DEFF Research Database (Denmark)

    Elholm, M; Bjerking, G; Knudsen, J

    1996-01-01

    for the ACBP DR-1 element. Addition of peroxisome proliferators (PP) to H4IIEC3 rat hepatoma cells led to an increase in the ACBP mRNA level, indicating that the DR-1 element could be a functional peroxisome proliferator responsive element (PPRE). Analysis of the ACBP promoter by transient transfection showed...

  8. A new variation in the promoter region, the -604 C>T, and the Leu72Met polymorphism of the ghrelin gene are associated with protection to insulin resistance.

    Science.gov (United States)

    Zavarella, S; Petrone, A; Zampetti, S; Gueorguiev, M; Spoletini, M; Mein, C A; Leto, G; Korbonits, M; Buzzetti, R

    2008-04-01

    Previous studies suggested that polymorphisms in the coding region of the preproghrelin were involved in the etiology of obesity and might modulate glucose-induced insulin secretion. We evaluated the association of a new variation, -604C>T, in the promoter region of the ghrelin gene, of Leu72Met (247C>A) and of Gln90Leu (265A>T), all haplotype-tagging single nucleotide polymorphisms (SNPs), with measures of insulin sensitivity in 1420 adult individuals. The three SNPs were genotyped using ABI PRISM 7900 HT Sequence Detection System. We used multiple linear regression analysis for quantitative traits and THESIAS software for haplotype analysis. We observed a protective effect exerted by Met72 variant of Leu72Met SNP on insulin resistance parameters; a significant decreasing trend from Leu/Leu to Leu/Met and to Met/Met homozygous subjects in triglycerides, fasting insulin levels and HOMA-IR index (P=0.02, 0.01 and 0.003, respectively), and, consistently, an increase in ghrelin levels (P=0.003) was found. A significant decrease from CC to TC and to TT genotypes in insulin levels and HOMA-IR index was also detected (P=0.00l for both), but only in subjects homozygous for Leu72, where the protective effect of Met72 was not present. The haplotype analysis results supported the data obtained by the evaluation of each single SNP, showing the highest value of insulin levels and HOMA-IR index in the -604(c)247(c) haplotype intermediate value in -604(T)247(C) and lowest value in -604(C)247(A). Our observations suggest a protective role of the Met72 variant and of -604 T allele in modulating insulin resistance. These SNPs or an unknown functional variant in linkage disequilibrium could increase ghrelin levels and probably insulin sensitivity.

  9. DNA methylation of specific CpG sites in the promoter region regulates the transcription of the mouse oxytocin receptor.

    Directory of Open Access Journals (Sweden)

    Shimrat Mamrut

    Full Text Available Oxytocin is a peptide hormone, well known for its role in labor and suckling, and most recently for its involvement in mammalian social behavior. All central and peripheral actions of oxytocin are mediated through the oxytocin receptor, which is the product of a single gene. Transcription of the oxytocin receptor is subject to regulation by gonadal steroid hormones, and is profoundly elevated in the uterus and mammary glands during parturition. DNA methylation is a major epigenetic mechanism that regulates gene transcription, and has been linked to reduced expression of the oxytocin receptor in individuals with autism. Here, we hypothesized that transcription of the mouse oxytocin receptor is regulated by DNA methylation of specific sites in its promoter, in a tissue-specific manner. Hypothalamus-derived GT1-7, and mammary-derived 4T1 murine cell lines displayed negative correlations between oxytocin receptor transcription and methylation of the gene promoter, and demethylation caused a significant enhancement of oxytocin receptor transcription in 4T1 cells. Using a reporter gene assay, we showed that methylation of specific sites in the gene promoter, including an estrogen response element, significantly inhibits transcription. Furthermore, methylation of the oxytocin receptor promoter was found to be differentially correlated with oxytocin receptor expression in mammary glands and the uterus of virgin and post-partum mice, suggesting that it plays a distinct role in oxytocin receptor transcription among tissues and under different physiological conditions. Together, these results support the hypothesis that the expression of the mouse oxytocin receptor gene is epigenetically regulated by DNA methylation of its promoter.

  10. Genome-wide Anaplasma phagocytophilum AnkA-DNA interactions are enriched in intergenic regions and gene promoters and correlate with infection-induced differential gene expression.

    Directory of Open Access Journals (Sweden)

    J Stephen Dumler

    2016-09-01

    Full Text Available Anaplasma phagocytophilum, an obligate intracellular prokaryote, infects neutrophils and alters cardinal functions via reprogrammed transcription. Large contiguous regions of neutrophil chromosomes are differentially expressed during infection. Secreted A. phagocytophilum effector AnkA transits into the neutrophil or granulocyte nucleus to complex with DNA in heterochromatin across all chromosomes. AnkA binds to gene promoters to dampen cis-transcription and also has features of matrix attachment region (MAR-binding proteins that regulate three-dimensional chromatin architecture and coordinate transcriptional programs encoded in topologically-associated chromatin domains. We hypothesize that identification of additional AnkA binding sites will better delineate how A. phagocytophilum infection results in reprogramming of the neutrophil genome. Using AnkA-binding ChIP-seq, we showed that AnkA binds broadly throughout all chromosomes in a reproducible pattern, especially at: i intergenic regions predicted to be matrix attachment regions (MARs; ii within predicted lamina-associated domains; and iii at promoters ≤3,000 bp upstream of transcriptional start sites. These findings provide genome-wide support for AnkA as a regulator of cis-gene transcription. Moreover, the dominant mark of AnkA in distal intergenic regions known to be AT-enriched, coupled with frequent enrichment in the nuclear lamina, provides strong support for its role as a MAR-binding protein and genome re-organizer. AnkA must be considered a prime candidate to promote neutrophil reprogramming and subsequent functional changes that belie improved microbial fitness and pathogenicity.

  11. Long Noncoding RNA Taurine-Upregulated Gene 1 Promotes Cell Proliferation and Invasion in Gastric Cancer via Negatively Modulating miRNA-145-5p.

    Science.gov (United States)

    Ren, Kewei; Li, Zhen; Li, Yahua; Zhang, Wenzhe; Han, Xinwei

    2017-05-24

    Long noncoding RNA (lncRNA) taurine-upregulated gene 1 (TUG1) is involved in the development and carcinogenesis of various tumors, suggesting the diagnostic potential of TUG1 in these cancers. However, the exact role of TUG1 and its underlying mechanism in gastric cancer (GC) remain unknown. In this study, the expression of TUG1 and miR-145-5p in GC cell lines and nonmalignant gastric epithelial cell lines was detected by qRT-PCR. BGC-823 and SGC-7901 cells were transfected with si-TUG1, pcDNA 3.1-TUG1, miR-145-5p mimics, or matched controls. The biological function of TUG1 and miR-145-5p in GC cell proliferation and invasion in vitro and tumor growth in vivo was investigated by MTT assay, Transwell invasion assay, and tumor xenograft experiments. The regulating relationship between TUG1 and miR-145-5 was confirmed by luciferase reporter assay. The results showed that TUG1 was significantly overexpressed and miR-145-5p was dramatically downregulated in GC cell lines. TUG1 knockdown strikingly inhibited cell proliferation and invasion in vitro and markedly suppressed tumor growth in vivo. Furthermore, TUG1 could directly bind to miR-145-5p and repress miR-145-5p expression. TUG1 overexpression significantly relieved the inhibition on GC cell proliferation and invasion in vitro and tumor growth in vivo, mediated by miR-145-5p overexpression. In conclusion, TUG1 promotes cell proliferation and invasion in GC via negatively modulating miRNA-145-5p, which undoubtedly contributes to understanding the mechanism of GC occurrence and development.

  12. The expression of VE-cadherin in breast cancer cells modulates cell dynamics as a function of tumor differentiation and promotes tumor-endothelial cell interactions.

    Science.gov (United States)

    Rezaei, Maryam; Cao, Jiahui; Friedrich, Katrin; Kemper, Björn; Brendel, Oliver; Grosser, Marianne; Adrian, Manuela; Baretton, Gustavo; Breier, Georg; Schnittler, Hans-Joachim

    2018-01-01

    The cadherin switch has profound consequences on cancer invasion and metastasis. The endothelial-specific vascular endothelial cadherin (VE-cadherin) has been demonstrated in diverse cancer types including breast cancer and is supposed to modulate tumor progression and metastasis, but underlying mechanisms need to be better understood. First, we evaluated VE-cadherin expression by tissue microarray in 392 cases of breast cancer tumors and found a diverse expression and distribution of VE-cadherin. Experimental expression of fluorescence-tagged VE-cadherin (VE-EGFP) in undifferentiated, fibroblastoid and E-cadherin-negative MDA-231 (MDA-VE-EGFP) as well as in differentiated E-cadherin-positive MCF-7 human breast cancer cell lines (MCF-VE-EGFP), respectively, displayed differentiation-dependent functional differences. VE-EGFP expression reversed the fibroblastoid MDA-231 cells to an epithelial-like phenotype accompanied by increased β-catenin expression, actin and vimentin remodeling, increased cell spreading and barrier function and a reduced migration ability due to formation of VE-cadherin-mediated cell junctions. The effects were largely absent in both MDA-VE-EGFP and in control MCF-EGFP cell lines. However, MCF-7 cells displayed a VE-cadherin-independent planar cell polarity and directed cell migration that both developed in MDA-231 only after VE-EGFP expression. Furthermore, VE-cadherin expression had no effect on tumor cell proliferation in monocultures while co-culturing with endothelial cells enhanced tumor cell proliferation due to integration of the tumor cells into monolayer where they form VE-cadherin-mediated cell contacts with the endothelium. We propose an interactive VE-cadherin-based crosstalk that might activate proliferation-promoting signals. Together, our study shows a VE-cadherin-mediated cell dynamics and an endothelial-dependent proliferation in a differentiation-dependent manner.

  13. Building an Entrepreneurial University in Brazil: The Role and Potential of University-Industry Linkages in Promoting Regional Economic Development

    Science.gov (United States)

    Amaral, Marcelo; Ferreira, Andre; Teodoro, Pitias

    2011-01-01

    This study is part of a broader research project, conducted by the Triple Helix Research Group--Brazil, focusing on university-industry-government linkages in the state of Rio de Janeiro. The case study reported here is that of the Regional University of Volta Redonda: the aim was to develop an understanding of how a regional university can be…

  14. Promoting biogas production and using it as transport fuel in the Helsinki region; Suunnitelma liikennebiokaasun tuotannon ja kaeytoen edistaemiseksi Helsingin seudulla

    Energy Technology Data Exchange (ETDEWEB)

    Rasi, S.; Havukainen, J.; Uusitalo, V.; Andersson, R.; Manninen, K.; Aro-Heinilae, E.; Rintala, J.

    2012-11-01

    The main objective of the project was to promote biogas production and its use as transport fuel. The aims in the four Finnish and two Estonian case areas were to reduce the amount and improve the sustainable use of waste and sludge, to promote biogas production, to start biogas use as transport fuel and to provide tools for implementing the aims. The total biomethane potential in the Helsinki region corresponds to approximately 450 GWh/a. The most potential user for biomethane is public transport. The total amount of biomethane would suffice for 80% of the busses operating in the Helsinki region. Using biogas as a transport fuel instead of energy production in the Helsinki region would result in emission reductions (13 000 t{sub CO2,eq}/a). However if the fuel replacing biogas in energy production would be renewable, the emission reductions would be significantly greater. The economical assessment indicates that the production of biogas is economically feasible if all the produced gas can be sold. Biogas produced near the natural gas grid can also be transported to the Helsinki region where there are better possibilities to find uses for it. In this way, for example, gas that is produced in Kymenlaakso but is not consumed there can be transported via the natural gas grid, assuming that the production plant is reasonably close to the grid. (orig.)

  15. Health-care users, key community informants and primary health care workers' views on health, health promotion, health assets and deficits: qualitative study in seven Spanish regions.

    Science.gov (United States)

    Pons-Vigués, Mariona; Berenguera, Anna; Coma-Auli, Núria; Pombo-Ramos, Haizea; March, Sebastià; Asensio-Martínez, Angela; Moreno-Peral, Patricia; Mora-Simón, Sara; Martínez-Andrés, Maria; Pujol-Ribera, Enriqueta

    2017-06-13

    Although some articles have analysed the definitions of health and health promotion from the perspective of health-care users and health care professionals, no published studies include the simultaneous participation of health-care users, primary health care professionals and key community informants. Understanding the perception of health and health promotion amongst these different stakeholders is crucial for the design and implementation of successful, equitable and sustainable measures that improve the health and wellbeing of populations. Furthermore, the identification of different health assets and deficits by the different informants will generate new evidence to promote healthy behaviours, improve community health and wellbeing and reduce preventable inequalities. The objective of this study is to explore the concept of health and health promotion and to compare health assets and deficits as identified by health-care users, key community informants and primary health care workers with the ultimate purpose to collect the necessary data for the design and implementation of a successful health promotion intervention. A descriptive-interpretive qualitative research was conducted with 276 participants from 14 primary care centres of 7 Spanish regions. Theoretical sampling was used for selection. We organized 11 discussion groups and 2 triangular groups with health-care users; 30 semi-structured interviews with key community informants; and 14 discussion groups with primary health care workers. A thematic content analysis was carried out. Health-care users and key community informants agree that health is a complex, broad, multifactorial concept that encompasses several interrelated dimensions (physical, psychological-emotional, social, occupational, intellectual, spiritual and environmental). The three participants' profiles consider health promotion indispensable despite defining it as complex and vague. In fact, most health-care users admit to having

  16. Attitudes, Beliefs and Predictors of Male Circumcision Promotion among Medical University Students in a Traditionally Non-Circumcising Region

    Directory of Open Access Journals (Sweden)

    Maria Ganczak

    2017-09-01

    Full Text Available Objective: To evaluate the beliefs of medical university students regarding male circumcision (MC, as well as attitudes and the predictors of its promotion in the case of adults at risk of HIV. Methods: A cross-sectional survey was conducted between 2013–2016 at the Medical University in Szczecin, Poland, among final year Polish/foreign students from Northern Europe, using a standardized questionnaire. Results: There were 539 participants, median age 25 years, 40.8% males, and 66.8% were Polish nationals. The MC rate was 16.7%. Regarding HIV/AIDS knowledge, 66.6% of the students scored more than 75%; and, 34.2% knew that MC reduces the risk of HIV infection. One in eleven respondents (9.1% believed that circumcised men felt more intense sexual pleasure. More than half of the respondents (54.8% declared that they would recommend MC to adult patients at risk for HIV. The belief that circumcised men felt more intense sexual pleasure, and knowledge on MC regarding HIV risk reduction was associated with greater odds of recommending adult MC (OR = 3.35 and OR = 2.13, respectively. Conclusions: Poor knowledge of its benefits and a low willingness to promote the procedure—strongly dependent on personal beliefs—suggest that medical students may need additional training to help them to discuss MC more openly with adult men at risk for HIV infection. Knowledge may be an effective tool when making decisions regarding MC promotion.

  17. Allelic variation of the inducible costimulator (ICOS) gene: detection of polymorphisms, analysis of the promoter region, and extended haplotype estimation

    DEFF Research Database (Denmark)

    Andersen, A.D.H.; Lange, Marianne; Lillevang, S.T.

    2003-01-01

    The human chromosome region 2q33 including the three costimulatory molecules CD28, CTLA-4 and ICOS, has been subject to much attention due to its linkage to a number of autoimmune diseases. The search for the causal relationship of this linkage has revealed several polymorphisms, but no variations...... in the amino acid sequences except for one polymorphism in, the leader sequence of CTLA-4. In the present study, we examined the ICOS gene of an unrelated group of healthy donors from the Danish population. We were able to report 16 intronic SNP, one intronic G-insert and two repeat regions in intron 4......, consistent with the [T](n) and the [GT](n) regions reported in a Japanese study. Putative haplotypes for the established SNP and repeat polymorphisms have been estimated by computational analysis. Sequencing of similar to3500 by of the upstream region of ICOS revealed an additional eight SNP of which two...

  18. 3. Promotion of environment protection of sea and near-sea region. Swinoujscie 12-14 October 1994

    International Nuclear Information System (INIS)

    1994-01-01

    The great number of problems connected with environment protection near shore marine zone, beach protection, effluent transport in ground and surface waters in region of North Port of Poland as well as technical solutions of water purification and legal problems have been discussed during the conference. All observations and experimental works have been carried out in that region. Among reported works two of them have been devoted to application of nuclear methods in interesting merit

  19. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  20. Promoter trans-activation of protooncogenes c-fos and c-myc, but not c-Ha-ras, by products of adenovirus early region 1A

    International Nuclear Information System (INIS)

    Sassone-Corsi, P.; Borrelli, E.

    1987-01-01

    The E1A (early region 1A) oncogene products of adenovirus type 2 trans-activate the other early viral transcription units, as well as some cellular promoters. Using a short-term cotransfection assay in murine NIH 3T3 fibroblasts, we show that c-fos and c-myc promoter activities are stimulated by the E1A proteins, whereas c-Ha-ras transcription is not affected. The product of E1A 13S mRNA is responsible for the trans-activation, whereas the 12S mRNA product has no effect. Analysis of the c-fos promoter sequences required for the E1A stimulation shows that responsive sequences are located between positions -402 and -240 upstream of the transcription initiation site. This same region also contains the c-fos serum-responsive element. Furthermore, transcription of the endogenous c-fos gene in HeLa cells is increased after E1A transfection

  1. Regional left ventricular myocardial contraction abnormalities and asynchrony in patients with hypertrophic cardiomyopathy evaluated by magnetic resonance spatial modulation of magnetization myocardial tagging

    International Nuclear Information System (INIS)

    Mishiro, Yuichiro; Oki, Takashi; Iuchi, Arata

    1999-01-01

    Global left ventricular (LV) pump function is generally preserved in patients with hypertrophic cardiomyopathy (HCM). However, it is unknown whether regional myocardial contractility is impaired, especially in nonhypertrophied regions. The purpose of this study was to evaluate regional LV myocardial contraction in patients with HCM using magnetic resonance (MR) spatial modulation of magnetization (SPAMM) myocardial tagging. The study group comprised 20 patients with asymmetric septal hypertrophy (HCM group) and 16 age-matched normal patients (control group), and data were collected using transthoracic M-mode and 2-dimensional echocardiography, and MR SPAMM myocardial tagging. The systolic strain ratio, maximum systolic strain velocity, and time from end-diastole to maximum systolic strain (ΔT) in the anterior, ventricular septal, inferior and lateral regions for 2 LV short-axis sections at the levels of the chordae tendineae and papillary muscles were measured at 50-ms intervals by MR myocardial tagging. The end-diastolic anterior and ventricular septal wall thicknesses and LV mass index were significantly different between the HCM and control groups. The systolic strain ratio for all 4 walls, particularly the anterior and ventricular septal regions, was significantly lower in the HCM group. In the HCM group, the maximum systolic strain velocity was significantly lower and ΔT was significantly shorter for all 4 walls, particularly the anterior and ventricular septal regions. The standard deviation for the ΔT, calculated from the ΔT for the 8 regions of the 2 LV short-axis sections, was significantly greater in the HCM group. In conclusion, regional LV myocardial contraction is impaired in both hypertrophied and nonhypertrophied regions, and systolic LV wall asynchrony occurs in patients with HCM. (author)

  2. A Peptide Derived from the HIV-1 gp120 Coreceptor-Binding Region Promotes Formation of PAP248-286 Amyloid Fibrils to Enhance HIV-1 Infection.

    Directory of Open Access Journals (Sweden)

    Jinquan Chen

    Full Text Available Semen is a major vehicle for HIV transmission. Prostatic acid phosphatase (PAP fragments, such as PAP248-286, in human semen can form amyloid fibrils to enhance HIV infection. Other endogenous or exogenous factors present during sexual intercourse have also been reported to promote the formation of seminal amyloid fibrils.Here, we demonstrated that a synthetic 15-residue peptide derived from the HIV-1 gp120 coreceptor-binding region, designated enhancing peptide 2 (EP2, can rapidly self-assemble into nanofibers. These EP2-derivated nanofibers promptly accelerated the formation of semen amyloid fibrils by PAP248-286, as shown by Thioflavin T (ThT and Congo red assays. The amyloid fibrils presented similar morphology, assessed via transmission electron microscopy (TEM, in the presence or absence of EP2. Circular dichroism (CD spectroscopy revealed that EP2 accelerates PAP248-286 amyloid fibril formation by promoting the structural transition of PAP248-286 from a random coil into a cross-β-sheet. Newly formed semen amyloid fibrils effectively enhanced HIV-1 infection in TZM-bl cells and U87 cells by promoting the binding of HIV-1 virions to target cells.Nanofibers composed of EP2 promote the formation of PAP248-286 amyloid fibrils and enhance HIV-1 infection.

  3. Insulators form gene loops by interacting with promoters in Drosophila.

    Science.gov (United States)

    Erokhin, Maksim; Davydova, Anna; Kyrchanova, Olga; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya

    2011-09-01

    Chromatin insulators are regulatory elements involved in the modulation of enhancer-promoter communication. The 1A2 and Wari insulators are located immediately downstream of the Drosophila yellow and white genes, respectively. Using an assay based on the yeast GAL4 activator, we have found that both insulators are able to interact with their target promoters in transgenic lines, forming gene loops. The existence of an insulator-promoter loop is confirmed by the fact that insulator proteins could be detected on the promoter only in the presence of an insulator in the transgene. The upstream promoter regions, which are required for long-distance stimulation by enhancers, are not essential for promoter-insulator interactions. Both insulators support basal activity of the yellow and white promoters in eyes. Thus, the ability of insulators to interact with promoters might play an important role in the regulation of basal gene transcription.

  4. Specific interactions between transcription factors and the promoter-regulatory region of the human cytomegalovirus major immediate-early gene

    International Nuclear Information System (INIS)

    Ghazal, P.; Lubon, H.; Hennighausen, L.

    1988-01-01

    Repeat sequence motifs as well as unique sequences between nucleotides -150 and -22 of the human cytomegalovirus immediate-early 1 gene interact in vitro with nuclear proteins. The authors show that a transcriptional element between nucleotides -91 and -65 stimulated promoter activity in vivo and in vitro by binding specific cellular transcription factors. Finally, a common sequence motif, (T)TGG/AC, present in 15 of the determined binding sites suggests a particular class of nuclear factors associated with the immediate-early 1 gene

  5. What would 5-HT do? Regional diversity of 5-HT1 receptor modulation of primary afferent neurotransmission

    OpenAIRE

    Connor, Mark

    2012-01-01

    5-HT (serotonin) is a significant modulator of sensory input to the CNS, but the only analgesics that selectively target G-protein-coupled 5-HT receptors are highly specific for treatment of headache. Two recent papers in BJP shed light on this puzzling situation by showing that primary afferent neurotransmission to the superficial layers of the spinal and trigeminal dorsal is inhibited by different subtypes of the 5-HT1 receptor – 5-HT1B(and 1D) in the trigeminal dorsal horn and 5-HT1A in th...

  6. [Drug registries: post-marketing evaluation of the benefit-risk profile and promotion of appropriateness. The regional point of view].

    Science.gov (United States)

    Martelli, Luisa; Venegoni, Mauro

    2013-06-01

    Italian Regions and the Italian regulatory agency share a common interest in promoting the appropriateness of drug use, containing drug expenditure and acquiring additional evidence on the effectiveness and safety of drugs. Drug registries can help attaining these objectives. Specifically, the registries implemented in Italy were able to cover the first two objectives, whereas some critical issues were raised on the third one. For instance, the data recorded in the registries are not available at regional level to conduct safety and effectiveness investigations. This is a paradox, when considering that drugs included in the registries have a risk-benefit profile that is only partially defined at the moment of marketing. Currently, researchers and regions can conduct epidemiological research (cohort and case control studies), on the basis of record-linkage procedures, on all drugs prescribed in general practice (which are older drugs with a better defined risk-benefit profile). The expected outcomes of registries should be more clearly defined: when the main aim is to promote appropriateness, the recording of only a very limited amount of data should be required (to avoid a bureaucratic burden on clinicians).The Italian centers of the ENCePP network might play an important role in planning and conducting drug registries: through the presence in the steering committees of the registries, and in conducting epidemiological studies that make the most of this powerful instrument.

  7. CRA-1 uncovers a double-strand break-dependent pathway promoting the assembly of central region proteins on chromosome axes during C. elegans meiosis.

    Science.gov (United States)

    Smolikov, Sarit; Schild-Prüfert, Kristina; Colaiácovo, Mónica P

    2008-06-06

    The synaptonemal complex (SC), a tripartite proteinaceous structure that forms between homologous chromosomes during meiosis, is crucial for faithful chromosome segregation. Here we identify CRA-1, a novel and conserved protein that is required for the assembly of the central region of the SC during C. elegans meiosis. In the absence of CRA-1, central region components fail to extensively localize onto chromosomes at early prophase and instead mostly surround the chromatin at this stage. Later in prophase, central region proteins polymerize along chromosome axes, but for the most part fail to connect the axes of paired homologous chromosomes. This defect results in an inability to stabilize homologous pairing interactions, altered double-strand break (DSB) repair progression, and a lack of chiasmata. Surprisingly, DSB formation and repair are required to promote the polymerization of the central region components along meiotic chromosome axes in cra-1 mutants. In the absence of both CRA-1 and any one of the C. elegans homologs of SPO11, MRE11, RAD51, or MSH5, the polymerization observed along chromosome axes is perturbed, resulting in the formation of aggregates of the SC central region proteins. While radiation-induced DSBs rescue this polymerization in cra-1; spo-11 mutants, they fail to do so in cra-1; mre-11, cra-1; rad-51, and cra-1; msh-5 mutants. Taken together, our studies place CRA-1 as a key component in promoting the assembly of a tripartite SC structure. Moreover, they reveal a scenario in which DSB formation and repair can drive the polymerization of SC components along chromosome axes in C. elegans.

  8. Sequence analysis of the Epstein-Barr virus (EBV) latent membrane protein-1 gene and promoter region

    DEFF Research Database (Denmark)

    Sandvej, Kristian; Gratama, J W; Munch, M

    1997-01-01

    Sequence variations in the Epstein-Barr virus (EBV) encoded latent membrane protein-1 (LMP-1) gene have been described in a Chinese nasopharyngeal carcinoma-derived isolate (CAO), and in viral isolates from various EBV-associated tumors. It has been suggested that these genetic changes, which...... include loss of a Xho I restriction site (position 169425) and a C-terminal 30-base pair (bp) deletion (position 168287-168256), define EBV genotypes associated with increased tumorigenicity or with disease among particular geographic populations. To determine the frequency of LMP-1 variations in European...... wild-type virus isolates, we sequenced the LMP-1 promoter and gene in EBV from lymphoblastoid cell lines from healthy carriers and patients without EBV-associated disease. Sequence changes were often present, and defined at least four main groups of viral isolates, which we designate Groups A through D...

  9. Temporal transcription of the lactococcal temperate phage TP901-1 and DNA sequence of the early promoter region

    DEFF Research Database (Denmark)

    Madsen, Hans Peter Lynge; Hammer, Karin

    1998-01-01

    to a phage repressor, a single-stranded DNA-binding protein, a topoisomerase, a Cro-like protein and two other phage proteins of unknown function were detected. The gene arrangement in the early transcribed region of TP901-1 thus consists of two transcriptional units: one from PR containing four genes......, of which at least two (the integrase gene and putative repressor) are needed for lysogeny, and the divergent and longer transcriptional unit from PL, presumably encoding functions required for the lytic life cycle. ORFs with homology to proteins involved in DNA replication were identified on the latter......Transcriptional analysis by Northern blotting identified clusters of early, middle and late transcribed regions of the temperate lactococcal bacteriophage TP901-1 during one-step growth experiments. The latent period was found to be 65 min and the burst size 40 +/- 10. The eight early transcripts...

  10. Cortical-limbic regions modulate depression and anxiety factors in functional dyspepsia. A PET-CT study

    International Nuclear Information System (INIS)

    Liu Mailan; Liang Fanrong; Zeng Fang; Tang Yong; Lan Lei; Song Wenzhong

    2012-01-01

    The objective of this study was to observe some specific brain areas or cerebral functional network participating in the modulation of depression and anxiety factors in functional dyspepsia (FD) patients by detecting cerebral glucose metabolism (CGM) in fluorine-18 fluorodeoxyglucose ( 18 F-FDG) positron emission tomography-computed tomography (PET-CT) scans. Eight FD patients with depression and anxiety (DA-FD group) and eight FD patients without depression and anxiety (non-DA-FD group) were recruited and evaluated by the Nepean Dyspepsia Index (NDI) and Dyspepsia Symptom Scores (DSS). Cerebral 18 F-FDG PET-CT scans were performed on the DA-FD group and non-DA-FD group, respectively. The differences in CGM between the two groups were analyzed with Statistical Parametric Mapping 2.0 (SPM2). Extensive changes in the CGM signals were observed in the cerebral cortex and limbic system of FD patients with depression and anxiety. Compared to non-DA-FD patients, DA-FD patients showed a higher glucose metabolism in the right postcentral gyrus (BA 1 and 5), inferior frontal gyrus (BA 45), superior temporal gyrus (BA 22), middle temporal gyrus (BA 22), inferior parietal lobule (BA 40), lingual gyrus (BA 18) and the left middle occipital gyrus (BA 37), as well as the limbic system including the left thalamus, lateral globus pallidus, parahippocampal gyrus (BA 35), right insular cortex (BA 13) and parahippocampal gyrus (BA 18); a lower glucose metabolism was presented in the left middle cingulated gyrus (BA 24), the right superior frontal gyrus (BA 6), the medial frontal gyrus (BA 6) and middle temporal gyrus (BA 21). An extensive cortical-limbic brain network might modulate the procession of FD patients with depression and anxiety factors. (author)

  11. Effect of price and in-store promotion on sales: a study of distinct regions in an emerging market

    OpenAIRE

    Sanchez, Juan Machado

    2016-01-01

    Increasing competition caused by globalization, high growth of some emerging markets and stagnation of developed economies motivate Consumer Packaged Goods (CPGs) manufacturers to drive their attention to emerging markets. These companies are expected to adapt their marketing activities to the particularities of these markets in order to succeed. In a country classified as emerging market, regions are not alike and some contrasts can be identified. In addition, divergences of marketing variab...

  12. Immediate-early gene region of human cytomegalovirus trans-activates the promoter of human immunodeficiency virus

    International Nuclear Information System (INIS)

    Davis, M.G.; Kenney, S.C.; Kamine, J.; Pagano, J.S.; Huang, E.S.

    1987-01-01

    Almost all homosexual patients with acquired immunodeficiency syndrome are also actively infected with human cytomegalovirus (HCMV). The authors have hypothesized that an interaction between HCMV and human immunodeficiency virus (HIV), the agent that causes acquired immunodeficiency syndrome, may exist at a molecular level and contribute to the manifestations of HIV infection. In this report, they demonstrate that the immediate-early gene region of HCMV, in particular immediate-early region 2, trans-activates the expression of the bacterial gene chloramphenicol acetyltransferase that is fused to the HIV long terminal repeat and carried by plasmid pHIV-CAT. The HCMV immediate-early trans-activator increases the level of mRNA from the plamid pHIV-CAT. The sequences of HIV that are responsive to trans-activation by the HDMV immediate-early region are distinct from HIV sequences that are required for response to the HIV tat. The stimulation of HIV gene expression by HDMV gene functions could enhance the consequences of HIV infection in persons with previous or concurrent HCMV infection

  13. Electroabsorption optical modulator

    Energy Technology Data Exchange (ETDEWEB)

    Skogen, Erik J.

    2017-11-21

    An electroabsorption modulator incorporates waveguiding regions along the length of the modulator that include quantum wells where at least two of the regions have quantum wells with different bandgaps. In one embodiment of the invention, the regions are arranged such that the quantum wells have bandgaps with decreasing bandgap energy along the length of the modulator from the modulator's input to its output. The bandgap energy of the quantum wells may be decreased in discrete steps or continuously. Advantageously, such an arrangement better distributes the optical absorption as well as the carrier density along the length of the modulator. Further advantageously, the modulator may handle increased optical power as compared with prior art modulators of similar dimensions, which allows for improved link gain when the optical modulator is used in an analog optical communication link.

  14. Synthetic promoter libraries for Corynebacterium glutamicum

    DEFF Research Database (Denmark)

    Rytter, Jakob Vang; Helmark, Søren; Chen, Jun

    2014-01-01

    The ability to modulate gene expression is an important genetic tool in systems biology and biotechnology. Here, we demonstrate that a previously published easy and fast PCR-based method for modulating gene expression in lactic acid bacteria is also applicable to Corynebacterium glutamicum. We co...... promoter library (SPL) technology is convenient for modulating gene expression in C. glutamicum and should have many future applications, within basic research as well as for optimizing industrial production organisms....... constructed constitutive promoter libraries based on various combinations of a previously reported C. glutamicum -10 consensus sequence (gngnTA(c/t)aaTgg) and the Escherichia coli -35 consensus, either with or without an AT-rich region upstream. A promoter library based on consensus sequences frequently found...... in low-GC Gram-positive microorganisms was also included. The strongest promoters were found in the library with a -35 region and a C. glutamicum -10 consensus, and this library also represents the largest activity span. Using the alternative -10 consensus TATAAT, which can be found in many other...

  15. N-terminal segments modulate the α-helical propensities of the intrinsically disordered basic regions of bZIP proteins.

    Science.gov (United States)

    Das, Rahul K; Crick, Scott L; Pappu, Rohit V

    2012-02-17

    Basic region leucine zippers (bZIPs) are modular transcription factors that play key roles in eukaryotic gene regulation. The basic regions of bZIPs (bZIP-bRs) are necessary and sufficient for DNA binding and specificity. Bioinformatic predictions and spectroscopic studies suggest that unbound monomeric bZIP-bRs are uniformly disordered as isolated domains. Here, we test this assumption through a comparative characterization of conformational ensembles for 15 different bZIP-bRs using a combination of atomistic simulations and circular dichroism measurements. We find that bZIP-bRs have quantifiable preferences for α-helical conformations in their unbound monomeric forms. This helicity varies from one bZIP-bR to another despite a significant sequence similarity of the DNA binding motifs (DBMs). Our analysis reveals that intramolecular interactions between DBMs and eight-residue segments directly N-terminal to DBMs are the primary modulators of bZIP-bR helicities. We test the accuracy of this inference by designing chimeras of bZIP-bRs to have either increased or decreased overall helicities. Our results yield quantitative insights regarding the relationship between sequence and the degree of intrinsic disorder within bZIP-bRs, and might have general implications for other intrinsically disordered proteins. Understanding how natural sequence variations lead to modulation of disorder is likely to be important for understanding the evolution of specificity in molecular recognition through intrinsically disordered regions (IDRs). Copyright © 2011 Elsevier Ltd. All rights reserved.

  16. ESR1 gene promoter region methylation in free circulating DNA and its correlation with estrogen receptor protein expression in tumor tissue in breast cancer patients

    International Nuclear Information System (INIS)

    Martínez-Galán, Joaquina; Ríos, Sandra; Delgado, Juan Ramón; Torres-Torres, Blanca; Núñez, María Isabel; López-Peñalver, Jesús; Del Moral, Rosario; Ruiz De Almodóvar, José Mariano; Menjón, Salomón; Concha, Ángel; Chamorro, Clara

    2014-01-01

    Tumor expression of estrogen receptor (ER) is an important marker of prognosis, and is predictive of response to endocrine therapy in breast cancer. Several studies have observed that epigenetic events, such methylation of cytosines and deacetylation of histones, are involved in the complex mechanisms that regulate promoter transcription. However, the exact interplay of these factors in transcription activity is not well understood. In this study, we explored the relationship between ER expression status in tumor tissue samples and the methylation of the 5′ CpG promoter region of the estrogen receptor gene (ESR1) isolated from free circulating DNA (fcDNA) in plasma samples from breast cancer patients. Patients (n = 110) with non-metastatic breast cancer had analyses performed of ER expression (luminal phenotype in tumor tissue, by immunohistochemistry method), and the ESR1-DNA methylation status (fcDNA in plasma, by quantitative methylation specific PCR technique). Our results showed a significant association between presence of methylated ESR1 in patients with breast cancer and ER negative status in the tumor tissue (p = 0.0179). There was a trend towards a higher probability of ESR1-methylation in those phenotypes with poor prognosis i.e. 80% of triple negative patients, 60% of HER2 patients, compared to 28% and 5.9% of patients with better prognosis such as luminal A and luminal B, respectively. Silencing, by methylation, of the promoter region of the ESR1 affects the expression of the estrogen receptor protein in tumors of breast cancer patients; high methylation of ESR1-DNA is associated with estrogen receptor negative status which, in turn, may be implicated in the patient’s resistance to hormonal treatment in breast cancer. As such, epigenetic markers in plasma may be of interest as new targets for anticancer therapy, especially with respect to endocrine treatment

  17. Workshop to promote the ratification of the protocol on heavy metals across the entire UN ECE region

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2009-12-15

    Within the workshop of the German Federal Environment Agency (Dessau-Rosslau, Federal Republic of Germany) at 14th to 16th May, 2008 in Yerevan (Armenia), the following lectures were held: (1) The convention and its protocols - framework and requirements (Tea Aulavuo); (2) Development of the heavy metals protocol up to now (D. Jost); (3) Experiences in transposing the obligations of the HM protocol into national law (Ivan Angelov); (4) Evaluation of concentrations of air pollutants and depositions of HM over the EECCA region (Ilia Ilyin); (5) The effectiveness of the HM protocol - emission reductions and costs (TNO-study) (M. van het Bolscher); (6) Technologies and techniques and their emission reduction potential and costs (Andre Peeters Weem); (7) Synergies of reduction of HM and particulate matter (Katja Kraus); (8) Critical loads / critical levels and effects of HM - integrated assessment (Jean-Paul Hettelingh); (9) Additional technical measures / options and their reduction potential (M. van het Bolscher); (10) Overview of the situation in the EECCA region - evaluation of a questionnaire of the Secretariat of the LRTAP Convention and ideas on revising the protocol and its annexes (Johan Sliggers); (11) Future aims of the TF (Katja Kraus).

  18. Growth modulation effects of CBM2a under the control of AtEXP4 and CaMV35S promoters in Arabidopsis thaliana, Nicotiana tabacum and Eucalyptus camaldulensis.

    Science.gov (United States)

    Keadtidumrongkul, Pornthep; Suttangkakul, Anongpat; Pinmanee, Phitsanu; Pattana, Kanokwan; Kittiwongwattana, Chokchai; Apisitwanich, Somsak; Vuttipongchaikij, Supachai

    2017-08-01

    The expression of cell-wall-targeted Carbohydrate Binding Modules (CBMs) can alter cell wall properties and modulate growth and development in plants such as tobacco and potato. CBM2a identified in xylanase 10A from Cellulomonas fimi is of particular interest for its ability to bind crystalline cellulose. However, its potential for promoting plant growth has not been explored. In this work, we tested the ability of CBM2a to promote growth when expressed using both CaMV35S and a vascular tissue-specific promoter derived from Arabidopsis expansin4 (AtEXP4) in three plant species: Arabidopsis, Nicotiana tabacum and Eucalyptus camaldulensis. In Arabidopsis, the expression of AtEXP4pro:CBM2a showed trends for growth promoting effects including the increase of root and hypocotyl lengths and the enlargements of the vascular xylem area, fiber cells and vessel cells. However, in N. tabacum, the expression of CBM2a under the control of either CaMV35S or AtEXP4 promoter resulted in subtle changes in the plant growth, and the thickness of secondary xylem and vessel and fiber cell sizes were generally reduced in the transgenic lines with AtEXP4pro:CBM2a. In Eucalyptus, while transgenics expressing CaMV35S:CBM2a showed very subtle changes compared to wild type, those transgenics with AtEXP4pro:CBM2a showed increases in plant height, enlargement of xylem areas and xylem fiber and vessel cells. These data provide comparative effects of expressing CBM2a protein in different plant species, and this finding can be applied for plant biomass improvement.

  19. Effects of changes in Italian bioenergy promotion schemes for agricultural biogas projects: Insights from a regional optimization model

    International Nuclear Information System (INIS)

    Chinese, D.; Patrizio, P.; Nardin, G.

    2014-01-01

    Italy has witnessed an extraordinary growth in biogas generation from livestock effluents and agricultural activities in the last few years as well as a severe isomorphic process, leading to a market dominance of 999 kW power plants owned by “entrepreneurial farms”. Under the pressure of the economic crisis in the country, the Italian government has restructured renewable energy support schemes, introducing a new program in 2013. In this paper, the effects of the previous and current support schemes on the optimal plant size, feedstock mix and profitability were investigated by introducing a spatially explicit biogas supply chain optimization model, which accounts for different incentive structures. By applying the model to a regional case study, homogenization observed to date is recognized as a result of former incentive structures. Considerable reductions in local economic potentials for agricultural biogas power plants without external heat use, are estimated. New plants are likely to be manure-based and due to the lower energy density of such feedstock, wider supply chains are expected although optimal plant size will be smaller. The new support scheme will therefore most likely eliminate past distortions but also slow down investments in agricultural biogas plants. - Highlights: • We review the evolution of agricultural biogas support schemes in Italy over last 20 years. • A biogas supply chain optimization model which accounts for feed-in-tariffs is introduced. • The model is applied to a regional case study under the two most recent support schemes. • Incentives in force until 2013 caused homogenization towards maize based 999 kW el plants. • Wider, manure based supply chains feeding smaller plants are expected with future incentives

  20. Control of growth promotion (CGP) and screening for malnutrition in central region and Lomé-Commune, January to June 2013 Togo

    International Nuclear Information System (INIS)

    Touglo, Adavi Lonlon; Bouraima, Mouawiyatou; Agbozouhoue, A. Eya; Bebou, Midassirou; Tchapo, Dapou; Akolly, Koffi

    2014-01-01

    Full text: Background: Control of Growth Promotion (CGP) is an activity that can detect early if the child has a developmental problem and investigate the cause and take appropriate decisions to overcome the consequences. In Togo, the goal in 2013 is to weigh at least 80 % of children 0-5 years during the sessions of CGP. What are the levels achieved this goal after the first semester and the problems of malnutrition detected? Method: We conducted a descriptive cross-sectional study data collected in the quarterly reports in two regions of Togo, Lomé - Commune in the South and Central Region in the North. The study involved data from the first semester of 2013 in all districts of the two regions. Database monitoring activities at national level CGP was used. Data from the two regions were separated and analyzed using Excel. Comparison tests of proportions were made using Epi Info 7. Results: Detection rate of nutritional status by the CGP in the first half of 2013 was 29% of the total target of 155,423 children under 5 years in the two regions. This rate was higher for the Central region (33 %) than for Lomé-Commune (26 %). No district has reached half of the goals. Their rates vary from 17.9 % and 18 % respectively for District No. 2 and District No. 4 of Lomé-Commune to 39.7% for the District of Tchaoudjo. The malnutrition rate was 8.8 %. This rate is higher in the Central region (10.9 %) than in Lomé-Commune (6.8 %) with a RR = 1.59, 95% CI = [1.50 to 1.69]. Severe malnutrition was 1.4 %. It is predominant in Lomé-commune (1.7 %) than in the Central region (1.1%) with a RR = 1.55, 95% CI = [1.32 to 1.82]. Conclusion: All districts in the two regions are below the target detection rate in the first half. The CGP has detected cases of moderate and severe malnutrition. To compare that rates with the survey data, the screening tools must be standard and adequate. (author)

  1. C-terminal region of MAP7 domain containing protein 3 (MAP7D3 promotes microtubule polymerization by binding at the C-terminal tail of tubulin.

    Directory of Open Access Journals (Sweden)

    Saroj Yadav

    Full Text Available MAP7 domain containing protein 3 (MAP7D3, a newly identified microtubule associated protein, has been shown to promote microtubule assembly and stability. Its microtubule binding region has been reported to consist of two coiled coil motifs located at the N-terminus. It possesses a MAP7 domain near the C-terminus and belongs to the microtubule associated protein 7 (MAP7 family. The MAP7 domain of MAP7 protein has been shown to bind to kinesin-1; however, the role of MAP7 domain in MAP7D3 remains unknown. Based on the bioinformatics analysis of MAP7D3, we hypothesized that the MAP7 domain of MAP7D3 may have microtubule binding activity. Indeed, we found that MAP7 domain of MAP7D3 bound to microtubules as well as enhanced the assembly of microtubules in vitro. Interestingly, a longer fragment MDCT that contained the MAP7 domain (MD with the C-terminal tail (CT of the protein promoted microtubule polymerization to a greater extent than MD and CT individually. MDCT stabilized microtubules against dilution induced disassembly. MDCT bound to reconstituted microtubules with an apparent dissociation constant of 3.0 ± 0.5 µM. An immunostaining experiment showed that MDCT localized along the length of the preassembled microtubules. Competition experiments with tau indicated that MDCT shares its binding site on microtubules with tau. Further, we present evidence indicating that MDCT binds to the C-terminal tail of tubulin. In addition, MDCT could bind to tubulin in HeLa cell extract. Here, we report a microtubule binding region in the C-terminal region of MAP7D3 that may have a role in regulating microtubule assembly dynamics.

  2. Modulating immunogenic properties of HIV-1 gp41 membrane-proximal external region by destabilizing six-helix bundle structure

    Energy Technology Data Exchange (ETDEWEB)

    Banerjee, Saikat; Shi, Heliang; Habte, Habtom H.; Qin, Yali; Cho, Michael W., E-mail: mcho@iastate.edu

    2016-03-15

    The C-terminal alpha-helix of gp41 membrane-proximal external region (MPER; {sup 671}NWFDITNWLWYIK{sup 683}) encompassing 4E10/10E8 epitopes is an attractive target for HIV-1 vaccine development. We previously reported that gp41-HR1-54Q, a trimeric protein comprised of the MPER in the context of a stable six-helix bundle (6HB), induced strong immune responses against the helix, but antibodies were directed primarily against the non-neutralizing face of the helix. To better target 4E10/10E8 epitopes, we generated four putative fusion intermediates by introducing double point mutations or deletions in the heptad repeat region 1 (HR1) that destabilize 6HB in varying degrees. One variant, HR1-∆10-54K, elicited antibodies in rabbits that targeted W672, I675 and L679, which are critical for 4E10/10E8 recognition. Overall, the results demonstrated that altering structural parameters of 6HB can influence immunogenic properties of the MPER and antibody targeting. Further exploration of this strategy could allow development of immunogens that could lead to induction of 4E10/10E8-like antibodies. - Highlights: • Four gp41 MPER-based immunogens that resemble fusion intermediates were generated. • C-terminal region of MPER that contains 4E10/10E8 epitopes was highly immunogenic. • Altering 6HB structure can influence immunogenic properties of the MPER. • Induced antibodies targeted multiple residues critical for 4E10/10E8 binding. • Development of immunogens based on fusion intermediates is a promising strategy.

  3. Definitive intensity-modulated radiotherapy concurrent with systemic therapy for oropharyngeal squamous cell carcinoma: Outcomes from an integrated regional Australian cancer centre

    International Nuclear Information System (INIS)

    Rahbari, Reza M.; McKay, Michael; Dwyer, Patrick; Winkley, Lauren; Hill, Jacques; Last, Andrew; Tahir, Abdul R.M.; Shakespeare, Thomas P.

    2016-01-01

    Oropharyngeal squamous cell carcinoma (OPSCC) incidence has increased over the past two decades largely because of an increase in human papilloma virus (HPV)-related OPSCC. We report here outcomes of definitive radiation therapy for OPSCC with simultaneous integrated boost intensity-modulated radiotherapy (IMRT) in a regional Australian cancer centre. We retrospectively reviewed electronic medical records (EMR) of all patients treated with IMRT for head and neck cancer. We included patients who received a curative intent IMRT for OPSCC (2010–2014). Of 61 patients, 80% were men, and the median age was 57 years. Ninety percent of our patients received concurrent systemic therapy, and 68% were p16 positive. The median radiotherapy dose received was 70 Gy in 35 fractions. The median follow up for surviving patients was 22 months. Twenty-four month actuarial data show that the loco-regional recurrence free, metastasis-free MFS, cancer-specific (CaSS) and overall survival percentages were 98.3%, 92.6%, 91% and 90.3%, respectively. We did not observe grades 4 or 5 acute or late toxicities, and 10 patients (16.2%) exhibited persistent grade 3 toxicity 6 months after completing the treatment. The results from curative IMRTs for OPSCC delivered in a regional cancer centre are comparable with results published by tertiary referral centres. A long-term follow up of this patient cohort will continue for further analyses and comparisons with tertiary centres.

  4. Regional evidence of modulation of cardiac adiponectin level in dilated cardiomyopathy: pilot study in a porcine animal model

    Directory of Open Access Journals (Sweden)

    Caselli Chiara

    2012-11-01

    Full Text Available Abstract Background The role of systemic and myocardial adiponectin (ADN in dilated cardiomyopathy is still debated. We tested the regulation of both systemic and myocardial ADN and the relationship with AMP-activated protein kinase (AMPK activity in a swine model of non-ischemic dilated cardiomyopathy. Methods and results Cardiac tissue was collected from seven instrumented adult male minipigs by pacing the left ventricular (LV free wall (180 beats/min, 3 weeks, both from pacing (PS and opposite sites (OS, and from five controls. Circulating ADN levels were inversely related to global and regional cardiac function. Myocardial ADN in PS was down-regulated compared to control (p Conclusions Paradoxically, circulating ADN did not show any cardioprotective effect, confirming its role as negative prognostic biomarker of heart failure. Myocardial ADN was reduced in PS compared to control in an AMPK-independent fashion, suggesting the occurrence of novel mechanisms by which reduced cardiac ADN levels may regionally mediate the decline of cardiac function.

  5. Exploiting nucleotide composition to engineer promoters.

    Directory of Open Access Journals (Sweden)

    Manfred G Grabherr

    Full Text Available The choice of promoter is a critical step in optimizing the efficiency and stability of recombinant protein production in mammalian cell lines. Artificial promoters that provide stable expression across cell lines and can be designed to the desired strength constitute an alternative to the use of viral promoters. Here, we show how the nucleotide characteristics of highly active human promoters can be modelled via the genome-wide frequency distribution of short motifs: by overlapping motifs that occur infrequently in the genome, we constructed contiguous sequence that is rich in GC and CpGs, both features of known promoters, but lacking homology to real promoters. We show that snippets from this sequence, at 100 base pairs or longer, drive gene expression in vitro in a number of mammalian cells, and are thus candidates for use in protein production. We further show that expression is driven by the general transcription factors TFIIB and TFIID, both being ubiquitously present across cell types, which results in less tissue- and species-specific regulation compared to the viral promoter SV40. We lastly found that the strength of a promoter can be tuned up and down by modulating the counts of GC and CpGs in localized regions. These results constitute a "proof-of-concept" for custom-designing promoters that are suitable for biotechnological and medical applications.

  6. Diode Laser Detection of Greenhouse Gases in the Near-Infrared Region by Wavelength Modulation Spectroscopy: Pressure Dependence of the Detection Sensitivity

    Directory of Open Access Journals (Sweden)

    Takashi Asakawa

    2010-05-01

    Full Text Available We have investigated the pressure dependence of the detection sensitivity of CO2, N2O and CH4 using wavelength modulation spectroscopy (WMS with distributed feed-back diode lasers in the near infrared region. The spectral line shapes and the background noise of the second harmonics (2f detection of the WMS were analyzed theoretically. We determined the optimum pressure conditions in the detection of CO2, N2O and CH4, by taking into consideration the background noise in the WMS. At the optimum total pressure for the detection of CO2, N2O and CH4, the limits of detection in the present system were determined.

  7. Methylation in the promoter regions of WT1, NKX6-1 and DBC1 genes in cervical cancer tissues of Uygur women in Xinjiang

    Directory of Open Access Journals (Sweden)

    Dan Wu

    Full Text Available Abstract This study aimed to explore: 1 DNA methylation in the promoter regions of Wilms tumor gene 1 (WT1, NK6 transcription factor related locus 1 gene (NKX6-1 and Deleted in bladder cancer 1 (DBC1 gene in cervical cancer tissues of Uygur women in Xinjiang, and 2 the correlation of gene methylation with the infection of HPV16/18 viruses. We detected HPV16/18 infection in 43 normal cervical tissues, 30 cervical intraepithelial neoplasia lesions (CIN and 48 cervical cancer tissues with polymerase chain reaction (PCR method. Methylation in the promoter regions of the WT1, NKX6-1 and DBC1 genes in the above-mentioned tissues was measured by methylation-specific PCR (MSP and cloning sequencing. The expression level of these three genes was measured by real-time PCR (qPCR in 10 methylation-positive cervical cancer tissues and 10 methylation-negative normal cervical tissues. We found that the infection of HPV16 in normal cervical tissues, CIN and cervical cancer tissues was 14.0, 36.7 and 66.7%, respectively. The infection of HPV18 was 0, 6.7 and 10.4%, respectively. The methylation rates of WT1, NKX6-1 and DBC1 genes were 7.0, 11.6 and 23.3% in normal cervical tissues, 36.7, 46.7 and 30.0% in CIN tissues, and 89.6, 77.1 and 85.4% in cervical cancer tissues. Furthermore, WT1, NKX6-1 and DBC1 genes were hypermethylated in the high-grade squamous intraepithelial lesion (CIN2, CIN3 and in the cervical cancer tissues with infection of HPV16/18 (both P< 0.05. The expression of WT1, NKX6-1 and DBC1 was significantly lower in the methylation-positive cervical cancer tissues than in methylation-negative normal cervical tissues. Our findings indicated that methylation in the promoter regions of WT1, NKX6-1 and DBC1 is correlated with cervical cancer tumorigenesis in Uygur women. The infection of HPV16/18 might be correlated with methylation in these genes. Gene inactivation caused by methylation might be related to the incidence and development of cervical

  8. The OSMATER project: promotion of stone materials from the Verbano-Cusio-Ossola region (Italy) and the Canton Ticino (Switzerland).

    Science.gov (United States)

    Cavallo, Alessandro; Antonella Dino, Giovanna

    2013-04-01

    The OSMATER (sub-Alpine Observatory Materials Territory Restoration) project, funded by the Piedmont Region (Italy) and the European Community, involved four Italian scientific bodies (Polytechnic of Turin, University of Turin, University of Milan-Bicocca, University of Bologna) and Switzerland (SUPSI). The aim was to investigate the present and historical quarrying and processing activities in the cross-border area between the Ossola Valley (Italy) and the Canton Ticino (Switzerland), and the use of dimension stones in local and national architecture. These materials are in many ways a "unique case", for their abundance and lithological variety. In the past, their extraction, processing and application characterized in a decisive way the architectural and constructive culture, both in terms of prestigious architecture and civil buildings, establishing a relationship between "stones and culture", "territory and its resources". In recent years, many of these traditions are losing importance and interest: this results in a loss of knowledge and historical memory, due mainly to the drastic changes in the market. The loss of this knowledge is likely to become irreversible in the short term, with the disappearance of people and social groups depositary of tradition. We can deduce that the creation of an "observatory", like OSMATER, is desirable and essential indeed, if we want to preserve the historical memory of the stone industry of an entire production area. The OSMATER project aimed the knowledge, recovery and enhancement of the architectural and cultural heritage of the cross-border area, through the census and classification of rocks, quarries (both active and historical - since Roman age), monuments and construction techniques typical of the sub-Alpine region, in order to create a documentation centre through a dedicated website. The first phase of the project was devoted to the identification of architectural works built with stone materials, with particular

  9. Treatment of chronic regional pain syndrome type 1 with palmitoylethanolamide and topical ketamine cream: modulation of nonneuronal cells

    Directory of Open Access Journals (Sweden)

    Keppel Hesselink JM

    2013-03-01

    Full Text Available Jan M Keppel Hesselink,1 David J Kopsky21Institute for Neuropathic Pain, Bosch en Duin, The Netherlands; 2Institute for Neuropathic Pain, Amsterdam, The NetherlandsAbstract: Chronic regional pain syndrome (CRPS can be intractable to treat and patients sometimes suffer for many years. Therefore, new treatment strategies are needed to alleviate symptoms in CRPS patients. This case report describes a patient suffering from intractable CRPS type 1 for 13 years. Due to her swollen painful feet and left knee she is wheelchair-bound. The combination of palmitoylethanolamide and ketamine 10% cream reduced her pain by more than 50% after 1 month of treatment, and a marked reduction in swelling and skin discoloration was noticed. Furthermore, she could walk independently again and she experienced no side effects. Thus, palmitoylethanolamide and topical ketamine could be a combination therapy option for treating CRPS patients.Keywords: palmitoylethanolamide, ketamine, cream, CRPS, endocannabinoid, sudeck, mast cells

  10. Training of verbal creativity modulates brain activity in regions associated with language- and memory-related demands.

    Science.gov (United States)

    Fink, Andreas; Benedek, Mathias; Koschutnig, Karl; Pirker, Eva; Berger, Elisabeth; Meister, Sabrina; Neubauer, Aljoscha C; Papousek, Ilona; Weiss, Elisabeth M

    2015-10-01

    This functional magnetic resonance (fMRI) study was designed to investigate changes in functional patterns of brain activity during creative ideation as a result of a computerized, 3-week verbal creativity training. The training was composed of various verbal divergent thinking exercises requiring participants to train approximately 20 min per day. Fifty-three participants were tested three times (psychometric tests and fMRI assessment) with an intertest-interval of 4 weeks each. Participants were randomly assigned to two different training groups, which received the training time-delayed: The first training group was trained between the first and the second test, while the second group accomplished the training between the second and the third test session. At the behavioral level, only one training group showed improvements in different facets of verbal creativity right after the training. Yet, functional patterns of brain activity during creative ideation were strikingly similar across both training groups. Whole-brain voxel-wise analyses (along with supplementary region of interest analyses) revealed that the training was associated with activity changes in well-known creativity-related brain regions such as the left inferior parietal cortex and the left middle temporal gyrus, which have been shown as being particularly sensitive to the originality facet of creativity in previous research. Taken together, this study demonstrates that continuous engagement in a specific complex cognitive task like divergent thinking is associated with reliable changes of activity patterns in relevant brain areas, suggesting more effective search, retrieval, and integration from internal memory representations as a result of the training. © 2015 Wiley Periodicals, Inc.

  11. Training of verbal creativity modulates brain activity in regions associated with language‐ and memory‐related demands

    Science.gov (United States)

    Benedek, Mathias; Koschutnig, Karl; Pirker, Eva; Berger, Elisabeth; Meister, Sabrina; Neubauer, Aljoscha C.; Papousek, Ilona; Weiss, Elisabeth M.

    2015-01-01

    Abstract This functional magnetic resonance (fMRI) study was designed to investigate changes in functional patterns of brain activity during creative ideation as a result of a computerized, 3‐week verbal creativity training. The training was composed of various verbal divergent thinking exercises requiring participants to train approximately 20 min per day. Fifty‐three participants were tested three times (psychometric tests and fMRI assessment) with an intertest‐interval of 4 weeks each. Participants were randomly assigned to two different training groups, which received the training time‐delayed: The first training group was trained between the first and the second test, while the second group accomplished the training between the second and the third test session. At the behavioral level, only one training group showed improvements in different facets of verbal creativity right after the training. Yet, functional patterns of brain activity during creative ideation were strikingly similar across both training groups. Whole‐brain voxel‐wise analyses (along with supplementary region of interest analyses) revealed that the training was associated with activity changes in well‐known creativity‐related brain regions such as the left inferior parietal cortex and the left middle temporal gyrus, which have been shown as being particularly sensitive to the originality facet of creativity in previous research. Taken together, this study demonstrates that continuous engagement in a specific complex cognitive task like divergent thinking is associated with reliable changes of activity patterns in relevant brain areas, suggesting more effective search, retrieval, and integration from internal memory representations as a result of the training. Hum Brain Mapp 36:4104–4115, 2015. © 2015 The Authors Human Brain Mapping Published by Wiley Periodicals, Inc. PMID:26178653

  12. What Research Says about Effective Teaching for Promoting Achievement and Positive Attitudes in Students. An Instructional Module Prepared for Undergraduate Teacher Education in the RAFT Project.

    Science.gov (United States)

    Handley, Herbert M., Ed.

    This module, developed by the Research Applications for Teaching (RAFT) project, was written to introduce the preservice teacher to the research base for effective teaching. Particular attention was given to the characteristics of teachers and teaching found in research literature to be associated with achievement and the development of positive…

  13. Familiarity to a Feed Additive Modulates Its Effects on Brain Responses in Reward and Memory Regions in the Pig Model.

    Science.gov (United States)

    Val-Laillet, David; Meurice, Paul; Clouard, Caroline

    2016-01-01

    Brain responses to feed flavors with or without a feed additive (FA) were investigated in piglets familiarized or not with this FA. Sixteen piglets were allocated to 2 dietary treatments from weaning until d 37: the naive group (NAI) received a standard control feed and the familiarized group (FAM) received the same feed added with a FA mainly made of orange extracts. Animals were subjected to a feed transition at d 16 post-weaning, and to 2-choice feeding tests at d 16 and d 23. Production traits of the piglets were assessed up to d 28 post-weaning. From d 26 onwards, animals underwent 2 brain imaging sessions (positron emission tomography of 18FDG) under anesthesia to investigate the brain activity triggered by the exposure to the flavors of the feed with (FA) or without (C) the FA. Images were analyzed with SPM8 and a region of interest (ROI)-based small volume correction (p reward, and included the prefrontal cortex, insular cortex, fusiform gyrus, limbic system and corpus striatum. The FAM animals showed a moderate preference for the novel post-transition FA feed compared to the C feed on d 16, i.e., day of the feed transition (67% of total feed intake). The presence or absence of the FA in the diet from weaning had no impact on body weight, average daily gain, and feed efficiency of the animals over the whole experimental period (p ≥ 0.10). Familiar feed flavors activated the prefrontal cortex. The amygdala, insular cortex, and prepyriform area were only activated in familiarized animals exposed to the FA feed flavor. The perception of FA feed flavor in the familiarized animals activated the dorsal striatum differently than the perception of the C feed flavor in naive animals. Our data demonstrated that the perception of FA in familiarized individuals induced different brain responses in regions involved in reward anticipation and/or perception processes than the familiar control feed flavor in naive animals. Chronic exposure to the FA might be necessary

  14. Familiarity to a Feed Additive Modulates Its Effects on Brain Responses in Reward and Memory Regions in the Pig Model.

    Directory of Open Access Journals (Sweden)

    David Val-Laillet

    Full Text Available Brain responses to feed flavors with or without a feed additive (FA were investigated in piglets familiarized or not with this FA. Sixteen piglets were allocated to 2 dietary treatments from weaning until d 37: the naive group (NAI received a standard control feed and the familiarized group (FAM received the same feed added with a FA mainly made of orange extracts. Animals were subjected to a feed transition at d 16 post-weaning, and to 2-choice feeding tests at d 16 and d 23. Production traits of the piglets were assessed up to d 28 post-weaning. From d 26 onwards, animals underwent 2 brain imaging sessions (positron emission tomography of 18FDG under anesthesia to investigate the brain activity triggered by the exposure to the flavors of the feed with (FA or without (C the FA. Images were analyzed with SPM8 and a region of interest (ROI-based small volume correction (p < 0.05, k ≥ 25 voxels per cluster. The brain ROI were selected upon their role in sensory evaluation, cognition and reward, and included the prefrontal cortex, insular cortex, fusiform gyrus, limbic system and corpus striatum. The FAM animals showed a moderate preference for the novel post-transition FA feed compared to the C feed on d 16, i.e., day of the feed transition (67% of total feed intake. The presence or absence of the FA in the diet from weaning had no impact on body weight, average daily gain, and feed efficiency of the animals over the whole experimental period (p ≥ 0.10. Familiar feed flavors activated the prefrontal cortex. The amygdala, insular cortex, and prepyriform area were only activated in familiarized animals exposed to the FA feed flavor. The perception of FA feed flavor in the familiarized animals activated the dorsal striatum differently than the perception of the C feed flavor in naive animals. Our data demonstrated that the perception of FA in familiarized individuals induced different brain responses in regions involved in reward anticipation and

  15. Eukaryotic elongation factor 1-beta interacts with the 5' untranslated region of the M gene of Nipah virus to promote mRNA translation.

    Science.gov (United States)

    Uchida, Shotaro; Sato, Hiroki; Yoneda, Misako; Kai, Chieko

    2016-09-01

    Nipah virus belongs to the genus Henipavirus in the family Paramyxoviridae, and its RNA genome is larger than those of other paramyxoviruses because it has long untranslated regions (UTRs) in each gene. However, the functions of these UTRs are not fully understood. In this study, we investigated the functions of the 5' UTRs and found that the 5' UTR of the M gene upregulated the translation of a reporter gene. Using an RNA pull-down assay, we showed that eukaryotic elongation factor 1-beta (EEF1B2) interacts with nucleotides 81-100 of the M 5' UTR and specifically enhances its translation efficiency. Our results suggest that the M 5' UTR promotes the production of M protein and viral budding by recruiting EEF1B2.

  16. Factor H binds to the hypervariable region of many Streptococcus pyogenes M proteins but does not promote phagocytosis resistance or acute virulence

    DEFF Research Database (Denmark)

    Gustafsson, Caj Ulrik Mattias; Lannergård, Jonas; Nilsson, Olof Rickard

    2013-01-01

    Many pathogens express a surface protein that binds the human complement regulator factor H (FH), as first described for Streptococcus pyogenes and the antiphagocytic M6 protein. It is commonly assumed that FH recruited to an M protein enhances virulence by protecting the bacteria against...... represents a distinct ligand-binding domain. The isolated HVRs specifically interacted with FH among all human serum proteins, interacted with the same region in FH and showed species specificity, but exhibited little or no antigenic cross-reactivity. Although these findings suggested that FH recruited...... to an M protein promotes virulence, studies in transgenic mice did not demonstrate a role for bound FH during acute infection. Moreover, phagocytosis tests indicated that ability to bind FH is neither sufficient nor necessary for S. pyogenes to resist killing in whole human blood. While these data shed...

  17. Imperial Tax System and Regional Development in the Eighteenth Century. The Monopoly of Tobacco as a Means for Economic Promotion in Louisiana

    Directory of Open Access Journals (Sweden)

    Laura Náter

    2004-07-01

    Full Text Available This paper analyzes Spain's Eighteenth-century tobacco policies in Louisiana, where it created a fiscal institution for mainly political reasons, subordinating economical yields and revenues to the  region's political  and  strategic needs.  This  case contrasts with the management  and exploitation of the same institution in other  Spanish colonial  properties,  which  also held monopolies of different products, including tobacco.  This study  shows that the tobacco monopoly was during the Eighteenth-century one of the Real Hacienda's favorite fiscal instruments for increasing revenues with which to promote economic development in certain colonies. The author's main conclusions refer to the mechanisms  through which the Real Hacienda de la Nueva  España used tobacco revenues to strengthen the economy of Louisiana.

  18. Patterns of Recurrence in Electively Irradiated Lymph Node Regions After Definitive Accelerated Intensity Modulated Radiation Therapy for Head and Neck Squamous Cell Carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Bosch, Sven van den, E-mail: sven.vandenbosch@radboudumc.nl; Dijkema, Tim; Verhoef, Lia C.G.; Zwijnenburg, Ellen M.; Janssens, Geert O.; Kaanders, Johannes H.A.M.

    2016-03-15

    Purpose: To provide a comprehensive risk assessment on the patterns of recurrence in electively irradiated lymph node regions after definitive radiation therapy for head and neck cancer. Methods and Materials: Two hundred sixty-four patients with stage cT2-4N0-2M0 squamous cell carcinoma of the oropharynx, larynx, or hypopharynx treated with accelerated intensity modulated radiation therapy between 2008 and 2012 were included. On the radiation therapy planning computed tomography (CT) scans from all patients, 1166 lymph nodes (short-axis diameter ≥5 mm) localized in the elective volume were identified and delineated. The exact sites of regional recurrences were reconstructed and projected on the initial radiation therapy planning CT scan by performing coregistration with diagnostic imaging of the recurrence. Results: The actuarial rate of recurrence in electively irradiated lymph node regions at 2 years was 5.1% (95% confidence interval 2.4%-7.8%). Volumetric analysis showed an increased risk of recurrence with increasing nodal volume. Receiver operating characteristic analysis demonstrated that the summed long- and short-axis diameter is a good alternative for laborious volume calculations, using ≥17 mm as cut-off (hazard ratio 17.8; 95% confidence interval 5.7-55.1; P<.001). Conclusions: An important risk factor was identified that can help clinicians in the pretreatment risk assessment of borderline-sized lymph nodes. Not overtly pathologic nodes with a summed diameter ≥17 mm may require a higher than elective radiation therapy dose. For low-risk elective regions (all nodes <17 mm), the safety of dose de-escalation below the traditional 45 to 50 Gy should be investigated.

  19. A Specific Mutation in the Promoter Region of the Silent cel Cluster Accounts for the Appearance of Lactose-Utilizing Lactococcus lactis MG1363

    Science.gov (United States)

    Solopova, Ana; Bachmann, Herwig; Teusink, Bas; Kok, Jan; Neves, Ana Rute

    2012-01-01

    The Lactococcus lactis laboratory strain MG1363 has been described to be unable to utilize lactose. However, in a rich medium supplemented with lactose as the sole carbon source, it starts to grow after prolonged incubation periods. Transcriptome analyses showed that L. lactis MG1363 Lac+ cells expressed celB, encoding a putative cellobiose-specific phosphotransferase system (PTS) IIC component, which is normally silent in MG1363 Lac− cells. Nucleotide sequence analysis of the cel cluster of a Lac+ isolate revealed a change from one of the guanines to adenine in the promoter region. We showed here that one particular mutation, taking place at increased frequency, accounts for the lactose-utilizing phenotype occurring in MG1363 cultures. The G-to-A transition creates a −10 element at an optimal distance from the −35 element. Thus, a fully active promoter is created, allowing transcription of the otherwise cryptic cluster. Nuclear magnetic resonance (NMR) spectroscopy results show that MG1363 Lac+ uses a novel pathway of lactose utilization. PMID:22660716

  20. c-Abl phosphorylation of Yin Yang 1's conserved tyrosine 254 in the spacer region modulates its transcriptional activity.

    Science.gov (United States)

    Daraiseh, Susan I; Kassardjian, Ari; Alexander, Karen E; Rizkallah, Raed; Hurt, Myra M

    2018-05-25

    Yin Yang 1 (YY1) is a multifunctional transcription factor that can activate or repress transcription depending on the promotor and/or the co-factors recruited. YY1 is phosphorylated in various signaling pathways and is critical for different biological functions including embryogenesis, apoptosis, proliferation, cell-cycle regulation and tumorigenesis. Here we report that YY1 is a substrate for c-Abl kinase phosphorylation at conserved residue Y254 in the spacer region. Pharmacological inhibition of c-Abl kinase by imatinib, nilotinib and GZD824, knock-down of c-Abl using siRNA, and the use of c-Abl kinase-dead drastically reduces tyrosine phosphorylation of YY1. Both radioactive and non-radioactive in vitro kinase assays, as well as co-immunoprecipitation in different cell lines, show that the target of c-Abl phosphorylation is tyrosine residue 254. c-Abl phosphorylation has little effect on YY1 DNA binding ability or cellular localization in asynchronous cells. However, functional studies reveal that c-Abl mediated phosphorylation of YY1 regulates YY1's transcriptional ability in vivo. In conclusion, we demonstrate the novel role of c-Abl kinase in regulation of YY1's transcriptional activity, linking YY1 regulation with c-Abl tyrosine kinase signaling pathways. Copyright © 2018. Published by Elsevier B.V.

  1. 5-Aza-2'-deoxycytidine acts as a modulator of chondrocyte hypertrophy and maturation in chick caudal region chondrocytes in culture.

    Science.gov (United States)

    Haq, Samina Hyder

    2016-06-01

    This study was carried out to explore the effect of DNA hypomethylation on chondrocytes phenotype, in particular the effect on chondrocyte hypertrophy, maturation, and apoptosis. Chondrocytes derived from caudal region of day 17 embryonic chick sterna were pretreated with hypomethylating drug 5-aza-2'-deoxycytidine for 48 hours and then maintained in the normal culture medium for up to 14 days. Histological studies showed distinct morphological changes occurred in the pretreated cultures when compared to the control cultures. The pretreated chondrocytes after 7 days in culture became bigger in size and acquired more flattened fibroblastic phenotype as well as a loss of cartilage specific extracellular matrix. Scanning electron microscopy at day 7 showed chondrocytes to have increased in cell volume and at day 14 in culture the extracellular matrix of the pretreated cultures showed regular fibrillar structure heavily embedded with matrix vesicles, which is the characteristic feature of chondrocyte hypertrophy. Transmission electron microscopic studies indicated the terminal fate of the hypertrophic cells in culture. The pretreated chondrocytes grown for 14 days in culture showed two types of cells: dark cells which had condense chromatin in dark patches and dark cytoplasm. The other light chondrocytes appeared to be heavily loaded with endoplasmic reticulum indicative of very active protein and secretory activity; their cytoplasm had large vacuoles and disintegrating cytoplasm. The biosynthetic profile showed that the pretreated cultures were actively synthesizing and secreting type X collagen and alkaline phosphatase as a major biosynthetic product.

  2. Genome-wide analysis of promoter architecture in Drosophila melanogaster

    Energy Technology Data Exchange (ETDEWEB)

    Hoskins, Roger A.; Landolin, Jane M.; Brown, James B.; Sandler, Jeremy E.; Takahashi, Hazuki; Lassmann, Timo; Yu, Charles; Booth, Benjamin W.; Zhang, Dayu; Wan, Kenneth H.; Yang, Li; Boley, Nathan; Andrews, Justen; Kaufman, Thomas C.; Graveley, Brenton R.; Bickel, Peter J.; Carninci, Piero; Carlson, Joseph W.; Celniker, Susan E.

    2010-10-20

    Core promoters are critical regions for gene regulation in higher eukaryotes. However, the boundaries of promoter regions, the relative rates of initiation at the transcription start sites (TSSs) distributed within them, and the functional significance of promoter architecture remain poorly understood. We produced a high-resolution map of promoters active in the Drosophila melanogaster embryo by integrating data from three independent and complementary methods: 21 million cap analysis of gene expression (CAGE) tags, 1.2 million RNA ligase mediated rapid amplification of cDNA ends (RLMRACE) reads, and 50,000 cap-trapped expressed sequence tags (ESTs). We defined 12,454 promoters of 8037 genes. Our analysis indicates that, due to non-promoter-associated RNA background signal, previous studies have likely overestimated the number of promoter-associated CAGE clusters by fivefold. We show that TSS distributions form a complex continuum of shapes, and that promoters active in the embryo and adult have highly similar shapes in 95% of cases. This suggests that these distributions are generally determined by static elements such as local DNA sequence and are not modulated by dynamic signals such as histone modifications. Transcription factor binding motifs are differentially enriched as a function of promoter shape, and peaked promoter shape is correlated with both temporal and spatial regulation of gene expression. Our results contribute to the emerging view that core promoters are functionally diverse and control patterning of gene expression in Drosophila and mammals.

  3. Characterization of the bovine pregnancy-associated glycoprotein gene family – analysis of gene sequences, regulatory regions within the promoter and expression of selected genes

    Directory of Open Access Journals (Sweden)

    Walker Angela M

    2009-04-01

    Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed

  4. Clinical significance of SNP (rs2596542 in histocompatibility complex class I-related gene A promoter region among hepatitis C virus related hepatocellular carcinoma cases

    Directory of Open Access Journals (Sweden)

    Amal A. Mohamed

    2017-07-01

    Full Text Available The major histocompatibility complex class I-related gene A (MICA is an antigen induced by stress and performs an integral role in immune responses as an anti-infectious and antitumor agent. This work was designed to investigate whether (SNP rs2596542C/T in MICA promoter region is predictive of liver cirrhosis (LC and hepatocellular carcinoma (HCC or not. Forty-seven healthy controls and 94 HCV-infected patients, subdivided into 47 LC and 47 HCC subjects were enrolled in this study. SNP association was studied using real time PCR and soluble serum MICA concentration was measured using ELISA. Results showed that heterozygous genotype rs2596542CT was significantly (P = 0.022 distributed between HCC and LC related CHC patients. The sMICA was significantly higher (P = 0.0001 among HCC and LC. No significant association (P = 0.56 between rs2596542CT genotypes and sMICA levels was observed. Studying SNP rs2596542C/T association with HCC and LC susceptibility revealed that statistical significant differences (P = 0.013, P = 0.027 were only observed between SNP rs2596542C/T and each of HCC and LC, respectively, versus healthy controls, indicating that the rs2596542C/T genetic variation is not a significant contributor to HCC development in LC patients. Moreover, the T allele was considered a risk factor for HCC and LC vulnerability in HCV patients (OR = 1.93 and 2.1, respectively, while the C allele contributes to decreasing HCC risk. Therefore, SNP (rs2596542C/T in MICA promoter region and sMICA levels might be potential useful markers in the assessment of liver disease progression to LC and HCC.

  5. Effect of metallothionein core promoter region polymorphism on cadmium, zinc and copper levels in autopsy kidney tissues from a Turkish population

    International Nuclear Information System (INIS)

    Kayaalti, Zeliha; Mergen, Goerkem; Soeylemezoglu, Tuelin

    2010-01-01

    Metallothioneins (MTs) are metal-binding, low molecular weight proteins and are involved in pathophysiological processes like metabolism of essential metals, metal ion homeostasis and detoxification of heavy metals. Metallothionein expression is induced by various heavy metals especially cadmium, mercury and zinc; MTs suppress toxicity of heavy metals by binding themselves to these metals. The aim of this study was to investigate the association between the - 5 A/G metallothionein 2A (MT2A) single nucleotide polymorphism (SNP) and Cd, Zn and Cu levels in the renal cortex from autopsy cases. MT2A core promoter region - 5 A/G SNP was analyzed by PCR-RFLP method using 114 autopsy kidney tissues and the genotype frequencies of this polymorphism were found as 87.7% homozygote typical (AA), 11.4% heterozygote (AG) and 0.9% homozygote atypical (GG). In order to assess the Cd, Zn and Cu levels in the same autopsy kidney tissues, a dual atomic absorption spectrophotometer system was used and the average levels of Cd, Zn and Cu were measured as 95.54 ± 65.58 μg/g, 181.20 ± 87.72 μg/g and 17.14 ± 16.28 μg/g, respectively. As a result, no statistical association was found between the - 5 A/G SNP in the MT2A gene and the Zn and Cu levels in the renal cortex (p > 0.05), but considerably high accumulation of Cd was monitored for individuals having AG (151.24 ± 60.21 μg/g) and GG genotypes (153.09 μg/g) compared with individuals having AA genotype (87.72 ± 62.98 μg/g) (p < 0.05). These results show that the core promoter region polymorphism of metallothionein 2A increases the accumulation of Cd in human renal cortex.

  6. The 5' untranslated region of a novel infectious molecular clone of the dicistrovirus cricket paralysis virus modulates infection.

    Science.gov (United States)

    Kerr, Craig H; Wang, Qing S; Keatings, Kathleen; Khong, Anthony; Allan, Douglas; Yip, Calvin K; Foster, Leonard J; Jan, Eric

    2015-06-01

    Dicistroviridae are a family of RNA viruses that possesses a single-stranded positive-sense RNA genome containing two distinct open reading frames (ORFs), each preceded by an internal ribosome entry site that drives translation of the viral structural and nonstructural proteins, respectively. The type species, Cricket paralysis virus (CrPV), has served as a model for studying host-virus interactions; however, investigations into the molecular mechanisms of CrPV and other dicistroviruses have been limited as an established infectious clone was elusive. Here, we report the construction of an infectious molecular clone of CrPV. Transfection of in vitro-transcribed RNA from the CrPV clone into Drosophila Schneider line 2 (S2) cells resulted in cytopathic effects, viral RNA accumulation, detection of negative-sense viral RNA, and expression of viral proteins. Transmission electron microscopy, viral titers, and immunofluorescence-coupled transwell assays demonstrated that infectious viral particles are released from transfected cells. In contrast, mutant clones containing stop codons in either ORF decreased virus infectivity. Injection of adult Drosophila flies with virus derived from CrPV clones but not UV-inactivated clones resulted in mortality. Molecular analysis of the CrPV clone revealed a 196-nucleotide duplication within its 5' untranslated region (UTR) that stimulated translation of reporter constructs. In cells infected with the CrPV clone, the duplication inhibited viral infectivity yet did not affect viral translation or RNA accumulation, suggesting an effect on viral packaging or entry. The generation of the CrPV infectious clone provides a powerful tool for investigating the viral life cycle and pathogenesis of dicistroviruses and may further understanding of fundamental host-virus interactions in insect cells. Dicistroviridae, which are RNA viruses that infect arthropods, have served as a model to gain insights into fundamental host-virus interactions in

  7. [Dissemination of psychotherapy modules for traumatized refugees : Experience gained from trauma work in crisis and conflict regions].

    Science.gov (United States)

    Elbert, T; Wilker, S; Schauer, M; Neuner, F

    2017-01-01

    With each additional accumulative exposure to severe and traumatic stressors, the likelihood of developing mental health problems and physical diseases increases. Displaced individuals have usually experienced a number of serious threats to health due to organized violence in their home country or attacks during the flight. Frequently, domestic violence adds additional strain to the stressors experienced. The resulting impairments in psychosocial functioning reduce the resources needed for social adjustment and integration. Social exclusion then in turn often further aggravates the existing mental health complications. For the treatment of trauma spectrum disorders, different evidence-based psychotherapies are available. In high-income countries, trained and licensed psychotherapists are typically in positions to apply such interventions; however, even an advanced system with a high capacity, such as the psychotherapeutic care offered in Germany, severely struggles to manage the demands associated with the rapid addition of hundreds of thousands of displaced people. Germany's mental healthcare system at present lacks the resources, both human and technological, to effectively manage the present demands. Systematic scientific studies in resource-poor regions of war and conflict have demonstrated that the dissemination of effective treatment to local personnel, even with limited training, results in substantial improvements in the mental health challenges within the community: Organized as a cascade model, members of the refugee community learn to identify weakened fellow citizens requiring in-depth diagnostic interviews. Educated, bilingual individuals acquainted with their country's healthcare system (e. g. nurses, teachers and social workers) receive training to conduct structured interviews and evidence-based interventions under the supervision of centrally organized licensed psychotherapists. More complex cases are referred to local psychotherapists

  8. Definition and visualisation of regions of interest in post-prostatectomy image-guided intensity modulated radiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Bell, Linda J, E-mail: linda.bell1@health.nsw.gov.au; Cox, Jennifer [Radiation Oncology Department, Northern Sydney Cancer Centre, Royal North Shore Hospital, St Leonards, New South Wales (Australia); Faculty of Health Sciences, University of Sydney, Lidcombe, New South Wales (Australia); Eade, Thomas; Rinks, Marianne; Kneebone, Andrew [Radiation Oncology Department, Northern Sydney Cancer Centre, Royal North Shore Hospital, St Leonards, New South Wales (Australia)

    2014-09-15

    Standard post-prostatectomy radiotherapy (PPRT) image verification uses bony anatomy alignment. However, the prostate bed (PB) moves independently of bony anatomy. Cone beam computed tomography (CBCT) can be used to soft tissue match, so radiation therapists (RTs) must understand pelvic anatomy and PPRT clinical target volumes (CTV). The aims of this study are to define regions of interest (ROI) to be used in soft tissue matching image guidance and determine their visibility on planning CT (PCT) and CBCT. Published CTV guidelines were used to select ROIs. The PCT scans (n = 23) and CBCT scans (n = 105) of 23 post-prostatectomy patients were reviewed. Details on ROI identification were recorded. Eighteen patients had surgical clips. All ROIs were identified on PCTs at least 90% of the time apart from mesorectal fascia (MF) (87%) due to superior image quality. When surgical clips are present, the seminal vesicle bed (SVB) was only seen in 2.3% of CBCTs and MF was unidentifiable. Most other structures were well identified on CBCT. The anterior rectal wall (ARW) was identified in 81.4% of images and penile bulb (PB) in 68.6%. In the absence of surgical clips, the MF and SVB were always identified; the ARW was identified in 89.5% of CBCTs and PB in 73.7%. Surgical clips should be used as ROIs when present to define SVB and MF. In the absence of clips, SVB, MF and ARW can be used. RTs must have a strong knowledge of soft tissue anatomy and PPRT CTV to ensure coverage and enable soft tissue matching.

  9. Definition and visualisation of regions of interest in post-prostatectomy image-guided intensity modulated radiotherapy

    International Nuclear Information System (INIS)

    Bell, Linda J; Cox, Jennifer; Eade, Thomas; Rinks, Marianne; Kneebone, Andrew

    2014-01-01

    Standard post-prostatectomy radiotherapy (PPRT) image verification uses bony anatomy alignment. However, the prostate bed (PB) moves independently of bony anatomy. Cone beam computed tomography (CBCT) can be used to soft tissue match, so radiation therapists (RTs) must understand pelvic anatomy and PPRT clinical target volumes (CTV). The aims of this study are to define regions of interest (ROI) to be used in soft tissue matching image guidance and determine their visibility on planning CT (PCT) and CBCT. Published CTV guidelines were used to select ROIs. The PCT scans (n = 23) and CBCT scans (n = 105) of 23 post-prostatectomy patients were reviewed. Details on ROI identification were recorded. Eighteen patients had surgical clips. All ROIs were identified on PCTs at least 90% of the time apart from mesorectal fascia (MF) (87%) due to superior image quality. When surgical clips are present, the seminal vesicle bed (SVB) was only seen in 2.3% of CBCTs and MF was unidentifiable. Most other structures were well identified on CBCT. The anterior rectal wall (ARW) was identified in 81.4% of images and penile bulb (PB) in 68.6%. In the absence of surgical clips, the MF and SVB were always identified; the ARW was identified in 89.5% of CBCTs and PB in 73.7%. Surgical clips should be used as ROIs when present to define SVB and MF. In the absence of clips, SVB, MF and ARW can be used. RTs must have a strong knowledge of soft tissue anatomy and PPRT CTV to ensure coverage and enable soft tissue matching

  10. The PDGF-BB-SOX7 axis-modulated IL-33 in pericytes and stromal cells promotes metastasis through tumour-associated macrophages

    DEFF Research Database (Denmark)

    Yang, Yunlong; Andersson, Patrik; Hosaka, Kayoko

    2016-01-01

    Signalling molecules and pathways that mediate crosstalk between various tumour cellular compartments in cancer metastasis remain largely unknown. We report a mechanism of the interaction between perivascular cells and tumour-associated macrophages (TAMs) in promoting metastasis through the IL-33......-ST2-dependent pathway in xenograft mouse models of cancer. IL-33 is the highest upregulated gene through activation of SOX7 transcription factor in PDGF-BB-stimulated pericytes. Gain- and loss-of-function experiments validate that IL-33 promotes metastasis through recruitment of TAMs. Pharmacological...... inhibition of the IL-33-ST2 signalling by a soluble ST2 significantly inhibits TAMs and metastasis. Genetic deletion of host IL-33 in mice also blocks PDGF-BB-induced TAM recruitment and metastasis. These findings shed light on the role of tumour stroma in promoting metastasis and have therapeutic...

  11. Can a peri-rectal hydrogel spaceOAR programme for prostate cancer intensity-modulated radiotherapy be successfully implemented in a regional setting?

    International Nuclear Information System (INIS)

    Te Velde, Bridget L.; Westhuyzen, Justin; Wood, Maree; Shakespeare, Thomas P.; Awad, Nader

    2017-01-01

    The aim of this study was to investigate whether the implementation of a hydrogel spacer (SpaceOAR) programme for patients treated with 81 Gy prostate intensity-modulated radiotherapy (IMRT) in a regional setting can reduce rectal doses and toxicity. In this retrospective study, 125 patients with localised prostate cancer treated between April 2014 (programme commencement) and June 2015 were compared: 65 with SpaceOAR (inserted by five different urologists) and 60 patients treated over the same time period without SpaceOAR. Patients were treated with 81 Gy in 45Fx of IMRT over 9 weeks. Planning aims included restricting rectal doses to V40 Gy < 35%, V65 Gy < 17%, V75 Gy < 10%. Acute toxicity was assessed weekly during radiotherapy and at 12 weeks. Rectal volume parameters were all significantly lower in the SpaceOAR group, with an associated reduction in acute diarrhoea (13.8% vs 31.7%). There were no significant differences in the very low rates of acute and late faecal incontinence or proctitis, however, there was a trend towards increased haemorrhoid rate in the SpaceOAR group (11.7% vs 3.1%, P = 0.09). A SpaceOAR programme in a regional setting with urologists performing low volumes of insertions (<1 per month on average) is of clinical benefit, and was associated with significantly lower radiation doses to the rectum and lower rates of acute diarrhoea.

  12. The Central Conserved Region (CCR) of Respiratory Syncytial Virus (RSV) G Protein Modulates Host miRNA Expression and Alters the Cellular Response to Infection.

    Science.gov (United States)

    Bakre, Abhijeet A; Harcourt, Jennifer L; Haynes, Lia M; Anderson, Larry J; Tripp, Ralph A

    2017-07-03

    Respiratory Syncytial Virus (RSV) infects respiratory epithelial cells and deregulates host gene expression by many mechanisms including expression of RSV G protein (RSV G). RSV G protein encodes a central conserved region (CCR) containing a CX3C motif that functions as a fractalkine mimic. Disruption of the CX3C motif (a.a. 182-186) located in the CCR of the G protein has been shown to affect G protein function in vitro and the severity of RSV disease pathogenesis in vivo. We show that infection of polarized Calu3 respiratory cells with recombinant RSV having point mutations in Cys173 and 176 (C173/176S) (rA2-GC12), or Cys186 (C186S) (rA2-GC4) is associated with a decline in the integrity of polarized Calu-3 cultures and decreased virus production. This is accompanied with downregulation of miRNAs let-7f and miR-24 and upregulation of interferon lambda (IFNλ), a primary antiviral cytokine for RSV in rA2-GC12/rA2-GC4 infected cells. These results suggest that residues in the cysteine noose region of RSV G protein can modulate IFN λ expression accompanied by downregulation of miRNAs, and are important for RSV G protein function and targeting.

  13. Environmental stress affects DNA methylation of a CpG rich promoter region of serotonin transporter gene in a nurse cohort.

    Directory of Open Access Journals (Sweden)

    Jukka S Alasaari

    Full Text Available Shift-working nurses are exposed to a stressful work environment, which puts them at an increased risk for burnout and depression. We explored the effect of environmental stress on serotonin transporter gene (SLC6A4 promoter methylation among nurses from high and low work stress environments.Using bisulfite sequencing, we investigated the methylation status of five CpG residues of a CpG-rich region in the promoter of SLC6A4 by comparing female shift working nurses from a high work stress environment (n = 24 to low work stress environment (n = 25. We also analyzed the association of 5-HTTLPR polymorphism at 5' end of SLC6A4. Work stress was assessed by the Karasek's Model and possible signs of burnout or depression were measured by the Maslach Burnout Index General Survey and Beck Depression Index. Methylation levels were assessed by bisulfite sequencing of DNA extracted from peripheral blood leucocytes. Restriction enzyme treatment followed by standard PCR was used to identify 5-HTTLPR genotypes.We found that nurses in the high stress environment had significantly lower promoter methylation levels at all five CpG residues compared to nurses in the low stress environment (p<0.01. There was no significant interaction of 5-HTTLPR genotype and work stress with methylation (p = 0.58. In unadjusted (bivariate analysis, burnout was not significantly associated to methylation levels. However, when mutually adjusted for both, burnout and work stress were significant contributors (p = 0.038 and p<0.0001 respectively to methylation levels.Our findings show that environmental stress is concurrent with decreased methylation of the SLC6A4 promoter. This may lead to increased transcriptional activity of the gene, increased reuptake of serotonin from synaptic clefts, and termination of the activity of serotonin. This could present a possible coping mechanism for environmental stress in humans that could eventually increase risk for disturbed functional

  14. Definitive intensity-modulated radiotherapy concurrent with systemic therapy for oropharyngeal squamous cell carcinoma: Outcomes from an integrated regional Australian cancer centre.

    Science.gov (United States)

    Masoud Rahbari, Reza; Winkley, Lauren; Hill, Jacques; Tahir, Abdul Rahim Mohammed; McKay, Michael; Last, Andrew; Shakespeare, Thomas P; Dwyer, Patrick

    2016-06-01

    Oropharyngeal squamous cell carcinoma (OPSCC) incidence has increased over the past two decades largely because of an increase in human papilloma virus (HPV)-related OPSCC. We report here outcomes of definitive radiation therapy for OPSCC with simultaneous integrated boost intensity-modulated radiotherapy (IMRT) in a regional Australian cancer centre. We retrospectively reviewed electronic medical records (EMR) of all patients treated with IMRT for head and neck cancer. We included patients who received a curative intent IMRT for OPSCC (2010-2014). Of 61 patients, 80% were men, and the median age was 57 years. Ninety percent of our patients received concurrent systemic therapy, and 68% were p16 positive. The median radiotherapy dose received was 70 Gy in 35 fractions. The median follow up for surviving patients was 22 months. Twenty-four month actuarial data show that the loco-regional recurrence free, metastasis-free MFS, cancer-specific (CaSS) and overall survival percentages were 98.3%, 92.6%, 91% and 90.3%, respectively. We did not observe grades 4 or 5 acute or late toxicities, and 10 patients (16.2%) exhibited persistent grade 3 toxicity 6 months after completing the treatment. The results from curative IMRTs for OPSCC delivered in a regional cancer centre are comparable with results published by tertiary referral centres. A long-term follow up of this patient cohort will continue for further analyses and comparisons with tertiary centres. © 2016 The Royal Australian and New Zealand College of Radiologists.

  15. Staphylococcus aureus RNAIII binds to two distant regions of coa mRNA to arrest translation and promote mRNA degradation.

    Directory of Open Access Journals (Sweden)

    Clément Chevalier

    2010-03-01

    Full Text Available Staphylococcus aureus RNAIII is the intracellular effector of the quorum sensing system that temporally controls a large number of virulence factors including exoproteins and cell-wall-associated proteins. Staphylocoagulase is one major virulence factor, which promotes clotting of human plasma. Like the major cell surface protein A, the expression of staphylocoagulase is strongly repressed by the quorum sensing system at the post-exponential growth phase. Here we used a combination of approaches in vivo and in vitro to analyze the mechanism used by RNAIII to regulate the expression of staphylocoagulase. Our data show that RNAIII represses the synthesis of the protein through a direct binding with the mRNA. Structure mapping shows that two distant regions of RNAIII interact with coa mRNA and that the mRNA harbors a conserved signature as found in other RNAIII-target mRNAs. The resulting complex is composed of an imperfect duplex masking the Shine-Dalgarno sequence of coa mRNA and of a loop-loop interaction occurring downstream in the coding region. The imperfect duplex is sufficient to prevent the formation of the ribosomal initiation complex and to repress the expression of a reporter gene in vivo. In addition, the double-strand-specific endoribonuclease III cleaves the two regions of the mRNA bound to RNAIII that may contribute to the degradation of the repressed mRNA. This study validates another direct target of RNAIII that plays a role in virulence. It also illustrates the diversity of RNAIII-mRNA topologies and how these multiple RNAIII-mRNA interactions would mediate virulence regulation.

  16. Integration Host Factor (IHF binds to the promoter region of the phtD operon involved in phaseolotoxin synthesis in P. syringae pv. phaseolicola NPS3121

    Directory of Open Access Journals (Sweden)

    Álvarez-Morales Ariel

    2011-05-01

    Full Text Available Abstract Background Pseudomonas syringae pv. phaseolicola, the causal agent of halo blight disease in beans, produces a toxin known as phaseolotoxin, in whose synthesis participate a group of genes organized within the genome in a region known as the "Pht cluster". This region, which is thought to have been acquired by horizontal gene transfer, includes 5 transcriptional units, two monocistronic (argK, phtL and three polycistronic (phtA, phtD, phtM, whose expression is temperature dependent. So far, the regulatory mechanisms involved in phaseolotoxin synthesis have not been elucidated and the only well-established fact is the requirement of low temperatures for its synthesis. In this work, we searched for regulatory proteins that could be involved in phaseolotoxin synthesis, focusing on the regulation of the phtD operon. Results In this study we identified the global regulator IHF (Integration Host Factor, which binds to the promoter region of the phtD operon, exerting a negative effect on the expression of this operon. This is the first regulatory protein identified as part of the phaseolotoxin synthesis system. Our findings suggest that the Pht cluster was similarly regulated in the ancestral cluster by IHF or similar protein, and integrated into the global regulatory mechanism of P. syringae pv. phaseolicola, after the horizontal gene transfer event by using the host IHF protein. Conclusion This study identifies the IHF protein as one element involved in the regulation of phaseolotoxin synthesis in P. syringae pv. phaseolicola NPS3121 and provides new insights into the regulatory mechanisms involved in phaseolotoxin production.

  17. Statistical significance of cis-regulatory modules

    Directory of Open Access Journals (Sweden)

    Smith Andrew D

    2007-01-01

    Full Text Available Abstract Background It is becoming increasingly important for researchers to be able to scan through large genomic regions for transcription factor binding sites or clusters of binding sites forming cis-regulatory modules. Correspondingly, there has been a push to develop algorithms for the rapid detection and assessment of cis-regulatory modules. While various algorithms for this purpose have been introduced, most are not well suited for rapid, genome scale scanning. Results We introduce methods designed for the detection and statistical evaluation of cis-regulatory modules, modeled as either clusters of individual binding sites or as combinations of sites with constrained organization. In order to determine the statistical significance of module sites, we first need a method to determine the statistical significance of single transcription factor binding site matches. We introduce a straightforward method of estimating the statistical significance of single site matches using a database of known promoters to produce data structures that can be used to estimate p-values for binding site matches. We next introduce a technique to calculate the statistical significance of the arrangement of binding sites within a module using a max-gap model. If the module scanned for has defined organizational parameters, the probability of the module is corrected to account for organizational constraints. The statistical significance of single site matches and the architecture of sites within the module can be combined to provide an overall estimation of statistical significance of cis-regulatory module sites. Conclusion The methods introduced in this paper allow for the detection and statistical evaluation of single transcription factor binding sites and cis-regulatory modules. The features described are implemented in the Search Tool for Occurrences of Regulatory Motifs (STORM and MODSTORM software.

  18. A common polymorphism in the promoter region of the TNFSF4 gene is associated with lower allele-specific expression and risk of myocardial infarction.

    Directory of Open Access Journals (Sweden)

    Massimiliano Ria

    Full Text Available BACKGROUND: The TNFSF4/TNFRSF4 system, along with several other receptor-ligand pairs, is involved in the recruitment and activation of T-cells and is therefore tentatively implicated in atherosclerosis and acute coronary syndromes. We have previously shown that genetic variants in TNFSF4 are associated with myocardial infarction (MI in women. This prompted functional studies of TNFSF4 expression. METHODS AND RESULTS: Based on a screening of the TNFSF4 genomic region, a promoter polymorphism (rs45454293 and a haplotype were identified, conceivably involved in gene regulation. The rs45454293T-allele, in agreement with the linked rs3850641G-allele, proved to be associated with increased risk of MI in women. Haplotype-specific chromatin immunoprecipitation of activated polymerase II, as a measure of transcriptional activity in vivo, suggested that the haplotype including the rs45454293 and rs3850641 polymorphisms is functionally important, the rs45454293T- and rs3850641G-alleles being associated with lower transcriptional activity in cells heterozygous for both polymorphisms. The functional role of rs45454293 on transcriptional levels of TNFSF4 was clarified by luciferase reporter assays, where the rs45454293T-allele decreased gene expression when compared with the rs45454293C-allele, while the rs3850641 SNP did not have any effect on TNFSF4 promoter activity. Electromobility shift assay showed that the rs45454293 polymorphism, but not rs3850641, affects the binding of nuclear factors, thus suggesting that the lower transcriptional activity is attributed to binding of one or more transcriptional repressor(s to the T-allele. CONCLUSIONS: Our data indicate that the TNFSF4 rs45454293T-allele is associated with lower TNFSF4 expression and increased risk of MI.

  19. SRSF1-3 contributes to diversification of the immunoglobulin variable region gene by promoting accumulation of AID in the nucleus.

    Science.gov (United States)

    Kawaguchi, Yuka; Nariki, Hiroaki; Kawamoto, Naoko; Kanehiro, Yuichi; Miyazaki, Satoshi; Suzuki, Mari; Magari, Masaki; Tokumitsu, Hiroshi; Kanayama, Naoki

    2017-04-01

    Activation-induced cytidine deaminase (AID) is essential for diversification of the Ig variable region (IgV). AID is excluded from the nucleus, where it normally functions. However, the molecular mechanisms responsible for regulating AID localization remain to be elucidated. The SR-protein splicing factor SRSF1 is a nucleocytoplasmic shuttling protein, a splicing isoform of which called SRSF1-3, has previously been shown to contribute to IgV diversification in chicken DT40 cells. In this study, we examined whether SRSF1-3 functions in IgV diversification by promoting nuclear localization of AID. AID expressed alone was localized predominantly in the cytoplasm. In contrast, co-expression of AID with SRSF1-3 led to the nuclear accumulation of both AID and SRSF1-3 and the formation of a protein complex that contained them both, although SRSF1-3 was dispensable for nuclear import of AID. Expression of either SRSF1-3 or a C-terminally-truncated AID mutant increased IgV diversification in DT40 cells. However, overexpression of exogenous SRSF1-3 was unable to further enhance IgV diversification in DT40 cells expressing the truncated AID mutant, although SRSF1-3 was able to form a protein complex with the AID mutant. These results suggest that SRSF1-3 promotes nuclear localization of AID probably by forming a nuclear protein complex, which might stabilize nuclear AID and induce IgV diversification in an AID C-terminus-dependent manner. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Phycocyanobilin promotes PC12 cell survival and modulates immune and inflammatory genes and oxidative stress markers in acute cerebral hypoperfusion in rats

    Energy Technology Data Exchange (ETDEWEB)

    Marín-Prida, Javier [Centre for Research and Biological Evaluations (CEIEB), Institute of Pharmacy and Food, University of Havana, Ave. 23 e/ 214 y 222, La Lisa, PO Box: 430, Havana (Cuba); Pavón-Fuentes, Nancy [International Centre for Neurological Restoration (CIREN), Ave. 25 e/ 158 y 160, Playa, PO Box: 11300, Havana (Cuba); Llópiz-Arzuaga, Alexey; Fernández-Massó, Julio R. [Centre for Genetic Engineering and Biotechnology (CIGB), Ave. 31 e/158 y 190, Playa, PO Box: 6162, Havana (Cuba); Delgado-Roche, Liván [Centre for Research and Biological Evaluations (CEIEB), Institute of Pharmacy and Food, University of Havana, Ave. 23 e/ 214 y 222, La Lisa, PO Box: 430, Havana (Cuba); Mendoza-Marí, Yssel; Santana, Seydi Pedroso; Cruz-Ramírez, Alieski; Valenzuela-Silva, Carmen; Nazábal-Gálvez, Marcelo; Cintado-Benítez, Alberto [Centre for Genetic Engineering and Biotechnology (CIGB), Ave. 31 e/158 y 190, Playa, PO Box: 6162, Havana (Cuba); Pardo-Andreu, Gilberto L. [Centre for Research and Biological Evaluations (CEIEB), Institute of Pharmacy and Food, University of Havana, Ave. 23 e/ 214 y 222, La Lisa, PO Box: 430, Havana (Cuba); Polentarutti, Nadia [Istituto Clinico Humanitas (IRCCS), Rozzano (Italy); Riva, Federica [Department of Veterinary Science and Public Health (DIVET), University of Milano (Italy); Pentón-Arias, Eduardo [Centre for Genetic Engineering and Biotechnology (CIGB), Ave. 31 e/158 y 190, Playa, PO Box: 6162, Havana (Cuba); Pentón-Rol, Giselle [Centre for Genetic Engineering and Biotechnology (CIGB), Ave. 31 e/158 y 190, Playa, PO Box: 6162, Havana (Cuba)

    2013-10-01

    Since the inflammatory response and oxidative stress are involved in the stroke cascade, we evaluated here the effects of Phycocyanobilin (PCB, the C-Phycocyanin linked tetrapyrrole) on PC12 cell survival, the gene expression and the oxidative status of hypoperfused rat brain. After the permanent bilateral common carotid arteries occlusion (BCCAo), the animals were treated with saline or PCB, taking samples 24 h post-surgery. Global gene expression was analyzed with GeneChip Rat Gene ST 1.1 from Affymetrix; the expression of particular genes was assessed by the Fast SYBR Green RT-PCR Master Mix and Bioplex methods; and redox markers (MDA, PP, CAT, SOD) were evaluated spectrophotometrically. The PCB treatment prevented the H{sub 2}O{sub 2} and glutamate induced PC12 cell injury assessed by the MTT assay, and modulated 190 genes (93 up- and 97 down-regulated) associated to several immunological and inflammatory processes in BCCAo rats. Furthermore, PCB positively modulated 19 genes mostly related to a detrimental pro-inflammatory environment and counteracted the oxidative imbalance in the treated BCCAo animals. Our results support the view of an effective influence of PCB on major inflammatory mediators in acute cerebral hypoperfusion. These results suggest that PCB has a potential to be a treatment for ischemic stroke for which further studies are needed. - Highlights: • Phycocyanobilin (PCB) prevents H{sub 2}O{sub 2} and glutamate induced PC12 cell viability loss. • Anterior cortex and striatum are highly vulnerable to cerebral hypoperfusion (CH). • PCB modulates 190 genes associated to inflammation in acute CH. • PCB regulates 19 genes mostly related to a detrimental pro-inflammatory environment. • PCB restores redox and immune balances showing promise as potential stroke therapy.

  1. Phycocyanobilin promotes PC12 cell survival and modulates immune and inflammatory genes and oxidative stress markers in acute cerebral hypoperfusion in rats

    International Nuclear Information System (INIS)

    Marín-Prida, Javier; Pavón-Fuentes, Nancy; Llópiz-Arzuaga, Alexey; Fernández-Massó, Julio R.; Delgado-Roche, Liván; Mendoza-Marí, Yssel; Santana, Seydi Pedroso; Cruz-Ramírez, Alieski; Valenzuela-Silva, Carmen; Nazábal-Gálvez, Marcelo; Cintado-Benítez, Alberto; Pardo-Andreu, Gilberto L.; Polentarutti, Nadia; Riva, Federica; Pentón-Arias, Eduardo; Pentón-Rol, Giselle

    2013-01-01

    Since the inflammatory response and oxidative stress are involved in the stroke cascade, we evaluated here the effects of Phycocyanobilin (PCB, the C-Phycocyanin linked tetrapyrrole) on PC12 cell survival, the gene expression and the oxidative status of hypoperfused rat brain. After the permanent bilateral common carotid arteries occlusion (BCCAo), the animals were treated with saline or PCB, taking samples 24 h post-surgery. Global gene expression was analyzed with GeneChip Rat Gene ST 1.1 from Affymetrix; the expression of particular genes was assessed by the Fast SYBR Green RT-PCR Master Mix and Bioplex methods; and redox markers (MDA, PP, CAT, SOD) were evaluated spectrophotometrically. The PCB treatment prevented the H 2 O 2 and glutamate induced PC12 cell injury assessed by the MTT assay, and modulated 190 genes (93 up- and 97 down-regulated) associated to several immunological and inflammatory processes in BCCAo rats. Furthermore, PCB positively modulated 19 genes mostly related to a detrimental pro-inflammatory environment and counteracted the oxidative imbalance in the treated BCCAo animals. Our results support the view of an effective influence of PCB on major inflammatory mediators in acute cerebral hypoperfusion. These results suggest that PCB has a potential to be a treatment for ischemic stroke for which further studies are needed. - Highlights: • Phycocyanobilin (PCB) prevents H 2 O 2 and glutamate induced PC12 cell viability loss. • Anterior cortex and striatum are highly vulnerable to cerebral hypoperfusion (CH). • PCB modulates 190 genes associated to inflammation in acute CH. • PCB regulates 19 genes mostly related to a detrimental pro-inflammatory environment. • PCB restores redox and immune balances showing promise as potential stroke therapy

  2. 3-Deoxysappanchalcone Promotes Proliferation of Human Hair Follicle Dermal Papilla Cells and Hair Growth in C57BL/6 Mice by Modulating WNT/β-Catenin and STAT Signaling

    Science.gov (United States)

    Kim, Young Eun; Choi, Hyung Chul; Lee, In-Chul; Yuk, Dong Yeon; Lee, Hyosung; Choi, Bu Young

    2016-01-01

    3-Deoxysappanchalcone (3-DSC) has been reported to possess anti-allergic, antiviral, anti-inflammatory and antioxidant activities. In the present study, we investigated the effects of 3-DSC on the proliferation of human hair follicle dermal papilla cells (HDPCs) and mouse hair growth in vivo. A real-time cell analyzer system, luciferase assay, Western blot and real-time polymerase chain reaction (PCR) were employed to measure the biochemical changes occurring in HDPCs in response to 3-DSC treatment. The effect of 3-DSC on hair growth in C57BL/6 mice was also examined. 3-DSC promoted the proliferation of HDPCs, similar to Tofacitinib, an inhibitor of janus-activated kinase (JAK). 3-DSC promoted phosphorylation of β-catenin and transcriptional activation of the T-cell factor. In addition, 3-DSC potentiated interleukin-6 (IL-6)-induced phosphorylation and subsequent transactivation of signal transducer and activator of transcription-3 (STAT3), thereby increasing the expression of cyclin-dependent kinase-4 (Cdk4), fibroblast growth factor (FGF) and vascular endothelial growth factor (VEGF). On the contrary, 3-DSC attenuated STAT6 mRNA expression and IL4-induced STAT6 phosphorylation in HDPCs. Finally, we observed that topical application of 3-DSC promoted the anagen phase of hair growth in C57BL/6 mice. 3-DSC stimulates hair growth possibly by inducing proliferation of follicular dermal papilla cells via modulation of WNT/β-catenin and STAT signaling. PMID:27795451

  3. Functional effects of polymorphisms on glucocorticoid receptor modulation of human anxiogenic substance-P gene promoter activity in primary amygdala neurones.

    Science.gov (United States)

    Hay, Colin W; Shanley, Lynne; Davidson, Scott; Cowie, Philip; Lear, Marissa; McGuffin, Peter; Riedel, Gernot; McEwan, Iain J; MacKenzie, Alasdair

    2014-09-01

    Expression or introduction of the neuropeptide substance-P (SP; encoded by the TAC1 gene in humans and Tac1 in rodents) in the amygdala induces anxiety related behaviour in rodents. In addition, pharmacological antagonism of the main receptor of SP in humans; NK1, is anxiolytic. In the current study, we show that the Tac1 locus is up-regulated in primary rat amygdala neurones in response to activation of the glucocorticoid receptor (GR); a classic component of the stress response. Using a combination of bioinformatics, electrophoretic mobility shift assays (EMSA) and reporter plasmid magnetofection into rat primary amygdala neurones we identified a highly conserved GR response sequence (2GR) in the human TAC1 promoter that binds GR in response to dexamethasone (Dex) or forskolin. We also identified a second GR binding site in the human promoter that was polymorphic and whose T-allele is only found in Japanese and Chinese populations. We present evidence that the T-allele of SNPGR increases the activity of the TAC1 promoter through de-sequestration or de-repression of 2GR. The identification of Dex/forskolin response elements in the TAC1 promoter in amygdala neurones suggests a possible link in the chain of molecular events connecting GR activation and anxiety. In addition, the discovery of a SNP which can alter this response may have implications for our understanding of the role of regulatory variation in susceptibility to stress in specific populations. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  4. Bacillus aryabhattai SRB02 tolerates oxidative and nitrosative stress and promotes the growth of soybean by modulating the production of phytohormones

    Science.gov (United States)

    Kang, Sang-Mo; Shahzad, Raheem; Seo, Chang-Woo; Kim, Ah-Yeong; Lee, Sang-Uk; Oh, Kyeong Yeol; Lee, Dong Yeol; Lee, In-Jung; Yun, Byung-Wook

    2017-01-01

    Plant growth promoting rhizobacteria (PGPR) are diverse, naturally occurring bacteria that establish a close association with plant roots and promote the growth and immunity of plants. Established mechanisms involved in PGPR-mediated plant growth promotion include regulation of phytohormones, improved nutrient availability, and antagonistic effects on plant pathogens. In this study, we isolated a bacterium from the rhizospheric soil of a soybean field in Chungcheong buk-do, South Korea. Using 16S rRNA sequencing, the bacterium was identified as Bacillus aryabhattai strain SRB02. Here we show that this strain significantly promotes the growth of soybean. Gas chromatography—mass spectrometry analysis showed that SRB02 produced significant amounts of abscisic acid, indole acetic acid, cytokinin and different gibberellic acids in culture. SRB02-treated soybean plants showed significantly better heat stress tolerance than did untreated plants. These plants also produced consistent levels of ABA under heat stress and exhibited ABA-mediated stomatal closure. High levels of IAA, JA, GA12, GA4, and GA7, were recorded in SRB02-treated plants. These plants produced longer roots and shoots than those of control plants. B. aryabhattai SRB02 was found to be highly tolerant to oxidative stress induced by H2O2 and MV potentiated by high catalase (CAT) and superoxide dismutase (SOD) activities. SRB02 also tolerated high nitrosative stress induced by the nitric oxide donors GSNO and CysNO. Because of these attributes, B. aryabhattai SRB02 may prove to be a valuable resource for incorporation in biofertilizers and other soil amendments that seek to improve crop productivity. PMID:28282395

  5. Bacillus aryabhattai SRB02 tolerates oxidative and nitrosative stress and promotes the growth of soybean by modulating the production of phytohormones.

    Directory of Open Access Journals (Sweden)

    Yeon-Gyeong Park

    Full Text Available Plant growth promoting rhizobacteria (PGPR are diverse, naturally occurring bacteria that establish a close association with plant roots and promote the growth and immunity of plants. Established mechanisms involved in PGPR-mediated plant growth promotion include regulation of phytohormones, improved nutrient availability, and antagonistic effects on plant pathogens. In this study, we isolated a bacterium from the rhizospheric soil of a soybean field in Chungcheong buk-do, South Korea. Using 16S rRNA sequencing, the bacterium was identified as Bacillus aryabhattai strain SRB02. Here we show that this strain significantly promotes the growth of soybean. Gas chromatography-mass spectrometry analysis showed that SRB02 produced significant amounts of abscisic acid, indole acetic acid, cytokinin and different gibberellic acids in culture. SRB02-treated soybean plants showed significantly better heat stress tolerance than did untreated plants. These plants also produced consistent levels of ABA under heat stress and exhibited ABA-mediated stomatal closure. High levels of IAA, JA, GA12, GA4, and GA7, were recorded in SRB02-treated plants. These plants produced longer roots and shoots than those of control plants. B. aryabhattai SRB02 was found to be highly tolerant to oxidative stress induced by H2O2 and MV potentiated by high catalase (CAT and superoxide dismutase (SOD activities. SRB02 also tolerated high nitrosative stress induced by the nitric oxide donors GSNO and CysNO. Because of these attributes, B. aryabhattai SRB02 may prove to be a valuable resource for incorporation in biofertilizers and other soil amendments that seek to improve crop productivity.

  6. Cancer-promoting effect of capsaicin on DMBA/TPA-induced skin tumorigenesis by modulating inflammation, Erk and p38 in mice.

    Science.gov (United States)

    Liu, Zhaoguo; Zhu, Pingting; Tao, Yu; Shen, Cunsi; Wang, Siliang; Zhao, Lingang; Wu, Hongyan; Fan, Fangtian; Lin, Chao; Chen, Chen; Zhu, Zhijie; Wei, Zhonghong; Sun, Lihua; Liu, Yuping; Wang, Aiyun; Lu, Yin

    2015-07-01

    Epidemiologic and animal studies revealed that capsaicin (8-methyl-N-vanillyl-6-noneamide) can act as a carcinogen or cocarcinogen. However, the influence of consumption of capsaicin-containing foods or vegetables on skin cancer patients remains largely unknown. In the present study, we demonstrated that capsaicin has a cocarcinogenic effect on 9, 10-dimethylbenz[a]anthracene (DMBA)/12-O-tetradecanoylphorbol-13-acetate (TPA)-induced skin tumorigenesis. Our results showed that topical application of capsaicin on the dorsal skin of DMBA-initiated and TPA-promoted mice could significantly accelerate tumor formation and growth and induce more and larger skin tumors than the model group (DMBA + TPA). Moreover, capsaicin could promote TPA-induced skin hyperplasia and tumor proliferation. Mechanistic study found that inflammation-related factors cyclooxygenase-2 (COX-2) and inducible nitric oxide synthase (iNOS) were highly elevated by pretreatment with capsaicin, suggesting an inflammation-dependent mechanism. Furthermore, mice that were administered capsaicin exhibited significant up-regulation of phosphorylation of nuclear factor kappaB (NF-κB), Erk and p38 but had no effect on JNK. Thus, our results indicated that inflammation, Erk and P38 collectively played a crucial role in cancer-promoting effect of capsaicin on carcinogen-induced skin cancer in mice. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. An Intergenic Region Shared by At4g35985 and At4g35987 in Arabidopsis thaliana Is a Tissue Specific and Stress Inducible Bidirectional Promoter Analyzed in Transgenic Arabidopsis and Tobacco Plants

    Science.gov (United States)

    Banerjee, Joydeep; Sahoo, Dipak Kumar; Dey, Nrisingha; Houtz, Robert L.; Maiti, Indu Bhushan

    2013-01-01

    On chromosome 4 in the Arabidopsis genome, two neighboring genes (calmodulin methyl transferase At4g35987 and senescence associated gene At4g35985) are located in a head-to-head divergent orientation sharing a putative bidirectional promoter. This 1258 bp intergenic region contains a number of environmental stress responsive and tissue specific cis-regulatory elements. Transcript analysis of At4g35985 and At4g35987 genes by quantitative real time PCR showed tissue specific and stress inducible expression profiles. We tested the bidirectional promoter-function of the intergenic region shared by the divergent genes At4g35985 and At4g35987 using two reporter genes (GFP and GUS) in both orientations in transient tobacco protoplast and Agro-infiltration assays, as well as in stably transformed transgenic Arabidopsis and tobacco plants. In transient assays with GFP and GUS reporter genes the At4g35985 promoter (P85) showed stronger expression (about 3.5 fold) compared to the At4g35987 promoter (P87). The tissue specific as well as stress responsive functional nature of the bidirectional promoter was evaluated in independent transgenic Arabidopsis and tobacco lines. Expression of P85 activity was detected in the midrib of leaves, leaf trichomes, apical meristemic regions, throughout the root, lateral roots and flowers. The expression of P87 was observed in leaf-tip, hydathodes, apical meristem, root tips, emerging lateral root tips, root stele region and in floral tissues. The bidirectional promoter in both orientations shows differential up-regulation (2.5 to 3 fold) under salt stress. Use of such regulatory elements of bidirectional promoters showing spatial and stress inducible promoter-functions in heterologous system might be an important tool for plant biotechnology and gene stacking applications. PMID:24260266

  8. An intergenic region shared by At4g35985 and At4g35987 in Arabidopsis thaliana is a tissue specific and stress inducible bidirectional promoter analyzed in transgenic arabidopsis and tobacco plants.

    Directory of Open Access Journals (Sweden)

    Joydeep Banerjee

    Full Text Available On chromosome 4 in the Arabidopsis genome, two neighboring genes (calmodulin methyl transferase At4g35987 and senescence associated gene At4g35985 are located in a head-to-head divergent orientation sharing a putative bidirectional promoter. This 1258 bp intergenic region contains a number of environmental stress responsive and tissue specific cis-regulatory elements. Transcript analysis of At4g35985 and At4g35987 genes by quantitative real time PCR showed tissue specific and stress inducible expression profiles. We tested the bidirectional promoter-function of the intergenic region shared by the divergent genes At4g35985 and At4g35987 using two reporter genes (GFP and GUS in both orientations in transient tobacco protoplast and Agro-infiltration assays, as well as in stably transformed transgenic Arabidopsis and tobacco plants. In transient assays with GFP and GUS reporter genes the At4g35985 promoter (P85 showed stronger expression (about 3.5 fold compared to the At4g35987 promoter (P87. The tissue specific as well as stress responsive functional nature of the bidirectional promoter was evaluated in independent transgenic Arabidopsis and tobacco lines. Expression of P85 activity was detected in the midrib of leaves, leaf trichomes, apical meristemic regions, throughout the root, lateral roots and flowers. The expression of P87 was observed in leaf-tip, hydathodes, apical meristem, root tips, emerging lateral root tips, root stele region and in floral tissues. The bidirectional promoter in both orientations shows differential up-regulation (2.5 to 3 fold under salt stress. Use of such regulatory elements of bidirectional promoters showing spatial and stress inducible promoter-functions in heterologous system might be an important tool for plant biotechnology and gene stacking applications.

  9. The effect of metallothionein 2A core promoter region single-nucleotide polymorphism on accumulation of toxic metals in sinonasal inverted papilloma tissues

    Energy Technology Data Exchange (ETDEWEB)

    Starska, Katarzyna, E-mail: katarzyna.starska@umed.lodz.pl [I Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Kopcinskiego 22, 90-153 Łódź (Poland); Bryś, Magdalena; Forma, Ewa [Department of Cytobiochemistry, University of Łódź, Pomorska 142/143, 90-236 Łódź (Poland); Olszewski, Jurek; Pietkiewicz, Piotr [II Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Żeromskiego 113, 90-549 Łódź (Poland); Lewy-Trenda, Iwona; Danilewicz, Marian [Department of Pathology, Medical University of Łódź, Pomorska 251, 92-213 Łódź (Poland); Krześlak, Anna [Department of Cytobiochemistry, University of Łódź, Pomorska 142/143, 90-236 Łódź (Poland)

    2015-06-15

    Metallothioneins (MTs) are intracellular thiol-rich heavy metal-binding proteins which join trace metal ions protecting cells against heavy metal toxicity and regulate metal distribution and donation to various enzymes and transcription factors. The goal of this study was to identify the − 5 A/G (rs28366003) single-nucleotide polymorphism (SNP) in the core promoter region of the MT2A gene, and to investigate its effect on allele-specific gene expression and Cd, Zn, Cu and Ni content in sinonasal inverted papilloma tissue (IP), with non-cancerous sinonasal mucosa (NCM) as a control. The MT2A promoter region − 5 A/G SNP was identified by restriction fragment length polymorphism using 117 IP and 132 NCM. MT2A gene analysis was performed by quantitative real-time PCR. Metal levels were analyzed by flame atomic absorption spectrometry. The frequency of A allele carriage was 99.2% and 100% in IP and NCM, respectively. The G allele carriage was detected in 23.9% of IP and in 12.1% of the NCM samples. As a result, a significant association of − 5 A/G SNP in MT2A gene with mRNA expression in both groups was determined. A significant association was identified between the − 5 A/G SNP in the MT2A gene with mRNA expression in both groups. A highly significant association was detected between the rs28366003 genotype and Cd and Zn content in IP. Furthermore, significant differences were identified between A/A and A/G genotype with regard to the type of metal contaminant. The Spearman rank correlation results showed the MT2A gene expression and both Cd and Cu levels were negatively correlated. The results obtained in this study suggest that the − 5 A/G SNP in the MT2A gene may have an effect on allele-specific gene expression and toxic metal accumulation in sinonasal inverted papilloma. - Highlights: • MT2A gene expression and metal content in sinonasal inverted papilloma tissues • Association between SNP (rs28366003) and expression of MT2A • Significant

  10. Polymorphisms in the presumptive promoter region of the SLC2A9 gene are associated with gout in a Chinese male population.

    Science.gov (United States)

    Li, Changgui; Chu, Nan; Wang, Binbin; Wang, Jing; Luan, Jian; Han, Lin; Meng, Dongmei; Wang, Yunlong; Suo, Peisu; Cheng, Longfei; Ma, Xu; Miao, Zhimin; Liu, Shiguo

    2012-01-01

    Glucose transporter 9 (GLUT9) is a high-capacity/low-affinity urate transporter. To date, several recent genome-wide association studies (GWAS) and follow-up studies have identified genetic variants of SLC2A9 associated with urate concentrations and susceptibility to gout. We therefore investigated associations between gout and polymorphisms and haplotypes in the presumptive promoter region of GLUT9 in Chinese males. The approximately 2000 bp presumptive promoter region upstream of the start site of exon 1 of GLUT9 was sequenced and subjected to genetic analysis. A genotype-phenotype correlation was performed and polymorphisms-induced changes in transcription factor binding sites were predicted. Of 21 SNPs identified in GLUT9, five had not been previously reported. Two of the SNPs (rs13124007 and rs6850166) were associated with susceptibility to gout (p = 0.009 and p = 0.042, respectively). The C allele of rs13124007 appeared to be the risk allele for predisposition to gout (p = 0.006, OR 1.709 [95% CI 1.162-2.514]). For rs6850166, an increased risk of gout was associated with the A allele (p = 0.029, OR 1.645 [95% CI 1.050-2.577]). After Bonferroni correction, there was statistically difference in rs13124007 allele frequencies between gout cases and controls (P = 0.042). Haplotype analyses showed that haplotype GG was a protective haplotype (p = 0.0053) and haplotype CA was associated with increased risk of gout (p = 0.0326). Genotype-phenotype analysis among gout patients revealed an association of rs13124007 with serum triglycerides levels (P = 0.001). The C to G substitution in polymorphism rs13124007 resulted in a loss of a binding site for transcription factor interferon regulatory factor 1 (IRF-1). Polymorphisms rs13124007 and rs6850166 are associated with susceptibility to gout in Chinese males.

  11. Modulation of aerosol radiative forcing due to mixing state in clear and cloudy-sky: A case study from Delhi National Capital Region, India

    Science.gov (United States)

    Srivastava, Parul; Dey, Sagnik; Srivastava, Atul K.; Singh, Sachchidanand; Tiwari, Suresh; Agarwal, Poornima

    2016-04-01

    Aerosol properties change with the change in mixing state of aerosols and therefore it is a source of uncertainty in estimated aerosol radiative forcing (ARF) from observations or by models assuming a specific mixing state. The problem is important in the Indo-Gangetic Basin, Northern India, where various aerosol types mix and show strong seasonal variations. Quantifying the modulation of ARF by mixing state is hindered by lack of knowledge about proper aerosol composition. Hence, first a detailed chemical composition analysis of aerosols for Delhi National capital region (NCR) is carried out. Aerosol composition is arranged quantitatively into five major aerosol types - accumulation dust, coarse dust, water soluble (WS), water insoluble (WINS), and black carbon (BC) (directly measured by Athelometer). Eight different mixing cases - external mixing, internal mixing, and six combinations of core- shell mixing (BC over dust, WS over dust, WS over BC, BC over WS, WS over WINS, and BC over WINS; each of the combinations externally mixed with other species) have been considered. The spectral aerosol optical properties - extinction coefficient, single scattering albedo (SSA) and asymmetry parameter (g) for each of the mixing cases are calculated and finally 'clear-sky' and 'cloudy-sky' ARF at the top-of-the-atmosphere (TOA) and surface are estimated using a radiative transfer model. Comparison of surface-reaching flux for each of the cases with MERRA downward shortwave surface flux reveals the most likely mixing state. 'BC-WINS+WS+Dust' show least deviation relative to MERRA during the pre-monsoon (MAMJ) and monsoon (JAS) seasons and hence is the most probable mixing states. During the winter season (DJF), 'BC-Dust+WS+WINS' case shows the closest match with MERRA, while external mixing is the most probable mixing state in the post-monsoon season (ON). Lowest values for both TOA and surface 'clear-sky' ARF is observed for 'BC-WINS+WS+ Dust' mixing case. TOA ARF is 0.28±2

  12. Can a peri-rectal hydrogel spaceOAR programme for prostate cancer intensity-modulated radiotherapy be successfully implemented in a regional setting?

    Science.gov (United States)

    Te Velde, Bridget L; Westhuyzen, Justin; Awad, Nader; Wood, Maree; Shakespeare, Thomas P

    2017-08-01

    The aim of this study was to investigate whether the implementation of a hydrogel spacer (SpaceOAR) programme for patients treated with 81 Gy prostate intensity-modulated radiotherapy (IMRT) in a regional setting can reduce rectal doses and toxicity. In this retrospective study, 125 patients with localised prostate cancer treated between April 2014 (programme commencement) and June 2015 were compared: 65 with SpaceOAR (inserted by five different urologists) and 60 patients treated over the same time period without SpaceOAR. Patients were treated with 81 Gy in 45Fx of IMRT over 9 weeks. Planning aims included restricting rectal doses to V40 Gy < 35%, V65 Gy < 17%, V75 Gy < 10%. Acute toxicity was assessed weekly during radiotherapy and at 12 weeks. Rectal volume parameters were all significantly lower in the SpaceOAR group, with an associated reduction in acute diarrhoea (13.8% vs 31.7%). There were no significant differences in the very low rates of acute and late faecal incontinence or proctitis, however, there was a trend towards increased haemorrhoid rate in the SpaceOAR group (11.7% vs 3.1%, P = 0.09). A SpaceOAR programme in a regional setting with urologists performing low volumes of insertions (<1 per month on average) is of clinical benefit, and was associated with significantly lower radiation doses to the rectum and lower rates of acute diarrhoea. © 2017 The Royal Australian and New Zealand College of Radiologists.

  13. Predictive factors of local-regional recurrences following parotid sparing intensity modulated or 3D conformal radiotherapy for head and neck cancer

    International Nuclear Information System (INIS)

    Feng, Mary; Jabbari, Siavash; Lin, Alexander; Bradford, Carol R.; Chepeha, Douglas B.; Teknos, Theodoros N.; Worden, Francis P.; Tsien, Christina; Schipper, Matthew J.; Wolf, Gregory T.; Dawson, Laura A.; Eisbruch, Avraham

    2005-01-01

    Background and purpose: Predictive factors for local-regional (LR) failures after parotid-sparing, Intensity modulated (IMRT) or 3D conformal radiotherapy for head and neck (HN) cancers were assessed. Patients and methods: One hundred and fifty-eight patients with mostly stages III-IV HN squamous cell carcinoma underwent curative bilateral neck irradiation aimed at sparing the parotid glands. Patient, tumor, and treatment factors were analyzed as predictive factors for LR failure. Results: Twenty-three patients had LR recurrence (19 in-field and four marginal). No differences were found in the doses delivered to the PTVs of patients with or without in-field recurrences. In univariate analysis, tumor site was highly predictive for LR failure in both postoperative and definitive RT patients. In postoperative RT patients, pathologic tumor size, margin status, extracapsular extension (ECE) and number of lymph node metastases, were also significantly predictive. Multivariate analysis showed tumor site (oropharynx vs. other sites) to be a significant predictor in all patients, and involved margins and number of involved lymph nodes in postoperative patients. Conclusions: Clinical rather than dosimetric factors predicted for LR failures in this series, and were similar to those reported following standard RT. These factors may aid in the selection of patients for studies of treatment intensification using IMRT

  14. Factor H Binds to the Hypervariable Region of Many Streptococcus pyogenes M Proteins but Does Not Promote Phagocytosis Resistance or Acute Virulence

    Science.gov (United States)

    Kristensen, Bodil M.; Olsen, John E.; Harris, Claire L.; Ufret-Vincenty, Rafael L.; Stålhammar-Carlemalm, Margaretha; Lindahl, Gunnar

    2013-01-01

    Many pathogens express a surface protein that binds the human complement regulator factor H (FH), as first described for Streptococcus pyogenes and the antiphagocytic M6 protein. It is commonly assumed that FH recruited to an M protein enhances virulence by protecting the bacteria against complement deposition and phagocytosis, but the role of FH-binding in S. pyogenes pathogenesis has remained unclear and controversial. Here, we studied seven purified M proteins for ability to bind FH and found that FH binds to the M5, M6 and M18 proteins but not the M1, M3, M4 and M22 proteins. Extensive immunochemical analysis indicated that FH binds solely to the hypervariable region (HVR) of an M protein, suggesting that selection has favored the ability of certain HVRs to bind FH. These FH-binding HVRs could be studied as isolated polypeptides that retain ability to bind FH, implying that an FH-binding HVR represents a distinct ligand-binding domain. The isolated HVRs specifically interacted with FH among all human serum proteins, interacted with the same region in FH and showed species specificity, but exhibited little or no antigenic cross-reactivity. Although these findings suggested that FH recruited to an M protein promotes virulence, studies in transgenic mice did not demonstrate a role for bound FH during acute infection. Moreover, phagocytosis tests indicated that ability to bind FH is neither sufficient nor necessary for S. pyogenes to resist killing in whole human blood. While these data shed new light on the HVR of M proteins, they suggest that FH-binding may affect S. pyogenes virulence by mechanisms not assessed in currently used model systems. PMID:23637608

  15. Factor H binds to the hypervariable region of many Streptococcus pyogenes M proteins but does not promote phagocytosis resistance or acute virulence.

    Directory of Open Access Journals (Sweden)

    Mattias C U Gustafsson

    Full Text Available Many pathogens express a surface protein that binds the human complement regulator factor H (FH, as first described for Streptococcus pyogenes and the antiphagocytic M6 protein. It is commonly assumed that FH recruited to an M protein enhances virulence by protecting the bacteria against complement deposition and phagocytosis, but the role of FH-binding in S. pyogenes pathogenesis has remained unclear and controversial. Here, we studied seven purified M proteins for ability to bind FH and found that FH binds to the M5, M6 and M18 proteins but not the M1, M3, M4 and M22 proteins. Extensive immunochemical analysis indicated that FH binds solely to the hypervariable region (HVR of an M protein, suggesting that selection has favored the ability of certain HVRs to bind FH. These FH-binding HVRs could be studied as isolated polypeptides that retain ability to bind FH, implying that an FH-binding HVR represents a distinct ligand-binding domain. The isolated HVRs specifically interacted with FH among all human serum proteins, interacted with the same region in FH and showed species specificity, but exhibited little or no antigenic cross-reactivity. Although these findings suggested that FH recruited to an M protein promotes virulence, studies in transgenic mice did not demonstrate a role for bound FH during acute infection. Moreover, phagocytosis tests indicated that ability to bind FH is neither sufficient nor necessary for S. pyogenes to resist killing in whole human blood. While these data shed new light on the HVR of M proteins, they suggest that FH-binding may affect S. pyogenes virulence by mechanisms not assessed in currently used model systems.

  16. Mutagenesis of the lac promoter region in M13 mp10 phage DNA by 4'-hydroxymethyl-4,5',8-trimethylpsoralen

    International Nuclear Information System (INIS)

    Piette, J.; Decuyper-Debergh, D.; Gamper, H.

    1985-01-01

    Double-stranded M13 phage DNA (M13 mp10 replicative form) was photoreacted with 4'-hydroxymethyl-4,5',8-trimethylpsoralen, using light of wavelength greater than 320 nm or greater than 390 nm to generate predominantly crosslinks or monoadducts, respectively. The damaged DNAs were scored for inactivation and mutagenesis after transfection into Escherichia coli. The appearance of light-blue or colorless plaques on indicator medium showed that mutation had occurred in the lac insert of the viral DNA. A comparison of the consequences of the two phototreatments with psoralen supports the idea that crosslinks are both more lethal and more mutagenic than monoadducts. Numerous mutant clones partially or totally deficient in beta-galactosidase were plaque-purified and amplified. The viral DNA of each clone was sequenced by the dideoxy chain-terminating procedure. All of the observed base-pair changes were mapped to the lac promoter region and consisted of 3 transition, 14 transversion, and 6 single base-pair frame-shift mutations. The predominant mutation was a T.A----G.C transversion

  17. A multistakeholder platform to promote health and prevent noncommunicable diseases in the region of the Americas: the Pan American Health Organization partners forum for action.

    Science.gov (United States)

    Hospedales, C James; Jané-Llopis, Eva

    2011-08-01

    Noncommunicable diseases (NCDs) and obesity are the most serious health problem facing the countries of the Americas in terms of avoidable deaths as well as costs to governments, families, and business. The main causes are ageing of the population, and widespread risks such as tobacco use, unhealthy diet, physical inactivity, and harmful use of alcohol, linked to major changes in the way we live and work, to public policies, cultural norms, and private sector forces. Underlying determinants are globalization, urbanization, poverty, education, gender, ethnicity, and access to health services. Yet, approximately 80% of cardiovascular disease and diabetes, and 40% of cancer, are preventable through a range of cost-effective population and individual measures for those at high risk of living with NCDs. However, the multisectoral nature of NCDs requires a cross-sector response to succeed. Several governments have commenced intersectoral efforts, and civil society and private sector also have many initiatives, but the responses are fragmented and skewed. The Partners Forum is being launched by the Pan American Health Organization in collaboration with the World Economic Forum and a set of partners including member states, partners in civil society, and partners in the private sector, as a multisector platform to catalyze, recognize, and scale up collaborative action to promote health and prevent and control NCDs at regional, subregional, and country level. The principles of partnership and lessons learned from other partnership experiences are being used in its design.

  18. The -2549 insertion/deletion polymorphism in the promoter region of VEGF is associated with the risk of recurrent spontaneous abortion.

    Science.gov (United States)

    Hashemi, Mohammad; Danesh, Hiva; Bizhani, Fatemeh; Mokhtari, Mojgan; Bahari, Gholamreza; Tabasi, Farhad; Taheri, Mohsen

    2018-03-01

    Recurrent spontaneous abortion (RSA) is a common health problem affecting women of reproductive age. Altered expression of vascular endothelial growth factor ( VEGF ) has been associated with spontaneous abortion. The present case-control study aimed to evaluate the impact of the 18-bp insertion/deletion (ins/del) polymorphism (rs35569394) in the promoter region of the VEGF gene on idiopathic RSA. Genomic DNA from 93 patients with RSA and 93 healthy fertile women of southeastern Iran was isolated using the salting-out method. Genotyping of the rs35569394 variant was performed by a polymerase chain reaction (PCR) method. The findings indicated that the VEGF 18-bp ins/del variant significantly increased the risk of RSA under codominant (ins/ins vs. del/del; OR=2.85, 95% CI=1.31-6.22, P=0.019), dominant (del/ins+ins/ins vs. del/del; OR=2.19, 95% CI=1.20-4.01, P=0.015) and allelic (ins vs. del; OR=1.90, 95% CI=1.25-2.88, P=0.003) inheritance models. In summary, the findings propose a significant association between the VEGF 18-bp ins/del polymorphism and risk of RSA in a sample of the southeast Iranian population. Further studies on larger sample sizes and different ethnicities are required to validate the present findings.

  19. Patterns of local-regional recurrence following parotid-sparing conformal and segmental intensity-modulated radiotherapy for head and neck cancer

    International Nuclear Information System (INIS)

    Dawson, Laura A.; Anzai, Yoshimi; Marsh, Lon; Martel, Mary K.; Paulino, Augusto; Ship, Jonathan A.; Eisbruch, Avraham

    2000-01-01

    Purpose: To analyze the patterns of local-regional recurrence in patients with head and neck cancer treated with parotid-sparing conformal and segmental intensity-modulated radiotherapy (IMRT). Methods and Materials: Fifty-eight patients with head and neck cancer were treated with bilateral neck radiation (RT) using conformal or segmental IMRT techniques, while sparing a substantial portion of one parotid gland. The targets for CT-based RT planning included the gross tumor volume (GTV) (primary tumor and lymph node metastases) and the clinical target volume (CTV) (postoperative tumor bed, expansions of the GTVs and lymph node groups at risk of subclinical disease). Lymph node targets at risk of subclinical disease included the bilateral jugulodigastric and lower jugular lymph nodes, bilateral retropharyngeal lymph nodes at risk, and high jugular nodes at the base of skull in the side of the neck at highest risk (containing clinical neck metastases and/or ipsilateral to the primary tumor). The CTVs were expanded by 5 mm to yield planning target volumes (PTVs). Planning goals included coverage of all PTVs (with a minimum of 95% of the prescribed dose) and sparing of a substantial portion of the parotid gland in the side of the neck at less risk. The median RT doses to the gross tumor, the operative bed, and the subclinical disease PTVs were 70.4 Gy, 61.2 Gy, and 50.4 Gy respectively. All recurrences were defined on CT scans obtained at the time of recurrence, transferred to the pretreatment CT dataset used for RT planning, and analyzed using dose-volume histograms. The recurrences were classified as 1) 'in-field', in which 95% or more of the recurrence volume (V recur ) was within the 95% isodose; 2) 'marginal', in which 20% to 95% of V recur was within the 95% isodose; or 3) 'outside', in which less than 20% of V recur was within the 95% isodose. Results: With a median follow-up of 27 months (range 6 to 60 months), 10 regional recurrences, 5 local recurrences

  20. Patterns of local-regional recurrence following parotid-sparing conformal and segmental intensity-modulated radiotherapy for head and neck cancer.

    Science.gov (United States)

    Dawson, L A; Anzai, Y; Marsh, L; Martel, M K; Paulino, A; Ship, J A; Eisbruch, A

    2000-03-15

    To analyze the patterns of local-regional recurrence in patients with head and neck cancer treated with parotid-sparing conformal and segmental intensity-modulated radiotherapy (IMRT). Fifty-eight patients with head and neck cancer were treated with bilateral neck radiation (RT) using conformal or segmental IMRT techniques, while sparing a substantial portion of one parotid gland. The targets for CT-based RT planning included the gross tumor volume (GTV) (primary tumor and lymph node metastases) and the clinical target volume (CTV) (postoperative tumor bed, expansions of the GTVs and lymph node groups at risk of subclinical disease). Lymph node targets at risk of subclinical disease included the bilateral jugulodigastric and lower jugular lymph nodes, bilateral retropharyngeal lymph nodes at risk, and high jugular nodes at the base of skull in the side of the neck at highest risk (containing clinical neck metastases and/or ipsilateral to the primary tumor). The CTVs were expanded by 5 mm to yield planning target volumes (PTVs). Planning goals included coverage of all PTVs (with a minimum of 95% of the prescribed dose) and sparing of a substantial portion of the parotid gland in the side of the neck at less risk. The median RT doses to the gross tumor, the operative bed, and the subclinical disease PTVs were 70.4 Gy, 61.2 Gy, and 50.4 Gy respectively. All recurrences were defined on CT scans obtained at the time of recurrence, transferred to the pretreatment CT dataset used for RT planning, and analyzed using dose-volume histograms. The recurrences were classified as 1) "in-field," in which 95% or more of the recurrence volume (V(recur)) was within the 95% isodose; 2) "marginal," in which 20% to 95% of V(recur) was within the 95% isodose; or 3) "outside," in which less than 20% of V(recur) was within the 95% isodose. With a median follow-up of 27 months (range 6 to 60 months), 10 regional recurrences, 5 local recurrences (including one noninvasive recurrence) and 1

  1. Understanding, promoting and protecting geodiversity and geoheritage of the Piemonte region (Italy) through innovative techniques and public engagement in Earth Science studies

    Science.gov (United States)

    Giardino, Marco; Lozar, Francesca; Perotti, Luigi; Palomba, Mauro; Groppo, Chiara; Natalicchio, Marcello; Ghiraldi, Luca; Beltramo, Riccardo; Lombardo, Vincenzo

    2016-04-01

    The onset of Antropocene demonstrates the importance of considering both 1) geodiversity and 2) geoheritage as parts of the landscape "interfaces" where relationships between natural and socio-economic systems can be studied and interpreted. By definition: 1) is the variety, recognizable in nature ("diversity"), of geological features (rocks, minerals, fossils…), of geomorphological environments (and related forms and processes) and of soil characteristics; 2) is an integral part of the global natural heritage focusing on unique, special and representative sites of geological interests (geosites l.s.). In the Antropocene, both 1) and 2) hold a dynamic character, as the result of actions and interactions of natural and/or human factors. Therefore, geodiversity and geoheritage studies are essential for breaking down geological environments and human territories into their main parts and to understand the variables and mechanisms that control their changes. In this perspective, results of the multidisciplinary project PROGEO-Piemonte ("PROactive management of GEOlogical heritage in the Piemonte Region") are presented here: an innovative approach for assessing geodiversity in order to select areas of high potential value of geoheritage to be enhanced by targeted management actions. Since the geodiversity of Piemonte is materialized by elements of high scientific, educational, tourism, etc. value, the geosites where this geoheritage is preserved have been comprehensively analysed and characterized for encompassing both public and private interests. 9 strategic geothematic areas have been selected in the Piemonte Region to test this approach, and to improve social engagement aimed at protecting and promoting geodiversity ad geoheritage. The investigated areas represent the multifaceted geodiversity of Piemonte; each area is characterized by high potential for scientific studies, enhancement of public understanding of science, recreation activities and for economic

  2. Modulation of thyroid hormone receptor transactivation by the early region 1A (E1A-like inhibitor of differentiation 1 (EID1

    Directory of Open Access Journals (Sweden)

    Diana Vargas

    2008-01-01

    Full Text Available Transcriptional activation (TA mediated by the effect of thyroid hormones on target genes requires co-activator proteins such as the early region 1A (E1A associated 300 kDa binding protein (p300 and the cAMP response element binding protein (CREB binding protein (CBP, known as the p300/CBP complex, which acetylate histones 3 and 4 to allow transcriptional machinery access to the target gene promoter. Little is known on the role of p300 in thyroid hormone receptor (TR mediated TA but the E1A-like inhibitor of differentiation 1 (EID1, an inhibitor of p300 histone acetyltransferase (HAT, is a functional homolog of E1A and may inhibit myogenic differentiation factor D (MyoD transcriptional activity and reduces muscle cell differentiation. We evaluated the influence of EID1 on TR-mediated transcriptional activity using transfection and mammalian two-hybrid studies to show that EID1 may partially reduces TA activity of the TR receptor, probably due to p300 blockage since EID1 mutants cannot reduce TR-mediated TA. The EID1 does not affect the function of p160 co-activator proteins (160 kDa proteins of steroid receptor co-activators and is functionally independent of co-repressor proteins or TR binding. Summarizing, EID1 reduces TR-mediated transcriptional activity by blocking p300 and may play an important role in thyroid receptor activity in muscle and other tissues.

  3. Qualitative analysis of Adenomatous Polyposis Coli promoter: Hypermethylation, engagement and effects on survival of patients with esophageal cancer in a high risk region of the world, a potential molecular marker

    International Nuclear Information System (INIS)

    Zare, Maryam; Jazii, Ferdous Rastgar; Alivand, Mohammad Reza; Nasseri, Negin Karimi; Malekzadeh, Reza; Yazdanbod, Mansour

    2009-01-01

    Squamous cell carcinoma of esophagus (SCCE) occurs at a high incidence rate in certain parts of the world. This feature necessitates that different aspects of the disease and in particular genetic characteristics be investigated in such regions. In addition, such investigations might lead to achievement of molecular markers helpful for early detection, successful treatment and follow up of the disease. Adenomatous Polyposis Coli (APC) promoter hypermethylation has been shown to be a suitable marker for both serum and solid tumors of adenocarcinoma of esophagus. We investigated the status of APC promoter hypermethylation in Iranian patients, compared the results with the former studies, and evaluated its applicability as a candidate molecular marker by examining association between survival of SCCE patients and APC promoter methylation. For evaluating the status of APC promoter hypermethylation and its association with SCCE, a qualitative methylation specific PCR (MSP) was used. DNA was extracted and digested with an appropriate restriction enzyme, treated with sodium bisulfite in agarose beads and amplified in two-step PCR reaction by applying either methylated or unmethylated promoter specific primers. Universally methylated DNA and methylase treated blood DNA of healthy donors were used as positive controls as well. Survival of patients was followed up for two years after treatment and survival rate of patients with methylated APC promoter was compared with that of unmethylated patients. Assessment of APC promoter methylation revealed that normal tissues were unmethylated, while twenty out of forty five (44.4%) tumor tissues were hypermethylated either in one or both alleles of APC. Among the tissues in which methylation was detected, seven were hypermethylated in both alleles while the other thirteen were hypermethylated in one of the two alleles of APC. Analyzing two-year survival rate of patients with respect to promoter hypermethylation showed a lower rate of

  4. Qualitative analysis of Adenomatous Polyposis Coli promoter: Hypermethylation, engagement and effects on survival of patients with esophageal cancer in a high risk region of the world, a potential molecular marker

    Directory of Open Access Journals (Sweden)

    Nasseri Negin

    2009-01-01

    Full Text Available Abstract Background Squamous cell carcinoma of esophagus (SCCE occurs at a high incidence rate in certain parts of the world. This feature necessitates that different aspects of the disease and in particular genetic characteristics be investigated in such regions. In addition, such investigations might lead to achievement of molecular markers helpful for early detection, successful treatment and follow up of the disease. Adenomatous Polyposis Coli (APC promoter hypermethylation has been shown to be a suitable marker for both serum and solid tumors of adenocarcinoma of esophagus. We investigated the status of APC promoter hypermethylation in Iranian patients, compared the results with the former studies, and evaluated its applicability as a candidate molecular marker by examining association between survival of SCCE patients and APC promoter methylation. Methods For evaluating the status of APC promoter hypermethylation and its association with SCCE, a qualitative methylation specific PCR (MSP was used. DNA was extracted and digested with an appropriate restriction enzyme, treated with sodium bisulfite in agarose beads and amplified in two-step PCR reaction by applying either methylated or unmethylated promoter specific primers. Universally methylated DNA and methylase treated blood DNA of healthy donors were used as positive controls as well. Survival of patients was followed up for two years after treatment and survival rate of patients with methylated APC promoter was compared with that of unmethylated patients. Results Assessment of APC promoter methylation revealed that normal tissues were unmethylated, while twenty out of forty five (44.4% tumor tissues were hypermethylated either in one or both alleles of APC. Among the tissues in which methylation was detected, seven were hypermethylated in both alleles while the other thirteen were hypermethylated in one of the two alleles of APC. Analyzing two-year survival rate of patients with respect

  5. Cellular stress-induced up-regulation of FMRP promotes cell survival by modulating PI3K-Akt phosphorylation cascades

    Directory of Open Access Journals (Sweden)

    Wells David

    2011-02-01

    Full Text Available Abstract Background Fragile X syndrome (FXS, the most commonly inherited mental retardation and single gene cause of autistic spectrum disorder, occurs when the Fmr1 gene is mutated. The product of Fmr1, fragile X linked mental retardation protein (FMRP is widely expressed in HeLa cells, however the roles of FMRP within HeLa cells were not elucidated, yet. Interacting with a diverse range of mRNAs related to cellular survival regulatory signals, understanding the functions of FMRP in cellular context would provide better insights into the role of this interesting protein in FXS. Using HeLa cells treated with etoposide as a model, we tried to determine whether FMRP could play a role in cell survival. Methods Apoptotic cell death was induced by etoposide treatment on Hela cells. After we transiently modulated FMRP expression (silencing or enhancing by using molecular biotechnological methods such as small hairpin RNA virus-induced knock down and overexpression using transfection with FMRP expression vectors, cellular viability was measured using propidium iodide staining, TUNEL staining, and FACS analysis along with the level of activation of PI3K-Akt pathway by Western blot. Expression level of FMRP and apoptotic regulator BcL-xL was analyzed by Western blot, RT-PCR and immunocytochemistry. Results An increased FMRP expression was measured in etoposide-treated HeLa cells, which was induced by PI3K-Akt activation. Without FMRP expression, cellular defence mechanism via PI3K-Akt-Bcl-xL was weakened and resulted in an augmented cell death by etoposide. In addition, FMRP over-expression lead to the activation of PI3K-Akt signalling pathway as well as increased FMRP and BcL-xL expression, which culminates with the increased cell survival in etoposide-treated HeLa cells. Conclusions Taken together, these results suggest that FMRP expression is an essential part of cellular survival mechanisms through the modulation of PI3K, Akt, and Bcl-xL signal

  6. Hippocampal “cholinergic interneurons” visualized with the choline acetyltransferase promoter: anatomical distribution, intrinsic membrane properties, neurochemical characteristics, and capacity for cholinergic modulation

    Science.gov (United States)

    Yi, Feng; Catudio-Garrett, Elizabeth; Gábriel, Robert; Wilhelm, Marta; Erdelyi, Ferenc; Szabo, Gabor; Deisseroth, Karl; Lawrence, Josh

    2015-01-01

    Release of acetylcholine (ACh) in the hippocampus (HC) occurs during exploration, arousal, and learning. Although the medial septum-diagonal band of Broca (MS-DBB) is the major extrinsic source of cholinergic input to the HC, cholinergic neurons intrinsic to the HC also exist but remain poorly understood. Here, ChAT-tauGFP and ChAT-CRE/Rosa26YFP (ChAT-Rosa) mice were examined in HC. The HC of ChAT-tauGFP mice was densely innervated with GFP-positive axons, often accompanied by large GFP-positive structures, some of which were Neurotrace/DAPI-negative and likely represent large axon terminals. In the HC of ChAT-Rosa mice, ChAT-YFP cells were Neurotrace-positive and more abundant in CA3 and dentate gyrus than CA1 with partial overlap with calretinin/VIP. Moreover, an anti-ChAT antibody consistently showed ChAT immunoreactivity in ChAT-YFP cells from MS-DBB but rarely from HC. Furthermore, ChAT-YFP cells from CA1 stratum radiatum/stratum lacunosum moleculare (SR/SLM) exhibited a stuttering firing phenotype but a delayed firing phenotype in stratum pyramidale (SP) of CA3. Input resistance and capacitance were also different between CA1 SR/LM and CA3 SP ChAT-YFP cells. Bath application of ACh increased firing frequency in all ChAT-YFP cells; however, cholinergic modulation was larger in CA1 SR/SLM than CA3 SP ChAT-YFP cells. Finally, CA3 SP ChAT-YFP cells exhibited a wider AP half-width and weaker cholinergic modulation than YFP-negative CA3 pyramidal cells. Consistent with CRE expression in a subpopulation of principal cells, optogenetic stimulation evoked glutamatergic postsynaptic currents in CA1 SR/SLM interneurons. In conclusion, the presence of fluorescently labeled hippocampal cells common to both ChAT-tauGFP and ChAT-Rosa mice are in good agreement with previous reports on the existence of cholinergic interneurons, but both transgenic mouse lines exhibited unexpected anatomical features that departed considerably from earlier observations. PMID:25798106

  7. Hippocampal "cholinergic interneurons" visualized with the choline acetyltransferase promoter: anatomical distribution, intrinsic membrane properties, neurochemical characteristics, and capacity for cholinergic modulation.

    Science.gov (United States)

    Yi, Feng; Catudio-Garrett, Elizabeth; Gábriel, Robert; Wilhelm, Marta; Erdelyi, Ferenc; Szabo, Gabor; Deisseroth, Karl; Lawrence, Josh

    2015-01-01

    Release of acetylcholine (ACh) in the hippocampus (HC) occurs during exploration, arousal, and learning. Although the medial septum-diagonal band of Broca (MS-DBB) is the major extrinsic source of cholinergic input to the HC, cholinergic neurons intrinsic to the HC also exist but remain poorly understood. Here, ChAT-tauGFP and ChAT-CRE/Rosa26YFP (ChAT-Rosa) mice were examined in HC. The HC of ChAT-tauGFP mice was densely innervated with GFP-positive axons, often accompanied by large GFP-positive structures, some of which were Neurotrace/DAPI-negative and likely represent large axon terminals. In the HC of ChAT-Rosa mice, ChAT-YFP cells were Neurotrace-positive and more abundant in CA3 and dentate gyrus than CA1 with partial overlap with calretinin/VIP. Moreover, an anti-ChAT antibody consistently showed ChAT immunoreactivity in ChAT-YFP cells from MS-DBB but rarely from HC. Furthermore, ChAT-YFP cells from CA1 stratum radiatum/stratum lacunosum moleculare (SR/SLM) exhibited a stuttering firing phenotype but a delayed firing phenotype in stratum pyramidale (SP) of CA3. Input resistance and capacitance were also different between CA1 SR/LM and CA3 SP ChAT-YFP cells. Bath application of ACh increased firing frequency in all ChAT-YFP cells; however, cholinergic modulation was larger in CA1 SR/SLM than CA3 SP ChAT-YFP cells. Finally, CA3 SP ChAT-YFP cells exhibited a wider AP half-width and weaker cholinergic modulation than YFP-negative CA3 pyramidal cells. Consistent with CRE expression in a subpopulation of principal cells, optogenetic stimulation evoked glutamatergic postsynaptic currents in CA1 SR/SLM interneurons. In conclusion, the presence of fluorescently labeled hippocampal cells common to both ChAT-tauGFP and ChAT-Rosa mice are in good agreement with previous reports on the existence of cholinergic interneurons, but both transgenic mouse lines exhibited unexpected anatomical features that departed considerably from earlier observations.

  8. Hippocampal cholinergic interneurons visualized with the choline acetyltransferase promoter: anatomical distribution, intrinsic membrane properties, neurochemical characteristics, and capacity for cholinergic modulation

    Directory of Open Access Journals (Sweden)

    Feng eYi

    2015-03-01

    Full Text Available Release of acetylcholine (ACh in the hippocampus (HC occurs during exploration, arousal, and learning. Although the medial septum-diagonal band of Broca (MS-DBB is the major extrinsic source of cholinergic input to the HC, cholinergic neurons intrinsic to the HC also exist but remain poorly understood. Here, ChAT-tauGFP and ChAT-CRE/Rosa26YFP (ChAT-Rosa mice were examined in HC. The HC of ChAT-tauGFP mice was densely innervated with GFP-positive axons, often accompanied by large GFP-positive structures, some of which were Neurotrace/DAPI-negative and likely represent large axon terminals. In the HC of ChAT-Rosa mice, ChAT-YFP cells were Neurotrace-positive and more abundant in CA3 and dentate gyrus than CA1 with partial overlapping with calretinin/VIP. Moreover, an anti-ChAT antibody consistently showed ChAT immunoreactivity in ChAT-YFP cells from MS-DBB but rarely from HC. Furthermore, ChAT-YFP cells from CA1 stratum radiatum/stratum lacunosum moleculare (SR/SLM exhibited a stuttering firing phenotype but a delayed firing phenotype in stratum pyramidale (SP of CA3. Input resistance and capacitance were also different between CA1 SR/LM and CA3 SP ChAT-YFP cells. Bath application of ACh increased firing frequency in all ChAT-YFP cells; however, cholinergic modulation was larger in CA1 SR/SLM than CA3 SP ChAT-YFP cells. Finally, CA3 SP ChAT-YFP cells exhibited a wider AP half-width and weaker cholinergic modulation than YFP-negative CA3 pyramidal cells. Consistent with CRE expression in a subpopulation of principal cells, optogenetic stimulation evoked glutamatergic postsynaptic currents in CA1 SR/SLM interneurons. In conclusion, the presence of fluorescently labeled hippocampal cells common to both ChAT-Rosa and ChAT-tauGFP mice are in good agreement with previous reports on the existence of cholinergic interneurons, but both transgenic mouse lines exhibited unexpected anatomical features that departed considerably from earlier observations.