Photovoltaic module with adhesion promoter
Xavier, Grace
2013-10-08
Photovoltaic modules with adhesion promoters and methods for fabricating photovoltaic modules with adhesion promoters are described. A photovoltaic module includes a solar cell including a first surface and a second surface, the second surface including a plurality of interspaced back-side contacts. A first glass layer is coupled to the first surface by a first encapsulating layer. A second glass layer is coupled to the second surface by a second encapsulating layer. At least a portion of the second encapsulating layer is bonded directly to the plurality of interspaced back-side contacts by an adhesion promoter.
Mechanosensitive promoter region in the human HB-GAM gene
DEFF Research Database (Denmark)
Liedert, Astrid; Kassem, Moustapha; Claes, Lutz
2009-01-01
Mechanical loading is essential for maintaining bone mass in the adult skeleton. However, the underlying process of the transfer of the physical stimulus into a biochemical response, which is termed mechanotransduction is poorly understood. Mechanotransduction results in the modulation of gene...... cells. Analysis of the human HB-GAM gene upstream regulatory region with luciferase reporter gene assays revealed that the upregulation of HB-GAM expression occurred at the transcriptional level and was mainly dependent on the HB-GAM promoter region most upstream containing three potential AP-1 binding...
Rosekind, Mark R.; Co, Elizabeth L.; Neri, David F.; Oyung, Raymond L.; Mallis, Melissa M.
2002-01-01
Regional operations encompass a broad range of pilots and equipment. This module is intended to help all those involved in regional aviation, including pilots, schedulers, dispatchers, maintenance technicians, policy makers, and others, to understand the physiological factors underlying fatigue, how flight operations affect fatigue, and what can be done to counteract fatigue and maximize alertness and performance in their operations. The overall purpose of this module is to promote aviation safety, performance, and productivity. It is intended to meet three specific objectives: (1) to explain the current state of knowledge about the physiological mechanisms underlying fatigue; (2) to demonstrate how this knowledge can be applied to improving flight crew sleep, performance, and alertness; and (3) to offer strategies for alertness management. Aviation Safety Reporting System (ASRS) and National Transportation Safety Board (NISH) reports are used throughout this module to demonstrate that fatigue is a safety issue in the regional operations community. The appendices at the end of this module include the ASRS reports used for the examples contained in this publication, brief introductions to sleep disorders and relaxation techniques, summaries of relevant NASA publications, and a list of general readings on sleep, sleep disorders, and circadian rhythms.
[Health-Promoting Schools Regional Initiative of the Americas].
Ippolito-Shepherd, Josefa; Cerqueira, Maria Teresa; Ortega, Diana Patricia
2005-01-01
In Latin America, comprehensive health promotion programmes and activities are being implemented in the school setting, which take into account the conceptual framework of the Health-Promoting Schools Regional Initiative of the Pan American Health Organization, Regional office of the World Health Organization (PAHO/WHO). These programmes help to strengthen the working relationships between the health and education sectors. The Health-Promoting Schools Regional Initiative, officially launched by PAHO/WHO in 1995, aims to form future generations to have the knowledge, abilities, and skills necessary for promoting and caring for their health and that of their family and community, as well as to create and maintain healthy environments and communities. The Initiative focuses on three main components: comprehensive health education, the creation and maintenance of healthy physical and psychosocial environments, and the access to health and nutrition services, mental health, and active life. In 2001, PAHO conducted a survey in 19 Latin American countries to assess the status and trends of Health-Promoting Schools in the Region, for the appropriate regional, subregional, and national planning of pertinent health promotion and health education programmes and activities. The results of this survey provided information about policies and national plans, multisectoral coordination mechanisms for the support of health promotion in the school settings, the formation and participation in national and international networks of Health-Promoting Schools and about the level of dissemination of the strategy. For the successful development of Health-Promoting Schools is essential to involve the society as a whole, in order to mobilise human resources and materials necessary for implementing health promotion in the school settings. Thus, the constitution and consolidation of networks has been a facilitating mechanism for the exchange of ideas, resources and experiences to strengthen
Synthetic promoter libraries for Corynebacterium glutamicum
DEFF Research Database (Denmark)
Rytter, Jakob Vang; Helmark, Søren; Chen, Jun
2014-01-01
The ability to modulate gene expression is an important genetic tool in systems biology and biotechnology. Here, we demonstrate that a previously published easy and fast PCR-based method for modulating gene expression in lactic acid bacteria is also applicable to Corynebacterium glutamicum. We co...... promoter library (SPL) technology is convenient for modulating gene expression in C. glutamicum and should have many future applications, within basic research as well as for optimizing industrial production organisms....... constructed constitutive promoter libraries based on various combinations of a previously reported C. glutamicum -10 consensus sequence (gngnTA(c/t)aaTgg) and the Escherichia coli -35 consensus, either with or without an AT-rich region upstream. A promoter library based on consensus sequences frequently found...... in low-GC Gram-positive microorganisms was also included. The strongest promoters were found in the library with a -35 region and a C. glutamicum -10 consensus, and this library also represents the largest activity span. Using the alternative -10 consensus TATAAT, which can be found in many other...
DEFF Research Database (Denmark)
Zhu, Xuefeng; Wirén, Marianna; Sinha, Indranil
2006-01-01
Mediator exists in a free form containing the Med12, Med13, CDK8, and CycC subunits (the Srb8-11 module) and a smaller form, which lacks these four subunits and associates with RNA polymerase II (Pol II), forming a holoenzyme. We use chromatin immunoprecipitation (ChIP) and DNA microarrays...... to investigate genome-wide localization of Mediator and the Srb8-11 module in fission yeast. Mediator and the Srb8-11 module display similar binding patterns, and interactions with promoters and upstream activating sequences correlate with increased transcription activity. Unexpectedly, Mediator also interacts...... with the downstream coding region of many genes. These interactions display a negative bias for positions closer to the 5' ends of open reading frames (ORFs) and appear functionally important, because downregulation of transcription in a temperature-sensitive med17 mutant strain correlates with increased Mediator...
Genome-wide analysis of regions similar to promoters of histone genes
Chowdhary, Rajesh
2010-05-28
Background: The purpose of this study is to: i) develop a computational model of promoters of human histone-encoding genes (shortly histone genes), an important class of genes that participate in various critical cellular processes, ii) use the model so developed to identify regions across the human genome that have similar structure as promoters of histone genes; such regions could represent potential genomic regulatory regions, e.g. promoters, of genes that may be coregulated with histone genes, and iii/ identify in this way genes that have high likelihood of being coregulated with the histone genes.Results: We successfully developed a histone promoter model using a comprehensive collection of histone genes. Based on leave-one-out cross-validation test, the model produced good prediction accuracy (94.1% sensitivity, 92.6% specificity, and 92.8% positive predictive value). We used this model to predict across the genome a number of genes that shared similar promoter structures with the histone gene promoters. We thus hypothesize that these predicted genes could be coregulated with histone genes. This hypothesis matches well with the available gene expression, gene ontology, and pathways data. Jointly with promoters of the above-mentioned genes, we found a large number of intergenic regions with similar structure as histone promoters.Conclusions: This study represents one of the most comprehensive computational analyses conducted thus far on a genome-wide scale of promoters of human histone genes. Our analysis suggests a number of other human genes that share a high similarity of promoter structure with the histone genes and thus are highly likely to be coregulated, and consequently coexpressed, with the histone genes. We also found that there are a large number of intergenic regions across the genome with their structures similar to promoters of histone genes. These regions may be promoters of yet unidentified genes, or may represent remote control regions that
Wei, Liang; Xu, Ning; Wang, Yiran; Zhou, Wei; Han, Guoqiang; Ma, Yanhe; Liu, Jun
2018-05-01
Due to the lack of efficient control elements and tools, the fine-tuning of gene expression in the multi-gene metabolic pathways is still a great challenge for engineering microbial cell factories, especially for the important industrial microorganism Corynebacterium glutamicum. In this study, the promoter library-based module combination (PLMC) technology was developed to efficiently optimize the expression of genes in C. glutamicum. A random promoter library was designed to contain the putative - 10 (NNTANANT) and - 35 (NNGNCN) consensus motifs, and refined through a three-step screening procedure to achieve numerous genetic control elements with different strength levels, including fluorescence-activated cell sorting (FACS) screening, agar plate screening, and 96-well plate screening. Multiple conventional strategies were employed for further precise characterizations of the promoter library, such as real-time quantitative PCR, sodium dodecyl sulfate polyacrylamide gel electrophoresis, FACS analysis, and the lacZ reporter system. These results suggested that the established promoter elements effectively regulated gene expression and showed varying strengths over a wide range. Subsequently, a multi-module combination technology was created based on the efficient promoter elements for combination and optimization of modules in the multi-gene pathways. Using this technology, the threonine biosynthesis pathway was reconstructed and optimized by predictable tuning expression of five modules in C. glutamicum. The threonine titer of the optimized strain was significantly improved to 12.8 g/L, an approximate 6.1-fold higher than that of the control strain. Overall, the PLMC technology presented in this study provides a rapid and effective method for combination and optimization of multi-gene pathways in C. glutamicum.
Identification and annotation of promoter regions in microbial
Indian Academy of Sciences (India)
2007-06-15
Jun 15, 2007 ... Analysis of various predicted structural properties of promoter regions in prokaryotic as well as eukaryotic genomes had earlier indicated that they have several common features, such as lower stability, higher curvature and less bendability, when compared with their neighboring regions. Based on the ...
Epigenetic transgenerational actions of vinclozolin on promoter regions of the sperm epigenome.
Directory of Open Access Journals (Sweden)
Carlos Guerrero-Bosagna
2010-09-01
Full Text Available Previous observations have demonstrated that embryonic exposure to the endocrine disruptor vinclozolin during gonadal sex determination promotes transgenerational adult onset disease such as male infertility, kidney disease, prostate disease, immune abnormalities and tumor development. The current study investigates genome-wide promoter DNA methylation alterations in the sperm of F3 generation rats whose F0 generation mother was exposed to vinclozolin. A methylated DNA immunoprecipitation with methyl-cytosine antibody followed by a promoter tilling microarray (MeDIP-Chip procedure was used to identify 52 different regions with statistically significant altered methylation in the sperm promoter epigenome. Mass spectrometry bisulfite analysis was used to map the CpG DNA methylation and 16 differential DNA methylation regions were confirmed, while the remainder could not be analyzed due to bisulfite technical limitations. Analysis of these validated regions identified a consensus DNA sequence (motif that associated with 75% of the promoters. Interestingly, only 16.8% of a random set of 125 promoters contained this motif. One candidate promoter (Fam111a was found to be due to a copy number variation (CNV and not a methylation change, suggesting initial alterations in the germline epigenome may promote genetic abnormalities such as induced CNV in later generations. This study identifies differential DNA methylation sites in promoter regions three generations after the initial exposure and identifies common genome features present in these regions. In addition to primary epimutations, a potential indirect genetic abnormality was identified, and both are postulated to be involved in the epigenetic transgenerational inheritance observed. This study confirms that an environmental agent has the ability to induce epigenetic transgenerational changes in the sperm epigenome.
Epigenetic transgenerational actions of vinclozolin on promoter regions of the sperm epigenome.
Guerrero-Bosagna, Carlos; Settles, Matthew; Lucker, Ben; Skinner, Michael K
2010-09-30
Previous observations have demonstrated that embryonic exposure to the endocrine disruptor vinclozolin during gonadal sex determination promotes transgenerational adult onset disease such as male infertility, kidney disease, prostate disease, immune abnormalities and tumor development. The current study investigates genome-wide promoter DNA methylation alterations in the sperm of F3 generation rats whose F0 generation mother was exposed to vinclozolin. A methylated DNA immunoprecipitation with methyl-cytosine antibody followed by a promoter tilling microarray (MeDIP-Chip) procedure was used to identify 52 different regions with statistically significant altered methylation in the sperm promoter epigenome. Mass spectrometry bisulfite analysis was used to map the CpG DNA methylation and 16 differential DNA methylation regions were confirmed, while the remainder could not be analyzed due to bisulfite technical limitations. Analysis of these validated regions identified a consensus DNA sequence (motif) that associated with 75% of the promoters. Interestingly, only 16.8% of a random set of 125 promoters contained this motif. One candidate promoter (Fam111a) was found to be due to a copy number variation (CNV) and not a methylation change, suggesting initial alterations in the germline epigenome may promote genetic abnormalities such as induced CNV in later generations. This study identifies differential DNA methylation sites in promoter regions three generations after the initial exposure and identifies common genome features present in these regions. In addition to primary epimutations, a potential indirect genetic abnormality was identified, and both are postulated to be involved in the epigenetic transgenerational inheritance observed. This study confirms that an environmental agent has the ability to induce epigenetic transgenerational changes in the sperm epigenome.
Assessing the early degradation of photovoltaic modules performance in the Saharan region
International Nuclear Information System (INIS)
Kahoul, Nabil; Houabes, Mourad; Sadok, Mohammed
2014-01-01
Highlights: • The study underlines the reliability of PV modules in South Algeria. • Early degradation of PV modules operating in the Saharan region for 11 years. • Performance analysis of these PV panels with suitable explanation of results. • Discovery of early degradation of PV modules performance and some PV defects. - Abstract: In this study, the electrical performance degradation of photovoltaic modules (UDTS-50) functioning for a period of 11 years in a region of the Sahara (URER-MS ADRAR) is analyzed. This paper is devoted to an experimental study of current–voltage characteristics of several PV modules exposed to the extreme weather conditions in desert area. The electrical performance degradation and failure modes are estimated from series of current–voltage characteristics performed in the field. Experimental results show that some PV modules degrade up to 12% compared to their initial state. The performance analysis of the others tested modules revealed some defects, such as cracked cells and physical material defects. The identification of the origin of degradation and failure modes and how they affect the photovoltaic modules is necessary to improve the reliability of photovoltaic installations
Unveiling DNA structural properties of promoter regions of ...
Indian Academy of Sciences (India)
Aditya Kumar
Unveiling DNA structural properties of promoter regions of prokaryotic transcriptome and their role in gene expression. Aditya Kumar. Assistant Professor. Molecular Biology & Biotechnology. Tezpur University. Tezpur – 784028, Assam ...
Social Media Marketing as a tool for promoting the regional investment portals
Directory of Open Access Journals (Sweden)
Alisa Yu. Fadeyeva
2016-01-01
Full Text Available Objective to investigate the potential of Social Media Marketing as a tool for promoting regional investment portals in the information environment to identify the most effective ways of its implementation and to determine the level of mastering of this tool by the Russian regions. Methods general scientific methods observation comparison analysis induction deduction analogy classification. Results the analysis showed that today Social Media Marketing is an essential tool for interaction with the investment community and one of the most effective ways to promote the regional portal which allows to increase the knowledge of and loyalty to the brand to increase the targeted website traffic to increase the awareness of investors about the specific features of the portal and the regional development agenciesrsquo functioning to promptly receive information about the investment environment and to establish contacts with investors. At the same time the study of SMMactivity in the Russian regions revealed a very low level of quality of communication with investors through social networks. Scientific novelty for the first time the article investigates the significance and makes the comparative analysis of the Social Media Marketing channels with regard to investment promotion agencies as well as the results of the regional structures functioning for effective communication through social networks. Practical significance the main results of the research can be used by the regional investment agencies in order to promote their websites increase the quality of communication with investors and promote the investment attractiveness of the region as a whole. nbsp
Directory of Open Access Journals (Sweden)
Rafael Estrada-Avilés
Full Text Available Calsequestrin-2 (CASQ2 is the main Ca2+-binding protein inside the sarcoplasmic reticulum of cardiomyocytes. Previously, we demonstrated that MEF-2 and SRF binding sites within the human CASQ2 gene (hCASQ2 promoter region are functional in neonatal cardiomyocytes. In this work, we investigated if the calcineurin/NFAT pathway regulates hCASQ2 expression in neonatal cardiomyocytes. The inhibition of NFAT dephosphorylation with CsA or INCA-6, reduced both the luciferase activity of hCASQ2 promoter constructs (-3102/+176 bp and -288/+176 bp and the CASQ2 mRNA levels in neonatal rat cardiomyocytes. Additionally, NFATc1 and NFATc3 over-expressing neonatal cardiomyocytes showed a 2-3-fold increase in luciferase activity of both hCASQ2 promoter constructs, which was prevented by CsA treatment. Site-directed mutagenesis of the -133 bp MEF-2 binding site prevented trans-activation of hCASQ2 promoter constructs induced by NFAT overexpression. Chromatin Immunoprecipitation (ChIP assays revealed NFAT and MEF-2 enrichment within the -288 bp to +76 bp of the hCASQ2 gene promoter. Besides, a direct interaction between NFAT and MEF-2 proteins was demonstrated by protein co-immunoprecipitation experiments. Taken together, these data demonstrate that NFAT interacts with MEF-2 bound to the -133 bp binding site at the hCASQ2 gene promoter. In conclusion, in this work, we demonstrate that the Ca2+-calcineurin/NFAT pathway modulates the transcription of the hCASQ2 gene in neonatal cardiomyocytes.
DEFF Research Database (Denmark)
Sohoni, Sujata Vijay; Fazio, Alessandro; Workman, Christopher
2014-01-01
The objective of this study was the application of the synthetic promoter library (SPL) technology for modulation of actinorhodin production in Streptomyces coelicolor A3(2). The SPL technology was used to optimize the expression of a pathway specific positive transcriptional regulator Actll orf4...... constitutive promoter. ScoSPL20 demonstrated exceptional productivity despite having a comparatively weak expression from the promoter. Interestingly, the ScoSPL20 promoter was activated at a much earlier stage of growth compared to the wild type, demonstrating the advantage of fine-tuning and temporal tuning......, which activates the transcription of the S. coelicolor actinorhodin biosynthetic gene cluster. The native actll orf4 promoter was replaced with synthetic promoters, generating a S. coelicolor library with a broad range of expression levels of actll orf4. The resulting library was screened based...
Perceptually Salient Regions of the Modulation Power Spectrum for Musical Instrument Identification.
Thoret, Etienne; Depalle, Philippe; McAdams, Stephen
2017-01-01
The ability of a listener to recognize sound sources, and in particular musical instruments from the sounds they produce, raises the question of determining the acoustical information used to achieve such a task. It is now well known that the shapes of the temporal and spectral envelopes are crucial to the recognition of a musical instrument. More recently, Modulation Power Spectra (MPS) have been shown to be a representation that potentially explains the perception of musical instrument sounds. Nevertheless, the question of which specific regions of this representation characterize a musical instrument is still open. An identification task was applied to two subsets of musical instruments: tuba, trombone, cello, saxophone, and clarinet on the one hand, and marimba, vibraphone, guitar, harp, and viola pizzicato on the other. The sounds were processed with filtered spectrotemporal modulations with 2D Gaussian windows. The most relevant regions of this representation for instrument identification were determined for each instrument and reveal the regions essential for their identification. The method used here is based on a "molecular approach," the so-called bubbles method. Globally, the instruments were correctly identified and the lower values of spectrotemporal modulations are the most important regions of the MPS for recognizing instruments. Interestingly, instruments that were confused with each other led to non-overlapping regions and were confused when they were filtered in the most salient region of the other instrument. These results suggest that musical instrument timbres are characterized by specific spectrotemporal modulations, information which could contribute to music information retrieval tasks such as automatic source recognition.
Promoting tissue regeneration by modulating the immune system.
Julier, Ziad; Park, Anthony J; Briquez, Priscilla S; Martino, Mikaël M
2017-04-15
The immune system plays a central role in tissue repair and regeneration. Indeed, the immune response to tissue injury is crucial in determining the speed and the outcome of the healing process, including the extent of scarring and the restoration of organ function. Therefore, controlling immune components via biomaterials and drug delivery systems is becoming an attractive approach in regenerative medicine, since therapies based on stem cells and growth factors have not yet proven to be broadly effective in the clinic. To integrate the immune system into regenerative strategies, one of the first challenges is to understand the precise functions of the different immune components during the tissue healing process. While remarkable progress has been made, the immune mechanisms involved are still elusive, and there is indication for both negative and positive roles depending on the tissue type or organ and life stage. It is well recognized that the innate immune response comprising danger signals, neutrophils and macrophages modulates tissue healing. In addition, it is becoming evident that the adaptive immune response, in particular T cell subset activities, plays a critical role. In this review, we first present an overview of the basic immune mechanisms involved in tissue repair and regeneration. Then, we highlight various approaches based on biomaterials and drug delivery systems that aim at modulating these mechanisms to limit fibrosis and promote regeneration. We propose that the next generation of regenerative therapies may evolve from typical biomaterial-, stem cell-, or growth factor-centric approaches to an immune-centric approach. Most regenerative strategies have not yet proven to be safe or reasonably efficient in the clinic. In addition to stem cells and growth factors, the immune system plays a crucial role in the tissue healing process. Here, we propose that controlling the immune-mediated mechanisms of tissue repair and regeneration may support
Identification and annotation of promoter regions in microbial ...
Indian Academy of Sciences (India)
PRAKASH KUMAR
2007-06-15
Jun 15, 2007 ... It remains important, not only to detect rarely expressed genes but also for ... well as in identifying genes associated with rRNA, tRNA and ... DNA stability; free energy calculation; promoter; upstream and downstream region.
Business networking for SMEs as a means to promote regional competitiveness: A Theoretical Framework
Vitor Braga
2004-01-01
The competitiveness of regions, as a means of promoting the competitiveness of a country as a whole, has been one of the main topics on the agenda of policy makers over the last decades. Several attempts at promoting competitiveness have been made with different degrees of success. In most cases, public investment in the regions was perceived as the solution to promote regional competitiveness and top-down policies were implemented. However, competitiveness also has an important dimension tha...
Selective androgen receptor modulators as function promoting therapies.
Bhasin, Shalender; Jasuja, Ravi
2009-05-01
The past decade has witnessed an unprecedented discovery effort to develop selective androgen receptor modulators (SARMs) that improve physical function and bone health without adversely affecting the prostate and cardiovascular outcomes. This review describes the historical evolution, the rationale for SARM development, and the mechanisms of testosterone action and SARM selectivity. Although steroidal SARMs have been around since the 1940s, a number of nonsteroidal SARMs that do not serve as substrates for CYP19 aromatase or 5alpha-reductase, act as full agonists in muscle and bone and as partial agonists in prostate are in development. The differing interactions of steroidal and nonsteroidal compounds with androgen receptor (AR) contribute to their unique pharmacologic actions. Ligand binding induces specific conformational changes in the ligand-binding domain, which could modulate surface topology and protein-protein interactions between AR and coregulators, resulting in tissue-specific gene regulation. Preclinical studies have demonstrated the ability of SARMs to increase muscle and bone mass in preclinical rodent models with varying degree of prostate sparing. Phase I trials of SARMs in humans have reported modest increments in fat-free mass. SARMs hold promise as a new class of function promoting anabolic therapies for a number of clinical indications, including functional limitations associated with aging and chronic disease, frailty, cancer cachexia, and osteoporosis.
Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori
Energy Technology Data Exchange (ETDEWEB)
Yan, Liu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Lian, Yu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Zhejiang Province Key Laboratory of Preventive Veterinary Medicine, Institute of Preventive Veterinary Medicine, Zhejiang University, Hangzhou 310029 (China); Xiuyang, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Tingqing, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Shengpeng, Wang [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Changde, Lu [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China)
2006-03-31
The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.
Reciprocal modulation of mesenchymal stem cells and tumor cells promotes lung cancer metastasis
Directory of Open Access Journals (Sweden)
Giulia Fregni
2018-03-01
Full Text Available Metastasis is a multi-step process in which direct crosstalk between cancer cells and their microenvironment plays a key role. Here, we assessed the effect of paired tumor-associated and normal lung tissue mesenchymal stem cells (MSCs on the growth and dissemination of primary human lung carcinoma cells isolated from the same patients. We show that the tumor microenvironment modulates MSC gene expression and identify a four-gene MSC signature that is functionally implicated in promoting metastasis. We also demonstrate that tumor-associated MSCs induce the expression of genes associated with an aggressive phenotype in primary lung cancer cells and selectively promote their dissemination rather than local growth. Our observations provide insight into mechanisms by which the stroma promotes lung cancer metastasis. Keywords: Tumor-associated MSCs, lung cancer, metastasis, GREM1, LOXL2, ADAMTS12, ITGA11
Perspectives on Promoting Regional Renewable Energy Research and Development
International Nuclear Information System (INIS)
Dresselhaus, M.
2008-01-01
Recent discussions at the Washington International Renewable Energy Conference (WIREC), hosted in March 2008 by the United States Government, with nearly 9000 participants including 103 ministers from 126 countries, concluded that a major acceleration in the adoption of renewable energy technologies was needed by mid-century. Because of different climatic conditions and societal preferences, regional cooperation is expected to play a major role in the efficient adoption of appropriate renewable energy technologies, and countries with special expertise in specific technologies seem eager to collaborate internationally to promote global goals in renewable energy. A review will be given of what we learned from this conference about renewable energy research and development strategies with a special focus given to using this basic knowledge base to promote the development of renewable energy technologies appropriate to specific regions of the world.(author)
International Nuclear Information System (INIS)
Thierry, F.; Heard, J.M.; Dartmann, K.; Yaniv, M.
1987-01-01
RNA present in cells derived from cervical carcinoma that contained human papillomavirus 18 genomes was initiated in the 1.053-kilobase BamHI fragment that covered the complete noncoding region of this virus. When cloned upstream of the chloramphenicol acetyltransferase gene, this viral fragment directed the expression of the bacterial enzyme only in the sense orientation. Initiation sites were mapped around the ATG of open reading frame E6. This promoter was active in some human and simian cell lines, and its expression was modulated positively by simian virus 40 large T antigen and negatively by adenovirus type 5 E1a antigen
Stains, Joseph P.; Lecanda, Fernando; Screen, Joanne; Towler, Dwight A.; Civitelli, Roberto
2003-01-01
Loss-of-function mutations of gap junction proteins, connexins, represent a mechanism of disease in a variety of tissues. We have shown that recessive (gene deletion) or dominant (connexin45 overexpression) disruption of connexin43 function results in osteoblast dysfunction and abnormal expression of osteoblast genes, including down-regulation of osteocalcin transcription. To elucidate the molecular mechanisms of gap junction-sensitive transcriptional regulation, we systematically analyzed the rat osteocalcin promoter for sensitivity to gap junctional intercellular communication. We identified an Sp1/Sp3 containing complex that assembles on a minimal element in the -70 to -57 region of the osteocalcin promoter in a gap junction-dependent manner. This CT-rich connexin-response element is necessary and sufficient to confer gap junction sensitivity to the osteocalcin proximal promoter. Repression of osteocalcin transcription occurs as a result of displacement of the stimulatory Sp1 by the inhibitory Sp3 on the promoter when gap junctional communication is perturbed. Modulation of Sp1/Sp3 recruitment also occurs on the collagen Ialpha1 promoter and translates into gap junction-sensitive transcriptional control of collagen Ialpha1 gene expression. Thus, regulation of Sp1/Sp3 recruitment to the promoter may represent a potential general mechanism for transcriptional control of target genes by signals passing through gap junctions.
Regional differences in gene expression and promoter usage in aged human brains
Pardo, Luba M.
2013-02-19
To characterize the promoterome of caudate and putamen regions (striatum), frontal and temporal cortices, and hippocampi from aged human brains, we used high-throughput cap analysis of gene expression to profile the transcription start sites and to quantify the differences in gene expression across the 5 brain regions. We also analyzed the extent to which methylation influenced the observed expression profiles. We sequenced more than 71 million cap analysis of gene expression tags corresponding to 70,202 promoter regions and 16,888 genes. More than 7000 transcripts were differentially expressed, mainly because of differential alternative promoter usage. Unexpectedly, 7% of differentially expressed genes were neurodevelopmental transcription factors. Functional pathway analysis on the differentially expressed genes revealed an overrepresentation of several signaling pathways (e.g., fibroblast growth factor and wnt signaling) in hippocampus and striatum. We also found that although 73% of methylation signals mapped within genes, the influence of methylation on the expression profile was small. Our study underscores alternative promoter usage as an important mechanism for determining the regional differences in gene expression at old age.
Growing Significance of EU Institutions in Promotion of Inter-regional policies
Directory of Open Access Journals (Sweden)
Ella V. Ermakova
2014-01-01
Full Text Available The article explores the variety of tools and vehicles applied within the EU to expand the prerogative of the regions of the EU member states. The author uses as an example the inter-regional policies in Belgium in respect of the Flemish Region and the Walloon Region. The author analyzes the mechanisms of promotion of external regional relations in Belgium as a means of addressing different problems both on national and all-European level, supporting the arguments and conclusions by examples of relevant EU initiatives. The article details the activities of the EU Regional Committee (RC, the EU advisory body with the powers of political initiative, upholding the principle ofsubsidarity in the implementation of the EU member states' regional policies. The involvement of the Flemish Region and the Walloon Region in the activities of EU RC is described and summarized. As a case study, the article deals with Belgium's rotating six months presidency in the EUin 2010 when the country, which was going through a severe political crisis with no federal government in place, was represented by the two regions. The special focus of the article is on the strategic EU program "Europe2020" and its implementation by the regions of Belgium. There is an account of the initiatives undertaken by the Flemish Region and the Walloon Region within the framework of this program outlining the interaction of the two regions. The author provides a comprehensive analysis of the involvement of the Flemish Region and the Walloon Region with various EU institutions describing how each party achieves the promotion of its regional interests. Within this context, it is a noteworthy development that the Flemish Region is participating in the international program "Pact 2020" on energy all by its own. The article features quotations by Flemish and Walloon political figures which serve as an illustration of the prevailing attitudes in the Belgian society to the process of
Directory of Open Access Journals (Sweden)
Sutapa Datta
Full Text Available An important step in understanding gene regulation is to identify the promoter regions where the transcription factor binding takes place. Predicting a promoter region de novo has been a theoretical goal for many researchers for a long time. There exists a number of in silico methods to predict the promoter region de novo but most of these methods are still suffering from various shortcomings, a major one being the selection of appropriate features of promoter region distinguishing them from non-promoters. In this communication, we have proposed a new composite method that predicts promoter sequences based on the interrelationship between structural profiles of DNA and primary sequence elements of the promoter regions. We have shown that a Context Free Grammar (CFG can formalize the relationships between different primary sequence features and by utilizing the CFG, we demonstrate that an efficient parser can be constructed for extracting these relationships from DNA sequences to distinguish the true promoter sequences from non-promoter sequences. Along with CFG, we have extracted the structural features of the promoter region to improve upon the efficiency of our prediction system. Extensive experiments performed on different datasets reveals that our method is effective in predicting promoter sequences on a genome-wide scale and performs satisfactorily as compared to other promoter prediction techniques.
Datta, Sutapa; Mukhopadhyay, Subhasis
2013-01-01
An important step in understanding gene regulation is to identify the promoter regions where the transcription factor binding takes place. Predicting a promoter region de novo has been a theoretical goal for many researchers for a long time. There exists a number of in silico methods to predict the promoter region de novo but most of these methods are still suffering from various shortcomings, a major one being the selection of appropriate features of promoter region distinguishing them from non-promoters. In this communication, we have proposed a new composite method that predicts promoter sequences based on the interrelationship between structural profiles of DNA and primary sequence elements of the promoter regions. We have shown that a Context Free Grammar (CFG) can formalize the relationships between different primary sequence features and by utilizing the CFG, we demonstrate that an efficient parser can be constructed for extracting these relationships from DNA sequences to distinguish the true promoter sequences from non-promoter sequences. Along with CFG, we have extracted the structural features of the promoter region to improve upon the efficiency of our prediction system. Extensive experiments performed on different datasets reveals that our method is effective in predicting promoter sequences on a genome-wide scale and performs satisfactorily as compared to other promoter prediction techniques. PMID:23437045
Selective Androgen Receptor Modulators (SARMs) as Function Promoting Therapies
Bhasin, Shalender; Jasuja, Ravi
2010-01-01
Purpose of review The last decade has witnessed unprecedented discovery effort to develop selective androgen receptor modulators (SARMs) that improve physical function and bone health without adversely affecting the prostate and cardiovascular outcomes. This review describes the historical evolution, the rationale for SARM development, and the mechanisms of testosterone action and SARM selectivity. Recent Findings While steroidal SARMs have been around since the 1940s, a number of nonsteroidal SARMs that do not serve as substrates for CYP19 aromatase or 5α-reductase, act as full agonists in muscle and bone and as partial agonists in prostate are in development. The differing interactions of steroidal and nonsteroidal compounds with AR contribute to their unique pharmacologic actions. Ligand binding induces specific conformational changes in the ligand binding domain, which could modulate surface topology and protein-protein interactions between AR and coregulators, resulting in tissue-specific gene regulation. Preclinical studies have demonstrated the ability of SARMs to increase muscle and bone mass in preclinical rodent models with varying degree of prostate sparing. Phase I trials of SARMs in humans have reported modest increments in fat-free mass. Summary SARMs hold promise as a new class of function promoting anabolic therapies for a number of clinical indications, including functional limitations associated with aging and chronic disease, frailty, cancer cachexia, and osteoporosis. PMID:19357508
Characterization of the promoter region of the human c-erbB-2 protooncogene
International Nuclear Information System (INIS)
Ishii, S.; Imamoto, F.; Yamanashi, Y.; Toyoshima, K.; Yamamoto, T.
1987-01-01
Three overlapping genomic clones that contain the 5'-terminal portion of the human c-erbB-2 gene (ERBB2) were isolated. The promoter region was identified by nuclease S1 mapping with c-erbB-2 mRNA. Seven transcriptional start sites were identified. DNA sequence analysis showed that the promoter region contains a TATA box and a CAAT box about 30 and 80 base pairs (bp), respectively, upstream of the most downstream RNA initiation site. Two putative binding sites for transcription factor Sp1 were identified about 50 and 110 bp upstream of the CAAT box, and six GGA repeats were found between the CAAT box and the TATA box. This region had strong promoter activity when placed upstream of the bacterial chloramphenicol acetyltransferase gene and transfected into monkey CV-1 cells. These data indicate that the promoter of the human c-erbB-2 protooncogene is different from that of the protooncogene c-erbB-1 (epidermal growth factor receptor gene), which does not contain either a TATA box or a CAAT box. Comparison of the promoter sequences and activities of the two protooncogenes should be helpful in analysis of the regulatory mechanism of expression of their gene products, which are growth-factor receptors
Energy Technology Data Exchange (ETDEWEB)
Huerta, Araceli M.; Francino, M. Pilar; Morett, Enrique; Collado-Vides, Julio
2006-03-01
The evolutionary processes operating in the DNA regions that participate in the regulation of gene expression are poorly understood. In Escherichia coli, we have established a sequence pattern that distinguishes regulatory from nonregulatory regions. The density of promoter-like sequences, that are recognizable by RNA polymerase and may function as potential promoters, is high within regulatory regions, in contrast to coding regions and regions located between convergently-transcribed genes. Moreover, functional promoter sites identified experimentally are often found in the subregions of highest density of promoter-like signals, even when individual sites with higher binding affinity for RNA polymerase exist elsewhere within the regulatory region. In order to investigate the generality of this pattern, we have used position weight matrices describing the -35 and -10 promoter boxes of E. coli to search for these motifs in 43 additional genomes belonging to most established bacterial phyla, after specific calibration of the matrices according to the base composition of the noncoding regions of each genome. We have found that all bacterial species analyzed contain similar promoter-like motifs, and that, in most cases, these motifs follow the same genomic distribution observed in E. coli. Differential densities between regulatory and nonregulatory regions are detectable in most bacterial genomes, with the exception of those that have experienced evolutionary extreme genome reduction. Thus, the phylogenetic distribution of this pattern mirrors that of genes and other genomic features that require weak selection to be effective in order to persist. On this basis, we suggest that the loss of differential densities in the reduced genomes of host-restricted pathogens and symbionts is the outcome of a process of genome degradation resulting from the decreased efficiency of purifying selection in highly structured small populations. This implies that the differential
Evaluation of Maxim Module-Integrated Electronics at the DOE Regional Test Centers: Preprint
Energy Technology Data Exchange (ETDEWEB)
Deline, C.; Sekulic, B.; Stein, J.; Barkaszi, S.; Yang, J.; Kahn, S.
2014-07-01
Module-embedded power electronics developed by Maxim Integrated are under evaluation through a partnership with the Department of Energy's Regional Test Center (RTC) program. Field deployments of both conventional modules and electronics-enhanced modules are designed to quantify the performance advantage of Maxim's products under different amounts of inter-row shading, and their ability to be deployed at a greater ground-coverage-ratio than conventional modules. Simulations in PVSYST have quantified the predicted performance difference between conventional modules and Maxim's modules from inter-row shading. Initial performance results have identified diffuse irradiance losses at tighter row spacing for both the Maxim and conventional modules. Comparisons with published models show good agreement with models predicting the greatest diffuse irradiance losses. At tighter row spacing, all of the strings equipped with embedded power electronics outperformed their conventional peers. An even greater performance advantage is predicted to occur in the winter months when the amount of inter-row shading mismatch is at a maximum.
Directory of Open Access Journals (Sweden)
Recep Colak
2010-10-01
Full Text Available Computational prediction of functionally related groups of genes (functional modules from large-scale data is an important issue in computational biology. Gene expression experiments and interaction networks are well studied large-scale data sources, available for many not yet exhaustively annotated organisms. It has been well established, when analyzing these two data sources jointly, modules are often reflected by highly interconnected (dense regions in the interaction networks whose participating genes are co-expressed. However, the tractability of the problem had remained unclear and methods by which to exhaustively search for such constellations had not been presented.We provide an algorithmic framework, referred to as Densely Connected Biclustering (DECOB, by which the aforementioned search problem becomes tractable. To benchmark the predictive power inherent to the approach, we computed all co-expressed, dense regions in physical protein and genetic interaction networks from human and yeast. An automatized filtering procedure reduces our output which results in smaller collections of modules, comparable to state-of-the-art approaches. Our results performed favorably in a fair benchmarking competition which adheres to standard criteria. We demonstrate the usefulness of an exhaustive module search, by using the unreduced output to more quickly perform GO term related function prediction tasks. We point out the advantages of our exhaustive output by predicting functional relationships using two examples.We demonstrate that the computation of all densely connected and co-expressed regions in interaction networks is an approach to module discovery of considerable value. Beyond confirming the well settled hypothesis that such co-expressed, densely connected interaction network regions reflect functional modules, we open up novel computational ways to comprehensively analyze the modular organization of an organism based on prevalent and largely
Colak, Recep; Moser, Flavia; Chu, Jeffrey Shih-Chieh; Schönhuth, Alexander; Chen, Nansheng; Ester, Martin
2010-10-25
Computational prediction of functionally related groups of genes (functional modules) from large-scale data is an important issue in computational biology. Gene expression experiments and interaction networks are well studied large-scale data sources, available for many not yet exhaustively annotated organisms. It has been well established, when analyzing these two data sources jointly, modules are often reflected by highly interconnected (dense) regions in the interaction networks whose participating genes are co-expressed. However, the tractability of the problem had remained unclear and methods by which to exhaustively search for such constellations had not been presented. We provide an algorithmic framework, referred to as Densely Connected Biclustering (DECOB), by which the aforementioned search problem becomes tractable. To benchmark the predictive power inherent to the approach, we computed all co-expressed, dense regions in physical protein and genetic interaction networks from human and yeast. An automatized filtering procedure reduces our output which results in smaller collections of modules, comparable to state-of-the-art approaches. Our results performed favorably in a fair benchmarking competition which adheres to standard criteria. We demonstrate the usefulness of an exhaustive module search, by using the unreduced output to more quickly perform GO term related function prediction tasks. We point out the advantages of our exhaustive output by predicting functional relationships using two examples. We demonstrate that the computation of all densely connected and co-expressed regions in interaction networks is an approach to module discovery of considerable value. Beyond confirming the well settled hypothesis that such co-expressed, densely connected interaction network regions reflect functional modules, we open up novel computational ways to comprehensively analyze the modular organization of an organism based on prevalent and largely available large
Directory of Open Access Journals (Sweden)
Dina A Moustafa
Full Text Available Brucella neotomae is not known to be associated with clinical disease in any host species. Previous research suggested that B. neotomae might not express detectable levels of Cu/Zn superoxide dismutase (SOD, a periplasmic enzyme known to be involved in protecting Brucella from oxidative bactericidal effects of host phagocytes. This study was undertaken to investigate the genetic basis for the disparity in SOD expression in B. neotomae. Our Western blot and SOD enzyme assay analyses indicated that B. neotomae does express SOD, but at a substantially reduced level. Nucleotide sequence analysis of region upstream to the sodC gene identified a single-nucleotide insertion in the potential promoter region. The same single-nucleotide insertion was also detected in the sodC promoter of B. suis strain Thomsen, belonging to biovar 2 in which SOD expression was undetectable previously. Examination of the sodC promoter activities using translational fusion constructs with E. coli β-galactosidase demonstrated that the B. neotomae and B. suis biovar 2 promoters were very weak in driving gene expression. Site-directed mutation studies indicated that the insertion of A in the B. neotomae sodC promoter reduced the promoter activity. Increasing the level of SOD expression in B. neotomae through complementation with B. abortus sodC gene did not alter the bacterial survival in J774A.1 macrophage-like cells and in tissues of BALB/c and C57BL/6 mice. These results for the first time demonstrate the occurrence of a single-nucleotide polymorphism affecting promoter function and gene expression in Brucella.
Directory of Open Access Journals (Sweden)
Sun JX
2014-05-01
Full Text Available Jingxu Sun,1,* Yongxi Song,1,* Zhenning Wang,1 Guoli Wang,2 Peng Gao,1 Xiaowan Chen,1 Zhaohua Gao,1 Huimian Xu1 1Department of Surgical Oncology and General Surgery, First Hospital of China Medical University, Shenyang, People’s Republic of China; 2Department of Biochemistry and Molecular Biology, China Medical University, Shenyang, People’s Republic of China *These authors contributed equally to this work Background: MicroRNAs are associated with tumor genesis and progression in various carcinomas. MicroRNA-148a (miR-148a was reported to have low expression in gastrointestinal cancers, and might be regulated by promoter region DNA methylation. Methods: Bisulfite-modified sequencing was used to determine the promoter region DNA methylation status of human gastrointestinal cancer cell lines. Expression levels of miR-148a in cell lines treated with 5-aza-2′-deoxycytidine were determined by quantitative real-time polymerase chain reaction. Total DNA was extracted from the tissues of 64 patients with gastric cancer and 51 patients with colorectal cancer. Methylation status was determined by methylation-specific polymerase chain reaction. All statistical analyses were performed with SPSS 17.0 software. Results: The promoter regions of genes in human gastrointestinal cancer cell lines were all hypermethylated, except for HT-29, and the expression of miR-148a tended to be higher than in controls after treatment with 5-aza-2′-deoxycytidine. The methylation-specific polymerase chain reaction results showed that 56.25% of gastric cancer tissues and 19.61% of colorectal cancer tissues were hypermethylated. A strong correlation was found between the expression of miR-148a and the methylation status of promoter regions (P<0.001, chi-square test and Pearson’s correlation. Furthermore, promoter region CpG site hypermethylation of miR-148a was correlated with increased tumor size (P=0.01 in gastric cancer after analyzing the correlation between
Brand Products of Regional Cuisine in the Promotion of Tourism in Roztocze
Directory of Open Access Journals (Sweden)
Bekier-Jaworska Ewa
2015-03-01
Full Text Available Introduction. There has been a trend over the last few years of using specialties of regional cuisine as an independent tourist attraction. The creation of local brands is an important element in the promotion of a given region and it also influences the development of culinary tourism. The aim of the studies conducted was to identify regional dishes - a choice of dishes that could be described as 'brand dishes' and the use of those dishes as tourist attractions in Roztocze. Material and methods. Studies were conducted on a group of students studying tourism and recreation at State Higher School of Vocational Education (PWSZ in Zamość using a questionnaire. Results. The questionnaire provided an assessment of the levels of knowledge of regional cuisine among Polish and Ukrainian students, identified the most characteristic dishes and selected brand products, and helped to arrive at a suitable method of promotion. Conclusions. Nationality, family customs and selection of local restaurants highly influence knowledge of regional cuisine. Interviewees decided that the most outstanding products from Roztocze were Zwierzyniec beer, and Biłgoraj pie. Regional products should be used as a tourist attraction in Roztocze.
Identification of functional DNA variants in the constitutive promoter region of MDM2
Directory of Open Access Journals (Sweden)
Lalonde Marie-Eve
2012-09-01
Full Text Available Abstract Although mutations in the oncoprotein murine double minute 2 (MDM2 are rare, MDM2 gene overexpression has been observed in several human tumors. Given that even modest changes in MDM2 levels might influence the p53 tumor suppressor signaling pathway, we postulated that sequence variation in the promoter region of MDM2 could lead to disregulated expression and variation in gene dosage. Two promoters have been reported for MDM2; an internal promoter (P2, which is located near the end of intron 1 and is p53-responsive, and an upstream constitutive promoter (P1, which is p53-independent. Both promoter regions contain DNA variants that could influence the expression levels of MDM2, including the well-studied single nucleotide polymorphism (SNP SNP309, which is located in the promoter P2; i.e., upstream of exon 2. In this report, we screened the promoter P1 for DNA variants and assessed the functional impact of the corresponding SNPs. Using the dbSNP database and genotyping validation in individuals of European descent, we identified three common SNPs (−1494 G > A; indel 40 bp; and −182 C > G. Three major promoter haplotypes were inferred by using these three promoter SNPs together with rs2279744 (SNP309. Following subcloning into a gene reporter system, we found that two of the haplotypes significantly influenced MDM2 promoter activity in a haplotype-specific manner. Site-directed mutagenesis experiments indicated that the 40 bp insertion/deletion variation is causing the observed allelic promoter activity. This study suggests that part of the variability in the MDM2 expression levels could be explained by allelic p53-independent P1 promoter activity.
Yang, Chunrong; Shang, Xueying; Cheng, Lei; Yang, Lei; Liu, Xuefei; Bai, Chunling; Wei, Zhuying; Hua, Jinlian; Li, Guangpeng
2017-01-01
Methylation is an important issue in gene expression regulation and also in the fields of genetics and reproduction. In this study, we created fat-1 transgenic sheep, investigated the fine-mapping and the modulatory mechanisms of promoter methylation. Sheep fetal fibroblasts were transfected by pCAG-fat1-IRES-EGFP. Monoclonal cell line was screened as nuclear donor and carried out nuclear transfer (441 transgenic cloned embryos, 52 synchronism recipient sheep). Six offsprings were obtained. Expressions of exogenous genes fat-1 and EGFP were detectable in 10 examined tissues and upregulated omega-3 fatty acid content. Interestingly, more or less EGFP negative cells were detectable in the positive transgenic fetal skin cells. EGFP negative and positive cells were sorted by flow cytometry, and their methylation status in the whole promoter region (1701 nt) were investigated by bisulphate sequencing. The fine-mapping of methylation in CAG promoter were proposed. The results suggested that exogenous gene expression was determined by the methylation status from 721-1346 nt and modulated by methylation levels at 101, 108 and 115 nt sites in CAG promoter. To clarify the regulatory mechanism of methylation, examination of four DNA methyltransferases (DNMTs) demonstrated that hypermethylation of CAG promoter is mainly maintained by DNMT 1 in EGFP negative cells. Furthermore, investigation of the cell surface antigen CD34, CD45 and CD166 indicated that EGFP positive and negative cells belong to different types. The present study systematically clarified methylation status of CAG promoter in transgenic sheep and regulatory mechanism, which will provide research strategies for gene expression regulation in transgenic animals.
International Nuclear Information System (INIS)
Dudetskiy, V Yu; Lariontsev, E G; Chekina, S N
2014-01-01
The synchronisation of the self-modulation oscillation frequency in a Nd : YAG ring laser by an external periodic signal modulating the pump power in the region of parametric resonance between self-modulation and relaxation oscillations is studied theoretically and experimentally. The characteristic features of synchronisation processes in lasers operating in the self-modulation regime of the first kind and in the regime with a doubled self-modulation period are considered. Two bistable branches of synchronisation of self-modulation oscillations are found by numerical calculation. The experimental data agree well with the numerical simulation results for one of these branches, but the other branch of bistable self-modulation oscillations was not observed experimentally. (control of laser radiation parameters)
Sato, Mitsuhiko P; Makino, Takashi; Kawata, Masakado
2016-02-09
Understanding the evolutionary forces that influence variation in gene regulatory regions in natural populations is an important challenge for evolutionary biology because natural selection for such variations could promote adaptive phenotypic evolution. Recently, whole-genome sequence analyses have identified regulatory regions subject to natural selection. However, these studies could not identify the relationship between sequence variation in the detected regions and change in gene expression levels. We analyzed sequence variations in core promoter regions, which are critical regions for gene regulation in higher eukaryotes, in a natural population of Drosophila melanogaster, and identified core promoter sequence variations associated with differences in gene expression levels subjected to natural selection. Among the core promoter regions whose sequence variation could change transcription factor binding sites and explain differences in expression levels, three core promoter regions were detected as candidates associated with purifying selection or selective sweep and seven as candidates associated with balancing selection, excluding the possibility of linkage between these regions and core promoter regions. CHKov1, which confers resistance to the sigma virus and related insecticides, was identified as core promoter regions that has been subject to selective sweep, although it could not be denied that selection for variation in core promoter regions was due to linked single nucleotide polymorphisms in the regulatory region outside core promoter regions. Nucleotide changes in core promoter regions of CHKov1 caused the loss of two basal transcription factor binding sites and acquisition of one transcription factor binding site, resulting in decreased gene expression levels. Of nine core promoter regions regions associated with balancing selection, brat, and CG9044 are associated with neuromuscular junction development, and Nmda1 are associated with learning
Sohoni, Sujata Vijay; Fazio, Alessandro; Workman, Christopher T.; Mijakovic, Ivan; Lantz, Anna Eliasson
2014-01-01
The objective of this study was the application of the synthetic promoter library (SPL) technology for modulation of actinorhodin production in Streptomyces coelicolor A3(2). The SPL technology was used to optimize the expression of a pathway specific positive transcriptional regulator ActII orf4, which activates the transcription of the S. coelicolor actinorhodin biosynthetic gene cluster. The native actII orf4 promoter was replaced with synthetic promoters, generating a S. coelicolor library with a broad range of expression levels of actII orf4. The resulting library was screened based on the yield of actinorhodin. Selected strains were further physiologically characterized. One of the strains from the library, ScoSPL20, showed considerably higher yield of actinorhodin and final actinorhodin titer, compared to S. coelicolor wild type and S. coelicolor with actII orf4 expressed from a strong constitutive promoter. ScoSPL20 demonstrated exceptional productivity despite having a comparatively weak expression from the promoter. Interestingly, the ScoSPL20 promoter was activated at a much earlier stage of growth compared to the wild type, demonstrating the advantage of fine-tuning and temporal tuning of gene expression in metabolic engineering. Transcriptome studies were performed in exponential and actinorhodin-producing phase of growth to compare gene expression between ScoSPL20 and the wild type. To our knowledge, this is the first successful application of the SPL technology for secondary metabolite production in filamentous bacteria. PMID:24963940
Transcriptional regulation by competing transcription factor modules.
Directory of Open Access Journals (Sweden)
Rutger Hermsen
2006-12-01
Full Text Available Gene regulatory networks lie at the heart of cellular computation. In these networks, intracellular and extracellular signals are integrated by transcription factors, which control the expression of transcription units by binding to cis-regulatory regions on the DNA. The designs of both eukaryotic and prokaryotic cis-regulatory regions are usually highly complex. They frequently consist of both repetitive and overlapping transcription factor binding sites. To unravel the design principles of these promoter architectures, we have designed in silico prokaryotic transcriptional logic gates with predefined input-output relations using an evolutionary algorithm. The resulting cis-regulatory designs are often composed of modules that consist of tandem arrays of binding sites to which the transcription factors bind cooperatively. Moreover, these modules often overlap with each other, leading to competition between them. Our analysis thus identifies a new signal integration motif that is based upon the interplay between intramodular cooperativity and intermodular competition. We show that this signal integration mechanism drastically enhances the capacity of cis-regulatory domains to integrate signals. Our results provide a possible explanation for the complexity of promoter architectures and could be used for the rational design of synthetic gene circuits.
Adachi, Akira; Senmatsu, Satoshi; Asada, Ryuta; Abe, Takuya; Hoffman, Charles S; Ohta, Kunihiro; Hirota, Kouji
2018-05-03
Numerous noncoding RNA transcripts are detected in eukaryotic cells. Noncoding RNAs transcribed across gene promoters are involved in the regulation of mRNA transcription via chromatin modulation. This function of noncoding RNA transcription was first demonstrated for the fission yeast fbp1 gene, where a cascade of noncoding RNA transcription events induces chromatin remodeling to facilitate transcription factor binding. We recently demonstrated that the noncoding RNAs from the fbp1 upstream region facilitate binding of the transcription activator Atf1 and thereby promote histone acetylation. Histone acetylation by histone acetyl transferases (HATs) and ATP-dependent chromatin remodelers (ADCRs) are implicated in chromatin remodeling, but the interplay between HATs and ADCRs in this process has not been fully elucidated. Here, we examine the roles played by two distinct ADCRs, Snf22 and Hrp3, and by the HAT Gcn5 in the transcriptional activation of fbp1. Snf22 and Hrp3 redundantly promote disassembly of chromatin in the fbp1 upstream region. Gcn5 critically contributes to nucleosome eviction in the absence of either Snf22 or Hrp3, presumably by recruiting Hrp3 in snf22∆ cells and Snf22 in hrp3∆ cells. Conversely, Gcn5-dependent histone H3 acetylation is impaired in snf22∆/hrp3∆ cells, suggesting that both redundant ADCRs induce recruitment of Gcn5 to the chromatin array in the fbp1 upstream region. These results reveal a previously unappreciated interplay between ADCRs and histone acetylation in which histone acetylation facilitates recruitment of ADCRs, while ADCRs are required for histone acetylation.
Lithium modulation of the human inositol monophosphatase 2 (IMPA2) promoter
International Nuclear Information System (INIS)
Seelan, Ratnam S.; Parthasarathy, Latha K.; Parthasarathy, Ranga N.
2004-01-01
The inositol-signaling pathway is a therapeutic target for lithium in the treatment of bipolar disorder. Inositol monophosphatases (IMPases) play a key role in inositol signaling. Lithium's ability to inhibit IMPase 1 is well known, but its effect on IMPase 2 or on the transcriptional regulation of these genes has not been studied. Here, we report the identification and characterization of the minimal promoter of IMPA2 (encoding IMPase 2) in HeLa (epithelial) and SK-N-AS (neuronal) cells. IMPA2 promoter activity appears to be contributed by different elements in the 5' flanking region, suggesting that the gene is differentially regulated in neuronal and non-neuronal cells. Furthermore, IMPA2 promoter activity in both cell lines is downregulated, in a dose-dependent manner, by lithium after treatment for only 24 h. This effect is also observed in vivo. Our results suggest a possible role for IMPA2 in bipolar disorder
Yin, Tao; Wu, Hanying; Zhang, Shanglong; Lu, Hongyu; Zhang, Lingxiao; Xu, Yong; Chen, Daming; Liu, Jingmei
2009-01-01
A 1.8 kb 5'-flanking region of the large subunit of ADP-glucose pyrophosphorylase, isolated from watermelon (Citrullus vulgaris S.), has fruit-specific promoter activity in transgenic tomato plants. Two negative regulatory regions, from -986 to -959 and from -472 to -424, were identified in this promoter region by fine deletion analyses. Removal of both regions led to constitutive expression in epidermal cells. Gain-of-function experiments showed that these two regions were sufficient to inhibit RFP (red fluorescent protein) expression in transformed epidermal cells when fused to the cauliflower mosaic virus (CaMV) 35S minimal promoter. Gel mobility shift experiments demonstrated the presence of leaf nuclear factors that interact with these two elements. A TCCAAAA motif was identified in these two regions, as well as one in the reverse orientation, which was confirmed to be a novel specific cis-element. A quantitative beta-glucuronidase (GUS) activity assay of stable transgenic tomato plants showed that the activities of chimeric promoters harbouring only one of the two cis-elements, or both, were approximately 10-fold higher in fruits than in leaves. These data confirm that the TCCAAAA motif functions as a fruit-specific element by inhibiting gene expression in leaves.
Genome-wide function of H2B ubiquitylation in promoter and genic regions.
Batta, Kiran; Zhang, Zhenhai; Yen, Kuangyu; Goffman, David B; Pugh, B Franklin
2011-11-01
Nucleosomal organization in and around genes may contribute substantially to transcriptional regulation. The contribution of histone modifications to genome-wide nucleosomal organization has not been systematically evaluated. In the present study, we examine the role of H2BK123 ubiquitylation, a key regulator of several histone modifications, on nucleosomal organization at promoter, genic, and transcription termination regions in Saccharomyces cerevisiae. Using high-resolution MNase chromatin immunoprecipitation and sequencing (ChIP-seq), we map nucleosome positioning and occupancy in mutants of the H2BK123 ubiquitylation pathway. We found that H2B ubiquitylation-mediated nucleosome formation and/or stability inhibits the assembly of the transcription machinery at normally quiescent promoters, whereas ubiquitylation within highly active gene bodies promotes transcription elongation. This regulation does not proceed through ubiquitylation-regulated histone marks at H3K4, K36, and K79. Our findings suggest that mechanistically similar functions of H2B ubiquitylation (nucleosome assembly) elicit different functional outcomes on genes depending on its positional context in promoters (repressive) versus transcribed regions (activating).
Directory of Open Access Journals (Sweden)
Regina Augustin
2011-01-01
Full Text Available The molecular mechanisms and genetic risk factors underlying Alzheimer's disease (AD pathogenesis are only partly understood. To identify new factors, which may contribute to AD, different approaches are taken including proteomics, genetics, and functional genomics. Here, we used a bioinformatics approach and found that distinct AD-related genes share modules of transcription factor binding sites, suggesting a transcriptional coregulation. To detect additional coregulated genes, which may potentially contribute to AD, we established a new bioinformatics workflow with known multivariate methods like support vector machines, biclustering, and predicted transcription factor binding site modules by using in silico analysis and over 400 expression arrays from human and mouse. Two significant modules are composed of three transcription factor families: CTCF, SP1F, and EGRF/ZBPF, which are conserved between human and mouse APP promoter sequences. The specific combination of in silico promoter and multivariate analysis can identify regulation mechanisms of genes involved in multifactorial diseases.
The promotion of regional integration of electricity markets: Lessons for developing countries
International Nuclear Information System (INIS)
Oseni, Musiliu O.; Pollitt, Michael G.
2016-01-01
This paper focuses on how to promote regional cooperation in electricity. We begin by discussing the theory of international trade cooperation in electricity, with a view to discussing what preconditions might be important in facilitating wide area trading across national borders. We then develop lessons based on the comparison of four case studies. These include three regional developing country power pools – the Southern African Power pool (SAPP), West African Power pool (WAPP) and the Central American Power Market (MER). We contrast these with Northern Europe's Nord Pool. These cases highlight both the potential and difficulty of having cross-jurisdictional power pools. In the light of the theory and evidence we present, we draw key lessons in the areas of: preconditions for trading; necessary institutional arrangements; practicalities of timetabling; reasons to be hopeful about future prospects. - Highlights: • This paper focuses on how to promote regional electricity cooperation. • We develop lessons based on comparison of four international case studies. • The cases highlight both the potential and difficulty of power pools. • We identify preconditions, institutional arrangements and timetabling. • We conclude that the future prospects for regional power pools are good.
Wei, Yongwei; Feng, Kurtis; Yao, Xiangjie; Cai, Hui; Li, Junan; Mirza, Anne M.; Iorio, Ronald M.
2012-01-01
The genus Metapneumovirus within the subfamily Pneumovirinae of the family Paramyxoviridae includes two members, human metapneumovirus (hMPV) and avian metapneumovirus (aMPV), causing respiratory tract infections in humans and birds, respectively. Paramyxoviruses enter host cells by fusing the viral envelope with a host cell membrane. Membrane fusion of hMPV appears to be unique, in that fusion of some hMPV strains requires low pH. Here, we show that the fusion (F) proteins of aMPV promote fusion in the absence of the attachment protein and low pH is not required. Furthermore, there are notable differences in cell-cell fusion among aMPV subtypes. Trypsin was required for cell-cell fusion induced by subtype B but not subtypes A and C. The F protein of aMPV subtype A was highly fusogenic, whereas those from subtypes B and C were not. By construction and evaluation of chimeric F proteins composed of domains from the F proteins of subtypes A and B, we localized a region composed of amino acid residues 170 to 338 in the F protein that is responsible for the hyperfusogenic phenotype of the F from subtype A. Further mutagenesis analysis revealed that residues R295, G297, and K323 in this region collectively contributed to the hyperfusogenicity. Taken together, we have identified a region in the aMPV F protein that modulates the extent of membrane fusion. A model for fusion consistent with these data is presented. PMID:22915815
Wei, Yongwei; Feng, Kurtis; Yao, Xiangjie; Cai, Hui; Li, Junan; Mirza, Anne M; Iorio, Ronald M; Li, Jianrong
2012-11-01
The genus Metapneumovirus within the subfamily Pneumovirinae of the family Paramyxoviridae includes two members, human metapneumovirus (hMPV) and avian metapneumovirus (aMPV), causing respiratory tract infections in humans and birds, respectively. Paramyxoviruses enter host cells by fusing the viral envelope with a host cell membrane. Membrane fusion of hMPV appears to be unique, in that fusion of some hMPV strains requires low pH. Here, we show that the fusion (F) proteins of aMPV promote fusion in the absence of the attachment protein and low pH is not required. Furthermore, there are notable differences in cell-cell fusion among aMPV subtypes. Trypsin was required for cell-cell fusion induced by subtype B but not subtypes A and C. The F protein of aMPV subtype A was highly fusogenic, whereas those from subtypes B and C were not. By construction and evaluation of chimeric F proteins composed of domains from the F proteins of subtypes A and B, we localized a region composed of amino acid residues 170 to 338 in the F protein that is responsible for the hyperfusogenic phenotype of the F from subtype A. Further mutagenesis analysis revealed that residues R295, G297, and K323 in this region collectively contributed to the hyperfusogenicity. Taken together, we have identified a region in the aMPV F protein that modulates the extent of membrane fusion. A model for fusion consistent with these data is presented.
International Nuclear Information System (INIS)
Cui Wei; Yin Lingling; Dong Lingyue
2012-01-01
Objective: To clarify the mechanism of immediate early response gene 5 (Ier5) transcription induced by radiation. Methods: Deletant construction, site-specific mutagenesis,electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) were used to forecast the promoter region, binding sites and transcription factors of Ier5 gene in HeLa cells. Results: The promoter region of Ier5 gene might be in the region of Ier5 -8 deletant (-408 - -238 bp). The Ier5 gene had two transcription factors of GCF and NFI, and GCF had two binding sites located in the region of -388 - -382 bp and -274 - -270 bp of Ier5 promoter. The binding site of NFI was located in -362 - -357 bp of Ier5 promoter. GCF could inhibit the expression of Ier5 gene and this inhibition was diminished when the radiation dose increased. In contrast, NFI increased the expression of Ier5. Conclusions: The most possible region of Ier5 promoter is from -408 to -238 bp which has two binding sites for the radiosensitivity transcription factors of GCF and NFI that could negatively and positively regulate the expression of Ier5 respectively. (authors)
DNA Methylation Analysis of BRD1 Promoter Regions and the Schizophrenia rs138880 Risk Allele.
Directory of Open Access Journals (Sweden)
Mads Dyrvig
Full Text Available The bromodomain containing 1 gene, BRD1 is essential for embryogenesis and CNS development. It encodes a protein that participates in histone modifying complexes and thereby regulates the expression of a large number of genes. Genetic variants in the BRD1 locus show association with schizophrenia and bipolar disorder and risk alleles in the promoter region correlate with reduced BRD1 expression. Insights into the transcriptional regulation of BRD1 and the pathogenic mechanisms associated with BRD1 risk variants, however, remain sparse. By studying transcripts in human HeLa and SH-SY5Y cells we provide evidence for differences in relative expression of BRD1 transcripts with three alternative 5' UTRs (exon 1C, 1B, and 1A. We further show that expression of these transcript variants covaries negatively with DNA methylation proportions in their upstream promoter regions suggesting that promoter usage might be regulated by DNA methylation. In line with findings that the risk allele of the rs138880 SNP in the BRD1 promoter region correlates with reduced BRD1 expression, we find that it is also associated with moderate regional BRD1 promoter hypermethylation in both adipose tissue and blood. Importantly, we demonstrate by inspecting available DNA methylation and expression data that these regions undergo changes in methylation during fetal brain development and that differences in their methylation proportions in fetal compared to postnatal frontal cortex correlate significantly with BRD1 expression. These findings suggest that BRD1 may be dysregulated in both the developing and mature brain of risk allele carriers. Finally, we demonstrate that commonly used mood stabilizers Lithium, Valproate, and Carbamazepine affect the expression of BRD1 in SH-SY5Y cells. Altogether this study indicates a link between genetic risk and epigenetic dysregulation of BRD1 which raises interesting perspectives for targeting the mechanisms pharmacologically.
Draeger, B. G.; Joyner, J. A.
1976-01-01
A detailed performance evaluation of the Abort Region Determinator (ARD) module design was provided in support of OFT-1 ascent and OFT-1 intact launch aborts. The evaluation method used compared ARD results against results obtained using the full-up Space Vehicle Dynamic Simulations program under the same conditions. Results were presented for each of the three major ARD math models: (1) the ascent numerical integrator; (2) the mass model, and (3) the second stage predictor as well as the total ARD module. These results demonstrate that the baselined ARD module meets all design objectives for mission control center orbital flight test launch/abort support.
Kopp, Sandra L; Smith, Hugh M
2011-01-01
Little is known about the use of Web-based education in regional anesthesia training. Benefits of Web-based education include the ability to standardize learning material quality and content, build appropriate learning progressions, use interactive multimedia technologies, and individualize delivery of course materials. The goals of this investigation were (1) to determine whether module design influences regional anesthesia knowledge acquisition, (2) to characterize learner preference patterns among anesthesia residents, and (3) to determine whether learner preferences play a role in knowledge acquisition. Direct comparison of knowledge assessments, learning styles, and learner preferences will be made between an interactive case-based and a traditional textbook-style module design. Forty-three Mayo Clinic anesthesiology residents completed 2 online modules, a knowledge pretest, posttest, an Index of Learning Styles assessment, and a participant satisfaction survey. Interscalene and lumbar plexus regional techniques were selected as the learning content for 4 Web modules constructed using the Blackboard Vista coursework application. One traditional textbook-style module and 1 interactive case-based module were designed for each of the interscalene and lumbar plexus techniques. Participants scored higher on the postmodule knowledge assessment for both of the interscalene and lumbar plexus modules. Postmodule knowledge performance scores were independent of both module design (interactive case-based versus traditional textbook style) and learning style preferences. However, nearly all participants reported a preference for Web-based learning and believe that it should be used in anesthesia resident education. Participants did not feel that Web-base learning should replace the current lecture-based curriculum. All residents scored higher on the postmodule knowledge assessment, but this improvement was independent of the module design and individual learning styles
Troll, Joshua V; Hamilton, M Kristina; Abel, Melissa L; Ganz, Julia; Bates, Jennifer M; Stephens, W Zac; Melancon, Ellie; van der Vaart, Michiel; Meijer, Annemarie H; Distel, Martin; Eisen, Judith S; Guillemin, Karen
2018-02-23
Resident microbes promote many aspects of host development, although the mechanisms by which microbiota influence host tissues remain unclear. We showed previously that the microbiota is required for allocation of appropriate numbers of secretory cells in the zebrafish intestinal epithelium. Because Notch signaling is crucial for secretory fate determination, we conducted epistasis experiments to establish whether the microbiota modulates host Notch signaling. We also investigated whether innate immune signaling transduces microbiota cues via the Myd88 adaptor protein. We provide the first evidence that microbiota-induced, Myd88-dependent signaling inhibits host Notch signaling in the intestinal epithelium, thereby promoting secretory cell fate determination. These results connect microbiota activity via innate immune signaling to the Notch pathway, which also plays crucial roles in intestinal homeostasis throughout life and when impaired can result in chronic inflammation and cancer. © 2018. Published by The Company of Biologists Ltd.
Melo, A D B; Silveira, H; Luciano, F B; Andrade, C; Costa, L B; Rostagno, M H
2016-01-01
The intestinal environment plays a critical role in maintaining swine health. Many factors such as diet, microbiota, and host intestinal immune response influence the intestinal environment. Intestinal alkaline phosphatase (IAP) is an important apical brush border enzyme that is influenced by these factors. IAP dephosphorylates bacterial lipopolysaccharides (LPS), unmethylated cytosine-guanosine dinucleotides, and flagellin, reducing bacterial toxicity and consequently regulating toll-like receptors (TLRs) activation and inflammation. It also desphosphorylates extracellular nucleotides such as uridine diphosphate and adenosine triphosphate, consequently reducing inflammation, modulating, and preserving the homeostasis of the intestinal microbiota. The apical localization of IAP on the epithelial surface reveals its role on LPS (from luminal bacteria) detoxification. As the expression of IAP is reported to be downregulated in piglets at weaning, LPS from commensal and pathogenic gram-negative bacteria could increase inflammatory processes by TLR-4 activation, increasing diarrhea events during this phase. Although some studies had reported potential IAP roles to promote gut health, investigations about exogenous IAP effects or feed additives modulating IAP expression and activity yet are necessary. However, we discussed in this paper that the critical assessment reported can suggest that exogenous IAP or feed additives that could increase its expression could show beneficial effects to reduce diarrhea events during the post weaning phase. Therefore, the main goals of this review are to discuss IAP's role in intestinal inflammatory processes and present feed additives used as growth promoters that may modulate IAP expression and activity to promote gut health in piglets.
A study of the frequency of methylation of gene promoter regions in ...
Indian Academy of Sciences (India)
2013-04-02
Apr 2, 2013 ... colorectal cancer in the Taiwanese population. CHANG-CHIEH WU1 ... hypermethylation of promoter-region CpG islands is an important ... mismatch repair gene MLH1 plays an important role in dele- ..... Asia Pac. J. Clin.
Insulators form gene loops by interacting with promoters in Drosophila.
Erokhin, Maksim; Davydova, Anna; Kyrchanova, Olga; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya
2011-09-01
Chromatin insulators are regulatory elements involved in the modulation of enhancer-promoter communication. The 1A2 and Wari insulators are located immediately downstream of the Drosophila yellow and white genes, respectively. Using an assay based on the yeast GAL4 activator, we have found that both insulators are able to interact with their target promoters in transgenic lines, forming gene loops. The existence of an insulator-promoter loop is confirmed by the fact that insulator proteins could be detected on the promoter only in the presence of an insulator in the transgene. The upstream promoter regions, which are required for long-distance stimulation by enhancers, are not essential for promoter-insulator interactions. Both insulators support basal activity of the yellow and white promoters in eyes. Thus, the ability of insulators to interact with promoters might play an important role in the regulation of basal gene transcription.
Ummenhofer, C. C.; Sen Gupta, A.; England, M. H.
2008-12-01
In a series of atmospheric general circulation model simulations, the potential impact of Indian Ocean sea surface temperature (SST) anomalies in modulating low- to mid-latitude precipitation around the Indian Ocean rim countries is explored. The relative importance of various characteristic tropical and subtropical Indian Ocean SST poles, both individually and in combination, to regional precipitation changes is quantified. A mechanism for the rainfall modulation is proposed, by which the SST anomalies induce changes in the thermal properties of the atmosphere, resulting in a reorganization of the large-scale atmospheric circulation across the Indian Ocean basin. Across western and southern regions of Australia, rainfall anomalies are found to be due to modulations in the meridional thickness gradient, thermal wind, and baroclinicity, leading to changes in the moisture flux onto the continent. The pattern of large-scale circulation changes over the tropical Indian Ocean and adjacent land masses is consistent with an anomalous strengthening of the Walker cell, leading to variations in precipitation of opposite sign across western and eastern regions of the basin. Links between long-term changes in Indian Ocean surface properties and regional precipitation changes in Indian Ocean rim countries are also discussed in a broader context with implications for water management and seasonal forecasting.
Genome-wide analysis of promoter architecture in Drosophila melanogaster
Energy Technology Data Exchange (ETDEWEB)
Hoskins, Roger A.; Landolin, Jane M.; Brown, James B.; Sandler, Jeremy E.; Takahashi, Hazuki; Lassmann, Timo; Yu, Charles; Booth, Benjamin W.; Zhang, Dayu; Wan, Kenneth H.; Yang, Li; Boley, Nathan; Andrews, Justen; Kaufman, Thomas C.; Graveley, Brenton R.; Bickel, Peter J.; Carninci, Piero; Carlson, Joseph W.; Celniker, Susan E.
2010-10-20
Core promoters are critical regions for gene regulation in higher eukaryotes. However, the boundaries of promoter regions, the relative rates of initiation at the transcription start sites (TSSs) distributed within them, and the functional significance of promoter architecture remain poorly understood. We produced a high-resolution map of promoters active in the Drosophila melanogaster embryo by integrating data from three independent and complementary methods: 21 million cap analysis of gene expression (CAGE) tags, 1.2 million RNA ligase mediated rapid amplification of cDNA ends (RLMRACE) reads, and 50,000 cap-trapped expressed sequence tags (ESTs). We defined 12,454 promoters of 8037 genes. Our analysis indicates that, due to non-promoter-associated RNA background signal, previous studies have likely overestimated the number of promoter-associated CAGE clusters by fivefold. We show that TSS distributions form a complex continuum of shapes, and that promoters active in the embryo and adult have highly similar shapes in 95% of cases. This suggests that these distributions are generally determined by static elements such as local DNA sequence and are not modulated by dynamic signals such as histone modifications. Transcription factor binding motifs are differentially enriched as a function of promoter shape, and peaked promoter shape is correlated with both temporal and spatial regulation of gene expression. Our results contribute to the emerging view that core promoters are functionally diverse and control patterning of gene expression in Drosophila and mammals.
Role of regional policies in promoting networking and innovation activity of firms
Kirsi Mukkala; Jari Ritsilä
2004-01-01
The success of firms and regions is increasingly defined by their innovation and learning capabilities. It has been emphasized in several studies that a local operational environment may have a positive impact on innovation activity of firms. From policy point of view, the relationship between firms and their local environment is an important research topic. The purpose of this paper is to explore whether there is a demand for regional policy makers in promoting innovative and networking acti...
Electroabsorption optical modulator
Energy Technology Data Exchange (ETDEWEB)
Skogen, Erik J.
2017-11-21
An electroabsorption modulator incorporates waveguiding regions along the length of the modulator that include quantum wells where at least two of the regions have quantum wells with different bandgaps. In one embodiment of the invention, the regions are arranged such that the quantum wells have bandgaps with decreasing bandgap energy along the length of the modulator from the modulator's input to its output. The bandgap energy of the quantum wells may be decreased in discrete steps or continuously. Advantageously, such an arrangement better distributes the optical absorption as well as the carrier density along the length of the modulator. Further advantageously, the modulator may handle increased optical power as compared with prior art modulators of similar dimensions, which allows for improved link gain when the optical modulator is used in an analog optical communication link.
DEFF Research Database (Denmark)
Jensen, Anne
Pricing of transport has been part of EU's common transport policy since this gained momentum in the early 1990s. Since then, it has been closely connected to the trans-European transport network (TEN-T) and to rising demands of efficient mobility systems at a local, regional and Community scale....... Development of pricing policies is contested at Community level and has taken place in a clash between different policy rationalities. Significantly though, the effects of the pricing policies are closely related to regional mobility systems, e.g. through financing large trans-border infrastructure projects...... and establishing common technical charging systems thus changing the conditions for regional mobility. This paper explores how policies of infrastructure pricing shape new ways of governing mobility which influences trans-border, regional policy-making. The key findings are that there is a tendency to include...
International Nuclear Information System (INIS)
Kong, Fangfang; Ying, Hongmei; Du, Chengrun; Huang, Shuang; Zhou, Junjun; Chen, Junchao; Sun, Lining; Chen, Xiaohui; Hu, Chaosu
2014-01-01
To analyze patterns of local-regional failure after primary intensity modulated radiotherapy (IMRT) for nasopharyngeal carcinoma (NPC). A total of 370 non-metastatic NPC patients consecutively treated with IMRT (with or without chemotherapy) were analyzed. Radiotherapy was administered using a simultaneous integrated boost (SIB) technique at the total prescribed dose of 66-70.4Gy (2.0-2.2Gy per fraction). The location and extent of local-regional failures were transferred to the pretreatment planning computed tomography (CT) for dosimetric analysis. The dose of radiation received by V recur (volume of recurrence) was calculated and analyzed with dose-volume histogram (DVH). Failures were classified as: 'in field' if 95% of V recur was within the 95% isodose, 'marginal' if 20% to 95% of V recur was within the 95% isodose, or 'outside' if less than 20% of V recur was inside the 95% isodose. With a median follow up of 26 months, 25 local-regional failures were found in 18 patients. The 1- and 2-year actuarial local-regional control rates for all patients were 99.7% and 95.5% respectively. Among the 22 local–regional failures with available diagnostic images, 16 (64%) occurred within the 95% isodose lines and were considered in-field failures; 3 (12%) were marginal and 3 (12%) were outside-field failures. Intensity-modulated radiotherapy provides excellent local-regional control for NPC. In-field failures are the main patterns for local-regional recurrence. Reducing the coverage of critical adjacent tissues in CTV purposefully for potential subclinical diseases was worth of study. Great attention in all IMRT steps is necessary to reduce potential causes of marginal failures. More studies about radioresistance are needed to reduce in-field failures
Engineered Promoters for Potent Transient Overexpression.
Directory of Open Access Journals (Sweden)
Dan Y Even
Full Text Available The core promoter, which is generally defined as the region to which RNA Polymerase II is recruited to initiate transcription, plays a pivotal role in the regulation of gene expression. The core promoter consists of different combinations of several short DNA sequences, termed core promoter elements or motifs, which confer specific functional properties to each promoter. Earlier studies that examined the ability to modulate gene expression levels via the core promoter, led to the design of strong synthetic core promoters, which combine different core elements into a single core promoter. Here, we designed a new core promoter, termed super core promoter 3 (SCP3, which combines four core promoter elements (the TATA box, Inr, MTE and DPE into a single promoter that drives prolonged and potent gene expression. We analyzed the effect of core promoter architecture on the temporal dynamics of reporter gene expression by engineering EGFP expression vectors that are driven by distinct core promoters. We used live cell imaging and flow cytometric analyses in different human cell lines to demonstrate that SCPs, particularly the novel SCP3, drive unusually strong long-term EGFP expression. Importantly, this is the first demonstration of long-term expression in transiently transfected mammalian cells, indicating that engineered core promoters can provide a novel non-viral strategy for biotechnological as well as gene-therapy-related applications that require potent expression for extended time periods.
Nucleopolis for promoting the nuclear excellence of the Normandy region
International Nuclear Information System (INIS)
2016-01-01
Nucleopolis is the Norman economic pole dedicated to nuclear energy, nuclear medicine and nuclear safety, it gathers about 70 enterprises whatever their sizes, research laboratories and teaching or training units. Nucleopolis was founded in 2009 with the economic development of the region as a unique purpose. Nucleopolis will ease the access of its members to local, national and international markets through actions of networking and by promoting innovations and skill development. Nucleopolis proposes to its members a series of services around 4 departments: Nucleo'Network to promote networking between the members themselves and between the members and major contractors; Nucleo'Business to propose assistance in national and international business; Nucleo'Competence to propose adequate training to its members to upgrade their skills and Nucleo'Innovation to foster collaborative work between its members on innovative projects. (A.C.)
Restoration of CpG Methylation in The Egf Promoter Region during Rat Liver Regeneration
Deming, Li; Ziwei, Li; Xueqiang, Guo; Cunshuan, Xu
2015-01-01
Epidermal growth factor (EGF) is an important factor for healing after tissue damage in diverse experimental models. It plays an important role in liver regeneration (LR). The objective of this experiment is to investigate the methylation variation of 10 CpG sites in the Egf promoter region and their relevance to Egf expression during rat liver regenera- tion. As a follow up of our previous study, rat liver tissue was collected after rat 2/3 partial hepatectomy (PH) during the re-organization phase (from days 14 to days 28). Liver DNA was extracted and modified by sodium bisulfate. The methylation status of 10 CpG sites in Egf promoter region was determined using bisulfite sequencing polymerase chain reaction (PCR), as BSP method. The results showed that 3 (sites 3, 4 and 9) out of 10 CpG sites have strikingly methylation changes during the re-organization phase compared to the regeneration phase (from 2 hours to 168 hours, P=0.002, 0.048 and 0.018, respectively). Our results showed that methylation modification of CpGs in the Egf promoter region could be restored to the status before PH operation and changes of methylation didn’t affect Egf mRNA expression during the re-organization phase. PMID:26464832
Exploiting nucleotide composition to engineer promoters.
Directory of Open Access Journals (Sweden)
Manfred G Grabherr
Full Text Available The choice of promoter is a critical step in optimizing the efficiency and stability of recombinant protein production in mammalian cell lines. Artificial promoters that provide stable expression across cell lines and can be designed to the desired strength constitute an alternative to the use of viral promoters. Here, we show how the nucleotide characteristics of highly active human promoters can be modelled via the genome-wide frequency distribution of short motifs: by overlapping motifs that occur infrequently in the genome, we constructed contiguous sequence that is rich in GC and CpGs, both features of known promoters, but lacking homology to real promoters. We show that snippets from this sequence, at 100 base pairs or longer, drive gene expression in vitro in a number of mammalian cells, and are thus candidates for use in protein production. We further show that expression is driven by the general transcription factors TFIIB and TFIID, both being ubiquitously present across cell types, which results in less tissue- and species-specific regulation compared to the viral promoter SV40. We lastly found that the strength of a promoter can be tuned up and down by modulating the counts of GC and CpGs in localized regions. These results constitute a "proof-of-concept" for custom-designing promoters that are suitable for biotechnological and medical applications.
Directory of Open Access Journals (Sweden)
Susanne Helm
Full Text Available During the blood meal of a Plasmodium-infected mosquito, 10 to 100 parasites are inoculated into the skin and a proportion of these migrate via the bloodstream to the liver where they infect hepatocytes. The Plasmodium liver stage, despite its clinical silence, represents a highly promising target for antimalarial drug and vaccine approaches. Successfully invaded parasites undergo a massive proliferation in hepatocytes, producing thousands of merozoites that are transported into a blood vessel to infect red blood cells. To successfully develop from the liver stage into infective merozoites, a tight regulation of gene expression is needed. Although this is a very interesting aspect in the biology of Plasmodium, little is known about gene regulation in Plasmodium parasites in general and in the liver stage in particular. We have functionally analyzed a novel promoter region of the rodent parasite Plasmodium berghei that is exclusively active during the liver stage of the parasite. To prove stage-specific activity of the promoter, GFP and luciferase reporter assays have been successfully established, allowing both qualitative and accurate quantitative analysis. To further characterize the promoter region, the transcription start site was mapped by rapid amplification of cDNA ends (5'-RACE. Using promoter truncation experiments and site-directed mutagenesis within potential transcription factor binding sites, we suggest that the minimal promoter contains more than one binding site for the recently identified parasite-specific ApiAP2 transcription factors. The identification of a liver stage-specific promoter in P. berghei confirms that the parasite is able to tightly regulate gene expression during its life cycle. The identified promoter region might now be used to study the biology of the Plasmodium liver stage, which has thus far proven problematic on a molecular level. Stage-specific expression of dominant-negative mutant proteins and
Zhang, Linjun; Yue, Qiuhai; Zhang, Yang; Shu, Hua; Li, Ping
2015-01-01
Numerous studies have revealed the essential role of the left lateral temporal cortex in auditory sentence comprehension along with evidence of the functional specialization of the anterior and posterior temporal sub-areas. However, it is unclear whether task demands (e.g., active vs. passive listening) modulate the functional specificity of these sub-areas. In the present functional magnetic resonance imaging (fMRI) study, we addressed this issue by applying both independent component analysis (ICA) and general linear model (GLM) methods. Consistent with previous studies, intelligible sentences elicited greater activity in the left lateral temporal cortex relative to unintelligible sentences. Moreover, responses to intelligibility in the sub-regions were differentially modulated by task demands. While the overall activation patterns of the anterior and posterior superior temporal sulcus and middle temporal gyrus (STS/MTG) were equivalent during both passive and active tasks, a middle portion of the STS/MTG was found to be selectively activated only during the active task under a refined analysis of sub-regional contributions. Our results not only confirm the critical role of the left lateral temporal cortex in auditory sentence comprehension but further demonstrate that task demands modulate functional specialization of the anterior-middle-posterior temporal sub-areas. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K
2011-09-01
Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.
Governmental promotion of the Information Society in the Spanish Region of Valencia
Directory of Open Access Journals (Sweden)
Emilio Feliu-García, Ph.D.
2011-01-01
Full Text Available Regional spheres are considered essential in the governmental promotion of the Information Society at the international level. The regional initiatives in Spain aim to strengthen and complement the initiatives promoted at the national level. This article analyses ICT penetration in the Valencian Community from 1996 to 2008. The objective is to identify which of the actions carried out by the Valencian Regional Government have had a positive effect on its society.The methodology employed in this study is benchmarking. The selection of indicators is based on the policies evaluation model proposed in the Plan Avanza (Spain’s national Information Society strategy. Data were collected from official statistical sources (like Spain’s National Statistics Institute, INE. Three statistical tests were applied to verify the hypotheses (Pearson’s r2, Chi-square and Student’s t.The results indicate that it is not possible to affirm that the actions implemented by the Valencian Regional Government have had a more positive effect on its society than those implemented by the Spanish Central Government. A reason for this may lie in the specific objectives of the political strategy implemented by the Valencian Government, which has focused primarily on e-Government and does not include enough projects centred on the implementation of new technologies in the private sector. Moreover, the integration of new technologies in everyday life is placed in a second level of importance despite citizens are central actors in the international agenda.
Crew Factors in Flight Operations XV: Alertness Management in General Aviation Education Module
Rosekind, Mark R.; Co, Elizabeth L.; Neri, David F.; Oyung, Raymond L.; Mallis, Melissa M.; Cannon, Mary M. (Technical Monitor)
2002-01-01
Regional operations encompass a broad range of pilots and equipment. This module is intended to help all those involved in regional aviation, including pilots, schedulers, dispatchers, maintenance technicians, policy makers, and others, to understand the physiological factors underlying fatigue, how flight operations affect fatigue, and what can be done to counteract fatigue and maximize alertness and performance in their operations. The overall purpose of this module is to promote aviation safety, performance, and productivity. It is intended to meet three specific objectives: (1) to explain the current state of knowledge about the physiological mechanisms underlying fatigue; (2) to demonstrate how this knowledge can be applied to improving flight crew sleep, performance, and alertness; and (3) to offer strategies for alertness management. Aviation Safety Reporting System (ASRS) and National Transportation Safety Board (NISH) reports are used throughout this module to demonstrate that fatigue is a safety issue in the regional operations community. The appendices at the end of this module include the ASRS reports used for the examples contained in this publication, brief introductions to sleep disorders and relaxation techniques, summaries of relevant NASA publications, and a list of general readings on sleep, sleep disorders, and circadian rhythms.
Hannan, Md Abdul; Mohibbullah, Md; Hong, Yong-Ki; Nam, Joo Hyun; Moon, Il Soo
2014-01-01
Neurotrophic factors are essential for the differentiation and maturation of developing neurons as well as providing survival support to the mature neurons. Moreover, therapeutically neurotrophic factors are promising to reconstruct partially damaged neuronal networks in neurodegenerative diseases. In the previous study, we reported that the ethanol extract of an edible marine alga, Gelidium amansii (GAE) had shown promising effects in the development and maturation of both axon and dendrites of hippocampal neurons. Here, we demonstrate that in primary culture of hippocampal neurons (1) GAE promotes a significant increase in the number of filopodia and dendritic spines; (2) promotes synaptogenesis; (3) enhances N-methyl-D-aspartic acid (NMDA) receptor recruitment; and (4) modulates NMDA-receptor-mediated postsynaptic current. Taken together these findings that GAE might be involved in both morphological and functional maturation of neurons suggest the possibility that GAE may constitute a promising candidate for novel compounds for the prevention and treatment of neurodegenerative diseases.
Kim, Yong Sook; Jeong, Hye-yun; Kim, Ah Ra; Kim, Woong-Hee; Cho, Haaglim; Um, JungIn; Seo, Youngha; Kang, Wan Seok; Jin, Suk-Won; Kim, Min Chul; Kim, Yong-Chul; Jung, Da-Woon; Williams, Darren R.; Ahn, Youngkeun
2016-01-01
The cardiac microenvironment includes cardiomyocytes, fibroblasts and macrophages, which regulate remodeling after myocardial infarction (MI). Targeting this microenvironment is a novel therapeutic approach for MI. We found that the natural compound derivative, BIO ((2′Z,3′E)-6-Bromoindirubin-3′-oxime) modulated the cardiac microenvironment to exert a therapeutic effect on MI. Using a series of co-culture studies, BIO induced proliferation in cardiomyocytes and inhibited proliferation in cardiac fibroblasts. BIO produced multiple anti-fibrotic effects in cardiac fibroblasts. In macrophages, BIO inhibited the expression of pro-inflammatory factors. Significantly, BIO modulated the molecular crosstalk between cardiac fibroblasts and differentiating macrophages to induce polarization to the anti-inflammatory M2 phenotype. In the optically transparent zebrafish-based heart failure model, BIO induced cardiomyocyte proliferation and completely recovered survival rate. BIO is a known glycogen synthase kinase-3β inhibitor, but these effects could not be recapitulated using the classical inhibitor, lithium chloride; indicating novel therapeutic effects of BIO. We identified the mechanism of BIO as differential modulation of p27 protein expression and potent induction of anti-inflammatory interleukin-10. In a rat MI model, BIO reduced fibrosis and improved cardiac performance. Histological analysis revealed modulation of the cardiac microenvironment by BIO, with increased presence of anti-inflammatory M2 macrophages. Our results demonstrate that BIO produces unique effects in the cardiac microenvironment to promote recovery post-MI. PMID:27510556
Newton, K; Jorgensen, N M; Wallace, A J; Buchanan, D D; Lalloo, F; McMahon, R F T; Hill, J; Evans, D G
2014-12-01
Lynch syndrome (LS) patients have DNA mismatch repair deficiency and up to 80% lifetime risk of colorectal cancer (CRC). Screening of mutation carriers reduces CRC incidence and mortality. Selection for constitutional mutation testing relies on family history (Amsterdam and Bethesda Guidelines) and tumour-derived biomarkers. Initial biomarker analysis uses mismatch repair protein immunohistochemistry and microsatellite instability. Abnormalities in either identify mismatch repair deficiency but do not differentiate sporadic epigenetic defects, due to MLH1 promoter region methylation (13% of CRCs) from LS (4% of CRCs). A diagnostic biomarker capable of making this distinction would be valuable. This study compared two biomarkers in tumours with mismatch repair deficiency; quantification of methylation of the MLH1 promoter region using a novel assay and BRAF c.1799T>A, p.(Val600Glu) mutation status in the identification of constitutional mutations. Tumour DNA was extracted (formalin fixed, paraffin embedded, FFPE tissue) and pyrosequencing used to test for MLH1 promoter methylation and presence of the BRAF c.1799T>A, p.(Val600Glu) mutation 71 CRCs from individuals with pathogenic MLH1 mutations and 73 CRCs with sporadic MLH1 loss. Specificity and sensitivity was compared. Unmethylated MLH1 promoter: sensitivity 94.4% (95% CI 86.2% to 98.4%), specificity 87.7% (95% CI 77.9% to 94.2%), Wild-type BRAF (codon 600): sensitivity 65.8% (95% CI 53.7% to 76.5%), specificity 98.6% (95% CI 92.4% to 100.0%) for the identification of those with pathogenic MLH1 mutations. Quantitative MLH1 promoter region methylation using pyrosequencing is superior to BRAF codon 600 mutation status in identifying constitutional mutations in mismatch repair deficient tumours. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
Substance P promotes wound healing in diabetes by modulating inflammation and macrophage phenotype.
Leal, Ermelindo C; Carvalho, Eugénia; Tellechea, Ana; Kafanas, Antonios; Tecilazich, Francesco; Kearney, Cathal; Kuchibhotla, Sarada; Auster, Michael E; Kokkotou, Efi; Mooney, David J; LoGerfo, Frank W; Pradhan-Nabzdyk, Leena; Veves, Aristidis
2015-06-01
Diabetic foot ulceration is a major complication of diabetes. Substance P (SP) is involved in wound healing, but its effect in diabetic skin wounds is unclear. We examined the effect of exogenous SP delivery on diabetic mouse and rabbit wounds. We also studied the impact of deficiency in SP or its receptor, neurokinin-1 receptor, on wound healing in mouse models. SP treatment improved wound healing in mice and rabbits, whereas the absence of SP or its receptor impaired wound progression in mice. Moreover, SP bioavailability in diabetic skin was reduced as SP gene expression was decreased, whereas the gene expression and protein levels of the enzyme that degrades SP, neutral endopeptidase, were increased. Diabetes and SP deficiency were associated with absence of an acute inflammatory response important for wound healing progression and instead revealed a persistent inflammation throughout the healing process. SP treatment induced an acute inflammatory response, which enabled the progression to the proliferative phase and modulated macrophage activation toward the M2 phenotype that promotes wound healing. In conclusion, SP treatment reverses the chronic proinflammatory state in diabetic skin and promotes healing of diabetic wounds. Copyright © 2015 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.
Bongiorni, Silvia; Tilesi, Francesca; Bicorgna, Silvia; Iacoponi, Francesca; Willems, Daniela; Gargani, Maria; D'Andrea, MariaSilvia; Pilla, Fabio; Valentini, Alessio
2014-11-07
Success of meat production and selection for improvement of meat quality is among the primary aims in animal production. Meat quality traits are economically important in swine; however, the underlying genetic nature is very complex. Therefore, an improved pork production strongly depends on identifying and studying how genetic variations contribute to modulate gene expression. Promoters are key regions in gene modulation as they harbour several binding motifs to transcription regulatory factors. Therefore, polymorphisms in these regions are likely to deeply affect RNA levels and consequently protein synthesis. In this study, we report the identification of single nucleotide polymorphisms (SNPs) in promoter regions of candidate genes involved in development, cellular differentiation and muscle growth in Sus scrofa. We identified SNPs in the promoter regions of genes belonging to the Myogenic Regulatory Factors (MRF) gene family (the Myogenic Differentiation gene, MYOD1) and to Growth and Differentiation Factors (GDF) gene family (Myostatin gene, MSTN, GDF8), in Casertana and Large White breeds. The purpose of this study was to investigate if polymorphisms in the promoters could affect the transcriptional activity of these genes. With this aim, we evaluated in vitro the functional activity of the luciferase reporter gene luc2 activity, driven by two constructs carrying different promoter haplotypes. We tested the effects of the G302A (U12574) transition on the promoter efficiency in MYOD1 gene. We ascertained a difference in transcription efficiency for the two variants. A stronger activity of the A-carrying construct is more evident in C2C12. The luciferase expression driven by the MYOD1-A allelic variant displayed a 3.8-fold increased transcriptional activity. We investigated the activity of two haplotype variants (AY527152) in the promoter of GDF8 gene. The haploptype-1 (A435-A447-A879) up-regulated the expression of the reporter gene by a two-fold increase, and
Ambigapathy, Ganesh; Zheng, Zhaoqing; Keifer, Joyce
2014-08-01
Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I-III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI-III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression.
Brown, Maile R; Kronengold, Jack; Gazula, Valeswara-Rao; Spilianakis, Charalampos G; Flavell, Richard A; von Hehn, Christian A A; Bhattacharjee, Arin; Kaczmarek, Leonard K
2008-11-01
The rates of activation and unitary properties of Na+-activated K+ (K(Na)) currents have been found to vary substantially in different types of neurones. One class of K(Na) channels is encoded by the Slack gene. We have now determined that alternative RNA splicing gives rise to at least five different transcripts for Slack, which produce Slack channels that differ in their predicted cytoplasmic amino-termini and in their kinetic properties. Two of these, termed Slack-A channels, contain an amino-terminus domain closely resembling that of another class of K(Na) channels encoded by the Slick gene. Neuronal expression of Slack-A channels and of the previously described Slack isoform, now called Slack-B, are driven by independent promoters. Slack-A mRNAs were enriched in the brainstem and olfactory bulb and detected at significant levels in four different brain regions. When expressed in CHO cells, Slack-A channels activate rapidly upon depolarization and, in single channel recordings in Xenopus oocytes, are characterized by multiple subconductance states with only brief transient openings to the fully open state. In contrast, Slack-B channels activate slowly over hundreds of milliseconds, with openings to the fully open state that are approximately 6-fold longer than those for Slack-A channels. In numerical simulations, neurones in which outward currents are dominated by a Slack-A-like conductance adapt very rapidly to repeated or maintained stimulation over a wide range of stimulus strengths. In contrast, Slack-B currents promote rhythmic firing during maintained stimulation, and allow adaptation rate to vary with stimulus strength. Using an antibody that recognizes all amino-termini isoforms of Slack, Slack immunoreactivity is present at locations that have no Slack-B-specific staining, including olfactory bulb glomeruli and the dendrites of hippocampal neurones, suggesting that Slack channels with alternate amino-termini such as Slack-A channels are present at
Liu, Xi; Dai, Fangyin; Guo, Enen; Li, Kang; Ma, Li; Tian, Ling; Cao, Yang; Zhang, Guozheng; Palli, Subba R; Li, Sheng
2015-11-06
As revealed in a previous microarray study to identify genes regulated by 20-hydroxyecdysone (20E) and juvenile hormone (JH) in the silkworm, Bombyx mori, E93 expression in the fat body was markedly low prior to the wandering stage but abundant during larval-pupal metamorphosis. Induced by 20E and suppressed by JH, E93 expression follows this developmental profile in multiple silkworm alleles. The reduction of E93 expression by RNAi disrupted 20E signaling and the 20E-induced autophagy, caspase activity, and cell dissociation in the fat body. Reducing E93 expression also decreased the expression of the 20E-induced pupal-specific cuticle protein genes and prevented growth and differentiation of the wing discs. Importantly, the two HTH domains in E93 are critical for inducing the expression of a subset of 20E response genes, including EcR, USP, E74, Br-C, and Atg1. By contrast, the LLQHLL and PLDLSAK motifs in E93 inhibit its transcriptional activity. E93 binds to the EcR-USP complex via a physical association with USP through its LLQHLL motif; and this association is enhanced by 20E-induced EcR-USP interaction, which attenuates the transcriptional activity of E93. E93 acts through the two HTH domains to bind to GAGA-containing motifs present in the Atg1 promoter region for inducing gene expression. In conclusion, E93 transcriptionally modulates 20E signaling to promote Bombyx larval-pupal metamorphosis. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Liu, Xi; Dai, Fangyin; Guo, Enen; Li, Kang; Ma, Li; Tian, Ling; Cao, Yang; Zhang, Guozheng; Palli, Subba R.; Li, Sheng
2015-01-01
As revealed in a previous microarray study to identify genes regulated by 20-hydroxyecdysone (20E) and juvenile hormone (JH) in the silkworm, Bombyx mori, E93 expression in the fat body was markedly low prior to the wandering stage but abundant during larval-pupal metamorphosis. Induced by 20E and suppressed by JH, E93 expression follows this developmental profile in multiple silkworm alleles. The reduction of E93 expression by RNAi disrupted 20E signaling and the 20E-induced autophagy, caspase activity, and cell dissociation in the fat body. Reducing E93 expression also decreased the expression of the 20E-induced pupal-specific cuticle protein genes and prevented growth and differentiation of the wing discs. Importantly, the two HTH domains in E93 are critical for inducing the expression of a subset of 20E response genes, including EcR, USP, E74, Br-C, and Atg1. By contrast, the LLQHLL and PLDLSAK motifs in E93 inhibit its transcriptional activity. E93 binds to the EcR-USP complex via a physical association with USP through its LLQHLL motif; and this association is enhanced by 20E-induced EcR-USP interaction, which attenuates the transcriptional activity of E93. E93 acts through the two HTH domains to bind to GAGA-containing motifs present in the Atg1 promoter region for inducing gene expression. In conclusion, E93 transcriptionally modulates 20E signaling to promote Bombyx larval-pupal metamorphosis. PMID:26378227
International Nuclear Information System (INIS)
Xie, Xin; Dai, Hui; Zhuang, Binyu; Chai, Li; Xie, Yanguang; Li, Yuzhen
2016-01-01
The effects and the underlying mechanisms of hydrogen sulfide (H 2 S) on keratinocyte proliferation and differentiation are still less known. In the current study, we investigated the effects and the underlying mechanisms of exogenous H 2 S on keratinocyte proliferation and differentiation. Human keratinocytes (HaCaT cells) were treated with various concentrations (0.05, 0.25, 0.5 and 1 mM) of sodium hydrosulfide (NaHS, a donor of H 2 S) for 24 h. A CCK-8 assay was used to assess cell viability. Western blot analysis was performed to determine the expression levels of proteins associated with differentiation and autophagy. Transmission electron microscopy was performed to observe autophagic vacuoles, and flow cytometry was applied to evaluate apoptosis. NaHS promoted the viability, induced the differentiation, and enhanced autophagic activity in a dose-dependent manner in HaCaT cells but had no effect on cell apoptosis. Blockage of autophagy by ATG5 siRNA inhibited NaHS-induced cell proliferation and differentiation. The current study demonstrated that autophagy in response to exogenous H 2 S treatment promoted keratinocyte proliferation and differentiation. Our results provide additional insights into the potential role of autophagy in keratinocyte proliferation and differentiation. - Highlights: • Exogenous H 2 S promotes keratinocyte proliferation and differentiation. • The effects of H 2 S on proliferation and differentiation is modulated by autophagy. • Exogenous H 2 S has no effect on keratinocyte apoptosis.
New PAH gene promoter KLF1 and 3'-region C/EBPalpha motifs influence transcription in vitro.
Klaassen, Kristel; Stankovic, Biljana; Kotur, Nikola; Djordjevic, Maja; Zukic, Branka; Nikcevic, Gordana; Ugrin, Milena; Spasovski, Vesna; Srzentic, Sanja; Pavlovic, Sonja; Stojiljkovic, Maja
2017-02-01
Phenylketonuria (PKU) is a metabolic disease caused by mutations in the phenylalanine hydroxylase (PAH) gene. Although the PAH genotype remains the main determinant of PKU phenotype severity, genotype-phenotype inconsistencies have been reported. In this study, we focused on unanalysed sequences in non-coding PAH gene regions to assess their possible influence on the PKU phenotype. We transiently transfected HepG2 cells with various chloramphenicol acetyl transferase (CAT) reporter constructs which included PAH gene non-coding regions. Selected non-coding regions were indicated by in silico prediction to contain transcription factor binding sites. Furthermore, electrophoretic mobility shift assay (EMSA) and supershift assays were performed to identify which transcriptional factors were engaged in the interaction. We found novel KLF1 motif in the PAH promoter, which decreases CAT activity by 50 % in comparison to basal transcription in vitro. The cytosine at the c.-170 promoter position creates an additional binding site for the protein complex involving KLF1 transcription factor. Moreover, we assessed for the first time the role of a multivariant variable number tandem repeat (VNTR) region located in the 3'-region of the PAH gene. We found that the VNTR3, VNTR7 and VNTR8 constructs had approximately 60 % of CAT activity. The regulation is mediated by the C/EBPalpha transcription factor, present in protein complex binding to VNTR3. Our study highlighted two novel promoter KLF1 and 3'-region C/EBPalpha motifs in the PAH gene which decrease transcription in vitro and, thus, could be considered as PAH expression modifiers. New transcription motifs in non-coding regions will contribute to better understanding of the PKU phenotype complexity and may become important for the optimisation of PKU treatment.
International Nuclear Information System (INIS)
Fox, J.D.
1981-01-01
This module provides bunch identification and timing signals for the PEP Interaction areas. Timing information is referenced to the PEP master oscillator, and adjusted in phase as a function of region. Identification signals are generated in a manner that allows observers in all interaction regions to agree on an unambiguous bunch identity. The module provides bunch identification signals via NIM level logic, upon CAMAC command, and through LED indicators. A front panel ''region select'' switch allows the same module to be used in all regions. The module has two modes of operation: a bunch identification mode and a calibration mode. In the identification mode, signals indicate which of the three bunches of electrons and positrons are interacting, and timing information about beam crossing is provided. The calibration mode is provided to assist experimenters making time of flight measurements. In the calibration mode, three distinct gating signals are referenced to a selected bunch, allowing three timing systems to be calibrated against a common standard. Physically, the bunch identifier is constructed as a single width CAMAC module. 2 figs., 1 tab
Cytosine deletion at AP2-box region of HSP70 promoter and its ...
Indian Academy of Sciences (India)
Cytosine deletion at AP2-box region of HSP70 promoter and its influence on semen quality traits in crossbred bulls ... Laboratory, ICAR-Central Institute for Research on Cattle, Meerut 250 001, India; School of Atmospheric Stress Management, ICAR-National Institute of Abiotic Stress Management, Baramati 413 115, India ...
Directory of Open Access Journals (Sweden)
Nelli Babayan
2011-12-01
Full Text Available Building on the model of the enlargement policy, the European Union (EU designed the European Neighbourhood Policy and the Eastern Partnership to further promote its norms and principles. One of the goals of its new policies has been to foster regional cooperation among partner countries and their neighbours. This article specifies the EU’s framework for promoting regional cooperation through the aforementioned policies and discusses its potential impact on the example of the South Caucasus republics of Armenia, Azerbaijan, and Georgia. The South Caucasus has not only been an arena of intraregional conflicts, but has also often been troubled by disputes between its neighbours. This article argues that, due to a lack of proactive and consistent engagement, the EU’s framework risks leaving regional conflicts in the current state of stagnation and without advancement in regional cooperation.
International Nuclear Information System (INIS)
Kiehl, Anita; Huang, Lili; Franchi, David; Anders, David G.
2003-01-01
The human cytomegalovirus (HCMV) UL57 gene lies adjacent to HCMV oriLyt, from which it is separated by an organizationally conserved, mostly noncoding region that is thought to both regulate UL57 expression and activate oriLyt function. However, the UL57 promoter has not been studied. We determined the 5' ends of UL57 transcripts toward an understanding of the potential relationship between UL57 expression and oriLyt activation. The results presented here identified three distinct 5' ends spread over 800 bp, at nt 90302, 90530, and 91138; use of these sites exhibited differential sensitivity to phosphonoformic acid treatment. Interestingly, a 10-kb UL57 transcript accumulated in cycloheximide-treated infected cells, even though other early transcripts were not detectable. However, the 10-kb transcript did not accumulate in cells treated with the more stringent translation inhibitor anisomycin. Consistent with the notion that the identified 5' ends arise from distinct transcription start sites, the sequences upstream of sites I and II functioned as promoters responsive to HCMV infection in transient assays. However, the origin-proximal promoter region III required downstream sequences for transcriptional activity. Mutation of candidate core promoter elements suggested that promoter III is regulated by an initiator region (Inr) and a downstream promoter element. Finally, a 42-bp sequence containing the candidate Inr activated a minimal oriLyt core construct in transient replication assays. Thus, these studies showed that a large, complex promoter region with novel features controls UL57 expression, and identified a sequence that regulates both UL57 transcription and oriLyt activation
DEFF Research Database (Denmark)
Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P
1994-01-01
To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter...... volunteers. By applying inverse polymerase chain reaction and direct DNA sequencing, 532 base pairs (bp) of the GS promoter were identified and the transcriptional start site determined by primer extension. SSCP scanning of the promoter region detected five single nucleotide substitutions, positioned at 42......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...
Statistical significance of cis-regulatory modules
Directory of Open Access Journals (Sweden)
Smith Andrew D
2007-01-01
Full Text Available Abstract Background It is becoming increasingly important for researchers to be able to scan through large genomic regions for transcription factor binding sites or clusters of binding sites forming cis-regulatory modules. Correspondingly, there has been a push to develop algorithms for the rapid detection and assessment of cis-regulatory modules. While various algorithms for this purpose have been introduced, most are not well suited for rapid, genome scale scanning. Results We introduce methods designed for the detection and statistical evaluation of cis-regulatory modules, modeled as either clusters of individual binding sites or as combinations of sites with constrained organization. In order to determine the statistical significance of module sites, we first need a method to determine the statistical significance of single transcription factor binding site matches. We introduce a straightforward method of estimating the statistical significance of single site matches using a database of known promoters to produce data structures that can be used to estimate p-values for binding site matches. We next introduce a technique to calculate the statistical significance of the arrangement of binding sites within a module using a max-gap model. If the module scanned for has defined organizational parameters, the probability of the module is corrected to account for organizational constraints. The statistical significance of single site matches and the architecture of sites within the module can be combined to provide an overall estimation of statistical significance of cis-regulatory module sites. Conclusion The methods introduced in this paper allow for the detection and statistical evaluation of single transcription factor binding sites and cis-regulatory modules. The features described are implemented in the Search Tool for Occurrences of Regulatory Motifs (STORM and MODSTORM software.
Newton, K; Jorgensen, NM; Wallace, AJ; Buchanan, DD; Lalloo, F; McMahon, RFT; Hill, J; Evans, DG
2016-01-01
Background & Aims Lynch syndrome patients have DNA mismatch repair deficiency and up to 80% life-time risk of colorectal cancer. Screening of mutation carriers reduces colorectal cancer incidence and mortality. Selection for constitutional mutation testing relies on family history (Amsterdam and Bethesda Guidelines) and tumour derived biomarkers. Initial biomarker analysis uses mismatch repair protein immunohistochemistry and microsatellite instability. Abnormalities in either identify mismatch repair deficiency but do not differentiate sporadic epigenetic defects, due to MLH1 promoter region methylation (13% of CRCs) from Lynch Syndrome (4% of CRCs). A diagnostic biomarker capable of making this distinction would be valuable. This study compared two biomarkers in tumours with mismatch repair deficiency; quantification of methylation of the MLH1 promoter region using a novel assay and BRAF c.1799T>A, p.(Val600Glu) mutation status in the identification of constitutional mutations. Methods Tumour DNA was extracted (FFPE tissue) and pyrosequencing used to test for MLH1 promoter methylation and presence of the BRAF c.1799T>A, p.(Val600Glu) mutation 71 CRCs from individuals with pathogenic MLH1 mutations and 73 CRCs with sporadic MLH1 loss. Specificity and sensitivity was compared. Findings Unmethylated MLH1 promoter: sensitivity 94.4% (95% CI 86.2–98.4%), specificity 87.7% (95% CI 77.9–94.2%), Wild-type BRAF (codon 600): sensitivity 65.8% (95% CI 53.7–76.5%), specificity 98.6% (95% CI 92.4–100.0%) for the identification of those with pathogenic MLH1 mutations. Conclusions Quantitative MLH1 promoter region methylation using pyrosequencing is superior to BRAF codon 600 mutation status in identifying constitutional mutations in mismatch repair deficient tumours. PMID:25280751
Carrara, Paola; Antoninetti, Massimo; Bacai, Hina; Basoni, Anna; Bosc, Christelle; Clave, Magali; Cornacchia, Carmela; L'Astorina, Alba; Monbet, Philippe; Mueller, Bastian; Nicolau, Sonia; Pergola, Nicola; Rampini, Anna; Tramutoli, Valerio; Schumacher, Volker; Wells, Alan; Zepeda Juarez, Jesus; Zolotikova, Svetlana
2013-04-01
which have significant impact on the economy, environment and the quality of life of the citizens To this aim since 2011 the system of Regional Contact Offices (RCOs) was promoted by the EU FP7 DORIS_Net (Downsteam Observatory organized by Regions Active in Space - Network, http://www.doris-net.eu/) project as the regional link to the services provided by the European GMES programme. Since then a first nucleus of 12 pilot European Regions were working together establishing 6 first RCOs around Europe. This paper will present RCOs network goals, achievements and perspectives as well as its planned actions devoted to improve quality of Space Technology products from one side, to promote awareness and use of them by potential end-users (and particularly LRAs), from the other side.
Energy Technology Data Exchange (ETDEWEB)
Xie, Xin [Department of Dermatology, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, Heilongjiang Province (China); Dai, Hui [Department of Cardiology, The First Affiliated Hospital of Harbin Medical University, Harbin, 150001, Heilongjiang Province (China); Zhuang, Binyu [Department of Dermatology, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, Heilongjiang Province (China); Chai, Li; Xie, Yanguang [Institute of Dermatology of Heilongjiang Province, Harbin, 150001, Heilongjiang Province (China); Li, Yuzhen, E-mail: liyuzhen@medmail.com.cn [Department of Dermatology, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, Heilongjiang Province (China)
2016-04-08
The effects and the underlying mechanisms of hydrogen sulfide (H{sub 2}S) on keratinocyte proliferation and differentiation are still less known. In the current study, we investigated the effects and the underlying mechanisms of exogenous H{sub 2}S on keratinocyte proliferation and differentiation. Human keratinocytes (HaCaT cells) were treated with various concentrations (0.05, 0.25, 0.5 and 1 mM) of sodium hydrosulfide (NaHS, a donor of H{sub 2}S) for 24 h. A CCK-8 assay was used to assess cell viability. Western blot analysis was performed to determine the expression levels of proteins associated with differentiation and autophagy. Transmission electron microscopy was performed to observe autophagic vacuoles, and flow cytometry was applied to evaluate apoptosis. NaHS promoted the viability, induced the differentiation, and enhanced autophagic activity in a dose-dependent manner in HaCaT cells but had no effect on cell apoptosis. Blockage of autophagy by ATG5 siRNA inhibited NaHS-induced cell proliferation and differentiation. The current study demonstrated that autophagy in response to exogenous H{sub 2}S treatment promoted keratinocyte proliferation and differentiation. Our results provide additional insights into the potential role of autophagy in keratinocyte proliferation and differentiation. - Highlights: • Exogenous H{sub 2}S promotes keratinocyte proliferation and differentiation. • The effects of H{sub 2}S on proliferation and differentiation is modulated by autophagy. • Exogenous H{sub 2}S has no effect on keratinocyte apoptosis.
The human oxytocin gene promoter is regulated by estrogens.
Richard, S; Zingg, H H
1990-04-15
Gonadal steroids affect brain function primarily by altering the expression of specific genes, yet the specific mechanisms by which neuronal target genes undergo such regulation are unknown. Recent evidence suggests that the expression of the neuropeptide gene for oxytocin (OT) is modulated by estrogens. We therefore examined the possibility that this regulation occurred via a direct interaction of the estrogen-receptor complex with cis-acting elements flanking the OT gene. DNA-mediated gene transfer experiments were performed using Neuro-2a neuroblastoma cells and chimeric plasmids containing portions of the human OT gene 5'-glanking region linked to the chloramphenicol acetyltransferase gene. We identified a 19-base pair region located at -164 to -146 upstream of the transcription start site which is capable of conferring estrogen responsiveness to the homologous as well as to a heterologous promoter. The hormonal response is strictly dependent on the presence of intracellular estrogen receptors, since estrogen induced stimulation occurred only in Neuro-2a cells co-transfected with an expression vector for the human estrogen receptor. The identified region contains a novel imperfect palindrome (GGTGACCTTGACC) with sequence similarity to other estrogen response elements (EREs). To define cis-acting elements that function in synergism with the ERE, sequences 3' to the ERE were deleted, including the CCAAT box, two additional motifs corresponding to the right half of the ERE palindrome (TGACC), as well as a CTGCTAA heptamer similar to the "elegans box" found in Caenorhabditis elegans. Interestingly, optimal function of the identified ERE was fully independent of these elements and only required a short promoter region (-49 to +36). Our studies define a molecular mechanism by which estrogens can directly modulate OT gene expression. However, only a subset of OT neurons are capable of binding estrogens, therefore, direct action of estrogens on the OT gene may be
Promoter-wide hypermethylation of the ribosomal RNA gene promoter in the suicide brain.
Directory of Open Access Journals (Sweden)
Patrick O McGowan
Full Text Available BACKGROUND: Alterations in gene expression in the suicide brain have been reported and for several genes DNA methylation as an epigenetic regulator is thought to play a role. rRNA genes, that encode ribosomal RNA, are the backbone of the protein synthesis machinery and levels of rRNA gene promoter methylation determine rRNA transcription. METHODOLOGY/PRINCIPAL FINDINGS: We test here by sodium bisulfite mapping of the rRNA promoter and quantitative real-time PCR of rRNA expression the hypothesis that epigenetic differences in critical loci in the brain are involved in the pathophysiology of suicide. Suicide subjects in this study were selected for a history of early childhood neglect/abuse, which is associated with decreased hippocampal volume and cognitive impairments. rRNA was significantly hypermethylated throughout the promoter and 5' regulatory region in the brain of suicide subjects, consistent with reduced rRNA expression in the hippocampus. This difference in rRNA methylation was not evident in the cerebellum and occurred in the absence of genome-wide changes in methylation, as assessed by nearest neighbor. CONCLUSIONS/SIGNIFICANCE: This is the first study to show aberrant regulation of the protein synthesis machinery in the suicide brain. The data implicate the epigenetic modulation of rRNA in the pathophysiology of suicide.
Directory of Open Access Journals (Sweden)
Mostafa M Abbas
Full Text Available As the number of sequenced bacterial genomes increases, the need for rapid and reliable tools for the annotation of functional elements (e.g., transcriptional regulatory elements becomes more desirable. Promoters are the key regulatory elements, which recruit the transcriptional machinery through binding to a variety of regulatory proteins (known as sigma factors. The identification of the promoter regions is very challenging because these regions do not adhere to specific sequence patterns or motifs and are difficult to determine experimentally. Machine learning represents a promising and cost-effective approach for computational identification of prokaryotic promoter regions. However, the quality of the predictors depends on several factors including: i training data; ii data representation; iii classification algorithms; iv evaluation procedures. In this work, we create several variants of E. coli promoter data sets and utilize them to experimentally examine the effect of these factors on the predictive performance of E. coli σ70 promoter models. Our results suggest that under some combinations of the first three criteria, a prediction model might perform very well on cross-validation experiments while its performance on independent test data is drastically very poor. This emphasizes the importance of evaluating promoter region predictors using independent test data, which corrects for the over-optimistic performance that might be estimated using the cross-validation procedure. Our analysis of the tested models shows that good prediction models often perform well despite how the non-promoter data was obtained. On the other hand, poor prediction models seems to be more sensitive to the choice of non-promoter sequences. Interestingly, the best performing sequence-based classifiers outperform the best performing structure-based classifiers on both cross-validation and independent test performance evaluation experiments. Finally, we propose a
Directory of Open Access Journals (Sweden)
Susanne Schmeier
2009-01-01
Full Text Available The development of international rivers is often perceived as leading to conflicts or even water wars. However, as the development of the Mekong River shows, cooperation has not only prevailed in the last decades, but River Basin Organizations (RBOs, established to mitigate river-related conflicts and/or develop the river basin, have also contributed to the emergence of more general cooperation structures, mainly by creating spill-over effects in other issue-areas, bringing cooperation to policy fields beyond the river itself. This article assesses the contribution of the Mekong River Commission (MRC and the Greater Mekong Sub-Region (GMS to the sustainable development of the Mekong Region as well as to the promotion of regional cooperation in mainland South-East Asia in general. --- Die Entwicklung grenzüberschreitender Flüsse wird oft mit Konflikten oder gar Kriegen um Wasser assoziiert. Wie jedoch die Entwicklung im Mekong-Becken zeigt, waren die vergangenen Jahrzehnte nicht nur von Kooperation gezeichnet, sondern Flussbeckenorganisationen konnten außerdem dazu beitragen, weitreichendere Kooperationsstrukturen zu entwickeln, die sich auf andere Politikfelder ausdehnen. Dieser Artikel beschäftigt sich mit dem Beitrag der Mekong River Commission (MRC und der Greater Mekong Sub-Region (GMS zur nachhaltigen Entwicklung in der Mekong Region sowie zur Förderung allgemeiner regionaler Kooperation im Festländischen Südostasien.
International Nuclear Information System (INIS)
Oliveira, Isaura N. Sombra; Schiable, Homero; Porcel, Naider T.; Frere, Annie F.; Marques, Paulo M.A.
1996-01-01
An investigation of the 'optimum region' of the radiation field considering mammographic systems is studied. Such a region was defined in previous works as the field range where the system has its best performance and sharpest images. This study is based on a correlation of two methods for evaluating radiologic imaging systems, both using computer simulation in order to determine modulation transfer functions (MTFs) due to the X-ray tube focal spot in several field orientation and locations
Levine, Arie; Shamir, Raanan; Wine, Eytan; Weiss, Batya; Karban, Amir; Shaoul, Ron R; Reif, Shimon S; Yakir, Benjamin; Friedlander, Marcello; Kaniel, Yael; Leshinsky-Silver, Esther
2005-07-01
Delayed growth is common in pediatric Crohn's disease (CD). Multiple factors have been shown to affect growth in this situation, the most prominent being the presence and severity of inflammation and inadequate nutritional intake. Inflammation, anorexia, and weight loss are all manifestations of circulating TNF-alpha, which is elevated in CD. The ability to secrete TNF-alpha may be affected by polymorphisms in the TNF-alpha promoter. The aim of our study was to determine whether growth retardation and disease severity in pediatric onset CD are affected by TNF promoter genotype. Genotyping for TNF-alpha and NOD2/CARD15 single nucleotide polymorphisms was performed in 87 patients with detailed growth records. Parameters including disease location and disease severity were recorded, and the effect of these polymorphisms on Z-scores for height and weight at disease onset and during follow-up were analyzed. Lower age of onset was linked to more height retardation, while the presence of colonic disease and the absence of ileal disease were more likely to predict the absence of growth retardation. The presence of two polymorphisms thought to decrease circulating TNF-alpha was associated with higher mean Z-scores for height and a trend toward less growth retardation. Two other polymorphisms were modestly associated with disease severity. Polymorphisms in the TNF-alpha promoter may independently modulate growth and disease severity in pediatric onset CD. The effect of these polymorphisms does not appear to be mediated via weight loss, and is relatively modest.
PI3K/AKT signaling modulates transcriptional expression of EWS/FLI1 through specificity protein 1.
Giorgi, Chiara; Boro, Aleksandar; Rechfeld, Florian; Lopez-Garcia, Laura A; Gierisch, Maria E; Schäfer, Beat W; Niggli, Felix K
2015-10-06
Ewing sarcoma (ES) is the second most frequent bone cancer in childhood and is characterized by the presence of the balanced translocation t(11;22)(q24;q12) in more than 85% of cases, generating a dysregulated transcription factor EWS/FLI1. This fusion protein is an essential oncogenic component of ES development which is necessary for tumor cell maintenance and represents an attractive therapeutic target. To search for modulators of EWS/FLI1 activity we screened a library of 153 targeted compounds and identified inhibitors of the PI3K pathway to directly modulate EWS/FLI1 transcription. Surprisingly, treatment of four different ES cell lines with BEZ235 resulted in down regulation of EWS/FLI1 mRNA and protein by ~50% with subsequent modulation of target gene expression. Analysis of the EWS/FLI1 promoter region (-2239/+67) using various deletion constructs identified two 14 bp minimal elements as being important for EWS/FLI1 transcription. We identified SP1 as modulator of EWS/FLI1 gene expression and demonstrated direct binding to one of these regions in the EWS/FLI1 promoter by EMSA and ChIP experiments. These results provide the first insights on the transcriptional regulation of EWS/FLI1, an area that has not been investigated so far, and offer an additional molecular explanation for the known sensitivity of ES cell lines to PI3K inhibition.
National Research Council Canada - National Science Library
Carpenter, Steven
1997-01-01
This study provides retrospective market research information about the population who enrolled in TRICARE Prime in TRICARE Region 11 and the advertising mediums used to promote enrollment in the TRICARE Prime program...
Modulational instability for an induced field in the far-wake region of a space vehicle
International Nuclear Information System (INIS)
Liao Jingjing; Deng Qian; Qu Wen
2012-01-01
The behavior of the induced field and the generation of density cavitons in the far-wake region (|k 0 | → 0) of a space vehicle can be described by a set of nonlinear coupling equations. Modulational instability of the induced field is investigated on the basis of the nonlinear equations. The results show that the induced field is modulationally unstable and will collapse into spatial localized structures; meanwhile, density cavitons will be generated. The characteristic scale and the maximum growth rate of the induced field depend not only on the angle between the amplitude of pump waves E 0 and the perturbation wave vector k, but also on the energy density of pump waves |E 0 | 2 . (paper)
International Nuclear Information System (INIS)
Apostolaki, Angeliki; Kalosakas, George
2011-01-01
We mapped promoter regions of double-stranded DNA with respect to the probabilities of appearance of relatively large bubble openings exclusively due to thermal fluctuations at physiological temperatures. We analyzed five well-studied promoter regions of procaryotic type and found a spatial correlation between the binding sites of transcription factors and the position of peaks in the probability pattern of large thermal openings. Other distinct peaks of the calculated patterns correlate with potential binding sites of DNA-binding proteins. These results suggest that a DNA molecule would more frequently expose the bases that participate in contacts with proteins, which would probably enhance the probability of the latter to reach their targets. It also stands for using this method as a means to analyze DNA sequences based on their intrinsic thermal properties
Alhammad, Yousef; Gu, Jun; Boo, Irene; Harrison, David; McCaffrey, Kathleen; Vietheer, Patricia T; Edwards, Stirling; Quinn, Charles; Coulibaly, Fásseli; Poumbourios, Pantelis; Drummer, Heidi E
2015-12-01
Hepatitis C virus (HCV) envelope glycoproteins E1 and E2 form a heterodimer and mediate receptor interactions and viral fusion. Both E1 and E2 are targets of the neutralizing antibody (NAb) response and are candidates for the production of vaccines that generate humoral immunity. Previous studies demonstrated that N-terminal hypervariable region 1 (HVR1) can modulate the neutralization potential of monoclonal antibodies (MAbs), but no information is available on the influence of HVR2 or the intergenotypic variable region (igVR) on antigenicity. In this study, we examined how the variable regions influence the antigenicity of the receptor binding domain of E2 spanning HCV polyprotein residues 384 to 661 (E2661) using a panel of MAbs raised against E2661 and E2661 lacking HVR1, HVR2, and the igVR (Δ123) and well-characterized MAbs isolated from infected humans. We show for a subset of both neutralizing and nonneutralizing MAbs that all three variable regions decrease the ability of MAbs to bind E2661 and reduce the ability of MAbs to inhibit E2-CD81 interactions. In addition, we describe a new MAb directed toward the region spanning residues 411 to 428 of E2 (MAb24) that demonstrates broad neutralization against all 7 genotypes of HCV. The ability of MAb24 to inhibit E2-CD81 interactions is strongly influenced by the three variable regions. Our data suggest that HVR1, HVR2, and the igVR modulate exposure of epitopes on the core domain of E2 and their ability to prevent E2-CD81 interactions. These studies suggest that the function of HVR2 and the igVR is to modulate antibody recognition of glycoprotein E2 and may contribute to immune evasion. This study reveals conformational and antigenic differences between the Δ123 and intact E2661 glycoproteins and provides new structural and functional data about the three variable regions and their role in occluding neutralizing and nonneutralizing epitopes on the E2 core domain. The variable regions may therefore function to
Directory of Open Access Journals (Sweden)
Masataka Kikuchi
Full Text Available Alzheimer's disease (AD, the most common cause of dementia, is associated with aging, and it leads to neuron death. Deposits of amyloid β and aberrantly phosphorylated tau protein are known as pathological hallmarks of AD, but the underlying mechanisms have not yet been revealed. A high-throughput gene expression analysis previously showed that differentially expressed genes accompanying the progression of AD were more down-regulated than up-regulated in the later stages of AD. This suggested that the molecular networks and their constituent modules collapsed along with AD progression. In this study, by using gene expression profiles and protein interaction networks (PINs, we identified the PINs expressed in three brain regions: the entorhinal cortex (EC, hippocampus (HIP and superior frontal gyrus (SFG. Dividing the expressed PINs into modules, we examined the stability of the modules with AD progression and with normal aging. We found that in the AD modules, the constituent proteins, interactions and cellular functions were not maintained between consecutive stages through all brain regions. Interestingly, the modules were collapsed with AD progression, specifically in the EC region. By identifying the modules that were affected by AD pathology, we found the transcriptional regulation-associated modules that interact with the proteasome-associated module via UCHL5 hub protein, which is a deubiquitinating enzyme. Considering PINs as a system made of network modules, we found that the modules relevant to the transcriptional regulation are disrupted in the EC region, which affects the ubiquitin-proteasome system.
Directory of Open Access Journals (Sweden)
Lu Ying
2004-04-01
Full Text Available Abstract Background TGM1(transglutaminase 1 is an enzyme that crosslinks the cornified envelope of mature keratinocytes. Appropriate expression of the TGM1 gene is crucial for proper keratinocyte function as inactivating mutations lead to the debilitating skin disease, lamellar ichthyosis. TGM1 is also expressed in squamous metaplasia, a consequence in some epithelia of vitamin A deficiency or toxic insult that can lead to neoplasia. An understanding of the regulation of this gene in normal and abnormal differentiation states may contribute to better disease diagnosis and treatment. Methods In vivo requirements for expression of the TGM1 gene were studied by fusing various lengths of promoter DNA to a reporter and injecting the DNA into mouse embryos to generate transgenic animals. Expression of the reporter was ascertained by Western blotting and immunohistochemistry. Further delineation of a transcriptionally important distal region was determined by transfections of progressively shortened or mutated promoter DNA into cultured keratinocytes. Results In vivo analysis of a reporter transgene driven by the TGM1 promoter revealed that 1.6 kilobases, but not 1.1 kilobases, of DNA was sufficient to confer tissue-specific and cell layer-specific expression. This same region was responsible for reporter expression in tissues undergoing squamous metaplasia as a response to vitamin A deprivation. Mutation of a distal promoter AP1 site or proximal promoter CRE site, both identified as important transcriptional elements in transfection assays, did not prevent appropriate expression. Further searching for transcriptional elements using electrophoretic mobility shift (EMSA and transfection assays in cultured keratinocytes identified two Sp1 elements in a transcriptionally active region between -1.6 and -1.4 kilobases. While mutation of either Sp1 site or the AP1 site singly had only a small effect, mutation of all three sites eliminated nearly all the
Pierard, Valérie; Guiguen, Allan; Colin, Laurence; Wijmeersch, Gaëlle; Vanhulle, Caroline; Van Driessche, Benoît; Dekoninck, Ann; Blazkova, Jana; Cardona, Christelle; Merimi, Makram; Vierendeel, Valérie; Calomme, Claire; Nguyên, Thi Liên-Anh; Nuttinck, Michèle; Twizere, Jean-Claude; Kettmann, Richard; Portetelle, Daniel; Burny, Arsène; Hirsch, Ivan; Rohr, Olivier; Van Lint, Carine
2010-06-18
Bovine leukemia virus (BLV) proviral latency represents a viral strategy to escape the host immune system and allow tumor development. Besides the previously demonstrated role of histone deacetylation in the epigenetic repression of BLV expression, we showed here that BLV promoter activity was induced by several DNA methylation inhibitors (such as 5-aza-2'-deoxycytidine) and that overexpressed DNMT1 and DNMT3A, but not DNMT3B, down-regulated BLV promoter activity. Importantly, cytosine hypermethylation in the 5'-long terminal repeat (LTR) U3 and R regions was associated with true latency in the lymphoma-derived B-cell line L267 but not with defective latency in YR2 cells. Moreover, the virus-encoded transactivator Tax(BLV) decreased DNA methyltransferase expression levels, which could explain the lower level of cytosine methylation observed in the L267(LTaxSN) 5'-LTR compared with the L267 5'-LTR. Interestingly, DNA methylation inhibitors and Tax(BLV) synergistically activated BLV promoter transcriptional activity in a cAMP-responsive element (CRE)-dependent manner. Mechanistically, methylation at the -154 or -129 CpG position (relative to the transcription start site) impaired in vitro binding of CRE-binding protein (CREB) transcription factors to their respective CRE sites. Methylation at -129 CpG alone was sufficient to decrease BLV promoter-driven reporter gene expression by 2-fold. We demonstrated in vivo the recruitment of CREB/CRE modulator (CREM) and to a lesser extent activating transcription factor-1 (ATF-1) to the hypomethylated CRE region of the YR2 5'-LTR, whereas we detected no CREB/CREM/ATF recruitment to the hypermethylated corresponding region in the L267 cells. Altogether, these findings suggest that site-specific DNA methylation of the BLV promoter represses viral transcription by directly inhibiting transcription factor binding, thereby contributing to true proviral latency.
Discovery and Evaluation of Polymorphisms in the and Promoter Regions for Risk of Korean Lung Cancer
Directory of Open Access Journals (Sweden)
Jae Sook Sung
2012-09-01
Full Text Available AKT is a signal transduction protein that plays a central role in the tumorigenesis. There are 3 mammalian isoforms of this serine/threonine protein kinase-AKT1, AKT2, and AKT3-showing a broad tissue distribution. We first discovered 2 novel polymorphisms (AKT2 -9826 C/G and AKT3 -811 A/G, and we confirmed 6 known polymorphisms (AKT2 -9473 C/T, AKT2 -9151 C/T, AKT2 -9025 C/T, AKT2 -8618G/A, AKT3 -675 A/-, and AKT3 -244 C/T of the AKT2 and AKT3 promoter region in 24 blood samples of Korean lung cancer patients using direct sequencing. To evaluate the role of AKT2 and AKT3 polymorphisms in the risk of Korean lung cancer, genotypes of the AKT2 and AKT3 polymorphisms (AKT2 -9826 C/G, AKT2 -9473 C/T, AKT2 -9151 C/T, AKT2 -9025 C/T, AKT2 -8618G/A, and AKT3 -675 A/- were determined in 360 lung cancer patients and 360 normal controls. Statistical analyses revealed that the genotypes and haplotypes in the AKT2 and AKT3 promoter regions were not significantly associated with the risk of lung cancer in the Korean population. These results suggest that polymorphisms of the AKT2 and AKT3 promoter regions do not contribute to the genetic susceptibility to lung cancer in the Korean population.
Directory of Open Access Journals (Sweden)
James Dollman
2016-01-01
Full Text Available Rural Australians are less physically active than their metropolitan counterparts, and yet very little is known of the candidate intervention targets for promoting physical activity in rural populations. As rural regions are economically, socially and environmentally diverse, drivers of regular physical activity are likely to vary between regions. This study explored the region-specific correlates of daily walking among middle age and older adults in rural regions with contrasting dominant primary industries. Participants were recruited through print and electronic media, primary care settings and community organisations. Pedometers were worn by 153 adults for at least four days, including a weekend day. A questionnaire identified potential intra-personal, social and environmental correlates of physical activity, according to a social ecological framework. Regression modelling identified independent correlates of daily walking separately in the two study regions. In one region, there were independent correlates of walking from all levels of the social ecological framework. In the other region, significant correlates of daily walking were almost all demographic (age, education and marital status. Participants living alone were less likely to be physically active regardless of region. This study highlights the importance of considering region-specific factors when designing strategies for promoting regular walking among rural adults.
Promoter de-methylation of cyclin D2 by sulforaphane in prostate cancer cells
Directory of Open Access Journals (Sweden)
Hsu Anna
2011-10-01
Full Text Available Abstract Sulforaphane (SFN, an isothiocyanate derived from cruciferous vegetables, induces potent anti-proliferative effects in prostate cancer cells. One mechanism that may contribute to the anti-proliferative effects of SFN is the modulation of epigenetic marks, such as inhibition of histone deacetylase (HDAC enzymes. However, the effects of SFN on other common epigenetic marks such as DNA methylation are understudied. Promoter hyper-methylation of cyclin D2, a major regulator of cell cycle, is correlated with prostate cancer progression, and restoration of cyclin D2 expression exerts anti-proliferative effects on LnCap prostate cancer cells. Our study aimed to investigate the effects of SFN on DNA methylation status of cyclin D2 promoter, and how alteration in promoter methylation impacts cyclin D2 gene expression in LnCap cells. We found that SFN significantly decreased the expression of DNA methyltransferases (DNMTs, especially DNMT1 and DNMT3b. Furthermore, SFN significantly decreased methylation in cyclin D2 promoter regions containing c-Myc and multiple Sp1 binding sites. Reduced methlyation of cyclin D2 promoter corresponded to an increase in cyclin D2 transcript levels, suggesting that SFN may de-repress methylation-silenced cyclin D2 by impacting epigenetic pathways. Our results demonstrated the ability of SFN to epigenetically modulate cyclin D2 expression, and provide novel insights into the mechanisms by which SFN may regulate gene expression as a prostate cancer chemopreventive agent.
Muhle, Rebecca A; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J; Muhle, Michael E; Fidock, David A
2009-11-01
Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitised erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilising the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var subtelomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronised parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may result from the integrated UpsA promoter being largely silenced by the neighbouring cg6 promoter. Our analyses also revealed that the DownsA 3' untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA-promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyse promoter activity of Group A var genes, which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of var
Genetic recombination is targeted towards gene promoter regions in dogs.
Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J Kim; Hayward, Jessica J; Cohen, Paula E; Greally, John M; Wang, Jun; Bustamante, Carlos D; Boyko, Adam R
2013-01-01
The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred.
Directory of Open Access Journals (Sweden)
Kusnanto Kusnanto
2017-04-01
Full Text Available Introduction: Diabetes mellitus was a kind of incurable chronic disease that actually manageable. The global prevalence tends to increase due to less self management of the disease and the impact of it was severe health condition. There were so many interventions implemented but failed to give optimal improvement in patient’s condition and there are so many DM patients have insufficient ability to manage their own disease. Patients need to have knowledge, skills, and self confident to be able to manage their disease. Patient’s self-management depends on patient’s education, empowerment, and self monitoring in evaluating their self-care management. The purpose of this research was promoting patient’s psychological, social, and spiritual conditions through Self Care Management. Improvement in psychological, social, and spiritual conditions in patients with DM will lead to better level of blood glucose and HbA1C. Method: Patient newly diagnose with Type 2 DM at Puskesmas Kebonsari was selected with purposive sampling and divided into two groups. Each group contains 25 patients. Intervention group was given Self Diabetes Management Module. Before and after intervention patient was given Questionnaire. The data then analyzed using Student-T test, McNemar and Chi-Square. Result: The result of this research showed patient have constructive coping, increase interpersonal relation. Patients also have better acceptance about the disease and involve in its management. Discussion: Self Care Management Module promotes psychological, social, and spiritual conditions in patients with type 2 DM.
DOF-binding sites additively contribute to guard cell-specificity of AtMYB60 promoter
Directory of Open Access Journals (Sweden)
Cominelli Eleonora
2011-11-01
Full Text Available Abstract Background We previously demonstrated that the Arabidopsis thaliana AtMYB60 protein is an R2R3MYB transcription factor required for stomatal opening. AtMYB60 is specifically expressed in guard cells and down-regulated at the transcriptional levels by the phytohormone ABA. Results To investigate the molecular mechanisms governing AtMYB60 expression, its promoter was dissected through deletion and mutagenesis analyses. By studying different versions of AtMYB60 promoter::GUS reporter fusions in transgenic plants we were able to demonstrate a modular organization for the AtMYB60 promoter. Particularly we defined: a minimal promoter sufficient to confer guard cell-specific activity to the reporter gene; the distinct roles of different DOF-binding sites organised in a cluster in the minimal promoter in determining guard cell-specific expression; the promoter regions responsible for the enhancement of activity in guard cells; a promoter region responsible for the negative transcriptional regulation by ABA. Moreover from the analysis of single and multiple mutants we could rule out the involvement of a group of DOF proteins, known as CDFs, already characterised for their involvement in flowering time, in the regulation of AtMYB60 expression. Conclusions These findings shed light on the regulation of gene expression in guard cells and provide new promoter modules as useful tools for manipulating gene expression in guard cells, both for physiological studies and future biotechnological applications.
Assessment of a Pharmaceutical Advertisement Analysis Module in a Drug Literature Evaluation Course.
Amin, Mohamed Ezzat Khamis; Fattouh, Youssef
2017-08-01
Objective. To evaluate the impact of an educational module on students' self-efficacy when analyzing the content of promotional drug brochures (PDBs) and to assess the students' value of PDBs' as an educational tool. Methods. Third-year bachelor of pharmacy students participated in a one-hour lecture and a two-hour laboratory. Students completed a survey before and after participating in the module. Results. The module elicited a statistically significant change in students' self-efficacy beliefs regarding evaluating promotional drug brochures, while the average perceived value of promotional drug brochures did not change significantly after the module. Conclusion. A brief educational module can increase students' self-efficacy in evaluating the content of PDBs.
International Nuclear Information System (INIS)
Rauscher, Garth H.; Kresovich, Jacob K.; Poulin, Matthew; Yan, Liying; Macias, Virgilia; Mahmoud, Abeer M.; Al-Alem, Umaima; Kajdacsy-Balla, Andre; Wiley, Elizabeth L.; Tonetti, Debra; Ehrlich, Melanie
2015-01-01
Breast cancer formation is associated with frequent changes in DNA methylation but the extent of very early alterations in DNA methylation and the biological significance of cancer-associated epigenetic changes need further elucidation. Pyrosequencing was done on bisulfite-treated DNA from formalin-fixed, paraffin-embedded sections containing invasive tumor and paired samples of histologically normal tissue adjacent to the cancers as well as control reduction mammoplasty samples from unaffected women. The DNA regions studied were promoters (BRCA1, CD44, ESR1, GSTM2, GSTP1, MAGEA1, MSI1, NFE2L3, RASSF1A, RUNX3, SIX3 and TFF1), far-upstream regions (EN1, PAX3, PITX2, and SGK1), introns (APC, EGFR, LHX2, RFX1 and SOX9) and the LINE-1 and satellite 2 DNA repeats. These choices were based upon previous literature or publicly available DNA methylome profiles. The percent methylation was averaged across neighboring CpG sites. Most of the assayed gene regions displayed hypermethylation in cancer vs. adjacent tissue but the TFF1 and MAGEA1 regions were significantly hypomethylated (p ≤0.001). Importantly, six of the 16 regions examined in a large collection of patients (105 – 129) and in 15-18 reduction mammoplasty samples were already aberrantly methylated in adjacent, histologically normal tissue vs. non-cancerous mammoplasty samples (p ≤0.01). In addition, examination of transcriptome and DNA methylation databases indicated that methylation at three non-promoter regions (far-upstream EN1 and PITX2 and intronic LHX2) was associated with higher gene expression, unlike the inverse associations between cancer DNA hypermethylation and cancer-altered gene expression usually reported. These three non-promoter regions also exhibited normal tissue-specific hypermethylation positively associated with differentiation-related gene expression (in muscle progenitor cells vs. many other types of normal cells). The importance of considering the exact DNA region analyzed and the
Mohammadpur, Ahmad; Rezaei, Mehdi; Sadeghi, Rasoul
2010-05-14
The aim of this qualitative study is to explore the way people using modern health care perceive its consequences in Ouraman-e-Takht region of Iranian Kurdistan. Ouraman-e-Takht is a rural, highly mountainous and dry region located in the southwest Kurdistan province of Iran. Recently, modern health practices have been introduced to the region. The purpose of this study was to investigate, from the Ouramains' point of view, the impact that modern health services and practices have had on the Ouraman traditional way of life. Interview data from respondents were analyzed by using grounded theory. Promoting survival was the core category that explained the impact that modern health practices have had on the Ouraman region. The people of Ouraman interpreted modern health practices as increasing their quality of life and promoting their survival. Results are organized around this core category in a paradigm model consisting of conditions, interactions, and consequences. This model can be used to understand the impact of change from the introduction of modern health on a traditional society.
Mohammadpur, Ahmad; Rezaei, Mehdi; Sadeghi, Rasoul
2010-01-01
The aim of this qualitative study is to explore the way people using modern health care perceive its consequences in Ouraman-e-Takht region of Iranian Kurdistan. Ouraman-e-Takht is a rural, highly mountainous and dry region located in the southwest Kurdistan province of Iran. Recently, modern health practices have been introduced to the region. The purpose of this study was to investigate, from the Ouramains' point of view, the impact that modern health services and practices have had on the Ouraman traditional way of life. Interview data from respondents were analyzed by using grounded theory. Promoting survival was the core category that explained the impact that modern health practices have had on the Ouraman region. The people of Ouraman interpreted modern health practices as increasing their quality of life and promoting their survival. Results are organized around this core category in a paradigm model consisting of conditions, interactions, and consequences. This model can be used to understand the impact of change from the introduction of modern health on a traditional society. PMID:20640020
AUTHOR|(CDS)2084596; Papastergiou, Konstantinos; Bongiorno, M; Thiringer, T
2016-01-01
This work investigates the current sharing effect of a high power Soft Punch Through IGBT module in the Negative Temperature Coefficient region. The unbalanced current sharing between two of the substrates is demonstrated for different current and temperature levels and its impact on the thermal stressing of the device is evaluated. The results indicate that the current asymmetry does not lead to a significant thermal stressing unbalance between the substrates.
DEFF Research Database (Denmark)
Gyan, B A; Goka, B; Cvetkovic, J T
2004-01-01
Immunoglobulin E has been associated with severe malaria suggesting a regulatory role for interleukin (IL)-4 and/or IgE in the pathogenesis of severe malaria. We have investigated possible associations between polymorphisms in the IL-4 repeat region (intron 3) and promoter regions (IL-4 +33CT and...
Auditory object formation affects modulation perception
DEFF Research Database (Denmark)
Piechowiak, Tobias
2005-01-01
Most sounds in our environment, including speech, music, animal vocalizations and environmental noise, have fluctuations in intensity that are often highly correlated across different frequency regions. Because across-frequency modulation is so common, the ability to process such information...... is thought to be a powerful survival strategy in the natural world (Klump, 1996; Nelken et al., 1999). Coherent modulations in one sound can aid in the detection of another sound (Hall et al., 1984; Durlach, 1963). On the other hand, modulation in one frequency region can also impede the detection...... or discrimination of modulation in other frequency regions (Yost et al., 1989). Although the neural substrates for across-frequency modulation processing remain unclear, recent studies have concentrated on brainstem structures (Pressnitzer et al., 2001). In this study it is shown that sounds occurring after...
Energy-modulation spectroscopy in hard X-ray region
Suzuki, M; Ishikawa, T
2001-01-01
An energy-modulation technique has been developed for XAFS spectroscopies requiring high energy resolution and high precision. Fast energy switching at 40 Hz has been achieved by adopting a Si channel-cut crystal as a second monochromator together with a piezo-driven oscillation stage, and the resulting variation in sample absorption was detected using an amplifier locked to the energy-modulation frequency. An energy-derivative XAFS spectrum was directly obtained at the Mn K-edge, and illustrated the advantages of this technique in high energy resolution and noise reduction.
Muhle, Rebecca A.; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J.; Muhle, Michael E.; Fidock, David A.
2009-01-01
Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitized erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilizing the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var sub-telomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronized parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may well result from the integrated UpsA promoter being largely silenced by the neighboring cg6 promoter. Our analyses also revealed that the DownsA 3’ untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyze promoter activity of Group A var genes which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of
A20 modulates lipid metabolism and energy production to promote liver regeneration.
Directory of Open Access Journals (Sweden)
Scott M Damrauer
2011-03-01
Full Text Available Liver regeneration is clinically of major importance in the setting of liver injury, resection or transplantation. We have demonstrated that the NF-κB inhibitory protein A20 significantly improves recovery of liver function and mass following extended liver resection (LR in mice. In this study, we explored the Systems Biology modulated by A20 following extended LR in mice.We performed transcriptional profiling using Affymetrix-Mouse 430.2 arrays on liver mRNA retrieved from recombinant adenovirus A20 (rAd.A20 and rAd.βgalactosidase treated livers, before and 24 hours after 78% LR. A20 overexpression impacted 1595 genes that were enriched for biological processes related to inflammatory and immune responses, cellular proliferation, energy production, oxidoreductase activity, and lipid and fatty acid metabolism. These pathways were modulated by A20 in a manner that favored decreased inflammation, heightened proliferation, and optimized metabolic control and energy production. Promoter analysis identified several transcriptional factors that implemented the effects of A20, including NF-κB, CEBPA, OCT-1, OCT-4 and EGR1. Interactive scale-free network analysis captured the key genes that delivered the specific functions of A20. Most of these genes were affected at basal level and after resection. We validated a number of A20's target genes by real-time PCR, including p21, the mitochondrial solute carriers SLC25a10 and SLC25a13, and the fatty acid metabolism regulator, peroxisome proliferator activated receptor alpha. This resulted in greater energy production in A20-expressing livers following LR, as demonstrated by increased enzymatic activity of cytochrome c oxidase, or mitochondrial complex IV.This Systems Biology-based analysis unravels novel mechanisms supporting the pro-regenerative function of A20 in the liver, by optimizing energy production through improved lipid/fatty acid metabolism, and down-regulated inflammation. These findings
2015 NREL Photovoltaic Module Reliability Workshops
Energy Technology Data Exchange (ETDEWEB)
Kurtz, Sarah [National Renewable Energy Laboratory (NREL), Golden, CO (United States)
2017-09-14
NREL's Photovoltaic (PV) Module Reliability Workshop (PVMRW) brings together PV reliability experts to share information, leading to the improvement of PV module reliability. Such improvement reduces the cost of solar electricity and promotes investor confidence in the technology--both critical goals for moving PV technologies deeper into the electricity marketplace.
2016 NREL Photovoltaic Module Reliability Workshop
Energy Technology Data Exchange (ETDEWEB)
Kurtz, Sarah [National Renewable Energy Laboratory (NREL), Golden, CO (United States)
2017-09-07
NREL's Photovoltaic (PV) Module Reliability Workshop (PVMRW) brings together PV reliability experts to share information, leading to the improvement of PV module reliability. Such improvement reduces the cost of solar electricity and promotes investor confidence in the technology - both critical goals for moving PV technologies deeper into the electricity marketplace.
Directory of Open Access Journals (Sweden)
Aebi Stefan
2008-10-01
Full Text Available Abstract Background The activity of dihydropyrimidine dehydrogenase (DPD, the key enzyme of pyrimidine catabolism, is thought to be an important determinant for the occurrence of severe toxic reactions to 5-fluorouracil (5-FU, which is one of the most commonly prescribed chemotherapeutic agents for the treatment of solid cancers. Genetic variation in the DPD gene (DPYD has been proposed as a main factor for variation in DPD activity in the population. However, only a small proportion of severe toxicities in 5-FU based chemotherapy can be explained with such rare deleterious DPYD mutations resulting in severe enzyme deficiencies. Recently, hypermethylation of the DPYD promoter region has been proposed as an alternative mechanism for DPD deficiency and thus as a major cause of severe 5-FU toxicity. Methods Here, the prognostic significance of this epigenetic marker with respect to severe 5-FU toxicity was assessed in 27 cancer patients receiving 5-FU based chemotherapy, including 17 patients experiencing severe toxic side effects following drug administration, none of which were carriers of a known deleterious DPYD mutation, and ten control patients. The methylation status of the DPYD promoter region in peripheral blood mononuclear cells was evaluated by analysing for each patient between 19 and 30 different clones of a PCR-amplified 209 base pair fragment of the bisulfite-modified DPYD promoter region. The fragments were sequenced to detect bisulfite-induced, methylation-dependent sequence differences. Results No evidence of DPYD promoter methylation was observed in any of the investigated patient samples, whereas in a control experiment, as little as 10% methylated genomic DNA could be detected. Conclusion Our results indicate that DYPD promoter hypermethylation is not of major importance as a prognostic factor for severe toxicity in 5-FU based chemotherapy.
Boundary Dpp promotes growth of medial and lateral regions of the Drosophila wing.
Barrio, Lara; Milán, Marco
2017-07-04
The gradient of Decapentaplegic (Dpp) in the Drosophila wing has served as a paradigm to characterize the role of morphogens in regulating patterning. However, the role of this gradient in regulating tissue size is a topic of intense debate as proliferative growth is homogenous. Here, we combined the Gal4/UAS system and a temperature-sensitive Gal80 molecule to induce RNAi-mediated depletion of dpp and characterise the spatial and temporal requirement of Dpp in promoting growth. We show that Dpp emanating from the AP compartment boundary is required throughout development to promote growth by regulating cell proliferation and tissue size. Dpp regulates growth and proliferation rates equally in central and lateral regions of the developing wing appendage and reduced levels of Dpp affects similarly the width and length of the resulting wing. We also present evidence supporting the proposal that graded activity of Dpp is not an absolute requirement for wing growth.
Directory of Open Access Journals (Sweden)
Simrén Magnus
2009-11-01
Full Text Available Abstract Background Oxytocin and the oxytocin receptor have been demonstrated in the gastrointestinal (GI tract and have been shown to exert physiological effects on gut motility. The role for oxytocin in the pathophysiology of GI complaints is unknown. The aim of this study was to examine genetic variations or polymorphism of oxytocin (OXT and its receptor (OXTR genes in patients with GI complaints without visible organic abnormalities. Methods Genetic variants in the OXT promoter region, and in the OXTR gene in DNA samples from 131 rigorously evaluated patients with Irritable Bowel Syndrome (IBS, 408 homozygous subjects referred for lactase (LCT-13910 C>T, rs4988235 genotyping, and 299 asymptomatic blood donors were compared. One polymorphism related to the OXT gene (rs6133010 A>G and 4 related to the OXTR gene (rs1465386 G>T, rs3806675 G>A, rs968389 A>G, rs1042778 G>T were selected for genotyping using Applied Biosystems 7900 HT allele discrimination assays. Results There were no statistically significant differences in the genotype or allele frequencies in any of the SNPs when IBS patients were compared to healthy controls. Among subjects referred for lactase genotyping, the rs6133010 A>G OXT promoter A/G genotype tended to be more common in the 154 non-persistent (27.3% subjects than in the 254 lactase persistant (18.1% subjects and in the healthy controls (19.4% (p = 0.08. When direct comparing, the A/G genotype was less common in the OXT promoter region in controls (p = 0.09 and in subjects with lactase persistence (p = 0.03 compared to subjects with lactase non-persistence. When healthy controls were viewed according to their own LCT-13910 genotypes, the C/C lactase non-persistent controls had a higher frequency for the OXT promoter A/G genotype than LCT-13910 T/T lactase persistent controls (41.2% vs 13.1%. No significant differences in frequencies of the investigated OXTR SNPs were noted in this study. Conclusion The results suggest
Has India's Solar Mission increased the deployment of domestically produced solar modules?
International Nuclear Information System (INIS)
Shrimali, Gireesh; Sahoo, Anshuman
2014-01-01
The Jawaharlal Nehru National Solar Mission (JNNSM), India's flagship policy for solar energy deployment, includes an increasingly strict Domestic Content Requirement (DCR) intended to promote the domestic crystalline photovoltaic solar industry. We examine the impact of the JNNSM DCR on the utilization of domestic and domestic crystalline silicon modules. Using a plant-level database of approximately 250 plants, we show that the first, and weaker, version of the policy accomplished its intention of promoting domestic crystalline silicon modules. However, the second, and stricter, version of the policy has not been as effective: it appears to have promoted the use of foreign thin film modules instead. This analysis shows that the tightening of the DCR was associated with leakage to foreign thin film modules. This suggests that DCR policies need to be comprehensive in scope to ensure that they achieve a goal of using only domestic content; however, policymakers should appropriately assess the welfare impacts of such restrictions. - Highlights: • Effectiveness of India's Solar Mission in promoting domestic content is assessed. • The Solar Mission promoted domestic crystalline silicon modules overall. • This effect was not as prominent as the DCR was tightened over time. • Ultimately, the Solar Mission allowed for leakage to foreign thin-film modules. • To be effective, the DCR would need to be comprehensive across module types
Kotsaki, Antigoni; Raftogiannis, Maria; Routsi, Christina; Baziaka, Fotini; Kotanidou, Anastasia; Antonopoulou, Anastasia; Orfanos, Stylianos E; Katsenos, Chrisostomos; Koutoukas, Pantelis; Plachouras, Diamantis; Mandragos, Konstantinos; Giamarellos-Bourboulis, Evangelos J
2012-08-01
Debatable findings exist among various studies regarding the impact of single nucleotide polymorphisms (SNPs) within the promoter region of the tumor necrosis factor (TNF) gene for susceptibility to infections. Their impact was investigated in a cohort of mechanically ventilated patients who developed ventilator-associated pneumonia (VAP). Two-hundred and thirteen mechanically ventilated patients who developed VAP were enrolled. Genomic DNA was extracted and SNPs at the -376, -308 and -238 position of the promoter region of the TNF gene were assessed by restriction fragment length polymorphisms. Monocytes were isolated from 47 patients when they developed sepsis and stimulated by bacterial endotoxin for the production of TNFα and of interleukin-6 (IL-6). Patients were divided into two groups; 166 patients bearing only wild-type alleles of all three studied polymorphisms; and 47 patients carrying at least one A allele of the three studied SNPs. Time between start of mechanical ventilation and advent of VAP was significantly shorter in the second group than in the first group (log-rank: 4.416, p: 0.041). When VAP supervened, disease severity did not differ between groups. Stimulation of TNFα and of IL-6 was much greater by monocytes for patients carrying A alleles. Carriage of at least one A allele of the three studied SNPs at the promoter region of the TNF-gene is associated with shorter time to development of VAP but it is not associated with disease severity. Findings may be related with a role of the studied SNPs in the production of pro-inflammatory cytokines. Copyright © 2012 Elsevier Ltd. All rights reserved.
MicroRNA-1185 Promotes Arterial Stiffness though Modulating VCAM-1 and E-Selectin Expression
Directory of Open Access Journals (Sweden)
Haoyuan Deng
2017-04-01
Full Text Available Background/Aims: Atherosclerosis is the primary cause of cardiovascular ischaemic events; arterial stiffness is a characteristic of the atherosclerotic process. MicroRNAs (miRNAs have been revealed as crucial modulators of atherosclerosis. However, the role of arterial stiffness-related miRNAs in the atherosclerotic process is still unclear. Methods: Four hundred six participants from Northern China were enrolled in this study. Circulating miR-1185 and adhesion molecule levels were measured. Multiple linear regression models were used to evaluate the association of miR-1185 levels with brachial-ankle pulse wave velocity (baPWV and adhesion molecule levels. A mediation analysis was also performed to examine the mediating effect. Cell adhesion molecule levels were measured in primary human umbilical vein endothelial cells (pHUVECs and human umbilical vein smooth cells (HUVSMCs transfected with miR-1185 or co-transfected with a miR-1185 inhibitor. Results: miR-1185 was independently correlated with arterial stiffness. A positive relationship between miR-1185 and vascular cell adhesion molecule-1 (VCAM-1 and E-selectin levels was observed. VCAM- 1 and E-selectin partially mediated the correlation between miR-1185 and arterial stiffness. miR-1185 induced a significant increase in the VCAM-1 and E-selectin levels in pHUVECs and HUVSMCs in vitro. According to our mechanistic analysis, VCAM-1 and E-selectin mediated miR-1185-induced arterial stiffening. Conclusions: miR-1185 modulated the expression of VCAM-1 and E-selectin to promote arterial stiffening, suggesting that miR-1185 plays a crucial role in the development of atherosclerosis and may serve as a novel therapeutic target for atherosclerosis.
Italian ICF training programs: describing and promoting human functioning and research.
Francescutti, Carlo; Fusaro, Guido; Leonardi, Matilde; Martinuzzi, Andrea; Sala, Marina; Russo, Emanuela; Frare, Mara; Pradal, Monica; Zampogna, Daniela; Cosentino, Alessandro; Raggi, Alberto
2009-01-01
Purpose of the article is to report on 5 years of ICF training experiences in Italy aimed at promoting a consistent approach to ICF's field application. More than 7000 persons participated in around 150 training events: almost half were organised by political bodies, at national, regional or local level, directly linked to implementation experiences. Few training events were organised by the school sector, while training commissioned by NGOs represent a relevant area and, in our opinion, constitute the first step towards a full inclusion of persons with disabilities. Central pillars of our training modules are: the inclusion of all ICF components in the description of functional profiles, the need of providing brief theoretical background information before moving to practical aspects and the importance of providing personalised face to face training modules, in contrast to self-administered learning modules, or web-based protocols. On the basis of our experience, we can conclude that training's objectives are generally reached: trainees improved their knowledge of the ICF and its related tools, and are able to begin practical applications in their contexts.
Directory of Open Access Journals (Sweden)
Matsutani Sachiko
2004-08-01
Full Text Available Abstract Background In eukaryotes, RNA polymerase III (RNAP III transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs. The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Results Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Conclusion Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and α-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants
Matsutani, Sachiko
2004-08-09
In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and alpha-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants than to fungi.
Modulation of gene expression made easy
DEFF Research Database (Denmark)
Solem, Christian; Jensen, Peter Ruhdal
2002-01-01
A new approach for modulating gene expression, based on randomization of promoter (spacer) sequences, was developed. The method was applied to chromosomal genes in Lactococcus lactis and shown to generate libraries of clones with broad ranges of expression levels of target genes. In one example...... that the method can be applied to modulating the expression of native genes on the chromosome. We constructed a series of strains in which the expression of the las operon, containing the genes pfk, pyk, and ldh, was modulated by integrating a truncated copy of the pfk gene. Importantly, the modulation affected...
International Nuclear Information System (INIS)
Hulme, M.; Raper, S.C.B.
1995-01-01
ESCAPE (the Evaluation of Strategies to address Climate change by Adapting to and Preventing Emissions) is an integrated climate change assessment model constructed between 1990 and 1992 for DG XI of the Commission of the European Community by a consortium of research institutes headed by the Climatic Research Unit (CRU). It has been designed to enable the user to generate future scenarios of greenhouse gas emissions (through an energy-economic model), examine their impact on global climate and sea level (through two independent global climate models), and illustrate some of the consequences of this global climate change at a regional scale for the European Community (through a regional climate scenario generator and impact models). We provide a very brief overview of the ESCAPE model which, although innovative, suffers from a number of major limitations. Subsequent work in the CRU has concentrated on improvements to the global climate module and work has also commenced on an improved regional climate scenario generating module. These improvements will lead to a new integrated climate change assessment model, MAGICC (Model for the Assessment of Greenhouse gas Induced Climate Change) which can easily be incorporated into new larger integrated frameworks developed by other institutes. (Author)
International Nuclear Information System (INIS)
Shannon, M.F.; Gamble, J.R.; Vadas, M.A.
1988-01-01
The gene for human granulocyte/macrophage colony-stimulating factor (GM-CSF) is expressed in a tissue-specific as well as an activation-dependent manner. The interaction of nuclear proteins with the promoter region of the GM-CSF gene that is likely to be responsible for this pattern of GM-CSF expression was investigated. The authors show that nuclear proteins interact with DNA fragments from the GM-CSF promoter in a cell-specific manner. A region spanning two cytokine-specific sequences, cytokine 1 (CK-1, 5', GAGATTCCAC 3') and cytokine 2 (CK-2, 5' TCAGGTA 3') bound two nuclear proteins from GM-CSF-expressing cells in gel retardation assays. NF-GMb was inducible with phorbol 12-myristate 13-acetate and accompanied induction of GM-CSF message. NF-GMb was absent in cell lines not producing GM-CSF, some of which had other distinct binding proteins. NF-GMa and NF-GMb eluted from a heparin-Sepharose column at 0.3 and 0.6 M KCl, respectively. They hypothesize that the sequences CK-1 and CK-2 bind specific proteins and regulate GM-CSF transcription
US-India Technical Collaboration to Promote Regional Stability
International Nuclear Information System (INIS)
Killinger, Mark H.; Griggs, James R.; Apt, Kenneth E.; Doyle, James E.
2001-01-01
Two US-India documents were signed in 2000 that provided new impetus for scientific and technical cooperation between the two countries. The first document is the US-India Science and Technology Agreement, which is aimed at 'promoting scientific and technological cooperation between the people of their two countries.' The second is the US-India Joint Statement on Energy and Environment, which states 'the United States and India believe that energy and environment could be one of the most important areas of cooperation between the two countries.' In addition to the work already underway as part of these two agreements, DOE has established a US-India Science and Technology Initiative to utilize the expertise of DOE national laboratories to conduct activities that support US policy objectives in South Asia. PNNL and LANL are working with US agencies and the Indian government and scientific communities to identify appropriate non-sensitive areas for US-Indian technical collaboration. The objectives of such collaboration are to address visible national/international problems, build trust between the United States and India, and contribute to regional stability in South Asia. This paper describes research done on the Indian scientific organization and infrastructure, potential areas for collaboration, the approach for this engagement, and current status of the initiative.
US-INDIA TECHNICAL COLLABORATION TO PROMOTE REGIONAL STABILITY
International Nuclear Information System (INIS)
Killinger, M.H.; Griggs, J.R.; Apt, Kenneth E.; Doyle, J.E.
2001-01-01
Two US-India documents were signed in 2000 that provided new impetus for scientific and technical cooperation between the two countries. The first document is the US-India Science and Technology Agreement, which is aimed at 'promoting scientific and technological cooperation between the people of their two countries.' The second is the US-India Joint Statement on Energy and Environment, which states 'the United States and India believe that energy and environment could be one of the most important areas of cooperation between the two countries.' In addition to the work already underway as part of these two agreements, the US Department of Energy (DOE) has established a US-India Science and Technology Initiative to utilize the expertise of DOE national laboratories to conduct activities that support US policy objectives in South Asia. PNNL and LANL are working with US government agencies to identify appropriate non-sensitive, non-nuclear areas for US-Indian technical collaboration. The objectives of such collaboration are to address visible national and international problems, build trust between the United States and India, and contribute to regional stability in South Asia. This paper describes the approach for this engagement, the Indian scientific organization and infrastructure, potential areas for collaboration, and current status of the initiative.
Barnidge, Ellen K; Baker, Elizabeth A; Estlund, Amy; Motton, Freda; Hipp, Pamela R; Brownson, Ross C
2015-06-11
Rural residents are less likely than urban and suburban residents to meet recommendations for nutrition and physical activity. Interventions at the environmental and policy level create environments that support healthy eating and physical activity. Healthier Missouri Communities (Healthier MO) is a community-based research project conducted by the Prevention Research Center in St. Louis with community partners from 12 counties in rural southeast Missouri. We created a regional partnership to leverage resources and enhance environmental and policy interventions to improve nutrition and physical activity in rural southeast Missouri. Partners were engaged in a participatory action planning process that included prioritizing, implementing, and evaluating promising evidence-based interventions to promote nutrition and physical activity. Group interviews were conducted with Healthier MO community partners post intervention to evaluate resource sharing and sustainability efforts of the regional partnership. Community partners identified the benefits and challenges of resource sharing within the regional partnership as well as the opportunities and threats to long-term partnership sustainability. The partners noted that the regional participatory process was difficult, but the benefits outweighed the challenges. Regional rural partnerships may be an effective way to leverage relationships to increase the capacity of rural communities to implement environmental and policy interventions to promote nutrition and physical activity.
Directory of Open Access Journals (Sweden)
Dobrovic Alexander
2009-09-01
Full Text Available Abstract Background Succinate dehydrogenase (SDH and fumarate hydratase (FH are tricarboxylic acid (TCA cycle enzymes that are also known to act as tumour suppressor genes. Increased succinate or fumarate levels as a consequence of SDH and FH deficiency inhibit hypoxia inducible factor-1α (HIF-1α prolyl hydroxylases leading to sustained HIF-1α expression in tumours. Since HIF-1α is frequently expressed in breast carcinomas, DNA methylation at the promoter regions of the SDHA, SDHB, SDHC and SDHD and FH genes was evaluated as a possible mechanism in silencing of SDH and FH expression in breast carcinomas. Findings No DNA methylation was identified in the promoter regions of the SDHA, SDHB, SDHC, SDHD and FH genes in 72 breast carcinomas and 10 breast cancer cell lines using methylation-sensitive high resolution melting which detects both homogeneous and heterogeneous methylation. Conclusion These results show that inactivation via DNA methylation of the promoter CpG islands of SDH and FH is unlikely to play a major role in sporadic breast carcinomas.
Virginia Polytechnic Inst. and State Univ., Blacksburg. Div. of Vocational-Technical Education.
This self-instructional module on developing your sales promotion plan is the fifth in a set of twelve modules designed for small business owner-managers. Competencies for this module are (1) describe the role of advertising, display, and personal selling in a sales promotion plan and (2) develop an effective sales promotion plan which…
Promoter motifs required for c-mpl gene expression induced by thrombopoietin in CMK cells.
Sunohara, Masataka; Sato, Iwao; Morikawa, Shigeru
2017-11-30
Thrombopoietin (TPO) and its receptor, c-Mpl, are the central regulators of megakaryocyte development and platelet production and are also crucial to regulate megakaryocytopoiesis. TPO remarkably elevated c-mpl promoter activity, while the protein kinase C (PKC) inhibitors, GF109203, H7 and Calphostin C, clearly reduced the steady level of its promoter activity. In the present study, motifs crucial for c-mpl promoter activity induced by TPO treatment have been analyzed using a human megakaryoblastic cell line, CMK. Destruction of the -107Sp1 and the -57Sp1 sites in the c-mpl promoter enhancer region resulted in decrease of the promoter activity by 53.1% and 64.4%, respectively, and destruction of -69Ets and -28Ets elements dramatically decreased the promoter activity by 96.4% and 87.8%, respectively, while mutation of -77GATA moderately reduced the activity by 31.4%. The result was in agreement with our previous report that showed the crucial motifs in the c-mpl promoter for the promoter activity induced by PMA-treatment. This indicates that TPO-induced activation of the c-mpl promoter activity is fully modulated by transcription through a PKC-dependent pathway and the two Sp1 and two Ets motifs are crucial for the activation of the c-mpl promoter activity rather than a GATA motif in the c-mpl promoter of CMK cells.
Quantifying Surface Coal-Mining Patterns to Promote Regional Sustainability in Ordos, Inner Mongolia
Directory of Open Access Journals (Sweden)
Xiaoji Zeng
2018-04-01
Full Text Available Ordos became the new “coal capital” of China within a few decades since the country’s economic reform in 1978, as large-scale surface coal mining dramatically propelled its per capita GDP from being one of the lowest to one of the highest in China, exceeding Hong Kong in 2009. Surface coal-mining areas (SCMAs have continued to expand in this region during recent decades, resulting in serious environmental and socioeconomic consequences. To understand these impacts and promote regional sustainability, quantifying the spatiotemporal patterns of SCMAs is urgently needed. Thus, the main objectives of this study were to quantify the spatiotemporal patterns of SCMAs in the Ordos region from 1990 to 2015, and to examine some of the major environmental and socioeconomic impacts in the study region. We extracted the SCMAs using remote-sensing data, and then quantified their spatiotemporal patterns using landscape metrics. The loss of natural habitat and several socioeconomic indicators were examined in relation to surface coal mining. Our results show that the area of SCMAs increased from 7.12 km2 to 355.95 km2, an increase of nearly 49 times from 1990 to 2015 in the Ordos region. The number of SCMAs in this region increased from 82 to 651, a nearly seven-fold increase. In particular, Zhungeer banner (an administrative division, Yijinhuoluo banner, Dongsheng District and Dalate banner in the north-eastern part of the Ordos region had higher growth rates of SCMAs. The income gap between urban and rural residents increased along with the growth in SCMAs, undermining social equity in the Ordos region. Moreover, the rapid increase in SCMAs resulted in natural habitat loss (including grasslands, forests, and deserts across this region. Thus, we suggest that regional sustainability in Ordos needs to emphasize effective measures to curb large-scale surface coal mining in order to reduce the urban–rural income gap, and to restore degraded natural
Cohen, Michael S; Rissman, Jesse; Suthana, Nanthia A; Castel, Alan D; Knowlton, Barbara J
2014-06-01
A number of prior fMRI studies have focused on the ways in which the midbrain dopaminergic reward system coactivates with hippocampus to potentiate memory for valuable items. However, another means by which people could selectively remember more valuable to-be-remembered items is to be selective in their use of effective but effortful encoding strategies. To broadly examine the neural mechanisms of value on subsequent memory, we used fMRI to assess how differences in brain activity at encoding as a function of value relate to subsequent free recall for words. Each word was preceded by an arbitrarily assigned point value, and participants went through multiple study-test cycles with feedback on their point total at the end of each list, allowing for sculpting of cognitive strategies. We examined the correlation between value-related modulation of brain activity and participants' selectivity index, which measures how close participants were to their optimal point total, given the number of items recalled. Greater selectivity scores were associated with greater differences in the activation of semantic processing regions, including left inferior frontal gyrus and left posterior lateral temporal cortex, during the encoding of high-value words relative to low-value words. Although we also observed value-related modulation within midbrain and ventral striatal reward regions, our fronto-temporal findings suggest that strategic engagement of deep semantic processing may be an important mechanism for selectively encoding valuable items.
Cohen, Michael S.; Rissman, Jesse; Suthana, Nanthia A.; Castel, Alan D.; Knowlton, Barbara J.
2014-01-01
A number of prior fMRI studies have focused on the ways in which the midbrain dopaminergic reward system co-activates with hippocampus to potentiate memory for valuable items. However, another means by which people could selectively remember more valuable to-be-remembered items is to be selective in their use of effective but effortful encoding strategies. To broadly examine the neural mechanisms of value on subsequent memory, we used fMRI to examine how differences in brain activity at encoding as a function of value relate to subsequent free recall for words. Each word was preceded by an arbitrarily assigned point value, and participants went through multiple study-test cycles with feedback on their point total at the end of each list, allowing for sculpting of cognitive strategies. We examined the correlation between value-related modulation of brain activity and participants’ selectivity index, a measure of how close participants were to their optimal point total given the number of items recalled. Greater selectivity scores were associated with greater differences in activation of semantic processing regions, including left inferior frontal gyrus and left posterior lateral temporal cortex, during encoding of high-value words relative to low-value words. Although we also observed value-related modulation within midbrain and ventral striatal reward regions, our fronto-temporal findings suggest that strategic engagement of deep semantic processing may be an important mechanism for selectively encoding valuable items. PMID:24683066
Directory of Open Access Journals (Sweden)
Sun Yuping
2016-03-01
Full Text Available Labor resource is the necessary productive factor in regional economic development, and one of important indexes to evaluate regional economic competitiveness. The great economic achievement brought by the 30-year reform and opening up of China is due to the fact that China brought the backward advantage of “demographic dividend” into play, promoted the fast development of industrialization and urbanization, and became the second largest economy in the world. The entity of “demographic dividend” is the non-agricultural migrant population, i.e., migrant workers. The transfer employment of migrant workers has typical regional liquidity, and the imbalance of regional economy causes the flow of many migrant workers. In order to achieve harmonious development and coordinated development, underdeveloped areas must understand the character and regulation, adopt positive industrial policy and supportive policy, guide the reasonable flow of migrant workers, and realize the transfer of local employment and citizenization of migrant workers, which can enhance regional economic competitiveness
Dawid Milner, M S; Lara, J P; López de Miguel, M P; López-González, M V; Spyer, K M; González-Barón, S
2003-08-22
We have examined the importance of the A5 region modulating cardiorespiratory responses evoked from the parabrachial complex (PB) in spontaneously breathing rats. Cardiorespiratory changes were analyzed in response to electrical stimulation and glutamate microinjections into the PB (10-20 nl, 1-2 nmol) before and after ipsilateral microinjection of muscimol (50 nl, 0.25 nmol) or lidocaine (50 nl, 0.5 nmol) within the A5 region. Stimulation of medial parabrachial and Kölliker-Fuse nuclei (mPB-KF) evoked a decrease in respiratory rate (Pinteractions between A5 and PB, extracellular recordings of putative A5 neurones were obtained during PB stimulation. Eighty-three A5 cells were recorded, 35 were activated from the mPB-KF (42%). The results indicate that neurones of the A5 region participate in the cardiorespiratory response evoked from the different regions of the PB complex. The possible mechanisms involved in these interactions are discussed.
Energy Technology Data Exchange (ETDEWEB)
Burnham, Laurie [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Lave, Matthew Samuel [Sandia National Lab. (SNL-CA), Livermore, CA (United States); Stein, Joshua [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)
2017-07-01
This report provides a preliminary (three month) analysis for the SolarWorld system installed at the New Mexico Regional Test Center (RTC.) The 8.7kW, four-string system consists of four module types): bifacial, mono-crystalline, mono-crystalline glass-glass and polycrystalline. Overall, the SolarWorld system has performed well to date: most strings closely match their specification-sheet module temperature coefficients and Sandia 's f lash tests show that Pmax values are well within expectations. Although the polycrystalline modules underperformed, the results may be a function of light exposure, as well as mismatch within the string, and not a production flaw. The instantaneous bifacial gains for SolarWorld 's Bisun modules were modest but it should be noted that the RTC racking is not optimized for bifacial modules, nor is albedo optimized at the site. Additional analysis, not only of the SolarWorld installation in New Mexico but of the SolarWorld installations at the Vermont and Florida RTCs will be provide much more information regarding the comparative performance of the four module types.
Blum, Walter; Pecze, László; Rodriguez, Janine Wörthmüller; Steinauer, Martine; Schwaller, Beat
2018-04-27
The calcium-binding protein calretinin (gene name: CALB2) is currently considered as the most sensitive and specific marker for the diagnosis of malignant mesothelioma (MM). MM is a very aggressive tumor strongly linked to asbestos exposure and with no existing cure so far. The mechanisms of calretinin regulation, as well as its distinct function in MM are still poorly understood. We searched for transcription factors binding to the CALB2 promoter and modulating calretinin expression. For this, DNA-binding assays followed by peptide shotgun-mass spectroscopy analyses were used. CALB2 promoter activity was assessed by dual-luciferase reporter assays. Furthermore, we analyzed the effects of CALB2 promoter-binding proteins by lentiviral-mediated overexpression or down-regulation of identified proteins in MM cells. The modulation of expression of such proteins by butyrate was determined by subsequent Western blot analysis. Immunohistochemical analysis of embryonic mouse lung tissue served to verify the simultaneous co-expression of calretinin and proteins interacting with the CALB2 promoter during early development. Finally, direct interactions of calretinin with target proteins were evidenced by co-immunoprecipitation experiments. Septin 7 was identified as a butyrate-dependent transcription factor binding to a CALB2 promoter region containing butyrate-responsive elements (BRE) resulting in decreased calretinin expression. Accordingly, septin 7 overexpression decreased calretinin expression levels in MM cells. The regulation was found to operate bi-directionally, i.e. calretinin overexpression also decreased septin 7 levels. During murine embryonic development calretinin and septin 7 were found to be co-expressed in embryonic mesenchyme and undifferentiated mesothelial cells. In MM cells, calretinin and septin 7 colocalized during cytokinesis in distinct regions of the cleavage furrow and in the midbody region of mitotic cells. Co-immunoprecipitation experiments
The role of COMESA in promoting intra-regional agricultural trade: Case study of Sudan
Directory of Open Access Journals (Sweden)
Azharia Abdelbagi Elbushra
2011-06-01
Full Text Available African countries have created many regional trade agreements with the economic objectives of reducing trade barriers and encouraging economic growth. The COMESA is an example of regional integration singed on 1993 by 19 African countries including Sudan. COMESA represents a chance for member countries to enhance their economic and social relations through increasing intra-trade. The objective of this paper is to assess the role of COMESA in promoting intra-regional agricultural trade between Sudan and COMESA countries. A multi-market model with Armington non-linear specification was applied. The paper results showed that there is a great potential for Sudan to increase its agricultural exports to other COMESA countries. The domestic agricultural markets are expected to be hampered by imports surge and increase in competition, while the producers of agricultural export commodities will be better off. In order to compete and benefit from potential in the COMESA markets, the paper recommended improving efficiency in the Sudanese agricultural sector through increasing productivity, lowering cost of production, enhancing marketing services, attaining economies of scale and attracting foreign investment.
Keadtidumrongkul, Pornthep; Suttangkakul, Anongpat; Pinmanee, Phitsanu; Pattana, Kanokwan; Kittiwongwattana, Chokchai; Apisitwanich, Somsak; Vuttipongchaikij, Supachai
2017-08-01
The expression of cell-wall-targeted Carbohydrate Binding Modules (CBMs) can alter cell wall properties and modulate growth and development in plants such as tobacco and potato. CBM2a identified in xylanase 10A from Cellulomonas fimi is of particular interest for its ability to bind crystalline cellulose. However, its potential for promoting plant growth has not been explored. In this work, we tested the ability of CBM2a to promote growth when expressed using both CaMV35S and a vascular tissue-specific promoter derived from Arabidopsis expansin4 (AtEXP4) in three plant species: Arabidopsis, Nicotiana tabacum and Eucalyptus camaldulensis. In Arabidopsis, the expression of AtEXP4pro:CBM2a showed trends for growth promoting effects including the increase of root and hypocotyl lengths and the enlargements of the vascular xylem area, fiber cells and vessel cells. However, in N. tabacum, the expression of CBM2a under the control of either CaMV35S or AtEXP4 promoter resulted in subtle changes in the plant growth, and the thickness of secondary xylem and vessel and fiber cell sizes were generally reduced in the transgenic lines with AtEXP4pro:CBM2a. In Eucalyptus, while transgenics expressing CaMV35S:CBM2a showed very subtle changes compared to wild type, those transgenics with AtEXP4pro:CBM2a showed increases in plant height, enlargement of xylem areas and xylem fiber and vessel cells. These data provide comparative effects of expressing CBM2a protein in different plant species, and this finding can be applied for plant biomass improvement.
Independent learning modules enhance student performance and understanding of anatomy.
Serrat, Maria A; Dom, Aaron M; Buchanan, James T; Williams, Alison R; Efaw, Morgan L; Richardson, Laura L
2014-01-01
Didactic lessons are only one part of the multimodal teaching strategies used in gross anatomy courses today. Increased emphasis is placed on providing more opportunities for students to develop lifelong learning and critical thinking skills during medical training. In a pilot program designed to promote more engaged and independent learning in anatomy, self-study modules were introduced to supplement human gross anatomy instruction at Joan C. Edwards School of Medicine at Marshall University. Modules use three-dimensional constructs to help students understand complex anatomical regions. Resources are self-contained in portable bins and are accessible at any time. Students use modules individually or in groups in a structured self-study format that augments material presented in lecture and laboratory. Pilot outcome data, measured by feedback surveys and examination performance statistics, suggest that the activity may be improving learning in gross anatomy. Positive feedback on both pre- and post-examination surveys showed that students felt the activity helped to increase their understanding of the topic. In concordance with student perception, average examination scores on module-related laboratory and lecture questions were higher in the two years of the pilot program compared with the year before its initiation. Modules can be fabricated on a modest budget using minimal resources, making implementation practical for smaller institutions. Upper level medical students assist in module design and upkeep, enabling continuous opportunities for vertical integration across the curriculum. This resource offers a feasible mechanism for enhancing independent and lifelong learning competencies, which could be a valuable complement to any gross anatomy curriculum. © 2014 American Association of Anatomists.
On the Capacity Region of the Intensity-Modulation Direct-Detection Optical Broadcast Channel
Chaaban, Anas
2015-08-11
The capacity of the intensity-modulation direct-detection free-space optical broadcast channel (OBC) is investigated. The Gaussian model with input-independent Gaussian noise is used, with both average and peak intensity constraints. An outer bound on the capacity region is derived by adapting Bergmans\\' approach to the OBC. Inner bounds are derived by using superposition coding with either truncated-Gaussian distributions or discrete distributions. While the discrete input distribution achieves higher rates than the truncated-Gaussian distribution, the latter allows expressing the achievable rate region in a closed form. At high signal-to-noise ratio (SNR), it is shown that the truncated-Gaussian distribution is nearly optimal. It achieves the symmetric-capacity within a constant gap (independent of SNR), which approaches half a bit as the number of users grows large. It also achieves the capacity region within a constant gap, which depends on the number of users. At low SNR, it is shown that on-off keying with time-division multiple-access (TDMA) is optimal, as it achieves any point on the boundary of the developed outer bound. This is interesting in practice since both OOK and TDMA have low complexity. At moderate SNR (typically [0,8] dB), a discrete distribution with a small alphabet size achieves a fairly good performance in terms of symmetric rate.
Xu, Meixiang; Nekhayeva, Ilona; Cross, Courtney E; Rondelli, Catherine M; Wickliffe, Jeffrey K; Abdel-Rahman, Sherif Z
2014-03-01
The O6-methylguanine-DNA methyltransferase gene (MGMT) encodes the direct reversal DNA repair protein that removes alkyl adducts from the O6 position of guanine. Several single-nucleotide polymorphisms (SNPs) exist in the MGMT promoter/enhancer (P/E) region. However, the haplotype structure encompassing these SNPs and their functional/biological significance are currently unknown. We hypothesized that MGMT P/E haplotypes, rather than individual SNPs, alter MGMT transcription and can thus alter human sensitivity to alkylating agents. To identify the haplotype structure encompassing the MGMT P/E region SNPs, we sequenced 104 DNA samples from healthy individuals and inferred the haplotypes using the data generated. We identified eight SNPs in this region, namely T7C (rs180989103), T135G (rs1711646), G290A (rs61859810), C485A (rs1625649), C575A (rs113813075), G666A (rs34180180), C777A (rs34138162) and C1099T (rs16906252). Phylogenetics and Sequence Evolution analysis predicted 21 potential haplotypes that encompass these SNPs ranging in frequencies from 0.000048 to 0.39. Of these, 10 were identified in our study population as 20 paired haplotype combinations. To determine the functional significance of these haplotypes, luciferase reporter constructs representing these haplotypes were transfected into glioblastoma cells and their effect on MGMT promoter activity was determined. Compared with the most common (reference) haplotype 1, seven haplotypes significantly upregulated MGMT promoter activity (18-119% increase; P alkylating agents.
Knowles, Ryan Thomas
2015-01-01
Utilizing data from the 2009 IEA International Civic and Citizenship Study Asian Regional Module, this secondary analysis explores the relationship between traditional Asian values and democratic citizenship. Findings identify two dimensions of Asian values: Asian civic values and obedience to authority. Among South Korean students, Asian civic…
Tarboton, D. G.; Habib, E. H.; Deshotel, M.; Merck, M. F.; Lall, U.; Farnham, D. J.
2016-12-01
Traditional approaches to undergraduate hydrology and water resource education are textbook based, adopt unit processes and rely on idealized examples of specific applications, rather than examining the contextual relations in the processes and the dynamics connecting climate and ecosystems. The overarching goal of this project is to address the needed paradigm shift in undergraduate education of engineering hydrology and water resources education to reflect parallel advances in hydrologic research and technology, mainly in the areas of new observational settings, data and modeling resources and web-based technologies. This study presents efforts to develop a set of learning modules that are case-based, data and simulation driven and delivered via a web user interface. The modules are based on real-world case studies from three regional hydrologic settings: Coastal Louisiana, Utah Rocky Mountains and Florida Everglades. These three systems provide unique learning opportunities on topics such as: regional-scale budget analysis, hydrologic effects of human and natural changes, flashflood protection, climate-hydrology teleconnections and water resource management scenarios. The technical design and contents of the modules aim to support students' ability for transforming their learning outcomes and skills to hydrologic systems other than those used by the specific activity. To promote active learning, the modules take students through a set of highly engaging learning activities that are based on analysis of hydrologic data and model simulations. The modules include user support in the form of feedback and self-assessment mechanisms that are integrated within the online modules. Module effectiveness is assessed through an improvement-focused evaluation model using a mixed-method research approach guiding collection and analysis of evaluation data. Both qualitative and quantitative data are collected through student learning data, product analysis, and staff interviews
Papadakis, Antonios E; Perisinakis, Kostas; Damilakis, John
2014-10-01
To study the effect of patient size, body region and modulation strength on tube current and image quality on CT examinations that use automatic tube current modulation (ATCM). Ten physical anthropomorphic phantoms that simulate an individual as neonate, 1-, 5-, 10-year-old and adult at various body habitus were employed. CT acquisition of head, neck, thorax and abdomen/pelvis was performed with ATCM activated at weak, average and strong modulation strength. The mean modulated mAs (mAsmod) values were recorded. Image noise was measured at selected anatomical sites. The mAsmod recorded for neonate compared to 10-year-old increased by 30 %, 14 %, 6 % and 53 % for head, neck, thorax and abdomen/pelvis, respectively, (P < 0.05). The mAsmod was lower than the preselected mAs with the exception of the 10-year-old phantom. In paediatric and adult phantoms, the mAsmod ranged from 44 and 53 for weak to 117 and 93 for strong modulation strength, respectively. At the same exposure parameters image noise increased with body size (P < 0.05). The ATCM system studied here may affect dose differently for different patient habitus. Dose may decrease for overweight adults but increase for children older than 5 years old. Care should be taken when implementing ATCM protocols to ensure that image quality is maintained. • ATCM efficiency is related to the size of the patient's body. • ATCM should be activated without caution in overweight adult individuals. • ATCM may increase radiation dose in children older than 5 years old. • ATCM efficiency depends on the protocol selected for a specific anatomical region. • Modulation strength may be appropriately tuned to enhance ATCM efficiency.
Ferreira, Joshua P.; Peacock, Ryan W. S.; Lawhorn, Ingrid E. B.; Wang, Clifford L.
2011-01-01
The human cytomegalovirus and elongation factor 1α promoters are constitutive promoters commonly employed by mammalian expression vectors. These promoters generally produce high levels of expression in many types of cells and tissues. To generate a library of synthetic promoters capable of generating a range of low, intermediate, and high expression levels, the TATA and CAAT box elements of these promoters were mutated. Other promoter variants were also generated by random mutagenesis. Evalua...
Modulation of chromatin structure by the FACT histone chaperone complex regulates HIV-1 integration.
Matysiak, Julien; Lesbats, Paul; Mauro, Eric; Lapaillerie, Delphine; Dupuy, Jean-William; Lopez, Angelica P; Benleulmi, Mohamed Salah; Calmels, Christina; Andreola, Marie-Line; Ruff, Marc; Llano, Manuel; Delelis, Olivier; Lavigne, Marc; Parissi, Vincent
2017-07-28
Insertion of retroviral genome DNA occurs in the chromatin of the host cell. This step is modulated by chromatin structure as nucleosomes compaction was shown to prevent HIV-1 integration and chromatin remodeling has been reported to affect integration efficiency. LEDGF/p75-mediated targeting of the integration complex toward RNA polymerase II (polII) transcribed regions ensures optimal access to dynamic regions that are suitable for integration. Consequently, we have investigated the involvement of polII-associated factors in the regulation of HIV-1 integration. Using a pull down approach coupled with mass spectrometry, we have selected the FACT (FAcilitates Chromatin Transcription) complex as a new potential cofactor of HIV-1 integration. FACT is a histone chaperone complex associated with the polII transcription machinery and recently shown to bind LEDGF/p75. We report here that a tripartite complex can be formed between HIV-1 integrase, LEDGF/p75 and FACT in vitro and in cells. Biochemical analyzes show that FACT-dependent nucleosome disassembly promotes HIV-1 integration into chromatinized templates, and generates highly favored nucleosomal structures in vitro. This effect was found to be amplified by LEDGF/p75. Promotion of this FACT-mediated chromatin remodeling in cells both increases chromatin accessibility and stimulates HIV-1 infectivity and integration. Altogether, our data indicate that FACT regulates HIV-1 integration by inducing local nucleosomes dissociation that modulates the functional association between the incoming intasome and the targeted nucleosome.
Mishra, Sonal; Shukla, Aparna; Upadhyay, Swati; Sanchita; Sharma, Pooja; Singh, Seema; Phukan, Ujjal J; Meena, Abha; Khan, Feroz; Tripathi, Vineeta; Shukla, Rakesh Kumar; Shrama, Ashok
2014-04-01
Plants posses a complex co-regulatory network which helps them to elicit a response under diverse adverse conditions. We used an in silico approach to identify the genes with both DRE and ABRE motifs in their promoter regions in Arabidopsis thaliana. Our results showed that Arabidopsis contains a set of 2,052 genes with ABRE and DRE motifs in their promoter regions. Approximately 72% or more of the total predicted 2,052 genes had a gap distance of less than 400 bp between DRE and ABRE motifs. For positional orientation of the DRE and ABRE motifs, we found that the DR form (one in direct and the other one in reverse orientation) was more prevalent than other forms. These predicted 2,052 genes include 155 transcription factors. Using microarray data from The Arabidopsis Information Resource (TAIR) database, we present 44 transcription factors out of 155 which are upregulated by more than twofold in response to osmotic stress and ABA treatment. Fifty-one transcripts from the one predicted above were validated using semiquantitative expression analysis to support the microarray data in TAIR. Taken together, we report a set of genes containing both DRE and ABRE motifs in their promoter regions in A. thaliana, which can be useful to understand the role of ABA under osmotic stress condition. © 2013 Institute of Botany, Chinese Academy of Sciences.
Kinoshita, Yumiko; Kizaki, Zenro; Ishihara, Yasunori; Nakajima, Hisakazu; Adachi, Shinsuke; Kosaka, Kitaro; Kinugasa, Akihiko; Sugimoto, Tohru
2007-01-01
Evidence is accumulating that the promoter region of the insulin-like growth factor I (IGF-I) gene polymorphism and low levels of IGF-I are associated with type 2 diabetes, cardiovascular disease and birth weight; however, the number of wild-type alleles is different in each country. This study aimed to examine the 737/738 marker, a cytosine-adenine repeat in the promoter region of the IGF-I gene polymorphism, and plasma IGF-I levels in Japanese infants and analyze the genetic background. Data were collected for 15 months in Kyoto Prefectural University of Medicine. The body composition parameters of all infants were determined at birth. At 5 days after birth, we took blood samples to measure the product size of the promoter region of the IGF-I gene polymorphism and plasma IGF-I. In a population-based sample of 160 subjects, 6 different alleles and 16 genotypes were identified in the promoter region of the IGF-I gene polymorphism. The existence of a 196-bp allele has proved to result in a low plasma IGF-I level, a small head and chest circumference (p body composition parameters in Japanese infants. Our results suggest genetical influence on prenatal growth and serum IGF-I levels.
DEFF Research Database (Denmark)
Hernandez Castellano, Lorenzo E; Morales-delaNuez, Antonio; Moreno-Indias, Isabel
2013-01-01
of this study, therefore, was to evaluate local and imported carcasses and meat quality in order to promote the consumption of local breeds, using the Canary Islands (Spain) as a model for other subtropical outermost regions. For this study 20 half-carcasses from Palmera breed and 20 imported half...
Artificial Promoters for Metabolic Optimization
DEFF Research Database (Denmark)
Jensen, Peter Ruhdal; Hammer, Karin
1998-01-01
In this article, we review some of the expression systems that are available for Metabolic Control Analysis and Metabolic Engineering, and examine their advantages and disadvantages in different contexts. In a recent approach, artificial promoters for modulating gene expression in micro-organisms...
Doyle, Joyce; Atkinson-Briggs, Sharon; Atkinson, Petah; Firebrace, Bradley; Calleja, Julie; Reilly, Rachel; Cargo, Margaret; Riley, Therese; Crumpen, Tui; Rowley, Kevin
2016-11-10
Aboriginal Community Controlled Organisations (ACCOs) provide community-focussed and culturally safe services for First Peoples in Australia, including crisis intervention and health promotion activities, in a holistic manner. The ecological model of health promotion goes some way towards describing the complexity of such health programs. The aims of this project were to: 1) identify the aims and purpose of existing health promotion programs conducted by an alliance of ACCOs in northern Victoria, Australia; and 2) evaluate the extent to which these programs are consistent with an ecological model of health promotion, addressing both individual and environmental determinants of health. The project arose from a long history of collaborative research. Three ACCOs and a university formed the Health Promotion Alliance to evaluate their health promotion programs. Local community members were trained in, and contributed to developing culturally sensitive methods for, data collection. Information on the aims and design of 88 health promotion activities making up 12 different programs across the ACCOs was systematically and prospectively collected. There was a wide range of activities addressing environmental and social determinants of health, as well as physical activity, nutrition and weight loss. The design of the great majority of activities had a minimal Western influence and were designed within a local Aboriginal cultural framework. The most common focus of the activities was social connectedness (76 %). Physical activity was represented in two thirds of the activities, and nutrition, weight loss and culture were each a focus of about half of the activities. A modified coding procedure designed to assess the ecological nature of these programs showed that they recruited from multiple settings; targeted a range of individual, social and environmental determinants; and used numerous and innovative strategies to achieve change. First Peoples' health promotion in the
Das, Rahul K; Crick, Scott L; Pappu, Rohit V
2012-02-17
Basic region leucine zippers (bZIPs) are modular transcription factors that play key roles in eukaryotic gene regulation. The basic regions of bZIPs (bZIP-bRs) are necessary and sufficient for DNA binding and specificity. Bioinformatic predictions and spectroscopic studies suggest that unbound monomeric bZIP-bRs are uniformly disordered as isolated domains. Here, we test this assumption through a comparative characterization of conformational ensembles for 15 different bZIP-bRs using a combination of atomistic simulations and circular dichroism measurements. We find that bZIP-bRs have quantifiable preferences for α-helical conformations in their unbound monomeric forms. This helicity varies from one bZIP-bR to another despite a significant sequence similarity of the DNA binding motifs (DBMs). Our analysis reveals that intramolecular interactions between DBMs and eight-residue segments directly N-terminal to DBMs are the primary modulators of bZIP-bR helicities. We test the accuracy of this inference by designing chimeras of bZIP-bRs to have either increased or decreased overall helicities. Our results yield quantitative insights regarding the relationship between sequence and the degree of intrinsic disorder within bZIP-bRs, and might have general implications for other intrinsically disordered proteins. Understanding how natural sequence variations lead to modulation of disorder is likely to be important for understanding the evolution of specificity in molecular recognition through intrinsically disordered regions (IDRs). Copyright © 2011 Elsevier Ltd. All rights reserved.
Edwards, Alexander; Abizaid, Alfonso
2016-07-01
Independent stimulation of either the ghrelin or endocannabinoid system promotes food intake and increases adiposity. Given the similar distribution of their receptors in feeding associated brain regions and organs involved in metabolism, it is not surprising that evidence of their interaction and its importance in modulating energy balance has emerged. This review documents the relationship between ghrelin and endocannabinoid systems within the periphery and hypothalamus (HYP) before presenting evidence suggesting that these two systems likewise work collaboratively within the ventral tegmental area (VTA) to modulate non-homeostatic feeding. Mechanisms, consistent with current evidence and local infrastructure within the VTA, will be proposed. Copyright © 2016 Elsevier Ltd. All rights reserved.
Faraday effect and λ-modulation absorption spectra of GaP
International Nuclear Information System (INIS)
Petkova, P N; Dimov, T N; Iliev, I A
2007-01-01
There are presented the absorption optical spectra of GaP measured by λ-modulation method at room temperature in the spectral region from 505 nm to 700 nm. It is not possible even by λ-modulation to be registered at room temperature the wave bands due to the exciton-phonon interaction. The absorption spectra of GaP carried out by a λ-modulation can be separated exactly in the spectral parts as follows: the transmittance region where the absorption is too slightly expressed; the region determined by the phonon-assisted indirect transitions; the region of the interband absorption. The purpose of Faraday rotation measurements is to establish the influence of the exciton-phonon interaction on the magneto-optical effect. The magneto-optical effect has been investigated by a φ-modulation. The spectral dependence of dn/dλ in the transmittance region is determined by the φ-modulated spectra
Energy Technology Data Exchange (ETDEWEB)
Wada, Takeyoshi [Faculty of Science and Engineering, Waseda University, TWIns, 2-2 Wakamatsu, Shinjuku, Tokyo, 162-8480 (Japan); Asahi, Toru [Faculty of Science and Engineering, Waseda University, TWIns, 2-2 Wakamatsu, Shinjuku, Tokyo, 162-8480 (Japan); Research Organization for Nano & Life Innovation, Waseda University #03C309, TWIns, 2-2 Wakamatsu, Shinjuku, Tokyo, 162-8480 (Japan); Sawamura, Naoya, E-mail: naoya.sawamura@gmail.com [Faculty of Science and Engineering, Waseda University, TWIns, 2-2 Wakamatsu, Shinjuku, Tokyo, 162-8480 (Japan); Research Organization for Nano & Life Innovation, Waseda University #03C309, TWIns, 2-2 Wakamatsu, Shinjuku, Tokyo, 162-8480 (Japan)
2016-08-26
The gene coding cereblon (CRBN) was originally identified in genetic linkage analysis of mild autosomal recessive nonsyndromic intellectual disability. CRBN has broad localization in both the cytoplasm and nucleus. However, the significance of nuclear CRBN remains unknown. In the present study, we aimed to elucidate the role of CRBN in the nucleus. First, we generated a series of CRBN deletion mutants and determined the regions responsible for the nuclear localization. Only CRBN protein lacking the N-terminal region was localized outside of the nucleus, suggesting that the N-terminal region is important for its nuclear localization. CRBN was also identified as a thalidomide-binding protein and component of the cullin-4-containing E3 ubiquitin ligase complex. Thalidomide has been reported to be involved in the regulation of the transcription factor Ikaros by CRBN-mediated degradation. To investigate the nuclear functions of CRBN, we performed co-immunoprecipitation experiments and evaluated the binding of CRBN to Ikaros. As a result, we found that CRBN was associated with Ikaros protein, and the N-terminal region of CRBN was required for Ikaros binding. In luciferase reporter gene experiments, CRBN modulated transcriptional activity of Ikaros. Furthermore, we found that CRBN modulated Ikaros-mediated transcriptional repression of the proenkephalin gene by binding to its promoter region. These results suggest that CRBN binds to Ikaros via its N-terminal region and regulates transcriptional activities of Ikaros and its downstream target, enkephalin. - Highlights: • We found that CRBN is a nucleocytoplasmic shutting protein and identified the key domain for nucleocytoplasmic shuttling. • CRBN associates with the transcription factor Ikaros via the N-terminal domain. • CRBN modulates Ikaros-mediated transcriptional regulation and its downstream target, enkephalin.
International Nuclear Information System (INIS)
Wada, Takeyoshi; Asahi, Toru; Sawamura, Naoya
2016-01-01
The gene coding cereblon (CRBN) was originally identified in genetic linkage analysis of mild autosomal recessive nonsyndromic intellectual disability. CRBN has broad localization in both the cytoplasm and nucleus. However, the significance of nuclear CRBN remains unknown. In the present study, we aimed to elucidate the role of CRBN in the nucleus. First, we generated a series of CRBN deletion mutants and determined the regions responsible for the nuclear localization. Only CRBN protein lacking the N-terminal region was localized outside of the nucleus, suggesting that the N-terminal region is important for its nuclear localization. CRBN was also identified as a thalidomide-binding protein and component of the cullin-4-containing E3 ubiquitin ligase complex. Thalidomide has been reported to be involved in the regulation of the transcription factor Ikaros by CRBN-mediated degradation. To investigate the nuclear functions of CRBN, we performed co-immunoprecipitation experiments and evaluated the binding of CRBN to Ikaros. As a result, we found that CRBN was associated with Ikaros protein, and the N-terminal region of CRBN was required for Ikaros binding. In luciferase reporter gene experiments, CRBN modulated transcriptional activity of Ikaros. Furthermore, we found that CRBN modulated Ikaros-mediated transcriptional repression of the proenkephalin gene by binding to its promoter region. These results suggest that CRBN binds to Ikaros via its N-terminal region and regulates transcriptional activities of Ikaros and its downstream target, enkephalin. - Highlights: • We found that CRBN is a nucleocytoplasmic shutting protein and identified the key domain for nucleocytoplasmic shuttling. • CRBN associates with the transcription factor Ikaros via the N-terminal domain. • CRBN modulates Ikaros-mediated transcriptional regulation and its downstream target, enkephalin.
A lipid-mediated conformational switch modulates the thermosensing activity of DesK.
Inda, María Eugenia; Vandenbranden, Michel; Fernández, Ariel; de Mendoza, Diego; Ruysschaert, Jean-Marie; Cybulski, Larisa Estefanía
2014-03-04
The thermosensor DesK is a multipass transmembrane histidine-kinase that allows the bacterium Bacillus subtilis to adjust the levels of unsaturated fatty acids required to optimize membrane lipid fluidity. The cytoplasmic catalytic domain of DesK behaves like a kinase at low temperature and like a phosphatase at high temperature. Temperature sensing involves a built-in instability caused by a group of hydrophilic residues located near the N terminus of the first transmembrane (TM) segment. These residues are buried in the lipid phase at low temperature and partially "buoy" to the aqueous phase at higher temperature with the thinning of the membrane, promoting the required conformational change. Nevertheless, the core question remains poorly understood: How is the information sensed by the transmembrane region converted into a rearrangement in the cytoplasmic catalytic domain to control DesK activity? Here, we identify a "linker region" (KSRKERERLEEK) that connects the TM sensor domain with the cytoplasmic catalytic domain involved in signal transmission. The linker adopts two conformational states in response to temperature-dependent membrane thickness changes: (i) random coiled and bound to the phospholipid head groups at the water-membrane interface, promoting the phosphatase state or (ii) unbound and forming a continuous helix spanning a region from the membrane to the cytoplasm, promoting the kinase state. Our results uphold the view that the linker is endowed with a helix/random coil conformational duality that enables it to behave like a transmission switch, with helix disruption decreasing the kinase/phosphatase activity ratio, as required to modulate the DesK output response.
Penta Rao, Tamarba; Rajendra Prasad, P.
2018-04-01
Entry region swirl promoters gain importance in industry because of its effectiveness in augmentation of mass and heat transfer augmentation. Design of equipment needs momentum transfer data along with mass or heat transfer data. Hence an experimental investigation was carried out with coaxially placed entry region spiral coil as turbulence promoters on momentum transfer in forced convection flow of electrolyte in circular conduits. Aqueous solution of sodium hydroxide and 0.01 M equimolal Ferri-ferro cyanide system was chosen for the study. The study covered parameters like effect of pitch of the coil, effect of length of the coil, diameter of the coil, diameter of the coil wire, diameter of the annular rod. The promoter is measured by limiting current technique using diffusion controlled electrochemical reactions. The study comprises of evaluation of momentum transfer rates at the outer wall of the electrochemical cell. Pressure drop measurements were also made to obtain the energy consumption pattern. Within the range of variables covered. The results are correlated by the momentum transfer similarity function. Momentum transfer coefficients were evaluated from measured limiting currents. Effect of each parameter was studied in terms of friction factor. A model was developed for momentum transfer. The experimental data on momentum transfer was modeled in terms of momentum transfer function and Reynolds number, geometric parameters.
Tunable promoters in systems biology
DEFF Research Database (Denmark)
Mijakovic, Ivan; Petranovic, Dina; Jensen, Peter Ruhdal
2005-01-01
The construction of synthetic promoter libraries has represented a major breakthrough in systems biology, enabling the subtle tuning of enzyme activities. A number of tools are now available that allow the modulation of gene expression and the detection of changes in expression patterns. But, how...
Archaeal promoter architecture and mechanism of gene activation
DEFF Research Database (Denmark)
Peng, Nan; Ao, Xiang; Liang, Yun Xiang
2011-01-01
element named ara box directing arabinose-inducible expression and the basal promoter element TATA, serving as the binding site for the TATA-binding protein. Strikingly, these promoters possess a modular structure that allows an essentially inactive basal promoter to be strongly activated. The invoked...... mechanisms include TFB (transcription factor B) recruitment by the ara-box-binding factor to activate gene expression and modulation of TFB recruitment efficiency to yield differential gene expression....
DEFF Research Database (Denmark)
Tchatchou, Sandrine; Riedel, Angela; Lyer, Stefan
2010-01-01
,466 unrelated German controls. Promoter studies in breast cancer cells demonstrate that the risk-increasing DMBT1 -93T allele displays significantly decreased promoter activity compared to the DMBT1 -93C allele, resulting in a loss of promoter activity. The data suggest that DMBT1 polymorphisms in the 5'-region......According to present estimations, the unfavorable combination of alleles with low penetrance but high prevalence in the population might account for the major part of hereditary breast cancer risk. Deleted in Malignant Brain Tumors 1 (DMBT1) has been proposed as a tumor suppressor for breast cancer...... and other cancer types. Genomewide mapping in mice further identified Dmbt1 as a potential modulator of breast cancer risk. Here, we report the association of two frequent and linked single-nucleotide polymorphisms (SNPs) with increased breast cancer risk in women above the age of 60 years: DMBT1 c.-93C...
International Nuclear Information System (INIS)
Kita, Atsushi; Yamasaki, Hironori; Kuwahara, Hironaga; Moriuchi, Akie; Fukushima, Keiko; Kobayashi, Masakazu; Fukushima, Tetsuya; Takahashi, Ryoko; Abiru, Norio; Uotani, Shigeo; Kawasaki, Eiji; Eguchi, Katsumi
2005-01-01
Adiponectin, an adipose tissue-specific plasma protein, is involved in insulin sensitizing and has anti-atherosclerotic properties. Plasma levels of adiponectin are decreased in obese individuals and patients with type 2 diabetes with insulin resistance. Tumor necrosis factor-α (TNF-α) decreases the expression of adiponectin in adipocytes. The aims of the present study were: (1) to identify the promoter region responsible for basal transcription of the human adiponectin gene, and (2) to investigate the mechanism by which adiponectin was regulated by TNF-α. The human adiponectin promoter (2.1 kb) was isolated and used for luciferase reporter analysis by transient transfection into 3T3-L1 adipocytes. Deletion analysis demonstrated that the promoter region from -676 to +41 was sufficient for basal transcriptional activity. Mutation analysis of putative response elements for sterol regulatory element binding protein (SREBP) (-431 to -423) and CCAAT/enhancer binding protein (C/EBP) (-230 to -224) showed that both elements were required for basal promoter activity. Adiponectin transcription was increased 3-fold in cells that over-expressed constitutively active C/EBP-β. Electrophoretic mobility shift assay, using nuclear extract from 3T3-L1 cells and the -258 to -199 region as a probe, demonstrated specific DNA-protein binding, which was abolished by TNF-α treatment. The present data indicate that the putative response elements for SREBP and C/EBP are required for human adiponectin promoter activity, and that suppression by TNF-α may, at least in part, be associated with inactivation of C/EBP-β
Saify, Khyber; Saadat, Iraj; Saadat, Mostafa
2014-11-30
Within the core promoter region of prodynorphin (PDYN), a 68-bp sequence was found to occur as a polymorphism element, either singular or as tandemly repeated two, three or four times. We report the sequence of a novel allele (5-repeats). Our study revealed the existence of an ancestral nucleotide (A) at 29th position of the VNTR in human. In total, 442 heroin addicts and 799 controls were included in this study. The present findings revealed a male-limited association between VNTR polymorphism and heroin dependence risk. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Ferreira, Joshua P; Peacock, Ryan W S; Lawhorn, Ingrid E B; Wang, Clifford L
2011-12-01
The human cytomegalovirus and elongation factor 1α promoters are constitutive promoters commonly employed by mammalian expression vectors. These promoters generally produce high levels of expression in many types of cells and tissues. To generate a library of synthetic promoters capable of generating a range of low, intermediate, and high expression levels, the TATA and CAAT box elements of these promoters were mutated. Other promoter variants were also generated by random mutagenesis. Evaluation using plasmid vectors integrated at a single site in the genome revealed that these various synthetic promoters were capable of expression levels spanning a 40-fold range. Retroviral vectors were equipped with the synthetic promoters and evaluated for their ability to reproduce the graded expression demonstrated by plasmid integration. A vector with a self-inactivating long terminal repeat could neither reproduce the full range of expression levels nor produce stable expression. Using a second vector design, the different synthetic promoters enabled stable expression over a broad range of expression levels in different cell lines. The online version of this article (doi:10.1007/s11693-011-9089-0) contains supplementary material, which is available to authorized users.
Core Promoter Structure in the Oomycete Phytophthora infestans
McLeod, Adele; Smart, Christine D.; Fry, William E.
2004-01-01
We have investigated the core promoter structure of the oomycete Phytophthora infestans. The transcriptional start sites (TSS) of three previously characterized P. infestans genes, Piexo1, Piexo3, and Piendo1, were determined by primer extension analyses. The TSS regions were homologous to a previously identified 16-nucleotide (nt) core sequence that overlaps the TSS in most oomycete genes. The core promoter regions of Piexo1 and Piendo1 were investigated by using a transient protoplast expression assay and the reporter gene β-glucuronidase. Mutational analyses of the promoters of Piexo1 and Piendo1 showed that there is a putative core promoter element encompassing the TSS (−2 to + 5) that has high sequence and functional homology to a known core promoter element present in other eukaryotes, the initiator element (Inr). Downstream and flanking the Inr is a highly conserved oomycete promoter region (+7 to + 15), hereafter referred to as FPR (flanking promoter region), which is also important for promoter function. The importance of the 19-nt core promoter region (Inr and FPR) in Piexo1 and Piendo1 was further investigated through electrophoretic mobility shift assays (EMSA). The EMSA studies showed that (i) both core promoters were able to specifically bind a protein or protein complex in a P. infestans whole-cell protein extract and (ii) the same mutations that reduced binding of the EMSA complex also reduced β-glucuronidase (GUS) levels in transient expression assays. The consistency of results obtained using two different assays (GUS transient assays [in vivo] and EMSA studies [in vitro]) supports a convergence of inference about the relative importance of specific nucleotides within the 19-nt core promoter region. PMID:14871940
Yu, Ying; Feng, Zhouyan; Cao, Jiayue; Guo, Zheshan; Wang, Zhaoxiang; Hu, Na; Wei, Xuefeng
2016-03-01
Modulation of the rhythmic activity of local field potentials (LFP) in neuronal networks could be a mechanism of deep brain stimulation (DBS). However, exact changes of LFP during the periods of high-frequency stimulation (HFS) of DBS are unclear because of the interference of dense stimulation artifacts with high amplitudes. In the present study, we investigated LFP changes induced by HFS of afferent axons in the hippocampal CA1 region of urethane-anesthetized rats by using a proper algorithm of artifact removal. Afterward, the LFP changes in the frequency bands of [Formula: see text], [Formula: see text], [Formula: see text], [Formula: see text] and [Formula: see text] rhythms were studied by power spectrum analysis and coherence analysis for the recorded signals collected in the pyramidal layer and in the stratum radiatum of CA1 region before, during and after 1-min long 100 and 200[Formula: see text]Hz HFS. Results showed that the power of LFP rhythms in higher-frequency band ([Formula: see text] rhythm) increased in the pyramidal layer and the power of LFP rhythms in lower-frequency bands ([Formula: see text], [Formula: see text] and [Formula: see text] rhythms) decreased in the stratum radiatum during HFS. The synchronization of [Formula: see text] rhythm decreased and the synchronization of [Formula: see text] rhythm increased during HFS in the stratum radiatum. These results suggest that axonal HFS could modulate LFP rhythms in the downstream brain areas with a plausible underlying mechanism of partial axonal blockage induced by HFS. The study provides new evidence to support the mechanism of DBS modulating rhythmic activity of neuronal populations.
Zavarella, S; Petrone, A; Zampetti, S; Gueorguiev, M; Spoletini, M; Mein, C A; Leto, G; Korbonits, M; Buzzetti, R
2008-04-01
Previous studies suggested that polymorphisms in the coding region of the preproghrelin were involved in the etiology of obesity and might modulate glucose-induced insulin secretion. We evaluated the association of a new variation, -604C>T, in the promoter region of the ghrelin gene, of Leu72Met (247C>A) and of Gln90Leu (265A>T), all haplotype-tagging single nucleotide polymorphisms (SNPs), with measures of insulin sensitivity in 1420 adult individuals. The three SNPs were genotyped using ABI PRISM 7900 HT Sequence Detection System. We used multiple linear regression analysis for quantitative traits and THESIAS software for haplotype analysis. We observed a protective effect exerted by Met72 variant of Leu72Met SNP on insulin resistance parameters; a significant decreasing trend from Leu/Leu to Leu/Met and to Met/Met homozygous subjects in triglycerides, fasting insulin levels and HOMA-IR index (P=0.02, 0.01 and 0.003, respectively), and, consistently, an increase in ghrelin levels (P=0.003) was found. A significant decrease from CC to TC and to TT genotypes in insulin levels and HOMA-IR index was also detected (P=0.00l for both), but only in subjects homozygous for Leu72, where the protective effect of Met72 was not present. The haplotype analysis results supported the data obtained by the evaluation of each single SNP, showing the highest value of insulin levels and HOMA-IR index in the -604(c)247(c) haplotype intermediate value in -604(T)247(C) and lowest value in -604(C)247(A). Our observations suggest a protective role of the Met72 variant and of -604 T allele in modulating insulin resistance. These SNPs or an unknown functional variant in linkage disequilibrium could increase ghrelin levels and probably insulin sensitivity.
Directory of Open Access Journals (Sweden)
Debbie Liao
2009-11-01
Full Text Available Local inflammation associated with solid tumors commonly results from factors released by tumor cells and the tumor stroma, and promotes tumor progression. Cancer associated fibroblasts comprise a majority of the cells found in tumor stroma and are appealing targets for cancer therapy. Here, our aim was to determine the efficacy of targeting cancer associated fibroblasts for the treatment of metastatic breast cancer.We demonstrate that cancer associated fibroblasts are key modulators of immune polarization in the tumor microenvironment of a 4T1 murine model of metastatic breast cancer. Elimination of cancer associated fibroblasts in vivo by a DNA vaccine targeted to fibroblast activation protein results in a shift of the immune microenvironment from a Th2 to Th1 polarization. This shift is characterized by increased protein expression of IL-2 and IL-7, suppressed recruitment of tumor-associated macrophages, myeloid derived suppressor cells, T regulatory cells, and decreased tumor angiogenesis and lymphangiogenesis. Additionally, the vaccine improved anti-metastatic effects of doxorubicin chemotherapy and enhanced suppression of IL-6 and IL-4 protein expression while increasing recruitment of dendritic cells and CD8(+ T cells. Treatment with the combination therapy also reduced tumor-associated Vegf, Pdgfc, and GM-CSF mRNA and protein expression.Our findings demonstrate that cancer associated fibroblasts promote tumor growth and metastasis through their role as key modulators of immune polarization in the tumor microenvironment and are valid targets for therapy of metastatic breast cancer.
Liao, Debbie; Luo, Yunping; Markowitz, Dorothy; Xiang, Rong; Reisfeld, Ralph A
2009-11-23
Local inflammation associated with solid tumors commonly results from factors released by tumor cells and the tumor stroma, and promotes tumor progression. Cancer associated fibroblasts comprise a majority of the cells found in tumor stroma and are appealing targets for cancer therapy. Here, our aim was to determine the efficacy of targeting cancer associated fibroblasts for the treatment of metastatic breast cancer. We demonstrate that cancer associated fibroblasts are key modulators of immune polarization in the tumor microenvironment of a 4T1 murine model of metastatic breast cancer. Elimination of cancer associated fibroblasts in vivo by a DNA vaccine targeted to fibroblast activation protein results in a shift of the immune microenvironment from a Th2 to Th1 polarization. This shift is characterized by increased protein expression of IL-2 and IL-7, suppressed recruitment of tumor-associated macrophages, myeloid derived suppressor cells, T regulatory cells, and decreased tumor angiogenesis and lymphangiogenesis. Additionally, the vaccine improved anti-metastatic effects of doxorubicin chemotherapy and enhanced suppression of IL-6 and IL-4 protein expression while increasing recruitment of dendritic cells and CD8(+) T cells. Treatment with the combination therapy also reduced tumor-associated Vegf, Pdgfc, and GM-CSF mRNA and protein expression. Our findings demonstrate that cancer associated fibroblasts promote tumor growth and metastasis through their role as key modulators of immune polarization in the tumor microenvironment and are valid targets for therapy of metastatic breast cancer.
González, O A; Ebersole, J L; Huang, C B
2010-04-01
Bacterial and host cell products during coinfections of Human Immunodeficiency Virus type 1-positive (HIV-1(+)) patients regulate HIV-1 recrudescence in latently infected cells (e.g. T cells, monocytes/macrophages), impacting highly active antiretroviral therapy (HAART) failure and progression of acquired immunodeficiency syndrome. A high frequency of oral opportunistic infections (e.g. periodontitis) in HIV-1(+) patients has been demonstrated; however, their potential to impact HIV-1 exacerbation is unclear. We sought to determine the ability of supernatants derived from oral epithelial cells (OKF4) and human gingival fibroblasts (Gin-4) challenged with periodontal pathogens, to modulate the HIV-1 promoter activation in monocytes/macrophages. BF24 monocytes/macrophages transfected with the HIV-1 promoter driving the expression of chloramphenicol acetyltransferase (CAT) were stimulated with Porphyromonas gingivalis, Fusobacterium nucleatum, or Treponema denticola in the presence of supernatants from OKF4 or Gin4 cells either unstimulated or previously pulsed with bacteria. CAT levels were determined by enzyme-linked immunosorbent assay and cytokine production was evaluated by Luminex beadlyte assays. OKF4 and Gin4 supernatants enhanced HIV-1 promoter activation particularly related to F. nucleatum challenge. An additive effect was observed in HIV-1 promoter activation when monocytes/macrophages were simultaneously stimulated with gingival cell supernatants and bacterial extracts. OKF4 cells produced higher levels of granulocyte-macrophage colony-stimulating factor (GM-CSF) and interleukins -6 and -8 in response to F. nucleatum and P. gingivalis. Preincubation of OKF4 supernatants with anti-GM-CSF reduced the additive effect in periodontopathogen-induced HIV-1 promoter activation. These results suggest that soluble mediators produced by gingival resident cells in response to periodontopathogens could contribute to HIV-1 promoter activation in monocytes
Khan, Hafizurrahman; Singh, Radha Dutt; Tiwari, Ratnakar; Gangopadhyay, Siddhartha; Roy, Somendu Kumar; Singh, Dhirendra; Srivastava, Vikas
2017-07-01
Mercury is one of the major heavy metal pollutants occurring in elemental, inorganic and organic forms. Due to ban on most inorganic mercury containing products, human exposure to mercury generally occurs as methylmercury (MeHg) by consumption of contaminated fish and other sea food. Animal and epidemiological studies indicate that MeHg affects neural and renal function. Our study is focused on nephrotoxic potential of MeHg. In this study, we have shown for the first time how MeHg could epigenetically modulate matrix metalloproteinase 9(MMP9) to promote nephrotoxicity using an animal model of sub chronic MeHg exposure. MeHg caused renal toxicity as was seen by increased levels of serum creatinine and expression of early nephrotoxicity markers (KIM-1, Clusterin, IP-10, and TIMP). MeHg exposure also correlated strongly with induction of MMP9 mRNA and protein in a dose dependent manner. Further, while induction of MMP9 promoted cytoskeleton disruption and loss of cell-cell adhesion (loss of F-actin, Vimentin and Fibronectin), inhibition of MMP9 was found to reduce these disruptions. Mechanistic studies by ChIP analysis showed that MeHg modulated MMP9 by promoting demethylation of its regulatory region to increase its expression. Bisulfite sequencing identified critical CpGs in the first exon of MMP9 which were demethylated following MeHg exposure. ChIP studies also showed loss of methyl binding protein, MeCP2 and transcription factor PEA3 at the demethylated site confirming decreased CpG methylation. Our studies thus show how MeHg could epigenetically modulate MMP9 to promote cytoskeleton disruption leading to loss of renal function. Copyright © 2017 Elsevier B.V. All rights reserved.
Matsutani Sachiko
2004-01-01
Abstract Background In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFII...
Intensity-modulated radiation therapy: overlapping co-axial modulated fields
International Nuclear Information System (INIS)
Metcalfe, P; Tangboonduangjit, P; White, P
2004-01-01
The Varian multi-leaf collimator has a 14.5 cm leaf extension limit from each carriage. This means the target volumes in the head and neck region are sometimes too wide for standard width-modulated fields to provide adequate dose coverage. A solution is to set up asymmetric co-axial overlapping fields. This protects the MLC carriage while in return the MLC provides modulated dose blending in the field overlap region. Planar dose maps for coincident fields from the Pinnacle radiotherapy treatment planning system are compared with planar dose maps reconstructed from radiographic film and electronic portal images. The film and portal images show small leaf-jaw matchlines at each field overlap border. Linear profiles taken across each image show that the observed leaf-jaw matchlines from the accelerator images are not accounted for by the treatment planning system. Dose difference between film reconstructed electronic portal images and planning system are about 2.5 cGy in a modulated field at d max . While the magnitude of the dose differences are small improved round end leaf modelling combined with a finer dose calculation grid may minimize the discrepancy between calculated and delivered dose
Directory of Open Access Journals (Sweden)
Cleidson Nogueira Dias
2014-12-01
Full Text Available This research paper examines the importance of inter-organizational network management as a government policy tool to promote regional development. This pattern requires Federal Government intervention so as to compensate for the imbalance that this causes and to guarantee that economic growth resulting from government actions leads to development in all regions of the country, thereby avoiding the traditional mechanisms of wealth concentration. For this, a methodology of content analysis was used based on a relevant public policy aimed at promoting development within Brazil and by analyzing the data collected in relation to the current theory related to strategy, local development and inter-organizational networks in general. The analysis results show that, when the policy studied in this work, applied in the federal network of professional education, science & technology, was implemented the networks had a positive influence on the outcome of the policy objectives and represented an extremely powerful support tool, being one of the most important factors to boost development.
Photovoltaic Module Reliability Workshop 2010: February 18-19, 2010
Energy Technology Data Exchange (ETDEWEB)
Kurtz, J.
2013-11-01
NREL's Photovoltaic (PV) Module Reliability Workshop (PVMRW) brings together PV reliability experts to share information, leading to the improvement of PV module reliability. Such improvement reduces the cost of solar electricity and promotes investor confidence in the technology--both critical goals for moving PV technologies deeper into the electricity marketplace.
Photovoltaic Module Reliability Workshop 2011: February 16-17, 2011
Energy Technology Data Exchange (ETDEWEB)
Kurtz, S.
2013-11-01
NREL's Photovoltaic (PV) Module Reliability Workshop (PVMRW) brings together PV reliability experts to share information, leading to the improvement of PV module reliability. Such improvement reduces the cost of solar electricity and promotes investor confidence in the technology--both critical goals for moving PV technologies deeper into the electricity marketplace.
Photovoltaic Module Reliability Workshop 2013: February 26-27, 2013
Energy Technology Data Exchange (ETDEWEB)
Kurtz, S.
2013-10-01
NREL's Photovoltaic (PV) Module Reliability Workshop (PVMRW) brings together PV reliability experts to share information, leading to the improvement of PV module reliability. Such improvement reduces the cost of solar electricity and promotes investor confidence in the technology--both critical goals for moving PV technologies deeper into the electricity marketplace.
Photovoltaic Module Reliability Workshop 2014: February 25-26, 2014
Energy Technology Data Exchange (ETDEWEB)
Kurtz, S.
2014-02-01
NREL's Photovoltaic (PV) Module Reliability Workshop (PVMRW) brings together PV reliability experts to share information, leading to the improvement of PV module reliability. Such improvement reduces the cost of solar electricity and promotes investor confidence in the technology--both critical goals for moving PV technologies deeper into the electricity marketplace.
Yang, Mihi; Youn, Je-In; Kim, Seung Joon; Park, Jong Y
2015-11-01
DNA methylation in promoter region can be a new chemopreventive marker against polycyclic aromatic hydrocarbons (PAHs). We performed a randomized, double blind and cross-over trial (N=12 healthy females) to evaluate chlorella (Chlorella vulgaris)-induced epigenetic modulation on exposure to PAHs. The subjects consumed 4 tablets of placebo or chlorella supplement (total chlorophyll ≈ 8.3mg/tablet) three times a day before meals for 2 weeks. When the subjects consumed chlorella, status of global hypermethylation (5-methylcytosine) was reduced, compared to placebo (p=0.04). However, DNA methylation at the DNMT1 or NQO1 was not modified by chlorella. We observed the reduced levels of urinary 1-hydroxypyrene (1-OHP), a typical metabolite of PAHs, by chlorella intake (pchlorella-induced changes in global hypermethylation and urinary 1-OHP (pchlorella works for PAH-detoxification through the epigenetic modulation, the interference of ADME of PAHs and the interaction of mechanisms. Copyright © 2015 Elsevier B.V. All rights reserved.
KIRMES: kernel-based identification of regulatory modules in euchromatic sequences.
Schultheiss, Sebastian J; Busch, Wolfgang; Lohmann, Jan U; Kohlbacher, Oliver; Rätsch, Gunnar
2009-08-15
Understanding transcriptional regulation is one of the main challenges in computational biology. An important problem is the identification of transcription factor (TF) binding sites in promoter regions of potential TF target genes. It is typically approached by position weight matrix-based motif identification algorithms using Gibbs sampling, or heuristics to extend seed oligos. Such algorithms succeed in identifying single, relatively well-conserved binding sites, but tend to fail when it comes to the identification of combinations of several degenerate binding sites, as those often found in cis-regulatory modules. We propose a new algorithm that combines the benefits of existing motif finding with the ones of support vector machines (SVMs) to find degenerate motifs in order to improve the modeling of regulatory modules. In experiments on microarray data from Arabidopsis thaliana, we were able to show that the newly developed strategy significantly improves the recognition of TF targets. The python source code (open source-licensed under GPL), the data for the experiments and a Galaxy-based web service are available at http://www.fml.mpg.de/raetsch/suppl/kirmes/.
Lambertini, Elisabetta; Tavanti, Elisa; Torreggiani, Elena; Penolazzi, Letizia; Gambari, Roberto; Piva, Roberta
2008-07-01
Estrogen-responsive genes often have an estrogen response element (ERE) positioned next to activator protein-1 (AP-1) binding sites. Considering that the interaction between ERE and AP-1 elements has been described for the modulation of bone-specific genes, we investigated the 17-beta-estradiol responsiveness and the role of these cis-elements present in the F promoter of the human estrogen receptor alpha (ERalpha) gene. The F promoter, containing the sequence analyzed here, is one of the multiple promoters of the human ERalpha gene and is the only active promoter in bone tissue. Through electrophoretic mobility shift (EMSA), chromatin immunoprecipitation (ChIP), and re-ChIP assays, we investigated the binding of ERalpha and four members of the AP-1 family (c-Jun, c-fos, Fra-2, and ATF2) to a region located approximately 800 bp upstream of the transcriptional start site of exon F of the human ERalpha gene in SaOS-2 osteoblast-like cells. Reporter gene assay experiments in combination with DNA binding assays demonstrated that F promoter activity is under the control of upstream cis-acting elements which are recognized by specific combinations of ERalpha, c-Jun, c-fos, and ATF2 homo- and heterodimers. Moreover, ChIP and re-ChIP experiments showed that these nuclear factors bind the F promoter in vivo with a simultaneous occupancy stimulated by 17-beta-estradiol. Taken together, our findings support a model in which ERalpha/AP-1 complexes modulate F promoter activity under conditions of 17-beta-estradiol stimulation. (c) 2008 Wiley-Liss, Inc.
International Nuclear Information System (INIS)
Erkhov, V.I.; Kolomeets, E.V.; Likhoded, V.A.; Sevast'yanov, V.N.; Stekol'nikov, N.V.
1981-01-01
The paper presents the results of numerical calculation of galactic cosmic ray modulation by solar wind. Calculations were carried out on the basis of diffusion model taking into account convection and adiabatic loss of particles in interplanetary space. Both isotropic and anisotropic models were used in calculations. Modulation coefficient was calculated using the data on intensity of neutron component of cosmic rays and primary cosmic rays in the stratosphere for the period 1958-1979. The form of modulation function was determined. Obtained results allow to determine the size of modulation region and dependence of solar wind speed and diffusion coefficient on distance
Babichev, A. V.; Karachinsky, L. Ya.; Novikov, I. I.; Gladyshev, A. G.; Mikhailov, S.; Iakovlev, V.; Sirbu, A.; Stepniak, G.; Chorchos, L.; Turkiewicz, J. P.; Agustin, M.; Ledentsov, N. N.; Voropaev, K. O.; Ionov, A. S.; Egorov, A. Yu.
2017-02-01
We report for the first time on wafer-fused InGaAs-InP/AlGaAs-GaAs 1550 nm vertical-cavity surface-emitting lasers (VCSELs) incorporating a InAlGaAs/InP MQW active region with re-grown tunnel junction sandwiched between top and bottom undoped AlGaAs/GaAs distributed Bragg reflectors (DBRs) all grown by molecular beam epitaxy. InP-based active region includes seven compressively strained quantum wells (2.8 nm) optimized to provide high differential gain. Devices with this active region demonstrate lasing threshold current 2 mW in the temperature range of 10-70°C. The wall-plug efficiency (WPE) value-reaches 20 %. Lasing spectra show single mode CW operation with a longitudinal side mode suppression ratio (SMSR) up to 45 dB at > 2 mW output power. Small signal modulation response measurements show a 3-dB modulation bandwidth of 9 GHz at pump current of 10 mA and a D-factor value of 3 GHz/(mA)1/2. Open-eye diagram at 30 Gb/s of standard NRZ is demonstrated. Achieved CW and modulation performance is quite sufficient for fiber to the home (FTTH) applications where very large volumes of low-cost lasers are required.
Cosmic ray modulation and merged interaction regions
International Nuclear Information System (INIS)
Burlaga, L.F.; Goldstein, M.L.; Mcdonald, F.B.
1985-01-01
Beyond several AU, interactions among shocks and streams give rise to merged interaction regions in which the magnetic field is turbulent. The integral intensity of . 75 MeV/Nuc cosmic rays at Voyager is generally observed to decrease when a merged interaction region moves past the spacecraft and to increase during the passage of a rarefaction region. When the separation between interaction regions is relatively large, the cosmic ray intensity tends to increase on a scale of a few months. This was the case at Voyager 1 from July 1, 1983 to May 1, 1984, when the spacecraft moved from 16.7 to 19.6 AU. Changes in cosmic ray intensity were related to the magnetic field strength in a simple way. It is estimated that the diffusion coefficient in merged interaction regions at this distance is similar to 0.6 x 10 to the 22nd power sq cm/s
Directory of Open Access Journals (Sweden)
Joyce Doyle
2016-11-01
achieve change. Conclusion First Peoples’ health promotion in the Goulburn-Murray Rivers region encompasses a broad range of social, cultural, lifestyle and community development activities, including reclaiming and strengthening cultural identity and social connectedness as a response to colonisation.
Yan, Wei; Yun, Yang; Ku, Tingting; Li, Guangke; Sang, Nan
2016-03-01
Air pollution has been reported to be associated with increased risks of cognitive impairment and neurodegenerative diseases. Because NO2 is a typical primary air pollutant and an important contributor to secondary aerosols, NO2-induced neuronal functional abnormalities have attracted greater attention, but the available experimental evidence, modulating mechanisms, and targeting medications remain ambiguous. In this study, we exposed C57BL/6J and APP/PS1 mice to dynamic NO2 inhalation and found for the first time that NO2 inhalation caused deterioration of spatial learning and memory, aggravated amyloid β42 (Aβ42) accumulation, and promoted pathological abnormalities and cognitive defects related to Alzheimer’s disease (AD). The microarray and bioinformation data showed that the cyclooxygenase-2 (COX-2)-mediated arachidonic acid (AA) metabolism of prostaglandin E2 (PGE2) played a key role in modulating this aggravation. Furthermore, increasing endocannabinoid 2-arachidonoylglycerol (2-AG) by inhibiting monoacylglycerol lipase (MAGL) prevented PGE2 production, neuroinflammation-associated Aβ42 accumulation, and neurodegeneration, indicating a therapeutic target for relieving cognitive impairment caused by NO2 exposure.
Gel shift analysis of the empA promoter region in Vibrio anguillarum
Directory of Open Access Journals (Sweden)
Denkin Steven M
2004-10-01
Full Text Available Abstract Background The induction of metalloprotease encoded by empA in Vibrio anguillarum occurs at high cell density in salmon intestinal mucus. Previously we have shown that there are significant differences in empA expression in two strains of V. anguillarum, M93Sm and NB10. It is hypothesized that differences in empA regulation are due to differences in binding of regulatory elements. Results Two strains of V. anguillarum, M93Sm and NB10, were examined and compared for the presence of DNA regulatory proteins that bind to and control the empA promoter region. Gel mobility shift assays, using a digoxigenin (DIG-labeled oligomer containing a lux box-like element and the promoter for empA, were done to demonstrate the presence of a DNA-binding protein. Protein extracts from NB10 cells incubated in Luria Bertani broth + 2% NaCl (LB20, nine salts solution + 200 μg/ml mucus (NSSM, 3M (marine minimal medium, or NSS resulted in a gel mobility shift. No gel mobility shift was seen when protein extracts from either LB20- or NSSM-grown M93Sm cells were mixed with the DIG-labeled empA oligomer. The azocasein assay detected protease activity in all incubation conditions for NB10 culture supernatants. In contrast, protease activity was detected in M93Sm culture supernatants only when incubated in NSSM. Since the luxR homologue in V. anguillarum, vanT, has been cloned, sequenced, and shown to be required for protease activity, we wanted to determine if vanT mutants of NB10 exhibit the same gel shift observed in the wild-type. Site-directed mutagenesis was used to create vanT mutants in V. anguillarum M93Sm and NB10 to test whether VanT is involved with the gel mobility shift. Both vanT mutants, M02 and NB02, did not produce protease activity in any conditions. However, protein extracts from NB02 incubated in each condition still exhibited a gel shift when mixed with the DIG-labeled empA oligomer. Conclusions The data demonstrate that protein extracts of V
Directory of Open Access Journals (Sweden)
J Stephen Dumler
2016-09-01
Full Text Available Anaplasma phagocytophilum, an obligate intracellular prokaryote, infects neutrophils and alters cardinal functions via reprogrammed transcription. Large contiguous regions of neutrophil chromosomes are differentially expressed during infection. Secreted A. phagocytophilum effector AnkA transits into the neutrophil or granulocyte nucleus to complex with DNA in heterochromatin across all chromosomes. AnkA binds to gene promoters to dampen cis-transcription and also has features of matrix attachment region (MAR-binding proteins that regulate three-dimensional chromatin architecture and coordinate transcriptional programs encoded in topologically-associated chromatin domains. We hypothesize that identification of additional AnkA binding sites will better delineate how A. phagocytophilum infection results in reprogramming of the neutrophil genome. Using AnkA-binding ChIP-seq, we showed that AnkA binds broadly throughout all chromosomes in a reproducible pattern, especially at: i intergenic regions predicted to be matrix attachment regions (MARs; ii within predicted lamina-associated domains; and iii at promoters ≤3,000 bp upstream of transcriptional start sites. These findings provide genome-wide support for AnkA as a regulator of cis-gene transcription. Moreover, the dominant mark of AnkA in distal intergenic regions known to be AT-enriched, coupled with frequent enrichment in the nuclear lamina, provides strong support for its role as a MAR-binding protein and genome re-organizer. AnkA must be considered a prime candidate to promote neutrophil reprogramming and subsequent functional changes that belie improved microbial fitness and pathogenicity.
Differential SLC1A2 Promoter Methylation in Bipolar Disorder With or Without Addiction
Directory of Open Access Journals (Sweden)
Yun-Fang Jia
2017-07-01
Full Text Available While downregulation of excitatory amino acid transporter 2 (EAAT2, the main transporter removing glutamate from the synapse, has been recognized in bipolar disorder (BD, the underlying mechanisms of downregulation have not been elucidated. BD is influenced by environmental factors, which may, via epigenetic modulation of gene expression, differentially affect illness presentation. This study thus focused on epigenetic DNA methylation regulation of SLC1A2, encoding for EAAT2, in BD with variable environmental influences of addiction. High resolution melting PCR (HRM-PCR and thymine–adenine (TA cloning with sequence analysis were conducted to examine methylation of the promoter region of the SLC1A2. DNA was isolated from blood samples drawn from BD patients (N = 150 with or without addiction to alcohol, nicotine, or food, defined as binge eating, and matched controls (N = 32. In comparison to controls, the SLC1A2 promoter region was hypermethylated in BD without addiction but was hypomethylated in BD with addiction. After adjusting for age and sex, the association of methylation levels with nicotine addiction (p = 0.0009 and binge eating (p = 0.0002 remained significant. Consistent with HRM-PCR, direct sequencing revealed increased methylation in CpG site 6 in BD, but decreased methylation in three CpG sites (6, 48, 156 in BD with alcohol and nicotine addictions. These results suggest that individual point methylation within the SLC1A2 promoter region may be modified by exogenous addiction and may have a potential for developing clinically valuable epigenetic biomarkers for BD diagnosis and monitoring.
International Nuclear Information System (INIS)
Jain, S.; Gupta, T.; Agarwal, J.P.; Baccher, G.; Shrivastava, S.K.; Reenadevi; Master, J.
2008-01-01
Radiation to larynx has long been associated with speech and voice dysfunction. The objective is to study dosimetric parameters and complication probability of vocal cord region (VCR) and the effect of voice-sparing (VS) in the patients treated with intensity modulated radiotherapy (IMRT). The secondary objective is to describe the post-radiation acoustic voice characteristics and correlate them with the dosimetric parameters. (author)
International Nuclear Information System (INIS)
Sassone-Corsi, P.; Borrelli, E.
1987-01-01
The E1A (early region 1A) oncogene products of adenovirus type 2 trans-activate the other early viral transcription units, as well as some cellular promoters. Using a short-term cotransfection assay in murine NIH 3T3 fibroblasts, we show that c-fos and c-myc promoter activities are stimulated by the E1A proteins, whereas c-Ha-ras transcription is not affected. The product of E1A 13S mRNA is responsible for the trans-activation, whereas the 12S mRNA product has no effect. Analysis of the c-fos promoter sequences required for the E1A stimulation shows that responsive sequences are located between positions -402 and -240 upstream of the transcription initiation site. This same region also contains the c-fos serum-responsive element. Furthermore, transcription of the endogenous c-fos gene in HeLa cells is increased after E1A transfection
Nectarine promotes longevity in Drosophila melanogaster
Aging is associated with increased oxidative damage and gradual decline of physiology function with age, and is modulated by numerous genetic and environmental factors. Functional fruits are thought to be ideal candidates for promoting longevity and healthspan due to their high contents of polypheno...
Ionic modulation of QPX stability as a nano-switch regulating gene expression in neurons
Baghaee Ravari, Soodeh
G-quadruplexes (G-QPX) have been the subject of intense research due to their unique structural configuration and potential applications, particularly their functionality in biological process as a novel type of nano--switch. They have been found in critical regions of the human genome such as telomeres, promoter regions, and untranslated regions of RNA. About 50% of human DNA in promoters has G-rich regions with the potential to form G-QPX structures. A G-QPX might act mechanistically as an ON/OFF switch, regulating gene expression, meaning that the formation of G-QPX in a single strand of DNA disrupts double stranded DNA, prevents the binding of transcription factors (TF) to their recognition sites, resulting in gene down-regulation. Although there are numerous studies on biological roles of G-QPXs in oncogenes, their potential formation in neuronal cells, in particular upstream of transcription start sites, is poorly investigated. The main focus of this research is to identify stable G-QPXs in the 97bp active promoter region of the choline acetyltransferase (ChAT) gene, the terminal enzyme involved in synthesis of the neurotransmitter acetylcholine, and to clarify ionic modulation of G-QPX nanostructures through the mechanism of neural action potentials. Different bioinformatics analyses (in silico), including the QGRS, quadparser and G4-Calculator programs, have been used to predict stable G-QPX in the active promoter region of the human ChAT gene, located 1000bp upstream from the TATA box. The results of computational studies (using those three different algorithms) led to the identification of three consecutive intramolecular G-QPX structures in the negative strand (ChAT G17-2, ChAT G17, and ChAT G29) and one intramolecular G-QPX structure in the positive strand (ChAT G30). Also, the results suggest the possibility that nearby G-runs in opposed DNA strands with a short distance of each other may be able to form a stable intermolecular G-QPX involving two DNA
Designing Customizable Reading Modules for a High School Literature Classroom
Russell, L. Roxanne; Cuevas, Joshua
2014-01-01
This design case follows an ongoing collaboration between an instructional technologist and a high school literature teacher promoting reading comprehension through modules that provide visually interesting display of text on a computer screen along with cognitive tools. The modules were found to boost comprehension of specific content in even one…
Song, Xiaopeng; Zhou, Shuqin; Zhang, Yi; Liu, Yijun; Zhu, Huaiqiu; Gao, Jia-Hong
2015-01-01
The eyes-open (EO) and eyes-closed (EC) states have differential effects on BOLD-fMRI signal dynamics, affecting both the BOLD oscillation frequency of a single voxel and the regional homogeneity (ReHo) of several neighboring voxels. To explore how the two resting-states modulate the local synchrony through different frequency bands, we decomposed the time series of each voxel into several components that fell into distinct frequency bands. The ReHo in each of the bands was calculated and compared between the EO and EC conditions. The cross-voxel correlations between the mean frequency and the overall ReHo of each voxel's original BOLD series in different brain areas were also calculated and compared between the two states. Compared with the EC state, ReHo decreased with EO in a wide frequency band of 0.01-0.25 Hz in the bilateral thalamus, sensorimotor network, and superior temporal gyrus, while ReHo increased significantly in the band of 0-0.01 Hz in the primary visual cortex, and in a higher frequency band of 0.02-0.1 Hz in the higher order visual areas. The cross-voxel correlations between the frequency and overall ReHo were negative in all the brain areas but varied from region to region. These correlations were stronger with EO in the visual network and the default mode network. Our results suggested that different frequency bands of ReHo showed different sensitivity to the modulation of EO-EC states. The better spatial consistency between the frequency and overall ReHo maps indicated that the brain might adopt a stricter frequency-dependent configuration with EO than with EC.
Directory of Open Access Journals (Sweden)
Stephanie E Hesselson
2009-09-01
Full Text Available Membrane transporters play crucial roles in the cellular uptake and efflux of an array of small molecules including nutrients, environmental toxins, and many clinically used drugs. We hypothesized that common genetic variation in the proximal promoter regions of transporter genes contribute to observed variation in drug response. A total of 579 polymorphisms were identified in the proximal promoters (-250 to +50 bp and flanking 5' sequence of 107 transporters in the ATP Binding Cassette (ABC and Solute Carrier (SLC superfamilies in 272 DNA samples from ethnically diverse populations. Many transporter promoters contained multiple common polymorphisms. Using a sliding window analysis, we observed that, on average, nucleotide diversity (pi was lowest at approximately 300 bp upstream of the transcription start site, suggesting that this region may harbor important functional elements. The proximal promoters of transporters that were highly expressed in the liver had greater nucleotide diversity than those that were highly expressed in the kidney consistent with greater negative selective pressure on the promoters of kidney transporters. Twenty-one promoters were evaluated for activity using reporter assays. Greater nucleotide diversity was observed in promoters with strong activity compared to promoters with weak activity, suggesting that weak promoters are under more negative selective pressure than promoters with high activity. Collectively, these results suggest that the proximal promoter region of membrane transporters is rich in variation and that variants in these regions may play a role in interindividual variation in drug disposition and response.
El-Awa, Fatimah M S; El Naga, Randa Abou; Labib, Sahar; Latif, Nisreen Abdel
2018-04-05
Tobacco use and placement of tobacco products in television (TV) productions and movies is a way to promote tobacco use while avoiding tobacco advertising bans that exist in most countries. The fact that such productions are broadcast widely and viewed by millions, including children and young people, is of concern. This paper reviews the evidence on the use of tobacco advertising, promotion and sponsorship (TAPS) in TV and films in the Eastern Mediterranean Region and the ways to combat it. Evidence from Egypt shows considerable and increasing use of tobacco products by actors on screen, including female actors, in programmes aired during Ramadan in 2015-2017. A study of Iranian movies in 2015 showed that tobacco scenes in Iranian movies were increasing. In 2014, the WHO Regional Office for the Eastern Mediterranean held a consultative meeting on TAPS in drama. The consultation recommended regulating the tobacco presence in movies and TV through complete implementation of Article 13 of the WHO FCTC, and raising the issue to the WHO FCTC Conference of the Parties. In 2016, the Conference of the Parties called on parties to consider scaling up the implementation of WHO FCTC Article 13 and monitoring the use of TAPS in entertainment media in accordance with national legislation. A comprehensive approach is essential to end the tobacco industry's use of TV productions and movies to promote their products. Copyright © World Health Organization (WHO) 2018. Some rights reserved. This work is available under the CC BY-NC-SA 3.0 IGO license (https://creativecommons.org/licenses/by-nc-sa/3.0/igo).
Photovoltaic Module Reliability Workshop 2012: February 28 - March 1, 2012
Energy Technology Data Exchange (ETDEWEB)
Kurtz, S.
2013-11-01
NREL's Photovoltaic (PV) Module Reliability Workshop (PVMRW) brings together PV reliability experts to share information, leading to the improvement of PV module reliability. Such improvement reduces the cost of solar electricity and promotes investor confidence in the technology--both critical goals for moving PV technologies deeper into the electricity marketplace.
The head module of Mediator directs activation of preloaded RNAPII in vivo.
Lee, Sarah K; Chen, Xu; Huang, Liangqun; Stargell, Laurie A
2013-12-01
The successful synthesis of a transcript by RNA polymerase II (RNAPII) is a multistage process with distinct rate-limiting steps that can vary depending on the particular gene. A growing number of genes in a variety of organisms are regulated at steps after the recruitment of RNAPII. The best-characterized Saccharomyces cerevisiae gene regulated in this manner is CYC1. This gene has high occupancy of RNAPII under non-inducing conditions, defining it as a poised gene. Here, we find that subunits of the head module of Mediator, Med18 and Med20, and Med19 are required for activation of transcription at the CYC1 promoter in response to environmental cues. These subunits of Mediator are required at the preloaded promoter for normal levels of recruitment and activity of the general transcription factor TFIIH. Strikingly, these Mediator components are dispensable for activation by the same activator at a different gene, which lacks a preloaded polymerase in the promoter region. Based on these results and other studies, we speculate that Mediator plays an essential role in triggering an inactive polymerase at CYC1 into a productively elongating form.
Kaatz, Glenn W.; Thyagarajan, Rama V.; Seo, Susan M.
2005-01-01
NorA is a Staphylococcus aureus multidrug transporter that confers resistance to structurally distinct compounds. The MgrA global regulatory protein is reported to augment norA expression when mgrA is overexpressed from an undefined plasmid-based promoter. Further details about norA regulatory mechanisms are scant. A chromosomal norA::lacZ transcriptional fusion was constructed in different S. aureus strains, and allele replacement was used to define the relevance of promoter region sequences...
Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.
Wyszyńska-Koko, J; Kurył, J
2004-01-01
MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.
Kang, Jung-Ok; Lee, Jee-Boong; Chang, Jun
2016-01-01
Cholera toxin (CT), an exotoxin produced by Vibrio cholera, acts as a mucosal adjuvant. In a previous study, we showed that CT skews differentiation of CD4 T cells to IL-17-producing Th17 cells. Here, we found that intranasal administration of CT induced migration of migratory dendritic cell (DC) populations, CD103+ DCs and CD11bhi DCs, to the lung draining mediastinal lymph nodes (medLN). Among those DC subsets, CD11bhi DCs that were relatively immature had a major role in Th17 cell differentiation after administration of CT. CT-treated BMDCs showed reduced expression of MHC class II and CD86, similar to CD11bhi DCs in medLN, and these BMDCs promoted Th17 cell differentiation more potently than other BMDCs expressing higher levels of MHC class II and CD86. By analyzing the expression of activation markers such as CD25 and CD69, proliferation and IL-2 production, we determined that CT-treated BMDCs showed diminished antigen-presenting potential to CD4+ T cells compared with normal BMDCs. We also found that CT-stimulated BMDCs promote activin A expression as well as IL-6 and IL-1β, and activin A had a synergic role with TGF-β1 in CT-mediated Th17 cell differentiation. Taken together, our results suggest that CT-stimulated DCs promote Th17 cell differentiation by not only modulating antigen-presenting potential but also inducing Th polarizing cytokines.
Martelli, Luisa; Venegoni, Mauro
2013-06-01
Italian Regions and the Italian regulatory agency share a common interest in promoting the appropriateness of drug use, containing drug expenditure and acquiring additional evidence on the effectiveness and safety of drugs. Drug registries can help attaining these objectives. Specifically, the registries implemented in Italy were able to cover the first two objectives, whereas some critical issues were raised on the third one. For instance, the data recorded in the registries are not available at regional level to conduct safety and effectiveness investigations. This is a paradox, when considering that drugs included in the registries have a risk-benefit profile that is only partially defined at the moment of marketing. Currently, researchers and regions can conduct epidemiological research (cohort and case control studies), on the basis of record-linkage procedures, on all drugs prescribed in general practice (which are older drugs with a better defined risk-benefit profile). The expected outcomes of registries should be more clearly defined: when the main aim is to promote appropriateness, the recording of only a very limited amount of data should be required (to avoid a bureaucratic burden on clinicians).The Italian centers of the ENCePP network might play an important role in planning and conducting drug registries: through the presence in the steering committees of the registries, and in conducting epidemiological studies that make the most of this powerful instrument.
International Nuclear Information System (INIS)
Abe, Hajime; Ogawa, Takashi; Wang, Liyun; Kimura, Masayuki; Tanaka, Takeshi; Morita, Reiko; Yoshida, Toshinori; Shibutani, Makoto
2014-01-01
Thioacetamide (TAA) has been used to develop a rodent model for hepatocarcinogenesis. To determine the genes with epigenetic modifications in early hepatocarcinogenesis, we did a genome-wide scan for hypermethylated promoter regions using CpG island microarrays in TAA-promoted rat liver tissue. Eight genes were selected based on the microarray profile; of these, Yy1 and Wdr45b were confirmed to be hypermethylated by methylation-specific polymerase chain reaction (PCR) and pyrosequencing and downregulated by real-time reverse transcription PCR. Non-neoplastic liver cells had nuclear Yy1 immunoreactivity, while preneoplastic foci with glutathione S-transferase placental form (GST-P) immunoreactivity had decreased Yy1 immunoreactivity. The incidence of these foci was proportional to the dose of TAA administered. Co-expression analysis of gene products downstream of Yy1 revealed increased nuclear phospho-c-Myc + foci as well as nuclear and cytoplasmic p21 Cip1+ foci in Yy1 − or GST-P + foci in response to TAA-promotion dose. Although the absolute number of cells was low, the incidence of death receptor 5 − foci was increased in Yy1 − foci in proportion to the TAA dose. Yy1 − /GST-P + foci revealed a higher number of proliferating cell nuclear antigen (PCNA)-immunoreactive cells than Yy1 + /GST-P + foci, while cleaved caspase-3 + cells were unchanged between Yy1 – /GST-P + and Yy1 + /GST-P + foci. In the case of Wdr45b, most GST-P + foci were Wdr45b – and were not increased by TAA promotion. These results suggest involvement of Yy1 in the epigenetic gene regulation at the early stages of TAA promoted cell proliferation and concomitant cell cycle arrest in preneoplastic lesions. - Highlights: • Epigenetically downregulated genes were searched in TAA-promnoted rat livers. • Yy1 and Wdr45b showed promoter-region hypermethylation and mRNA downregulation. • TAA promoted increase of preneoplastic Yy1 – /GST-P + foci showing high proliferation. • TAA
The Disordered C-Terminus of Yeast Hsf1 Contains a Cryptic Low-Complexity Amyloidogenic Region
Directory of Open Access Journals (Sweden)
Jordi Pujols
2018-05-01
Full Text Available Response mechanisms to external stress rely on networks of proteins able to activate specific signaling pathways to ensure the maintenance of cell proteostasis. Many of the proteins mediating this kind of response contain intrinsically disordered regions, which lack a defined structure, but still are able to interact with a wide range of clients that modulate the protein function. Some of these interactions are mediated by specific short sequences embedded in the longer disordered regions. Because the physicochemical properties that promote functional and abnormal interactions are similar, it has been shown that, in globular proteins, aggregation-prone and binding regions tend to overlap. It could be that the same principle applies for disordered protein regions. In this context, we show here that a predicted low-complexity interacting region in the disordered C-terminus of the stress response master regulator heat shock factor 1 (Hsf1 protein corresponds to a cryptic amyloid region able to self-assemble into fibrillary structures resembling those found in neurodegenerative disorders.
The Disordered C-Terminus of Yeast Hsf1 Contains a Cryptic Low-Complexity Amyloidogenic Region.
Pujols, Jordi; Santos, Jaime; Pallarès, Irantzu; Ventura, Salvador
2018-05-06
Response mechanisms to external stress rely on networks of proteins able to activate specific signaling pathways to ensure the maintenance of cell proteostasis. Many of the proteins mediating this kind of response contain intrinsically disordered regions, which lack a defined structure, but still are able to interact with a wide range of clients that modulate the protein function. Some of these interactions are mediated by specific short sequences embedded in the longer disordered regions. Because the physicochemical properties that promote functional and abnormal interactions are similar, it has been shown that, in globular proteins, aggregation-prone and binding regions tend to overlap. It could be that the same principle applies for disordered protein regions. In this context, we show here that a predicted low-complexity interacting region in the disordered C-terminus of the stress response master regulator heat shock factor 1 (Hsf1) protein corresponds to a cryptic amyloid region able to self-assemble into fibrillary structures resembling those found in neurodegenerative disorders.
International Nuclear Information System (INIS)
Gillen, V.A.
1990-09-01
The Regional Co-operative Arrangement for the Promotion of Nuclear Science and Technology in Latin America, ARCAL, has completed its first five-year phase (1985-1989). This booklet summarizes the first phase of the ARCAL programme and contains descriptions of projects in the fields of agriculture, medicine, industry and energy
Shang, Qingsen; Wang, Ya; Pan, Lin; Niu, Qingfeng; Li, Chao; Jiang, Hao; Cai, Chao; Hao, Jiejie; Li, Guoyun; Yu, Guangli
2018-05-17
Recently, accumulating evidence has suggested that Enteromorpha clathrata polysaccharide (ECP) could contribute to the treatment of diseases. However, as a promising candidate for marine drug development, although ECP has been extensively studied, less consideration has been given to exploring its effect on gut microbiota. In this light, given the critical role of gut microbiota in health and disease, we investigated here the effect of ECP on gut microbiota using 16S rRNA high-throughput sequencing. As revealed by bioinformatic analyses, ECP considerably changed the structure of the gut microbiota and significantly promoted the growth of probiotic bacteria in C57BL/6J mice. However, interestingly, ECP exerted different effects on male and female microbiota. In females, ECP increased the abundances of Bifidobacterium spp. and Akkermansia muciniphila , a next-generation probiotic bacterium, whereas in males, ECP increased the population of Lactobacillus spp. Moreover, by shaping a more balanced structure of the microbiota, ECP remarkably reduced the antigen load from the gut in females. Altogether, our study demonstrates for the first time a prebiotic effect of ECP on gut microbiota and forms the basis for the development of ECP as a novel gut microbiota modulator for health promotion and disease management.
Different regions of the newcastle disease virus fusion protein modulate pathogenicity.
Directory of Open Access Journals (Sweden)
Sandra Heiden
Full Text Available Newcastle disease virus (NDV, also designated as Avian paramyxovirus type 1 (APMV-1, is the causative agent of a notifiable disease of poultry but it exhibits different pathogenicity dependent on the virus strain. The molecular basis for this variability is not fully understood. The efficiency of activation of the fusion protein (F is determined by presence or absence of a polybasic amino acid sequence at an internal proteolytic cleavage site which is a major determinant of NDV virulence. However, other determinants of pathogenicity must exist since APMV-1 of high (velogenic, intermediate (mesogenic and low (lentogenic virulence specify a polybasic F cleavage site. We aimed at elucidation of additional virulence determinants by constructing a recombinant virus that consists of a lentogenic NDV Clone 30 backbone and the F protein gene from a mesogenic pigeon paramyxovirus-1 (PPMV-1 isolate with an intracerebral pathogenicity index (ICPI of 1.1 specifying the polybasic sequence R-R-K-K-R*F motif at the cleavage site. The resulting virus was characterized by an ICPI of 0.6, indicating a lentogenic pathotype. In contrast, alteration of the cleavage site G-R-Q-G-R*L of the lentogenic Clone 30 to R-R-K-K-R*F resulted in a recombinant virus with an ICPI of 1.36 which was higher than that of parental PPMV-1. Substitution of different regions of the F protein of Clone 30 by those of PPMV-1, while maintaining the polybasic amino acid sequence at the F cleavage site, resulted in recombinant viruses with ICPIs ranging from 0.59 to 1.36 suggesting that virulence is modulated by regions of the F protein other than the polybasic cleavage site.
J.A.J.B.M. Maas (Janneke); D.O. Mook-Kanamori (Dennis); L. Ay (Lamise); R.P.M. Steegers-Theunissen (Régine); P. Tikka-Kleemola (Päivi); A. Hofman (Albert); A.C.S. Hokken-Koelega (Anita); V.W.V. Jaddoe (Vincent)
2010-01-01
textabstractObjective: The objective of this study was to examine the associations between insulin gene variable number of tandem repeats (INS VNTR) and insulin-like growth factor 1 (IGF1) gene promoter region polymorphisms with body composition in early childhood. Methods: This study was embedded
The ATPases of cohesin interface with regulators to modulate cohesin-mediated DNA tethering
Çamdere, Gamze; Guacci, Vincent; Stricklin, Jeremiah; Koshland, Douglas
2015-01-01
Cohesin tethers together regions of DNA, thereby mediating higher order chromatin organization that is critical for sister chromatid cohesion, DNA repair and transcriptional regulation. Cohesin contains a heterodimeric ATP-binding Cassette (ABC) ATPase comprised of Smc1 and Smc3 ATPase active sites. These ATPases are required for cohesin to bind DNA. Cohesin’s DNA binding activity is also promoted by the Eco1 acetyltransferase and inhibited by Wpl1. Recently we showed that after cohesin stably binds DNA, a second step is required for DNA tethering. This second step is also controlled by Eco1 acetylation. Here, we use genetic and biochemical analyses to show that this second DNA tethering step is regulated by cohesin ATPase. Furthermore, our results also suggest that Eco1 promotes cohesion by modulating the ATPase cycle of DNA-bound cohesin in a state that is permissive for DNA tethering and refractory to Wpl1 inhibition. DOI: http://dx.doi.org/10.7554/eLife.11315.001 PMID:26583750
Energy Technology Data Exchange (ETDEWEB)
Rasi, S.; Havukainen, J.; Uusitalo, V.; Andersson, R.; Manninen, K.; Aro-Heinilae, E.; Rintala, J.
2012-11-01
The main objective of the project was to promote biogas production and its use as transport fuel. The aims in the four Finnish and two Estonian case areas were to reduce the amount and improve the sustainable use of waste and sludge, to promote biogas production, to start biogas use as transport fuel and to provide tools for implementing the aims. The total biomethane potential in the Helsinki region corresponds to approximately 450 GWh/a. The most potential user for biomethane is public transport. The total amount of biomethane would suffice for 80% of the busses operating in the Helsinki region. Using biogas as a transport fuel instead of energy production in the Helsinki region would result in emission reductions (13 000 t{sub CO2,eq}/a). However if the fuel replacing biogas in energy production would be renewable, the emission reductions would be significantly greater. The economical assessment indicates that the production of biogas is economically feasible if all the produced gas can be sold. Biogas produced near the natural gas grid can also be transported to the Helsinki region where there are better possibilities to find uses for it. In this way, for example, gas that is produced in Kymenlaakso but is not consumed there can be transported via the natural gas grid, assuming that the production plant is reasonably close to the grid. (orig.)
Xavier, Mariana N.; Winter, Maria G.; Spees, Alanna M.; Nguyen, Kim; Atluri, Vidya L.; Silva, Teane M. A.; Bäumler, Andreas J.; Müller, Werner; Santos, Renato L.; Tsolis, Renée M.
2013-01-01
Evasion of host immune responses is a prerequisite for chronic bacterial diseases; however, the underlying mechanisms are not fully understood. Here, we show that the persistent intracellular pathogen Brucella abortus prevents immune activation of macrophages by inducing CD4+CD25+ T cells to produce the anti-inflammatory cytokine interleukin-10 (IL-10) early during infection. IL-10 receptor (IL-10R) blockage in macrophages resulted in significantly higher NF-kB activation as well as decreased bacterial intracellular survival associated with an inability of B. abortus to escape the late endosome compartment in vitro. Moreover, either a lack of IL-10 production by T cells or a lack of macrophage responsiveness to this cytokine resulted in an increased ability of mice to control B. abortus infection, while inducing elevated production of pro-inflammatory cytokines, which led to severe pathology in liver and spleen of infected mice. Collectively, our results suggest that early IL-10 production by CD25+CD4+ T cells modulates macrophage function and contributes to an initial balance between pro-inflammatory and anti-inflammatory cytokines that is beneficial to the pathogen, thereby promoting enhanced bacterial survival and persistent infection. PMID:23818855
International Nuclear Information System (INIS)
Dogan, Nesrin; Leybovich, Leonid B.; Sethi, Anil; Emami, Bahman
2002-01-01
In recent years, intensity modulated radiation therapy (IMRT) is used to radiate tumors that are in close proximity to vital organs. Targets consisting of a deep-seated region followed by a superficial one may be treated with abutting photon and electron fields. However, no systematic study regarding matching of IMRT and electron beams was reported. In this work, a study of dose distributions in the abutment region between tomographic and step-and-shoot IMRT and electron fields was carried out. A method that significantly improves dose homogeneity between abutting tomographic IMRT and electron fields was developed and tested. In this method, a target region that is covered by IMRT was extended into the superficial target area by ∼2.0 cm. The length and shape of IMRT target extension was chosen such that high isodose lines bent away from the region treated by the electrons. This reduced the magnitude of hot spots caused by the 'bulging effect' of electron field penumbra. To account for the uncertainties in positioning of the IMRT and electron fields, electron field penumbra was modified using conventional (photon) multileaf collimator (MLC). The electron beam was delivered in two steps: half of the dose delivered with MLCs in retracted position and another half with MLCs extended to the edge of electron field that abuts tomographic IMRT field. The experimental testing of this method using film dosimetry has demonstrated that the magnitude of the hot spots was reduced from ∼45% to ∼5% of the prescription dose. When an error of ±1.5 mm in field positioning was introduced, the dose inhomogeneity in the abutment region did not exceed ±15% of the prescription dose. With step-and-shoot IMRT, the most homogeneous dose distribution was achieved when there was a 3 mm gap between the IMRT and electron fields
Curcumin and Turmeric Modulate the Tumor-Promoting Effects of Iron In Vitro.
Messner, Donald J; Robinson, Todd; Kowdley, Kris V
2017-04-01
Free or loosely chelated iron has tumor-promoting properties in vitro. Curcumin, a polyphenol derived from the food spice turmeric (Curcuma longa), is a potent antioxidant that binds iron. The primary aim of this study was to investigate whether curcuminoids prevent tumor-promoting effects of iron in T51B cells, a non-neoplastic rat liver epithelial cell line. Purified curcuminoids (curcumin) or a standardized turmeric extract similarly reduced oxidative stress and cytotoxicity associated with iron overload (IC 50 values near 10 μM, P turmeric for 16 wk in culture; subsequently assayed by soft agar colony formation) was nearly complete at 20 μM of total curcuminoids (P turmeric extract were taken up better by cells, had a longer half-life, and appeared more effective in blocking tumor promotion (P < 0.01), suggesting enhanced curcuminoid delivery to cells in culture. The primary finding that curcuminoids can inhibit tumor promotion caused by iron in T51B cells is tempered by evidence for an underlying increase in neoplastic transformation at lower concentrations.
Directory of Open Access Journals (Sweden)
Isaacs Richard J
2007-05-01
Full Text Available Abstract Background Topoisomerase IIα has been shown to be down-regulated in doxorubicin-resistant cell lines. The specificity proteins Sp1 and Sp3 have been implicated in regulation of topoisomerase IIα transcription, although the mechanism by which they regulate expression is not fully understood. Sp1 has been shown to bind specifically to both proximal and distal GC elements of the human topoisomerase IIα promoter in vitro, while Sp3 binds only to the distal GC element unless additional flanking sequences are included. While Sp1 is thought to be an activator of human topoisomerase IIα, the functional significance of Sp3 binding is not known. Therefore, we sought to determine the functional relationship between Sp1 and Sp3 binding to the topoisomerase IIα promoter in vivo. We investigated endogenous levels of Sp1, Sp3 and topoisomerase IIα as well as binding of both Sp1 and Sp3 to the GC boxes of the topoisomerase IIα promoter in breast cancer cell lines in vivo after short term doxorubicin exposure. Results Functional effects of Sp1 and Sp3 were studied using transient cotransfection assays using a topoisomerase IIα promoter reporter construct. The in vivo interactions of Sp1 and Sp3 with the GC elements of the topoisomerase IIα promoter were studied in doxorubicin-treated breast cancer cell lines using chromatin immunoprecipitation assays. Relative amounts of endogenous proteins were measured using immunoblotting. In vivo DNA looping mediated by proteins bound at the GC1 and GC2 elements was studied using the chromatin conformation capture assay. Both Sp1 and Sp3 bound to the GC1 and GC2 regions. Sp1 and Sp3 were transcriptional activators and repressors respectively, with Sp3 repression being dominant over Sp1-mediated activation. The GC1 and GC2 elements are linked in vivo to form a loop, thus bringing distal regulatory elements and their cognate transcription factors into close proximity with the transcription start site
Promoters of Escherichia coli versus promoter islands: function and structure comparison.
Directory of Open Access Journals (Sweden)
Valeriy V Panyukov
Full Text Available Expression of bacterial genes takes place under the control of RNA polymerase with exchangeable σ-subunits and multiple transcription factors. A typical promoter region contains one or several overlapping promoters. In the latter case promoters have the same or different σ-specificity and are often subjected to different regulatory stimuli. Genes, transcribed from multiple promoters, have on average higher expression levels. However, recently in the genome of Escherichia coli we found 78 regions with an extremely large number of potential transcription start points (promoter islands, PIs. It was shown that all PIs interact with RNA polymerase in vivo and are able to form transcriptionally competent open complexes both in vitro and in vivo but their transcriptional activity measured by oligonucleotide microarrays was very low, if any. Here we confirmed transcriptional defectiveness of PIs by analyzing the 5'-end specific RNA-seq data, but showed their ability to produce short oligos (9-14 bases. This combination of functional properties indicated a deliberate suppression of transcriptional activity within PIs. According to our data this suppression may be due to a specific conformation of the DNA double helix, which provides an ideal platform for interaction with both RNA polymerase and the histone-like nucleoid protein H-NS. The genomic DNA of E.coli contains therefore several dozen sites optimized by evolution for staying in a heterochromatin-like state. Since almost all promoter islands are associated with horizontally acquired genes, we offer them as specific components of bacterial evolution involved in acquisition of foreign genetic material by turning off the expression of toxic or useless aliens or by providing optimal promoter for beneficial genes. The putative molecular mechanism underlying the appearance of promoter islands within recipient genomes is discussed.
Biphasic Estradiol-induced AKT Phosphorylation Is Modulated by PTEN via MAP Kinase in HepG2 Cells
Marino, Maria; Acconcia, Filippo; Trentalance, Anna
2003-01-01
We reported previously in HepG2 cells that estradiol induces cell cycle progression throughout the G1–S transition by the parallel stimulation of both PKC-α and ERK signaling molecules. The analysis of the cyclin D1 gene expression showed that only the MAP kinase pathway was involved. Here, the presence of rapid/nongenomic, estradiol-regulated, PI3K/AKT signal transduction pathway, its modulation by the levels of the tumor suppressor PTEN, its cross-talk with the ERK pathway, and its involvement in DNA synthesis and cyclin D1 gene promoter activity have all been studied in HepG2 cells. 17β-Estradiol induced the rapid and biphasic phosphorylation of AKT. These phosphorylations were independent of each other, being the first wave of activation independent of the estrogen receptor (ER), whereas the second was dependent on ER. Both activations were dependent on PI3K activity; furthermore, the ERK pathway modulated AKT phosphorylation by acting on the PTEN levels. The results showed that the PI3K pathway, as well as ER, were strongly involved in both G1–S progression and cyclin D1 promoter activity by acting on its proximal region (-254 base pairs). These data indicate that in HepG2 cells, different rapid/nongenomic estradiol-induced signal transduction pathways modulate the multiple steps of G1–S phase transition. PMID:12808053
Directory of Open Access Journals (Sweden)
Jayashree Dolpady
2016-01-01
Full Text Available The gut microbiota modulates the autoimmune pathogenesis of type 1 diabetes (T1D via mechanisms that remain largely unknown. The inflammasome components are innate immune sensors that are highly influenced by the gut environment and play pivotal roles in maintaining intestinal immune homeostasis. In this study we show that modifications of the gut microbiota induced by oral treatment with Lactobacillaceae-enriched probiotic VSL#3, alone or in combination with retinoic acid (RA, protect NOD mice from T1D by affecting inflammasome at the intestinal level. In particular, we show that VSL#3 treatment inhibits IL-1β expression while enhancing release of protolerogenic components of the inflammasome, such as indoleamine 2,3-dioxygenase (IDO and IL-33. Those modifications of the intestinal microenvironment in VSL#3-treated NOD mice modulate gut immunity by promoting differentiation of tolerogenic CD103+ DCs and reducing differentiation/expansion of Th1 and Th17 cells in the intestinal mucosa and at the sites of autoimmunity, that is, within the pancreatic lymph nodes (PLN of VSL#3-treated NOD mice. Our data provide a link between dietary factors, microbiota composition, intestinal inflammation, and immune homeostasis in autoimmune diabetes and could pave the way for new therapeutic approaches aimed at changing the intestinal microenvironment with probiotics to counterregulate autoimmunity and prevent T1D.
International Nuclear Information System (INIS)
Papadakis, Antonios E.; Perisinakis, Kostas; Damilakis, John
2014-01-01
To study the effect of patient size, body region and modulation strength on tube current and image quality on CT examinations that use automatic tube current modulation (ATCM). Ten physical anthropomorphic phantoms that simulate an individual as neonate, 1-, 5-, 10-year-old and adult at various body habitus were employed. CT acquisition of head, neck, thorax and abdomen/pelvis was performed with ATCM activated at weak, average and strong modulation strength. The mean modulated mAs (mAs mod ) values were recorded. Image noise was measured at selected anatomical sites. The mAs mod recorded for neonate compared to 10-year-old increased by 30 %, 14 %, 6 % and 53 % for head, neck, thorax and abdomen/pelvis, respectively, (P mod was lower than the preselected mAs with the exception of the 10-year-old phantom. In paediatric and adult phantoms, the mAs mod ranged from 44 and 53 for weak to 117 and 93 for strong modulation strength, respectively. At the same exposure parameters image noise increased with body size (P < 0.05). The ATCM system studied here may affect dose differently for different patient habitus. Dose may decrease for overweight adults but increase for children older than 5 years old. Care should be taken when implementing ATCM protocols to ensure that image quality is maintained. circle ATCM efficiency is related to the size of the patient's body. (orig.)
Wang, Zhaoyue; Jiang, Mingyue; Guo, Xuena; Liu, Zhaozheng; He, Xiuping
2018-04-11
2-phenylethanol (2-PE) is an important aromatic compound with a lovely rose-like scent. Saccharomyces cerevisiae is a desirable microbe for 2-PE production but its natural yield is not high, and one or two crucial genes' over-expression in S. cerevisiae did not improve 2-PE greatly. A new metabolic module was established here, in which, permease Gap1p for L-phenylalanine transportation, catalytic enzymes Aro8p, Aro10p and Adh2p in Ehrlich pathway respectively responsible for transamination, decarboxylation and reduction were assembled, besides, glutamate dehydrogenase Gdh2p was harbored for re-supplying another substrate 2-oxoglutarate, relieving product glutamate repression and regenerating cofactor NADH. Due to different promoter strengths, GAP1, ARO8, ARO9, ARO10, ADH2 and GDH2 in the new modularized YS58(G1-A8-A10-A2)-GDH strain enhanced 11.6-, 15.4-, 3.6-, 17.7-, 12.4- and 7.5-folds respectively, and crucial enzyme activities of aromatic aminotransferases and phenylpyruvate decarboxylase were 4.8- and 7-folds respectively higher than that of the control. Under the optimum medium and cell density, YS58(G1-A8-A10-A2)-GDH presented efficient 2-PE synthesis ability with ~ 6.3 g L -1 of 2-PE titer in 5-L fermenter reaching 95% of conversation ratio. Under fed-batch fermentation, 2-PE productivity at 24 h increased 29% than that of single-batch fermentation. Metabolic modularization with promoter strategy provides a new prospective for efficient 2-PE production.
Deletion analysis of susy-sl promoter for the identification of optimal promoter sequence
International Nuclear Information System (INIS)
Bacha, S.; Khatoon, A.; Asif, M.; Bshir, A.
2015-01-01
The promoter region of sucrose synthase (susy-Sl) was identified and isolated from tomato. The 5? deletion analysis was carried out for the identification of minimum optimal promoter. Transgenic lines of Arabidopsis thaliana were developed by floral dip method incorporating various promoter deletion cassettes controlling GUS reporter gene. GUS assay of transgenic tissues indicated that full length susy-Sl promoter and its deletion mutants were constitutively expressed in vegetative and floral tissues of A. thaliana. The expression was observed in roots, shoots and flowers of A. thaliana. Analysis of 5? deletion series of susy-Sl promoter showed that a minimum of 679 bp fragment of the promoter was sufficient to drive expression of GUS reporter gene in the major tissues of transgenic A. thaliana. (author)
Promoting regional energy co-operation in South Asia
International Nuclear Information System (INIS)
Srivastava, Leena; Misra, Neha
2007-01-01
Energy is a key ingredient of the socio-economic development of any region. South Asia is not only one of the fastest growing regions in the world; it is also one of the poorest, which thus puts energy at the very heart of the development process in the region. This paper looks at the challenges faced by the South Asia sub-region for economic co-operation (SASEC) comprised of Bangladesh, Bhutan, India and Nepal, and also at the role of greater regional energy co-operation therein. The region is characterized by pressures of growing economies and increasing population. While the per capita energy consumption is one of the lowest in the world, energy intensity continues to be very high. A large portion of the population lacks access to modern sources of energy and depends on traditional sources that are not only inefficient but also have severe health and environmental problems associated with them. Increasing oil import dependency and huge investment needs for energy market development pose a further challenge. The region has a good resource potential and tremendous scope for energy co-operation, which can play a key role in addressing many of these energy security concerns and in putting it on the path of sustainable development. It is ironic that the record in the area has been so limited and that too in the most basic form of co-operation, i.e. bilateral arrangements between countries. This paper puts forth a multi-pronged strategy for sub-regional energy co-operation encompassing softer options aimed at confidence building to more substantial and larger scale co-operation efforts. Delays in decision making to ensure stronger and mutually beneficial co-operation efforts are associated with high costs not only to the energy sector but also for the entire development agenda. With the precarious energy situation in the region and unprecedented increases in international oil prices seen in recent times, it is high time for policy makers, financing institutions, NGOs
Objects but not concepts modulate the size of the attended region.
Goodhew, Stephanie C; Edwards, Mark
2017-07-01
Here we investigated the types of stimuli that modulate the size of the attentional spotlight. In particular, it has been previously shown that conceptual cues that either directly refer to or are semantically related to particular spatial locations can shift attention to that location (known as "conceptual cueing"). For example, reading the word sun or joy can shift attention upward whereas the word boot or hostile can shift attention downward. Here, therefore, we tested whether words could modulate the size of the attended area. Across five experiments, we found that words that either directly referred to, or were abstractly associated with, particular sizes (small versus large) did not change the size of the attentional spotlight, whereas the presence of differently sized stimuli did, as evidenced by faster responses to targets when the spotlight is small than when it is large. This suggests that physical but not conceptual inducers can modulate the size of the attentional spotlight. This highlights an important difference between the regulation of spotlight size and shifts of attention, supporting the notion that they are subserved by distinct mechanisms.
Decoding task-based attentional modulation during face categorization.
Chiu, Yu-Chin; Esterman, Michael; Han, Yuefeng; Rosen, Heather; Yantis, Steven
2011-05-01
Attention is a neurocognitive mechanism that selects task-relevant sensory or mnemonic information to achieve current behavioral goals. Attentional modulation of cortical activity has been observed when attention is directed to specific locations, features, or objects. However, little is known about how high-level categorization task set modulates perceptual representations. In the current study, observers categorized faces by gender (male vs. female) or race (Asian vs. White). Each face was perceptually ambiguous in both dimensions, such that categorization of one dimension demanded selective attention to task-relevant information within the face. We used multivoxel pattern classification to show that task-specific modulations evoke reliably distinct spatial patterns of activity within three face-selective cortical regions (right fusiform face area and bilateral occipital face areas). This result suggests that patterns of activity in these regions reflect not only stimulus-specific (i.e., faces vs. houses) responses but also task-specific (i.e., race vs. gender) attentional modulation. Furthermore, exploratory whole-brain multivoxel pattern classification (using a searchlight procedure) revealed a network of dorsal fronto-parietal regions (left middle frontal gyrus and left inferior and superior parietal lobule) that also exhibit distinct patterns for the two task sets, suggesting that these regions may represent abstract goals during high-level categorization tasks.
Modulation of hepatic stellate cells and reversibility of hepatic fibrosis
Energy Technology Data Exchange (ETDEWEB)
Huang, Yu, E-mail: 1293363632@QQ.com [Faculty of Graduate Studies of Guangxi University of Chinese Medicine, Nanning 530001, Guangxi Zhuang Autonomous Region (China); Deng, Xin, E-mail: Hendly@163.com [Ruikang Hospital Affiliated to Guangxi University of Chinese Medicine, 10 East China Road, Nanning 530011, Guangxi Zhuang Autonomous Region (China); Liang, Jian, E-mail: lj99669@163.com [Guangxi University of Chinese Medicine, Nanning 530001, Guangxi Zhuang Autonomous Region (China)
2017-03-15
Hepatic fibrosis (HF) is the pathological component of a variety of chronic liver diseases. Hepatic stellate cells (HSC) are the main collagen-producing cells in the liver and their activation promotes HF. If HSC activation and proliferation can be inhibited, HF occurrence and development can theoretically be reduced and even reversed. Over the past ten years, a number of studies have addressed this process, and here we present a review of HSC modulation and HF reversal. - Highlights: • We present a review of the modulation of hepatic stellate cells (HSC) and reversibility of hepatic fibrosis (HF). • HSC are the foci of HF occurrence and development, HF could be prevented and treated by modulating HSC. • If HSC activation and proliferation can be inhibited, HF could theoretically be inhibited and even reversed. • Prevention or reversal of HSC activation, or promotion of HSC apoptosis, immune elimination, and senescence may prevent, inhibit or reverse HF.
Zhou, Fei; Sun, Tian-Hu; Zhao, Lei; Pan, Xi-Wu; Lu, Shan
2015-01-01
The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site) which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA), we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS) transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD) and constant dark (DD) conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC) driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.
Modulation of the mesolimbic dopamine system by leptin.
Opland, Darren M; Leinninger, Gina M; Myers, Martin G
2010-09-02
Nutritional status modulates many forms of reward-seeking behavior, with caloric restriction increasing the drive for drugs of abuse as well as for food. Understanding the interactions between the mesolimbic dopamine (DA) system (which mediates the incentive salience of natural and artificial rewards) and the neural and hormonal systems that sense and regulate energy balance is thus of significant importance. Leptin, which is produced by adipocytes in proportion to fat content as a hormonal signal of long-term energy stores, acts via its receptor (LepRb) on multiple populations of central nervous system neurons to modulate neural circuits in response to body energy stores. Leptin suppresses feeding and plays a central role in the control of energy balance. In addition to demonstrating that leptin modulates hypothalamic and brainstem circuits to promote satiety, recent work has begun to explore the mechanisms by which leptin influences the mesolimbic DA system and related behaviors. Indeed, leptin diminishes several measures of drug and food reward, and promotes a complex set of changes in the mesolimbic DA system. While many of the details remain to be worked out, several lines of evidence suggest that leptin regulates the mesolimbic DA system via multiple neural pathways and processes, and that distinct sets of LepRb neurons each modulate unique aspects of the mesolimbic DA system and behavior in response to leptin. 2010 Elsevier B.V. All rights reserved.
Palytoxin: exploiting a novel skin tumor promoter to explore signal transduction and carcinogenesis.
Wattenberg, Elizabeth V
2007-01-01
Palytoxin is a novel skin tumor promoter, which has been used to help probe the role of different types of signaling mechanisms in carcinogenesis. The multistage mouse skin model indicates that tumor promotion is an early, prolonged, and reversible phase of carcinogenesis. Understanding the molecular mechanisms underlying tumor promotion is therefore important for developing strategies to prevent and treat cancer. Naturally occurring tumor promoters that bind to specific cellular receptors have proven to be useful tools for investigating important biochemical events in multistage carcinogenesis. For example, the identification of protein kinase C as the receptor for the prototypical skin tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA) (also called phorbol 12-myristate 13-acetate, PMA) provided key evidence that tumor promotion involves the aberrant modulation of signaling cascades that govern cell fate and function. The subsequent discovery that palytoxin, a marine toxin isolated from zoanthids (genus Palythoa), is a potent skin tumor promoter yet does not activate protein kinase C indicated that investigating palytoxin action could help reveal new aspects of tumor promotion. Interestingly, the putative receptor for palytoxin is the Na(+),K(+)-ATPase. This review focuses on palytoxin-stimulated signaling and how palytoxin has been used to investigate alternate biochemical mechanisms by which important targets in carcinogenesis can be modulated.
Proposed method of assembly for the BCD silicon strip vertex detector modules
International Nuclear Information System (INIS)
Lindenmeyer, C.
1989-01-01
The BCD Silicon strip Vertex Detector is constructed of 10 identical central region modules and 18 similar forward region modules. This memo describes a method of assembling these modules from individual silicon wafers. Each wafer is fitted with associated front end electronics and cables and has been tested to insure that only good wafers reach the final assembly stage. 5 figs
Janssen, Paddy K C; Zwinderman, Aeilko H; Olivier, Berend; Waldinger, Marcel D
PURPOSE: To investigate the association between the 5-HT-transporter-gene-linked promoter region (5-HTTLPR) polymorphism and 20-mg paroxetine-induced ejaculation delay in men with lifelong premature ejaculation (LPE). MATERIALS AND METHODS: This was a prospective study of 10 weeks of paroxetine
A single-copy galK promoter cloning vector suitable for cloning strong promoters
DEFF Research Database (Denmark)
Dandanell, Gert; Court, Donald L.; Hammer, Karin
1986-01-01
We report the construction of lambda galK promoter cloning vectors for cloning and characterization of strong promoters. This phage, which contains a unique HindIII cloning site, was applied to the cloning and analysis of transcription initiations of the regulatory region of the deo-operon of...
Wang, Xiaohong; Liu, Haibin; Ge, Hui; Ajiro, Masahiko; Sharma, Nishi R; Meyers, Craig; Morozov, Pavel; Tuschl, Thomas; Klar, Amar; Court, Donald; Zheng, Zhi-Ming
2017-05-30
The life cycle of human papillomaviruses (HPVs) is tightly linked to keratinocyte differentiation. Although expression of viral early genes is initiated immediately upon virus infection of undifferentiated basal cells, viral DNA amplification and late gene expression occur only in the mid to upper strata of the keratinocytes undergoing terminal differentiation. In this report, we show that the relative activity of HPV18 TATA-less late promoter P 811 depends on its orientation relative to that of the origin (Ori) of viral DNA replication and is sensitive to the eukaryotic DNA polymerase inhibitor aphidicolin. Additionally, transfected 70-nucleotide (nt)-long single-strand DNA oligonucleotides that are homologous to the region near Ori induce late promoter activity. We also found that promoter activation in raft cultures leads to production of the late promoter-associated, sense-strand transcription initiation RNAs (tiRNAs) and splice-site small RNAs (spliRNAs). Finally, a cis -acting AAGTATGCA core element that functions as a repressor to the promoter was identified. This element interacts with hnRNP D0B and hnRNP A/B factors. Point mutations in the core prevented binding of hnRNPs and increased the promoter activity. Confirming this result, knocking down the expression of both hnRNPs in keratinocytes led to increased promoter activity. Taking the data together, our study revealed the mechanism of how the HPV18 late promoter is regulated by DNA replication and host factors. IMPORTANCE It has been known for decades that the activity of viral late promoters is associated with viral DNA replication among almost all DNA viruses. However, the mechanism of how DNA replication activates the viral late promoter and what components of the replication machinery are involved remain largely unknown. In this study, we characterized the P 811 promoter region of HPV18 and demonstrated that its activation depends on the orientation of DNA replication. Using single
Directory of Open Access Journals (Sweden)
Enrique Yamil Alul González
2010-12-01
Full Text Available The Regional Productive Development Agencies implemented in Chile in 2006, were developed as a way to answer the longing desire to territorially decentralize, and that the own Regions be whom define their future. The Agencies have the responsibility to develop innovation and productive development Agendas in participative processes, which means with public, academic and private actors. Also, the Agencies have the mission to implement Competitive Improvement Plans-PMC (clusters in prioritized economic sectors by the own region. These PMC are leaded by private actors in each sector.
DEFF Research Database (Denmark)
Hansen, Martin A; Nielsen, John E; Retelska, Dorota
2008-01-01
, sequences corresponding to the shared promoter region of the CYPT family were identified at 39 loci. Most loci were located immediately upstream of genes belonging to the VCX/Y, SPANX, or CSAG gene families. Sequence comparison of the loci revealed a conserved CYPT promoter-like (CPL) element featuring TATA...... cell types. The genomic regions harboring the gene families were rich in direct and inverted segmental duplications (SD), which may facilitate gene conversion and rapid evolution. The conserved CPL and the common expression profiles suggest that the human VCX/Y, SPANX, and CSAG2 gene families together......Many testis-specific genes from the sex chromosomes are subject to rapid evolution, which can make it difficult to identify murine genes in the human genome. The murine CYPT gene family includes 15 members, but orthologs were undetectable in the human genome. However, using refined homology search...
CD147 Promotes CXCL1 Expression and Modulates Liver Fibrogenesis
Directory of Open Access Journals (Sweden)
Wen-Pu Shi
2018-04-01
Full Text Available Activated hepatic stellate cells (HSCs release pro-inflammatory and pro-fibrogenic factors. CXC chemokine-ligand-1 (CXCL1 is expressed on HSCs. We previously found that the CD147 is overexpressed in activated HSCs. In this study, we showed an important role of CD147 in promoting liver fibrosis by activating HSCs and upregulating expression of chemokines. Specifically, we found that CD147 specific deletion in HSCs mice alleviated CCl4-induced liver fibrosis and inhibited HSCs activation. Overexpression of CD147 upregulated the secretion of CXCL1. Meanwhile, CXCL1 promoted HSCs activation through autocrine. Treating with PI3K/AKT inhibitor could effectively suppress CD147-induced CXCL1 expression. Taken together, these findings suggest that CD147 regulates CXCL1 release in HSCs by PI3K/AKT signaling. Inhibition of CD147 attenuates CCl4-induced liver fibrosis and inflammation. Therefore, administration of targeting CD147 could be a promising therapeutic strategy in liver fibrosis.
Energy Technology Data Exchange (ETDEWEB)
Papadakis, Antonios E. [University Hospital of Heraklion, Department of Medical Physics, Stavrakia, P.O. Box 1352, Heraklion, Crete (Greece); Perisinakis, Kostas; Damilakis, John [University of Crete, Faculty of Medicine, Department of Medical Physics, P.O. Box 2208, Heraklion, Crete (Greece)
2014-10-15
To study the effect of patient size, body region and modulation strength on tube current and image quality on CT examinations that use automatic tube current modulation (ATCM). Ten physical anthropomorphic phantoms that simulate an individual as neonate, 1-, 5-, 10-year-old and adult at various body habitus were employed. CT acquisition of head, neck, thorax and abdomen/pelvis was performed with ATCM activated at weak, average and strong modulation strength. The mean modulated mAs (mAs{sub mod}) values were recorded. Image noise was measured at selected anatomical sites. The mAs{sub mod} recorded for neonate compared to 10-year-old increased by 30 %, 14 %, 6 % and 53 % for head, neck, thorax and abdomen/pelvis, respectively, (P < 0.05). The mAs{sub mod} was lower than the preselected mAs with the exception of the 10-year-old phantom. In paediatric and adult phantoms, the mAs{sub mod} ranged from 44 and 53 for weak to 117 and 93 for strong modulation strength, respectively. At the same exposure parameters image noise increased with body size (P < 0.05). The ATCM system studied here may affect dose differently for different patient habitus. Dose may decrease for overweight adults but increase for children older than 5 years old. Care should be taken when implementing ATCM protocols to ensure that image quality is maintained. circle ATCM efficiency is related to the size of the patient's body. (orig.)
Hong, Soonil; Kang, Hongkyu; Kim, Geunjin; Lee, Seongyu; Kim, Seok; Lee, Jong-Hoon; Lee, Jinho; Yi, Minjin; Kim, Junghwan; Back, Hyungcheol; Kim, Jae-Ryoung; Lee, Kwanghee
2016-01-05
The fabrication of organic photovoltaic modules via printing techniques has been the greatest challenge for their commercial manufacture. Current module architecture, which is based on a monolithic geometry consisting of serially interconnecting stripe-patterned subcells with finite widths, requires highly sophisticated patterning processes that significantly increase the complexity of printing production lines and cause serious reductions in module efficiency due to so-called aperture loss in series connection regions. Herein we demonstrate an innovative module structure that can simultaneously reduce both patterning processes and aperture loss. By using a charge recombination feature that occurs at contacts between electron- and hole-transport layers, we devise a series connection method that facilitates module fabrication without patterning the charge transport layers. With the successive deposition of component layers using slot-die and doctor-blade printing techniques, we achieve a high module efficiency reaching 7.5% with area of 4.15 cm(2).
Janssen, Paddy K. C.; Zwinderman, Aeilko H.; Olivier, Berend; Waldinger, Marcel D.
2014-01-01
To investigate the association between the 5-HT-transporter-gene-linked promoter region (5-HTTLPR) polymorphism and 20-mg paroxetine-induced ejaculation delay in men with lifelong premature ejaculation (LPE). This was a prospective study of 10 weeks of paroxetine treatment in 54 men with LPE.
Directory of Open Access Journals (Sweden)
X. Xu
2016-09-01
Full Text Available Powerful high-frequency (HF radio waves can be used to efficiently modify the upper-ionospheric plasmas of the F region. The pressure gradient induced by modulated electron heating at ultralow-frequency (ULF drives a local oscillating diamagnetic ring current source perpendicular to the ambient magnetic field, which can act as an antenna radiating ULF waves. In this paper, utilizing the HF heating model and the model of ULF wave generation and propagation, we investigate the effects of both the background ionospheric profiles at different latitudes in the daytime and nighttime ionosphere and the modulation frequency on the process of the HF modulated heating and the subsequent generation and propagation of artificial ULF waves. Firstly, based on a relation among the radiation efficiency of the ring current source, the size of the spatial distribution of the modulated electron temperature and the wavelength of ULF waves, we discuss the possibility of the effects of the background ionospheric parameters and the modulation frequency. Then the numerical simulations with both models are performed to demonstrate the prediction. Six different background parameters are used in the simulation, and they are from the International Reference Ionosphere (IRI-2012 model and the neutral atmosphere model (NRLMSISE-00, including the High Frequency Active Auroral Research Program (HAARP; 62.39° N, 145.15° W, Wuhan (30.52° N, 114.32° E and Jicamarca (11.95° S, 76.87° W at 02:00 and 14:00 LT. A modulation frequency sweep is also used in the simulation. Finally, by analyzing the numerical results, we come to the following conclusions: in the nighttime ionosphere, the size of the spatial distribution of the modulated electron temperature and the ground magnitude of the magnetic field of ULF wave are larger, while the propagation loss due to Joule heating is smaller compared to the daytime ionosphere; the amplitude of the electron temperature
International Nuclear Information System (INIS)
Sundaram, Kumaran; Nishimura, Riko; Senn, Joseph; Youssef, Rimon F.; London, Steven D.; Reddy, Sakamuri V.
2007-01-01
Osteoclast differentiation is tightly regulated by receptor activator of NF-κB ligand (RANKL) signaling. Matrix metalloproteinase-9 (MMP-9), a type IV collagenase is highly expressed in osteoclast cells and plays an important role in degradation of extracellular matrix; however, the molecular mechanisms that regulate MMP-9 gene expression are unknown. In this study, we demonstrate that RANKL signaling induces MMP-9 gene expression in osteoclast precursor cells. We further show that RANKL regulates MMP-9 gene expression through TRAF6 but not TRAF2. Interestingly, blockade of p38 MAPK activity by pharmacological inhibitor, SB203580 increases MMP-9 activity whereas ERK1/2 inhibitor, PD98059 decreases RANKL induced MMP-9 activity in RAW264.7 cells. These data suggest that RANKL differentially regulates MMP-9 expression through p38 and ERK signaling pathways during osteoclast differentiation. Transient expression of MMP-9 gene (+ 1 to - 1174 bp relative to ATG start codon) promoter-luciferase reporter plasmids in RAW264.7 cells and RANKL stimulation showed significant increase (20-fold) of MMP-9 gene promoter activity; however, there is no significant change with respect to + 1 bp to - 446 bp promoter region and empty vector transfected cells. These results indicated that MMP-9 promoter sequence from - 446 bp to - 1174 bp relative to start codon is responsive to RANKL stimulation. Sequence analysis of the mouse MMP-9 gene promoter region further identified the presence of binding motif (- 1123 bp to - 1153 bp) for the nuclear factor of activated T cells 1 (NFATc1) transcription factor. Inhibition of NFATc1 using siRNA and VIVIT peptide inhibitor significantly decreased RANKL stimulation of MMP-9 activity. We further confirm by oligonucleotide pull-down assay that RANKL stimuli enhanced NFATc1 binding to MMP-9 gene promoter element. In addition, over-expression of constitutively active NFAT in RAW264.7 cells markedly increased (5-fold) MMP-9 gene promoter activity in
Directory of Open Access Journals (Sweden)
Hassan A. Aziz
2018-06-01
Full Text Available Tobacco smoking is widespread behavior in Qatar and worldwide and is considered one of the major preventable causes of ill health and death. Nicotine is part of tobacco smoke that causes numerous health risks and is incredibly addictive; it binds to the α7 nicotinic acetylcholine receptor (α7nAChR in the brain. Recent studies showed α7nAChR involvement in the initiation and addiction of smoking. Kynurenic acid (KA, a significant tryptophan metabolite, is an antagonist of α7nAChR. Inhibition of kynurenine 3-monooxygenase enzyme encoded by KMO enhances the KA levels. Modulating KMO gene expression could be a useful tactic for the treatment of tobacco initiation and dependence. Since KMO regulation is still poorly understood, we aimed to investigate the 5′ and 3′-regulatory factors of KMO gene to advance our knowledge to modulate KMO gene expression. In this study, bioinformatics methods were used to identify the regulatory sequences associated with expression of KMO. The displayed differential expression of KMO mRNA in the same tissue and different tissues suggested the specific usage of the KMO multiple alternative promoters. Eleven KMO alternative promoters identified at 5′-regulatory region contain TATA-Box, lack CpG Island (CGI and showed dinucleotide base-stacking energy values specific to transcription factor binding sites (TFBSs. The structural features of regulatory sequences can influence the transcription process and cell type-specific expression. The uncharacterized LOC105373233 locus coding for non-coding RNA (ncRNA located on the reverse strand in a convergent manner at the 3′-side of KMO locus. The two genes likely expressed by a promoter that lacks TATA-Box harbor CGI and two TFBSs linked to the bidirectional transcription, the NRF1, and ZNF14 motifs. We identified two types of microRNA (miR in the uncharacterized LOC105373233 ncRNA, which are like hsa-miR-5096 and hsa-miR-1285-3p and can target the miR recognition
Raijmakers, MTM; Jansen, PLM; Steegers, EAP; Peters, WHM
Background/Aims: Gilbert's syndrome is a benign form of a deficiency in bilirubin glucuronidation. It is associated with a homozygous polymorphism, A(TA)(7)TAA instead of A(TA)(6)TAA, in the TATA-box of the promoter region of the bilirubin UDP-glucuronyltransferase gene. In this study the
Directory of Open Access Journals (Sweden)
Nandini V L Hayes
Full Text Available Phosducin-like protein 3 (PhLP3 forms a ternary complex with the ATP-dependent molecular chaperone CCT and its folding client tubulin. In vitro studies suggest PhLP3 plays an inhibitory role in β-tubulin folding while conversely in vivo genetic studies suggest PhLP3 is required for the correct folding of β-tubulin. We have a particular interest in the cytoskeleton, its chaperones and their role in determining cellular phenotypes associated with high level recombinant protein expression from mammalian cell expression systems.As studies into PhLP3 function have been largely carried out in non mammalian systems, we examined the effect of human PhLP3 over-expression and siRNA silencing using a single murine siRNA on both tubulin and actin systems in mammalian Chinese hamster ovary (CHO cell lines. We show that over-expression of PhLP3 promotes an imbalance of α and β tubulin subunits, microtubule disassembly and cell death. In contrast, β-actin levels are not obviously perturbed. On-the-other-hand, RNA silencing of PhLP3 increases RhoA-dependent actin filament formation and focal adhesion formation and promotes a dramatic elongated fibroblast-like change in morphology. This was accompanied by an increase in phosphorylated MAPK which has been associated with promoting focal adhesion assembly and maturation. Transient overexpression of PhLP3 in knockdown experiments rescues cells from the morphological change observed during PhLP3 silencing but mitosis is perturbed, probably reflecting a tipping back of the balance of PhLP3 levels towards the overexpression state.Our results support the hypothesis that PhLP3 is important for the maintenance of β-tubulin levels in mammalian cells but also that its modulation can promote actin-based cytoskeletal remodelling by a mechanism linked with MAPK phosphorylation and RhoA-dependent changes. PhLP3 levels in mammalian cells are thus finely poised and represents a novel target for engineering industrially
Directory of Open Access Journals (Sweden)
Fei eZhou
2015-04-01
Full Text Available The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA, we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD and constant dark (DD conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.
South Asia's health promotion kaleidoscope.
Mukhopadhyay, Alok
2007-01-01
South Asia has 22 percent of the world's population but only 1.3 percent of the global income. Consequently 40 percent of the population is living in absolute poverty. However the health transition in some of its countries including India and Sri Lanka is a testimony to the fact that there are proven solutions to the problems of health and development within the region. The countries of the region have much in common, including a democratic political system, four major religions, a vibrant and living tradition of voluntarism and an extensive health infrastructure which is operating well below par. Despite the underlying unity, South Asia enjoys enormous cultural, linguistic and ethnic diversity. In this large, complex and vibrant region, health promotion is a challenging task, but it also holds the key to a dramatic change in the global health situation. Many of these solutions lie in wider areas of socio-political action. There are much needed shifts in the health promotion and development efforts, particularly in the area of poverty and social justice; gender inequity; population stabilisation; health and environment; control of communicable and non-communicable diseases; and urban health strategies. The principle of cooperation, partnership and intersectoral collaboration for health will be explored. Developing an appropriate, sustainable and people centred health and development strategy in the coming decades is an enormous challenge. There has been an attempt to focus on the emerging needs of the region, which call for health promotion, and involvement of civil society, private sector and the governments bestowed with the increased responsibility of ensuring health security for people. Strengthening the existing health systems, allocating adequate resources for health development and ensuring community participation are all prerequisites to the success of health promotion in the region.
MicroRNA modulation in complex regional pain syndrome
Directory of Open Access Journals (Sweden)
Orlova Irina A
2011-11-01
Full Text Available Abstract Background Aberrant expression of small noncoding RNAs called microRNAs (miRNAs is a common feature of several human diseases. The objective of the study was to identify miRNA modulation in patients with complex regional pain syndrome (CRPS a chronic pain condition resulting from dysfunction in the central and/or peripheral nervous systems. Due to a multitude of inciting pathologies, symptoms and treatment conditions, the CRPS patient population is very heterogeneous. Our goal was to identify differentially expressed miRNAs in blood and explore their utility in patient stratification. Methods We profiled miRNAs in whole blood from 41 patients with CRPS and 20 controls using TaqMan low density array cards. Since neurogenic inflammation is known to play a significant role in CRPS we measured inflammatory markers including chemokines, cytokines, and their soluble receptors in blood from the same individuals. Correlation analyses were performed for miRNAs, inflammatory markers and other parameters including disease symptoms, medication, and comorbid conditions. Results Three different groups emerged from miRNA profiling. One group was comprised of 60% of CRPS patients and contained no control subjects. miRNA profiles from the remaining patients were interspersed among control samples in the other two groups. We identified differential expression of 18 miRNAs in CRPS patients. Analysis of inflammatory markers showed that vascular endothelial growth factor (VEGF, interleukin1 receptor antagonist (IL1Ra and monocyte chemotactic protein-1 (MCP1 were significantly elevated in CRPS patients. VEGF and IL1Ra showed significant correlation with the patients reported pain levels. Analysis of the patients who were clustered according to their miRNA profile revealed correlations that were not significant in the total patient population. Correlation analysis of miRNAs detected in blood with additional parameters identified miRNAs associated with
Expression of an expansin carbohydrate-binding module affects ...
African Journals Online (AJOL)
Expansins are believed to be involved in disrupting the non-covalent adhesion of cellulose to matrix polysaccharides, thereby promoting wall creep. We have targeted a putative potato expansin (EXPA) carbohydrate-binding module (CBM) to the cell walls of tobacco plants. Histological examinations and electron ...
Directory of Open Access Journals (Sweden)
L. Minieri
2010-04-01
Full Text Available A region of glucokinase (GCK gene was sequenced in 14 horses of 14 different breeds. The resulting GCK nucleotide sequence (GenBank number EF136885 showed 77% homology with human GCK gene portion containing the upstream promoter region and the corresponding 5’ UTR of the exon 1. Conserved regulatory sequences near the putative transcriptional start site were identified. The obtained sequences were aligned to detect polymorphism. A new C>T transition within the 5’ UTR of exon 1 was found. Allele frequencies of this polymorphism were studied by PCR-RFLP in 193 horses of 14 breeds (Bardigiano, 21; Esperia Pony, 5; Haflinger, 10; Italian Heavy Draught Horse, 28; Italian Saddle, 25; Italian Trotter, 16; Lipizzan, 12; Maremmano, 15; Murgese, 14; Norico, 10; Salernitano, 12; Thoroughbred, 10; Tolfetano, 7 and Ventasso Horse, 8. The polymorphism was found in all breeds and differences in allelic frequencies among the breeds were observed. The new SNP identified within a regulative region of GCK gene, which plays an important role in insulin secretion and feeding behaviour, could be used for association studies with performance traits of the horses.
Regulation of the human ADAMTS-4 promoter by transcription factors and cytokines
International Nuclear Information System (INIS)
Thirunavukkarasu, Kannan; Pei, Yong; Moore, Terry L.; Wang, He; Yu, Xiao-peng; Geiser, Andrew G.; Chandrasekhar, Srinivasan
2006-01-01
ADAMTS-4 (aggrecanase-1) is a metalloprotease that plays a role in aggrecan degradation in the cartilage extracellular matrix. In order to understand the regulation of ADAMTS-4 gene expression we have cloned and characterized a functional 4.5 kb human ADAMTS-4 promoter. Sequence analysis of the promoter revealed the presence of putative binding sites for nuclear factor of activated T cells (NFAT) and Runx family of transcription factors that are known to regulate chondrocyte maturation and differentiation. Using promoter-reporter assays and mRNA analysis we have analyzed the role of chondrocyte-expressed transcription factors NFATp and Runx2 and have shown that ADAMTS-4 is a potential downstream target of these two factors. Our results suggest that inhibition of the expression/function of NFATp and/or Runx2 may enable us to modulate aggrecan degradation in normal physiology and/or in degenerative joint diseases. The ADAMTS-4 promoter would serve as a valuable mechanistic tool to better understand the regulation of ADAMTS-4 expression by signaling pathways that modulate cartilage matrix breakdown
Amirhaeri, S; Wohlrab, F; Wells, R D
1995-02-17
The influence of simple repeat sequences, cloned into different positions relative to the SV40 early promoter/enhancer, on the transient expression of the chloramphenicol acetyltransferase (CAT) gene was investigated. Insertion of (G)29.(C)29 in either orientation into the 5'-untranslated region of the CAT gene reduced expression in CV-1 cells 50-100 fold when compared with controls with random sequence inserts. Analysis of CAT-specific mRNA levels demonstrated that the effect was due to a reduction of CAT mRNA production rather than to posttranscriptional events. In contrast, insertion of the same insert in either orientation upstream of the promoter-enhancer or downstream of the gene stimulated gene expression 2-3-fold. These effects could be reversed by cotransfection of a competitor plasmid carrying (G)25.(C)25 sequences. The results suggest that a G.C-binding transcription factor modulates gene expression in this system and that promoter strength can be regulated by providing protein-binding sites in trans. Although constructs containing longer tracts of alternating (C-G), (T-G), or (A-T) sequences inhibited CAT expression when inserted in the 5'-untranslated region of the CAT gene, the amount of CAT mRNA was unaffected. Hence, these inhibitions must be due to posttranscriptional events, presumably at the level of translation. These effects of microsatellite sequences on gene expression are discussed with respect to recent data on related simple repeat sequences which cause several human genetic diseases.
Banerjee, Joydeep; Sahoo, Dipak Kumar; Dey, Nrisingha; Houtz, Robert L.; Maiti, Indu Bhushan
2013-01-01
On chromosome 4 in the Arabidopsis genome, two neighboring genes (calmodulin methyl transferase At4g35987 and senescence associated gene At4g35985) are located in a head-to-head divergent orientation sharing a putative bidirectional promoter. This 1258 bp intergenic region contains a number of environmental stress responsive and tissue specific cis-regulatory elements. Transcript analysis of At4g35985 and At4g35987 genes by quantitative real time PCR showed tissue specific and stress inducible expression profiles. We tested the bidirectional promoter-function of the intergenic region shared by the divergent genes At4g35985 and At4g35987 using two reporter genes (GFP and GUS) in both orientations in transient tobacco protoplast and Agro-infiltration assays, as well as in stably transformed transgenic Arabidopsis and tobacco plants. In transient assays with GFP and GUS reporter genes the At4g35985 promoter (P85) showed stronger expression (about 3.5 fold) compared to the At4g35987 promoter (P87). The tissue specific as well as stress responsive functional nature of the bidirectional promoter was evaluated in independent transgenic Arabidopsis and tobacco lines. Expression of P85 activity was detected in the midrib of leaves, leaf trichomes, apical meristemic regions, throughout the root, lateral roots and flowers. The expression of P87 was observed in leaf-tip, hydathodes, apical meristem, root tips, emerging lateral root tips, root stele region and in floral tissues. The bidirectional promoter in both orientations shows differential up-regulation (2.5 to 3 fold) under salt stress. Use of such regulatory elements of bidirectional promoters showing spatial and stress inducible promoter-functions in heterologous system might be an important tool for plant biotechnology and gene stacking applications. PMID:24260266
Directory of Open Access Journals (Sweden)
Joydeep Banerjee
Full Text Available On chromosome 4 in the Arabidopsis genome, two neighboring genes (calmodulin methyl transferase At4g35987 and senescence associated gene At4g35985 are located in a head-to-head divergent orientation sharing a putative bidirectional promoter. This 1258 bp intergenic region contains a number of environmental stress responsive and tissue specific cis-regulatory elements. Transcript analysis of At4g35985 and At4g35987 genes by quantitative real time PCR showed tissue specific and stress inducible expression profiles. We tested the bidirectional promoter-function of the intergenic region shared by the divergent genes At4g35985 and At4g35987 using two reporter genes (GFP and GUS in both orientations in transient tobacco protoplast and Agro-infiltration assays, as well as in stably transformed transgenic Arabidopsis and tobacco plants. In transient assays with GFP and GUS reporter genes the At4g35985 promoter (P85 showed stronger expression (about 3.5 fold compared to the At4g35987 promoter (P87. The tissue specific as well as stress responsive functional nature of the bidirectional promoter was evaluated in independent transgenic Arabidopsis and tobacco lines. Expression of P85 activity was detected in the midrib of leaves, leaf trichomes, apical meristemic regions, throughout the root, lateral roots and flowers. The expression of P87 was observed in leaf-tip, hydathodes, apical meristem, root tips, emerging lateral root tips, root stele region and in floral tissues. The bidirectional promoter in both orientations shows differential up-regulation (2.5 to 3 fold under salt stress. Use of such regulatory elements of bidirectional promoters showing spatial and stress inducible promoter-functions in heterologous system might be an important tool for plant biotechnology and gene stacking applications.
Dynamic range in BOLD modulation: lifespan aging trajectories and association with performance.
Kennedy, Kristen M; Boylan, Maria A; Rieck, Jenny R; Foster, Chris M; Rodrigue, Karen M
2017-12-01
Alteration of dynamic range of modulation to cognitive difficulty has been proposed as a salient predictor of cognitive aging. Here, we examine in 171 adults (aged 20-94 years) the effects of age on dynamic modulation of blood oxygenation-level dependent activation to difficulty in parametrically increasing working memory (WM) load (0-, 2-, 3-, and 4-back conditions). First, we examined parametric increases and decreases in activation to increasing WM load (positive modulation effect and negative modulation effect). Second, we examined the effect of age on modulation to difficulty (WM load) to identify regions that differed with age as difficulty increased (age-related positive and negative modulation effects). Weakened modulation to difficulty with age was found in both the positive modulation (middle frontal, superior/inferior parietal) and negative modulation effect (deactivated) regions (insula, cingulate, medial superior frontal, fusiform, and parahippocampal gyri, hippocampus, and lateral occipital cortex). Age-related alterations to positive modulation emerged later in the lifespan than negative modulation. Furthermore, these effects were significantly coupled in that greater upmodulation was associated with lesser downmodulation. Importantly, greater fronto-parietal upmodulation to difficulty and greater downmodulation of deactivated regions were associated with better task accuracy and upmodulation with better WM span measured outside the scanner. These findings suggest that greater dynamic range of modulation of activation to cognitive challenge is in service of current task performance, as well as generalizing to cognitive ability beyond the scanner task, lending support to its utility as a marker of successful cognitive aging. Copyright © 2017 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk
2014-04-25
Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
Beta-Glucan induced immune modulation of wound healing in common carp (Cyprinus carpio)
Jiménez, Natalia Ivonne Vera; Nielsen, Michael Engelbrecht; Lindenstrøm, Thomas
2012-01-01
Immune modulators are compounds capable to interact with the immune system and to modify the host response. This interaction enhances non-specific defense mechanisms, improving health and promoting survival. β-glucans are glucose polysaccharides present in sea weed, bacteria, fungi and cereal but not in animals. β-glucans are commonly used as immune modulators, but the mechanisms through which the modulation is achieved remains to be understood. Wound healing and tissue regeneration are essen...
2D Finite Element Model of a CIGS Module
Energy Technology Data Exchange (ETDEWEB)
Janssen, G.J.M.; Slooff, L.H.; Bende, E.E. [ECN Solar Energy, P.O.Box 1, NL-1755 ZG Petten (Netherlands)
2012-06-15
The performance of thin-film CIGS (Copper indium gallium selenide) modules is often limited due to inhomogeneities in CIGS layers. A 2-dimensional Finite Element Model for CIGS modules is presented that predicts the impact of such inhomogeneities on the module performance. Results are presented of a module with a region of poor diode characteristics. It is concluded that according to this model the effects of poor diodes depend strongly on their location in the module and on their dispersion over the module surface. Due to its generic character the model can also be applied to other series connections of photovoltaic cells.
2D - Finite element model of a CIGS module
Energy Technology Data Exchange (ETDEWEB)
Janssen, G.J.M.; Slooff, L.H.; Bende, E.E. [ECN Solar Energy, Petten (Netherlands)
2012-09-15
The performance of thin-film CIGS modules is often limited due to inhomogeneities in CIGS layers. A 2-dimensional Finite Element Model for CIGS modules is demonstrated that predicts the impact of such inhomogeneities on the module performance. Results are presented of a module with a region of poor diode characteristics. It is concluded that according to this model the effects of poor diodes depend strongly on their location in the module and on their dispersion over the module surface. Due to its generic character the model can also be applied to other series connections of photovoltaic cells.
Modulating the level of components within plants
Bobzin, Steven Craig; Apuya, Nestor; Chiang, Karen; Doukhanina, Elena; Feldmann, Kenneth; Jankowski, Boris; Margolles-Clark, Emilio; Mumenthaler, Daniel; Okamuro, Jack; Park, Joon-Hyun; Van Fleet, Jennifer E.; Zhang, Ke
2017-09-12
Materials and Methods for identifying lignin regulatory region-regulatory protein associations are disclosed. Materials and methods for modulating lignin accumulation are also disclosed. In addition, methods and materials for modulating (e.g., increasing or decreasing) the level of a component (e.g., protein, oil, lignin, carbon, a carotenoid, or a triterpenoid) in plants are disclosed.
International Nuclear Information System (INIS)
Chattopadhyay, Anasuya; Schmidt, Martin C.; Khan, Saleem A.
2005-01-01
Human papillomaviruses (HPVs) replicate as nuclear plasmids in infected cells. Since the DNA replication machinery is generally conserved between humans and Saccharomyces cerevisiae, we studied whether HPV-1 DNA can replicate in yeast. Plasmids containing a selectable marker (with or without a yeast centromere) and either the full-length HPV-1 genome or various regions of the viral long control region (LCR) and the 3' end of the L1 gene were introduced into S. cerevisiae and their ability to replicate episomally was investigated. Our results show that HPV-1 sequences promote episomal replication of plasmids although the yeast centromere is required for plasmid retention. We have mapped the autonomously replicating sequence activity of HPV-1 DNA to a 450 base-pair sequence (HPV-1 nt 6783-7232) that includes 293 nucleotides from the 5' region of the viral LCR and 157 nucleotides from the 3' end of the L1 gene. The HPV-1 ARS does not include the binding sites for the viral E1 and E2 proteins, and these proteins are dispensable for replication in S. cerevisiae
Energy Technology Data Exchange (ETDEWEB)
Gee, K.W.; Bolger, M.B.; Brinton, R.E.; Coirini, H.; McEwen, B.S.
1988-08-01
Further in vitro studies of steroids active at the gamma-aminobutyric acidA (GABAA) receptor regulated Cl- channel labeled by (35S)-t-butylbicyclophosphorothionate ((35S)TBPS) reveal additional structural requirements necessary for activity. Evaluation of selected steroids for activity against TBPS-induced convulsions show similar requirements for activity. Interestingly, steroids (e.g., 5 alpha-pregnan-3 alpha, 20 alpha-diol) were identified that have high potency but limited efficacy as modulators of (35S)TBPS binding. These characteristics are reminiscent of the clinically useful benzodiazepines (BZs) such as clonazepam. However, interactions between the prototypical anesthetic-barbiturate, sodium pentobarbital, and steroids active at the Cl- channel suggest that they do not share a common site of action as allosteric modulators of (35S)TBPS and BZ receptor binding. The most potent steroid evaluated, 5 alpha-pregnan-3 alpha-ol-20-one, modulates (35S)TBPS binding at low concentrations (IC50 approximately 17 nM) in a regionally dependent manner. All (35S)TBPS binding sites appear to be functionally coupled to a steroid modulatory site. Because several of the active steroids are metabolites of progesterone, their ability to inhibit the binding of (3H)promegestrone to the cytosolic progestin receptor in rat uterus was evaluated. Those steroids showing potent activity at the GABAA receptor-Cl- ionophore were inactive at the intracellular progestin receptor. Such specificity coupled with their high potency provide additional support for the hypothesis that some of these steroids may be involved in the homeostatic regulation of brain excitability via the GABAA-BZ receptor complex.
Stress modulation of cognitive and affective processes
CAMPEAU, SERGE; LIBERZON, ISRAEL; MORILAK, DAVID; RESSLER, KERRY
2012-01-01
This review summarizes the major discussion points of a symposium on stress modulation of cognitive and affective processes, which was held during the 2010 workshop on the neurobiology of stress (Boulder, CO, USA). The four discussants addressed a number of specific cognitive and affective factors that are modulated by exposure to acute or repeated stress. Dr David Morilak discussed the effects of various repeated stress situations on cognitive flexibility, as assessed with a rodent model of attentional set-shifting task, and how performance on slightly different aspects of this test is modulated by different prefrontal regions through monoaminergic neurotransmission. Dr Serge Campeau summarized the findings of several studies exploring a number of factors and brain regions that regulate habituation of various autonomic and neuroendocrine responses to repeated audiogenic stress exposures. Dr Kerry Ressler discussed a body of work exploring the modulation and extinction of fear memories in rodents and humans, especially focusing on the role of key neurotransmitter systems including excitatory amino acids and brain-derived neurotrophic factor. Dr Israel Liberzon presented recent results on human decision-making processes in response to exogenous glucocorticoid hormone administration. Overall, these discussions are casting a wider framework on the cognitive/affective processes that are distinctly regulated by the experience of stress and some of the brain regions and neurotransmitter systems associated with these effects. PMID:21790481
Altered brain network modules induce helplessness in major depressive disorder.
Peng, Daihui; Shi, Feng; Shen, Ting; Peng, Ziwen; Zhang, Chen; Liu, Xiaohua; Qiu, Meihui; Liu, Jun; Jiang, Kaida; Fang, Yiru; Shen, Dinggang
2014-10-01
The abnormal brain functional connectivity (FC) has been assumed to be a pathophysiological aspect of major depressive disorder (MDD). However, it is poorly understood, regarding the underlying patterns of global FC network and their relationships with the clinical characteristics of MDD. Resting-state functional magnetic resonance imaging data were acquired from 16 first episode, medication-naïve MDD patients and 16 healthy control subjects. The global FC network was constructed using 90 brain regions. The global topological patterns, e.g., small-worldness and modularity, and their relationships with depressive characteristics were investigated. Furthermore, the participant coefficient and module degree of MDD patients were measured to reflect the regional roles in module network, and the impairment of FC was examined by network based statistic. Small-world property was not altered in MDD. However, MDD patients exhibited 5 atypically reorganized modules compared to the controls. A positive relationship was also found among MDD patients between the intra-module I and helplessness factor evaluated via the Hamilton Depression Scale. Specifically, eight regions exhibited the abnormal participant coefficient or module degree, e.g., left superior orbital frontal cortex and right amygdala. The decreased FC was identified among the sub-network of 24 brain regions, e.g., frontal cortex, supplementary motor area, amygdala, thalamus, and hippocampus. The limited size of MDD samples precluded meaningful study of distinct clinical characteristics in relation to aberrant FC. The results revealed altered patterns of brain module network at the global level in MDD patients, which might contribute to the feelings of helplessness. Copyright © 2014 Elsevier B.V. All rights reserved.
Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S
2014-01-10
Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first
Periodic equivalence ratio modulation method and apparatus for controlling combustion instability
Richards, George A.; Janus, Michael C.; Griffith, Richard A.
2000-01-01
The periodic equivalence ratio modulation (PERM) method and apparatus significantly reduces and/or eliminates unstable conditions within a combustion chamber. The method involves modulating the equivalence ratio for the combustion device, such that the combustion device periodically operates outside of an identified unstable oscillation region. The equivalence ratio is modulated between preselected reference points, according to the shape of the oscillation region and operating parameters of the system. Preferably, the equivalence ratio is modulated from a first stable condition to a second stable condition, and, alternatively, the equivalence ratio is modulated from a stable condition to an unstable condition. The method is further applicable to multi-nozzle combustor designs, whereby individual nozzles are alternately modulated from stable to unstable conditions. Periodic equivalence ratio modulation (PERM) is accomplished by active control involving periodic, low frequency fuel modulation, whereby low frequency fuel pulses are injected into the main fuel delivery. Importantly, the fuel pulses are injected at a rate so as not to affect the desired time-average equivalence ratio for the combustion device.
TALE-mediated modulation of transcriptional enhancers in vivo.
Crocker, Justin; Stern, David L
2013-08-01
We tested whether transcription activator-like effectors (TALEs) could mediate repression and activation of endogenous enhancers in the Drosophila genome. TALE repressors (TALERs) targeting each of the five even-skipped (eve) stripe enhancers generated repression specifically of the focal stripes. TALE activators (TALEAs) targeting the eve promoter or enhancers caused increased expression primarily in cells normally activated by the promoter or targeted enhancer, respectively. This effect supports the view that repression acts in a dominant fashion on transcriptional activators and that the activity state of an enhancer influences TALE binding or the ability of the VP16 domain to enhance transcription. In these assays, the Hairy repression domain did not exhibit previously described long-range transcriptional repression activity. The phenotypic effects of TALER and TALEA expression in larvae and adults are consistent with the observed modulations of eve expression. TALEs thus provide a novel tool for detection and functional modulation of transcriptional enhancers in their native genomic context.
International Nuclear Information System (INIS)
Kanaji, Toru; Urano, Toshio
1981-01-01
In Bayard-Alpert (B-A) ionization gauges widely used as total pressure-measuring gauges, the collector current is expressed as the sum of ion current Ii and soft X-ray photoelectron current Ix, if noise current is composed of only Ix. Ii and Ix are proportional to emission current Ie, respectively, and the pressure Px = α/S at which Ie is equal to Ix is called X-ray limit pressure, where α is X-ray current generating rate, and S is sensitivity coefficient. Therefore, it is necessary to make α smaller, and at the same time, to make S larger in order to reduce Px. But actually, the noise current is not composed of Ix only. Thereupon, the collector current other than true ion current in the lump is expressed as In, then the measuring limit pressure can be improved by epsilon n/kappa fold, where epsilon n and kappa are modulation coefficients of In and Ii, respectively. The authors have studied the three concentric cylindrical grid type modulated B-A gauge, and presently are working to try to make epsilon n smaller, putting the emphasis on holding the electric field around the collector constant. By the detailed consideration on the noise current of this gauge, it can be expected that the gauge holds linearity down to considerably low pressure region, but there are many problems to verify it. Thus this gauge is expected to be developed further as the gauges for ultra-high vacuum application. (Wakatsuki, Y.)
Geoheritage promotion of Thonon-les-Bains (Fr) region by the development of a geotourism product
Fanguin, Pauline
2014-05-01
Since 2012, the Chablais region (only in France) has acquired the Geopark label. This Geopark contributes to sustainable economic development of the region through geotourism. Moreover, the three Chablais (figure 1) are concerned by an Interreg IV program since 2009 (program of cooperation between European countries). The main objective of this program is to enhance the heritage resources (nature, culture and lifestyle of the region) (www.interreg-francesuisse.org). Therefore, the geotourism offer in this area just waiting to expand. The geodidactics models like the simplification of the scientific content are essential for geoheritage promotion, because this content must be available to a wide audience, allowing thereby the geoheritage recognition. The geotourism permits to apply different models (Cayla et al. 2010, Sellier, 2009) through a wide range of geotourism products, like guide, educational panels, thematic hikes and recently developed, new medias (website, smartphone applications). A geotourism product is based on four areas of questioning and was developed by Martin et al. (2010): (1) site (choice of sites to be valued), (2) public (a family public, good example of heterogeneous public), (3) contents (reasoning on geodidactics models) and (4) support (smartphone application). These four areas are very fundamental before the creation of any geotourism product. These reflexions aim to obtain a mediation product that integrates into geotourism offer of a region and contributes to its development and meets public expectations. New media, such as digital media - smartphone, tablets, website - become geotourism products more and more attractive. In addition, the necessary technologies to develop new media help to integrate a high interactivity potential with the public and thus get their attention. The architecture of this geotourism product is based on the new application developed by the Institute of Geography and sustainability, and the Bureau Relief. One
Localization and regulation of bacteriophage Mu promoters
International Nuclear Information System (INIS)
Stoddard, S.F.; Howe, M.M.
1989-01-01
Mu promoters active during the lytic cycle were located by isolating RNA at various times after induction of Mu prophages, radiolabeling it by capping in vitro, and hybridizing it to Mu DNA fragments on Southern blots. Signals were detected from four new promoters in addition to the previously characterized P e (early), P cM (repressor), and P mom (late) promoters. A major signal upstream of C was first observed at 12 min and intensified thereafter with RNA from cts and C amber but not replication-defective prophages; these characteristics indicate that this signal arises from a middle promoter, which we designate P m . With 20- and 40-min RNA, four additional major signals originated in the C-lys, F-G-I, N-P, and com-mom regions. These signals were missing with RNA from C amber and replication-defective prophages and therefore reflected the activity of late promoters, one of which we presume was P mom . Uninduced lysogens showed weak signals from five regions, one from the early regulatory region, three between genes B and lys, and one near the late genes K, L, and M. The first of these probably resulted from P cM activity; the others remain to be identified
Graphene-based hybrid plasmonic modulator
International Nuclear Information System (INIS)
Shin, Jin-Soo; Kim, Jin-Soo; Tae Kim, Jin
2015-01-01
A graphene-based hybrid plasmonic modulator is designed based on an asymmetric double-electrode plasmonic waveguide structure. The photonic device consists of a monolayer graphene, a thin metal strip, and a thin dielectric layer that is inserted between the grapheme and the metal strip. By electrically tuning the graphene’s refractive index, the propagation loss of the hybrid long-range surface plasmon polariton strip mode in the proposed graphene-based hybrid plasmonic waveguide is switchable, and hence the intensity of the guided modes is modulated. The highest modulation depth is observed at the graphene’s epsilon-near-zero region. The device characteristics are characterized over the entire C-band (1.530–1.565 μm). (paper)
STMN1 Promotes Progesterone Production Via StAR Up-regulation in Mouse Granulosa Cells.
Dou, Yun-De; Zhao, Han; Huang, Tao; Zhao, Shi-Gang; Liu, Xiao-Man; Yu, Xiao-Chen; Ma, Zeng-Xiang; Zhang, Yu-Chao; Liu, Tao; Gao, Xuan; Li, Lei; Lu, Gang; Chan, Wai-Yee; Gao, Fei; Liu, Hong-Bin; Chen, Zi-Jiang
2016-06-08
Stathmin 1 (STMN1) is a biomarker in several types of neoplasms. It plays an important role in cell cycle progression, mitosis, signal transduction and cell migration. In ovaries, STMN1 is predominantly expressed in granulosa cells (GCs). However, little is known about the role of STMN1 in ovary. In this study, we demonstrated that STMN1 is overexpressed in GCs in patients with polycystic ovary syndrome (PCOS). In mouse primary GCs, the overexpression of STMN1 stimulated progesterone production, whereas knockdown of STMN1 decreased progesterone production. We also found that STMN1 positively regulates the expression of Star (steroidogenic acute regulatory protein) and Cyp11a1 (cytochrome P450 family 11 subfamily A member 1). Promoter and ChIP assays indicated that STMN1 increased the transcriptional activity of Star and Cyp11a1 by binding to their promoter regions. The data suggest that STMN1 mediates the progesterone production by modulating the promoter activity of Star and Cyp11a1. Together, our findings provide novel insights into the molecular mechanisms of STMN1 in ovary GC steroidogenesis. A better understanding of this potential interaction between STMN1 and Star in progesterone biosynthesis in GCs will facilitate the discovery of new therapeutic targets in PCOS.
Promoting Evidence-Based Practices: New Teaching Module for Early Childhood Teacher Educators
Young Children, 2009
2009-01-01
Linda Halgunseth, head of NAEYC's Office of Applied Research (OAR), tells readers about Child Care and Early Education Research Connections, a Web site (www.researchconnections.org/teaching_modules) to help teacher educators integrate knowledge about evidence-based practices into teacher education programs. In addition, the article touts the…
Directory of Open Access Journals (Sweden)
Cristy Phillips
2017-01-01
Full Text Available The number of the elderly across the globe will approximate 2.1 billion by 2050. Juxtaposed against this burgeoning segment of the population is evidence that nonpathological aging is associated with an increased risk for cognitive decline in a variety of domains, changes that can cause mild disability even before the onset of dementia. Given that pharmacological treatments that mitigate dementia are still outstanding, alternative therapeutic options are being investigated increasingly. The results from translational studies have shown that modifiable lifestyle factors—including physical activity, cognitive engagement, and diet—are a key strategy for maintaining brain health during aging. Indeed, a multiplicity of studies has demonstrated relationships between lifestyle factors, brain structure and function, and cognitive function in aging adults. For example, physical activity and diet modulate common neuroplasticity substrates (neurotrophic signaling, neurogenesis, inflammation, stress response, and antioxidant defense in the brain whereas cognitive engagement enhances brain and cognitive reserve. The aims of this review are to evaluate the relationship between modifiable lifestyle factors, neuroplasticity, and optimal brain health during aging; to identify putative mechanisms that contribute positive brain aging; and to highlight future directions for scientists and clinicians. Undoubtedly, the translation of cutting-edge knowledge derived from the field of cognitive neuroscience will advance our understanding and enhance clinical treatment interventions as we endeavor to promote brain health during aging.
Numerical analysis of gas puff modulation experiment on JT-60U
International Nuclear Information System (INIS)
Nagashima, Keisuke; Sakasai, Akira
1992-03-01
In tokamak transport physics, source modulation experiments are one of the most effective methods. For an analysis of these modulation experiments, a simple numerical method was developed to solve the general transport equations. This method was applied to gas puff modulation experiments on JT-60U. From the comparison between the measured and calculated density perturbations, it was found that the particle diffusion coefficient is about 0.8 m 2 /sec in the edge region and 0.1-0.2 m 2 /sec in the central region. (author)
NPY2-receptor variation modulates iconic memory processes.
Arning, Larissa; Stock, Ann-Kathrin; Kloster, Eugen; Epplen, Jörg T; Beste, Christian
2014-08-01
Sensory memory systems are modality-specific buffers that comprise information about external stimuli, which represent the earliest stage of information processing. While these systems have been the subject of cognitive neuroscience research for decades, little is known about the neurobiological basis of sensory memory. However, accumulating evidence suggests that the glutamatergic system and systems influencing glutamatergic neural transmission are important. In the current study we examine if functional promoter variations in neuropeptide Y (NPY) and its receptor gene NPY2R affect iconic memory processes using a partial report paradigm. We found that iconic memory decayed much faster in individuals carrying the rare promoter NPY2R G allele which is associated with increased expression of the Y2 receptor. Possibly this effect is due to altered presynaptic inhibition of glutamate release, known to be modulated by Y2 receptors. Altogether, our results provide evidence that the functionally relevant single nucleotide polymorphism (SNP) in the NPY2R promoter gene affect circumscribed processes of early sensory processing, i.e. only the stability of information in sensory memory buffers. This leads us to suggest that especially the stability of information in sensory memory buffers depends on glutamatergic neural transmission and factors modulating glutamatergic turnover. Copyright © 2014 Elsevier B.V. and ECNP. All rights reserved.
Directory of Open Access Journals (Sweden)
Dongkyoon Kim
2017-12-01
Full Text Available Arid3a/Bright/Dril1 is a B cell-specific transactivator that regulates immunoglobulin heavy chain (IgH gene transcription by binding promoter and enhancer-associated matrix attachment regions (MARs within the IgH gene locus. Promoter MAR-mediated Arid3a transactivation is antagonized by direct competition of MAR binding by Cux1/CDP—a ubiquitously expressed repressor originally termed NF-μNR. We report that the NF-μNR complex includes Arid3a in B cells but not in non-B cells through mobility shift assays. The binding activity of NF-μNR and Arid3a in B cells is reciprocally altered during the cell division cycle and by the B cell mitogen lipopolysaccharide LPS. LPS treatment had no effect on Arid3a localization but increased its total abundance within the nucleus and cytoplasm. We show that this increased level of Arid3a is capable of displacing Cux from the MARs to facilitate IgH gene transcription. Finally, we showed that the MARs (termed Bf150 and Tx125 associated with the VH1 rearranged variable region expressed in the S107 murine plasmacytoma, can repress reporter gene transcription in non-B cells and that they can relieve the repression mediated by Eμ enhancer in B cells. These results have significant implications for early human development and demonstrate that MARs in IgH locus, NF-µNR and Arid3a regulate IgH gene expression in a concerted fashion. This paves the way for future studies examining the misregulation of this pathway in pediatric disease.
Modulation of Translation Initiation Efficiency in Classical Swine Fever Virus
DEFF Research Database (Denmark)
Friis, Martin Barfred; Rasmussen, Thomas Bruun; Belsham, Graham J.
Modulation of translation initiation efficiency on classical swine fever virus (CSFV) RNA can be achieved by targeted mutations within the internal ribosome entry site (IRES). In this study, the nucleotides 47 to 427, including the IRES region of the wt CSFV strain Paderborn, were amplified...... and inserted, under T7 promoter control, into mono- and dicistronic plasmids containing the reporter genes rLuc and fLuc. Mutant fragments of the IRES sequence were generated by overlap PCR and inserted into the reporter plasmids. To evaluate IRES functionality, translation of the rLUC was placed under...... viruses were obtained after one cell culture passage from constructs with more than 75 % translation efficiency compared to the wildtype IRES. cDNA was generated from these clones and sequenced to verify the maintenance of the changes in the IRES. These results show that full-length viable mutant viruses...
Rausch, Vanessa H; Bauch, Eva M; Bunzeck, Nico
2014-07-01
In neural systems, information processing can be facilitated by adding an optimal level of white noise. Although this phenomenon, the so-called stochastic resonance, has traditionally been linked with perception, recent evidence indicates that white noise may also exert positive effects on cognitive functions, such as learning and memory. The underlying neural mechanisms, however, remain unclear. Here, on the basis of recent theories, we tested the hypothesis that auditory white noise, when presented during the encoding of scene images, enhances subsequent recognition memory performance and modulates activity within the dopaminergic midbrain (i.e., substantia nigra/ventral tegmental area, SN/VTA). Indeed, in a behavioral experiment, we can show in healthy humans that auditory white noise-but not control sounds, such as a sinus tone-slightly improves recognition memory. In an fMRI experiment, white noise selectively enhances stimulus-driven phasic activity in the SN/VTA and auditory cortex. Moreover, it induces stronger connectivity between SN/VTA and right STS, which, in addition, exhibited a positive correlation with subsequent memory improvement by white noise. Our results suggest that the beneficial effects of auditory white noise on learning depend on dopaminergic neuromodulation and enhanced connectivity between midbrain regions and the STS-a key player in attention modulation. Moreover, they indicate that white noise could be particularly useful to facilitate learning in conditions where changes of the mesolimbic system are causally related to memory deficits including healthy and pathological aging.
Park, Moo Suk; He, Qianbin; Edwards, Michael G; Sergew, Amen; Riches, David W H; Albert, Richard K; Douglas, Ivor S
2012-07-01
Mechanical ventilation induces heterogeneous lung injury by mitogen-activated protein kinase (MAPK) and nuclear factor-κB. Mechanisms regulating regional injury and protective effects of prone positioning are unclear. To determine the key regulators of the lung regional protective effects of prone positioning in rodent lungs exposed to injurious ventilation. Adult rats were ventilated with high (18 ml/kg, positive end-expiratory pressure [PEEP] 0) or low Vt (6 ml/kg; PEEP 3 cm H(2)O; 3 h) in supine or prone position. Dorsal-caudal lung mRNA was analyzed by microarray and MAPK phosphatases (MKP)-1 quantitative polymerase chain reaction. MKP-1(-/-) or wild-type mice were ventilated with very high (24 ml/kg; PEEP 0) or low Vt (6-7 ml/kg; PEEP 3 cm H(2)O). The MKP-1 regulator PG490-88 (MRx-108; 0.75 mg/kg) or phosphate-buffered saline was administered preventilation. Injury was assessed by lung mechanics, bronchioalveolar lavage cell counts, protein content, and lung injury scoring. Immunoblotting for MKP-1, and IκBα and cytokine ELISAs were performed on lung lysates. Prone positioning was protective against injurious ventilation in rats. Expression profiling demonstrated MKP-1 20-fold higher in rats ventilated prone rather than supine and regional reduction in p38 and c-jun N-terminal kinase activation. MKP-1(-/-) mice experienced amplified injury. PG490-88 improved static lung compliance and injury scores, reduced bronchioalveolar lavage cell counts and cytokine levels, and induced MKP-1 and IκBα. Injurious ventilation induces MAPK in an MKP-1-dependent fashion. Prone positioning is protective and induces MKP-1. PG490-88 induced MKP-1 and was protective against high Vt in a nuclear factor-κB-dependent manner. MKP-1 is a potential target for modulating regional effects of injurious ventilation.
HOX Gene Promoter Prediction and Inter-genomic Comparison: An Evo-Devo Study
Directory of Open Access Journals (Sweden)
Marla A. Endriga
2010-10-01
Full Text Available Homeobox genes direct the anterior-posterior axis of the body plan in eukaryotic organisms. Promoter regions upstream of the Hox genes jumpstart the transcription process. CpG islands found within the promoter regions can cause silencing of these promoters. The locations of the promoter regions and the CpG islands of Homeo sapiens sapiens (human, Pan troglodytes (chimpanzee, Mus musculus (mouse, and Rattus norvegicus (brown rat are compared and related to the possible influence on the specification of the mammalian body plan. The sequence of each gene in Hox clusters A-D of the mammals considered were retrieved from Ensembl and locations of promoter regions and CpG islands predicted using Exon Finder. The predicted promoter sequences were confirmed via BLAST and verified against the Eukaryotic Promoter Database. The significance of the locations was determined using the Kruskal-Wallis test. Among the four clusters, only promoter locations in cluster B showed significant difference. HOX B genes have been linked with the control of genes that direct the development of axial morphology, particularly of the vertebral column bones. The magnitude of variation among the body plans of closely-related species can thus be partially attributed to the promoter kind, location and number, and gene inactivation via CpG methylation.
Selective AR Modulators that Distinguish Proliferative from Differentiative Gene Promoters
2016-08-01
levels, and in some cases be useful in early stage disease or watchful waiting, and in other cases castration resistant prostate cancer (CRPC...dependent kinase inhibitor p21 gene through an androgen response element in the proximal promoter. Molecular endocrinology 13, 376 (Mar, 1999). 9...analyses and in mouse xenograft experiments, as planned. We will also continue to probe the molecular mechanism by which dox elicits these differential
The Digital North Denmark Programme -Promoting Regional Change?
DEFF Research Database (Denmark)
Østergaard, Christian Richter
2007-01-01
The Digital North Denmark (DDN) was an IT programme running from 2000 to 2003 in the North Jutland County in Denmark with national government support of € 23 million. The Danish government initiated the programme with the aim of further strengthening regions with an already proven ICT capability...... (Dybkjær and Lindegaard, 1999, p.96-100). The declared approach was to build on the existing competencies in industry as well as at universities. The national government chose two regions – Ørestaden, a new concentration of knowledge-based institutions near Copenhagen Airport, and North Jutland......-offers within four themes. The participants - meant to be project consortia of ideally private firms, public or private organisations as well as regional and municipal government bodies - could get a maximum national government support of one third of the total project sum.This chapter investigates how...
Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.
Meier, Daniel; Schindler, Detlev
2011-01-01
The Fanconi anemia (FA) gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M) that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS). In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs), and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.
Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.
Directory of Open Access Journals (Sweden)
Daniel Meier
Full Text Available The Fanconi anemia (FA gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS. In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs, and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.
NEMS integrating module documentation report
Energy Technology Data Exchange (ETDEWEB)
1993-12-14
The National Energy Modeling System (NEMS) is a computer modeling system that produces a general equilibrium solution for energy supply and demand in the US energy markets. The model achieves a supply and demand balance in the end-use demand regions, defined as the nine Census Divisions, by solving for the prices of each energy type such that the quantities producers are willing to supply equal the quantities consumers wish to consume. The system reflects market economics, industry structure, and energy policies and regulations that influence market behavior. The NEMS Integrating Module is the central integrating component of a complex modeling system. As such, a thorough understanding of its role in the modeling process can only be achieved by placing it in the proper context with respect to the other modules. To that end, this document provides an overview of the complete NEMS model, and includes brief descriptions of the modules with which the Integrating Module interacts. The emphasis and focus, however, is on the structure and function of the Integrating Module of NEMS.
The CRESST-III detector module
Energy Technology Data Exchange (ETDEWEB)
Wuestrich, Marc [Max-Planck-Institut f. Physik (Werner-Heisenberg-Institut) (Germany); Collaboration: CRESST-Collaboration
2016-07-01
The direct dark matter experiment CRESST uses scintillating calorimeters to detected WIMP induced nuclear scattering in CaWO{sub 4} single crystals. Equipped with transition edge sensors (TESs), these detectors can achieve detection thresholds well below 1 keV. The last physics run of CRESST-II proved the high potential of the experiment especially for small WIMP masses and triggered the development of a new detector module using much smaller CaWO{sub 4} main absorbers. The upcoming CRESST-III run will mainly be equipped with these newly developed modules, which combine a fully scintillating detector housing with an improved detection threshold (<100 keV). While many features of the new module were adapted from previous module designs in an improved way, also new features are implemented like instrumented sticks (iSticks) holding the crystals and optimized TES structures for phonon and light detectors. First tests above ground validated the improved performance of these detector modules and promise to explore new regions in the WIMP parameter space in the next CRESST-III run.
Spectrotemporal processing in spectral tuning modules of cat primary auditory cortex.
Directory of Open Access Journals (Sweden)
Craig A Atencio
Full Text Available Spectral integration properties show topographical order in cat primary auditory cortex (AI. Along the iso-frequency domain, regions with predominantly narrowly tuned (NT neurons are segregated from regions with more broadly tuned (BT neurons, forming distinct processing modules. Despite their prominent spatial segregation, spectrotemporal processing has not been compared for these regions. We identified these NT and BT regions with broad-band ripple stimuli and characterized processing differences between them using both spectrotemporal receptive fields (STRFs and nonlinear stimulus/firing rate transformations. The durations of STRF excitatory and inhibitory subfields were shorter and the best temporal modulation frequencies were higher for BT neurons than for NT neurons. For NT neurons, the bandwidth of excitatory and inhibitory subfields was matched, whereas for BT neurons it was not. Phase locking and feature selectivity were higher for NT neurons. Properties of the nonlinearities showed only slight differences across the bandwidth modules. These results indicate fundamental differences in spectrotemporal preferences--and thus distinct physiological functions--for neurons in BT and NT spectral integration modules. However, some global processing aspects, such as spectrotemporal interactions and nonlinear input/output behavior, appear to be similar for both neuronal subgroups. The findings suggest that spectral integration modules in AI differ in what specific stimulus aspects are processed, but they are similar in the manner in which stimulus information is processed.
Directory of Open Access Journals (Sweden)
Gian Luigi Corinto
2016-05-01
The paper analyzes the case study of the Tuscan Region which in 2007 has charged the Sistema Toscana Foundation to strategically control all the territorial marketing activities, even including those of the regional film commission and the promotional tourist web site. The aim is to analyze the specific promotional model for enogastronomy and film tourism, as in the peculiar combination of the Tuscan case. The findings are that enongatronomy and tourism have been promoted in combination but only referring to 'minor' tuscan destinations, different from the crowded regional capital or other cultural sites. This choice has been determined by the strategic market positioning of the entire regional tourism supply, effectively integrating local vocations in the web communications. The task of the Foundation in promoting the whole territory and even the minor destinations must be considered as substantially successful, mainly because it has increased the visibility of the Tuscan region by conveniently using all the old and new media tools.
International Nuclear Information System (INIS)
Matsukura, Hiroshi; Aisaki, Ken-ichi; Igarashi, Katsuhide; Matsushima, Yuko; Kanno, Jun; Muramatsu, Masaaki; Sudo, Katsuko; Sato, Noriko
2011-01-01
Highlights: → Genistein (GEN) is a phytoestrogen found in soy products. → GEN demethylated/unsilenced the steroidogenic factor 1 gene in endometrial tissue. → GEN thus altered mRNA expression in uteri of ovariectomized (OVX) mice. → A high-resolution melting assay was used to screen for epigenetic change. → We isolated an endometrial cell clone that was epigenetically modulated by GEN. -- Abstract: It has recently been demonstrated that genistein (GEN), a phytoestrogen in soy products, is an epigenetic modulator in various types of cells; but its effect on endometrium has not yet been determined. We investigated the effects of GEN on mouse uterine cells, in vivo and in vitro. Oral administration of GEN for 1 week induced mild proliferation of the endometrium in ovariectomized (OVX) mice, which was accompanied by the induction of steroidogenic factor 1 (SF-1) gene expression. GEN administration induced demethylation of multiple CpG sites in the SF-1 promoter; these sites are extensively methylated and thus silenced in normal endometrium. The GEN-mediated promoter demethylation occurred predominantly on the luminal side, as opposed to myometrium side, indicating that the epigenetic change was mainly shown in regenerated cells. Primary cultures of endometrial stromal cell colonies were screened for GEN-mediated alterations of DNA methylation by a high-resolution melting (HRM) method. One out of 20 colony-forming cell clones showed GEN-induced demethylation of SF-1. This clone exhibited a high proliferation capacity with continuous colony formation activity through multiple serial clonings. We propose that only a portion of endometrial cells are capable of receiving epigenetic modulation by GEN.
Energy Technology Data Exchange (ETDEWEB)
Matsukura, Hiroshi, E-mail: hmatsukura.epi@mri.tmd.ac.jp [Department of Molecular Epidemiology, Medical Research Institute, Tokyo Medical and Dental University, 2-3-10 Kanda-surugadai, Chiyoda-ku, Tokyo 101-0062 (Japan); Aisaki, Ken-ichi; Igarashi, Katsuhide; Matsushima, Yuko; Kanno, Jun [Division of Cellular and Molecular Toxicology, National Institute of Health Sciences, 1-18-1 Kamiyoga, Setagaya-ku, Tokyo 158-8501 (Japan); Muramatsu, Masaaki [Department of Molecular Epidemiology, Medical Research Institute, Tokyo Medical and Dental University, 2-3-10 Kanda-surugadai, Chiyoda-ku, Tokyo 101-0062 (Japan); Sudo, Katsuko [Department of Molecular Epidemiology, Medical Research Institute, Tokyo Medical and Dental University, 2-3-10 Kanda-surugadai, Chiyoda-ku, Tokyo 101-0062 (Japan); Animal Research Center, Tokyo Medical University, 6-1-1 Shinjuku, Shinjuku-ku, Tokyo 160-8402 (Japan); Sato, Noriko, E-mail: nsato.epi@tmd.ac.jp [Department of Molecular Epidemiology, Medical Research Institute, Tokyo Medical and Dental University, 2-3-10 Kanda-surugadai, Chiyoda-ku, Tokyo 101-0062 (Japan)
2011-08-26
Highlights: {yields} Genistein (GEN) is a phytoestrogen found in soy products. {yields} GEN demethylated/unsilenced the steroidogenic factor 1 gene in endometrial tissue. {yields} GEN thus altered mRNA expression in uteri of ovariectomized (OVX) mice. {yields} A high-resolution melting assay was used to screen for epigenetic change. {yields} We isolated an endometrial cell clone that was epigenetically modulated by GEN. -- Abstract: It has recently been demonstrated that genistein (GEN), a phytoestrogen in soy products, is an epigenetic modulator in various types of cells; but its effect on endometrium has not yet been determined. We investigated the effects of GEN on mouse uterine cells, in vivo and in vitro. Oral administration of GEN for 1 week induced mild proliferation of the endometrium in ovariectomized (OVX) mice, which was accompanied by the induction of steroidogenic factor 1 (SF-1) gene expression. GEN administration induced demethylation of multiple CpG sites in the SF-1 promoter; these sites are extensively methylated and thus silenced in normal endometrium. The GEN-mediated promoter demethylation occurred predominantly on the luminal side, as opposed to myometrium side, indicating that the epigenetic change was mainly shown in regenerated cells. Primary cultures of endometrial stromal cell colonies were screened for GEN-mediated alterations of DNA methylation by a high-resolution melting (HRM) method. One out of 20 colony-forming cell clones showed GEN-induced demethylation of SF-1. This clone exhibited a high proliferation capacity with continuous colony formation activity through multiple serial clonings. We propose that only a portion of endometrial cells are capable of receiving epigenetic modulation by GEN.
Smolikov, Sarit; Schild-Prüfert, Kristina; Colaiácovo, Mónica P
2008-06-06
The synaptonemal complex (SC), a tripartite proteinaceous structure that forms between homologous chromosomes during meiosis, is crucial for faithful chromosome segregation. Here we identify CRA-1, a novel and conserved protein that is required for the assembly of the central region of the SC during C. elegans meiosis. In the absence of CRA-1, central region components fail to extensively localize onto chromosomes at early prophase and instead mostly surround the chromatin at this stage. Later in prophase, central region proteins polymerize along chromosome axes, but for the most part fail to connect the axes of paired homologous chromosomes. This defect results in an inability to stabilize homologous pairing interactions, altered double-strand break (DSB) repair progression, and a lack of chiasmata. Surprisingly, DSB formation and repair are required to promote the polymerization of the central region components along meiotic chromosome axes in cra-1 mutants. In the absence of both CRA-1 and any one of the C. elegans homologs of SPO11, MRE11, RAD51, or MSH5, the polymerization observed along chromosome axes is perturbed, resulting in the formation of aggregates of the SC central region proteins. While radiation-induced DSBs rescue this polymerization in cra-1; spo-11 mutants, they fail to do so in cra-1; mre-11, cra-1; rad-51, and cra-1; msh-5 mutants. Taken together, our studies place CRA-1 as a key component in promoting the assembly of a tripartite SC structure. Moreover, they reveal a scenario in which DSB formation and repair can drive the polymerization of SC components along chromosome axes in C. elegans.
Insulin promotes cell migration by regulating PSA-NCAM
Energy Technology Data Exchange (ETDEWEB)
Monzo, Hector J.; Coppieters, Natacha [Centre for Brain Research, Faculty of Medical and Health Sciences, The University of Auckland, Private Bag, 92019, Auckland (New Zealand); Department of Anatomy and Medical Imaging, Faculty of Medical and Health Sciences, The University of Auckland, Private Bag, 92019, Auckland (New Zealand); Park, Thomas I.H. [Centre for Brain Research, Faculty of Medical and Health Sciences, The University of Auckland, Private Bag, 92019, Auckland (New Zealand); Department of Pharmacology, Faculty of Medical and Health Sciences, The University of Auckland, Private Bag, 92019, Auckland (New Zealand); Dieriks, Birger V.; Faull, Richard L.M. [Centre for Brain Research, Faculty of Medical and Health Sciences, The University of Auckland, Private Bag, 92019, Auckland (New Zealand); Department of Anatomy and Medical Imaging, Faculty of Medical and Health Sciences, The University of Auckland, Private Bag, 92019, Auckland (New Zealand); Dragunow, Mike [Centre for Brain Research, Faculty of Medical and Health Sciences, The University of Auckland, Private Bag, 92019, Auckland (New Zealand); Department of Pharmacology, Faculty of Medical and Health Sciences, The University of Auckland, Private Bag, 92019, Auckland (New Zealand); Curtis, Maurice A., E-mail: m.curtis@auckland.ac.nz [Centre for Brain Research, Faculty of Medical and Health Sciences, The University of Auckland, Private Bag, 92019, Auckland (New Zealand); Department of Anatomy and Medical Imaging, Faculty of Medical and Health Sciences, The University of Auckland, Private Bag, 92019, Auckland (New Zealand)
2017-06-01
Cellular interactions with the extracellular environment are modulated by cell surface polysialic acid (PSA) carried by the neural cell adhesion molecule (NCAM). PSA-NCAM is involved in cellular processes such as differentiation, plasticity, and migration, and is elevated in Alzheimer's disease as well as in metastatic tumour cells. Our previous work demonstrated that insulin enhances the abundance of cell surface PSA by inhibiting PSA-NCAM endocytosis. In the present study we have identified a mechanism for insulin-dependent inhibition of PSA-NCAM turnover affecting cell migration. Insulin enhanced the phosphorylation of the focal adhesion kinase leading to dissociation of αv-integrin/PSA-NCAM clusters, and promoted cell migration. Our results show that αv-integrin plays a key role in the PSA-NCAM turnover process. αv-integrin knockdown stopped PSA-NCAM from being endocytosed, and αv-integrin/PSA-NCAM clusters co-labelled intracellularly with Rab5, altogether indicating a role for αv-integrin as a carrier for PSA-NCAM during internalisation. Furthermore, inhibition of p-FAK caused dissociation of αv-integrin/PSA-NCAM clusters and counteracted the insulin-induced accumulation of PSA at the cell surface and cell migration was impaired. Our data reveal a functional association between the insulin/p-FAK-dependent regulation of PSA-NCAM turnover and cell migration through the extracellular matrix. Most importantly, they identify a novel mechanism for insulin-stimulated cell migration. - Highlights: • Insulin modulates PSA-NCAM turnover through upregulation of p-FAK. • P-FAK modulates αv-integrin/PSA-NCAM clustering. • αv-integrin acts as a carrier for PSA-NCAM endocytosis. • Cell migration is promoted by cell surface PSA. • Insulin promotes PSA-dependent migration in vitro.
Insulin promotes cell migration by regulating PSA-NCAM
International Nuclear Information System (INIS)
Monzo, Hector J.; Coppieters, Natacha; Park, Thomas I.H.; Dieriks, Birger V.; Faull, Richard L.M.; Dragunow, Mike; Curtis, Maurice A.
2017-01-01
Cellular interactions with the extracellular environment are modulated by cell surface polysialic acid (PSA) carried by the neural cell adhesion molecule (NCAM). PSA-NCAM is involved in cellular processes such as differentiation, plasticity, and migration, and is elevated in Alzheimer's disease as well as in metastatic tumour cells. Our previous work demonstrated that insulin enhances the abundance of cell surface PSA by inhibiting PSA-NCAM endocytosis. In the present study we have identified a mechanism for insulin-dependent inhibition of PSA-NCAM turnover affecting cell migration. Insulin enhanced the phosphorylation of the focal adhesion kinase leading to dissociation of αv-integrin/PSA-NCAM clusters, and promoted cell migration. Our results show that αv-integrin plays a key role in the PSA-NCAM turnover process. αv-integrin knockdown stopped PSA-NCAM from being endocytosed, and αv-integrin/PSA-NCAM clusters co-labelled intracellularly with Rab5, altogether indicating a role for αv-integrin as a carrier for PSA-NCAM during internalisation. Furthermore, inhibition of p-FAK caused dissociation of αv-integrin/PSA-NCAM clusters and counteracted the insulin-induced accumulation of PSA at the cell surface and cell migration was impaired. Our data reveal a functional association between the insulin/p-FAK-dependent regulation of PSA-NCAM turnover and cell migration through the extracellular matrix. Most importantly, they identify a novel mechanism for insulin-stimulated cell migration. - Highlights: • Insulin modulates PSA-NCAM turnover through upregulation of p-FAK. • P-FAK modulates αv-integrin/PSA-NCAM clustering. • αv-integrin acts as a carrier for PSA-NCAM endocytosis. • Cell migration is promoted by cell surface PSA. • Insulin promotes PSA-dependent migration in vitro.
Promoting Food Safety Awareness for Older Adults by Using Online Education Modules
Roy, Amber; Francis, Sarah L.; Shaw, Angela; Rajagopal, Lakshman
2016-01-01
Older adults are susceptible to and at greater risk for food-borne illness in comparison to those in other adult age groups. Online education is an underused method for the delivery of food safety information to this population. Three online mini-modules, based on social marketing theory (SMT), were created for and pilot-tested with older adults.…
Properties of promoters cloned randomly from the Saccharomyces cerevisiae genome.
Santangelo, G M; Tornow, J; McLaughlin, C S; Moldave, K
1988-01-01
Promoters were isolated at random from the genome of Saccharomyces cerevisiae by using a plasmid that contains a divergently arrayed pair of promoterless reporter genes. A comprehensive library was constructed by inserting random (DNase I-generated) fragments into the intergenic region upstream from the reporter genes. Simple in vivo assays for either reporter gene product (alcohol dehydrogenase or beta-galactosidase) allowed the rapid identification of promoters from among these random fragments. Poly(dA-dT) homopolymer tracts were present in three of five randomly cloned promoters. With two exceptions, each RNA start site detected was 40 to 100 base pairs downstream from a TATA element. All of the randomly cloned promoters were capable of activating reporter gene transcription bidirectionally. Interestingly, one of the promoter fragments originated in a region of the S. cerevisiae rDNA spacer; regulated divergent transcription (presumably by RNA polymerase II) initiated in the same region. Images PMID:2847031
ULF Generation by Modulated Ionospheric Heating
Chang, C.; Labenski, J.; Wallace, T.; Papadopoulos, K.
2013-12-01
Modulated ionospheric heating experiments designed to generate ULF waves using the HAARP heater have been conducted since 2007. Artificial ULF waves in the Pc1 frequency range were observed from space and by ground induction magnetometers located in the vicinity of the heater as well as at long distances. Two distinct generation mechanisms of artificial ULF waves were identified. The first was electroject modulation under geomagnetically disturbed conditions. The second was pressure modulation in the E and F regions of the ionosphere under quiet conditions. Ground detections of ULF waves near the heater included both Shear Alfven waves and Magnetosonic waves generated by electrojet and/or pressure modulations. Distant ULF detections involved Magnetosonic wave propagation in the Alfvenic duct with pressure modulation as the most likely source. Summary of our observations and theoretical interpretations will be presented at the meeting. We would like to acknowledge the support provided by the staff at the HAARP facility during our ULF experiments.
Controlling traffic jams by time modulating the safety distance
DEFF Research Database (Denmark)
Gaididei, Yu B.; Gorria, C.; Berkemer, R.
2013-01-01
The possibility of controlling traffic dynamics by applying high-frequency time modulation of traffic flow parameters is studied. It is shown that the region of the car density where the uniform (free) flow is unstable changes in the presence of time modulation compared with the unmodulated case....
Compilation and analysis of Escherichia coli promoter DNA sequences.
Hawley, D K; McClure, W R
1983-01-01
The DNA sequence of 168 promoter regions (-50 to +10) for Escherichia coli RNA polymerase were compiled. The complete listing was divided into two groups depending upon whether or not the promoter had been defined by genetic (promoter mutations) or biochemical (5' end determination) criteria. A consensus promoter sequence based on homologies among 112 well-defined promoters was determined that was in substantial agreement with previous compilations. In addition, we have tabulated 98 promoter ...
DEFF Research Database (Denmark)
Jensen, Peter Ruhdal; Hammer, Karin
1998-01-01
A library of synthetic promoters for Lactococcus lactis was constructed, in which the known consensus sequences were kept constant while the sequences of the separating spacers were randomized. The library consists of 38 promoters which differ in strength from 0.3 relative units, and up to more t......-reactors and cell factories....
Benferhat, Rima; Josse, Thibaut; Albaud, Benoit; Gentien, David; Mansuroglu, Zeyni; Marcato, Vasco; Souès, Sylvie; Le Bonniec, Bernard; Bouloy, Michèle; Bonnefoy, Eliette
2012-10-01
Rift Valley fever virus (RVFV) is a highly pathogenic Phlebovirus that infects humans and ruminants. Initially confined to Africa, RVFV has spread outside Africa and presently represents a high risk to other geographic regions. It is responsible for high fatality rates in sheep and cattle. In humans, RVFV can induce hepatitis, encephalitis, retinitis, or fatal hemorrhagic fever. The nonstructural NSs protein that is the major virulence factor is found in the nuclei of infected cells where it associates with cellular transcription factors and cofactors. In previous work, we have shown that NSs interacts with the promoter region of the beta interferon gene abnormally maintaining the promoter in a repressed state. In this work, we performed a genome-wide analysis of the interactions between NSs and the host genome using a genome-wide chromatin immunoprecipitation combined with promoter sequence microarray, the ChIP-on-chip technique. Several cellular promoter regions were identified as significantly interacting with NSs, and the establishment of NSs interactions with these regions was often found linked to deregulation of expression of the corresponding genes. Among annotated NSs-interacting genes were present not only genes regulating innate immunity and inflammation but also genes regulating cellular pathways that have not yet been identified as targeted by RVFV. Several of these pathways, such as cell adhesion, axonal guidance, development, and coagulation were closely related to RVFV-induced disorders. In particular, we show in this work that NSs targeted and modified the expression of genes coding for coagulation factors, demonstrating for the first time that this hemorrhagic virus impairs the host coagulation cascade at the transcriptional level.
Dynamic nucleosome organization at hox promoters during zebrafish embryogenesis.
Directory of Open Access Journals (Sweden)
Steven E Weicksel
Full Text Available Nucleosome organization at promoter regions plays an important role in regulating gene activity. Genome-wide studies in yeast, flies, worms, mammalian embryonic stem cells and transformed cell lines have found well-positioned nucleosomes flanking a nucleosome depleted region (NDR at transcription start sites. This nucleosome arrangement depends on DNA sequence (cis-elements as well as DNA binding factors and ATP-dependent chromatin modifiers (trans-factors. However, little is understood about how the nascent embryonic genome positions nucleosomes during development. This is particularly intriguing since the embryonic genome must undergo a broad reprogramming event upon fusion of sperm and oocyte. Using four stages of early embryonic zebrafish development, we map nucleosome positions at the promoter region of 37 zebrafish hox genes. We find that nucleosome arrangement at the hox promoters is a progressive process that takes place over several stages. At stages immediately after fertilization, nucleosomes appear to be largely disordered at hox promoter regions. At stages after activation of the embryonic genome, nucleosomes are detectable at hox promoters, with positions becoming more uniform and more highly occupied. Since the genomic sequence is invariant during embryogenesis, this progressive change in nucleosome arrangement suggests that trans-factors play an important role in organizing nucleosomes during embryogenesis. Separating hox genes into expressed and non-expressed groups shows that expressed promoters have better positioned and occupied nucleosomes, as well as distinct NDRs, than non-expressed promoters. Finally, by blocking the retinoic acid-signaling pathway, we disrupt early hox gene transcription, but observe no effect on nucleosome positions, suggesting that active hox transcription is not a driving force behind the arrangement of nucleosomes at the promoters of hox genes during early development.
Tripathi, Raakhi Kaliprasad; Jalgaonkar, Sharmila Vinayak; Sarkate, Pankaj V; Rege, Nirmala Narayan
2016-10-01
Underreporting and poor quality of adverse drug reaction (ADR) reports pose a challenge for the Pharmacovigilance Program of India. A module to impart knowledge and skills of ADR reporting to MBBS students was developed and evaluated. The module consisted of (a) e-mailing an ADR narrative and online filling of the "suspected ADR reporting form" (SARF) and (b) a week later, practical on ADR reporting was conducted followed by online filling of SARF postpractical at 1 and 6 months. SARF was an 18-item form with a total score of 36. The module was implemented in the year 2012-2013. Feedback from students and faculty was taken using 15-item prevalidated feedback questionnaires. The module was modified based on the feedback and implemented for the subsequent batch in the year 2013-2014. The evaluation consisted of recording the number of students responding and the scores achieved. A total of 171 students in 2012-2013 batch and 179 in 2013-2014 batch participated. In the 2012-2013 batch, the number of students filling the SARF decreased from basal: 171; 1 month: 122; 6 months: 17. The average scores showed improvement from basal 16.2 (45%) to 26.4 (73%) at 1 month and to 27.3 (76%) at 6 months. For the 2013-2014 batch, the number ( n = 179) remained constant throughout and the average score progressively increased from basal 10.5 (30%) to 27.8 (77%) at 1 month and 30.3 (84%) at 6 months. This module improved the accuracy of filling SARF by students and this subsequently will led to better ADR reporting. Hence, this module can be used to inculcate better ADR reporting practices in budding physicians.
Histamine from brain resident MAST cells promotes wakefulness and modulates behavioral states.
Directory of Open Access Journals (Sweden)
Sachiko Chikahisa
Full Text Available Mast cell activation and degranulation can result in the release of various chemical mediators, such as histamine and cytokines, which significantly affect sleep. Mast cells also exist in the central nervous system (CNS. Since up to 50% of histamine contents in the brain are from brain mast cells, mediators from brain mast cells may significantly influence sleep and other behaviors. In this study, we examined potential involvement of brain mast cells in sleep/wake regulations, focusing especially on the histaminergic system, using mast cell deficient (W/W(v mice. No significant difference was found in the basal amount of sleep/wake between W/W(v mice and their wild-type littermates (WT, although W/W(v mice showed increased EEG delta power and attenuated rebound response after sleep deprivation. Intracerebroventricular injection of compound 48/80, a histamine releaser from mast cells, significantly increased histamine levels in the ventricular region and enhanced wakefulness in WT mice, while it had no effect in W/W(v mice. Injection of H1 antagonists (triprolidine and mepyramine significantly increased the amounts of slow-wave sleep in WT mice, but not in W/W(v mice. Most strikingly, the food-seeking behavior observed in WT mice during food deprivation was completely abolished in W/W(v mice. W/W(v mice also exhibited higher anxiety and depression levels compared to WT mice. Our findings suggest that histamine released from brain mast cells is wake-promoting, and emphasizes the physiological and pharmacological importance of brain mast cells in the regulation of sleep and fundamental neurobehavior.
Gβγ interacts with mTOR and promotes its activation
Energy Technology Data Exchange (ETDEWEB)
Robles-Molina, Evelyn [Department of Pharmacology, Centro de Investigación y de Estudios Avanzados del Instituto Politécnico Nacional (CINVESTAV-IPN), Apartado postal 14-740, México, D.F. 07360 (Mexico); Dionisio-Vicuña, Misael [Department of Cell Biology, Centro de Investigación y de Estudios Avanzados del Instituto Politécnico Nacional (CINVESTAV-IPN), Apartado postal 14-740, México, D.F. 07360 (Mexico); Guzmán-Hernández, María Luisa [Department of Pharmacology, Centro de Investigación y de Estudios Avanzados del Instituto Politécnico Nacional (CINVESTAV-IPN), Apartado postal 14-740, México, D.F. 07360 (Mexico); Reyes-Cruz, Guadalupe [Department of Cell Biology, Centro de Investigación y de Estudios Avanzados del Instituto Politécnico Nacional (CINVESTAV-IPN), Apartado postal 14-740, México, D.F. 07360 (Mexico); Vázquez-Prado, José, E-mail: jvazquez@cinvestav.mx [Department of Pharmacology, Centro de Investigación y de Estudios Avanzados del Instituto Politécnico Nacional (CINVESTAV-IPN), Apartado postal 14-740, México, D.F. 07360 (Mexico)
2014-02-07
Highlights: • Gβγ interacts with mTOR kinase domain via a mechanism sensitive to chronic treatment with rapamycin. • Gβγ interacts with mTORC1 and mTORC2 which correlates with its ability to promote mTORC1 and mTORC2 signaling. • Gβγ heterodimers containing different Gβ subunits, except Gβ{sub 4}, interact with mTOR. - Abstract: Diverse G protein-coupled receptors depend on Gβγ heterodimers to promote cell polarization and survival via direct activation of PI3Kγ and potentially other effectors. These events involve full activation of AKT via its phosphorylation at Ser473, suggesting that mTORC2, the kinase that phosphorylates AKT at Ser473, is activated downstream of Gβγ. Thus, we tested the hypothesis that Gβγ directly contributes to mTOR signaling. Here, we demonstrate that endogenous mTOR interacts with Gβγ. Cell stimulation with serum modulates Gβγ interaction with mTOR. The carboxyl terminal region of mTOR, expressed as a GST-fusion protein, including the serine/threonine kinase domain, binds Gβγ heterodimers containing different Gβ subunits, except Gβ{sub 4}. Both, mTORC1 and mTORC2 complexes interact with Gβ{sub 1}γ{sub 2} which promotes phosphorylation of their respective substrates, p70S6K and AKT. In addition, chronic treatment with rapamycin, a condition known to interfere with assembly of mTORC2, reduces the interaction between Gβγ and mTOR and the phosphorylation of AKT; whereas overexpression of Gαi interfered with the effect of Gβγ as promoter of p70S6K and AKT phosphorylation. Altogether, our results suggest that Gβγ positively regulates mTOR signaling via direct interactions and provide further support to emerging strategies based on the therapeutical potential of inhibiting different Gβγ signaling interfaces.
Performance of free-range chickens reared in production modules enriched with shade net and perches
Directory of Open Access Journals (Sweden)
MJB Santos
2014-03-01
Full Text Available An experiment was carried out to evaluate the effect of environmental enrichment in a free-range chicken production system on live performance as a function of microclimate, physiological parameters, and performance parameters. Four production modules were divided into four pens with 10 birds each, totaling 60 birds. The following treatments were applied: access to a paddock (TEST, access to a paddock with perches (PER, access to a paddock with artificial shade (SHA, and access to the paddock with perches and artificial shade (PESH. The PESH production module presented the best globe temperature (Tbg,ºC and enthalpy (h, kJ/kg, and thereby, the best thermal environmental conditions, which ensured the longest permanence time of the birds in the paddock. The SHA and PESH modules promoted the lowest respiratory rate and shank and comb temperatures. Live performance was influenced by the presence of environmental enrichment (modules SHA and PESH, with the highest live weight (LW and weight gain (WG and the lowest feed conversion ratio (FCR and metabolizable energy intake (MEI. Parts yield, such as giblets, were not influenced by production modules, except for PESH, which promoted higher offal weight. In general, chickens reared in enriched production modules presented greatest performance and comfort results and were considered close to optimal rearing conditions.
Wang, Zhigang; Xu, Lu; Hu, Yinying; Huang, Yanqin; Zhang, Yujuan; Zheng, Xiufen; Wang, Shanshan; Wang, Yifan; Yu, Yanrong; Zhang, Meng; Yuan, Keng; Min, Weiping
2016-05-09
Macrophage polarization is a highly plastic physiological process that responds to a variety of environmental factors by changing macrophage phenotype and function. Tumor-associated macrophages (TAMs) are generally recognized as promoting tumor progression. As universal regulators, microRNAs (miRNAs) are functionally involved in numerous critical cellular processes including macrophage polarization. Let-7b, a miRNA, has differential expression patterns in inflamed tissues compared with healthy controls. However, whether and how miRNA let-7b regulates macrophage phenotype and function is unclear. In this report, we find that up-regulation of let-7b is characteristic of prostatic TAMs, and down-regulation of let-7b in TAMs leads to changes in expression profiles of inflammatory cytokines, such as IL-12, IL-23, IL-10 and TNF-α. As a result, TAMs treated with let-7b inhibitors reduce angiogenesis and prostate carcinoma (PCa) cell mobility. Let-7b may play a vital role in regulating macrophage polarization, thus modulating the prognosis of prostate cancer.
Evaluation of a high resolution silicon PET insert module
Energy Technology Data Exchange (ETDEWEB)
Grkovski, Milan, E-mail: milan.grkovski@ijs.si [Jožef Stefan Institute, Ljubljana (Slovenia); Memorial Sloan Kettering Cancer Center, New York, NY (United States); Brzezinski, Karol [IFIC/CSIC, Valencia (Spain); Cindro, Vladimir [Jožef Stefan Institute, Ljubljana (Slovenia); Clinthorne, Neal H. [University of Michigan, Ann Arbor, MI (United States); Kagan, Harris [Ohio State University, Columbus, OH (United States); Lacasta, Carlos [IFIC/CSIC, Valencia (Spain); Mikuž, Marko [Jožef Stefan Institute, Ljubljana (Slovenia); Solaz, Carles [IFIC/CSIC, Valencia (Spain); Studen, Andrej [Jožef Stefan Institute, Ljubljana (Slovenia); Weilhammer, Peter [Ohio State University, Columbus, OH (United States); Žontar, Dejan [Jožef Stefan Institute, Ljubljana (Slovenia)
2015-07-11
Conventional PET systems can be augmented with additional detectors placed in close proximity of the region of interest. We developed a high resolution PET insert module to evaluate the added benefit of such a combination. The insert module consists of two back-to-back 1 mm thick silicon sensors, each segmented into 1040 1 mm{sup 2} pads arranged in a 40 by 26 array. A set of 16 VATAGP7.1 ASICs and a custom assembled data acquisition board were used to read out the signal from the insert module. Data were acquired in slice (2D) geometry with a Jaszczak phantom (rod diameters of 1.2–4.8 mm) filled with {sup 18}F-FDG and the images were reconstructed with ML-EM method. Both data with full and limited angular coverage from the insert module were considered and three types of coincidence events were combined. The ratio of high-resolution data that substantially improves quality of the reconstructed image for the region near the surface of the insert module was estimated to be about 4%. Results from our previous studies suggest that such ratio could be achieved at a moderate technological expense by using an equivalent of two insert modules (an effective sensor thickness of 4 mm)
International Nuclear Information System (INIS)
Sushilov, N.V.; Kholodkevich, E.D.
1995-01-01
An analytical expression is derived for the polarization induced by a weak probe field with periodically modulated amplitude in a two-level medium saturated by a strong amplitude-and phase-modulated resonance field. It is shown that the absorption spectrum of the probe field includes parametric resonances, the maxima corresponding to the condition δ= 2nΓ-Ω w and the minima to that of δ= (2n + 1)Γ- w , where δ is the probe-field detuning front the resonance frequency, Ω w is the modulation frequency of the probe-field amplitude, and Γ is the transition line width, n = 1, 2, 3, hor-ellipsis. At the specific modulation parameters, a substantial region of negative values (i.e., the region of amplification without the population inversion) exists in the absorption spectrum of the probe field
Temperature-dependent modulation of regional lymphatic contraction frequency and flow.
Solari, Eleonora; Marcozzi, Cristiana; Negrini, Daniela; Moriondo, Andrea
2017-11-01
Lymph drainage and propulsion are sustained by an extrinsic mechanism, based on mechanical forces acting from the surrounding tissues against the wall of lymphatic vessels, and by an intrinsic mechanism attributable to active spontaneous contractions of the lymphatic vessel muscle. Despite being heterogeneous, the mechanisms underlying the generation of spontaneous contractions share a common biochemical nature and are thus modulated by temperature. In this study, we challenged excised tissues from rat diaphragm and hindpaw, endowed with spontaneously contracting lymphatic vessels, to temperatures from 24°C (hindpaw) or 33°C (diaphragmatic vessels) to 40°C while measuring lymphatic contraction frequency ( f c ) and amplitude. Both vessel populations displayed a sigmoidal relationship between f c and temperature, each centered around the average temperature of surrounding tissue (36.7 diaphragmatic and 32.1 hindpaw lymphatics). Although the slope factor of the sigmoidal fit to the f c change of hindpaw vessels was 2.3°C·cycles -1 ·min -1 , a value within the normal range displayed by simple biochemical reactions, the slope factor of the diaphragmatic lymphatics was 0.62°C·cycles -1 ·min -1 , suggesting the added involvement of temperature-sensing mechanisms. Lymph flow calculated as a function of temperature confirmed the relationship observed on f c data alone and showed that none of the two lymphatic vessel populations would be able to adapt to the optimal working temperature of the other tissue district. This poses a novel question whether lymphatic vessels might not adapt their function to accommodate the change if exposed to a surrounding temperature, which is different from their normal condition. NEW & NOTEWORTHY This study demonstrates to what extent lymphatic vessel intrinsic contractility and lymph flow are modulated by temperature and that this modulation is dependent on the body district that the vessels belong to, suggesting a possible
Ralli, Massimo; Altissimi, Giancarlo; Turchetta, Rosaria; Mazzei, Filippo; Salviati, Massimo; Cianfrone, Francesca; Orlando, Maria Patrizia; Testugini, Valeria; Cianfrone, Giancarlo
2016-01-01
In a subpopulation of patients, tinnitus can be modulated by movements of the jaw or head and neck due to complex somatosensory-auditory interactions. In some of these subjects, tinnitus could be related to an underlying temporomandibular (TMJ) or craniocervical (NECK) dysfunction that, if correctly identified, could streamline treatment and increase chances of tinnitus improvement. However, it is still unclear whether somatic modulation of tinnitus could be used as a screening tool for identifying such patients. In this study, we included 310 tinnitus patients with normal hearing, no psychiatric comorbidities, and a positive history of TMJ and/or NECK dysfunction and/or a positive modulation of tinnitus to evaluate the characteristics of somatic modulation, investigate the relationship between positive history and positive modulation, and identify factors most strongly associated with somatic modulation. Tinnitus modulation was present in 79.67% of the patients. We found a significant association within the same subjects between a positive history and a positive tinnitus modulation for the same region, mainly for TMJ in unilateral tinnitus patients and for TMJ + NECK in bilateral tinnitus patients. A strong correlation between history and modulation in the same somatic region within the same subgroups of subjects was also identified. Most TMJ maneuvers resulted in an increased loudness, while NECK maneuvers showed an increase in tinnitus loudness in about 59% of cases. High-pitched tinnitus and male gender were associated with a higher prevalence of modulation; no differences were found for tinnitus onset, Tinnitus Handicap Inventory score, and age. In this paper, we report a strong association between history and modulation for the same regions within the same patients; such an association should always be investigated to improve chances of a correct diagnosis of somatosensory tinnitus. © 2017 S. Karger AG, Basel.
Ellerström, M; Stålberg, K; Ezcurra, I; Rask, L
1996-12-01
The promoter region (-309 to +44) of the Brassica napus storage protein gene napA was studied in transgenic tobacco by successive 5' as well as internal deletions fused to the reporter gene GUS (beta-glucuronidase). The expression in the two main tissues of the seed, the endosperm and the embryo, was shown to be differentially regulated. This tissue-specific regulation within the seed was found to affect the developmental expression during seed development. The region between -309 to -152, which has a large effect on quantitative expression, was shown to harbour four elements regulating embryo and one regulating endosperm expression. This region also displayed enhancer activity. Deletion of eight bp from position -152 to position -144 totally abolished the activity of the napA promoter. This deletion disrupted a cis element with similarity to an ABA-responsive element (ABRE) overlapping with an E-box, demonstrating its crucial importance for quantitative expression. An internal deletion of the region -133 to -120, resulted in increased activity in both leaves and endosperm and a decreased activity in the embryo. Within this region, a cis element similar to the (CA)n element, found in other storage protein promoters, was identified. This suggest that the (CA)n element is important for conferring seed specificity by serving both as an activator and a repressor element.
Research on modulated structure alloys
International Nuclear Information System (INIS)
Tsujimoto, Tokuzo; Saito, Kazuo; Hashimoto, Kenki
1982-01-01
Research was carried out for the purposes of clarifying the cause of modulated structure formation, developing the structure control method utilizing modulated structure and clarifying the suitability of modulated structure alloys as radiation damage-resisting materials. The research on structure control method encountered a difficulty in the analysis of experimental results, bu the following results were obtained in the other items. The method of solving a diffusion equation including a nonlinear term was found in course of the clarification of the cause of modulated structure formation. As a means of detecting faint unevenness in solid solution, of which the deviation of composition is a few %, the structure analysis method utilizing magnetic property was developed. This method was applied to Ni-9.6 at.% Ti alloy, and the process of expanding amplitude in composition variation in spinodal decomposition and the formation of solute atomshort region at the time of nucleation-growth were confirmed. Utilizing the high energy electron beam generated in a superhigh voltage electron microscope, electron beam irradiation experiment was carried out on precipitation hardening alloys with modulated structure. As the result, it was found that in Ni-Ti alloy, the amount of void swelling resistance showed the change with the increase of modulated structure period. (Kako, I.)
Streptomyces rhizobacteria modulate the secondary metabolism of Eucalyptus plants.
Salla, Tamiris Daros; da Silva, Ramos; Astarita, Leandro Vieira; Santarém, Eliane Romanato
2014-12-01
The genus Eucalyptus comprises economically important species, such as Eucalyptus grandis and Eucalyptus globulus, used especially as a raw material in many industrial sectors. Species of Eucalyptus are very susceptible to pathogens, mainly fungi, which leads to mortality of plant cuttings in rooting phase. One alternative to promote plant health and development is the potential use of microorganisms that act as agents for biological control, such as plant growth-promoting rhizobacteria (PGPR). Rhizobacteria Streptomyces spp have been considered as PGPR. This study aimed at selecting strains of Streptomyces with ability to promote plant growth and modulate secondary metabolism of E. grandis and E. globulus in vitro plants. The experiments assessed the development of plants (root number and length), changes in key enzymes in plant defense (polyphenol oxidase and peroxidase) and induction of secondary compounds(total phenolic and quercetinic flavonoid fraction). The isolate Streptomyces PM9 showed highest production of indol-3-acetic acid and the best potential for root induction. Treatment of Eucalyptus roots with Streptomyces PM9 caused alterations in enzymes activities during the period of co-cultivation (1-15 days), as well as in the levels of phenolic compounds and flavonoids. Shoots also showed alteration in the secondary metabolism, suggesting induced systemic response. The ability of Streptomyces sp. PM9 on promoting root growth, through production of IAA, and possible role on modulation of secondary metabolism of Eucalyptus plants characterizes this isolate as PGPR and indicates its potential use as a biological control in forestry.
What Factors Promote Student Resilience on a Level 1 Distance Learning Module?
Simons, Joan; Beaumont, Kythe; Holland, Lesley
2018-01-01
Resilience is understood to be the ability to adapt positively in the face of adversity. In relation to new students on a distance learning module, this can mean how they adapt and make sense of the demands of their chosen study to enable them to persist in their studies. This article reports a small-scale study involving semi-structured telephone…
Potential-Induced Degradation-Delamination Mode in Crystalline Silicon Modules: Preprint
Energy Technology Data Exchange (ETDEWEB)
Hacke, Peter L [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Kempe, Michael D [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Wohlgemuth, John [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Li, Jichao [SunPower Corporation; Shen, Yu-Chen [SunPower Corporation
2018-03-21
A test sequence producing potential-induced degradation-delamination (PID-d) in crystalline silicon modules has been tested and found comparable under visual inspection to cell/encapsulant delamination seen in some fielded modules. Four commercial modules were put through this sequence, 85 degrees C, 85%, 1000 h damp heat, followed by an intensive PID stress sequence of 72 degrees C, 95% RH, and -1000 V, with the module face grounded using a metal foil. The 60 cell c-Si modules exhibiting the highest current transfer (4.4 center dot 10-4 A) exhibited PID-d at the first inspection after 156 h of PID stress. Effects promoting PID-d are reduced adhesion caused by damp heat, sodium migration further reducing adhesion to the cells, and gaseous products of electrochemical reactions driven by the applied system voltage. A new work item proposal for an IEC test standard to evaluate for PID-d is anticipated.
Energy Technology Data Exchange (ETDEWEB)
Wu, Yongyan [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); Ai, Zhiying [Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); College of Life Sciences, Northwest A and F University, Yangling 712100, Shaanxi (China); Yao, Kezhen [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); Cao, Lixia; Du, Juan; Shi, Xiaoyan [Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); College of Life Sciences, Northwest A and F University, Yangling 712100, Shaanxi (China); Guo, Zekun, E-mail: gzk@nwsuaf.edu.cn [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); Zhang, Yong, E-mail: zhylab@hotmail.com [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China)
2013-10-15
Embryonic stem cells (ESCs) can proliferate indefinitely in vitro and differentiate into cells of all three germ layers. These unique properties make them exceptionally valuable for drug discovery and regenerative medicine. However, the practical application of ESCs is limited because it is difficult to derive and culture ESCs. It has been demonstrated that CHIR99021 (CHIR) promotes self-renewal and enhances the derivation efficiency of mouse (m)ESCs. However, the downstream targets of CHIR are not fully understood. In this study, we identified CHIR-regulated genes in mESCs using microarray analysis. Our microarray data demonstrated that CHIR not only influenced the Wnt/β-catenin pathway by stabilizing β-catenin, but also modulated several other pluripotency-related signaling pathways such as TGF-β, Notch and MAPK signaling pathways. More detailed analysis demonstrated that CHIR inhibited Nodal signaling, while activating bone morphogenetic protein signaling in mESCs. In addition, we found that pluripotency-maintaining transcription factors were up-regulated by CHIR, while several developmental-related genes were down-regulated. Furthermore, we found that CHIR altered the expression of epigenetic regulatory genes and long intergenic non-coding RNAs. Quantitative real-time PCR results were consistent with microarray data, suggesting that CHIR alters the expression pattern of protein-encoding genes (especially transcription factors), epigenetic regulatory genes and non-coding RNAs to establish a relatively stable pluripotency-maintaining network. - Highlights: • Combined use of CHIR with LIF promotes self-renewal of J1 mESCs. • CHIR-regulated genes are involved in multiple pathways. • CHIR inhibits Nodal signaling and promotes Bmp4 expression to activate BMP signaling. • Expression of epigenetic regulatory genes and lincRNAs is altered by CHIR.
International Nuclear Information System (INIS)
Wu, Yongyan; Ai, Zhiying; Yao, Kezhen; Cao, Lixia; Du, Juan; Shi, Xiaoyan; Guo, Zekun; Zhang, Yong
2013-01-01
Embryonic stem cells (ESCs) can proliferate indefinitely in vitro and differentiate into cells of all three germ layers. These unique properties make them exceptionally valuable for drug discovery and regenerative medicine. However, the practical application of ESCs is limited because it is difficult to derive and culture ESCs. It has been demonstrated that CHIR99021 (CHIR) promotes self-renewal and enhances the derivation efficiency of mouse (m)ESCs. However, the downstream targets of CHIR are not fully understood. In this study, we identified CHIR-regulated genes in mESCs using microarray analysis. Our microarray data demonstrated that CHIR not only influenced the Wnt/β-catenin pathway by stabilizing β-catenin, but also modulated several other pluripotency-related signaling pathways such as TGF-β, Notch and MAPK signaling pathways. More detailed analysis demonstrated that CHIR inhibited Nodal signaling, while activating bone morphogenetic protein signaling in mESCs. In addition, we found that pluripotency-maintaining transcription factors were up-regulated by CHIR, while several developmental-related genes were down-regulated. Furthermore, we found that CHIR altered the expression of epigenetic regulatory genes and long intergenic non-coding RNAs. Quantitative real-time PCR results were consistent with microarray data, suggesting that CHIR alters the expression pattern of protein-encoding genes (especially transcription factors), epigenetic regulatory genes and non-coding RNAs to establish a relatively stable pluripotency-maintaining network. - Highlights: • Combined use of CHIR with LIF promotes self-renewal of J1 mESCs. • CHIR-regulated genes are involved in multiple pathways. • CHIR inhibits Nodal signaling and promotes Bmp4 expression to activate BMP signaling. • Expression of epigenetic regulatory genes and lincRNAs is altered by CHIR
Construction and performance of the ATLAS silicon microstrip barrel modules
International Nuclear Information System (INIS)
Kondo, T.; Apsimon, R.; Beck, G.A.; Bell, P.; Brenner, R.; Bruckman de Renstrom, P.; Carter, A.A.; Carter, J.R.; Charlton, D.; Dabrowski, W.; Dorholt, O.; Ekelof, T.; Eklund, L.; Gibson, M.; Gadomski, S.; Grillo, A.; Grosse-Knetter, J.; Haber, C.; Hara, K.; Hill, J.C.; Ikegami, Y.; Iwata, Y.; Johansen, L.G.; Kohriki, T.; Macpherson, A.; McMahon, S.; Moorhead, G.; Morin, J.; Morris, J.; Morrissey, M.; Nagai, K.; Nakano, I.; Pater, J.; Pernegger, H.; Perrin, E.; Phillips, P.; Robinson, D.; Skubic, B.; Spencer, N.; Stapnes, S.; Stugu, B.; Takashima, R.; Terada, S.; Tyndel, M.; Ujiie, N.; Unno, Y.; Vos, M.
2002-01-01
The ATLAS Semiconductor Tracker (SCT) consists of four barrel cylinders and 18 end-cap disks. This paper describes the SCT modules of the barrel region, of which more than 2000 are about to be constructed. The module design is fixed. Its design concept is given together with the electrical, thermal and mechanical specifications. The pre-series production of the barrel modules is underway using mass-production procedures and jigs. The pre-series modules have given satisfactory performances on noise, noise occupancy, electrical as well as mechanical and thermal properties. In addition, irradiated modules were demonstrated to work successfully. Also first results from a 10-module system test are given
Recommendations on practice of conditioned pain modulation (CPM) testing.
Yarnitsky, D; Bouhassira, D; Drewes, A M; Fillingim, R B; Granot, M; Hansson, P; Landau, R; Marchand, S; Matre, D; Nilsen, K B; Stubhaug, A; Treede, R D; Wilder-Smith, O H G
2015-07-01
Protocols for testing conditioned pain modulation (CPM) vary between different labs/clinics. In order to promote research and clinical application of this tool, we summarize the recommendations of interested researchers consensus meeting regarding the practice of CPM and report of its results. © 2014 European Pain Federation - EFIC®
Allosteric modulation of G-protein coupled receptors
DEFF Research Database (Denmark)
Jensen, Anders A.; Spalding, Tracy A
2004-01-01
are believed to activate (agonists) or inhibit (competitive antagonists) receptor signalling by binding the receptor at the same site as the endogenous agonist, the orthosteric site. In contrast, allosteric ligands modulate receptor function by binding to different regions in the receptor, allosteric sites....... In recent years, combinatorial chemistry and high throughput screening have helped identify several allosteric GPCR modulators with novel structures, several of which already have become valuable pharmacological tools and may be candidates for clinical testing in the near future. This mini review outlines...... the current status and perspectives of allosteric modulation of GPCR function with emphasis on the pharmacology of endogenous and synthesised modulators, their receptor interactions and the therapeutic prospects of allosteric ligands compared to orthosteric ligands....
Combgap Promotes Ovarian Niche Development and Chromatin Association of EcR-Binding Regions in BR-C.
Hitrik, Anna; Popliker, Malka; Gancz, Dana; Mukamel, Zohar; Lifshitz, Aviezer; Schwartzman, Omer; Tanay, Amos; Gilboa, Lilach
2016-11-01
The development of niches for tissue-specific stem cells is an important aspect of stem cell biology. Determination of niche size and niche numbers during organogenesis involves precise control of gene expression. How this is achieved in the context of a complex chromatin landscape is largely unknown. Here we show that the nuclear protein Combgap (Cg) supports correct ovarian niche formation in Drosophila by controlling ecdysone-Receptor (EcR)- mediated transcription and long-range chromatin contacts in the broad locus (BR-C). Both cg and BR-C promote ovarian growth and the development of niches for germ line stem cells. BR-C levels were lower when Combgap was either reduced or over-expressed, indicating an intricate regulation of the BR-C locus by Combgap. Polytene chromosome stains showed that Cg co-localizes with EcR, the major regulator of BR-C, at the BR-C locus and that EcR binding to chromatin was sensitive to changes in Cg levels. Proximity ligation assay indicated that the two proteins could reside in the same complex. Finally, chromatin conformation analysis revealed that EcR-bound regions within BR-C, which span ~30 KBs, contacted each other. Significantly, these contacts were stabilized in an ecdysone- and Combgap-dependent manner. Together, these results highlight Combgap as a novel regulator of chromatin structure that promotes transcription of ecdysone target genes and ovarian niche formation.
Flux penetration in a superconducting alloy with spatial by modulated concentration
International Nuclear Information System (INIS)
Dobrosavljevic, L.; Centre National de la Recherche Scientifique, 38 - Grenoble
1976-01-01
The flux penetration in inhomogeneous superconductors with periodic structure is studied. Superconducting alloys with the impurity concentration varying periodically in one direction are considered. In a London model the magnetic structure of a single vortex, the change of its self-energy and of the interaction between two vortices due to the concentration modulation are studied. The matching between the vortex lattice and the periodic modulation of the concentration are also studied: at some definite values of the external field, H=Hsub(n1,n2), the vortices are arranged in a triangular lattice in such a way that all the vortices lie in the high concentration regions. The projection of the sides of the triangles on the modulation direction is then a multiple of the modulation period L 0 . At H=Hsub(n1,n2) the Gibbs' free energy of the system is lowered and a pinning vortices takes place. The possibility of such a matching effect in the low field region (H> approximately Hsub(1)) and in the intermediate field region (Hsub(c1) [fr
Practicing health promotion in primary care -a reflective enquiry.
Pati, S; Chauhan, A S; Mahapatra, S; Sinha, R; Pati, S
2017-12-01
Health promotion is an integral part of routine clinical practice. The physicians' role in improving the health status of the general population, through effective understanding and delivery of health promotion practice, is evident throughout the international literature. Data from India suggest that physicians have limited skills in delivering specific health promotion services. However, the data available on this is scarce. This study was planned to document the current health promotion knowledge, perception and practices of local primary care physicians in Odisha. An exploratory study was planned between the months of January - February 2013 in Odisha among primary care physicians working in government set up. This exploratory study was conducted, using a two-step self-administered questionnaire, thirty physicians practicing under government health system were asked to map their ideal and current health promotion practice, and potential health promotion elements to be worked upon to enhance the practice. The study recorded a significant difference between the mean of current and ideal health promotion practices. The study reported that physicians want to increase their practice on health education. We concluded that inclusion of health promotion practices in routine care is imperative for a strong healthcare system. It should be incorporated as a structured health promotion module in medical curriculum as well.
Energy Technology Data Exchange (ETDEWEB)
Ohashi, Koji [Department of Clinical Biochemistry, Fujita Health University School of Health Sciences, Toyoake (Japan); Munetsuna, Eiji [Department of Biochemistry, Fujita Health University School of Medicine, Toyoake (Japan); Yamada, Hiroya, E-mail: hyamada@fujita-hu.ac.jp [Department of Hygiene, Fujita Health University School of Medicine, Toyoake (Japan); Ando, Yoshitaka [Department of Joint Research Laboratory of Clinical Medicine, Fujita Health University Hospital, Toyoake (Japan); Yamazaki, Mirai; Taromaru, Nao; Nagura, Ayuri; Ishikawa, Hiroaki [Department of Clinical Biochemistry, Fujita Health University School of Health Sciences, Toyoake (Japan); Suzuki, Koji [Department of Public Health, Fujita Health University School of Health Sciences, Toyoake (Japan); Teradaira, Ryoji [Department of Clinical Biochemistry, Fujita Health University School of Health Sciences, Toyoake (Japan); Hashimoto, Shuji [Department of Hygiene, Fujita Health University School of Medicine, Toyoake (Japan)
2015-12-04
DNA methylation status is affected by environmental factors, including nutrition. Fructose consumption is considered a risk factor for the conditions that make up metabolic syndrome such as dyslipidemia. However, the pathogenetic mechanism by which fructose consumption leads to metabolic syndrome is unclear. Based on observations that epigenetic modifications are closely related to induction of metabolic syndrome, we hypothesized that fructose-induced metabolic syndrome is caused by epigenetic alterations. Male SD rats were designated to receive water or 20% fructose solution for 14 weeks. mRNA levels for peroxisome proliferator-activated receptor alpha (PPARα) and carnitine palmitoyltransferase 1A (CPT1A) was analyzed using Real-time PCR. Restriction digestion and real-time PCR (qAMP) was used for the analysis of DNA methylation status. Hepatic lipid accumulation was also observed by fructose intake. Fructose feeding also significantly decreased mRNA levels for PPARα and CPT1A. qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status, and pathogenesis of metabolic syndrome induced by fructose relates to DNA methylation status. - Highlights: • No general consensus has been reached regarding the molecular mechanisms of the pathogenesis of fructose-induced diseases. • Significant increase in hepatic total methylation level was observed after fructose-supplemented feeding. • Fructose feeding significantly decreased mRNA levels for PPARα and CPT1A. • qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. • Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status in rat liver.
International Nuclear Information System (INIS)
Ohashi, Koji; Munetsuna, Eiji; Yamada, Hiroya; Ando, Yoshitaka; Yamazaki, Mirai; Taromaru, Nao; Nagura, Ayuri; Ishikawa, Hiroaki; Suzuki, Koji; Teradaira, Ryoji; Hashimoto, Shuji
2015-01-01
DNA methylation status is affected by environmental factors, including nutrition. Fructose consumption is considered a risk factor for the conditions that make up metabolic syndrome such as dyslipidemia. However, the pathogenetic mechanism by which fructose consumption leads to metabolic syndrome is unclear. Based on observations that epigenetic modifications are closely related to induction of metabolic syndrome, we hypothesized that fructose-induced metabolic syndrome is caused by epigenetic alterations. Male SD rats were designated to receive water or 20% fructose solution for 14 weeks. mRNA levels for peroxisome proliferator-activated receptor alpha (PPARα) and carnitine palmitoyltransferase 1A (CPT1A) was analyzed using Real-time PCR. Restriction digestion and real-time PCR (qAMP) was used for the analysis of DNA methylation status. Hepatic lipid accumulation was also observed by fructose intake. Fructose feeding also significantly decreased mRNA levels for PPARα and CPT1A. qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status, and pathogenesis of metabolic syndrome induced by fructose relates to DNA methylation status. - Highlights: • No general consensus has been reached regarding the molecular mechanisms of the pathogenesis of fructose-induced diseases. • Significant increase in hepatic total methylation level was observed after fructose-supplemented feeding. • Fructose feeding significantly decreased mRNA levels for PPARα and CPT1A. • qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. • Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status in rat liver.
Evaluation of methylation pattern in promoter region of E-cadherin ...
African Journals Online (AJOL)
user
2011-03-07
Mar 7, 2011 ... promoter methylation in CDH1 gene inactivation in breast cancer, the CpG methylation status of E- ..... 5'CpG island of CDH1 in prostate, lung, liver, bladder, .... and estrogen receptor alpha from Sp1 sites to induce cell cycle.
Network-dependent modulation of brain activity during sleep.
Watanabe, Takamitsu; Kan, Shigeyuki; Koike, Takahiko; Misaki, Masaya; Konishi, Seiki; Miyauchi, Satoru; Miyahsita, Yasushi; Masuda, Naoki
2014-09-01
Brain activity dynamically changes even during sleep. A line of neuroimaging studies has reported changes in functional connectivity and regional activity across different sleep stages such as slow-wave sleep (SWS) and rapid-eye-movement (REM) sleep. However, it remains unclear whether and how the large-scale network activity of human brains changes within a given sleep stage. Here, we investigated modulation of network activity within sleep stages by applying the pairwise maximum entropy model to brain activity obtained by functional magnetic resonance imaging from sleeping healthy subjects. We found that the brain activity of individual brain regions and functional interactions between pairs of regions significantly increased in the default-mode network during SWS and decreased during REM sleep. In contrast, the network activity of the fronto-parietal and sensory-motor networks showed the opposite pattern. Furthermore, in the three networks, the amount of the activity changes throughout REM sleep was negatively correlated with that throughout SWS. The present findings suggest that the brain activity is dynamically modulated even in a sleep stage and that the pattern of modulation depends on the type of the large-scale brain networks. Copyright © 2014 Elsevier Inc. All rights reserved.
Choi, Jee-Hye; Min, Na Young; Park, Jina; Kim, Jin Hong; Park, Soo Hyun; Ko, Young Jong; Kang, Yoonsung; Moon, Young Joon; Rhee, Sangmyung; Ham, Seung Wook; Park, Ae Ja; Lee, Kwang-Ho
2010-01-01
Trichostatin A (TSA), an inhibitor of histone deacetylase, is a well-known antitumor agent that effectively and selectively induces tumor growth arrest and apoptosis. Recently, it was reported that hTERT is one of the primary targets for TSA-induced apoptosis in cancer cells but the mechanism of which has not yet been elucidated. In the present study, to better understand the epigenetic regulation mechanism responsible for the repression of hTERT by TSA, we examined expression of hTERT in the HCT116 colon cancer cell line after treatment with TSA and performed site-specific CpG methylation analysis of the hTERT promoter. We found that TSA-induced the demethylation of site-specific CpGs on the promoter of hTERT, which was caused by down-regulation of DNA methyltransferase 1 (DNMT1). Among the demethylated region, the 31st-33rd CpGs contained a binding site for CTCF, an inhibitor of hTERT transcription. ChIP analysis revealed that TSA-induced demethylation of the 31st-33rd CpGs promoted CTCF binding on hTERT promoter, leading to repression of hTERT. Taken together, down-regulation of DNMT1 by TSA caused demethylation of a CTCF binding site on the hTERT promoter, the result of which was repression of hTERT via recruitment of CTCF to the promoter. Copyright 2009 Elsevier Inc. All rights reserved.
The effect of phenobarbital on the methylation level of the p16 promoter region in rat liver
International Nuclear Information System (INIS)
Kostka, Grazyna; Urbanek, Katarzyna; Ludwicki, Jan K.
2007-01-01
It has been suggested that non-genotoxic carcinogens (NGCs) may cause modification of the DNA methylation status. We studied the effects of phenobarbital (PB) - a non-genotoxic rodent liver carcinogen - on the methylation level of the promoter region of the p16 suppressor gene, as well as on hepatomegaly, DNA synthesis, and DNA-methyltransferase (DNMTs) activity in the rat liver. Male Wistar rats received PB in 1, 3 or 14 daily oral doses (at 24-h intervals), each equivalent to 1/10 of the LD 50 value. The study showed that PB has caused persistent elevation in relative liver weight (RLW) as well as a transient increase in DNA synthesis. This suggests that the PB-induced increase in RLW was due to a combination of both hyperplasia and hypertrophy of liver cells. The effect of PB on DNA synthesis corresponded to an increase in the methylation pattern of the p16 promoter sequence. Methylation of cytosine in the analyzed CpG sites of the p16 gene was found after short exposure of the animals to PB. Treatment of rats with PB for 1 and 3 days also produced an increase in nuclear DNMTs activity. After prolonged administration (14 days), DNA synthesis declined, returning to the control level. No changes in methylation of the p16 gene nor in DNMTs activity were observed. The reversibility of early induced changes in target tissues is a mark characteristic of tumor promoters. Thus, transient changes in methylation of the p16 gene, although their direct role in the mechanisms of PB toxicity, including its carcinogenic action, remains doubtful, may therefore be a significant element of such processes
Directory of Open Access Journals (Sweden)
Vassilis MONASTIRIOTIS
2010-12-01
Full Text Available Studies on the productivity spillovers of FDI have concentrated on the nationalsectoral level. As a result, little is known about the impact of FDI on absolute and relative regional economic performance. In this paper we examine this issue by relying on a unique dataset of over 20,000 Greek firms for the period 2002-2006 covering all sectors of economic activity. We examine the spatial distribution of foreign-owned firms in the country and analyse the effect that their presence – at the local, regional and national levels – has on the productivity of domestic firms. We find strong evidence suggesting that foreignowned firms self-select into regions and sectors of high productivity. Net of this selection effect, the impact of foreign presence on domestic productivity is negative – although at the very local level some positive spillover effects are identifiable. The bulk of the effects concentrate in non-manufacturing activities, high-tech sectors, and medium-sized high-productivity firms. Importantly, this effect is not constant across space however. Productivity spillovers tend to be negative in the regions hosting the main urban areas in the country but positive in smaller and more peripheral regions. In this way, despite the tendency of FDI to concentrate in a limited number of areas within the country – those of the highest level of development – the externalities that FDI activity generates to the local economies appear to be of a rather equilibrating character.
Luethy, Paul M; Huynh, Steven; Ribardo, Deborah A; Winter, Sebastian E; Parker, Craig T; Hendrixson, David R
2017-05-09
Campylobacter jejuni promotes commensalism in the intestinal tracts of avian hosts and diarrheal disease in humans, yet components of intestinal environments recognized as spatial cues specific for different intestinal regions by the bacterium to initiate interactions in either host are mostly unknown. By analyzing a C. jejuni acetogenesis mutant defective in converting acetyl coenzyme A (Ac-CoA) to acetate and commensal colonization of young chicks, we discovered evidence for in vivo microbiota-derived short-chain fatty acids (SCFAs) and organic acids as cues recognized by C. jejuni that modulate expression of determinants required for commensalism. We identified a set of C. jejuni genes encoding catabolic enzymes and transport systems for amino acids required for in vivo growth whose expression was modulated by SCFAs. Transcription of these genes was reduced in the acetogenesis mutant but was restored upon supplementation with physiological concentrations of the SCFAs acetate and butyrate present in the lower intestinal tracts of avian and human hosts. Conversely, the organic acid lactate, which is abundant in the upper intestinal tract where C. jejuni colonizes less efficiently, reduced expression of these genes. We propose that microbiota-generated SCFAs and lactate are cues for C. jejuni to discriminate between different intestinal regions. Spatial gradients of these metabolites likely allow C. jejuni to locate preferred niches in the lower intestinal tract and induce expression of factors required for intestinal growth and commensal colonization. Our findings provide insights into the types of cues C. jejuni monitors in the avian host for commensalism and likely in humans to promote diarrheal disease. IMPORTANCE Campylobacter jejuni is a commensal of the intestinal tracts of avian species and other animals and a leading cause of diarrheal disease in humans. The types of cues sensed by C. jejuni to influence responses to promote commensalism or
Nonlinear modulation of ionization waves
International Nuclear Information System (INIS)
Bekki, Naoaki
1981-01-01
In order to investigate the nonlinear characteristics of ionization waves (moving-striations) in the positive column of glow discharge, a nonlinear modulation of ionization waves in the region of the Pupp critical current is analysed by means of the reductive perturbation method. The modulation of ionization waves is described by a nonlinear Schroedinger type equation. The coefficients of the equation are evaluated using the data of the low pressure Argon-discharge, and the simple solutions (plane wave and envelope soliton type solutions) are presented. Under a certain condition an envelope soliton is propagated through the positive column. (author)
The feasibility of a regional CTDIvol to estimate organ dose from tube current modulated CT exams
International Nuclear Information System (INIS)
Khatonabadi, Maryam; Kim, Hyun J.; Lu, Peiyun; McMillan, Kyle L.; Cagnon, Chris H.; McNitt-Gray, Michael F.; DeMarco, John J.
2013-01-01
Purpose: In AAPM Task Group 204, the size-specific dose estimate (SSDE) was developed by providing size adjustment factors which are applied to the Computed Tomography (CT) standardized dose metric, CTDI vol . However, that work focused on fixed tube current scans and did not specifically address tube current modulation (TCM) scans, which are currently the majority of clinical scans performed. The purpose of this study was to extend the SSDE concept to account for TCM by investigating the feasibility of using anatomic and organ specific regions of scanner output to improve accuracy of dose estimates. Methods: Thirty-nine adult abdomen/pelvis and 32 chest scans from clinically indicated CT exams acquired on a multidetector CT using TCM were obtained with Institutional Review Board approval for generating voxelized models. Along with image data, raw projection data were obtained to extract TCM functions for use in Monte Carlo simulations. Patient size was calculated using the effective diameter described in TG 204. In addition, the scanner-reported CTDI vol (CTDI vol,global ) was obtained for each patient, which is based on the average tube current across the entire scan. For the abdomen/pelvis scans, liver, spleen, and kidneys were manually segmented from the patient datasets; for the chest scans, lungs and for female models only, glandular breast tissue were segmented. For each patient organ doses were estimated using Monte Carlo Methods. To investigate the utility of regional measures of scanner output, regional and organ anatomic boundaries were identified from image data and used to calculate regional and organ-specific average tube current values. From these regional and organ-specific averages, CTDI vol values, referred to as regional and organ-specific CTDI vol , were calculated for each patient. Using an approach similar to TG 204, all CTDI vol values were used to normalize simulated organ doses; and the ability of each normalized dose to correlate with
International Nuclear Information System (INIS)
Guo, Bin; Liu, Chen; Li, Hua; Yi, Keke; Ding, Nengfei; Li, Ningyu; Lin, Yicheng; Fu, Qinglin
2016-01-01
Highlights: • The role of endogenous SA in mediating Cd tolerance was explored using sid2 mutants. • Cd stress induces SA accumulation in a SID2 dependent way. • Depletion of SA causes negative effects on Cd tolerance. • Endogenous SA is required for promoting Cd tolerance by modulating GSH metabolism. • Possible mode of SA signaling through GR/GSH pathway under Cd toxicity was discussed. - Abstract: A few studies with NahG transgenic lines of Arabidopsis show that depletion of SA enhances cadmium (Cd) tolerance. However, it remains some uncertainties that the defence signaling may be a result of catechol accumulation in NahG transgenic lines but not SA deficiency. Here, we conducted a set of hydroponic assays with another SA-deficient mutant sid2 to examine the endogenous roles of SA in Cd tolerance, especially focusing on the glutathione (GSH) cycling. Our results showed that reduced SA resulted in negative effects on Cd tolerance, including decreased Fe uptake and chlorophyll concentration, aggravation of oxidative damage and growth inhibition. Cd exposure significantly increased SA concentration in wild-type leaves, but did not affect it in sid2 mutants. Depletion of SA did not disturb the Cd uptake in either roots or shoots. The reduced Cd tolerance in sid2 mutants is due to the lowered GSH status, which is associated with the decreased expression of serine acetyltransferase along with a decline in contents of non-protein thiols, phytochelatins, and the lowered transcription and activities of glutathione reductase1 (GR1) which reduced GSH regeneration. Finally, the possible mode of SA signaling through the GR/GSH pathway during Cd exposure is discussed.
Energy Technology Data Exchange (ETDEWEB)
Guo, Bin, E-mail: ndgb@163.com [Institute of Environment, Resource, Soil and Fertilizer, Zhejiang Academy of Agricultural Sciences, Geological Research Center For Agricultural Applications, China Geological Survey, Hangzhou (China); Liu, Chen; Li, Hua [Institute of Environment, Resource, Soil and Fertilizer, Zhejiang Academy of Agricultural Sciences, Geological Research Center For Agricultural Applications, China Geological Survey, Hangzhou (China); Yi, Keke [Institute of Virology and Biotechnology, Zhejiang Academy of Agricultural Sciences, Hangzhou (China); Ding, Nengfei; Li, Ningyu; Lin, Yicheng [Institute of Environment, Resource, Soil and Fertilizer, Zhejiang Academy of Agricultural Sciences, Geological Research Center For Agricultural Applications, China Geological Survey, Hangzhou (China); Fu, Qinglin, E-mail: fuql161@yahoo.com.cn [Institute of Environment, Resource, Soil and Fertilizer, Zhejiang Academy of Agricultural Sciences, Geological Research Center For Agricultural Applications, China Geological Survey, Hangzhou (China)
2016-10-05
Highlights: • The role of endogenous SA in mediating Cd tolerance was explored using sid2 mutants. • Cd stress induces SA accumulation in a SID2 dependent way. • Depletion of SA causes negative effects on Cd tolerance. • Endogenous SA is required for promoting Cd tolerance by modulating GSH metabolism. • Possible mode of SA signaling through GR/GSH pathway under Cd toxicity was discussed. - Abstract: A few studies with NahG transgenic lines of Arabidopsis show that depletion of SA enhances cadmium (Cd) tolerance. However, it remains some uncertainties that the defence signaling may be a result of catechol accumulation in NahG transgenic lines but not SA deficiency. Here, we conducted a set of hydroponic assays with another SA-deficient mutant sid2 to examine the endogenous roles of SA in Cd tolerance, especially focusing on the glutathione (GSH) cycling. Our results showed that reduced SA resulted in negative effects on Cd tolerance, including decreased Fe uptake and chlorophyll concentration, aggravation of oxidative damage and growth inhibition. Cd exposure significantly increased SA concentration in wild-type leaves, but did not affect it in sid2 mutants. Depletion of SA did not disturb the Cd uptake in either roots or shoots. The reduced Cd tolerance in sid2 mutants is due to the lowered GSH status, which is associated with the decreased expression of serine acetyltransferase along with a decline in contents of non-protein thiols, phytochelatins, and the lowered transcription and activities of glutathione reductase1 (GR1) which reduced GSH regeneration. Finally, the possible mode of SA signaling through the GR/GSH pathway during Cd exposure is discussed.
Constructing a State Policy To Promote Regionalism in School Government.
Zukowsky, Jerome; And Others.
This paper defines regionalism, sets some tentative directions for the concept, and raises difficult questions related to its application in New York State. Regionalism, which offers an alternative to a State-local school governing system, is used to decentralize the planning and management of public services. A regional unit permits district…
Assembly and Electrical Tests of the First Full-size Forward Module for the ATLAS ITk Strip Detector
Garcia-Argos, Carlos; The ATLAS collaboration
2017-01-01
The ATLAS experiment will replace the existing Inner Detector by an all-silicon detector named the Inner Tracker (ITk) for the High Luminosity LHC upgrades. In the outer region of the Inner Tracker is the strip detector, which consists of a four layer barrel and six discs to each side of the barrel, with silicon-strip modules as basic units. Each module is composed of a sensor and one or more flex circuits that hold the read-out electronics. In the experiment, the modules are mounted on support structures with integrated power and cooling. The modules are designed with geometries that accommodate the central and forward regions, with rectangular sensors in the barrels and wedge shaped sensors in the end-caps. The strips lengths and pitch sizes vary according to the occupancy of the region. In this contribution, we present the construction and the results of the electrical tests of the first full-size module of the innermost forward region, named Ring 0 in the ATLAS ITk strip detector nomenclature. This module...
Sun, X; Lu, B; Hu, B; Xiao, W; Li, W; Huang, Z
2014-03-28
12-O-tetradecanoylphorbol-13-acetate (TPA) activates multiple signaling pathways, alters gene expression and causes leukemic cell differentiation. How TPA-induced genes contribute to leukemic cell differentiation remains elusive. We noticed that chromosome 7 open reading frame 41 (C7ORF41) was a TPA-responsive gene and its upregulation concurred with human megakaryocyte differentiation. In K562 cells, ectopic expression of C7ORF41 significantly increased CD61 expression, enhanced ERK and JNK signaling, and upregulated RUNX1 and FLI1, whereas C7ORF41 knockdown caused an opposite phenotype. These observations suggest that C7ORF41 may promote megakaryocyte differentiation partially through modulating ERK and JNK signaling that leads to upregulation of RUNX1 and FLI1. In supporting this, C7ORF41 overexpression rescued megakaryocyte differentiation blocked by ERK inhibition while JNK inhibition abrogated the upregulation of FLI1 by C7ORF41. Furthermore, we found that Y34F mutant C7ORF41 inhibited megakaryocyte differentiation. nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) was the major activator of C7ORF41 that in turn repressed NF-κB activity by inhibiting its phosphorylation at serine 536, while MAPK/ERK was the potent repressor of C7ORF41. Finally, we showed that C7ORF41 knockdown in mouse fetal liver cells impaired megakaryocyte differentiation. Taken together, we have identified the function of a novel gene C7ORF41 that forms interplaying regulatory network in TPA-induced signaling and promotes leukemic and normal megakaryocyte differentiation.
International Nuclear Information System (INIS)
Sun, X; Lu, B; Hu, B; Xiao, W; Li, W; Huang, Z
2014-01-01
12-O-tetradecanoylphorbol-13-acetate (TPA) activates multiple signaling pathways, alters gene expression and causes leukemic cell differentiation. How TPA-induced genes contribute to leukemic cell differentiation remains elusive. We noticed that chromosome 7 open reading frame 41 (C7ORF41) was a TPA-responsive gene and its upregulation concurred with human megakaryocyte differentiation. In K562 cells, ectopic expression of C7ORF41 significantly increased CD61 expression, enhanced ERK and JNK signaling, and upregulated RUNX1 and FLI1, whereas C7ORF41 knockdown caused an opposite phenotype. These observations suggest that C7ORF41 may promote megakaryocyte differentiation partially through modulating ERK and JNK signaling that leads to upregulation of RUNX1 and FLI1. In supporting this, C7ORF41 overexpression rescued megakaryocyte differentiation blocked by ERK inhibition while JNK inhibition abrogated the upregulation of FLI1 by C7ORF41. Furthermore, we found that Y34F mutant C7ORF41 inhibited megakaryocyte differentiation. nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) was the major activator of C7ORF41 that in turn repressed NF-κB activity by inhibiting its phosphorylation at serine 536, while MAPK/ERK was the potent repressor of C7ORF41. Finally, we showed that C7ORF41 knockdown in mouse fetal liver cells impaired megakaryocyte differentiation. Taken together, we have identified the function of a novel gene C7ORF41 that forms interplaying regulatory network in TPA-induced signaling and promotes leukemic and normal megakaryocyte differentiation
Promoting health equity: WHO health inequality monitoring at global and national levels
Hosseinpoor, Ahmad Reza; Bergen, Nicole; Schlotheuber, Anne
2015-01-01
Background Health equity is a priority in the post-2015 sustainable development agenda and other major health initiatives. The World Health Organization (WHO) has a history of promoting actions to achieve equity in health, including efforts to encourage the practice of health inequality monitoring. Health inequality monitoring systems use disaggregated data to identify disadvantaged subgroups within populations and inform equity-oriented health policies, programs, and practices. Objective This paper provides an overview of a number of recent and current WHO initiatives related to health inequality monitoring at the global and/or national level. Design We outline the scope, content, and intended uses/application of the following: Health Equity Monitor database and theme page; State of inequality: reproductive, maternal, newborn, and child health report; Handbook on health inequality monitoring: with a focus on low- and middle-income countries; Health inequality monitoring eLearning module; Monitoring health inequality: an essential step for achieving health equity advocacy booklet and accompanying video series; and capacity building workshops conducted in WHO Member States and Regions. Conclusions The paper concludes by considering how the work of the WHO can be expanded upon to promote the establishment of sustainable and robust inequality monitoring systems across a variety of health topics among Member States and at the global level. PMID:26387506
Promoting health equity: WHO health inequality monitoring at global and national levels.
Hosseinpoor, Ahmad Reza; Bergen, Nicole; Schlotheuber, Anne
2015-01-01
Health equity is a priority in the post-2015 sustainable development agenda and other major health initiatives. The World Health Organization (WHO) has a history of promoting actions to achieve equity in health, including efforts to encourage the practice of health inequality monitoring. Health inequality monitoring systems use disaggregated data to identify disadvantaged subgroups within populations and inform equity-oriented health policies, programs, and practices. This paper provides an overview of a number of recent and current WHO initiatives related to health inequality monitoring at the global and/or national level. We outline the scope, content, and intended uses/application of the following: Health Equity Monitor database and theme page; State of inequality: reproductive, maternal, newborn, and child health report; Handbook on health inequality monitoring: with a focus on low- and middle-income countries; Health inequality monitoring eLearning module; Monitoring health inequality: an essential step for achieving health equity advocacy booklet and accompanying video series; and capacity building workshops conducted in WHO Member States and Regions. The paper concludes by considering how the work of the WHO can be expanded upon to promote the establishment of sustainable and robust inequality monitoring systems across a variety of health topics among Member States and at the global level.
Promoting health equity: WHO health inequality monitoring at global and national levels
Directory of Open Access Journals (Sweden)
Ahmad Reza Hosseinpoor
2015-09-01
Full Text Available Background: Health equity is a priority in the post-2015 sustainable development agenda and other major health initiatives. The World Health Organization (WHO has a history of promoting actions to achieve equity in health, including efforts to encourage the practice of health inequality monitoring. Health inequality monitoring systems use disaggregated data to identify disadvantaged subgroups within populations and inform equity-oriented health policies, programs, and practices. Objective: This paper provides an overview of a number of recent and current WHO initiatives related to health inequality monitoring at the global and/or national level. Design: We outline the scope, content, and intended uses/application of the following: Health Equity Monitor database and theme page; State of inequality: reproductive, maternal, newborn, and child health report; Handbook on health inequality monitoring: with a focus on low- and middle-income countries; Health inequality monitoring eLearning module; Monitoring health inequality: an essential step for achieving health equity advocacy booklet and accompanying video series; and capacity building workshops conducted in WHO Member States and Regions. Conclusions: The paper concludes by considering how the work of the WHO can be expanded upon to promote the establishment of sustainable and robust inequality monitoring systems across a variety of health topics among Member States and at the global level.
Cholinergic modulation of the hippocampal region and memory function.
Haam, Juhee; Yakel, Jerrel L
2017-08-01
Acetylcholine (ACh) plays an important role in memory function and has been implicated in aging-related dementia, in which the impairment of hippocampus-dependent learning strongly manifests. Cholinergic neurons densely innervate the hippocampus, mediating the formation of episodic as well as semantic memory. Here, we will review recent findings on acetylcholine's modulation of memory function, with a particular focus on hippocampus-dependent learning, and the circuits involved. In addition, we will discuss the complexity of ACh actions in memory function to better understand the physiological role of ACh in memory. This is an article for the special issue XVth International Symposium on Cholinergic Mechanisms. © 2017 International Society for Neurochemistry.
[Promoting citizen participation in healthcare through PyDEsalud.com].
Perestelo-Pérez, Lilisbeth; Pérez-Ramos, Jeanette; Abt-Sacks, Analía; Rivero-Santana, Amado; Serrano-Aguilar, Pedro
2013-01-01
This project supports the initiative promoted by the Spanish National Health System to provide informational materials, in printed or interactive format, to encourage public participation in decision making and healthcare. We present the newly created PyDEsalud.com, a web platform aimed at people with chronic diseases with a high socioeconomic impact, such as breast cancer, depression, and diabetes. This platform uses scientific methodology and contains three information service modules (Patients' experiences, Shared decision making, and Research needs), aimed at promoting health education for patients and families. Copyright © 2012 SESPAS. Published by Elsevier Espana. All rights reserved.
Ignatieva, Elena V; Levitsky, Victor G; Yudin, Nikolay S; Moshkin, Mikhail P; Kolchanov, Nikolay A
2014-01-01
The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors), which are activated by olfactory stimuli (ligands). Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter [a region of DNA about 100-1000 base pairs long located upstream of the transcription start site (TSS)]. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.). In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli.
Interaction of the Modulated Electron Beam with Plasma: Kinetic Effects
International Nuclear Information System (INIS)
Anisimov, I.O.; Kiyanchuk, M.J.; Soroka, S.V.; Velikanets', D.M.
2006-01-01
Evolution of the velocity distribution functions of plasma and beam electrons during modulated electron beam propagation in homogeneous and inhomogeneous plasmas was studied numerically. Velocity distribution function of plasma electrons at the late time moments strongly differs from the initially Maxwellian one. In the regions of strong electric field plasma electrons' bunches are formed. Comparison of distribution functions of beam electrons for modulated and non-modulated beams shows that deep initial modulation suppresses resonant instability development. In the inhomogeneous plasma acceleration of electrons in the plasma resonance point can be observed
Boundary modulation effects on MHD instabilities in Heliotrons
International Nuclear Information System (INIS)
Nakajima, N.; Hudson, S.R.; Hegna, C.C.; Nakamura, Y.
2005-01-01
In three-dimensional configurations, the confinement region is surrounded by the stochastic magnetic field lines related to magnetic islands or separatrix, leading to the fact that the plasma-vacuum boundary is not so definite compared with tokamaks that the various modulations of the plasma-vacuum boundary will be induced around the stochastic region by a large Shafranov shift of the whole plasma, in especially high-β operations. To examine such the modulation effects of the plasma boundary on MHD instabilities, high-β plasmas allowing a large Shafranov shift are considered in the inward-shifted LHD configurations with the vacuum magnetic axis R ax of 3.6m, for which previous theoretical analyses indicate that pressure-driven modes are significantly more unstable compared with experimental observations. It is shown that the boundary modulation due to a free motion of the equilibrium plasma has not only significant stabilizing effects on ideal MHD instabilities, but also characteristics consistent to experimental observations. (author)
Laing, Mark; Rees, Adrian; Vuong, Quoc C
2015-01-01
The temporal congruence between auditory and visual signals coming from the same source can be a powerful means by which the brain integrates information from different senses. To investigate how the brain uses temporal information to integrate auditory and visual information from continuous yet unfamiliar stimuli, we used amplitude-modulated tones and size-modulated shapes with which we could manipulate the temporal congruence between the sensory signals. These signals were independently modulated at a slow or a fast rate. Participants were presented with auditory-only, visual-only, or auditory-visual (AV) trials in the fMRI scanner. On AV trials, the auditory and visual signal could have the same (AV congruent) or different modulation rates (AV incongruent). Using psychophysiological interaction analyses, we found that auditory regions showed increased functional connectivity predominantly with frontal regions for AV incongruent relative to AV congruent stimuli. We further found that superior temporal regions, shown previously to integrate auditory and visual signals, showed increased connectivity with frontal and parietal regions for the same contrast. Our findings provide evidence that both activity in a network of brain regions and their connectivity are important for AV integration, and help to bridge the gap between transient and familiar AV stimuli used in previous studies.
Directory of Open Access Journals (Sweden)
Mark eLaing
2015-10-01
Full Text Available The temporal congruence between auditory and visual signals coming from the same source can be a powerful means by which the brain integrates information from different senses. To investigate how the brain uses temporal information to integrate auditory and visual information from continuous yet unfamiliar stimuli, we use amplitude-modulated tones and size-modulated shapes with which we could manipulate the temporal congruence between the sensory signals. These signals were independently modulated at a slow or a fast rate. Participants were presented with auditory-only, visual-only or auditory-visual (AV trials in the scanner. On AV trials, the auditory and visual signal could have the same (AV congruent or different modulation rates (AV incongruent. Using psychophysiological interaction analyses, we found that auditory regions showed increased functional connectivity predominantly with frontal regions for AV incongruent relative to AV congruent stimuli. We further found that superior temporal regions, shown previously to integrate auditory and visual signals, showed increased connectivity with frontal and parietal regions for the same contrast. Our findings provide evidence that both activity in a network of brain regions and their connectivity are important for auditory-visual integration, and help to bridge the gap between transient and familiar AV stimuli used in previous studies.
Shaping and detecting mid-IR light with a spatial light modulator
CSIR Research Space (South Africa)
Maweza, Elijah L
2016-10-01
Full Text Available modulator Maweza, Elijah L Gailele, Lucas M Strauss, Hencharl J Litvin, Ihar Forbes, Andrew Dudley, Angela L ABSTRACT: We demonstrate the operation and calibration of a spatial light modulator in the mid-IR region by creating and measuring...
DNA methylation of PTEN gene promoter region is not correlated ...
African Journals Online (AJOL)
Tumor suppressor gene PTEN plays an important role in cell cycle. Disorder of PTEN protein can cause cell growth and division in an uncontrolled way, which can lead to the formation of tumors. It has been proven that epigenetic mechanisms, such as promoter hypermethylation, may account for inactivation of PTEN in a ...
Directory of Open Access Journals (Sweden)
Pekevski Siniša
2008-01-01
Full Text Available Taking an attention to promotion as operational variable in marketing effort, author focused on so called ways of creating national images. As a case of very interesting activity paper discuss an experience of regional chamber of Croatia with activities in upgrading international recognition of national products as well as country as destination in such context.
Module theory, extending modules and generalizations
Tercan, Adnan
2016-01-01
The main focus of this monograph is to offer a comprehensive presentation of known and new results on various generalizations of CS-modules and CS-rings. Extending (or CS) modules are generalizations of injective (and also semisimple or uniform) modules. While the theory of CS-modules is well documented in monographs and textbooks, results on generalized forms of the CS property as well as dual notions are far less present in the literature. With their work the authors provide a solid background to module theory, accessible to anyone familiar with basic abstract algebra. The focus of the book is on direct sums of CS-modules and classes of modules related to CS-modules, such as relative (injective) ejective modules, (quasi) continuous modules, and lifting modules. In particular, matrix CS-rings are studied and clear proofs of fundamental decomposition results on CS-modules over commutative domains are given, thus complementing existing monographs in this area. Open problems round out the work and establish the...
Comparative analyses of bidirectional promoters in vertebrates
Directory of Open Access Journals (Sweden)
Taylor James
2008-05-01
Full Text Available Abstract Background Orthologous genes with deep phylogenetic histories are likely to retain similar regulatory features. In this report we utilize orthology assignments for pairs of genes co-regulated by bidirectional promoters to map the ancestral history of the promoter regions. Results Our mapping of bidirectional promoters from humans to fish shows that many such promoters emerged after the divergence of chickens and fish. Furthermore, annotations of promoters in deep phylogenies enable detection of missing data or assembly problems present in higher vertebrates. The functional importance of bidirectional promoters is indicated by selective pressure to maintain the arrangement of genes regulated by the promoter over long evolutionary time spans. Characteristics unique to bidirectional promoters are further elucidated using a technique for unsupervised classification, known as ESPERR. Conclusion Results of these analyses will aid in our understanding of the evolution of bidirectional promoters, including whether the regulation of two genes evolved as a consequence of their proximity or if function dictated their co-regulation.
Umarov, Ramzan
2017-02-03
Accurate computational identification of promoters remains a challenge as these key DNA regulatory regions have variable structures composed of functional motifs that provide gene-specific initiation of transcription. In this paper we utilize Convolutional Neural Networks (CNN) to analyze sequence characteristics of prokaryotic and eukaryotic promoters and build their predictive models. We trained a similar CNN architecture on promoters of five distant organisms: human, mouse, plant (Arabidopsis), and two bacteria (Escherichia coli and Bacillus subtilis). We found that CNN trained on sigma70 subclass of Escherichia coli promoter gives an excellent classification of promoters and non-promoter sequences (Sn = 0.90, Sp = 0.96, CC = 0.84). The Bacillus subtilis promoters identification CNN model achieves Sn = 0.91, Sp = 0.95, and CC = 0.86. For human, mouse and Arabidopsis promoters we employed CNNs for identification of two well-known promoter classes (TATA and non-TATA promoters). CNN models nicely recognize these complex functional regions. For human promoters Sn/Sp/CC accuracy of prediction reached 0.95/0.98/0,90 on TATA and 0.90/0.98/0.89 for non-TATA promoter sequences, respectively. For Arabidopsis we observed Sn/Sp/CC 0.95/0.97/0.91 (TATA) and 0.94/0.94/0.86 (non-TATA) promoters. Thus, the developed CNN models, implemented in CNNProm program, demonstrated the ability of deep learning approach to grasp complex promoter sequence characteristics and achieve significantly higher accuracy compared to the previously developed promoter prediction programs. We also propose random substitution procedure to discover positionally conserved promoter functional elements. As the suggested approach does not require knowledge of any specific promoter features, it can be easily extended to identify promoters and other complex functional regions in sequences of many other and especially newly sequenced genomes. The CNNProm program is available to run at web server http://www.softberry.com.
Promoters active in interphase are bookmarked during mitosis by ubiquitination
Arora, Mansi; Zhang, Jie; Heine, George F.; Ozer, Gulcin; Liu, Hui-wen; Huang, Kun; Parvin, Jeffrey D.
2012-01-01
We analyzed modification of chromatin by ubiquitination in human cells and whether this mark changes through the cell cycle. HeLa cells were synchronized at different stages and regions of the genome with ubiquitinated chromatin were identified by affinity purification coupled with next-generation sequencing. During interphase, ubiquitin marked the chromatin on the transcribed regions of ∼70% of highly active genes and deposition of this mark was sensitive to transcriptional inhibition. Promoters of nearly half of the active genes were highly ubiquitinated specifically during mitosis. The ubiquitination at the coding regions in interphase but not at promoters during mitosis was enriched for ubH2B and dependent on the presence of RNF20. Ubiquitin labeling of both promoters during mitosis and transcribed regions during interphase, correlated with active histone marks H3K4me3 and H3K36me3 but not a repressive histone modification, H3K27me3. The high level of ubiquitination at the promoter chromatin during mitosis was transient and was removed within 2 h after the cells exited mitosis and entered the next cell cycle. These results reveal that the ubiquitination of promoter chromatin during mitosis is a bookmark identifying active genes during chromosomal condensation in mitosis, and we suggest that this process facilitates transcriptional reactivation post-mitosis. PMID:22941662
Experimental Studies on the Flammability and Fire Hazards of Photovoltaic Modules.
Yang, Hong-Yun; Zhou, Xiao-Dong; Yang, Li-Zhong; Zhang, Tao-Lin
2015-07-09
Many of the photovoltaic (PV) systems on buildings are of sufficiently high voltages, with potential to cause or promote fires. However, research about photovoltaic fires is insufficient. This paper focuses on the flammability and fire hazards of photovoltaic modules. Bench-scale experiments based on polycrystalline silicon PV modules have been conducted using a cone calorimeter. Several parameters including ignition time ( t ig ), mass loss, heat release rate (HRR), carbon monoxide (CO) and carbon dioxide (CO₂) concentration, were investigated. The fire behaviours, fire hazards and toxicity of gases released by PV modules are assessed based on experimental results. The results show that PV modules under tests are inflammable with the critical heat flux of 26 kW/m². This work will lead to better understanding on photovoltaic fires and how to help authorities determine the appropriate fire safety provisions for controlling photovoltaic fires.
EXPERIMENTAL DETERMINATION OF JUNG MODULE FOR POLYMER MATERIALS
Directory of Open Access Journals (Sweden)
S. N. Savin
2016-04-01
Full Text Available In the article the method of calculation-experimental determination of the Jung module is offered for standards from materials of different types in form plates long from 40 to 200 mm, width from 5 to 50 mm and in thick 0,5 to 20 mm. For measuring the experimental setting, consisting of hard steel frame was used, set of loads to 4 kg and horizontal microscope. Solution of task of calculation of deformations and tensions in the loaded cantilever plate the finite elements method is offered. For verification of exactness of measurings standards were used from pure metals: aluminium, zinc, copper, and, also, polymethylmethacrylate. For all control standards the certain is experimental value of the Jung module at the small and middle loadings exactly corresponds reference data. For the estimation of influence of contents of powder phisico-mechanical properties of polymeric composites the values of the module were certain Jung module for an epoxypolymers and epoxycomposites with a 50% filling with powder of nickel. It is rotined that conduct 50% metallic contents promotes inflexibility of material more than in 2 times. The offered method does not require the strict sizes of standards, that comfortably for determination of the Jung module of experimental materials, above all things oriented polymeric composites.
Characterization and sequence analysis of the F2 promoter from corynephage BFK20
International Nuclear Information System (INIS)
Koptides, M.; Ugorcakova, J.; Baloghova, E.; Bukovska, G.; Timko, J.
1994-01-01
F2 promoter from corynephage BFK20 was isolated and characterized. It was functional in Escherichia coli and Corynebacterium glutamicum. Cloning of the F2 promoter into the pJUP05 promoter probe vector caused an increase of the neomycin phosphotransferase II specific activity. According to the Northern blot hybridization the nptII gene was expressed from the cloned F2 promoter. The apparent transcription start point in E. coli and C. glutamicum was determined. The-35 region of F2 promoter showed high similarity to that of E. coli promoter consensus sequence, but its - 10 region was G+C rich and had no significant homology to that. (author)
The frequency of CCR5 promoter polymorphisms and CCR5 32 mutation in Iranian populations
Directory of Open Access Journals (Sweden)
Mohammad Zare-Bidaki
2015-04-01
Full Text Available Evidence showed that chemokines serve as pro-migratory factors for immune cells. CCL3, CCL4 and CCL5, as the main CC chemokines subfamily members, activate immune cells through binding to CC chemokine receptor 5 or CCR5. Macrophages, NK cells and T lymphocytes express CCR5 and thus, affected CCR5 expression or functions could be associated with altered immune responses. Deletion of 32 base pairs (D 32 in the exon 1 of the CCR5 gene, which is known as CCR5 D 32 mutation causes down regulation and malfunction of the molecule. Furthermore, it has been evidenced that three polymorphisms in the promoter region of CCR5 modulate its expression. Altered CCR5 expression in microbial infection and immune related diseases have been reported by several researchers but the role of CCR5 promoter polymorphisms and CCR5 D 32 mutation in Iranian patients suffering from these diseases are controversial. Due to the fact that Iranian people have different genetic backgrounds compared to other ethnics, hence, CCR5 promoter polymorphisms and CCR5 D 32 mutation association with the diseases may be different in Iranian patients. Therefore, this review addresses the most recent information regarding the prevalence as well as association of the mutation and polymorphisms in Iranian patients with microbial infection and immune related diseases as along with normal population.
Energy Technology Data Exchange (ETDEWEB)
Bizer, Kilian; Bossmeyer, Christoph
2012-07-01
Actually, there is a controversial public discussion on the exploitation of conventional natural gas by means of hydraulic fracturing (Fracking). The contribution under consideration examines the geologic, toxicological or technical as well as legal points of contact with respect to the different effects for the actor groups. Based on the existing scientific realizations, the regional economic effects of the fracking technology and the subsequent promotion of unconventional natural gas deposits have to be worked out.
Directory of Open Access Journals (Sweden)
Kelly Lei
2016-08-01
Full Text Available Addiction to alcohol remains a major social and economic problem, in part because of the high motivation for alcohol that humans exhibit and the hazardous binge intake this promotes. Orexin-1-type receptors (OX1Rs promote reward intake under conditions of strong drives for reward, including excessive alcohol intake. While systemic modulation of OX1Rs can alter alcohol drinking, the brain regions that mediate this OX1R enhancement of excessive drinking remain unknown. Given the importance of the nucleus accumbens (NAc and anterior insular cortex (aINS in driving many addictive behaviors, including OX1Rs within these regions, we examined the importance of OX1Rs in these regions on excessive alcohol drinking in C57BL/6 mice during limited-access alcohol drinking in the dark cycle. Inhibition of OX1Rs with the widely used SB-334867 within the medial NAc Shell (mNAsh significantly reduced drinking of alcohol, with no effect on saccharin intake, and no effect on alcohol consumption when infused above the mNAsh. In contrast, intra-mNAsh infusion of the orexin-2 receptor TCS-OX2-29 had no impact on alcohol drinking. In addition, OX1R inhibition within the aINS had no effect on excessive drinking, which was surprising given the importance of aINS-NAc circuits in promoting alcohol consumption and the role for aINS OX1Rs in driving nicotine intake. However, OX1R inhibition within the mPFC did reduce alcohol drinking, indicating cortical OXR involvement in promoting intake. Also, in support of the critical role for mNAsh OX1Rs, SB within the mNAsh also significantly reduced operant alcohol self-administration in rats. Finally, orexin ex vivo enhanced firing in mNAsh neurons from alcohol-drinking mice, with no effect on evoked EPSCs or input resistance; a similar orexin increase in firing without a change in input resistance was observed in alcohol-naïve mice. Taken together, our results strongly suggest that OX1Rs within the mNAsh, but not the aINS, play a
Fuentes-Pananá, E M; Swaminathan, S; Ling, P D
1999-01-01
The Epstein-Barr virus (EBV) EBNA2 protein is a transcriptional activator that controls viral latent gene expression and is essential for EBV-driven B-cell immortalization. EBNA2 is expressed from the viral C promoter (Cp) and regulates its own expression by activating Cp through interaction with the cellular DNA binding protein CBF1. Through regulation of Cp and EBNA2 expression, EBV controls the pattern of latent protein expression and the type of latency established. To gain further insight into the important regulatory elements that modulate Cp usage, we isolated and sequenced the Cp regions corresponding to nucleotides 10251 to 11479 of the EBV genome (-1079 to +144 relative to the transcription initiation site) from the EBV-like lymphocryptoviruses found in baboons (herpesvirus papio; HVP) and Rhesus macaques (RhEBV). Sequence comparison of the approximately 1,230-bp Cp regions from these primate viruses revealed that EBV and HVP Cp sequences are 64% conserved, EBV and RhEBV Cp sequences are 66% conserved, and HVP and RhEBV Cp sequences are 65% conserved relative to each other. Approximately 50% of the residues are conserved among all three sequences, yet all three viruses have retained response elements for glucocorticoids, two positionally conserved CCAAT boxes, and positionally conserved TATA boxes. The putative EBNA2 100-bp enhancers within these promoters contain 54 conserved residues, and the binding sites for CBF1 and CBF2 are well conserved. Cp usage in the HVP- and RhEBV-transformed cell lines was detected by S1 nuclease protection analysis. Transient-transfection analysis showed that promoters of both HVP and RhEBV are responsive to EBNA2 and that they bind CBF1 and CBF2 in gel mobility shift assays. These results suggest that similar mechanisms for regulation of latent gene expression are conserved among the EBV-related lymphocryptoviruses found in nonhuman primates.
Energy Technology Data Exchange (ETDEWEB)
Joshi, J.B. (National Heart, Lung, and Blood Inst., Bethesda, MD (United States)); Dave, H.P.G. (National Inst. of Health, Bethesda, MD (United States))
1992-02-01
Human T-cell lymphotropic virus type I (HTLV-I), an etiologic agent for adult T-cell leukemia, is strongly associated with certain neurological diseases. The HTLV-I genome encodes a protein, Tax{sub 1}, that transactivates viral gene transcription. CD4-positive T helper lymphocytes express the proenkephalin gene, and enkephalins have been implicated as neuroimmunomodulators. The authors have investigated the effect of Tax{sub 1} on the proenkephalin gene promoter in C6 rat glioma cells and demonstrated its transactivation. Analysis using 5{prime} deletion mutants of the promoter region showed that sequences upstream of base pair - 190 are necessary for maximal transactivation. Forskolin, a cAMP modulator, synergistically increased Tax{sub 1}-mediated transactivation of the proenkephalin promoter. Neither Tax{sub 1} transactivation alone nor Tax{sub 1}/cAMP synergism exclusively involved cAMP-responsive elements. Endogenous proenkephalin gene expression increased in Tax{sub 1}-expressing C6 cells. Since HTLV-I infects lymphocytes, which express proenkephalin mRNA, Tax{sub 1} transregulation of proenkephalin expression may provide bidirectional communication between the nervous and immune systems in HTLV-I-related diseases.
Transcriptional regulation of Caenorhabditis elegans FOXO/DAF-16 modulates lifespan.
Bansal, Ankita; Kwon, Eun-Soo; Conte, Darryl; Liu, Haibo; Gilchrist, Michael J; MacNeil, Lesley T; Tissenbaum, Heidi A
2014-01-01
Insulin/IGF-1 signaling plays a central role in longevity across phylogeny. In C. elegans, the forkhead box O (FOXO) transcription factor, DAF-16, is the primary target of insulin/IGF-1 signaling, and multiple isoforms of DAF-16 (a, b, and d/f) modulate lifespan, metabolism, dauer formation, and stress resistance. Thus far, across phylogeny modulation of mammalian FOXOs and DAF-16 have focused on post-translational regulation with little focus on transcriptional regulation. In C. elegans, we have previously shown that DAF-16d/f cooperates with DAF-16a to promote longevity. In this study, we generated transgenic strains expressing near-endogenous levels of either daf-16a or daf-16d/f, and examined temporal expression of the isoforms to further define how these isoforms contribute to lifespan regulation. Here, we show that DAF-16a is sensitive both to changes in gene dosage and to alterations in the level of insulin/IGF-1 signaling. Interestingly, we find that as worms age, the intestinal expression of daf-16d/f but not daf-16a is dramatically upregulated at the level of transcription. Preventing this transcriptional upregulation shortens lifespan, indicating that transcriptional regulation of daf-16d/f promotes longevity. In an RNAi screen of transcriptional regulators, we identify elt-2 (GATA transcription factor) and swsn-1 (core subunit of SWI/SNF complex) as key modulators of daf-16d/f gene expression. ELT-2 and another GATA factor, ELT-4, promote longevity via both DAF-16a and DAF-16d/f while the components of SWI/SNF complex promote longevity specifically via DAF-16d/f. Our findings indicate that transcriptional control of C. elegans FOXO/daf-16 is an essential regulatory event. Considering the conservation of FOXO across species, our findings identify a new layer of FOXO regulation as a potential determinant of mammalian longevity and age-related diseases such as cancer and diabetes.
Directory of Open Access Journals (Sweden)
Eva\tDHIMITRI
2015-12-01
Full Text Available Local governance is a broad concept and is defined as the formulation and execution of collective action at the local level. The purpose of local government is to ensure effective and efficient use of public resources and service delivery at the level closest to citizens. Regional development is a new concept that aims to stimulate and diversify the economic activity of a country (region, to encourage investment in the private sector, to create a new jobs vacancy and improves living standards of the country. Regional development policies are a number of measures designed and promoted by the central and local administration, but the cooperation undertaken at the actors are in a different one, which included the private sector and civil society. At the center of these regional policies or practices is the use of efficient potential of each region, being particularly focused on business, means promoting the development of the new enterprises, promoting labor market and investment, improve the quality of environment, health , education and culture. Traditional objective of regional development policies is the reduction of territorial disparities for achieving a relative balance between economic and social levels of development in different areas in the national territory. Regional development is the actual task of local government units in Albania, and is one of the tasks and challenges of the future. Currently it takes a special importance in the context of European Union integration. Reforms have begun to change the system in 1990 in order to implement local democracy and decentralization principles that are present today. Inequalities that exist within the region and between them indicate that in some regions the economic potential is not being fully utilized, and that it reduces the overall performance in national level.
Planar Silicon Optical Waveguide Light Modulators
DEFF Research Database (Denmark)
Leistiko, Otto; Bak, H.
1994-01-01
that values in the nanosecond region should be possible, however, the measured values are high, 20 microseconds, due to the large area of the injector junctions, 1× 10¿2 cm2, and the limitations imposed by the detection circuit. The modulating properties of these devices are impressive, measurements......The results of an experimental investigation of a new type of optical waveguide based on planar technology in which the liglht guiding and modulation are achieved by exploiting free carrier effects in silicon are presented. Light is guided between the n+ substrate and two p+ regions, which also...... serve as carrier injectors for controling absorption. Light confinement of single mode devices is good, giving spot sizes of 9 ¿m FWHM. Insertion loss measurements indicate that the absorption losses for these waveguides are extremely low, less 1 dB/cm. Estimates of the switching speed indicate...
Directory of Open Access Journals (Sweden)
Aghil Habibi Sola
2007-10-01
Full Text Available Objectives: As individuals live longer, health promotion behaviors get even more important, particularly with regard to maintaining functional independence and improving quality of life. The purpose of this study was to explore the relationship between health promotion behaviors and level of Activities of Daily Living (ADL and Instrumental Activities of Daily Living (IADL among elderly people in west region of Tehran. Methods & Materials: This was a descriptive-correlational study. A multi-stage sample of 410 community residents who were over 60 years old were selected from west region of Tehran. Participants who consented to participate in the study were interviewed with a structured questionnaire. The questionnaire consisted of 2-part; Health Promotion Behavior Checklist and questions related to status of physical functioning, which includes activities of daily living (ADLs and instrumental activities of daily living (IADLs. Descriptive statistics and T-test were used to data analysis. Results: The results of the study showed that there were significant relations between ADLs and ' exercise or walking', 'drinking milk, eating dairy and meat', 'eating vegetables and fruits', 'low salt diet' and 'low fat diet' (P<0.05. Furthermore there were significant relations between the IADLs and 'smoking cessation', 'alcohol abstinence', 'exercise or walking', 'drinking milk, eating dairy and meat', 'eating vegetables and fruits', 'low salt diet' and 'low fat diet' (P<0.05. Conclusion: Study showed, health promotion behaviors and level of ADL and IADL are related meaningfully. Health care professionals should enhance the physical functioning in elderly people by facilitating health promotion behaviors through formal health promotion programs which focus on regular diet, exercise, and regular physical check-ups which will maintain and increase a healthy and active life.
CRE promoter sites modulate alternative splicing via p300-mediated histone acetylation
Czech Academy of Sciences Publication Activity Database
Dušková, Eva; Hnilicová, Jarmila; Staněk, David
2014-01-01
Roč. 11, č. 7 (2014), s. 865-874 ISSN 1547-6286 R&D Projects: GA ČR(CZ) GBP305/12/G034 Institutional support: RVO:68378050 Keywords : alternative splicing * fibronectin * p300 * histone acetylation * promoter Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.974, year: 2014
Analysis of an osmotically regulated pathogenesis-related osmotin gene promoter.
Raghothama, K G; Liu, D; Nelson, D E; Hasegawa, P M; Bressan, R A
1993-12-01
Osmotin is a small (24 kDa), basic, pathogenesis-related protein, that accumulates during adaptation of tobacco (Nicotiana tabacum) cells to osmotic stress. There are more than 10 inducers that activate the osmotin gene in various plant tissues. The osmotin promoter contains several sequences bearing a high degree of similarity to ABRE, as-1 and E-8 cis element sequences. Gel retardation studies indicated the presence of at least two regions in the osmotin promoter that show specific interactions with nuclear factors isolated from cultured cells or leaves. The abundance of these binding factors increased in response to salt, ABA and ethylene. Nuclear factors protected a 35 bp sequence of the promoter from DNase I digestion. Different 5' deletions of the osmotin promoter cloned into a promoter-less GUSNOS plasmid (pBI 201) were used in transient expression studies with a Biolistic gun. The transient expression studies revealed the presence of three distinct regions in the osmotin promoter. The promoter sequence from -108 to -248 bp is absolutely required for reporter gene activity, followed by a long stretch (up to -1052) of enhancer-like sequence and then a sequence upstream of -1052, which appears to contain negative elements. The responses to ABA, ethylene, salt, desiccation and wounding appear to be associated with the -248 bp sequence of the promoter. This region also contains a putative ABRE (CACTGTG) core element. Activation of the osmotin gene by various inducers is discussed in view of antifungal activity of the osmotin protein.
Construction and Tests of Modules for the ATLAS Pixel Detector
AUTHOR|(CDS)2068490
2003-01-01
The ATLAS Pixel Detector is the innermost layer of the ATLAS tracking system and will contribute significantly to the ATLAS track and vertex reconstruction. The detector consists of identical sensor-chip-hybrid modules, arranged in three barrels in the centre and three disks on either side for the forward region. The position of the pixel detector near the interaction point requires excellent radiation hardness, mechanical and thermal robustness, good long-term stability, all combined with a low material budget. The pre-production phase of such pixel modules has nearly finished, yielding fully functional modules. Results are presented of tests with these modules.
Xiao, Deyi; Barry, Samantha; Kmetz, Daniel; Egger, Michael; Pan, Jianmin; Rai, Shesh N; Qu, Jifu; McMasters, Kelly M.; Hao, Hongying
2016-01-01
The tumor microenvironment is abundant with exosomes that are secreted by the cancer cells themselves. Exosomes are nanosized, organelle-like membranous structures that are increasingly being recognized as major contributors in the progression of malignant neoplasms. A critical element in melanoma progression is its propensity to metastasize, but little is known about how melanoma cell-derived exosomes modulate the microenvironment to optimize conditions for tumor progression and metastasis. Here, we provide evidence that melanoma cell-derived exosomes promote phenotype switching in primary melanocytes through paracrine/autocrine signaling. We found that the mitogen-activated protein kinase (MAPK) signaling pathway was activated during the exosome-mediated epithelial-to-mesenchymal transition (EMT)-resembling process, which promotes metastasis. Let-7i, an miRNA modulator of EMT, was also involved in this process. We further defined two other miRNA modulators of EMT (miR-191 and let-7a) in serum exosomes for differentiating stage I melanoma patients from non-melanoma subjects. These results provide the first strong molecular evidence that melanoma cell-derived exosomes promote the EMT-resembling process in the tumor microenvironment. Thus, novel strategies targeting EMT and modulating the tumor microenvironment may emerge as important approaches for the treatment of metastatic melanoma. PMID:27063098
Intensity-modulated tangential beam irradiation of the intact breast
International Nuclear Information System (INIS)
Hong, L.; Hunt, M.; Chui, C.; Spirou, S.; Forster, K.; Lee, H.; Yahalom, J.; Kutcher, G.J.; McCormick, B.
1999-01-01
Purpose: To evaluate the potential benefits of intensity modulated tangential beams in the irradiation of the intact breast. Methods and Materials: Three-dimensional treatment planning was performed on five left and five right breasts using standard wedged and intensity modulated (IM) tangential beams. Optimal beam parameters were chosen using beams-eye-view display. For the standard plans, the optimal wedge angles were chosen based on dose distributions in the central plane calculated without inhomogeneity corrections, according to our standard protocol. Intensity-modulated plans were generated using an inverse planning algorithm and a standard set of target and critical structure optimization criteria. Plans were compared using multiple dose distributions and dose volume histograms for the planning target volume (PTV), ipsilateral lung, coronary arteries, and contralateral breast. Results: Significant improvements in the doses to critical structures were achieved using intensity modulation. Compared with a standard-wedged plan prescribed to 46 Gy, the dose from the IM plan encompassing 20% of the coronary artery region decreased by 25% (from 36 to 27 Gy) for patients treated to the left breast; the mean dose to the contralateral breast decreased by 42% (from 1.2 to 0.7 Gy); the ipsilateral lung volume receiving more than 46 Gy decreased by 30% (from 10% to 7%); the volume of surrounding soft tissue receiving more than 46 Gy decreased by 31% (from 48% to 33%). Dose homogeneity within the target volume improved greatest in the superior and inferior regions of the breast (approximately 8%), although some decrease in the medial and lateral high-dose regions (approximately 4%) was also observed. Conclusion: Intensity modulation with a standard tangential beam arrangement significantly reduces the dose to the coronary arteries, ipsilateral lung, contralateral breast, and surrounding soft tissues. Improvements in dose homogeneity throughout the target volume can also be
Fortnightly modulation of San Andreas tremor and low-frequency earthquakes
Van Der Elst, Nicholas; Delorey, Andrew; Shelly, David R.; Johnson, Paul
2016-01-01
Earth tides modulate tremor and low-frequency earthquakes (LFEs) on faults in the vicinity of the brittle−ductile (seismic−aseismic) transition. The response to the tidal stress carries otherwise inaccessible information about fault strength and rheology. Here, we analyze the LFE response to the fortnightly tide, which modulates the amplitude of the daily tidal stress over a 14-d cycle. LFE rate is highest during the waxing fortnightly tide, with LFEs most strongly promoted when the daily stress exceeds the previous peak stress by the widest margin. This pattern implies a threshold failure process, with slip initiated when stress exceeds the local fault strength. Variations in sensitivity to the fortnightly modulation may reflect the degree of stress concentration on LFE-producing brittle asperities embedded within an otherwise aseismic fault.
Module based training improves and sustains surgical skills
DEFF Research Database (Denmark)
Carlsen, C G; Lindorff-Larsen, K; Funch-Jensen, P
2015-01-01
PURPOSE: Traditional surgical training is challenged by factors such as patient safety issues, economic considerations and lack of exposure to surgical procedures due to short working hours. A module-based clinical training model promotes rapidly acquired and persistent surgical skills. METHODS...... hernia repair was preferable in both short and long-term compared with standard clinical training. The model will probably be applicable to other surgical training procedures....
Directory of Open Access Journals (Sweden)
Elena V. Ignatieva
2014-03-01
Full Text Available The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors, which are activated by olfactory stimuli (ligands. Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter (a region of DNA about 100–1000 base pairs long located upstream of the transcription start site. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.. In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli.
Institute of Scientific and Technical Information of China (English)
R. B. Singh; D. K. Mishra
2004-01-01
In recent years, mountain regions are attracting great attention to Indian tourists in general and foreign tourists in particular. The potential mountain resources for promoting green tourism are enormous in the form of natural and cultural heritage such as biosphere reserves, flora and fauna, lakes and rivers and traditional rural resources. In order to utilise tourism industry market, uncontrolled numbers of tourists and related haphazard infrastructural facilities in the vulnerable mountain regions pose serious environmental implications. The ecological pressures are threatening land, water and wild life resources through direct and indirect environmental impacts together with generation of solid and liquid wastes, so green tourism is emerging as an important task in order to develop new relationship between communities, government agencies and private sectors. The strategy focuses on ecological understanding, environmental protection and ecodevelopment. The major attributes of the green tourism include environmental conservation and education and distribution of income to local people based on strong partnership. Various knowledge systems go a long way for achieving the goals of the green tourism, which creates awareness about the value of environmental resources.Mountains have ecological, recreational, educational and scientific values, which need to be utilised in sustainable way. Various tourist activities and facilities need to be diversified in order to achieve multiple benefits including scientific field excursion,recreation in natural and cultural areas, community festivals and sport tourisms. Green tourism considers tourism development as an integral part of a national and regional development. The paper discusses the social, economic and environmental dimensions of the green tourism with particular reference to village tourism development programme taking empirical evidences from the Himalaya. Such programme also minimises biophysical and human
2013-06-24
other relevant exposures which may influ- ence DNA methylation , such as dietary factors ( folate , vitamin B12 intake) (Fenech, 2001; Piyathilake and...ARTICLE published: 24 June 2013 doi: 10.3389/fpsyt.2013.00056 PTSD and DNA methylation in select immune function gene promoter regions: a repeated measures...largely unknown. Dis- tinct expression signatures for PTSD have been found, in particular for immune activation transcripts. DNA methylation may be
Transparent electrode requirements for thin film solar cell modules
Rowell, Michael W.; McGehee, Michael D.
2011-01-01
The transparent conductor (TC) layer in thin film solar cell modules has a significant impact on the power conversion efficiency. Reflection, absorption, resistive losses and lost active area either from the scribed interconnect region in monolithically integrated modules or from the shadow losses of a metal grid in standard modules typically reduce the efficiency by 10-25%. Here, we perform calculations to show that a competitive TC must have a transparency of at least 90% at a sheet resistance of less than 10 Ω/sq (conductivity/absorptivity ≥ 1 Ω -1) for monolithically integrated modules. For standard modules, losses are much lower and the performance of alternative lower cost TC materials may already be sufficient to replace conducting oxides in this geometry. © 2011 The Royal Society of Chemistry.
International Nuclear Information System (INIS)
Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi
2011-01-01
Highlights: → The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. → The core promoter was located in the 5F-1. → Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. → These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.
Cohen, Oren; Kapteyn, Henry C.; Mumane, Margaret M.
2010-02-16
Phase matching high harmonic generation (HHG) uses a single, long duration non-collinear modulating pulse intersecting the driving pulse. A femtosecond driving pulse is focused into an HHG medium (such as a noble gas) to cause high-harmonic generation (HHG), for example in the X-ray region of the spectrum, via electrons separating from and recombining with gas atoms. A non-collinear pulse intersects the driving pulse within the gas, and modulates the field seen by the electrons while separated from their atoms. The modulating pulse is low power and long duration, and its frequency and amplitude is chosen to improve HHG phase matching by increasing the areas of constructive interference between the driving pulse and the HHG, relative to the areas of destructive interference.
Characterization of promoter sequence of toll-like receptor genes in Vechur cattle
Directory of Open Access Journals (Sweden)
R. Lakshmi
2016-06-01
Full Text Available Aim: To analyze the promoter sequence of toll-like receptor (TLR genes in Vechur cattle, an indigenous breed of Kerala with the sequence of Bos taurus and access the differences that could be attributed to innate immune responses against bovine mastitis. Materials and Methods: Blood samples were collected from Jugular vein of Vechur cattle, maintained at Vechur cattle conservation center of Kerala Veterinary and Animal Sciences University, using an acid-citrate-dextrose anticoagulant. The genomic DNA was extracted, and polymerase chain reaction was carried out to amplify the promoter region of TLRs. The amplified product of TLR2, 4, and 9 promoter regions was sequenced by Sanger enzymatic DNA sequencing technique. Results: The sequence of promoter region of TLR2 of Vechur cattle with the B. taurus sequence present in GenBank showed 98% similarity and revealed variants for four sequence motifs. The sequence of the promoter region of TLR4 of Vechur cattle revealed 99% similarity with that of B. taurus sequence but not reveals significant variant in motifregions. However, two heterozygous loci were observed from the chromatogram. Promoter sequence of TLR9 gene also showed 99% similarity to B. taurus sequence and revealed variants for four sequence motifs. Conclusion: The results of this study indicate that significant variation in the promoter of TLR2 and 9 genes in Vechur cattle breed and may potentially link the influence the innate immunity response against mastitis diseases.
Deciphering the BAR code of membrane modulators.
Salzer, Ulrich; Kostan, Julius; Djinović-Carugo, Kristina
2017-07-01
The BAR domain is the eponymous domain of the "BAR-domain protein superfamily", a large and diverse set of mostly multi-domain proteins that play eminent roles at the membrane cytoskeleton interface. BAR domain homodimers are the functional units that peripherally associate with lipid membranes and are involved in membrane sculpting activities. Differences in their intrinsic curvatures and lipid-binding properties account for a large variety in membrane modulating properties. Membrane activities of BAR domains are further modified and regulated by intramolecular or inter-subunit domains, by intermolecular protein interactions, and by posttranslational modifications. Rather than providing detailed cell biological information on single members of this superfamily, this review focuses on biochemical, biophysical, and structural aspects and on recent findings that paradigmatically promote our understanding of processes driven and modulated by BAR domains.
76 FR 68067 - United States-Peru Trade Promotion Agreement
2011-11-03
... between the Parties and promoting regional economic integration; promoting broad-based economic development in order to reduce poverty and generate opportunities for sustainable economic alternatives to... rule. CBP also invites comments that relate to the economic, environmental, or federalism effects that...
International Nuclear Information System (INIS)
Chung, Heeteak; Jin, Hosang; Dempsey, James F.; Liu, Chihray; Palta, Jatinder; Suh, Tae-Suk; Kim, Siyong
2005-01-01
Despite much development, there remains dosimetric uncertainty in the surface and build-up regions in intensity-modulated radiation therapy treatment plans for head and neck cancers. Experiments were performed to determine the dosimetric discrepancies in the surface and build-up region between the treatment planning system (TPS) prediction and experimental measurement using radiochromic film. A head and neck compression film phantom was constructed from two semicylindrical solid water slabs. Treatment plans were generated using two commercial TPSs (PINNACLE3 and CORVUS) for two cases, one with a shallow (∼0.5 cm depth) target and another with a deep (∼6 cm depth) target. The plans were evaluated for a 54 Gy prescribed dose. For each case, two pieces of radiochromic film were used for dose measurement. A small piece of film strip was placed on the surface and another was inserted within the phantom. Overall, both TPSs showed good agreement with the measurement. For the shallow target case, the dose differences were within ±300 cGy (5.6% with respect to the prescribed dose) for PINNACLE3 and ±240 cGy (4.4%) for CORVUS in 90% of the region of interest. For the deep target case, the dose differences were ±350 (6.5%) for PINNACLE3 and ±260 cGy (4.8%) for CORVUS in 90% of the region of interest. However, it was found that there were significant discrepancies from the surface to about 0.2 cm in depth for both the shallow and deep target cases. It was concluded that both TPSs overestimated the surface dose for both shallow and deep target cases. The amount of overestimation ranges from 400 to 1000 cGy (∼7.4% to 18.5% with respect to the prescribed dose, 5400 cGy)
Expression of versican 3'-untranslated region modulates endogenous microRNA functions.
Lee, Daniel Y; Jeyapalan, Zina; Fang, Ling; Yang, Jennifer; Zhang, Yaou; Yee, Albert Y; Li, Minhui; Du, William W; Shatseva, Tatiana; Yang, Burton B
2010-10-25
Mature microRNAs (miRNAs) are single-stranded RNAs that regulate post-transcriptional gene expression. In our previous study, we have shown that versican 3'UTR, a fragment of non-coding transcript, has the ability to antagonize miR-199a-3p function thereby regulating expression of the matrix proteins versican and fibronectin, and thus resulting in enhanced cell-cell adhesion and organ adhesion. However, the impact of this non-coding fragment on tumorigenesis is yet to be determined. Using computational prediction confirmed with in vitro and in vivo experiments, we report that the expression of versican 3'UTR not only antagonizes miR-199a-3p but can also lower its steady state expression. We found that expression of versican 3'UTR in a mouse breast carcinoma cell line, 4T1, decreased miR-199a-3p levels. The decrease in miRNA activity consequently translated into differences in tumor growth. Computational analysis indicated that both miR-199a-3p and miR-144 targeted a cell cycle regulator, Rb1. In addition, miR-144 and miR-136, which have also been shown to interact with versican 3'UTR, was found to target PTEN. Expression of Rb1 and PTEN were up-regulated synergistically in vitro and in vivo, suggesting that the 3'UTR binds and modulates miRNA activities, freeing Rb1 and PTEN mRNAs for translation. In tumor formation assays, cells transfected with the 3'UTR formed smaller tumors compared with cells transfected with a control vector. Our results demonstrated that a 3'UTR fragment can be used to modulate miRNA functions. Our study also suggests that miRNAs in the cancer cells are more susceptible to degradation, due to its interaction with a non-coding 3'UTR. This non-coding component of mRNA may be used retrospectively to modulate miRNA activities.
Expression of versican 3'-untranslated region modulates endogenous microRNA functions.
Directory of Open Access Journals (Sweden)
Daniel Y Lee
Full Text Available BACKGROUND: Mature microRNAs (miRNAs are single-stranded RNAs that regulate post-transcriptional gene expression. In our previous study, we have shown that versican 3'UTR, a fragment of non-coding transcript, has the ability to antagonize miR-199a-3p function thereby regulating expression of the matrix proteins versican and fibronectin, and thus resulting in enhanced cell-cell adhesion and organ adhesion. However, the impact of this non-coding fragment on tumorigenesis is yet to be determined. METHODS AND FINDINGS: Using computational prediction confirmed with in vitro and in vivo experiments, we report that the expression of versican 3'UTR not only antagonizes miR-199a-3p but can also lower its steady state expression. We found that expression of versican 3'UTR in a mouse breast carcinoma cell line, 4T1, decreased miR-199a-3p levels. The decrease in miRNA activity consequently translated into differences in tumor growth. Computational analysis indicated that both miR-199a-3p and miR-144 targeted a cell cycle regulator, Rb1. In addition, miR-144 and miR-136, which have also been shown to interact with versican 3'UTR, was found to target PTEN. Expression of Rb1 and PTEN were up-regulated synergistically in vitro and in vivo, suggesting that the 3'UTR binds and modulates miRNA activities, freeing Rb1 and PTEN mRNAs for translation. In tumor formation assays, cells transfected with the 3'UTR formed smaller tumors compared with cells transfected with a control vector. CONCLUSION: Our results demonstrated that a 3'UTR fragment can be used to modulate miRNA functions. Our study also suggests that miRNAs in the cancer cells are more susceptible to degradation, due to its interaction with a non-coding 3'UTR. This non-coding component of mRNA may be used retrospectively to modulate miRNA activities.
Plant growth and resistance promoted by Streptomyces spp. in tomato.
Dias, Maila P; Bastos, Matheus S; Xavier, Vanessa B; Cassel, Eduardo; Astarita, Leandro V; Santarém, Eliane R
2017-09-01
Plant Growth Promoting Rhizobacteria (PGPR) represent an alternative to improve plant growth and yield as well as to act as agents of biocontrol. This study characterized isolates of Streptomyces spp. (Stm) as PGPR, determined the antagonism of these isolates against Pectobacterium carotovorum subsp. brasiliensis (Pcb), evaluated the ability of Stm on promoting growth and modulating the defense-related metabolism of tomato plants, and the potential of Stm isolates on reducing soft rot disease in this species. The VOC profile of Stm was also verified. Promotion of plant growth was assessed indirectly through VOC emission and by direct interaction with Stm isolates in the roots. Evaluation of soft rot disease was performed in vitro on plants treated with Stm and challenged with Pcb. Enzymes related to plant defense were then analyzed in plants treated with three selected isolates of Stm, and PM1 was chosen for further Pcb-challenging experiment. Streptomyces spp. isolates displayed characteristics of PGPR. PM3 was the isolate with efficient antagonism against Pcb by dual-culture. Most of the isolates promoted growth of root and shoot of tomato plants by VOC, and PM5 was the isolate that most promoted growth by direct interaction with Stm. Soft rot disease and mortality of plants were significantly reduced when plants were treated with StmPM1. Modulation of secondary metabolism was observed with Stm treatment, and fast response of polyphenoloxidases was detected in plants pretreated with StmPM1 and challenged with Pcb. Peroxidase was significantly activated three days after infection with Pcb in plants pretreated with StmPM1. Results suggest that Streptomyces sp. PM1 and PM5 have the potential to act as PGPR. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene
International Nuclear Information System (INIS)
Mavrothalassitis, G.J.; Watson, D.K.; Papas, T.S.
1990-01-01
The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical TATA and CAAT elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1,400 base pairs (bp) upstream from the first major transcription initiation site. A G+C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with TATA-less promoters
Assembly and Electrical Tests of the First Full-size Forward Module for the ATLAS ITk Strip Detector
Garcia-Argos, Carlos; The ATLAS collaboration
2018-01-01
The ATLAS experiment will replace the existing Inner Detector by an all-silicon detector named the Inner Tracker (ITk) for the High Luminosity LHC upgrades. In the outer region of the Inner Tracker is the strip detector, which consists of a four layer barrel and six discs to each side of the barrel, with silicon-strip modules as basic units. Each module is composed of a sensor and one or more flex circuits that hold the read-out electronics. In the experiment, the modules are mounted on support structures with integrated power and cooling. The modules are designed with geometries that accommodate the central and forward regions, with rectangular sensors in the barrels and wedge shaped sensors in the end-caps. The strips lengths and pitch sizes vary according to the occupancy of the region. In this contribution, we present the construction and results of the electrical tests of the first full-size module of the innermost forward region, named \\textit{Ring 0} in the ATLAS ITk strip detector nomenclature. This m...
Modules and Front-End Electronics Developments for the ATLAS ITk Strips Upgrade
Garcia-Argos, Carlos; The ATLAS collaboration
2017-01-01
The ATLAS experiment is currently preparing for an upgrade of the tracking system in the course of the High Luminosity LHC, scheduled for 2024. The existing Inner Detector will be replaced by an all-silicon Inner Tracker (ITk) with a pixel detector surrounded by a strip detector. The ITk strip detector consists of a four layer barrel and a forward region composed of six discs on each side of the barrel. The basic unit of the detector is the silicon-strip module, consisting of a sensor and one or more hybrid circuits that hold the read-out electronics. The geometries of the barrel and end-cap modules take into account the regions that they have to cover. In the central region, the detectors are rectangular with straight strips, whereas on the forward region the modules require wedge shaped sensors with varying strip length and pitch. The current prototyping phase has resulted in the ITk Strip Detector Technical Design Report (TDR), which kicks-off the pre-production readiness phase at the involved institutes. ...
Modules and Front-End Electronics Developments for the ATLAS ITk Strips Upgrade
Garcia-Argos, Carlos; The ATLAS collaboration
2017-01-01
The ATLAS experiment is currently preparing for an upgrade of the tracking system in the course of the High Luminosity LHC, scheduled for 2024. The existing Inner Detector will be replaced by an all-silicon Inner Tracker (ITk) with a pixel detector surrounded by a strip detector. The ITk strip detector consists of a four layer barrel and a forward region composed of six discs on each side of the barrel. The basic unit of the detector is the silicon-strip module, consisting of a sensor and one or more hybrid circuits that hold the read-out electronics. The geometries of the barrel and end-cap modules take into account the regions that they have to cover. In the central region, the detectors are rectangular with straight strips, whereas in the forward region the modules require wedge shaped sensors with varying strip length and pitch. The current prototyping phase has resulted in the ITk Strip Detector Technical Design Report (TDR), which kicks-off the pre-production readiness phase at the involved institutes. ...
Functional Analysis of Promoter Region from Eel Cytochrome P450 1A1 Gene in Transgenic Medaka.
Ogino; Itakura; Kato; Aoki; Sato
1999-07-01
: Transcription of the CYP1A1 genes in mammals and fish is stimulated by polyaromatic hydrocarbons. DNA sequencing analysis revealed that CYP1A1 gene in eel (Anguilla japonica) contains two kinds of putative cis-acting regulatory elements, XRE (xenobiotic-responsive element) and ERE (estrogen-responsive element). XRE is known as the enhancer that is responsible for the inducibility of the genes of CYP1A1 and some other drug-metabolizing enzymes. In the eel CYP1A1 gene, XRE motifs are distributed as follows: five times in the region from -2136 to -1125 bp, XRE(-6) to (-2); once in the proximal basal promoter region, XRE(-1); and once in the first intron, XRE(+1). The region between XRE(-2) and XRE(-1) contains three ERE motifs. To investigate the function of the cis-acting regulatory elements in the eel CYP1A1 gene, recombinant plasmids prepared with its 5' upstream sequence and the structural gene for luciferase were microinjected into fertilized eggs of medaka at the one-cell stage. Hatched fry were treated with 3-methylcholanthrene, and the transcription efficiency was assayed using competitive polymerase chain reaction analysis. Deletion of the region containing the five XREs, XRE(-6) to XRE(-2), and the point mutation of XRE(-1) reduced the inducible expressions by 75% and 56%, respectively, showing apparent dependency of the drug induction on the XREs. Constitutive expression, however, was not significantly affected by deletion or disruption of the XREs. When the region between XRE(-2) and XRE(-1) containing no XREs but three ERE motifs was internally deleted, the inducible expression and the constitutive expression were reduced by 88% and 75%, respectively. Replacement of this region with a partial fragment of eel CYP1A1 complementary DNA, with slight alteration of the distance between the five XREs and XRE(-1), reduced the inducible expression and the constitutive expression by 91% and 60%, respectively. These results strongly suggest that not only XRE but
Experimental Studies on the Flammability and Fire Hazards of Photovoltaic Modules
Directory of Open Access Journals (Sweden)
Hong-Yun Yang
2015-07-01
Full Text Available Many of the photovoltaic (PV systems on buildings are of sufficiently high voltages, with potential to cause or promote fires. However, research about photovoltaic fires is insufficient. This paper focuses on the flammability and fire hazards of photovoltaic modules. Bench-scale experiments based on polycrystalline silicon PV modules have been conducted using a cone calorimeter. Several parameters including ignition time (tig, mass loss, heat release rate (HRR, carbon monoxide (CO and carbon dioxide (CO2 concentration, were investigated. The fire behaviours, fire hazards and toxicity of gases released by PV modules are assessed based on experimental results. The results show that PV modules under tests are inflammable with the critical heat flux of 26 kW/m2. This work will lead to better understanding on photovoltaic fires and how to help authorities determine the appropriate fire safety provisions for controlling photovoltaic fires.
Scannerless laser range imaging using loss modulation
Energy Technology Data Exchange (ETDEWEB)
Sandusky, John V [Albuquerque, NM
2011-08-09
A scannerless 3-D imaging apparatus is disclosed which utilizes an amplitude modulated cw light source to illuminate a field of view containing a target of interest. Backscattered light from the target is passed through one or more loss modulators which are modulated at the same frequency as the light source, but with a phase delay .delta. which can be fixed or variable. The backscattered light is demodulated by the loss modulator and detected with a CCD, CMOS or focal plane array (FPA) detector to construct a 3-D image of the target. The scannerless 3-D imaging apparatus, which can operate in the eye-safe wavelength region 1.4-1.7 .mu.m and which can be constructed as a flash LADAR, has applications for vehicle collision avoidance, autonomous rendezvous and docking, robotic vision, industrial inspection and measurement, 3-D cameras, and facial recognition.
Characterization of modulated integrate-and-fire systems
International Nuclear Information System (INIS)
Alstroem, P.; Christiansen, B.; Levinsen, M.T.
1988-01-01
The phase locking structure in threshold modulated integrate-and-fire systems is explored. The existence of a smooth critical line where the Poincare map has an infinite slope inflection point is emphasized. At and below this line the system is related to circle map systems. Especially, this allows realization of systems with higher order scaling structures, qualitatively distinct from ordinary third order circle map structures. Hourglass patterns develop in parameter space and at small modulation amplitudes the behavior of the phase-locking regions (Arnold tongues) change dramatically. Above the critical line the Arnold tongues complete the parameter space, leaving along any line a zero-dimensional Cantor set of points associated with irrational rotation numbers. The critical line is not associated with a transition to chaos. In particular non-chaotic regions with complete phase-locking exist. In the supercritical region a gap is present in the Poincare map. The features at this gap are examined. Also local hysteresis may occur. We discuss the applicability of the local approximation. (orig.)
Tayon, Wesley A.; Domack, Marcia S.; Hoffman, Eric K.; Hales, Stephen J.
2013-01-01
In order to improve manufacturing efficiency and reduce structural mass and costs in the production of launch vehicle structures, NASA is pursuing a wide-range of innovative, near-net shape manufacturing technologies. A technology that combines friction stir welding (FSW) and spin-forming has been applied to manufacture a single-piece crew module using Aluminum-Lithium (AL-Li) Alloy 2195. Plate size limitations for Al-Li alloy 2195 require that two plates be FSW together to produce a spin-forming blank of sufficient size to form the crew module. Subsequent forming of the FSW results in abnormal grain growth (AGG) within the weld region upon solution heat treatment (SHT), which detrimentally impacts strength, ductility, and fracture toughness. The current study seeks to identify microstructural factors that contribute to the development of AGG. Electron backscatter diffraction (EBSD) was used to correlate driving forces for AGG, such as stored energy, texture, and grain size distributions, with the propensity for AGG. Additionally, developmental annealing treatments prior to SHT are examined to reduce or eliminate the occurrence of AGG by promoting continuous, or uniform, grain growth
Solar cell degradation under open circuit condition in out-doors-in desert region
Directory of Open Access Journals (Sweden)
M. Boussaid
Full Text Available The reliability of solar cells is an important parameter in the design of photovoltaic systems and particularly for cost estimation. Solar cell degradation is the result of various operating conditions; temperature is one of most important factors. Installed PV modules in desert regions are subjected to various temperature changes with significant gradient leading to accelerated degradation. In the present work, we demonstrate the influence of open-circuit condition on the degradation of PV modules. The experiment is carried out in the desert region of ADRAR (southern Algeria using two modules IJISEL of single-crystal silicon. A continuous monitoring allows analysis of both performances of modules for duration of 330 days. The module in open-circuit condition reaches higher temperature means than the module in charging condition; therefore, it undergoes a higher degradation. By simulation, we found that the life of a PV module (whose power output is close to 50% in a condition of an open-circuit in the desert region could be reduced to 4 years, and that has a significant impact on economy. Keywords: WEIBULL, Photovoltaic, Degradation, Open-circuit, Single-crystal, Silicon
Directory of Open Access Journals (Sweden)
Maseapo P. Mthobeni
2013-02-01
Full Text Available South African communities are still greatly affected by the high rate of infection with HIV or who are living with AIDS, mirrored in the 2008 overall national HIV prevalence of 29.3%(UNAIDS 2010:10. In addressing the challenge, the health system is dependent on community care level workers such as caregivers to render health promotion and education in the homes and communities. The caregivers based in the communities are the ones with first-hand information on what is needed for the success of health promotion programmes. This study, aimed at exploring the challenges faced by the health promoters, described their perceptions regarding a health promotion programme for families with adolescents orphaned as a result of AIDS. Data were collected on the purposively selected participants at the rural Hammanskraal region in South Africa and the research question: ‘What is your perception regarding health promotion programmes for families with adolescents orphaned as a result of AIDS’ was asked and discussed by participants in a focus group interview. Data were analysed using the adapted Tesch method to organize and isolate the main categories, sub-categories and themes. The following main categories were isolated: attitudes of adolescents, effectiveness of home visits, need for health education and limited resources. Based on the findings, it was therefore recommended that health care planners assist in the improvement of health promotion and education by using the community and national media, providing information material and providing access to the internet in order to allow more people, including young people, to access the information.Suid-Afrikaanse gemeenskappe word steeds grootliks beïnvloed deur die hoë vlak van MIV en vigs, soos weerspieël in die algehele nasionale MIV-syfer in 2008 van 29.3% (UNAIDS 2010:10. In die aanspreek van hierdie uitdaging is die gesondheidstelsel afhanklik van gemeenskapsorgwerkers om gesondheidsbevordering
Directory of Open Access Journals (Sweden)
Maseapo P. Mthobeni
2013-02-01
Full Text Available South African communities are still greatly affected by the high rate of infection with HIV or who are living with AIDS, mirrored in the 2008 overall national HIV prevalence of 29.3%(UNAIDS 2010:10. In addressing the challenge, the health system is dependent on community care level workers such as caregivers to render health promotion and education in the homes and communities. The caregivers based in the communities are the ones with first-hand information on what is needed for the success of health promotion programmes. This study, aimed at exploring the challenges faced by the health promoters, described their perceptions regarding a health promotion programme for families with adolescents orphaned as a result of AIDS. Data were collected on the purposively selected participants at the rural Hammanskraal region in South Africa and the research question: ‘What is your perception regarding health promotion programmes for families with adolescents orphaned as a result of AIDS’ was asked and discussed by participants in a focus group interview. Data were analysed using the adapted Tesch method to organize and isolate the main categories, sub-categories and themes. The following main categories were isolated: attitudes of adolescents, effectiveness of home visits, need for health education and limited resources. Based on the findings, it was therefore recommended that health care planners assist in the improvement of health promotion and education by using the community and national media, providing information material and providing access to the internet in order to allow more people, including young people, to access the information. Suid-Afrikaanse gemeenskappe word steeds grootliks beïnvloed deur die hoë vlak van MIV en vigs, soos weerspieël in die algehele nasionale MIV-syfer in 2008 van 29.3% (UNAIDS 2010:10. In die aanspreek van hierdie uitdaging is die gesondheidstelsel afhanklik van gemeenskapsorgwerkers om gesondheidsbevordering
Emotional Modulation of Learning and Memory: Pharmacological Implications.
LaLumiere, Ryan T; McGaugh, James L; McIntyre, Christa K
2017-07-01
Memory consolidation involves the process by which newly acquired information becomes stored in a long-lasting fashion. Evidence acquired over the past several decades, especially from studies using post-training drug administration, indicates that emotional arousal during the consolidation period influences and enhances the strength of the memory and that multiple different chemical signaling systems participate in this process. The mechanisms underlying the emotional influences on memory involve the release of stress hormones and activation of the basolateral amygdala, which work together to modulate memory consolidation. Moreover, work suggests that this amygdala-based memory modulation occurs with numerous types of learning and involves interactions with many different brain regions to alter consolidation. Additionally, studies suggest that emotional arousal and amygdala activity in particular influence synaptic plasticity and associated proteins in downstream brain regions. This review considers the historical understanding for memory modulation and cellular consolidation processes and examines several research areas currently using this foundational knowledge to develop therapeutic treatments. Copyright © 2017 by The American Society for Pharmacology and Experimental Therapeutics.
Irreducible Specht modules are signed Young modules
Hemmer, David J.
2005-01-01
Recently Donkin defined signed Young modules as a simultaneous generalization of Young and twisted Young modules for the symmetric group. We show that in odd characteristic, if a Specht module $S^\\lambda$ is irreducible, then $S^\\lambda$ is a signed Young module. Thus the set of irreducible Specht modules coincides with the set of irreducible signed Young modules. This provides evidence for our conjecture that the signed Young modules are precisely the class of indecomposable self-dual module...
Energy spectrum control for modulated proton beams
International Nuclear Information System (INIS)
Hsi, Wen C.; Moyers, Michael F.; Nichiporov, Dmitri; Anferov, Vladimir; Wolanski, Mark; Allgower, Chris E.; Farr, Jonathan B.; Mascia, Anthony E.; Schreuder, Andries N.
2009-01-01
In proton therapy delivered with range modulated beams, the energy spectrum of protons entering the delivery nozzle can affect the dose uniformity within the target region and the dose gradient around its periphery. For a cyclotron with a fixed extraction energy, a rangeshifter is used to change the energy but this produces increasing energy spreads for decreasing energies. This study investigated the magnitude of the effects of different energy spreads on dose uniformity and distal edge dose gradient and determined the limits for controlling the incident spectrum. A multilayer Faraday cup (MLFC) was calibrated against depth dose curves measured in water for nonmodulated beams with various incident spectra. Depth dose curves were measured in a water phantom and in a multilayer ionization chamber detector for modulated beams using different incident energy spreads. Some nozzle entrance energy spectra can produce unacceptable dose nonuniformities of up to ±21% over the modulated region. For modulated beams and small beam ranges, the width of the distal penumbra can vary by a factor of 2.5. When the energy spread was controlled within the defined limits, the dose nonuniformity was less than ±3%. To facilitate understanding of the results, the data were compared to the measured and Monte Carlo calculated data from a variable extraction energy synchrotron which has a narrow spectrum for all energies. Dose uniformity is only maintained within prescription limits when the energy spread is controlled. At low energies, a large spread can be beneficial for extending the energy range at which a single range modulator device can be used. An MLFC can be used as part of a feedback to provide specified energy spreads for different energies.
Directory of Open Access Journals (Sweden)
Alexandru NEDELEA
2009-06-01
Full Text Available In order to establish an adequate balance between tourists' welfare, the needs of the natural and cultural environment, as well as to develop tourist destinations and organizations' competitiveness, it is necessary to carry out a global and integrated approach, where all interested parties share the same goals regarding the durability of tourism and the approached challenges. The purpose of this work is to identify the factors of reduced risk having a major impact over the sustainability of the tourist region under analysis and to highlight the risk factors' connections and impact in order to minimize and eliminate them, with direct effects over the awareness of tourist industry's values. The identification of lasting development's indicators will take into account all these three aspects of the durable development of tourism, namely ecological, economical and social factors, that play a part in highlighting the real performance of a tourist destination. All these aspects are absolutely necessary for the promotion of the Danube's tourist potential, achievable through the emphasis of the relevant values from the tourist patrimony of the county of Galati. The promotion of the Danube' tourist potential presupposes a series of objectives that are subordinated to the general direction that is marked at the national level, respectively Romania's transformation into a qualitative tourist destination based on its natural and cultural patrimony, in order to correspond to the European Union standards. The new policy regarding tourism proposed by the European Commission aims at offering constant support for this industry to be able to face different challenges, by promoting also competitiveness in general.
Cooperative monitoring and its role in regional security
Energy Technology Data Exchange (ETDEWEB)
Biringer, K.; Olsen, J.; Lincoln, R.; Wehling, F. [and others
1997-03-01
Cooperative monitoring systems can play an important part in promoting the implementation of regional cooperative security agreements. These agreements advance the national security interests of the United States in a post Cold War environment. Regional issues as widely varying as nuclear nonproliferation, trade and environmental pollution can be the source of tensions which may escalate to armed conflict which could have global implications. The Office of National Security Policy Analysis at the US Department of Energy (DOE) has an interest in seeking ways to promote regional cooperation that can reduce the threats posed by regional conflict. DOE technologies and technical expertise can contribute to developing solutions to a wide variety of these international problems. Much of this DOE expertise has been developed in support of the US nuclear weapons and arms control missions. It is now being made available to other agencies and foreign governments in their search for regional security and cooperation. This report presents two examples of interest to DOE in which monitoring technologies could be employed to promote cooperation through experimentation. The two scenarios include nuclear transparency in Northeast Asia and environmental restoration in the Black Sea. Both offer the potential for the use of technology to promote regional cooperation. The issues associated with both of these monitoring applications are presented along with examples of appropriate monitoring technologies, potential experiments and potential DOE contributions to the scenarios.
Regions and the Territorial Cohesion
Directory of Open Access Journals (Sweden)
Ioan Ianos
2013-08-01
Full Text Available Territorial cohesion is an important target of European Union, constantly promoted by its institutions and their representatives. In the context of the Europe 2020 strategy, one of the most important support documents, the region represents a very important issue, being considered to be the key to its successfulness. The region is seen as a support for the smart growth and all the operational policy concepts try to make use of the spatial potential, by taking better account of the territorial specificities. Two main questions play attention: the need to transform the present-day developmental regions into administrative ones is a priority? What kind of regionalization it must to be promoted? Correlating these issues with already defined territorial cohesion, the administrative region is a real tool for the future territorial development. The experience of the last 14 years asks urgently the building of a new territorial administrative reform, giving competences to regions. For instant, each development region is a construction resulted from a free association of the counties. Their role in the regional development is much reduced one, because their regional councils are not elected; decisions taken at this level are consultative for the social, economical, cultural or political actors.
The Cascade Drift Module: a GIS-based study on regional pesticide deposition
Holterman, H.J.; Zande, van de J.C.
2008-01-01
The Cascade Project describes the modelling of spray drift and pesticide fate for a network of interconnected water bodies in a rural area. The present study concerns the first part of the proj ect, the Cascade Drift Module, which models the spatial and temporal distribution of deposits of spray
Method for measuring retardation of infrared wave-plate by modulated-polarized visible light
Zhang, Ying; Song, Feijun
2012-11-01
A new method for precisely measuring the optical phase retardation of wave-plates in the infrared spectral region is presented by using modulated-polarized visible light. An electro-optic modulator is used to accurately determine the zero point by the frequency-doubled signal of the Modulated-polarized light. A Babinet-Soleil compensator is employed to make the phase delay compensation. Based on this method, an instrument is set up to measure the retardations of the infrared wave-plates with visible region laser. Measurement results with high accuracy and sound repetition are obtained by simple calculation. Its measurement precision is less than and repetitive precision is within 0.3%.
Endocannabinoid modulation of homeostatic and non-homeostatic feeding circuits.
Lau, Benjamin K; Cota, Daniela; Cristino, Luigia; Borgland, Stephanie L
2017-09-15
The endocannabinoid system has emerged as a key player in the control of eating. Endocannabinoids, including 2-arachidonoylglycerol (2-AG) and anandamide (AEA), modulate neuronal activity via cannabinoid 1 receptors (CB1Rs) in multiple nuclei of the hypothalamus to induce or inhibit food intake depending on nutritional and hormonal status, suggesting that endocannabinoids may act in the hypothalamus to integrate different types of signals informing about the animal's energy needs. In the mesocorticolimbic system, (endo)cannabinoids modulate synaptic transmission to promote dopamine release in response to palatable food. In addition, (endo)cannabinoids act within the nucleus accumbens to increase food's hedonic impact; although this effect depends on activation of CB1Rs at excitatory, but not inhibitory inputs in the nucleus accumbens. While hyperactivation of the endocannabinoid system is typically associated with overeating and obesity, much evidence has emerged in recent years suggesting a more complicated system than first thought - endocannabinoids promote or suppress feeding depending on cell and input type, or modulation by various neuronal or hormonal signals. This review presents our latest knowledge of the endocannabinoid system in non-homeostatic and homeostatic feeding circuits. In particular, we discuss the functional role and cellular mechanism of action by endocannabinoids within the hypothalamus and mesocorticolimbic system, and how these are modulated by neuropeptide signals related to feeding. In light of recent advances and complexity in the field, we review cannabinoid-based therapeutic strategies for the treatment of obesity and how peripheral restriction of CB1R antagonists may provide a different mechanism of weight loss without the central adverse effects. This article is part of the Special Issue entitled "A New Dawn in Cannabinoid Neurobiology". Copyright © 2017 Elsevier Ltd. All rights reserved.
An NPARC Turbulence Module with Wall Functions
Zhu, J.; Shih, T.-H.
1997-01-01
The turbulence module recently developed for the NPARC code has been extended to include wall functions. The Van Driest transformation is used so that the wall functions can be applied to both incompressible and compressible flows. The module is equipped with three two-equation K-epsilon turbulence models: Chien, Shih-Lumley and CMOTR models. Details of the wall functions as well as their numerical implementation are reported. It is shown that the inappropriate artificial viscosity in the near-wall region has a big influence on the solution of the wall function approach. A simple way to eliminate this influence is proposed, which gives satisfactory results during the code validation. The module can be easily linked to the NPARC code for practical applications.
Walsh, Mary F; Ampasala, Dinakar R; Rishi, Arun K; Basson, Marc D
2009-02-01
TGF-beta and FAK modulate cell migration, differentiation, proliferation and apoptosis, and TGF-beta promotes FAK transcription in intestinal epithelial cells via Smad-dependent and independent pathways. We utilized a 1320 bp FAK promoter-luciferase construct to characterize basal and TGF-beta-mediated FAK gene transcription in IEC-6 cells. Inhibiting JNK or Akt negated TGF-beta-stimulated promoter activity; ERK inhibition did not block the TGF-beta effect but increased basal activity. Co-transfection with Co-Smad4 enhanced the TGF-beta response while the inhibitory Smad7 abolished it. Serial deletions sequentially removing the four Smad binding elements (SBE) in the 5' untranslated region of the promoter revealed that the two most distal SBE's are positive regulators while SBE3 exerts a negative influence. Mutational deletion of two upstream p53 sites enhanced basal but did not affect TGF-beta-stimulated increases in promoter activity. TGF-beta increased DNA binding of Smad4, phospho-Smad2/3 and Runx1/AML1a to the most distal 435 bp containing 3 SBE and 2 AML1a sites by ChIP assay. However, although point mutation of SBE1 ablated the TGF-beta-mediated rise in SV40-promoter activity, mutation of AML1a sites did not. TGF-beta regulation of FAK transcription reflects a complex interplay between positive and negative non-Smad signals and SBE's, the last independent of p53 or AML1a.
Ottini, Laura; Rizzolo, Piera; Siniscalchi, Ester; Zijno, Andrea; Silvestri, Valentina; Crebelli, Riccardo; Marcon, Francesca
2015-02-01
The influence of DNA repair capacity, plasma nutrients and tobacco smoke exposure on DNA methylation was investigated in blood cells of twenty-one couples of monozygotic twins with discordant smoking habits. All study subjects had previously been characterized for mutagen sensitivity with challenge assays with ionizing radiation in peripheral blood lymphocytes. Plasma levels of folic acid, vitamin B12 and homocysteine were also available from a previous investigation. In this work DNA methylation in the promoter region of a panel of ten genes involved in cell cycle control, differentiation, apoptosis and DNA repair (p16, FHIT, RAR, CDH1, DAPK1, hTERT, RASSF1A, MGMT, BRCA1 and PALB2) was assessed in the same batches of cells isolated for previous studies, using the methylation-sensitive high-resolution melting technique. Fairly similar profiles of gene promoter methylation were observed within co-twins compared to unrelated subjects (p= 1.23 × 10(-7)), with no significant difference related to smoking habits (p = 0.23). In a regression analysis the methylation index of study subjects, used as synthetic descriptor of overall promoter methylation, displayed a significant inverse correlation with radiation-induced micronuclei (p = 0.021) and plasma folic acid level (p = 0.007) both in smokers and in non-smokers. The observed association between repair of radiation-induced DNA damage and promoter methylation suggests the involvement of the DNA repair machinery in DNA modification. Data also highlight the possible modulating effect of folate deficiency on DNA methylation and the strong influence of familiarity on the individual epigenetic profile. Copyright © 2015 Elsevier B.V. All rights reserved.
Modelling PV modules' performance in Sahelian climates
Energy Technology Data Exchange (ETDEWEB)
Diarra, D.C.; Akuffo, F.O. [Kwame Nkrumah Univ. of Science and Technology, Kumasi (Ghana). Dept. of Mechanical Engineering
2003-08-01
This paper describes the development of a thermo-optical model designed to evaluate the temperature of a photovoltaic (PV) module in an effort to design a cost-effective cooling system for PV modules operating under high ambient temperatures. The power output of a PV module is greatly reduced when its temperature rises. This loss in efficiency is particularly significant in Sahelian regions where PV modules are subjected to high solar radiation intensities and high ambient temperatures. The newly developed thermo-optical model confirms that most of the heat in a PV module is generated in the solar cell. The results of the analysis include: the optical absorption, reflection and transmission of the solar radiation incident on the module; the temperature distribution in the module; and, the heat transfer through the top and bottom of the module. At incidence angles of 60 degrees, approximately three-quarters of the heat is generated in the solar cell. The optical efficiency is 88.44 per cent at normal incidence angle and 82.48 per cent when the incidence angle is 60 degrees. It was determined that the cooling system should be located as close as possible to the solar cell in order to increase the thermal heat flow from the cell. 4 refs., 3 tabs., 4 figs.
International Nuclear Information System (INIS)
Mishiro, Yuichiro; Oki, Takashi; Iuchi, Arata
1999-01-01
Global left ventricular (LV) pump function is generally preserved in patients with hypertrophic cardiomyopathy (HCM). However, it is unknown whether regional myocardial contractility is impaired, especially in nonhypertrophied regions. The purpose of this study was to evaluate regional LV myocardial contraction in patients with HCM using magnetic resonance (MR) spatial modulation of magnetization (SPAMM) myocardial tagging. The study group comprised 20 patients with asymmetric septal hypertrophy (HCM group) and 16 age-matched normal patients (control group), and data were collected using transthoracic M-mode and 2-dimensional echocardiography, and MR SPAMM myocardial tagging. The systolic strain ratio, maximum systolic strain velocity, and time from end-diastole to maximum systolic strain (ΔT) in the anterior, ventricular septal, inferior and lateral regions for 2 LV short-axis sections at the levels of the chordae tendineae and papillary muscles were measured at 50-ms intervals by MR myocardial tagging. The end-diastolic anterior and ventricular septal wall thicknesses and LV mass index were significantly different between the HCM and control groups. The systolic strain ratio for all 4 walls, particularly the anterior and ventricular septal regions, was significantly lower in the HCM group. In the HCM group, the maximum systolic strain velocity was significantly lower and ΔT was significantly shorter for all 4 walls, particularly the anterior and ventricular septal regions. The standard deviation for the ΔT, calculated from the ΔT for the 8 regions of the 2 LV short-axis sections, was significantly greater in the HCM group. In conclusion, regional LV myocardial contraction is impaired in both hypertrophied and nonhypertrophied regions, and systolic LV wall asynchrony occurs in patients with HCM. (author)
Modulation of medial prefrontal cortical activity using in vivo recordings and optogenetics
Directory of Open Access Journals (Sweden)
Ji Guangchen
2012-10-01
Full Text Available Abstract Background The medial prefrontal cortex (mPFC serves major executive functions. mPFC output to subcortical brain areas such as the amygdala controls emotional processing and plays an important role in fear extinction. Impaired mPFC function correlates with extinction deficits in anxiety disorders such as PTSD and with cognitive decision-making deficits in neuropsychiatric disorders and persistent pain. Controlling mPFC output is a desirable therapeutic goal in neuropsychiatric disorders but functional differences of cell types (pyramidal cells and interneurons and regions (infralimbic and prelimbic represent a challenge. This electrophysiological study used optogenetics for the cell- and region-specific modulation of mPFC pyramidal output in the intact anesthetized animal. Results Extracellular single-unit recordings were made from infralimbic (IL pyramidal cells, IL interneurons and prelimbic (PL pyramidal cells 2–3 weeks after intra-IL injection of a viral vector encoding channel rhodopsin 2 (ChR2 under the control of the CaMKII promoter (rAAV5/CaMKIIa-ChR2(H134R-EYFP or a control vector that lacked the ChR2 sequence (rAAV5/CaMKIIa-EYFP. Optical stimulation with laser-generated blue light pulses delivered through an optical fiber to the IL increased spontaneous and evoked action potential firing of ChR2 expressing IL pyramidal cells but had no effect on IL interneurons that were distinguished from pyramidal cells based on their higher firing rate and shorter spike duration. Optical activation of IL pyramidal cells also inhibited PL pyramidal cells, suggesting that IL output controls PL output. The effects were light intensity-dependent and reversible. Confocal microscopy confirmed ChR2-EYFP or control vector expression in mPFC pyramidal cells but not in GABAergic cells. Conclusions The novelty of our study is the analysis of optogenetic effects on background and evoked activity of defined cell types in different mPFC regions. The
Liu, Fu-Jun; Song, Xiulong; Yang, Dongfang; Deng, Ruitang; Yan, Bingfang
2008-01-01
CYP3A4 (cytochrome P450 3A4) is involved in the metabolism of more than 50% of drugs and other xenobiotics. The expression of CYP3A4 is induced by many structurally dissimilar compounds. The PXR (pregnane X receptor) is recognized as a key regulator for the induction, and the PXR-directed transactivation of the CYP3A4 gene is achieved through a co-ordinated mechanism of the distal module with the proximal promoter. Recently, a far module was found to support constitutive expression of CYP3A4. The far module, like the distal module, is structurally clustered by a PXR response element (F-ER6) and elements recognized by HNF-4alpha (hepatocyte nuclear receptor-4alpha). We hypothesized that the far module supports PXR transactivation of the CYP3A4 gene. Consistent with the hypothesis, fusion of the far module to the proximal promoter of CYP3A4 markedly increased rifampicin-induced reporter activity. The increase was synergistically enhanced when both the far and distal modules were fused to the proximal promoter. The increase, however, was significantly reduced when the F-ER6 was disrupted. Chromatin immunoprecipitation detected the presence of PXR in the far module. Interestingly, HNF-4alpha increased the activity of the distal-proximal fused promoter, but decreased the activity of the far-proximal fused promoter. Given the fact that induction of CYP3A4 represents an important detoxification mechanism, the functional redundancy and synergistic interaction in supporting PXR transactivation suggest that the far and distal modules ensure the induction of CYP3A4 during chemical insults. The difference in responding to HNF-4alpha suggests that the magnitude of the induction is under control through various transcriptional networks.
Power Generator with Thermo-Differential Modules
Saiz, John R.; Nguyen, James
2010-01-01
A thermoelectric power generator consists of an oven box and a solar cooker/solar reflector unit. The solar reflector concentrates sunlight into heat and transfers the heat into the oven box via a heat pipe. The oven box unit is surrounded by five thermoelectric modules and is located at the bottom end of the solar reflector. When the heat is pumped into one side of the thermoelectric module and ejected from the opposite side at ambient temperatures, an electrical current is produced. Typical temperature accumulation in the solar reflector is approximately 200 C (392 F). The heat pipe then transfers heat into the oven box with a loss of about 40 percent. At the ambient temperature of about 20 C (68 F), the temperature differential is about 100 C (180 F) apart. Each thermoelectric module, generates about 6 watts of power. One oven box with five thermoelectric modules produces about 30 watts. The system provides power for unattended instruments in remote areas, such as space colonies and space vehicles, and in polar and other remote regions on Earth.
7 CFR 1205.319 - Cotton-producing region.
2010-01-01
... 7 Agriculture 10 2010-01-01 2010-01-01 false Cotton-producing region. 1205.319 Section 1205.319... Cotton Research and Promotion Order Definitions § 1205.319 Cotton-producing region. Cotton-producing region means each of the following groups of cotton-producing States: (a) Southeast Region: Alabama...
Jé gu, Teddy; Veluchamy, Alaguraj; Ramirez Prado, Juan Sebastian; Rizzi-Paillet, Charley; Perez, Magalie; Lhomme, Anaï s; Latrasse, David; Coleno, Emeline; Vicaire, Serge; Legras, Sté phanie; Jost, Bernard; Rougé e, Martin; Barneche, Fredy; Bergounioux, Catherine; Crespi, Martin; Mahfouz, Magdy M.; Hirt, Heribert; Raynaud, Cé cile; Benhamed, Moussa
2017-01-01
Plant adaptive responses to changing environments involve complex molecular interplays between intrinsic and external signals. Whilst much is known on the signaling components mediating diurnal, light, and temperature controls on plant development, their influence on chromatin-based transcriptional controls remains poorly explored.In this study we show that a SWI/SNF chromatin remodeler subunit, BAF60, represses seedling growth by modulating DNA accessibility of hypocotyl cell size regulatory genes. BAF60 binds nucleosome-free regions of multiple G box-containing genes, opposing in cis the promoting effect of the photomorphogenic and thermomorphogenic regulator Phytochrome Interacting Factor 4 (PIF4) on hypocotyl elongation. Furthermore, BAF60 expression level is regulated in response to light and daily rhythms.These results unveil a short path between a chromatin remodeler and a signaling component to fine-tune plant morphogenesis in response to environmental conditions.
Jégu, Teddy
2017-06-15
Plant adaptive responses to changing environments involve complex molecular interplays between intrinsic and external signals. Whilst much is known on the signaling components mediating diurnal, light, and temperature controls on plant development, their influence on chromatin-based transcriptional controls remains poorly explored.In this study we show that a SWI/SNF chromatin remodeler subunit, BAF60, represses seedling growth by modulating DNA accessibility of hypocotyl cell size regulatory genes. BAF60 binds nucleosome-free regions of multiple G box-containing genes, opposing in cis the promoting effect of the photomorphogenic and thermomorphogenic regulator Phytochrome Interacting Factor 4 (PIF4) on hypocotyl elongation. Furthermore, BAF60 expression level is regulated in response to light and daily rhythms.These results unveil a short path between a chromatin remodeler and a signaling component to fine-tune plant morphogenesis in response to environmental conditions.
The HTLV-I tax protein transcriptionally modulates OX40 antigen expression.
Pankow, R; Dürkop, H; Latza, U; Krause, H; Kunzendorf, U; Pohl, T; Bulfone-Paus, S
2000-07-01
OX40 is a member of the TNF receptor family, expressed on activated T cells. It is the only costimulatory T cell molecule known to be specifically up-regulated in human T cell leukemia virus type-I (HTLV-I)-producing cells. In a T cell line, OX40 surface expression was shown to be induced by HTLV-I Tax alone. To understand molecular mechanisms of OX40 gene regulation and modulation by HTLV-I Tax, we have cloned the human OX40 gene and analyzed its 5'-flanking region. By reporter gene analysis with progressive 5' deletions from nucleotides -1259 to -64, we have defined a 157-bp DNA fragment as a minimal promoter for constitutive expression. In addition, we show that in the OX40+ cell line, Co, Tax is able to further increase OX40 surface expression. Up-regulation of OX40 promoter activity by Tax requires two upstream NF-kappaB sites, which are not active in the constitutive OX40 expression. Their deletion abrogates Tax responsiveness in reporter gene analysis. The site-directed mutagenesis of each NF-kappaB site demonstrates that cooperative NF-kappaB binding is a prerequisite for Tax-directed activity as neither site alone is sufficient for a full Tax responsiveness of the OX40 promoter. Upon Tax expression, both sites bind p65 and c-Rel. These data provide new insight into the direct regulation of OX40 by Tax and add to our understanding of the possible role of the OX40/OX40 ligand system in the proliferation of HTLV-I+ T cells.
Multilevel photonic modules for millimeter-wave phased-array antennas
Paolella, Arthur C.; Bauerle, Athena; Joshi, Abhay M.; Wright, James G.; Coryell, Louis A.
2000-09-01
Millimeter wave phased array systems have antenna element sizes and spacings similar to MMIC chip dimensions by virtue of the operating wavelength. Designing modules in traditional planar packaing techniques are therefore difficult to implement. An advantageous way to maintain a small module footprint compatible with Ka-Band and high frequency systems is to take advantage of two leading edge technologies, opto- electronic integrated circuits (OEICs) and multilevel packaging technology. Under a Phase II SBIR these technologies are combined to form photonic modules for optically controlled millimeter wave phased array antennas. The proposed module, consisting of an OEIC integrated with a planar antenna array will operate on the 40GHz region. The OEIC consists of an InP based dual-depletion PIN photodetector and distributed amplifier. The multi-level module will be fabricated using an enhanced circuit processing thick film process. Since the modules are batch fabricated using an enhanced circuit processing thick film process. Since the modules are batch fabricated, using standard commercial processes, it has the potential to be low cost while maintaining high performance, impacting both military and commercial communications systems.
TRYPTOPHAN PROMOTES CHARITABLE DONATING
Directory of Open Access Journals (Sweden)
Laura eSteenbergen
2014-12-01
Full Text Available The link between serotonin (5-HT and one of the most important elements of prosocial behavior, charity, has remained largely uninvestigated. In the present study, we tested whether charitable donating can be promoted by administering the food supplement L-Tryptophan (TRP, the biochemical precursor of 5-HT. Participants were compared with respect to the amount of money they donated when given the opportunity to make a charitable donation. As expected, compared to a neutral placebo, TRP appears to increase the participants’ willingness to donate money to a charity. This result supports the idea that the food we eat may act as a cognitive enhancer modulating the way we think and perceive the world and others.
Directory of Open Access Journals (Sweden)
Qiang Sun
Full Text Available IgA nephropathy (IgAN is one of the most common glomerular diseases leading to end-stage renal failure. Elevation of aberrantly glycosylated IgA1 is a key feature of it. The expression of the specific molecular chaperone of core1ß1, 3galactosyl transferase (Cosmc is known to be reduced in IgAN. We aimed to investigate whether the methylation of CpG islands of Cosmc gene promoter region could act as a possible mechanism responsible for down-regulation of Cosmc and related higher secretion of aberrantly glycosylated IgA1in lymphocytes from children with IgA nephropathy. Three groups were included: IgAN children (n = 26, other renal diseases (n = 11 and healthy children (n = 13. B-lymphocytes were isolated and cultured, treated or not with IL-4 or 5-Aza-2'-deoxycytidine (AZA. The levels of DNA methylation of Cosmc promotor region were not significantly different between the lymphocytes of the three children populations (P = 0.113, but there were significant differences between IgAN lymphocytes and lymphocytes of the other two children populations after IL-4 (P<0.0001 or AZA (P<0.0001. Cosmc mRNA expression was low in IgAN lymphocytes compared to the other two groups (P<0.0001. The level of aberrantly glycosylated IgA1 was markedly higher in IgAN group compared to the other groups (P<0.0001. After treatment with IL-4, the levels of Cosmc DNA methylation and aberrantly glycosylated IgA1 in IgAN lymphocytes were remarkably higher than the other two groups (P<0.0001 with more markedly decreased Cosmc mRNA content (P<0.0001. After treatment with AZA, the levels in IgAN lymphocytes were decreased, but was still remarkably higher than the other two groups (P<0.0001, while Cosmc mRNA content in IgAN lymphocytes were more markedly increased than the other two groups (P<0.0001. The alteration of DNA methylation by IL-4 or AZA specifically correlates in IgAN lymphocytes with alterations in Cosmc mRNA expression and with the level of aberrantly glycosylated
Regional Innovation Policies in MERCOSUR : Obstacles and ...
International Development Research Centre (IDRC) Digital Library (Canada)
... review existing regional cooperation initiatives, identify sectors with strong potential for regional cooperation, review other experiences in regional cooperation for innovation (European Union - EU, North American Free Trade Agreement - NAFTA), and propose institutional arrangements for promoting innovation among ...
Signed Young Modules and Simple Specht Modules
Danz, Susanne; Lim, Kay Jin
2015-01-01
By a result of Hemmer, every simple Specht module of a finite symmetric group over a field of odd characteristic is a signed Young module. While Specht modules are parametrized by partitions, indecomposable signed Young modules are parametrized by certain pairs of partitions. The main result of this article establishes the signed Young module labels of simple Specht modules. Along the way we prove a number of results concerning indecomposable signed Young modules that are of independent inter...
DEFF Research Database (Denmark)
Kiselyov, Vladislav V; Berezin, Vladimir; Bock, Elisabeth
2008-01-01
We report here the NMR assignment of the second fibronectin type III module of the neural cell adhesion molecule (NCAM). This module has previously been shown to interact with the fibroblast growth factor receptor (FGFR), and the FGFR-binding site was mapped by NMR to the FG-loop region of the mo......We report here the NMR assignment of the second fibronectin type III module of the neural cell adhesion molecule (NCAM). This module has previously been shown to interact with the fibroblast growth factor receptor (FGFR), and the FGFR-binding site was mapped by NMR to the FG-loop region...... of the module. The FG-loop region also contains a putative nucleotide-binding motif, which was shown by NMR to interact with ATP. Furthermore, ATP was demonstrated to inhibit binding of the second F3 module of NCAM to FGFR....
Tissue specific promoters improve the localization of radiation-inducible gene expression
International Nuclear Information System (INIS)
Hallahan, Dennis; Kataoka, Yasushi; Kuchibhotla, Jaya; Virudachalam, Subbu; Weichselbaum, Ralph
1996-01-01
Purpose: Site-specific activation of gene expression can be achieved by the use of a promoter that is induced by physical agents such as x-rays. The purpose of the present study was to determine whether site-specific activation of gene therapy can also be achieved within the vascular endothelium by use of radiation-inducible promoters. We studied induction of promoter-reporter gene constructs using previously identified radiation-promoters from c-jun, c-fos, Egr-1, ICAM-1, ELAM-1 after transfection into in the vascular endothelium. Methods: The following radiation-inducible genetic constructs were created: The ELAM-1 promoter fragment was cloned into pOGH to obtain the pE-sel(-587 +35)GH reporter construct. The ICAM-1 promoter fragment (-1162/+1) was cloned upstream of the CAT coding region of the pCAT-plasmid (Promega) after removal of the SV40 promoter by Bgl2/Stu1 digestion to create the pBS-CAT plasmid. The 132 to +170 bp segment of the 5' untranslated region of the c-jun promoter was cloned to the CAT reporter gene to create the -132/+170 cjun-CAT. The Egr-1 promoter fragment (-425/+75) was cloned upstream of the CAT coding region to create the pE425-CAT plasmid. Tandem repeats of the AP-1 binding site were cloned upstream of the CAT coding region (3 xTRE-CAT). Tandem repeats of the Egr binding site (EBS) were cloned upstream of the CAT coding region (EBS-CAT). Human vascular endothelial cells from both large vessel and small vessel origin (HUVEC and HMEC), as well as human tumor cell lines were transfected with plasmids -132/+170 cjun-CAT, pE425-CAT, 3 xTRE-CAT, EBS-CAT, pE-sel-GH and pBS-CAT by use of liposomes. Humor tumor cell lines included SQ20B (squamous), RIT3 (sarcoma), and HL525 (leukemia). Each plasmid was cotransfected with a plasmid containing a CMV promoter linked to the LacZ gene (1 μg). Transfected cells were treated with mock irradiation or x-rays. Cell extracts were assayed for reporter gene expression. Results: Radiation-induced gene
Regional planning and urban infrastructure development in the ...
African Journals Online (AJOL)
Regional planning and urban infrastructure development in the Gongola region, ... PROMOTING ACCESS TO AFRICAN RESEARCH ... In North-eastern Nigeria, the Gongola region has been one of the least developed since independence.
McNeal, Karen S.; Libarkin, Julie C.; Ledley, Tamara Shapiro; Bardar, Erin; Haddad, Nick; Elins, Kathy; Dutta, Saranee
2014-01-01
This study reports on an effort to illustrate the coupling of educational research with ongoing curriculum development to promote effective and evidence-based online learning. The research findings have been used to inform the "EarthLabs" curriculum development team as they revise existing modules and create new modules, in order to…
International Nuclear Information System (INIS)
Yang Minghui; Zang Qian; Dou Yongqi; Feng Linchun
2007-01-01
Objective: To observe the modulation by Blood-cooling and Blood Flow-promoting Herbs to expressions of tumor necrosis factor α (TNF-α) and basic fibroblast growth factors (bFGF) in radiation-induced lung injury of rats at different radiation times, and explore the mechanism of prevention and curative effect of the herbs on radiation lung injury. Methods: 160 wistar rats were randomly allocated into irradiation group, treatment group, herb-fracture group and control group. The first two groups were irradiated to right hemithorax with a dose of 30 Gy/10 fraction/5 weeks. Animals were sacrificed at weeks 3,5,8,12 and 26 post irradiation. The level of immunoreactivity of cytokine TNF-α and bFGF was evaluated. Results: The acute radiation-induced pneumonia occurred at weeks 3 and was most serious at weeks 5 and pulmonary fibrosis was remarkable at the late phase in irradiation group. The pneumonia and fibrosis of treatment group were lighter than that of irradiation group. Expressions of TNF-α and bFGF reached their peaks at weeks 5 and 26 of respectively. The expressions in treatment group was significantly lower than that the irradiation group( P<0.01). Conclusions: Blood-cooling and Blood Flow-promoting Herbs can prevent and treat the radiation-reduced lung injury by restraining the expression of TNF-α and bFGF. (authors)
Kim, Young Eun; Choi, Hyung Chul; Lee, In-Chul; Yuk, Dong Yeon; Lee, Hyosung; Choi, Bu Young
2016-01-01
3-Deoxysappanchalcone (3-DSC) has been reported to possess anti-allergic, antiviral, anti-inflammatory and antioxidant activities. In the present study, we investigated the effects of 3-DSC on the proliferation of human hair follicle dermal papilla cells (HDPCs) and mouse hair growth in vivo. A real-time cell analyzer system, luciferase assay, Western blot and real-time polymerase chain reaction (PCR) were employed to measure the biochemical changes occurring in HDPCs in response to 3-DSC treatment. The effect of 3-DSC on hair growth in C57BL/6 mice was also examined. 3-DSC promoted the proliferation of HDPCs, similar to Tofacitinib, an inhibitor of janus-activated kinase (JAK). 3-DSC promoted phosphorylation of β-catenin and transcriptional activation of the T-cell factor. In addition, 3-DSC potentiated interleukin-6 (IL-6)-induced phosphorylation and subsequent transactivation of signal transducer and activator of transcription-3 (STAT3), thereby increasing the expression of cyclin-dependent kinase-4 (Cdk4), fibroblast growth factor (FGF) and vascular endothelial growth factor (VEGF). On the contrary, 3-DSC attenuated STAT6 mRNA expression and IL4-induced STAT6 phosphorylation in HDPCs. Finally, we observed that topical application of 3-DSC promoted the anagen phase of hair growth in C57BL/6 mice. 3-DSC stimulates hair growth possibly by inducing proliferation of follicular dermal papilla cells via modulation of WNT/β-catenin and STAT signaling. PMID:27795451
A novel amplitude modulated triangular carrier gain linearization technique for SPWM inverter
Directory of Open Access Journals (Sweden)
Ramkumar Subburam
2009-01-01
Full Text Available This paper presents a new method to extend the linearity of the sinusoidal pulse width modulation (SPWM to full range of the pulse dropping region. The proposed amplitude modulated triangular carrier PWM method (AMTCPWM increases the dynamic range of the SPWM control and eliminates the need of nonlinear modulation in the pulse dropping region to reach the square wave boundary. The novel method combines the spectral quality of SPWM with the efficient single-mode linear control. A simple analytical characterization of the exact method is presented and its effectiveness is demonstrated using simulation for the basic single-phase H-bridge inverter circuit. The hardware results of the designed prototype inverter are presented to validate the betterment of the novel scheme. .
Cai, Qing; Li, Yuanyuan; Pei, Gang
2017-03-24
Ganoderma lucidum (GL) has been widely used in Asian countries for hundreds of years to promote health and longevity. The pharmacological functions of which had been classified, including the activation of innate immune responses, suppression of tumour and modulation of cell proliferations. Effective fractions of Ganoderma lucidum polysaccharides (GLP) had already been reported to regulate the immune system. Nevertheless, the role of GLP in the microglia-mediated neuroinflammation has not been sufficiently elucidated. Further, GLP effect on microglial behavioural modulations in correlation with the inflammatory responses remains to be unravelled. The aim of this work was to quantitatively analyse the contributions of GLP on microglia. The BV2 microglia and primary mouse microglia were stimulated by lipopolysaccharides (LPS) and amyloid beta 42 (Aβ 42 ) oligomer, respectively. Investigation on the effect of GLP was carried by quantitative determination of the microglial pro- and anti-inflammatory cytokine expressions and behavioural modulations including migration, morphology and phagocytosis. Analysis of microglial morphology and phagocytosis modulations was confirmed in the zebrafish brain. Quantitative results revealed that GLP down-regulates LPS- or Aβ-induced pro-inflammatory cytokines and promotes anti-inflammatory cytokine expressions in BV-2 and primary microglia. In addition, GLP attenuates inflammation-related microglial migration, morphological alterations and phagocytosis probabilities. We also showed that modulations of microglial behavioural responses were associated with MCP-1 and C1q expressions. Overall, our study provides an insight into the GLP regulation of LPS- and Aβ-induced neuroinflammation and serves an implication that the neuroprotective function of GLP might be achieved through modulation of microglial inflammatory and behavioural responses.
Thomas, James A; Deaton, Rebecca A; Hastings, Nicole E; Shang, Yueting; Moehle, Christopher W; Eriksson, Ulf; Topouzis, Stavros; Wamhoff, Brian R; Blackman, Brett R; Owens, Gary K
2009-02-01
Platelet-derived growth factor (PDGF)-BB is a well-known smooth muscle (SM) cell (SMC) phenotypic modulator that signals by binding to PDGF alphaalpha-, alphabeta-, and betabeta-membrane receptors. PDGF-DD is a recently identified PDGF family member, and its role in SMC phenotypic modulation is unknown. Here we demonstrate that PDGF-DD inhibited expression of multiple SMC genes, including SM alpha-actin and SM myosin heavy chain, and upregulated expression of the potent SMC differentiation repressor gene Kruppel-like factor-4 at the mRNA and protein levels. On the basis of the results of promoter-reporter assays, changes in SMC gene expression were mediated, at least in part, at the level of transcription. Attenuation of the SMC phenotypic modulatory activity of PDGF-DD by pharmacological inhibitors of ERK phosphorylation and by a small interfering RNA to Kruppel-like factor-4 highlight the role of these two pathways in this process. PDGF-DD failed to repress SM alpha-actin and SM myosin heavy chain in mouse SMCs lacking a functional PDGF beta-receptor. Importantly, PDGF-DD expression was increased in neointimal lesions in the aortic arch region of apolipoprotein C-deficient (ApoE(-/-)) mice. Furthermore, human endothelial cells exposed to an atherosclerosis-prone flow pattern, as in vascular regions susceptible to the development of atherosclerosis, exhibited a significant increase in PDGF-DD expression. These findings demonstrate a novel activity for PDGF-DD in SMC biology and highlight the potential contribution of this molecule to SMC phenotypic modulation in the setting of disturbed blood flow.
Inverter power module with distributed support for direct substrate cooling
Miller, David Harold [San Pedro, CA; Korich, Mark D [Chino Hills, CA; Ward, Terence G [Redondo Beach, CA; Mann, Brooks S [Redondo Beach, CA
2012-08-21
Systems and/or methods are provided for an inverter power module with distributed support for direct substrate cooling. An inverter module comprises a power electronic substrate. A first support frame is adapted to house the power electronic substrate and has a first region adapted to allow direct cooling of the power electronic substrate. A gasket is interposed between the power electronic substrate and the first support frame. The gasket is configured to provide a seal between the first region and the power electronic substrate. A second support frame is adapted to house the power electronic substrate and joined to the first support frame to form the seal.
The use of lac-type promoters in control analysis
DEFF Research Database (Denmark)
Jensen, Peter Ruhdal; Westerhoff, H. v.; Michelsen, Ole
1993-01-01
experimentally by constructing E. coli strains, in which the chromosomal atp operon is transcribed from the lacUV5 and the tacI promoter. We measured the concentration of the c subunit of H+-ATPase, and found that the expression of this enzyme could be modulated between non-detectable levels and up to five times...... the wild-type level. Thus, in the absence of inducer, no expression of atp genes could be detected when the atp operon was controlled by the lacUV5 promoter, and we estimate that the expression was less than 0.0025 times the wild-type level. We show that the introduction of a lac Y mutation facilitated...
Directory of Open Access Journals (Sweden)
Chinnusamy Viswanathan
2010-04-01
Full Text Available Abstract Background Carotenoids are a group of C40 isoprenoid molecules that play diverse biological and ecological roles in plants. Tomato is an important vegetable in human diet and provides the vitamin A precursor β-carotene. Genes encoding enzymes involved in carotenoid biosynthetic pathway have been cloned. However, regulation of genes involved in carotenoid biosynthetic pathway and accumulation of specific carotenoid in chromoplasts are not well understood. One of the approaches to understand regulation of carotenoid metabolism is to characterize the promoters of genes encoding proteins involved in carotenoid metabolism. Lycopene β-cyclase is one of the crucial enzymes in carotenoid biosynthesis pathway in plants. Its activity is required for synthesis of both α-and β-carotenes that are further converted into other carotenoids such as lutein, zeaxanthin, etc. This study describes the isolation and characterization of chromoplast-specific Lycopene β-cyclase (CYC-B promoter from a green fruited S. habrochaites genotype EC520061. Results A 908 bp region upstream to the initiation codon of the Lycopene β-cyclase gene was cloned and identified as full-length promoter. To identify promoter region necessary for regulating developmental expression of the ShCYC-B gene, the full-length promoter and its three different 5' truncated fragments were cloned upstream to the initiation codon of GUS reporter cDNA in binary vectors. These four plant transformation vectors were separately transformed in to Agrobacterium. Agrobacterium-mediated transient and stable expression systems were used to study the GUS expression driven by the full-length promoter and its 5' deletion fragments in tomato. The full-length promoter showed a basal level activity in leaves, and its expression was upregulated > 5-fold in flowers and fruits in transgenic tomato plants. Deletion of -908 to -577 bp 5' to ATG decreases the ShCYC-B promoter strength, while deletion of -908
TOF-SEMSANS—Time-of-flight spin-echo modulated small-angle neutron scattering
Strobl, M.; Tremsin, A.S.; Hilger, A.; Wieder, F.; Kardjilov, N.; Manke, I.; Bouwman, W.G.; Plomp, J.
2012-01-01
We report on measurements of spatial beam modulation of a polarized neutron beam induced by triangular precession regions in time-of-flight mode and the application of this novel technique spin-echo modulated small-angle neutron scattering (SEMSANS) to small-angle neutron scattering in the very
Directory of Open Access Journals (Sweden)
Nasseri Negin
2009-01-01
Full Text Available Abstract Background Squamous cell carcinoma of esophagus (SCCE occurs at a high incidence rate in certain parts of the world. This feature necessitates that different aspects of the disease and in particular genetic characteristics be investigated in such regions. In addition, such investigations might lead to achievement of molecular markers helpful for early detection, successful treatment and follow up of the disease. Adenomatous Polyposis Coli (APC promoter hypermethylation has been shown to be a suitable marker for both serum and solid tumors of adenocarcinoma of esophagus. We investigated the status of APC promoter hypermethylation in Iranian patients, compared the results with the former studies, and evaluated its applicability as a candidate molecular marker by examining association between survival of SCCE patients and APC promoter methylation. Methods For evaluating the status of APC promoter hypermethylation and its association with SCCE, a qualitative methylation specific PCR (MSP was used. DNA was extracted and digested with an appropriate restriction enzyme, treated with sodium bisulfite in agarose beads and amplified in two-step PCR reaction by applying either methylated or unmethylated promoter specific primers. Universally methylated DNA and methylase treated blood DNA of healthy donors were used as positive controls as well. Survival of patients was followed up for two years after treatment and survival rate of patients with methylated APC promoter was compared with that of unmethylated patients. Results Assessment of APC promoter methylation revealed that normal tissues were unmethylated, while twenty out of forty five (44.4% tumor tissues were hypermethylated either in one or both alleles of APC. Among the tissues in which methylation was detected, seven were hypermethylated in both alleles while the other thirteen were hypermethylated in one of the two alleles of APC. Analyzing two-year survival rate of patients with respect
International Nuclear Information System (INIS)
Zare, Maryam; Jazii, Ferdous Rastgar; Alivand, Mohammad Reza; Nasseri, Negin Karimi; Malekzadeh, Reza; Yazdanbod, Mansour
2009-01-01
Squamous cell carcinoma of esophagus (SCCE) occurs at a high incidence rate in certain parts of the world. This feature necessitates that different aspects of the disease and in particular genetic characteristics be investigated in such regions. In addition, such investigations might lead to achievement of molecular markers helpful for early detection, successful treatment and follow up of the disease. Adenomatous Polyposis Coli (APC) promoter hypermethylation has been shown to be a suitable marker for both serum and solid tumors of adenocarcinoma of esophagus. We investigated the status of APC promoter hypermethylation in Iranian patients, compared the results with the former studies, and evaluated its applicability as a candidate molecular marker by examining association between survival of SCCE patients and APC promoter methylation. For evaluating the status of APC promoter hypermethylation and its association with SCCE, a qualitative methylation specific PCR (MSP) was used. DNA was extracted and digested with an appropriate restriction enzyme, treated with sodium bisulfite in agarose beads and amplified in two-step PCR reaction by applying either methylated or unmethylated promoter specific primers. Universally methylated DNA and methylase treated blood DNA of healthy donors were used as positive controls as well. Survival of patients was followed up for two years after treatment and survival rate of patients with methylated APC promoter was compared with that of unmethylated patients. Assessment of APC promoter methylation revealed that normal tissues were unmethylated, while twenty out of forty five (44.4%) tumor tissues were hypermethylated either in one or both alleles of APC. Among the tissues in which methylation was detected, seven were hypermethylated in both alleles while the other thirteen were hypermethylated in one of the two alleles of APC. Analyzing two-year survival rate of patients with respect to promoter hypermethylation showed a lower rate of
Directory of Open Access Journals (Sweden)
Lauren A Vanderlinden
Full Text Available To identify brain transcriptional networks that may predispose an animal to consume alcohol, we used weighted gene coexpression network analysis (WGCNA. Candidate coexpression modules are those with an eigengene expression level that correlates significantly with the level of alcohol consumption across a panel of BXD recombinant inbred mouse strains, and that share a genomic region that regulates the module transcript expression levels (mQTL with a genomic region that regulates alcohol consumption (bQTL. To address a controversy regarding utility of gene expression profiles from whole brain, vs specific brain regions, as indicators of the relationship of gene expression to phenotype, we compared candidate coexpression modules from whole brain gene expression data (gathered with Affymetrix 430 v2 arrays in the Colorado laboratories and from gene expression data from 6 brain regions (nucleus accumbens (NA; prefrontal cortex (PFC; ventral tegmental area (VTA; striatum (ST; hippocampus (HP; cerebellum (CB available from GeneNetwork. The candidate modules were used to construct candidate eigengene networks across brain regions, resulting in three "meta-modules", composed of candidate modules from two or more brain regions (NA, PFC, ST, VTA and whole brain. To mitigate the potential influence of chromosomal location of transcripts and cis-eQTLs in linkage disequilibrium, we calculated a semi-partial correlation of the transcripts in the meta-modules with alcohol consumption conditional on the transcripts' cis-eQTLs. The function of transcripts that retained the correlation with the phenotype after correction for the strong genetic influence, implicates processes of protein metabolism in the ER and Golgi as influencing susceptibility to variation in alcohol consumption. Integration of these data with human GWAS provides further information on the function of polymorphisms associated with alcohol-related traits.
DEVELOPMENT OF VACUUM SUBLIMATION DRYERS USING THERMOELECTRIC MODULES
Directory of Open Access Journals (Sweden)
R. A. Barykin
2014-01-01
Full Text Available Summary. The main directions of use of freeze-dryed products and ingredients are revealed. The analysis of sales markets of freeze-dryed products is provided. It is shown that introduction of innovative production technologies will allow to develop dynamically not only to the large companies, but also small firms that will create prerequisites for growth of the Russian market of freeze-dryed products. Tendencies of development of the freeze-drying equipment are analysed. Relevance of development of energy saving freeze-dryers is proved The integrated approach to creation of competitive domestic technologies and the equipment for sublimation dehydration of thermolabile products consists in use of the effective combined remedies of a power supply, a process intensification, reduction of specific energy consumption and, as a result, decrease in product cost at achievement of high quality indicators. Advantages of thermoelectric modules as alternative direction to existing vapor-compression and absorbing refrigerating appliances are given. Researches of process of freeze-drying dehydration with use of thermoelectric modules are conducted. It is scientifically confirmed, that the thermoelectric module working at Peltier effect, promotes increase in refrigerating capacity due to use of the principle of the thermal pump. Options of use of thermoelectric modules in designs of dryers are offered. Optimum operating modes and number of modules in section are defined. Ways of increase of power efficiency of freeze-dryers with use of thermoelectric modules are specified. The received results will allow to make engineering calculations and design of progressive freeze-drying installations with various ways of a power supply.
Regional cooperative agreement for the Asia and Pacific region
International Nuclear Information System (INIS)
Anon.
1981-01-01
Among the means available to the International Atomic Energy Agency to promote cooperative efforts in the nuclear field is the Regional Cooperative Agreement (RCA) for Research, Development, and Training related to Nuclear Science and Technology for the Asia and Pacific Region. Under the terms of this agreement, which came into force on June 12, 1972, participating countries aim to promote and coordinate research, development, and training projects in nuclear fields through collaborative efforts among relevant national institutions in the region. The Agency's role is to provide organizational, administrative, advisory, technical, and financial assistance when needed to secure successful execution of the projects undertaken within the framework of the RCA. Although this presentation deals primarily with the benefits of regional cooperation under the agreement, a review of the RCA would be somewhat imbalanced without a mention of its shortcomings. One of the principal impediments to more rapid progress, as is the case in many other areas, is financing. There is no stable source of funding outside the research contract program and, the likelihood of large-scale UNDP support notwithstanding, a greater willingness on the part of participating Member States to support the program along with the development of a greater sense of common purpose are called for. In this connection serious consideration is being given to the possibility of establishing an Asian Centre for Research and Training, an institute that would bring together scientists from the region to collaborate on problems common to the RCA countries. A study group has already been convened to investigate the feasibility of this proposal
Molecular and Functional Properties of Regional Astrocytes in the Adult Brain.
Morel, Lydie; Chiang, Ming Sum R; Higashimori, Haruki; Shoneye, Temitope; Iyer, Lakshmanan K; Yelick, Julia; Tai, Albert; Yang, Yongjie
2017-09-06
The molecular signature and functional properties of astroglial subtypes in the adult CNS remain largely undefined. By using translational ribosome affinity purification followed by RNA-Seq, we profiled astroglial ribosome-associated (presumably translating) mRNAs in major cortical and subcortical brain regions (cortex, hippocampus, caudate-putamen, nucleus accumbens, thalamus, and hypothalamus) of BAC aldh1l1 -translational ribosome affinity purification (TRAP) mice (both sexes). We found that the expression of astroglial translating mRNAs closely follows the dorsoventral axis, especially from cortex/hippocampus to thalamus/hypothalamus posteriorly. This region-specific expression pattern of genes, such as synaptogenic modulator sparc and transcriptional factors ( emx2 , lhx2 , and hopx ), was validated by qRT-PCR and immunostaining in brain sections. Interestingly, cortical or subcortical astrocytes selectively promote neurite growth and synaptic activity of neurons only from the same region in mismatched cocultures, exhibiting region-matched astrocyte to neuron communication. Overall, these results generated new molecular signature of astrocyte types in the adult CNS, providing insights into their origin and functional diversity. SIGNIFICANCE STATEMENT We investigated the in vivo molecular and functional heterogeneity of astrocytes inter-regionally from adult brain. Our results showed that the expression pattern of ribosome-associated mRNA profiles in astrocytes closely follows the dorsoventral axis, especially posteriorly from cortex/hippocampus to thalamus/hypothalamus. In line with this, our functional results further demonstrated region-selective roles of cortical and subcortical astrocytes in regulating cortical or subcortical neuronal synaptogenesis and maturation. These in vivo studies provide a previously uncharacterized and important molecular atlas for exploring region-specific astroglial functions. Copyright © 2017 the authors 0270-6474/17/378706-12$15.00/0.
Interacting Brain Modules for Memory: An Adaptive Representations Architecture
National Research Council Canada - National Science Library
Gluck, Mark A
2008-01-01
...) as a central system for creating optimal and adaptive stimulus representations, and then worked outwards from the hippocampal region to the brain systems that it modulates, including the cerebellum...
Directory of Open Access Journals (Sweden)
Shan Xin
Full Text Available Apoplastic ascorbate oxidase (AO plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1 gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA. Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome, Gossypium raimondii (Gr, diploid cotton with a DD genome and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence
Xin, Shan; Tao, Chengcheng; Li, Hongbin
2016-01-01
Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a
Lactobacillus crispatus Modulates Vaginal Epithelial Cell Innate Response to Candida albicans
Directory of Open Access Journals (Sweden)
Xiao-Xi Niu
2017-01-01
Conclusions: L. crispatus can attenuate the virulence of C. albicans, modulate the secretion of cytokines and chemokines, and enhance the immune response of VK2/E6E7 cells in vitro. The vaginal mucosa has a potential function in the local immune responses against pathogens that can be promoted by L. crispatus.
Combined amino acids modulation with H 2 O 2 stress for ...
African Journals Online (AJOL)
Strategies of amino acids addition coupled with H2O2 stresses were developed for glutathione (GSH) overproduction in high cell density (HCD) cultivation of Candida utilis. Based on the fact that glycine shows two functions of promoting cells growth as well as GSH production, precursor amino acids modulations of feeding ...
Directory of Open Access Journals (Sweden)
Takashi Asakawa
2010-05-01
Full Text Available We have investigated the pressure dependence of the detection sensitivity of CO2, N2O and CH4 using wavelength modulation spectroscopy (WMS with distributed feed-back diode lasers in the near infrared region. The spectral line shapes and the background noise of the second harmonics (2f detection of the WMS were analyzed theoretically. We determined the optimum pressure conditions in the detection of CO2, N2O and CH4, by taking into consideration the background noise in the WMS. At the optimum total pressure for the detection of CO2, N2O and CH4, the limits of detection in the present system were determined.
Optogenetic Modulation and Multi-Electrode Analysis of Cerebellar Networks In Vivo
Kruse, Wolfgang; Krause, Martin; Aarse, Janna; Mark, Melanie D.; Manahan-Vaughan, Denise; Herlitze, Stefan
2014-01-01
The firing patterns of cerebellar Purkinje cells (PCs), as the sole output of the cerebellar cortex, determine and tune motor behavior. PC firing is modulated by various inputs from different brain regions and by cell-types including granule cells (GCs), climbing fibers and inhibitory interneurons. To understand how signal integration in PCs occurs and how subtle changes in the modulation of PC firing lead to adjustment of motor behaviors, it is important to precisely record PC firing in vivo and to control modulatory pathways in a spatio-temporal manner. Combining optogenetic and multi-electrode approaches, we established a new method to integrate light-guides into a multi-electrode system. With this method we are able to variably position the light-guide in defined regions relative to the recording electrode with micrometer precision. We show that PC firing can be precisely monitored and modulated by light-activation of channelrhodopsin-2 (ChR2) expressed in PCs, GCs and interneurons. Thus, this method is ideally suited to investigate the spatio/temporal modulation of PCs in anesthetized and in behaving mice. PMID:25144735
Optogenetic modulation and multi-electrode analysis of cerebellar networks in vivo.
Directory of Open Access Journals (Sweden)
Wolfgang Kruse
Full Text Available The firing patterns of cerebellar Purkinje cells (PCs, as the sole output of the cerebellar cortex, determine and tune motor behavior. PC firing is modulated by various inputs from different brain regions and by cell-types including granule cells (GCs, climbing fibers and inhibitory interneurons. To understand how signal integration in PCs occurs and how subtle changes in the modulation of PC firing lead to adjustment of motor behaviors, it is important to precisely record PC firing in vivo and to control modulatory pathways in a spatio-temporal manner. Combining optogenetic and multi-electrode approaches, we established a new method to integrate light-guides into a multi-electrode system. With this method we are able to variably position the light-guide in defined regions relative to the recording electrode with micrometer precision. We show that PC firing can be precisely monitored and modulated by light-activation of channelrhodopsin-2 (ChR2 expressed in PCs, GCs and interneurons. Thus, this method is ideally suited to investigate the spatio/temporal modulation of PCs in anesthetized and in behaving mice.
Task Oriented Evaluation of Module Extraction Techniques
Palmisano, Ignazio; Tamma, Valentina; Payne, Terry; Doran, Paul
Ontology Modularization techniques identify coherent and often reusable regions within an ontology. The ability to identify such modules, thus potentially reducing the size or complexity of an ontology for a given task or set of concepts is increasingly important in the Semantic Web as domain ontologies increase in terms of size, complexity and expressivity. To date, many techniques have been developed, but evaluation of the results of these techniques is sketchy and somewhat ad hoc. Theoretical properties of modularization algorithms have only been studied in a small number of cases. This paper presents an empirical analysis of a number of modularization techniques, and the modules they identify over a number of diverse ontologies, by utilizing objective, task-oriented measures to evaluate the fitness of the modules for a number of statistical classification problems.
Design of band pass filter in a modulated magnetic graphene superlattice
International Nuclear Information System (INIS)
Lu, Wei-Tao; Li, Wen
2015-01-01
Electronic transport of graphene through a modulated magnetic superlattice where the barrier heights present Gaussian profile is studied. It is found that the incident electron could be completely transmitted in the miniband regions and be completely reflected in the bandgap regions. The results suggest an application of the structure as an effectively band pass filter, which can be controlled by the structural parameters. It is concluded that the positions of miniband and bandgap are robust to the Gaussian variation of barrier heights. The effect of this modulated magnetic superlattice is also available for the conventional electrons described by Schrödinger equation
Asia-Pacific Regional Economic Integration: Coopetition vs. Conflict
Directory of Open Access Journals (Sweden)
YuJane Chen
2016-04-01
Full Text Available In the era of economic globalization, promoting regional trade agreements or regional cooperation has become a plausible strategy to attract foreign direct investment and to promote national competitiveness at a global level. Nonetheless, facing the differential national economic interests and the needs of protection of domestic industries, as well as the diverse levels of economic liberalization domestically, the involvement of FTA negotiation in every country is universally in the situation of struggling between securing economic sovereignty and national economic development. Countries in the Asia-Pacific region are in the same situation. This article analyzes how countries balance between securing economic sovereignty and promoting national economic development when they are involved in TPP and RCEP negotiations. By confirming the appropriate linkage between each participating countries’ decision for balancing between domestic economic sovereignty and further integrating into regional economic cooperation institutions the validity of the proposition for this research project can be verified.
Viral Vector-Based Dissection of Marmoset GFAP Promoter in Mouse and Marmoset Brains.
Directory of Open Access Journals (Sweden)
Yoichiro Shinohara
Full Text Available Adeno-associated virus (AAV vectors are small in diameter, diffuse easily in the brain, and represent a highly efficient means by which to transfer a transgene to the brain of a large animal. A major demerit of AAV vectors is their limited accommodation capacity for transgenes. Thus, a compact promoter is useful when delivering large transgenes via AAV vectors. In the present study, we aimed to identify the shortest astrocyte-specific GFAP promoter region that could be used for AAV-vector-mediated transgene expression in the marmoset brain. The 2.0-kb promoter region upstream of the GFAP gene was cloned from the marmoset genome, and short promoters (1.6 kb, 1.4 kb, 0.6 kb, 0.3 kb and 0.2 kb were obtained by progressively deleting the original 2.0-kb promoter from the 5' end. The short promoters were screened in the mouse cerebellum in terms of their strength and astrocyte specificity. We found that the 0.3-kb promoter maintained 40% of the strength of the original 2.0-kb promoter, and approximately 90% of its astrocyte specificity. These properties were superior to those of the 1.4-kb, 0.6-kb (20% promoter strength and 0.2-kb (70% astrocyte specificity promoters. Then, we verified whether the 0.3-kb GFAP promoter retained astrocyte specificity in the marmoset cerebral cortex. Injection of viral vectors carrying the 0.3-kb marmoset GFAP promoter specifically transduced astrocytes in both the cerebral cortex and cerebellar cortex of the marmoset. These results suggest that the compact 0.3-kb promoter region serves as an astrocyte-specific promoter in the marmoset brain, which permits us to express a large gene by AAV vectors that have a limited accommodation capacity.
4G/5G polymorphism modulates PAI-1 circulating levels in obese women.
Fernandes, Karla S; Sandrim, Valéria C
2012-05-01
The increase in plasminogen activator inhibitor type 1 (PAI-1) has been described as a risk factor to thrombosis-related diseases. In addition, it has been demonstrated that the variant 4G of polymorphism 4G/5G located in promoter region of PAI-1 gene is associated with higher PAI-1 levels. We investigate the role of this polymorphism on circulating PAI-1 concentration in a population of 57 obese women (23%, 4G/4G; 49%, 4G/5G and 28%, 5G/5G genotypes). Our results demonstrate a genotype-specific modulation on PAI-1 levels in obese women, thus 5G/5G genotype presented significantly lower levels of plasma PAI-1 when compared to 4G/4G group (46 ± 19 ng/mL vs. 63 ± 13 ng/mL, respectively). Our findings indicate that obese carriers of 4G/4G genotype may have increased risk to develop thrombotic diseases.
Dunnick, Wesley A; Shi, Jian; Holden, Victoria; Fontaine, Clinton; Collins, John T
2011-01-01
Germline transcription precedes class switch recombination (CSR). The promoter regions and I exons of these germline transcripts include binding sites for activation- and cytokine-induced transcription factors, and the promoter regions/I exons are essential for CSR. Therefore, it is a strong hypothesis that the promoter/I exons regions are responsible for much of cytokine-regulated, gene-specific CSR. We tested this hypothesis by swapping the germline promoter and I exons for the murine γ1 and γ2a H chain genes in a transgene of the entire H chain C-region locus. We found that the promoter/I exon for γ1 germline transcripts can direct robust IL-4-induced recombination to the γ2a gene. In contrast, the promoter/I exon for the γ2a germline transcripts works poorly in the context of the γ1 H chain gene, resulting in expression of γ1 H chains that is level. Nevertheless, the small amount of recombination to the chimeric γ1 gene is induced by IFN-γ. These results suggest that cytokine regulation of CSR, but not the magnitude of CSR, is regulated by the promoter/I exons.
Role of promoter element in c-mpl gene expression induced by TPO.
Sunohara, Masataka; Morikawa, Shigeru; Fuse, Akira; Sato, Iwao
2013-01-01
Thrombopoietin (TPO) and its receptor, c-Mpl, play the crucial role for the development of megakaryocyte and considered to regulate megakaryocytopoiesis. Previously we reported that TPO increased the c-mpl promoter activity determined by a transient expression system using a vector containing the luciferase gene as a reporter and the expression of the c-mpl gene is modulated by transcription through a protein kinase C (PKC)-dependent pathway in the megakaryoblastic cells. In this research, to elucidate the required elements in c-mpl promoter, the promoter activity of the deletion constructs and site-directed mutagenesis were measured by a transient transfection assay system. Destruction of -77GATA in c-mpl promoter decreased the activity by 22.8%. Our study elucidated that -77GATA involved in TPO-induced c-mpl gene expression in a human megakaryoblastic cell line, CMK.
Roozendaal, Benno; McGaugh, James L.
2011-01-01
Our memories are not all created equally strong: Some experiences are well remembered while others are remembered poorly, if at all. Research on memory modulation investigates the neurobiological processes and systems that contribute to such differences in the strength of our memories. Extensive evidence from both animal and human research indicates that emotionally significant experiences activate hormonal and brain systems that regulate the consolidation of newly acquired memories. These effects are integrated through noradrenergic activation of the basolateral amygdala which regulates memory consolidation via interactions with many other brain regions involved in consolidating memories of recent experiences. Modulatory systems not only influence neurobiological processes underlying the consolidation of new information, but also affect other mnemonic processes, including memory extinction, memory recall and working memory. In contrast to their enhancing effects on consolidation, adrenal stress hormones impair memory retrieval and working memory. Such effects, as with memory consolidation, require noradrenergic activation of the basolateral amygdala and interactions with other brain regions. PMID:22122145
Chen, Wen-Hui; Tang, Lin-Quan; Guo, Shan-Shan; Chen, Qiu-Yan; Zhang, Lu; Liu, Li-Ting; Qian, Chao-Nan; Guo, Xiang; Xie, Dan; Zeng, Mu-Sheng; Mai, Hai-Qiang
2016-02-01
This study aimed to evaluate the prognostic value of plasma Epstein-Barr Virus DNA (EBV DNA) for local and regionally advanced nasopharyngeal carcinoma (NPC) patients treated with concurrent chemoradiotherapy in intensity-modulated radiotherapy (IMRT) era.In this observational study, 404 nonmetastatic local and regionally advanced NPC patients treated with IMRT and cisplatin-based concurrent chemotherapy were recruited. Blood samples were collected before treatment for examination of plasma EBV DNA levels. We evaluated the association of pretreatment plasma EBV DNA levels with progression-free survival rate (PFS), distant metastasis-free survival rate (DMFS), and overall survival rate (OS).Compared to patients with an EBV DNA level advanced NPC patients treated with IMRT and cisplatin-based concurrent chemotherapy. Future ramdomized clinical trials are needed to further evaluate whether plasma EBV DNA levels could be applied to guide concurrent chemotherapy regimen for local and regionally advanced NPC patients.
Directory of Open Access Journals (Sweden)
Jinquan Chen
Full Text Available Semen is a major vehicle for HIV transmission. Prostatic acid phosphatase (PAP fragments, such as PAP248-286, in human semen can form amyloid fibrils to enhance HIV infection. Other endogenous or exogenous factors present during sexual intercourse have also been reported to promote the formation of seminal amyloid fibrils.Here, we demonstrated that a synthetic 15-residue peptide derived from the HIV-1 gp120 coreceptor-binding region, designated enhancing peptide 2 (EP2, can rapidly self-assemble into nanofibers. These EP2-derivated nanofibers promptly accelerated the formation of semen amyloid fibrils by PAP248-286, as shown by Thioflavin T (ThT and Congo red assays. The amyloid fibrils presented similar morphology, assessed via transmission electron microscopy (TEM, in the presence or absence of EP2. Circular dichroism (CD spectroscopy revealed that EP2 accelerates PAP248-286 amyloid fibril formation by promoting the structural transition of PAP248-286 from a random coil into a cross-β-sheet. Newly formed semen amyloid fibrils effectively enhanced HIV-1 infection in TZM-bl cells and U87 cells by promoting the binding of HIV-1 virions to target cells.Nanofibers composed of EP2 promote the formation of PAP248-286 amyloid fibrils and enhance HIV-1 infection.
Directory of Open Access Journals (Sweden)
Anabel Cardoso Raicik
2015-08-01
Full Text Available This paper examines the results obtained with the implementation of a teaching module in a discipline of History of Science. Data were collected through a questionnaire which demanded the students a historical and philosophical analysis of a specific period of electricity and a critical assessment of the implemented module in the discipline. In general terms, the proposed module was effective promoting a satisfactory articulation between the historical content and specific aspects of the philosophy of science
International Nuclear Information System (INIS)
Shimazu, Akira
2009-01-01
The ability of a slow positron beam to prove vacancies at the surface and in bulk regions of optical modulation polymers was demonstrated. A slow positron beam system was found to be a powerful tool to study the change in the microstructure driven by photopolymerization of novel optical modulation polymers. (author)
ABERRANT METHYLATION OF THE PROMOTER OF APC, CDH13 AND MGMT GENES IN COLORECTAL CANCER PATIENTS
Directory of Open Access Journals (Sweden)
O. I. Kit
2016-01-01
Full Text Available Aberrant methylation of gene promoter regions is the main epigenetic change characterizing colorectal cancer. Methylation levels of 42 CpG-sites of promoter regions of the MGMT, APC and CDH13 genes in colorectal cancer were studied in comparison with methylation levels of the adjacent normal tissue in 25 patients. Pyrosequencing showed an increase in methylation levels of promoter regions of the MGMT, APC and CDH13 genes in tumor samples by 3 to 5 times. These tumor samples were screened for activating SNP-mutations in the KRAS (40 %, NRAS (0 % and BRAF (0 % oncogenes. SNP-mutations in the KRAS gene were accompanied by hypermethylation of one or more promoters of the studied genes. Association of this epigenetic index with tumor metastasis was proved. The data on an increase in methylation of the promoter regions of oncosupressor genes can be used as sensitive prognostic markers of progression and metastasis of colorectal cancer.
Photovoltaic module and interlocked stack of photovoltaic modules
Wares, Brian S.
2014-09-02
One embodiment relates to an arrangement of photovoltaic modules configured for transportation. The arrangement includes a plurality of photovoltaic modules, each photovoltaic module including a frame. A plurality of individual male alignment features and a plurality of individual female alignment features are included on each frame. Adjacent photovoltaic modules are interlocked by multiple individual male alignment features on a first module of the adjacent photovoltaic modules fitting into and being surrounded by corresponding individual female alignment features on a second module of the adjacent photovoltaic modules. Other embodiments, features and aspects are also disclosed.
Characterization of carotenoid hydroxylase gene promoter in Haematococcus pluvialis.
Meng, C X; Wei, W; Su, Z- L; Qin, S
2006-10-01
Astaxanthin, a high-value ketocarotenoid is mainly used in fish aquaculture. It also has potential in human health due to its higher antioxidant capacity than beta-carotene and vitamin E. The unicellular green alga Haematococcus pluvialis is known to accumulate astaxanthin in response to environmental stresses, such as high light intensity and salt stress. Carotenoid hydroxylase plays a key role in astaxanthin biosynthesis in H. pluvialis. In this paper, we report the characterization of a promoter-like region (-378 to -22 bp) of carotenoid hydroxylase gene by cloning, sequence analysis and functional verification of its 919 bp 5'-flanking region in H. pluvialis. The 5'-flanking region was characterized using micro-particle bombardment method and transient expression of LacZ reporter gene. Results of sequence analysis showed that the 5'-flanking region might have putative cis-acting elements, such as ABA (abscisic acid)-responsive element (ABRE), C-repeat/dehydration responsive element (C-repeat/DRE), ethylene-responsive element (ERE), heat-shock element (HSE), wound-responsive element (WUN-motif), gibberellin-responsive element (P-box), MYB-binding site (MBS) etc., except for typical TATA and CCAAT boxes. Results of 5' deletions construct and beta-galactosidase assays revealed that a highest promoter-like region might exist from -378 to -22 bp and some negative regulatory elements might lie in the region from -919 to -378 bp. Results of site-directed mutagenesis of a putative C-repeat/DRE and an ABRE-like motif in the promoter-like region (-378 to -22 bp) indicated that the putative C-repeat/DRE and ABRE-like motif might be important for expression of carotenoid hydroxylase gene.
Salmonella modulation of host cell gene expression promotes its intracellular growth.
Directory of Open Access Journals (Sweden)
Sebastian Hannemann
Full Text Available Salmonella Typhimurium has evolved a complex functional interface with its host cell largely determined by two type III secretion systems (T3SS, which through the delivery of bacterial effector proteins modulate a variety of cellular processes. We show here that Salmonella Typhimurium infection of epithelial cells results in a profound transcriptional reprogramming that changes over time. This response is triggered by Salmonella T3SS effector proteins, which stimulate unique signal transduction pathways leading to STAT3 activation. We found that the Salmonella-stimulated changes in host cell gene expression are required for the formation of its specialized vesicular compartment that is permissive for its intracellular replication. This study uncovers a cell-autonomous process required for Salmonella pathogenesis potentially opening up new avenues for the development of anti-infective strategies that target relevant host pathways.
Salmonella modulation of host cell gene expression promotes its intracellular growth.
Hannemann, Sebastian; Gao, Beile; Galán, Jorge E
2013-01-01
Salmonella Typhimurium has evolved a complex functional interface with its host cell largely determined by two type III secretion systems (T3SS), which through the delivery of bacterial effector proteins modulate a variety of cellular processes. We show here that Salmonella Typhimurium infection of epithelial cells results in a profound transcriptional reprogramming that changes over time. This response is triggered by Salmonella T3SS effector proteins, which stimulate unique signal transduction pathways leading to STAT3 activation. We found that the Salmonella-stimulated changes in host cell gene expression are required for the formation of its specialized vesicular compartment that is permissive for its intracellular replication. This study uncovers a cell-autonomous process required for Salmonella pathogenesis potentially opening up new avenues for the development of anti-infective strategies that target relevant host pathways.
Mechanisms and applications of plant growth promoting rhizobacteria: Current perspective
Directory of Open Access Journals (Sweden)
Munees Ahemad
2014-01-01
Full Text Available Plant growth promoting rhizobacteria are the soil bacteria inhabiting around/on the root surface and are directly or indirectly involved in promoting plant growth and development via production and secretion of various regulatory chemicals in the vicinity of rhizosphere. Generally, plant growth promoting rhizobacteria facilitate the plant growth directly by either assisting in resource acquisition (nitrogen, phosphorus and essential minerals or modulating plant hormone levels, or indirectly by decreasing the inhibitory effects of various pathogens on plant growth and development in the forms of biocontrol agents. Various studies have documented the increased health and productivity of different plant species by the application of plant growth promoting rhizobacteria under both normal and stressed conditions. The plant-beneficial rhizobacteria may decrease the global dependence on hazardous agricultural chemicals which destabilize the agro-ecosystems. This review accentuates the perception of the rhizosphere and plant growth promoting rhizobacteria under the current perspectives. Further, explicit outlooks on the different mechanisms of rhizobacteria mediated plant growth promotion have been described in detail with the recent development and research. Finally, the latest paradigms of applicability of these beneficial rhizobacteria in different agro-ecosystems have been presented comprehensively under both normal and stress conditions to highlight the recent trends with the aim to develop future insights.
Effect of synthetic jet modulation schemes on the reduction of a laminar separation bubble
Seo, J. H.; Cadieux, F.; Mittal, R.; Deem, E.; Cattafesta, L.
2018-03-01
The response of a laminar separation bubble to synthetic jet forcing with various modulation schemes is investigated via direct numerical simulations. A simple sinusoidal waveform is considered as a reference case, and various amplitude modulation schemes, including the square-wave "burst" modulation, are employed in the simulations. The results indicate that burst modulation is less effective at reducing the length of the flow separation than the sinusoidal forcing primarily because burst modulation is associated with a broad spectrum of input frequencies that are higher than the target frequency for the flow control. It is found that such high-frequency forcing delays vortex roll-up and promotes vortex pairing and merging, which have an adverse effect on reducing the separation bubble length. A commonly used amplitude modulation scheme is also found to have reduced effectiveness due to its spectral content. A new amplitude modulation scheme which is tailored to impart more energy at the target frequency is proposed and shown to be more effective than the other modulation schemes. Experimental measurements confirm that modulation schemes can be preserved through the actuator and used to enhance the energy content at the target modulation frequency. The present study therefore suggests that the effectiveness of synthetic jet-based flow control could be improved by carefully designing the spectral content of the modulation scheme.
Neuro-cognitive mechanisms underlying the emotional modulation of word reading
Institute of Scientific and Technical Information of China (English)
无
2006-01-01
A novel neural model for emotional modulation of word reading is proposed. This model has four principal hypotheses: the dominant activation region hypothesis, the emotional modulation hypothesis, the attentional level hypothesis, and the interaction hypothesis. Four lines of research were reviewed to provide evidence for these hypotheses: (1) neuro-cognitive studies on the mechanisms of word reading (i.e., neural networks for reading); (2) studies on the influence of words' emotional valence on word reading; (3) studies of the effect of attention on word reading; and (4) studies on emotional modulation of word reading under different attentional levels.
CARM1 modulators affect epigenome of stem cells and change morphology of nucleoli.
Franek, M; Legartová, S; Suchánková, J; Milite, C; Castellano, S; Sbardella, G; Kozubek, S; Bártová, E
2015-01-01
CARM1 interacts with numerous transcription factors to mediate cellular processes, especially gene expression. This is important for the maintenance of ESC pluripotency or intervention to tumorigenesis. Here, we studied epigenomic effects of two potential CARM1 modulators: an activator (EML159) and an inhibitor (ellagic acid dihydrate, EA). We examined nuclear morphology in human and mouse embryonic stem cells (hESCs, mESCs), as well as in iPS cells. The CARM1 modulators did not function similarly in all cell types. EA decreased the levels of the pluripotency markers, OCT4 and NANOG, particularly in iPSCs, whereas the levels of these proteins increased after EML159 treatment. EML159 treatment of mouse ESCs led to decreased levels of OCT4 and NANOG, which was accompanied by an increased level of Endo-A. The same trend was observed for NANOG and Endo-A in hESCs affected by EML159. Interestingly, EA mainly changed epigenetic features of nucleoli because a high level of arginine asymmetric di-methylation in the nucleoli of hESCs was reduced after EA treatment. ChIP-PCR of ribosomal genes confirmed significantly reduced levels of H3R17me2a, in both the promoter region of ribosomal genes and rDNA encoding 28S rRNA, after EA addition. Moreover, EA treatment changed the nuclear pattern of AgNORs (silver-stained nucleolus organizer regions) in all cell types studied. In EA-treated ESCs, AgNOR pattern was similar to the pattern of AgNORs after inhibition of RNA pol I by actinomycin D. Together, inhibitory effect of EA on arginine methylation and effect on related morphological parameters was especially observed in compartment of nucleoli.
Weyl modules, demazure modules, KR-modules, crystals, fusion products and limit constructions
Fourier, G.; Littelmann, P.
2007-01-01
We study finite dimensional representations of current algebras, loop algebras and their quantized versions. For the current algebra of a simple Lie algebra of type {\\tt ADE}, we show that Kirillov-Reshetikhin modules and Weyl modules are in fact all Demazure modules. As a consequence one obtains an elementary proof of the dimension formula for Weyl modules for the current and the loop algebra. Further, we show that the crystals of the Weyl and the Demazure module are the same up to some addi...
Evaluating an Online E-Module for Portuguese Primary Teachers: Trainees' Perceptions
Pombo, L.; Smith, M.; Abelha, M.; Caixinha, H.; Costa, N.
2012-01-01
The work reported in this article is part of a wider project that aims to develop and implement a web-based, pan-European, in-service professional development platform for teachers to enhance their role in promoting education through science. This article aims to evaluate the implementation of the e-module on Assessment of Children's Learning in…
The shopping brain: math anxiety modulates brain responses to buying decisions.
Jones, William J; Childers, Terry L; Jiang, Yang
2012-01-01
Metacognitive theories propose that consumers track fluency feelings when buying, which may have biological underpinnings. We explored this using event-related potential (ERP) measures as twenty high-math anxiety (High MA) and nineteen low-math anxiety (Low MA) consumers made buying decisions for promoted (e.g., 15% discount) and non-promoted products. When evaluating prices, ERP correlates of higher perceptual and conceptual fluency were associated with buys, however only for High MA females under no promotions. In contrast, High MA females and Low MA males demonstrated greater FN400 amplitude, associated with enhanced conceptual processing, to prices of buys relative to non-buys under promotions. Concurrent late positive component (LPC) differences under no promotions suggest discrepant retrieval processes during price evaluations between consumer groups. When making decisions to buy or not, larger (smaller) P3, sensitive to outcome responses in the brain, was associated with buying for High MA females (Low MA females) under promotions, an effect also present for males under no promotions. Thus, P3 indexed decisions to buy differently between anxiety groups, but only for promoted items among females and for no promotions among males. Our findings indicate that perceptual and conceptual processes interact with anxiety and gender to modulate brain responses during consumer choices. Copyright © 2011 Elsevier B.V. All rights reserved.
Expression of Versican 3′-Untranslated Region Modulates Endogenous MicroRNA Functions
Lee, Daniel Y.; Jeyapalan, Zina; Fang, Ling; Yang, Jennifer; Zhang, Yaou; Yee, Albert Y.; Li, Minhui; Du, William W.; Shatseva, Tatiana; Yang, Burton B.
2010-01-01
Background Mature microRNAs (miRNAs) are single-stranded RNAs that regulate post-transcriptional gene expression. In our previous study, we have shown that versican 3′UTR, a fragment of non-coding transcript, has the ability to antagonize miR-199a-3p function thereby regulating expression of the matrix proteins versican and fibronectin, and thus resulting in enhanced cell-cell adhesion and organ adhesion. However, the impact of this non-coding fragment on tumorigenesis is yet to be determined. Methods and Findings Using computational prediction confirmed with in vitro and in vivo experiments, we report that the expression of versican 3′UTR not only antagonizes miR-199a-3p but can also lower its steady state expression. We found that expression of versican 3′UTR in a mouse breast carcinoma cell line, 4T1, decreased miR-199a-3p levels. The decrease in miRNA activity consequently translated into differences in tumor growth. Computational analysis indicated that both miR-199a-3p and miR-144 targeted a cell cycle regulator, Rb1. In addition, miR-144 and miR-136, which have also been shown to interact with versican 3′UTR, was found to target PTEN. Expression of Rb1 and PTEN were up-regulated synergistically in vitro and in vivo, suggesting that the 3′UTR binds and modulates miRNA activities, freeing Rb1 and PTEN mRNAs for translation. In tumor formation assays, cells transfected with the 3′UTR formed smaller tumors compared with cells transfected with a control vector. Conclusion Our results demonstrated that a 3′UTR fragment can be used to modulate miRNA functions. Our study also suggests that miRNAs in the cancer cells are more susceptible to degradation, due to its interaction with a non-coding 3′UTR. This non-coding component of mRNA may be used retrospectively to modulate miRNA activities. PMID:21049042
Joanisse, Marc F; DeSouza, Diedre D
2014-01-01
Functional Magnetic Resonance Imaging (fMRI) was used to investigate the extent, magnitude, and pattern of brain activity in response to rapid frequency-modulated sounds. We examined this by manipulating the direction (rise vs. fall) and the rate (fast vs. slow) of the apparent pitch of iterated rippled noise (IRN) bursts. Acoustic parameters were selected to capture features used in phoneme contrasts, however the stimuli themselves were not perceived as speech per se. Participants were scanned as they passively listened to sounds in an event-related paradigm. Univariate analyses revealed a greater level and extent of activation in bilateral auditory cortex in response to frequency-modulated sweeps compared to steady-state sounds. This effect was stronger in the left hemisphere. However, no regions showed selectivity for either rate or direction of frequency modulation. In contrast, multivoxel pattern analysis (MVPA) revealed feature-specific encoding for direction of modulation in auditory cortex bilaterally. Moreover, this effect was strongest when analyses were restricted to anatomical regions lying outside Heschl's gyrus. We found no support for feature-specific encoding of frequency modulation rate. Differential findings of modulation rate and direction of modulation are discussed with respect to their relevance to phonetic discrimination.
Directory of Open Access Journals (Sweden)
Dan Wu
Full Text Available Abstract This study aimed to explore: 1 DNA methylation in the promoter regions of Wilms tumor gene 1 (WT1, NK6 transcription factor related locus 1 gene (NKX6-1 and Deleted in bladder cancer 1 (DBC1 gene in cervical cancer tissues of Uygur women in Xinjiang, and 2 the correlation of gene methylation with the infection of HPV16/18 viruses. We detected HPV16/18 infection in 43 normal cervical tissues, 30 cervical intraepithelial neoplasia lesions (CIN and 48 cervical cancer tissues with polymerase chain reaction (PCR method. Methylation in the promoter regions of the WT1, NKX6-1 and DBC1 genes in the above-mentioned tissues was measured by methylation-specific PCR (MSP and cloning sequencing. The expression level of these three genes was measured by real-time PCR (qPCR in 10 methylation-positive cervical cancer tissues and 10 methylation-negative normal cervical tissues. We found that the infection of HPV16 in normal cervical tissues, CIN and cervical cancer tissues was 14.0, 36.7 and 66.7%, respectively. The infection of HPV18 was 0, 6.7 and 10.4%, respectively. The methylation rates of WT1, NKX6-1 and DBC1 genes were 7.0, 11.6 and 23.3% in normal cervical tissues, 36.7, 46.7 and 30.0% in CIN tissues, and 89.6, 77.1 and 85.4% in cervical cancer tissues. Furthermore, WT1, NKX6-1 and DBC1 genes were hypermethylated in the high-grade squamous intraepithelial lesion (CIN2, CIN3 and in the cervical cancer tissues with infection of HPV16/18 (both P< 0.05. The expression of WT1, NKX6-1 and DBC1 was significantly lower in the methylation-positive cervical cancer tissues than in methylation-negative normal cervical tissues. Our findings indicated that methylation in the promoter regions of WT1, NKX6-1 and DBC1 is correlated with cervical cancer tumorigenesis in Uygur women. The infection of HPV16/18 might be correlated with methylation in these genes. Gene inactivation caused by methylation might be related to the incidence and development of cervical
Functional analysis of the rice rubisco activase promoter in transgenic Arabidopsis
Energy Technology Data Exchange (ETDEWEB)
Yang, Zhipan; Lu, Qingtao; Wen, Xiaogang [Key Laboratory of Photobiology, Institute of Botany, Chinese Academy of Sciences, Beijing 100093 (China); Chen, Fan [Key Laboratory of Molecular and Developmental Biology, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100080 (China); Lu, Congming, E-mail: lucm@ibcas.ac.cn [Key Laboratory of Photobiology, Institute of Botany, Chinese Academy of Sciences, Beijing 100093 (China)
2012-02-17
Highlights: Black-Right-Pointing-Pointer Rice rubisco activase promoter was analyzed in transgenic Arabidopsis system. Black-Right-Pointing-Pointer Region conferring tissue specific and light inducible expression of Rca was identified. Black-Right-Pointing-Pointer -58 to +43 bp region mediates tissue-specific expression of rice Rca. Black-Right-Pointing-Pointer Light inducible expression of rice Rca is mediated by -297 to -58 bp region. Black-Right-Pointing-Pointer Rice nuclear proteins bind specifically with the light inducible region. -- Abstract: To gain a better understanding of the regulatory mechanism of the rice rubisco activase (Rca) gene, variants of the Rca gene promoter (one full-length and four deletion mutants) fused to the coding region of the bacterial reporter gene {beta}-glucuronidase (GUS) were introduced into Arabidopsis via Agrobacterium-mediated transformation. Our results show that a 340 bp fragment spanning from -297 to +43 bp relative to the transcription initiation site is enough to promote tissue-specific and light-inducible expression of the rice Rca gene as done by the full-length promoter (-1428 to +43 bp). Further deletion analysis indicated that the region conferring tissue-specificity of Rca expression is localized within a 105 bp fragment from -58 to +43 bp, while light-inducible expression of Rca is mediated by the region from -297 to -58 bp. Gel shift assays and competition experiments demonstrated that rice nuclear proteins bind specifically with the fragment conferring light responsiveness at more than one binding site. This implies that multiple cis-elements may be involved in light-induced expression of the rice Rca gene. These works provide a useful reference for understanding transcriptional regulation mechanism of the rice Rca gene, and lay a strong foundation for further detection of related cis-elements and trans-factors.
Functional analysis of the rice rubisco activase promoter in transgenic Arabidopsis
International Nuclear Information System (INIS)
Yang, Zhipan; Lu, Qingtao; Wen, Xiaogang; Chen, Fan; Lu, Congming
2012-01-01
Highlights: ► Rice rubisco activase promoter was analyzed in transgenic Arabidopsis system. ► Region conferring tissue specific and light inducible expression of Rca was identified. ► −58 to +43 bp region mediates tissue-specific expression of rice Rca. ► Light inducible expression of rice Rca is mediated by −297 to −58 bp region. ► Rice nuclear proteins bind specifically with the light inducible region. -- Abstract: To gain a better understanding of the regulatory mechanism of the rice rubisco activase (Rca) gene, variants of the Rca gene promoter (one full-length and four deletion mutants) fused to the coding region of the bacterial reporter gene β-glucuronidase (GUS) were introduced into Arabidopsis via Agrobacterium-mediated transformation. Our results show that a 340 bp fragment spanning from −297 to +43 bp relative to the transcription initiation site is enough to promote tissue-specific and light-inducible expression of the rice Rca gene as done by the full-length promoter (−1428 to +43 bp). Further deletion analysis indicated that the region conferring tissue-specificity of Rca expression is localized within a 105 bp fragment from −58 to +43 bp, while light-inducible expression of Rca is mediated by the region from −297 to −58 bp. Gel shift assays and competition experiments demonstrated that rice nuclear proteins bind specifically with the fragment conferring light responsiveness at more than one binding site. This implies that multiple cis-elements may be involved in light-induced expression of the rice Rca gene. These works provide a useful reference for understanding transcriptional regulation mechanism of the rice Rca gene, and lay a strong foundation for further detection of related cis-elements and trans-factors.