The zebrafish progranulin gene family and antisense transcripts
Directory of Open Access Journals (Sweden)
Baranowski David
2005-11-01
Full Text Available Abstract Background Progranulin is an epithelial tissue growth factor (also known as proepithelin, acrogranin and PC-cell-derived growth factor that has been implicated in development, wound healing and in the progression of many cancers. The single mammalian progranulin gene encodes a glycoprotein precursor consisting of seven and one half tandemly repeated non-identical copies of the cystine-rich granulin motif. A genome-wide duplication event hypothesized to have occurred at the base of the teleost radiation predicts that mammalian progranulin may be represented by two co-orthologues in zebrafish. Results The cDNAs encoding two zebrafish granulin precursors, progranulins-A and -B, were characterized and found to contain 10 and 9 copies of the granulin motif respectively. The cDNAs and genes encoding the two forms of granulin, progranulins-1 and -2, were also cloned and sequenced. Both latter peptides were found to be encoded by precursors with a simplified architecture consisting of one and one half copies of the granulin motif. A cDNA encoding a chimeric progranulin which likely arises through the mechanism of trans-splicing between grn1 and grn2 was also characterized. A non-coding RNA gene with antisense complementarity to both grn1 and grn2 was identified which may have functional implications with respect to gene dosage, as well as in restricting the formation of the chimeric form of progranulin. Chromosomal localization of the four progranulin (grn genes reveals syntenic conservation for grna only, suggesting that it is the true orthologue of mammalian grn. RT-PCR and whole-mount in situ hybridization analysis of zebrafish grns during development reveals that combined expression of grna and grnb, but not grn1 and grn2, recapitulate many of the expression patterns observed for the murine counterpart. This includes maternal deposition, widespread central nervous system distribution and specific localization within the epithelial
Progranulin in neurodegenerative disease.
Petkau, Terri L; Leavitt, Blair R
2014-07-01
Loss-of-function mutations in the progranulin gene are a common cause of familial frontotemporal dementia (FTD). The purpose of this review is to summarize the role of progranulin in health and disease, because the field is now poised to begin examining therapeutics that alter endogenous progranulin levels. We first review the clinical and neuropathological phenotype of FTD patients carrying mutations in the progranulin gene, which suggests that progranulin-mediated neurodegeneration is multifactorial and influenced by other genetic and/or environmental factors. We then examine evidence for the role of progranulin in the brain with a focus on mouse model systems. A better understanding of the complexity of progranulin biology in the brain will help guide the development of progranulin-modulating therapies for neurodegenerative disease. Copyright © 2014 Elsevier Ltd. All rights reserved.
Luzzi, Simona; Colleoni, Lara; Corbetta, Paola; Baldinelli, Sara; Fiori, Chiara; Girelli, Francesca; Silvestrini, Mauro; Caroppo, Paola; Giaccone, Giorgio; Tagliavini, Fabrizio; Rossi, Giacomina
2017-06-01
Gene coding for progranulin, GRN, is a major gene linked to frontotemporal lobar degeneration. While most of pathogenic GRN mutations are null mutations leading to haploinsufficiency, GRN missense mutations do not have an obvious pathogenicity, and only a few have been revealed to act through different pathogenetic mechanisms, such as cytoplasmic missorting, protein degradation, and abnormal cleavage by elastase. The aim of this study was to disclose the pathogenetic mechanisms of the GRN A199V missense mutation, which was previously reported not to alter physiological progranulin features but was associated with a reduced plasma progranulin level. After investigating the family pedigree, we performed genetic and biochemical analysis on its members and performed RNA expression studies. We found that the mutation segregates with the disease and discovered that its pathogenic feature is the alteration of GRN mRNA splicing, actually leading to haploinsufficiency. Thus, when facing with a missense GRN mutation, its pathogenetic effects should be investigated, especially if associated with low plasma progranulin levels, to determine its nature of either benign polymorphism or pathogenic mutation. Copyright © 2017 Elsevier Inc. All rights reserved.
Buttenschøn, Henriette N; Nielsen, Marit N; Thotakura, Gangadaar; Lee, Chris W; Nykjær, Anders; Mors, Ole; Glerup, Simon
2017-06-01
The identification of peripheral biomarkers for bipolar disorder is of great importance and has the potential to improve diagnosis, treatment and prognosis. Recent studies have reported lower plasma progranulin levels in bipolar individuals compared with controls and association with single nucleotide polymorphisms (SNPs) within the progranulin gene (GRN). In the present study, we investigated the effect of GRN and sortilin (SORT1) gene variation on serum progranulin levels in bipolar individuals and controls. In a Danish cohort of individuals with bipolar disorder and controls, we analysed the serum progranulin level (nbipolar=80, ncontrols=76) and five SNPs located within GRN and two SNPs near the SORT1 gene encoding sortilin, a progranulin scavenger receptor known to affect circulating progranulin levels (nbipolar=166, ncontrols=186). We observed no significant difference in the serum progranulin level between cases and controls and none of the analysed SNPs located within GRN or close to SORT1 were associated with bipolar disorder. Crude and adjusted (adjusted for case-control status, sex and age) linear regression analyses showed no effect of any SNPs on the serum progranulin level. However, we observed that the mean serum progranulin level in cases and controls is affected differently depending on the genotypes of two SNPs within GRN (rs2879096 and rs4792938). The sample size is relatively small and detailed information on medication and polarity of the disorder is not available. No correction for multiple testing was performed. Our study suggests that the potential of progranulin as a biomarker for bipolar disorder is genotype dependent.
Almeida, Maria R; Macário, Maria C; Ramos, Lina; Baldeiras, Inês; Ribeiro, Maria H; Santana, Isabel
2016-05-01
We and others have reported heterozygous progranulin mutations as an important cause of frontotemporal lobar degeneration (FTLD). It has been identified a complete progranulin deficiency because of a homozygous mutation in a sibling pair with neuronal ceroid lipofuscinosis (NCL). Here, we describe the first case of NCL caused by a homozygous progranulin mutation segregating in a family with neuropathological confirmed FTLD. In this FTLD-NCL family, we detail the clinical phenotype, neuropsychological evaluation and imaging data of our proband harboring a homozygous mutation, c.900_901dupGT, with serum progranulin level (progranulin levels in suspected recessive adult-onset NCL cases. Overall, a more holistic neurologic intervention is needed to guarantee a proper genetic counseling in cases like the present family where two distinct phenotypes are generated according to the individuals' mutation state. Copyright © 2016 Elsevier Inc. All rights reserved.
The Evolution of the Secreted Regulatory Protein Progranulin.
Palfree, Roger G E; Bennett, Hugh P J; Bateman, Andrew
2015-01-01
Progranulin is a secreted growth factor that is active in tumorigenesis, wound repair, and inflammation. Haploinsufficiency of the human progranulin gene, GRN, causes frontotemporal dementia. Progranulins are composed of chains of cysteine-rich granulin modules. Modules may be released from progranulin by proteolysis as 6kDa granulin polypeptides. Both intact progranulin and some of the granulin polypeptides are biologically active. The granulin module occurs in certain plant proteases and progranulins are present in early diverging metazoan clades such as the sponges, indicating their ancient evolutionary origin. There is only one Grn gene in mammalian genomes. More gene-rich Grn families occur in teleost fish with between 3 and 6 members per species including short-form Grns that have no tetrapod counterparts. Our goals are to elucidate progranulin and granulin module evolution by investigating (i): the origins of metazoan progranulins (ii): the evolutionary relationships between the single Grn of tetrapods and the multiple Grn genes of fish (iii): the evolution of granulin module architectures of vertebrate progranulins (iv): the conservation of mammalian granulin polypeptide sequences and how the conserved granulin amino acid sequences map to the known three dimensional structures of granulin modules. We report that progranulin-like proteins are present in unicellular eukaryotes that are closely related to metazoa suggesting that progranulin is among the earliest extracellular regulatory proteins still employed by multicellular animals. From the genomes of the elephant shark and coelacanth we identified contemporary representatives of a precursor for short-from Grn genes of ray-finned fish that is lost in tetrapods. In vertebrate Grns pathways of exon duplication resulted in a conserved module architecture at the amino-terminus that is frequently accompanied by an unusual pattern of tandem nearly identical module repeats near the carboxyl-terminus. Polypeptide
The Evolution of the Secreted Regulatory Protein Progranulin.
Directory of Open Access Journals (Sweden)
Roger G E Palfree
Full Text Available Progranulin is a secreted growth factor that is active in tumorigenesis, wound repair, and inflammation. Haploinsufficiency of the human progranulin gene, GRN, causes frontotemporal dementia. Progranulins are composed of chains of cysteine-rich granulin modules. Modules may be released from progranulin by proteolysis as 6kDa granulin polypeptides. Both intact progranulin and some of the granulin polypeptides are biologically active. The granulin module occurs in certain plant proteases and progranulins are present in early diverging metazoan clades such as the sponges, indicating their ancient evolutionary origin. There is only one Grn gene in mammalian genomes. More gene-rich Grn families occur in teleost fish with between 3 and 6 members per species including short-form Grns that have no tetrapod counterparts. Our goals are to elucidate progranulin and granulin module evolution by investigating (i: the origins of metazoan progranulins (ii: the evolutionary relationships between the single Grn of tetrapods and the multiple Grn genes of fish (iii: the evolution of granulin module architectures of vertebrate progranulins (iv: the conservation of mammalian granulin polypeptide sequences and how the conserved granulin amino acid sequences map to the known three dimensional structures of granulin modules. We report that progranulin-like proteins are present in unicellular eukaryotes that are closely related to metazoa suggesting that progranulin is among the earliest extracellular regulatory proteins still employed by multicellular animals. From the genomes of the elephant shark and coelacanth we identified contemporary representatives of a precursor for short-from Grn genes of ray-finned fish that is lost in tetrapods. In vertebrate Grns pathways of exon duplication resulted in a conserved module architecture at the amino-terminus that is frequently accompanied by an unusual pattern of tandem nearly identical module repeats near the carboxyl
Directory of Open Access Journals (Sweden)
Sandra Almeida
Full Text Available The reduced production or activity of the cysteine-rich glycoprotein progranulin is responsible for about 20% of cases of familial frontotemporal dementia. However, little is known about the molecular mechanisms that govern the level and secretion of progranulin. Here we show that progranulin is expressed in mouse cortical neurons and more prominently in mouse microglia in culture and is abundant in the endoplasmic reticulum (ER and Golgi. Using chemical crosslinking, immunoprecipitation, and mass spectrometry, we found that progranulin is bound to a network of ER Ca(2+-binding chaperones including BiP, calreticulin, GRP94, and four members of the protein disulfide isomerase (PDI family. Loss of ERp57 inhibits progranulin secretion. Thus, progranulin is a novel substrate of several PDI family proteins and modulation of the ER chaperone network may be a therapeutic target for controlling progranulin secretion.
Human genetics as a tool to identify progranulin regulators.
Nicholson, Alexandra M; Finch, NiCole A; Rademakers, Rosa
2011-11-01
Frontotemporal lobar degeneration (FTLD) is a common neurodegenerative disorder that predominantly affects individuals under the age of 65. It is known that the most common pathological subtype is FTLD with TAR DNA-binding protein 43 inclusions (FTLD-TDP). FTLD has a strong genetic component with about 50% of cases having a positive family history. Mutations identified in the progranulin gene (GRN) have been shown to cause FTLD-TDP as a result of progranulin haploinsufficiency. These findings suggest a progranulin-dependent mechanism in this pathological FTLD subtype. Thus, identifying regulators of progranulin levels is essential for new therapies and treatments for FTLD and related disorders. In this review, we discuss the role of genetic studies in identifying progranulin regulators, beginning with the discovery of pathogenic GRN mutations and additional GRN risk variants. We also cover more recent genetic advances, including the detection of variants in the transmembrane protein 106 B gene that increase FTLD-TDP risk presumably by modulating progranulin levels and the identification of a potential progranulin receptor, sortilin. This review highlights the importance of genetic studies in the context of FTLD and further emphasizes the need for future genetic and cell biology research to continue the effort in finding a cure for progranulin-related diseases.
Petkau, T L; Hill, A; Leavitt, B R
2016-02-19
Loss-of-function mutations in the progranulin gene (GRN) are a common cause of familial frontotemporal lobar degeneration (FTLD). A high degree of heterogeneity in the age-of-onset, duration of disease, and clinical presentation of FTLD, even among families carrying the same GRN mutation, suggests that additional modifying genes may be important to pathogenesis. Progranulin-knockout mice display subtle behavioral abnormalities and progressive neuropathological changes, as well as altered dendritic morphology and synaptic deficits in the hippocampus. In this study we evaluated multiple neuropathological endpoints in aged progranulin knockout mice and their wild-type littermates on two different genetic backgrounds: C57Bl/6 and 129/SvImJ. We find that in most brain regions, both strains are susceptible to progranulin-mediated neuropathological phenotypes, including astrogliosis, microgliosis, and highly accelerated deposition of the aging pigment lipofuscin. Neuroinflammation due to progranulin deficiency is exaggerated in the B6 strain and present, but less pronounced, in the 129 strain. Differences between the strains in hippocampal neuron counts and neuronal morphology suggest a complex role for progranulin in the hippocampus. We conclude that core progranulin-mediated neurodegenerative phenotypes are penetrant on multiple inbred mouse strains, but that genetic background modulates progranulin's role in neuroinflammation and hippocampal biology. Copyright © 2015 IBRO. Published by Elsevier Ltd. All rights reserved.
Arrant, Andrew E; Onyilo, Vincent C; Unger, Daniel E; Roberson, Erik D
2018-02-28
Loss-of-function mutations in progranulin, a lysosomal glycoprotein, cause neurodegenerative disease. Progranulin haploinsufficiency causes frontotemporal dementia (FTD) and complete progranulin deficiency causes CLN11 neuronal ceroid lipofuscinosis (NCL). Progranulin replacement is a rational therapeutic strategy for these disorders, but there are critical unresolved mechanistic questions about a progranulin gene therapy approach, including its potential to reverse existing pathology. Here, we address these issues using an AAV vector (AAV- Grn ) to deliver progranulin in Grn -/- mice (both male and female), which model aspects of NCL and FTD pathology, developing lysosomal dysfunction, lipofuscinosis, and microgliosis. We first tested whether AAV- Grn could improve preexisting pathology. Even with treatment after onset of pathology, AAV- Grn reduced lipofuscinosis in several brain regions of Grn -/- mice. AAV- Grn also reduced microgliosis in brain regions distant from the injection site. AAV-expressed progranulin was only detected in neurons, not in microglia, indicating that the microglial activation in progranulin deficiency can be improved by targeting neurons and thus may be driven at least in part by neuronal dysfunction. Even areas with sparse transduction and almost undetectable progranulin showed improvement, indicating that low-level replacement may be sufficiently effective. The beneficial effects of AAV- Grn did not require progranulin binding to sortilin. Finally, we tested whether AAV- Grn improved lysosomal function. AAV-derived progranulin was delivered to the lysosome, ameliorated the accumulation of LAMP-1 in Grn -/- mice, and corrected abnormal cathepsin D activity. These data shed light on progranulin biology and support progranulin-boosting therapies for NCL and FTD due to GRN mutations. SIGNIFICANCE STATEMENT Heterozygous loss-of-function progranulin ( GRN ) mutations cause frontotemporal dementia (FTD) and homozygous mutations cause neuronal
Circulating progranulin as a biomarker for neurodegenerative diseases.
Ghidoni, Roberta; Paterlini, Anna; Benussi, Luisa
2012-01-01
Progranulin is a growth factor involved in the regulation of multiple processes including tumorigenesis, wound repair, development, and inflammation. The recent discovery that mutations in the gene encoding for progranulin (GRN) cause frontotemporal lobar degeneration (FTLD), and other neurodegenerative diseases leading to dementia, has brought renewed interest in progranulin and its functions in the central nervous system. GRN null mutations cause protein haploinsufficiency, leading to a significant decrease in progranulin levels that can be detected in plasma, serum and cerebrospinal fluid (CSF) of mutation carriers. The dosage of circulating progranulin sped up the identification of GRN mutations thus favoring genotype-phenotype correlation studies. Researchers demonstrated that, in GRN null mutation carriers, the shortage of progranulin invariably precedes clinical symptoms and thus mutation carriers are "captured" regardless of their disease status. GRN is a particularly appealing gene for drug targeting, in the way that boosting its expression may be beneficial for mutation carriers, preventing or delaying the onset of GRN-related neurodegenerative diseases. Physiological regulation of progranulin expression level is only partially known. Progranulin expression reflects mutation status and, intriguingly, its levels can be modulated by some additional factor (i.e. genetic background; drugs). Thus, factors increasing the production and secretion of progranulin from the normal gene are promising potential therapeutic avenues. In conclusion, peripheral progranulin is a nonintrusive highly accurate biomarker for early identification of mutation carriers and for monitoring future treatments that might boost the level of this protein.
Almeida, Sandra; Zhou, Lijuan; Gao, Fen-Biao
2011-01-01
The reduced production or activity of the cysteine-rich glycoprotein progranulin is responsible for about 20% of cases of familial frontotemporal dementia. However, little is known about the molecular mechanisms that govern the level and secretion of progranulin. Here we show that progranulin is expressed in mouse cortical neurons and more prominently in mouse microglia in culture and is abundant in the endoplasmic reticulum (ER) and Golgi. Using chemical crosslinking, immunoprecipitation, an...
Progranulin, lysosomal regulation and neurodegenerative disease.
Kao, Aimee W; McKay, Andrew; Singh, Param Priya; Brunet, Anne; Huang, Eric J
2017-06-01
The discovery that heterozygous and homozygous mutations in the gene encoding progranulin are causally linked to frontotemporal dementia and lysosomal storage disease, respectively, reveals previously unrecognized roles of the progranulin protein in regulating lysosome biogenesis and function. Given the importance of lysosomes in cellular homeostasis, it is not surprising that progranulin deficiency has pleiotropic effects on neural circuit development and maintenance, stress response, innate immunity and ageing. This Progress article reviews recent advances in progranulin biology emphasizing its roles in lysosomal function and brain innate immunity, and outlines future avenues of investigation that may lead to new therapeutic approaches for neurodegeneration.
Progranulin is neurotrophic in vivo and protects against a mutant TDP-43 induced axonopathy.
Directory of Open Access Journals (Sweden)
Angela S Laird
Full Text Available Mislocalization, aberrant processing and aggregation of TAR DNA-binding protein 43 (TDP-43 is found in the neurons affected by two related diseases, amyotrophic lateral sclerosis (ALS and frontotemporal lobe dementia (FTLD. These TDP-43 abnormalities are seen when TDP-43 is mutated, such as in familial ALS, but also in FTLD, caused by null mutations in the progranulin gene. They are also found in many patients with sporadic ALS and FTLD, conditions in which only wild type TDP-43 is present. The common pathological hallmarks and symptomatic cross over between the two diseases suggest that TDP-43 and progranulin may be mechanistically linked. In this study we aimed to address this link by establishing whether overexpression of mutant TDP-43 or knock-down of progranulin in zebrafish embryos results in motor neuron phenotypes and whether human progranulin is neuroprotective against such phenotypes. Mutant TDP-43 (A315T mutation induced a motor axonopathy characterized by short axonal outgrowth and aberrant branching, similar, but more severe, than that induced by mutant SOD1. Knockdown of the two zebrafish progranulin genes, grna and grnb, produced a substantial decrease in axonal length, with knockdown of grna alone producing a greater decrease in axonal length than grnb. Progranulin overexpression rescued the axonopathy induced by progranulin knockdown. Interestingly, progranulin also rescued the mutant TDP-43 induced axonopathy, whilst it failed to affect the mutant SOD1-induced phenotype. TDP-43 was found to be nuclear in all conditions described. The findings described here demonstrate that progranulin is neuroprotective in vivo and may have therapeutic potential for at least some forms of motor neuron degeneration.
Wilke, Carlo; Gillardon, Frank; Deuschle, Christian; Hobert, Markus A; Jansen, Iris E; Metzger, Florian G; Heutink, Peter; Gasser, Thomas; Maetzler, Walter; Blauwendraat, Cornelis; Synofzik, Matthis
2017-01-01
Reduced progranulin levels are a hallmark of frontotemporal dementia (FTD) caused by loss-of-function (LoF) mutations in the progranulin gene (GRN). However, alterations of central nervous progranulin expression also occur in neurodegenerative disorders unrelated to GRN mutations, such as Alzheimer's disease. We hypothesised that central nervous progranulin levels are also reduced in GRN-negative FTD. Progranulin levels were determined in both cerebrospinal fluid (CSF) and serum in 75 subjects (37 FTD patients and 38 controls). All FTD patients were assessed by whole-exome sequencing for GRN mutations, yielding a target cohort of 34 patients without pathogenic mutations in GRN (GRN-negative cohort) and 3 GRN mutation carriers (2 LoF variants and 1 novel missense variant). Not only the GRN mutation carriers but also the GRN-negative patients showed decreased CSF levels of progranulin (serum levels in GRN-negative patients were normal). The decreased CSF progranulin levels were unrelated to patients' increased CSF levels of total tau, possibly indicating different destructive neuronal processes within FTD neurodegeneration. The patient with the novel GRN missense variant (c.1117C>T, p.P373S) showed substantially decreased CSF levels of progranulin, comparable to the 2 patients with GRN LoF mutations, suggesting a pathogenic effect of this missense variant. Our results indicate that central nervous progranulin reduction is not restricted to the relatively rare cases of FTD caused by GRN LoF mutations, but also contributes to the more common GRN-negative forms of FTD. Central nervous progranulin reduction might reflect a partially distinct pathogenic mechanism underlying FTD neurodegeneration and is not directly linked to tau alterations. © 2016 S. Karger AG, Basel.
Progranulin Is a Chemoattractant for Microglia and Stimulates Their Endocytic Activity
Pickford, Fiona; Marcus, Jacob; Camargo, Luiz Miguel; Xiao, Qiurong; Graham, Danielle; Mo, Jan-Rung; Burkhardt, Matthew; Kulkarni, Vinayak; Crispino, Jamie; Hering, Heike; Hutton, Michael
2011-01-01
Mutations resulting in progranulin haploinsufficiency cause disease in patients with a subset of frontotemporal lobar degeneration; however, the biological functions of progranulin in the brain remain unknown. To address this subject, the present study initially assessed changes in gene expression and cytokine secretion in rat primary cortical neurons treated with progranulin. Molecular pathways enriched in the progranulin gene set included cell adhesion and cell motility pathways and pathway...
Galimberti, Daniela; Bertram, Kelly; Formica, Alessandra; Fenoglio, Chiara; Cioffi, Sara M G; Arighi, Andrea; Scarpini, Elio; Colosimo, Carlo
2016-05-04
Progranulin gene (GRN) mutations are characterized by heterogeneous presentations. Corticobasal syndrome (CBS) is often associated with GRN mutations, whereas association with progressive supranuclear palsy syndrome (PSPS) is rare. Plasma progranulin levels were evaluated in 34 patients, including 19 with PSPS, 12 with CBS, and 3 with mixed signs, with the purpose to screen for the presence of causal mutations, associated with low levels. We found undetectable levels in a patient with CBS. Sequencing confirmed the presence of the Thr272fs deletion. Progranulin mutation screening is suggested in cases of CBS, even in the absence of positive family history for dementia and/or movement disorders.
Progranulin is expressed within motor neurons and promotes neuronal cell survival
Directory of Open Access Journals (Sweden)
Kay Denis G
2009-10-01
Full Text Available Abstract Background Progranulin is a secreted high molecular weight growth factor bearing seven and one half copies of the cysteine-rich granulin-epithelin motif. While inappropriate over-expression of the progranulin gene has been associated with many cancers, haploinsufficiency leads to atrophy of the frontotemporal lobes and development of a form of dementia (frontotemporal lobar degeneration with ubiquitin positive inclusions, FTLD-U associated with the formation of ubiquitinated inclusions. Recent reports indicate that progranulin has neurotrophic effects, which, if confirmed would make progranulin the only neuroprotective growth factor that has been associated genetically with a neurological disease in humans. Preliminary studies indicated high progranulin gene expression in spinal cord motor neurons. However, it is uncertain what the role of Progranulin is in normal or diseased motor neuron function. We have investigated progranulin gene expression and subcellular localization in cultured mouse embryonic motor neurons and examined the effect of progranulin over-expression and knockdown in the NSC-34 immortalized motor neuron cell line upon proliferation and survival. Results In situ hybridisation and immunohistochemical techniques revealed that the progranulin gene is highly expressed by motor neurons within the mouse spinal cord and in primary cultures of dissociated mouse embryonic spinal cord-dorsal root ganglia. Confocal microscopy coupled to immunocytochemistry together with the use of a progranulin-green fluorescent protein fusion construct revealed progranulin to be located within compartments of the secretory pathway including the Golgi apparatus. Stable transfection of the human progranulin gene into the NSC-34 motor neuron cell line stimulates the appearance of dendritic structures and provides sufficient trophic stimulus to survive serum deprivation for long periods (up to two months. This is mediated at least in part through
Progranulin mutation causes frontotemporal dementia in the Swedish Karolinska family.
Chiang, Huei-Hsin; Rosvall, Lina; Brohede, Jesper; Axelman, Karin; Björk, Behnosh F; Nennesmo, Inger; Robins, Tiina; Graff, Caroline
2008-11-01
Frontotemporal dementia (FTD) is a neurodegenerative disease characterized by cognitive impairment, language dysfunction, and/or changes in personality. Recently it has been shown that progranulin (GRN) mutations can cause FTD as well as other neurodegenerative phenotypes. DNA from 30 family members, of whom seven were diagnosed with FTD, in the Karolinska family was available for GRN sequencing. Fibroblast cell mRNA from one affected family member and six control individuals was available for relative quantitative real-time polymerase chain reaction to investigate the effect of the mutation. Furthermore, the cDNA of an affected individual was sequenced. Clinical and neuropathologic findings of a previously undescribed family branch are presented. A frameshift mutation in GRN (g.102delC) was detected in all affected family members and absent in four unaffected family members older than 70 years. Real-time polymerase chain reaction data showed an approximately 50% reduction of GRN fibroblast mRNA in an affected individual. The mutated mRNA transcripts were undetectable by cDNA sequencing. Segregation and RNA analyses showed that the g.102delC mutation, previously reported, causes FTD in the Karolinska family. Our findings add further support to the significance of GRN in FTD etiology and the presence of modifying genes, which emphasize the need for further studies into the mechanisms of clinical heterogeneity. However, the results already call for attention to the complexity of predictive genetic testing of GRN mutations.
Progranulin mutations as risk factors for Alzheimer disease.
Perry, David C; Lehmann, Manja; Yokoyama, Jennifer S; Karydas, Anna; Lee, Jason Jiyong; Coppola, Giovanni; Grinberg, Lea T; Geschwind, Dan; Seeley, William W; Miller, Bruce L; Rosen, Howard; Rabinovici, Gil
2013-06-01
Mutations in the progranulin gene are known to cause diverse clinical syndromes, all attributed to frontotemporal lobar degeneration. We describe 2 patients with progranulin gene mutations and evidence of Alzheimer disease (AD) pathology. We also conducted a literature review. This study focused on case reports of 2 unrelated patients with progranulin mutations at the University of California, San Francisco, Memory and Aging Center. One patient presented at age 65 years with a clinical syndrome suggestive of AD and showed evidence of amyloid aggregation on positron emission tomography. Another patient presented at age 54 years with logopenic progressive aphasia and, at autopsy, showed both frontotemporal lobar degeneration with TDP-43 inclusions and AD. In addition to autosomal-dominant frontotemporal lobar degeneration, mutations in the progranulin gene may be a risk factor for AD clinical phenotypes and neuropathology.
Progranulin gene variability and plasma levels in bipolar disorder and schizophrenia.
Directory of Open Access Journals (Sweden)
Daniela Galimberti
Full Text Available Basing on the assumption that frontotemporal lobar degeneration (FTLD, schizophrenia and bipolar disorder (BPD might share common aetiological mechanisms, we analyzed genetic variation in the FTLD risk gene progranulin (GRN in a German population of patients with schizophrenia (n = 271 or BPD (n = 237 as compared with 574 age-, gender- and ethnicity-matched controls. Furthermore, we measured plasma progranulin levels in 26 German BPD patients as well as in 61 Italian BPD patients and 29 matched controls.A significantly decreased allelic frequency of the minor versus the wild-type allele was observed for rs2879096 (23.2 versus 34.2%, P<0.001, OR:0.63, 95%CI:0.49-0.80, rs4792938 (30.7 versus 39.7%, P = 0.005, OR: 0.70, 95%CI: 0.55-0.89 and rs5848 (30.3 versus 36.8, P = 0.007, OR: 0.71, 95%CI: 0.56-0.91. Mean±SEM progranulin plasma levels were significantly decreased in BPD patients, either Germans or Italians, as compared with controls (89.69±3.97 and 116.14±5.80 ng/ml, respectively, versus 180.81±18.39 ng/ml P<0.001 and were not correlated with age.In conclusion, GRN variability decreases the risk to develop BPD and schizophrenia, and progranulin plasma levels are significantly lower in BPD patients than in controls. Nevertheless, a larger replication analysis would be needed to confirm these preliminary results.
Progranulin Is a Chemoattractant for Microglia and Stimulates Their Endocytic Activity
Pickford, Fiona; Marcus, Jacob; Camargo, Luiz Miguel; Xiao, Qiurong; Graham, Danielle; Mo, Jan-Rung; Burkhardt, Matthew; Kulkarni, Vinayak; Crispino, Jamie; Hering, Heike; Hutton, Michael
2011-01-01
Mutations resulting in progranulin haploinsufficiency cause disease in patients with a subset of frontotemporal lobar degeneration; however, the biological functions of progranulin in the brain remain unknown. To address this subject, the present study initially assessed changes in gene expression and cytokine secretion in rat primary cortical neurons treated with progranulin. Molecular pathways enriched in the progranulin gene set included cell adhesion and cell motility pathways and pathways involved in growth and development. Secretion of cytokines and several chemokines linked to chemoattraction but not inflammation were also increased from progranulin-treated primary neurons. Therefore, whether progranulin is involved in recruitment of immune cells in the brain was investigated. Localized lentiviral expression of progranulin in C57BL/6 mice resulted in an increase of Iba1-positive microglia around the injection site. Moreover, progranulin alone was sufficient to promote migration of primary mouse microglia in vitro. Primary microglia and C4B8 cells demonstrated more endocytosis of amyloid β1-42 when treated with progranulin. These data demonstrate that progranulin acts as a chemoattractant in the brain to recruit or activate microglia and can increase endocytosis of extracellular peptides such as amyloid β. PMID:21224065
Progranulin levels in blood in Alzheimer's disease and mild cognitive impairment.
Cooper, Yonatan A; Nachun, Daniel; Dokuru, Deepika; Yang, Zhongan; Karydas, Anna M; Serrero, Ginette; Yue, Binbin; Boxer, Adam L; Miller, Bruce L; Coppola, Giovanni
2018-05-01
Changes in progranulin ( GRN ) expression have been hypothesized to alter risk for Alzheimer's disease (AD). We investigated the relationship between GRN expression in peripheral blood and clinical diagnosis of AD and mild cognitive impairment (MCI). Peripheral blood progranulin gene expression was measured, using microarrays from Alzheimer's ( n = 186), MCI ( n = 118), and control ( n = 204) subjects from the University of California San Francisco Memory and Aging Center (UCSF-MAC) and two independent published series (AddNeuroMed and ADNI). GRN gene expression was correlated with clinical, demographic, and genetic data, including APOE haplotype and the GRN rs5848 single-nucleotide polymorphism. Finally, we assessed progranulin protein levels, using enzyme-linked immunosorbent assay, and methylation status using methylation microarrays. We observed an increase in blood progranulin gene expression and a decrease in GRN promoter methylation in males ( P = 0.007). Progranulin expression was 13% higher in AD and MCI patients compared with controls in the UCSF-MAC cohort ( F 2,505 = 10.41, P = 3.72*10 -5 ). This finding was replicated in the AddNeuroMed ( F 2,271 = 17.9, P = 4.83*10 -8 ) but not the ADNI series. The rs5848 SNP (T-allele) predicted decreased blood progranulin gene expression ( P = 0.03). The APOE4 haplotype was positively associated with progranulin expression independent of diagnosis ( P = 0.04). Finally, we did not identify differences in plasma progranulin protein levels or gene methylation between diagnostic categories. Progranulin mRNA is elevated in peripheral blood of patients with AD and MCI and its expression is associated with numerous genetic and demographic factors. These data suggest a role in the pathogenesis of neurodegenerative dementias besides frontotemporal dementia.
Ghidoni, Roberta; Stoppani, Elena; Rossi, Giacomina; Piccoli, Elena; Albertini, Valentina; Paterlini, Anna; Glionna, Michela; Pegoiani, Eleonora; Agnati, Luigi F; Fenoglio, Chiara; Scarpini, Elio; Galimberti, Daniela; Morbin, Michela; Tagliavini, Fabrizio; Binetti, Giuliano; Benussi, Luisa
2012-01-01
Recently, attention was drawn to a role for progranulin in the central nervous system with the identification of mutations in the progranulin gene (GRN) as an important cause of frontotemporal lobar degeneration. GRN mutations are associated with a strong reduction of circulating progranulin and widely variable clinical phenotypes: thus, the dosage of plasma progranulin is a useful tool for a quick and inexpensive large-scale screening of carriers of GRN mutations. To establish the best cutoff threshold for normal versus abnormal levels of plasma progranulin. 309 cognitively healthy controls (25-87 years of age), 72 affected and unaffected GRN+ null mutation carriers (24-86 years of age), 3 affected GRN missense mutation carriers, 342 patients with neurodegenerative diseases and 293 subjects with mild cognitive impairment were enrolled at the Memory Clinic, IRCCS S. Giovanni di Dio-Fatebenefratelli, Brescia, Italy, and at the Alzheimer Unit, Ospedale Maggiore Policlinico and IRCCS Istituto Neurologico C. Besta, Milan, Italy. Plasma progranulin levels were measured using an ELISA kit (AdipoGen Inc., Seoul, Korea). Plasma progranulin did not correlate with age, gender or body mass index. We established a new plasma progranulin protein cutoff level of 61.55 ng/ml that identifies, with a specificity of 99.6% and a sensitivity of 95.8%, null mutation carriers among subjects attending to a memory clinic. Affected and unaffected GRN null mutation carriers did not differ in terms of circulating progranulin protein (p = 0.686). A significant disease anticipation was observed in GRN+ subjects with the lowest progranulin levels. We propose a new plasma progranulin protein cutoff level useful for clinical practice. Copyright © 2011 S. Karger AG, Basel.
Progranulin: at the interface of neurodegenerative and metabolic diseases.
Nguyen, Andrew D; Nguyen, Thi A; Martens, Lauren Herl; Mitic, Laura L; Farese, Robert V
2013-12-01
Progranulin is a widely expressed, cysteine-rich, secreted glycoprotein originally discovered for its growth factor-like properties. Its subsequent identification as a causative gene for frontotemporal dementia (FTD), a devastating early-onset neurodegenerative disease, has catalyzed a surge of new discoveries about progranulin function in the brain. More recently, progranulin was recognized as an adipokine involved in diet-induced obesity and insulin resistance, revealing its metabolic function. We review here progranulin biology in both neurodegenerative and metabolic diseases. In particular, we highlight the growth factor-like, trophic, and anti-inflammatory properties of progranulin as potential unifying themes in these seemingly divergent conditions. We also discuss potential therapeutic options for raising progranulin levels to treat progranulin-deficient FTD, as well as the possible consequences of such treatment. Copyright © 2013 Elsevier Ltd. All rights reserved.
Further evidence for plasma progranulin as a biomarker in bipolar disorder.
Kittel-Schneider, Sarah; Weigl, Johannes; Volkert, Julia; Geßner, Alexandra; Schmidt, Brigitte; Hempel, Susanne; Kiel, Tilman; Olmes, David G; Bartl, Jasmin; Weber, Heike; Kopf, Juliane; Reif, Andreas
2014-03-01
A recent study suggested that progranulin (encoded by the fronto-temporal dementia risk gene GRN) plasma levels are decreased in bipolar disorder (BD). Replication of this finding is however lacking. Progranulin plasma levels of bipolar patients (n=104) and healthy controls (n=80) were measured by enzyme-linked immunosorbent assay (ELISA). Participants were also genotyped for three single nucleotide polymorphisms (SNPs) in the GRN gene (rs2879096, rs4792938 and rs5848), and the effect of genetic variation on progranulin levels was examined. Plasma progranulin levels were decreased in BD (ANCOVA, p=0.001). Furthermore, age was significantly and positively correlated with plasma progranulin (Pearson׳s correlation, r=0.269, pprogranulin plasma levels (ANCOVA, p=0.007). Specifically in BD, the GRN SNP rs5848 was associated with progranulin plasma levels (Kruskal-Wallis test, pprogranulin as a biomarker for BD is limited due to the overlap between patients and controls. The findings strengthen the evidence for progranulin being involved in pathomechanisms of bipolar disorder, and suggest a genetic determinant of progranulin concentrations that is relevant specifically in bipolar patients. Copyright © 2014 Elsevier B.V. All rights reserved.
P. van Damme (Damme); A. van Hoecke (Annelies); D. Lambrechts (Diether); P. Vanacker (Peter); E. Bogaert (Elke); J.C. van Swieten (John); P. Carmeliet (Peter); L. van den Bosch (Ludo); W. Robberecht (Wim)
2008-01-01
textabstractRecently, mutations in the progranulin (PGRN) gene were found to cause familial and apparently sporadic frontotemporal lobe dementia (FTLD). Moreover, missense changes in PGRN were identified in patients with motor neuron degeneration, a condition that is related to FTLD. Most mutations
Chen-Plotkin, Alice S.; Unger, Travis L.; Gallagher, Michael D.; Bill, Emily; Kwong, Linda K.; Volpicelli-Daley, Laura; Busch, Johanna I.; Akle, Sebastian; Grossman, Murray; Van Deerlin, Vivianna; Trojanowski, John Q.; Lee, Virginia M.-Y.
2012-01-01
Frontotemporal lobar degeneration with TDP-43 inclusions (FTLD-TDP) is a fatal neurodegenerative disease with no available treatments. Mutations in the progranulin gene (GRN) causing impaired production or secretion of progranulin are a common Mendelian cause of FTLD-TDP; additionally, common variants at chromosome 7p21 in the uncharacterized gene TMEM106B were recently linked by genome-wide association to FTLD-TDP with and without GRN mutations. Here we show that TMEM106B is neuronally expressed in postmortem human brain tissue, and that expression levels are increased in FTLD-TDP brain. Furthermore, using an unbiased, microarray-based screen of over 800 microRNAs, we identify microRNA-132 as the top microRNA differentiating FTLD-TDP and control brains, with progranulin in late endo-lysosomes, and TMEM106B over-expression increases intracellular levels of progranulin. Thus, TMEM106B is an FTLD-TDP risk gene, with microRNA-132/212 depression as an event which can lead to aberrant over-expression of TMEM106B, which in turn alters progranulin pathways. Evidence for this pathogenic cascade includes the striking convergence of two independent, genomic-scale screens on a microRNA:mRNA regulatory pair. Our findings open novel directions for elucidating miRNA-based therapies in FTLD-TDP. PMID:22895706
Effects of Exercise on Progranulin Levels and Gliosis in Progranulin-Insufficient Mice.
Arrant, Andrew E; Patel, Aashka R; Roberson, Erik D
2015-01-01
Loss-of-function mutations in progranulin ( GRN ) are one of the most common genetic causes of frontotemporal dementia (FTD), a progressive, fatal neurodegenerative disorder with no available disease-modifying treatments. Through haploinsufficiency, these mutations reduce levels of progranulin, a protein that has neurotrophic and anti-inflammatory effects. Increasing progranulin expression from the intact allele is therefore a potential approach for treating individuals with GRN mutations. Based on the well-known effects of physical exercise on other neurotrophic factors, we hypothesized that exercise might increase brain progranulin levels. We tested this hypothesis in progranulin heterozygous ( Grn + / - ) mice, which model progranulin haploinsufficiency. We housed wild-type and progranulin-insufficient mice in standard cages or cages with exercise wheels for 4 or 7.5 weeks, and then measured brain and plasma progranulin levels. Although exercise modestly increased progranulin in very young (2-month-old) wild-type mice, this effect was limited to the hippocampus. Exercise did not increase brain progranulin mRNA or protein in multiple regions, nor did it increase plasma progranulin, in 4- to 8-month-old wild-type or Grn + / - mice, across multiple experiments and under conditions that increased hippocampal BDNF and neurogenesis. Grn - / - mice were included in the study to test for progranulin-independent benefits of exercise on gliosis. Exercise attenuated cortical microgliosis in 8-month-old Grn - / - mice, consistent with a progranulin-independent, anti-inflammatory effect of exercise. These results suggest that exercise may have some modest, nonspecific benefits for FTD patients with progranulin mutations, but do not support exercise as a strategy to raise progranulin levels.
Petkau, Terri L; Blanco, Jake; Leavitt, Blair R
2017-10-01
Progranulin deficiency due to heterozygous null mutations in the GRN gene is a common cause of familial frontotemporal lobar degeneration (FTLD), while homozygous loss-of-function GRN mutations cause neuronal ceroid lipofuscinosis (NCL). Aged progranulin-knockout mice display highly exaggerated lipofuscinosis, microgliosis, and astrogliosis, as well as mild cell loss in specific brain regions. Progranulin is a secreted glycoprotein expressed in both neurons and microglia, but not astrocytes, in the brain. We generated conditional progranulin-knockout mice that lack progranulin in nestin-expressing cells (Nes-cKO mice), which include most neurons as well as astrocytes. We confirmed near complete knockout of progranulin in neurons in Nes-cKO mice, while microglial progranulin levels remained similar to that of wild-type animals. Overall brain progranulin levels were reduced by about 50% in Nes-cKO, and no Grn was detected in primary Nes-cKO neurons. Nes-cKO mice aged to 12months did not display any increase in lipofuscin deposition, microgliosis, or astrogliosis in the four brain regions examined, though increases were observed for most of these measures in Grn-null animals. We conclude that neuron-specific loss of progranulin is not sufficient to cause similar neuropathological changes to those seen in constitutive Grn-null animals. Our results suggest that increased lipofuscinosis and gliosis in Grn-null animals are not caused by intrinsic progranulin deficiency in neurons, and that microglia-derived progranulin may be sufficient to maintain neuronal health and homeostasis in the brain. Copyright © 2017 Elsevier Inc. All rights reserved.
Galimberti, Daniela; Prunas, Cecilia; Paoli, Riccardo A; Dell'Osso, Bernardo; Fenoglio, Chiara; Villa, Chiara; Palazzo, Carlotta; Cigliobianco, Michela; Camuri, Giulia; Serpente, Maria; Scarpini, Elio; Altamura, A Carlo
2014-11-01
Recent data have shown that genetic variability in the progranulin (GRN) gene may contribute to the susceptibility to developing bipolar disorder (BD). However, in regard to patients with BD, no information is available on the role of genetic variability and plasma progranulin levels in different types of this disorder. In this study, we performed an association analysis of GRN in an Italian population consisting of 134 patients with BD and 232 controls to evaluate progranulin plasma levels. The presence of the polymorphic variant of the rs5848 single nucleotide polymorphism is protective for the development of bipolar I disorder (BD-I) (odds ratio = 0.55, 95% confidence interval: 0.33-0.93; p = 0.024) but not bipolar II disorder (BD-II) (p > 0.05). In addition, plasma progranulin levels are significantly decreased in BD [mean ± standard deviation (SD) 112 ± 35 versus 183 ± 93 ng/mL in controls; p < 0.001]. Regarding the influence of GRN variability on BD susceptibility, the predisposing genetic background differs between BD-I and BD-II, possibly implying that pathogenic mechanisms differ between the two subtypes of BD. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Progranulin promotes peripheral nerve regeneration and reinnervation: role of notch signaling.
Altmann, Christine; Vasic, Verica; Hardt, Stefanie; Heidler, Juliana; Häussler, Annett; Wittig, Ilka; Schmidt, Mirko H H; Tegeder, Irmgard
2016-10-22
Peripheral nerve injury is a frequent cause of lasting motor deficits and chronic pain. Although peripheral nerves are capable of regrowth they often fail to re-innervate target tissues. Using newly generated transgenic mice with inducible neuronal progranulin overexpression we show that progranulin accelerates axonal regrowth, restoration of neuromuscular synapses and recovery of sensory and motor functions after injury of the sciatic nerve. Oppositely, progranulin deficient mice have long-lasting deficits in motor function tests after nerve injury due to enhanced losses of motor neurons and stronger microglia activation in the ventral horn of the spinal cord. Deep proteome and gene ontology (GO) enrichment analysis revealed that the proteins upregulated in progranulin overexpressing mice were involved in 'regulation of transcription' and 'response to insulin' (GO terms). Transcription factor prediction pointed to activation of Notch signaling and indeed, co-immunoprecipitation studies revealed that progranulin bound to the extracellular domain of Notch receptors, and this was functionally associated with higher expression of Notch target genes in the dorsal root ganglia of transgenic mice with neuronal progranulin overexpression. Functionally, these transgenic mice recovered normal gait and running, which was not achieved by controls and was stronger impaired in progranulin deficient mice. We infer that progranulin activates Notch signaling pathways, enhancing thereby the regenerative capacity of partially injured neurons, which leads to improved motor function recovery.
Directory of Open Access Journals (Sweden)
Yanqiu Zheng
Full Text Available Progranulin haplo-insufficiency is a main cause of frontotemporal lobar degeneration (FTLD with TDP-43 aggregates. Previous studies have shown that sortilin regulates progranulin trafficking and is a main determinant of progranulin level in the brain. In this study, we mapped the binding site between progranulin and sortilin. Progranulin binds to the beta-propeller region of sortilin through its C-terminal tail. The C-terminal progranulin fragment is fully sufficient for sortilin binding and progranulin C-terminal peptide displaces progranulin binding to sortilin. Deletion of the last 3 residues of progranulin (QLL abolishes its binding to sortilin and also sortilin dependent regulation of progranulin trafficking. Since progranulin haplo-insufficiency results in FTLD, these results may provide important insights into future studies of progranulin trafficking and signaling and progranulin based therapy for FTLD.
Meng, Peter S.; Mao, Yuxin; Hu, Fenghua
2011-01-01
Progranulin haplo-insufficiency is a main cause of frontotemporal lobar degeneration (FTLD) with TDP-43 aggregates. Previous studies have shown that sortilin regulates progranulin trafficking and is a main determinant of progranulin level in the brain. In this study, we mapped the binding site between progranulin and sortilin. Progranulin binds to the beta-propeller region of sortilin through its C-terminal tail. The C-terminal progranulin fragment is fully sufficient for sortilin binding and progranulin C-terminal peptide displaces progranulin binding to sortilin. Deletion of the last 3 residues of progranulin (QLL) abolishes its binding to sortilin and also sortilin dependent regulation of progranulin trafficking. Since progranulin haplo-insufficiency results in FTLD, these results may provide important insights into future studies of progranulin trafficking and signaling and progranulin based therapy for FTLD. PMID:21698296
Sortilin regulates progranulin action in castration-resistant prostate cancer cells.
Tanimoto, Ryuta; Morcavallo, Alaide; Terracciano, Mario; Xu, Shi-Qiong; Stefanello, Manuela; Buraschi, Simone; Lu, Kuojung G; Bagley, Demetrius H; Gomella, Leonard G; Scotlandi, Katia; Belfiore, Antonino; Iozzo, Renato V; Morrione, Andrea
2015-01-01
The growth factor progranulin is as an important regulator of transformation in several cellular systems. We have previously demonstrated that progranulin acts as an autocrine growth factor and stimulates motility, proliferation, and anchorage-independent growth of castration-resistant prostate cancer cells, supporting the hypothesis that progranulin may play a critical role in prostate cancer progression. However, the mechanisms regulating progranulin action in castration-resistant prostate cancer cells have not been characterized. Sortilin, a single-pass type I transmembrane protein of the vacuolar protein sorting 10 family, binds progranulin in neurons and negatively regulates progranulin signaling by mediating progranulin targeting for lysosomal degradation. However, whether sortilin is expressed in prostate cancer cells and plays any role in regulating progranulin action has not been established. Here, we show that sortilin is expressed at very low levels in castration-resistant PC3 and DU145 cells. Significantly, enhancing sortilin expression in PC3 and DU145 cells severely diminishes progranulin levels and inhibits motility, invasion, proliferation, and anchorage-independent growth. In addition, sortilin overexpression negatively modulates Akt (protein kinase B, PKB) stability. These results are recapitulated by depleting endogenous progranulin in PC3 and DU145 cells. On the contrary, targeting sortilin by short hairpin RNA approaches enhances progranulin levels and promotes motility, invasion, and anchorage-independent growth. We dissected the mechanisms of sortilin action and demonstrated that sortilin promotes progranulin endocytosis through a clathrin-dependent pathway, sorting into early endosomes and subsequent lysosomal degradation. Collectively, these results point out a critical role for sortilin in regulating progranulin action in castration-resistant prostate cancer cells, suggesting that sortilin loss may contribute to prostate cancer progression.
EphA2 is a functional receptor for the growth factor progranulin.
Neill, Thomas; Buraschi, Simone; Goyal, Atul; Sharpe, Catherine; Natkanski, Elizabeth; Schaefer, Liliana; Morrione, Andrea; Iozzo, Renato V
2016-12-05
Although the growth factor progranulin was discovered more than two decades ago, the functional receptor remains elusive. Here, we discovered that EphA2, a member of the large family of Ephrin receptor tyrosine kinases, is a functional signaling receptor for progranulin. Recombinant progranulin bound with high affinity to EphA2 in both solid phase and solution. Interaction of progranulin with EphA2 caused prolonged activation of the receptor, downstream stimulation of mitogen-activated protein kinase and Akt, and promotion of capillary morphogenesis. Furthermore, we found an autoregulatory mechanism of progranulin whereby a feed-forward loop occurred in an EphA2-dependent manner that was independent of the endocytic receptor sortilin. The discovery of a functional signaling receptor for progranulin offers a new avenue for understanding the underlying mode of action of progranulin in cancer progression, tumor angiogenesis, and perhaps neurodegenerative diseases. © 2016 Neill et al.
Petkau, Terri L; Kosior, Natalia; de Asis, Kathleen; Connolly, Colúm; Leavitt, Blair R
2017-11-17
Progranulin deficiency due to heterozygous null mutations in the GRN gene are a common cause of familial frontotemporal lobar degeneration (FTLD), while homozygous loss-of-function GRN mutations are thought to be a rare cause of neuronal ceroid lipofuscinosis (NCL). Aged progranulin-knockout (Grn-null) mice display highly exaggerated lipofuscinosis, microgliosis, and astrogliosis, as well as mild cell loss in specific brain regions. In the brain, progranulin is predominantly expressed in neurons and microglia, and previously, we demonstrated that neuronal-specific depletion of progranulin does not recapitulate the neuropathological phenotype of Grn-null mice. In this study, we evaluated whether selective depletion of progranulin expression in myeloid-lineage cells, including microglia, causes NCL-like neuropathology or neuroinflammation in mice. We generated mice with progranulin depleted in myeloid-lineage cells by crossing mice homozygous for a floxed progranulin allele to mice expressing Cre recombinase under control of the LyzM promotor (Lyz-cKO). Progranulin expression was reduced by approximately 50-70% in isolated microglia compared to WT levels. Lyz-cKO mice aged to 12 months did not display any increase in lipofuscin deposition, microgliosis, or astrogliosis in the four brain regions examined, though increases were observed for many of these measures in Grn-null animals. To evaluate the functional effect of reduced progranulin expression in isolated microglia, primary cultures were stimulated with controlled standard endotoxin and cytokine release was measured. While Grn-null microglia display a hyper-inflammatory phenotype, Lyz-cKO and WT microglia secreted similar levels of inflammatory cytokines. We conclude that progranulin expression from either microglia or neurons is sufficient to prevent the development of NCL-like neuropathology in mice. Furthermore, microglia that are deficient for progranulin expression but isolated from a progranulin
Effects of Exercise on Progranulin Levels and Gliosis in Progranulin-Insufficient Mice1,2,3
Arrant, Andrew E.; Patel, Aashka R.
2015-01-01
Abstract Loss-of-function mutations in progranulin (GRN) are one of the most common genetic causes of frontotemporal dementia (FTD), a progressive, fatal neurodegenerative disorder with no available disease-modifying treatments. Through haploinsufficiency, these mutations reduce levels of progranulin, a protein that has neurotrophic and anti-inflammatory effects. Increasing progranulin expression from the intact allele is therefore a potential approach for treating individuals with GRN mutations. Based on the well-known effects of physical exercise on other neurotrophic factors, we hypothesized that exercise might increase brain progranulin levels. We tested this hypothesis in progranulin heterozygous (Grn+/−) mice, which model progranulin haploinsufficiency. We housed wild-type and progranulin-insufficient mice in standard cages or cages with exercise wheels for 4 or 7.5 weeks, and then measured brain and plasma progranulin levels. Although exercise modestly increased progranulin in very young (2-month-old) wild-type mice, this effect was limited to the hippocampus. Exercise did not increase brain progranulin mRNA or protein in multiple regions, nor did it increase plasma progranulin, in 4- to 8-month-old wild-type or Grn+/− mice, across multiple experiments and under conditions that increased hippocampal BDNF and neurogenesis. Grn−/−mice were included in the study to test for progranulin-independent benefits of exercise on gliosis. Exercise attenuated cortical microgliosis in 8-month-old Grn−/−mice, consistent with a progranulin-independent, anti-inflammatory effect of exercise. These results suggest that exercise may have some modest, nonspecific benefits for FTD patients with progranulin mutations, but do not support exercise as a strategy to raise progranulin levels. PMID:26361634
Losing protein in the brain: the case of progranulin.
Ghidoni, Roberta; Paterlini, Anna; Albertini, Valentina; Binetti, Giuliano; Benussi, Luisa
2012-10-02
It is well known that progranulin protein is involved in wound repair, inflammation, and tumor formation. The wedding between progranulin and brain was celebrated in 2006 with the involvement of progranulin gene (GRN) in Frontotemporal lobar degeneration (FTLD), the most common form of early-onset dementia: up to date, 75 mutations have been detected in FTLD patients as well as in patients with widely variable clinical phenotypes. All pathogenic GRN mutations identified thus far cause the disease through a uniform mechanism, i.e. loss of functional progranulin or haploinsufficiency. Studies on GRN knockout mice suggest that progranulin-related neurodegenerative diseases may result from lifetime depletion of neurotrophic support together with cumulative damage in association with dysregulated inflammation, thus highlighting possible new molecular targets for GRN-related FTLD treatment. Recently, the dosage of plasma progranulin has been proposed as a useful tool for a quick and inexpensive large-scale screening of affected and unaffected carriers of GRN mutations. Before it is systematically translated into clinical practice and, more importantly, included into diagnostic criteria for dementias, further standardization of plasma progranulin test and harmonization of its use are required. Once a specific treatment becomes available for these pathologies, this test - being applicable on large scale - will represent an important step towards personalized healthcare. This article is part of a Special Issue entitled: Brain Integration. Copyright © 2012 Elsevier B.V. All rights reserved.
Zheng, Yanqiu; Brady, Owen A.; Meng, Peter S.; Mao, Yuxin; Hu, Fenghua
2011-01-01
Progranulin haplo-insufficiency is a main cause of frontotemporal lobar degeneration (FTLD) with TDP-43 aggregates. Previous studies have shown that sortilin regulates progranulin trafficking and is a main determinant of progranulin level in the brain. In this study, we mapped the binding site between progranulin and sortilin. Progranulin binds to the beta-propeller region of sortilin through its C-terminal tail. The C-terminal progranulin fragment is fully sufficient for sortilin binding and...
Secreted Progranulin Is a Homodimer and Is Not a Component of High Density Lipoproteins (HDL)*
Nguyen, Andrew D.; Nguyen, Thi A.; Cenik, Basar; Yu, Gang; Herz, Joachim; Walther, Tobias C.; Davidson, W. Sean; Farese, Robert V.
2013-01-01
Progranulin is a secreted glycoprotein, and the GRN gene is mutated in some cases of frontotemporal dementia. Progranulin has also been implicated in cell growth, wound healing, inflammation, and cancer. We investigated the molecular nature of secreted progranulin and provide evidence that progranulin exists as a homodimer. Although recombinant progranulin has a molecular mass of ∼85 kDa by SDS-PAGE, it elutes in fractions corresponding to ∼170–180 kDa by gel-filtration chromatography. Additionally, recombinant progranulin can be intermolecularly cross-linked, yielding a complex corresponding to a dimer (∼180 kDa), and progranulins containing different epitope tags physically interact. In plasma, progranulin similarly forms complexes of ∼180–190 kDa. Although progranulin partially co-fractionated with high density lipoproteins (HDL) by gel-filtration chromatography, we found no evidence that progranulin in mouse or human plasma is a component of HDL either by ultracentrifugation or by lipid binding assays. We conclude that circulating progranulin exists as a dimer and is not likely a component of HDL. PMID:23364791
Secreted progranulin is a homodimer and is not a component of high density lipoproteins (HDL).
Nguyen, Andrew D; Nguyen, Thi A; Cenik, Basar; Yu, Gang; Herz, Joachim; Walther, Tobias C; Davidson, W Sean; Farese, Robert V
2013-03-22
Progranulin is a secreted glycoprotein, and the GRN gene is mutated in some cases of frontotemporal dementia. Progranulin has also been implicated in cell growth, wound healing, inflammation, and cancer. We investigated the molecular nature of secreted progranulin and provide evidence that progranulin exists as a homodimer. Although recombinant progranulin has a molecular mass of ∼85 kDa by SDS-PAGE, it elutes in fractions corresponding to ∼170-180 kDa by gel-filtration chromatography. Additionally, recombinant progranulin can be intermolecularly cross-linked, yielding a complex corresponding to a dimer (∼180 kDa), and progranulins containing different epitope tags physically interact. In plasma, progranulin similarly forms complexes of ∼180-190 kDa. Although progranulin partially co-fractionated with high density lipoproteins (HDL) by gel-filtration chromatography, we found no evidence that progranulin in mouse or human plasma is a component of HDL either by ultracentrifugation or by lipid binding assays. We conclude that circulating progranulin exists as a dimer and is not likely a component of HDL.
Filiano, Anthony J; Martens, Lauren Herl; Young, Allen H; Warmus, Brian A; Zhou, Ping; Diaz-Ramirez, Grisell; Jiao, Jian; Zhang, Zhijun; Huang, Eric J; Gao, Fen-Biao; Farese, Robert V; Roberson, Erik D
2013-03-20
Frontotemporal dementia (FTD) is a neurodegenerative disease with hallmark deficits in social and emotional function. Heterozygous loss-of-function mutations in GRN, the progranulin gene, are a common genetic cause of the disorder, but the mechanisms by which progranulin haploinsufficiency causes neuronal dysfunction in FTD are unclear. Homozygous progranulin knock-out (Grn(-/-)) mice have been studied as a model of this disorder and show behavioral deficits and a neuroinflammatory phenotype with robust microglial activation. However, homozygous GRN mutations causing complete progranulin deficiency were recently shown to cause a different neurological disorder, neuronal ceroid lipofuscinosis, suggesting that the total absence of progranulin may have effects distinct from those of haploinsufficiency. Here, we studied progranulin heterozygous (Grn(+/-)) mice, which model progranulin haploinsufficiency. We found that Grn(+/-) mice developed age-dependent social and emotional deficits potentially relevant to FTD. However, unlike Grn(-/-) mice, behavioral deficits in Grn(+/-) mice occurred in the absence of gliosis or increased expression of tumor necrosis factor-α. Instead, we found neuronal abnormalities in the amygdala, an area of selective vulnerability in FTD, in Grn(+/-) mice. Our findings indicate that FTD-related deficits resulting from progranulin haploinsufficiency can develop in the absence of detectable gliosis and neuroinflammation, thereby dissociating microglial activation from functional deficits and suggesting an important effect of progranulin deficiency on neurons.
Multiple therapeutic effects of progranulin on experimental acute ischaemic stroke.
Kanazawa, Masato; Kawamura, Kunio; Takahashi, Tetsuya; Miura, Minami; Tanaka, Yoshinori; Koyama, Misaki; Toriyabe, Masafumi; Igarashi, Hironaka; Nakada, Tsutomu; Nishihara, Masugi; Nishizawa, Masatoyo; Shimohata, Takayoshi
2015-07-01
In the central nervous system, progranulin, a glycoprotein growth factor, plays a crucial role in maintaining physiological functions, and progranulin gene mutations cause TAR DNA-binding protein-43-positive frontotemporal lobar degeneration. Although several studies have reported that progranulin plays a protective role against ischaemic brain injury, little is known about temporal changes in the expression level, cellular localization, and glycosylation status of progranulin after acute focal cerebral ischaemia. In addition, the precise mechanisms by which progranulin exerts protective effects on ischaemic brain injury remains unknown. Furthermore, the therapeutic potential of progranulin against acute focal cerebral ischaemia, including combination treatment with tissue plasminogen activator, remains to be elucidated. In the present study, we aimed to determine temporal changes in the expression and localization of progranulin after ischaemia as well as the therapeutic effects of progranulin on ischaemic brain injury using in vitro and in vivo models. First, we demonstrated a dynamic change in progranulin expression in ischaemic Sprague-Dawley rats, including increased levels of progranulin expression in microglia within the ischaemic core, and increased levels of progranulin expression in viable neurons as well as induction of progranulin expression in endothelial cells within the ischaemic penumbra. We also demonstrated that the fully glycosylated mature secretory isoform of progranulin (∼88 kDa) decreased, whereas the glycosylated immature isoform of progranulin (58-68 kDa) markedly increased at 24 h and 72 h after reperfusion. In vitro experiments using primary cells from C57BL/6 mice revealed that the glycosylated immature isoform was secreted only from the microglia. Second, we demonstrated that progranulin could protect against acute focal cerebral ischaemia by a variety of mechanisms including attenuation of blood-brain barrier disruption
Genome-wide meta-analysis identifies novel determinants of circulating serum progranulin.
Tönjes, Anke; Scholz, Markus; Krüger, Jacqueline; Krause, Kerstin; Schleinitz, Dorit; Kirsten, Holger; Gebhardt, Claudia; Marzi, Carola; Grallert, Harald; Ladenvall, Claes; Heyne, Henrike; Laurila, Esa; Kriebel, Jennifer; Meisinger, Christa; Rathmann, Wolfgang; Gieger, Christian; Groop, Leif; Prokopenko, Inga; Isomaa, Bo; Beutner, Frank; Kratzsch, Jürgen; Fischer-Rosinsky, Antje; Pfeiffer, Andreas; Krohn, Knut; Spranger, Joachim; Thiery, Joachim; Blüher, Matthias; Stumvoll, Michael; Kovacs, Peter
2018-02-01
Progranulin is a secreted protein with important functions in processes including immune and inflammatory response, metabolism and embryonic development. The present study aimed at identification of genetic factors determining progranulin concentrations. We conducted a genome-wide association meta-analysis for serum progranulin in three independent cohorts from Europe: Sorbs (N = 848) and KORA (N = 1628) from Germany and PPP-Botnia (N = 335) from Finland (total N = 2811). Single nucleotide polymorphisms (SNPs) associated with progranulin levels were replicated in two additional German cohorts: LIFE-Heart Study (Leipzig; N = 967) and Metabolic Syndrome Berlin Potsdam (Berlin cohort; N = 833). We measured mRNA expression of genes in peripheral blood mononuclear cells (PBMC) by micro-arrays and performed mRNA expression quantitative trait and expression-progranulin association studies to functionally substantiate identified loci. Finally, we conducted siRNA silencing experiments in vitro to validate potential candidate genes within the associated loci. Heritability of circulating progranulin levels was estimated at 31.8% and 26.1% in the Sorbs and LIFE-Heart cohort, respectively. SNPs at three loci reached study-wide significance (rs660240 in CELSR2-PSRC1-MYBPHL-SORT1, rs4747197 in CDH23-PSAP and rs5848 in GRN) explaining 19.4%/15.0% of the variance and 61%/57% of total heritability in the Sorbs/LIFE-Heart Study. The strongest evidence for association was at rs660240 (P = 5.75 × 10-50), which was also associated with mRNA expression of PSRC1 in PBMC (P = 1.51 × 10-21). Psrc1 knockdown in murine preadipocytes led to a consecutive 30% reduction in progranulin secretion. In conclusion, the present meta-GWAS combined with mRNA expression identified three loci associated with progranulin and supports the role of PSRC1 in the regulation of progranulin secretion. © The Author(s) 2017. Published by Oxford University Press. All rights
Progranulin as a therapeutic target for dementia.
Galimberti, Daniela; Fenoglio, Chiara; Scarpini, Elio
2018-06-22
Progranulin (PGRN) is an acrosomal glycoprotein that is synthesized during spermatogenesis. It is overexpressed in tumors and has anti-inflammatory properties. The protein may be cleaved into granulins which display pro-inflammatory properties. In 2006, mutations in progranulin gene (GRN) that cause haploinsufficiency were found in familial cases of frontotemporal dementia (FTD). Patients with null mutations in GRN display very low-plasma PGRN levels; this analysis is useful for identifying mutation carriers, independent of the clinical presentation, and in those before the appearance of symptoms. Areas covered: Here, we review the current knowledge of PGRN physiological functions and GRN mutations associated with FTD; we also summarize state of the art clinical trials and those compounds able to replace PGRN loss in preclinical models. Expert opinion: PGRN represents a promising therapeutic target for FTD. Cohorts suitable for treatment, ideally at the preclinical stage, where pathogenic mechanisms ongoing in the brain are targeted, are available. However, PGRN may have side effects, such as the risk of tumorigenesis, and the risk/benefit ratio of any intervention cannot be predicted. Furthermore, at present, the situation is complicated by the absence of adequate outcome measures.
Tanimoto, Ryuta; Palladino, Chiara; Xu, Shi-Qiong; Buraschi, Simone; Neill, Thomas; Gomella, Leonard G; Peiper, Stephen C; Belfiore, Antonino; Iozzo, Renato V; Morrione, Andrea
2017-12-01
Despite extensive clinical and experimental studies over the past decades, the pathogenesis and progression to the castration-resistant stage of prostate cancer remains largely unknown. Progranulin, a secreted growth factor, strongly binds the heparin-sulfate proteoglycan perlecan, and counteracts its biological activity. We established that progranulin acts as an autocrine growth factor and promotes prostate cancer cell motility, invasion, and anchorage-independent growth. Progranulin was overexpressed in prostate cancer tissues vis-à-vis non-neoplastic tissues supporting the hypothesis that progranulin may play a key role in prostate cancer progression. However, progranulin's mode of action is not well understood and proteins regulating progranulin signaling have not been identified. Sortilin, a single-pass type I transmembrane protein of the Vps10 family, binds progranulin in neurons and targets progranulin for lysosomal degradation. Significantly, in DU145 and PC3 cells, we detected very low levels of sortilin associated with high levels of progranulin production and enhanced motility. Restoring sortilin expression decreased progranulin levels, inhibited motility and anchorage-independent growth and destabilized Akt. These results demonstrated a critical role for sortilin in regulating progranulin and suggest that sortilin loss may contribute to prostate cancer progression. Here, we provide the novel observation that progranulin downregulated sortilin protein levels independent of transcription. Progranulin induced sortilin ubiquitination, internalization via clathrin-dependent endocytosis and sorting into early endosomes for lysosomal degradation. Collectively, these results constitute a regulatory feed-back mechanism whereby sortilin downregulation ensures sustained progranulin-mediated oncogenesis. Copyright © 2017. Published by Elsevier B.V.
Progranulin: At the interface of neurodegenerative and metabolic diseases
Nguyen, Andrew D.; Nguyen, Thi A.; Martens, Lauren Herl; Mitic, Laura L.; Farese, Robert V.
2013-01-01
Progranulin is a widely expressed, cysteine-rich, secreted glycoprotein originally discovered for its growth factor–like properties. Its subsequent identification as a causative gene for frontotemporal dementia (FTD), a devastating early-onset neurodegenerative disease, has catalyzed a surge of new discoveries about progranulin’s function in the brain. More recently, progranulin was recognized as an adipokine involved in diet-induced obesity and insulin resistance, revealing its metabolic fun...
Progranulin: a new avenue towards the understanding and treatment of neurodegenerative disease.
Chitramuthu, Babykumari P; Bennett, Hugh P J; Bateman, Andrew
2017-12-01
Progranulin, a secreted glycoprotein, is encoded in humans by the single GRN gene. Progranulin consists of seven and a half, tandemly repeated, non-identical copies of the 12 cysteine granulin motif. Many cellular processes and diseases are associated with this unique pleiotropic factor that include, but are not limited to, embryogenesis, tumorigenesis, inflammation, wound repair, neurodegeneration and lysosome function. Haploinsufficiency caused by autosomal dominant mutations within the GRN gene leads to frontotemporal lobar degeneration, a progressive neuronal atrophy that presents in patients as frontotemporal dementia. Frontotemporal dementia is an early onset form of dementia, distinct from Alzheimer's disease. The GRN-related form of frontotemporal lobar dementia is a proteinopathy characterized by the appearance of neuronal inclusions containing ubiquitinated and fragmented TDP-43 (encoded by TARDBP). The neurotrophic and neuro-immunomodulatory properties of progranulin have recently been reported but are still not well understood. Gene delivery of GRN in experimental models of Alzheimer's- and Parkinson's-like diseases inhibits phenotype progression. Here we review what is currently known concerning the molecular function and mechanism of action of progranulin in normal physiological and pathophysiological conditions in both in vitro and in vivo models. The potential therapeutic applications of progranulin in treating neurodegenerative diseases are highlighted. © The Author (2017). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Ichimura, Yohei; Asano, Yoshihide; Akamata, Kaname; Noda, Shinji; Taniguchi, Takashi; Takahashi, Takehiro; Toyama, Tetsuo; Tada, Yayoi; Sugaya, Makoto; Sato, Shinichi; Kadono, Takafumi
2015-12-01
Progranulin is a growth factor that is active in wound repair and is an antagonist of tumor necrosis factor (TNF) receptors, regulating fibroblast activation, angiogenesis, and inflammation. Because long-standing activation of gene programs related to wound healing is a hallmark of systemic sclerosis (SSc), we sought to investigate the role of progranulin in SSc. Progranulin expression levels in human and murine skin samples were determined by immunohistochemical analysis and quantitative reverse transcription-polymerase chain reaction. The role of progranulin in fibroblast activation was examined using a gene-silencing technique. Progranulin levels in serum obtained from 60 patients with SSc and 16 healthy control subjects were determined by enzyme-linked immunosorbent assay. Progranulin expression was increased in SSc dermal fibroblasts compared with normal dermal fibroblasts, both in vivo and in vitro. Transcription factor Fli-1, a deficiency of which is involved in the activation of SSc dermal fibroblasts, served as a potent repressor of the progranulin gene, and Fli-1(+/-) mice and bleomycin-treated wild-type mice exhibited up-regulated expression of progranulin in dermal fibroblasts. SSc dermal fibroblasts were resistant to the antifibrotic effect of TNF, but this resistance was reversed by gene silencing of progranulin. Serum progranulin levels were elevated in patients with early diffuse cutaneous SSc (dcSSc), especially in those with inflammatory skin symptoms, and were positively correlated with the C-reactive protein level. Progranulin overproduction due to Fli-1 deficiency may contribute to the constitutive activation of SSc dermal fibroblasts by antagonizing the antifibrotic effect of TNF. Progranulin may also be involved in the inflammatory process associated with progressive skin sclerosis in early dcSSc. © 2015, American College of Rheumatology.
Filiano, Anthony J.; Martens, Lauren Herl; Young, Allen H.; Warmus, Brian A.; Zhou, Ping; Diaz-Ramirez, Grisell; Jiao, Jian; Zhang, Zhijun; Huang, Eric J.; Gao, Fen-Biao; Farese, Robert V.; Roberson, Erik D.
2013-01-01
Frontotemporal dementia (FTD) is a neurodegenerative disease with hallmark deficits in social and emotional function. Heterozygous loss-of-function mutations in GRN, the progranulin gene, are a common genetic cause of the disorder, but the mechanisms by which progranulin haploinsufficiency causes neuronal dysfunction in FTD are unclear. Homozygous progranulin knockout (Grn−/−) mice have been studied as a model of this disorder and show behavioral deficits and a neuroinflammatory phenotype with robust microglial activation. However, homozygous GRN mutations causing complete progranulin deficiency were recently shown to cause a different neurological disorder, neuronal ceroid lipofuscinosis, suggesting that the total absence of progranulin may have effects distinct from those of haploinsufficiency. Here, we studied progranulin heterozygous (Grn+/−) mice, which model progranulin haploinsufficiency. We found that Grn+/− mice developed age-dependent social and emotional deficits potentially relevant to FTD. However, unlike Grn−/− mice, behavioral deficits in Grn+/− mice occurred in the absence of gliosis or increased expression of tumor necrosis factor–α. Instead, we found neuronal abnormalities in the amygdala, an area of selective vulnerability in FTD, in Grn+/− mice. Our findings indicate that FTD-related deficits due to progranulin haploinsufficiency can develop in the absence of detectable gliosis and neuroinflammation, thereby dissociating microglial activation from functional deficits and suggesting an important effect of progranulin deficiency on neurons. PMID:23516300
Galimberti, Daniela; Fumagalli, Giorgio G; Fenoglio, Chiara; Cioffi, Sara M G; Arighi, Andrea; Serpente, Maria; Borroni, Barbara; Padovani, Alessandro; Tagliavini, Fabrizio; Masellis, Mario; Tartaglia, Maria Carmela; van Swieten, John; Meeter, Lieke; Graff, Caroline; de Mendonça, Alexandre; Bocchetta, Martina; Rohrer, Jonathan D; Scarpini, Elio
2018-02-01
We investigated whether progranulin plasma levels are predictors of the presence of progranulin gene (GRN) null mutations or of the development of symptoms in asymptomatic at risk members participating in the Genetic Frontotemporal Dementia Initiative, including 19 patients, 64 asymptomatic carriers, and 77 noncarriers. In addition, we evaluated a possible role of TMEM106B rs1990622 as a genetic modifier and correlated progranulin plasma levels and gray-matter atrophy. Plasma progranulin mean ± SD plasma levels in patients and asymptomatic carriers were significantly decreased compared with noncarriers (30.5 ± 13.0 and 27.7 ± 7.5 versus 99.6 ± 24.8 ng/mL, p 61.55 ng/mL, the test had a sensitivity of 98.8% and a specificity of 97.5% in predicting the presence of a mutation, independent of symptoms. No correlations were found between progranulin plasma levels and age, years from average age at onset in each family, or TMEM106B rs1990622 genotype (p > 0.05). Plasma progranulin levels did not correlate with brain atrophy. Plasma progranulin levels predict the presence of GRN null mutations independent of proximity to symptoms and brain atrophy. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Van Damme, Philip
2017-10-01
Loss-of-function mutations in the gene encoding the growth factor progranulin cause degeneration of the ageing brain in a dose-dependent manner. While heterozygous mutations result in adult onset frontotemporal dementia, the much rarer homozygous null mutations cause an early onset lysosomal storage disorder. A better understanding of the biology of progranulin in the central nervous system is needed to find solutions for these incurable diseases. This Editorial highlights a study by Zhou et al. in the current issue of the Journal of Neurochemistry, in which the authors provide data that are a step towards this goal. Progranulin is mainly expressed by neurons and microglia and, although it is a secreted protein, it also ends up in lysosomes. Recently, the trafficking of progranulin and the molecular players involved have become better understood. A special interaction between progranulin and its travelling companion, prosaposin, explains how both proteins can use each other's transport receptors to gain access to lysosomes. © 2017 The Authors. Journal of Neurochemistry published by John Wiley & Sons Ltd on behalf of International Society for Neurochemistry.
Almeida, Sandra; Gao, Fuying; Coppola, Giovanni; Gao, Fen-Biao
2016-06-01
Mutations in the granulin (GRN) gene cause frontotemporal dementia (FTD) due to progranulin haploinsufficiency. Compounds that can increase progranulin production and secretion may be considered as potential therapeutic drugs; however, very few of them have been directly tested on human cortical neurons. To this end, we differentiated 9 induced pluripotent stem cell lines derived from a control subject, a sporadic FTD case and an FTD patient with progranulin S116X mutation. Treatment with 1 μM suberoylanilide hydroxamic acid (SAHA), a histone deacetylase inhibitor, increased the production of progranulin in cortical neurons of all subjects at both the mRNA and protein levels without affecting their viability. Microarray analysis revealed that SAHA treatment not only reversed some gene expression changes caused by progranulin haploinsufficiency but also caused massive alterations in the overall transcriptome. Thus, histone deacetylase inhibitors may be considered as therapeutic drugs for GRN mutation carriers. However, this class of drugs also causes drastic changes in overall gene expression in human cortical neurons and their side effects and potential impacts on other pathways should be carefully evaluated. Copyright © 2016 Elsevier Inc. All rights reserved.
Association Between Progranulin and Gaucher Disease
Jian, Jinlong; Zhao, Shuai; Tian, Qing-Yun; Liu, Helen; Zhao, Yunpeng; Chen, Wen-Chi; Grunig, Gabriele; Torres, Paola A.; Wang, Betty C.; Zeng, Bai; Pastores, Gregory; Tang, Wei; Sun, Ying; Grabowski, Gregory A.; Kong, Max Xiangtian
2016-01-01
Background: Gaucher disease (GD) is a genetic disease caused by mutations in the GBA1 gene which result in reduced enzymatic activity of β-glucocerebrosidase (GCase). This study identified the progranulin (PGRN) gene (GRN) as another gene associated with GD. Methods: Serum levels of PGRN were measured from 115 GD patients and 99 healthy controls, whole GRN gene from 40 GD patients was sequenced, and the genotyping of 4 SNPs identified in GD patients was performed in 161 GD and 142 healthy ...
The Progranulin Cleavage Products, Granulins, Exacerbate TDP-43 Toxicity and Increase TDP-43 Levels.
Salazar, Dominique A; Butler, Victoria J; Argouarch, Andrea R; Hsu, Tsung-Yuan; Mason, Amanda; Nakamura, Ayumi; McCurdy, Helen; Cox, David; Ng, Rachel; Pan, Gloria; Seeley, William W; Miller, Bruce L; Kao, Aimee W
2015-06-24
Mutations in the human progranulin gene resulting in protein haploinsufficiency cause frontotemporal lobar degeneration with TDP-43 inclusions. Although progress has been made in understanding the normal functions of progranulin and TDP-43, the molecular interactions between these proteins remain unclear. Progranulin is proteolytically processed into granulins, but the role of granulins in the pathogenesis of neurodegenerative disease is unknown. We used a Caenorhabditis elegans model of neuronal TDP-43 proteinopathy to specifically interrogate the contribution of granulins to the neurodegenerative process. Complete loss of the progranulin gene did not worsen TDP-43 toxicity, whereas progranulin heterozygosity did. Interestingly, expression of individual granulins alone had little effect on behavior. In contrast, when granulins were coexpressed with TDP-43, they exacerbated its toxicity in a variety of behaviors including motor coordination. These same granulins increased TDP-43 levels via a post-translational mechanism. We further found that in human neurodegenerative disease subjects, granulin fragments accumulated specifically in diseased regions of brain. To our knowledge, this is the first demonstration of a toxic role for granulin fragments in a neurodegenerative disease model. These studies suggest that presence of cleaved granulins, rather than or in addition to loss of full-length progranulin, may contribute to disease in TDP-43 proteinopathies. Copyright © 2015 the authors 0270-6474/15/359315-14$15.00/0.
Heidler, Juliana; Hardt, Stefanie; Wittig, Ilka; Tegeder, Irmgard
2016-12-01
Progranulin deficiency is associated with neurodegeneration in humans and in mice. The mechanisms likely involve progranulin-promoted removal of protein waste via autophagy. We performed a deep proteomic screen of the pre-frontal cortex in aged (13-15 months) female progranulin-deficient mice (GRN -/- ) and mice with inducible neuron-specific overexpression of progranulin (SLICK-GRN-OE) versus the respective control mice. Proteins were extracted and analyzed per liquid chromatography/mass spectrometry (LC/MS) on a Thermo Scientific™ Q Exactive Plus equipped with an ultra-high performance liquid chromatography unit and a Nanospray Flex Ion-Source. Full Scan MS-data were acquired using Xcalibur and raw files were analyzed using the proteomics software Max Quant. The mouse reference proteome set from uniprot (June 2015) was used to identify peptides and proteins. The DiB data file is a reduced MaxQuant output and includes peptide and protein identification, accession numbers, protein and gene names, sequence coverage and label free quantification (LFQ) values of each sample. Differences in protein expression in genotypes are presented in "Progranulin overexpression in sensory neurons attenuates neuropathic pain in mice: Role of autophagy" (C. Altmann, S. Hardt, C. Fischer, J. Heidler, H.Y. Lim, A. Haussler, B. Albuquerque, B. Zimmer, C. Moser, C. Behrends, F. Koentgen, I. Wittig, M.H. Schmidt, A.M. Clement, T. Deller, I. Tegeder, 2016) [1].
Directory of Open Access Journals (Sweden)
Juliana Heidler
2016-12-01
Full Text Available Progranulin deficiency is associated with neurodegeneration in humans and in mice. The mechanisms likely involve progranulin-promoted removal of protein waste via autophagy. We performed a deep proteomic screen of the pre-frontal cortex in aged (13–15 months female progranulin-deficient mice (GRN−/− and mice with inducible neuron-specific overexpression of progranulin (SLICK-GRN-OE versus the respective control mice. Proteins were extracted and analyzed per liquid chromatography/mass spectrometry (LC/MS on a Thermo Scientific™ Q Exactive Plus equipped with an ultra-high performance liquid chromatography unit and a Nanospray Flex Ion-Source. Full Scan MS-data were acquired using Xcalibur and raw files were analyzed using the proteomics software Max Quant. The mouse reference proteome set from uniprot (June 2015 was used to identify peptides and proteins. The DiB data file is a reduced MaxQuant output and includes peptide and protein identification, accession numbers, protein and gene names, sequence coverage and label free quantification (LFQ values of each sample. Differences in protein expression in genotypes are presented in "Progranulin overexpression in sensory neurons attenuates neuropathic pain in mice: Role of autophagy" (C. Altmann, S. Hardt, C. Fischer, J. Heidler, H.Y. Lim, A. Haussler, B. Albuquerque, B. Zimmer, C. Moser, C. Behrends, F. Koentgen, I. Wittig, M.H. Schmidt, A.M. Clement, T. Deller, I. Tegeder, 2016 [1].
Sensitivity to neurotoxic stress is not increased in progranulin-deficient mice.
Petkau, Terri L; Zhu, Shanshan; Lu, Ge; Fernando, Sarah; Cynader, Max; Leavitt, Blair R
2013-11-01
Loss-of-function mutations in the progranulin (GRN) gene are a common cause of autosomal dominant frontotemporal lobar degeneration, a fatal and progressive neurodegenerative disorder common in people less than 65 years of age. In the brain, progranulin is expressed in multiple regions at varying levels, and has been hypothesized to play a neuroprotective or neurotrophic role. Four neurotoxic agents were injected in vivo into constitutive progranulin knockout (Grn(-/-)) mice and their wild-type (Grn(+/+)) counterparts to assess neuronal sensitivity to toxic stress. Administration of 3-nitropropionic acid, quinolinic acid, kainic acid, and pilocarpine induced robust and measurable neuronal cell death in affected brain regions, but no differential cell death was observed between Grn(+/+) and Grn(-/-) mice. Thus, constitutive progranulin knockout mice do not have increased sensitivity to neuronal cell death induced by the acute chemical models of neuronal injury used in this study. Copyright © 2013. Published by Elsevier Inc.
Ghidoni, Roberta; Flocco, Rosa; Paterlini, Anna; Glionna, Michela; Caruana, Loredana; Tonoli, Elisa; Binetti, Giuliano; Benussi, Luisa
2014-01-01
The discovery that mutations in the gene encoding for progranulin (GRN) cause frontotemporal lobar degeneration (FTLD) and other neurodegenerative diseases leading to dementia has brought renewed interest in progranulin and its functions in the central nervous system. Full length progranulin is preserved from cleavage by secretory leukocyte protease inhibitor (SLPI), one of the smallest serine protease inhibitor circulating in plasma. Herein, we investigated the relationship between circulating SLPI and progranulin in affected and unaffected subjects belonging to 26 Italian pedigrees carrying GRN null mutations. In GRN null mutation carriers, we demonstrated: i) an increase of circulating SLPI levels in affected subjects; ii) an age-related upregulation of the serine-protease inhibitor in response to lifetime progranulin shortage; and iii) a delay in the age of onset in subjects with the highest SLPI protein levels. The study of SLPI and its relation to progranulin suggests the existence of unexpected molecular players in progranulin-associated neurodegeneration.
Progranulin antibodies in autoimmune diseases.
Thurner, Lorenz; Preuss, Klaus-Dieter; Fadle, Natalie; Regitz, Evi; Klemm, Philipp; Zaks, Marina; Kemele, Maria; Hasenfus, Andrea; Csernok, Elena; Gross, Wolfgang L; Pasquali, Jean-Louis; Martin, Thierry; Bohle, Rainer Maria; Pfreundschuh, Michael
2013-05-01
Systemic vasculitides constitute a heterogeneous group of diseases. Autoimmunity mediated by B lymphocytes and their humoral effector mechanisms play a major role in ANCA-associated vasculitis (AAV) as well as in non-ANCA associated primary systemic vasculitides and in the different types of autoimmune connective tissue disorders and rheumatoid arthritis. In order to detect autoantibodies in systemic vasculitides, we screened protein macroarrays of human cDNA expression libraries with sera from patients with ANCA-associated and ANCA-negative primary systemic vasculitides. This approach led to the identification of antibodies against progranulin, a 88 kDA secreted glycoprotein with strong anti-inflammatory activity in the course of disease of giant-cell arteritis/polymyalgia rheumatica (14/65), Takayasu's arteritis (4/13), classical panarteritis nodosa (4/10), Behcet's disease (2/6) and in the course of disease in granulomatosis with polyangiitis (31/75), Churg-Strauss syndrome (7/23) and in microscopic polyangiitis (7/19). In extended screenings the progranulin antibodies were also detected in other autoimmune diseases such as systemic lupus erythematosus (39/91) and rheumatoid arthritis (16/44). Progranulin antibodies were detected only in 1 of 97 healthy controls. Anti-progranulin positive patients with systemic vasculitides, systemic lupus erythematosus or rheumatoid arthritis had significant lower progranulin plasma levels, indicating a neutralizing effect. In light of the anti-inflammatory effects of progranulin, progranulin antibodies might exert pro-inflammatory effects thus contributing to the pathogenesis of the respective autoimmune diseases and might serve as a marker for disease activity. This hypothesis is supported by the fact that a positive progranulin antibody status was associated with active disease in granulomatosis with polyangiitis. Copyright © 2012 Elsevier Ltd. All rights reserved.
Wild-type bone marrow transplant partially reverses neuroinflammation in progranulin-deficient mice.
Yang, Yue; Aloi, Macarena S; Cudaback, Eiron; Josephsen, Samuel R; Rice, Samantha J; Jorstad, Nikolas L; Keene, C Dirk; Montine, Thomas J
2014-11-01
Frontotemporal dementia (FTD) is a neurodegenerative disease with devastating changes in behavioral performance and social function. Mutations in the progranulin gene (GRN) are one of the most common causes of inherited FTD due to reduced progranulin expression or activity, including in brain where it is expressed primarily by neurons and microglia. Thus, efforts aimed at enhancing progranulin levels might be a promising therapeutic strategy. Bone marrow (BM)-derived cells are able to engraft in the brain and adopt a microglial phenotype under myeloablative irradiation conditioning. This ability makes BM-derived cells a potential cellular vehicle for transferring therapeutic molecules to the central nervous system. Here, we utilized BM cells from Grn(+/+) (wild type or wt) mice labeled with green fluorescence protein for delivery of progranulin to progranulin-deficient (Grn(-/-)) mice. Our results showed that wt bone marrow transplantation (BMT) partially reconstituted progranulin in the periphery and in cerebral cortex of Grn(-/-) mice. We demonstrated a pro-inflammatory effect in vivo and in ex vivo preparations of cerebral cortex of Grn(-/-) mice that was partially to fully reversed 5 months after BMT. Our findings suggest that BMT can be administered as a stem cell-based approach to prevent or to treat neurodegenerative diseases.
Wild Type Bone Marrow Transplant Partially Reverses Neuroinflammation in Progranulin-Deficient Mice
Yang, Yue; Aloi, Macarena S.; Cudaback, Eiron; Josephsen, Samuel R.; Rice, Samantha J.; Jorstad, Nikolas L.; Keene, C. Dirk; Montine, Thomas J.
2014-01-01
Frontotemporal dementia (FTD) is a neurodegenerative disease with devastating changes in behavioral performance and social function. Mutations in the progranulin gene (GRN) are one of the most common causes of inherited FTD due to reduced progranulin expression or activity, including in brain where it is expressed primarily by neurons and microglia. Thus, efforts aimed at enhancing progranulin levels might be a promising therapeutic strategy. Bone marrow-derived cells are able to engraft in the brain and adopt a microglial phenotype under myeloablative irradiation conditioning. This ability makes bone marrow (BM)-derived cells a potential cellular vehicle for transferring therapeutic molecules to the central nervous system. Here, we utilized BM cells from Grn+/+ (wild type or wt) mice labeled with green fluorescence protein for delivery of progranulin to progranulin deficient (Grn−/−) mice. Our results showed that wt bone marrow transplantation (BMT) partially reconstituted progranulin in the periphery and in cerebral cortex of Grn−/− mice. We demonstrated a pro-inflammatory effect in vivo and in ex vivo preparations of cerebral cortex of Grn−/− mice that was partially to fully reversed five months after BMT. Our findings suggest that BMT can be administered as a stem cell-based approach to prevent or to treat neurodegenerative diseases. PMID:25199051
Low plasma progranulin levels in children with autism
Directory of Open Access Journals (Sweden)
Mostafa Gehan A
2011-09-01
Full Text Available Abstract Background Autoimmunity to brain may play a pathogenic role in autism. In autoimmune disorders, the formation of antigen-antibody complexes triggers an inflammatory response by inducing the infiltration of neutrophils. Local administration of recombinant progranulin, which is an anti-inflammatory neurotrophic factor, potently inhibit neutrophilic inflammation in vivo, demonstrating that progranulin represents a crucial inflammation-suppressing mediator. We are the first to measure plasma progranulin levels in autism. Methods Plasma levels of progranulin were measured, by ELISA, in 40 autistic patients, aged between 3 and 12 years, and 40 healthy-matched children. Results Autistic children had significantly lower plasma progranulin levels, P = 0.001. Reduced plasma progranulin levels were found in 65% (26/40 of autistic children. On the other hand, there was a non significant difference between plasma progranulin levels of children with mild to moderate autism and patients with severe autism, P = 0.11. Conclusions Plasma progranulin levels were reduced in a subgroup of patients with autism. Progranulin insufficiency in some patients with autism may result in many years of reduced neutrotrophic support together with cumulative damage in association with dysregulated inflammation that may have a role in autism. However, these data should be treated with caution until further investigations are performed, with a larger subject population, to determine whether the decrease of plasma progranulin levels is a mere consequence of autism or has a pathogenic role in the disease. The role of progranulin therapy should also be studied in autism.
Low plasma progranulin levels in children with autism.
Al-Ayadhi, Laila Y; Mostafa, Gehan A
2011-09-05
Autoimmunity to brain may play a pathogenic role in autism. In autoimmune disorders, the formation of antigen-antibody complexes triggers an inflammatory response by inducing the infiltration of neutrophils. Local administration of recombinant progranulin, which is an anti-inflammatory neurotrophic factor, potently inhibit neutrophilic inflammation in vivo, demonstrating that progranulin represents a crucial inflammation-suppressing mediator. We are the first to measure plasma progranulin levels in autism. Plasma levels of progranulin were measured, by ELISA, in 40 autistic patients, aged between 3 and 12 years, and 40 healthy-matched children. Autistic children had significantly lower plasma progranulin levels, P = 0.001. Reduced plasma progranulin levels were found in 65% (26/40) of autistic children.On the other hand, there was a non significant difference between plasma progranulin levels of children with mild to moderate autism and patients with severe autism, P = 0.11. Plasma progranulin levels were reduced in a subgroup of patients with autism. Progranulin insufficiency in some patients with autism may result in many years of reduced neutrotrophic support together with cumulative damage in association with dysregulated inflammation that may have a role in autism. However, these data should be treated with caution until further investigations are performed, with a larger subject population, to determine whether the decrease of plasma progranulin levels is a mere consequence of autism or has a pathogenic role in the disease. The role of progranulin therapy should also be studied in autism.
Progranulin is increased in human and murine lipodystrophy.
Miehle, Konstanze; Ebert, Thomas; Kralisch, Susan; Hoffmann, Annett; Kratzsch, Jürgen; Schlögl, Haiko; Stumvoll, Michael; Fasshauer, Mathias
2016-10-01
Lipodystrophies (LD) are genetic or acquired disorders sharing the symptom of partial or complete adipose tissue deficiency and a dysregulation of adipokines including leptin and adiponectin. Progranulin, an adipokine with proinflammatory and insulin resistance-inducing characteristics, has not been investigated in LD so far. Circulating progranulin was determined in LD patients (N=37) and in age-, gender-, and body mass index-matched healthy control subjects (N=37). Additionally, we investigated progranulin expression in an LD mouse model as compared to wild-type mice. Moreover, we elucidated circulating progranulin before and during metreleptin supplementation in 10 patients with LD. Median [interquartile range] circulating progranulin was increased in patients with LD (82.9 [25.9] μg/l) as compared to controls (73.6 [22.8] μg/l) (p=0.005). C-reactive protein (CRP) remained an independent and positive predictor of progranulin in multivariate analysis. Progranulin mRNA was significantly upregulated in all adipose tissue depots, i.e. visceral, subcutaneous, and brown adipose tissue, and in muscle of LD animals versus wild-type mice. Progranulin levels did not significantly change during metreleptin supplementation. Progranulin serum concentration is increased in patients with LD, and shows an independent and positive correlation with CRP. Different adipose tissue depots and muscle might be potential origins of elevated progranulin. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Progranulin-Associated Primary Progressive Aphasia: A Distinct Phenotype?
Rohrer, Jonathan D.; Crutch, Sebastian J.; Warrington, Elizabeth K.; Warren, Jason D.
2010-01-01
The neuropsychological features of the primary progressive aphasia (PPA) syndromes continue to be defined. Here we describe a detailed neuropsychological case study of a patient with a mutation in the progranulin ("GRN") gene who presented with progressive word-finding difficulty. Key neuropsychological features in this case included gravely…
Tegeder, Irmgard
2016-12-01
Progranulin deficiency in humans is associated with neurodegeneration. Its mechanisms are not yet fully understood. We performed a Yeast-2-Hybrid screen using human full-length progranulin as bait to assess the interactions of progranulin. Progranulin was screened against human fetal brain and human bone marrow libraries using the standard Matchmaker technology (Clontech). This article contains the full Y2H data table, including blast results and sequences, a sorted table according to selection criteria for likely positive, putatively positive, likely false and false preys, and tables showing the gene ontology terms associated with the likely and putative preys of the brain and bone marrow libraries. The interactions with autophagy proteins were confirmed and functionally analyzed in "Progranulin overexpression in sensory neurons attenuates neuropathic pain in mice: Role of autophagy" (C. Altmann, S. Hardt, C. Fischer, J. Heidler, H.Y. Lim, A. Haussler, B. Albuquerque, B. Zimmer, C. Moser, C. Behrends, F. Koentgen, I. Wittig, M.H. Schmidt, A.M. Clement, T. Deller, I. Tegeder, 2016) [1].
Hardt, Stefanie; Heidler, Juliana; Albuquerque, Boris; Valek, Lucie; Altmann, Christine; Wilken-Schmitz, Annett; Schäfer, Michael K E; Wittig, Ilka; Tegeder, Irmgard
2017-11-01
Affective and cognitive processing of nociception contributes to the development of chronic pain and vice versa, pain may precipitate psychopathologic symptoms. We hypothesized a higher risk for the latter with immanent neurologic diseases and studied this potential interrelationship in progranulin-deficient mice, which are a model for frontotemporal dementia, a disease dominated by behavioral abnormalities in humans. Young naïve progranulin deficient mice behaved normal in tests of short-term memory, anxiety, depression and nociception, but after peripheral nerve injury, they showed attention-deficit and depression-like behavior, over-activity, loss of shelter-seeking, reduced impulse control and compulsive feeding behavior, which did not occur in equally injured controls. Hence, only the interaction of 'pain x progranulin deficiency' resulted in the complex phenotype at young age, but neither pain nor progranulin deficiency alone. A deep proteome analysis of the prefrontal cortex and olfactory bulb revealed progranulin-dependent alterations of proteins involved in synaptic transport, including neurotransmitter transporters of the solute carrier superfamily. In particular, progranulin deficiency was associated with a deficiency of nuclear and synaptic zinc transporters (ZnT9/Slc30a9; ZnT3/Slc30a3) with low plasma zinc. Dietary zinc supplementation partly normalized the attention deficit of progranulin-deficient mice, which was in part reminiscent of autism-like and compulsive behavior of synaptic zinc transporter Znt3-knockout mice. Hence, the molecular studies point to defective zinc transport possibly contributing to progranulin-deficiency-associated psychopathology. Translated to humans, our data suggest that neuropathic pain may precipitate cognitive and psychopathological symptoms of an inherent, still silent neurodegenerative disease. Copyright © 2017. Published by Elsevier B.V.
Clinicopathologic and prognostic implications of progranulin in breast carcinoma.
Li, Li-qin; Huang, Hui-lian; Ping, Jin-liang; Wang, Xiao-hong; Zhong, Jing; Dai, Li-cheng
2011-07-05
Progranulin is a newly discovered 88-kDa glycoprotein originally purified from the highly tumorigenic mouse teratoma-derived cell line PC. Its expression is closely correlated with the development and metastasis of several cancers. However, no immunohistochemical evidence currently exists to correlate progranulin expression with clinicopathologic features in breast carcinoma biopsies, and the role of progranulin as a new marker of metastatic risk and prognosis in breast cancer has not yet been studied. The aim of this study was to investigate the clinicopathologic and prognostic implications of progranulin expression in breast carcinoma and its correlation with tumor angiogenesis. Progranulin expression was determined immunohistochemically in 183 surgical specimens from patients with breast cancer and 20 tissue samples from breast fibroadenomas. The tumor angiogenesis-related biomarker, vascular endothelial growth factor was assayed and microvessel density was assessed by counting vascular endothelial cells in tumor tissues labeled with endoglin antibody. The relationship between progranulin expression and the clinicopathologic data were analyzed. Progranulin proteins were overexpressed in breast cancer. The level of progranulin expression was significantly correlated with tumor size (P = 0.004), lymph node metastasis (P progranulin expression was associated with higher tumor angiogenesis, reflected by increased vascular endothelial growth factor expression (P Progranulin may be a valuable marker for assessing the metastasis and prognosis of breast cancer, and could provide the basis for new combination regimens with antiangiogenic activity.
Schmid, A; Leszczak, S; Ober, I; Schäffler, A; Karrasch, T
2015-07-01
The postprandial regulation of progranulin by oral uptake of lipids and carbohydrates in healthy individuals has not yet been investigated. The regulation of progranulin in 2 large cohorts of healthy volunteers during oral lipid tolerance test (OLTT; n=100) and oral glucose tolerance test (OGTT; n=100) was analyzed. One hundred healthy volunteers underwent OLTT and OGTT in an outpatient setting. Venous blood was drawn at 0 hours (h) (fasting) and at 2, 4, and 6 h in OLTT or 1 and 2 h in OGTT. A novel OLTT solution completely free of carbohydrates and protein was applied. Subjects were characterized by anthropometric and laboratory parameters. Serum concentrations of progranulin were measured by enzyme-linked immunosorbent assay (ELISA). Circulating progranulin levels remained unchanged during OLTT and OGTT. Fasting progranulin levels ranged between 31.3±8.7 and 40.6±7.7 ng/ml and were not different in subgroups addressing BMI, gender, family history, smoking habits, and hormonal contraception. There was a reciprocal correlation of progranulin with HDL (negative) and LDL cholesterol levels (positive). In healthy adults, fasting and postprandial circulating progranulin levels are not different in BMI subgroups. Oral uptake of carbohydrates and lipids does not influence circulating progranulin levels in a short-term manner. A postprandial and short-term regulation of this adipokine is absent, at least in healthy subjects. There is a negative correlation of progranulin with HDL cholesterol, but a positive correlation with LDL cholesterol. This reciprocal association might be of physiological importance for an individual's atherosclerotic risk. © Georg Thieme Verlag KG Stuttgart · New York.
Zhang, Kun; Li, Yu-Jiao; Guo, Yanyan; Zheng, Kai-Yin; Yang, Qi; Yang, Le; Wang, Xin-Shang; Song, Qian; Chen, Tao; Zhuo, Min; Zhao, Ming-Gao
2017-12-01
Fragile X syndrome is an inheritable form of intellectual disability caused by loss of fragile X mental retardation protein (FMRP, encoded by the FMR1 gene). Absence of FMRP caused overexpression of progranulin (PGRN, encoded by GRN), a putative tumour necrosis factor receptor ligand. In the present study, we found that progranulin mRNA and protein were upregulated in the medial prefrontal cortex of Fmr1 knock-out mice. In Fmr1 knock-out mice, elevated progranulin caused insufficient dendritic spine pruning and late-phase long-term potentiation in the medial prefrontal cortex of Fmr1 knock-out mice. Partial progranulin knock-down restored spine morphology and reversed behavioural deficits, including impaired fear memory, hyperactivity, and motor inflexibility in Fmr1 knock-out mice. Progranulin increased levels of phosphorylated glutamate ionotropic receptor GluA1 and nuclear factor kappa B in cultured wild-type neurons. Tumour necrosis factor receptor 2 antibody perfusion blocked the effects of progranulin on GluA1 phosphorylation; this result indicates that tumour necrosis factor receptor 2 is required for progranulin-mediated GluA1 phosphorylation and late-phase long-term potentiation expression. However, high basal level of progranulin in Fmr1 knock-out mice prevented further facilitation of synaptic plasticity by exogenous progranulin. Partial downregulation of progranulin or tumour necrosis factor receptor 2/nuclear factor kappa B signalling restored synaptic plasticity and memory deficits in Fmr1 knock-out mice. These findings suggest that elevated PGRN is linked to cognitive deficits of fragile X syndrome, and the progranulin/tumour necrosis factor receptor 2 signalling pathway may be a putative therapeutic target for improving cognitive deficits in fragile X syndrome. © The Author (2017). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
The molecular basis for development of proinflammatory autoantibodies to progranulin.
Thurner, Lorenz; Fadle, Natalie; Regitz, Evi; Kemele, Maria; Klemm, Philipp; Zaks, Marina; Stöger, Elisabeth; Bette, Birgit; Carbon, Gabi; Zimmer, Vincent; Assmann, Gunter; Murawski, Niels; Kubuschok, Boris; Held, Gerhard; Preuss, Klaus-Dieter; Pfreundschuh, Michael
2015-07-01
Recently we identified in a wide spectrum of autoimmune diseases frequently occurring proinflammatory autoantibodies directed against progranulin, a direct inhibitor of TNFR1 & 2 and of DR3. In the present study we investigated the mechanisms for the breakdown of self-tolerance against progranulin. Isoelectric focusing identified a second, differentially electrically charged progranulin isoform exclusively present in progranulin-antibody-positive patients. Alkaline phosphatase treatment revealed this additional progranulin isoform to be hyperphosphorylated. Subsequently Ser81, which is located within the epitope region of progranulin-antibodies, was identified as hyperphosphorylated serine residue by site directed mutagenesis of candidate phosphorylation sites. Hyperphosphorylated progranulin was detected exclusively in progranulin-antibody-positive patients during the courses of their diseases. The occurrence of hyperphosphorylated progranulin preceded seroconversions of progranulin-antibodies, indicating adaptive immune response. Utilizing panels of kinase and phosphatase inhibitors, PKCβ1 was identified as the relevant kinase and PP1 as the relevant phosphatase for phosphorylation and dephosphorylation of Ser81. In contrast to normal progranulin, hyperphosphorylated progranulin interacted exclusively with inactivated (pThr320) PP1, suggesting inactivated PP1 to cause the detectable occurrence of phosphorylated Ser81 PGRN. Investigation of possible functional alterations of PGRN due to Ser81 phosphorylation revealed, that hyperphosphorylation prevents the interaction and thus direct inhibition of TNFR1, TNFR2 and DR3, representing an additional direct proinflammatory effect. Finally phosphorylation of Ser81 PGRN alters the conversion pattern of PGRN. In conclusion, inactivated PP1 induces hyperphosphorylation of progranulin in a wide spectrum of autoimmune diseases. This hyperphosphorylation prevents direct inhibition of TNFR1, TNFR2 and DR3 by PGRN, alters the
Directory of Open Access Journals (Sweden)
Irmgard Tegeder
2016-12-01
Full Text Available Progranulin deficiency in humans is associated with neurodegeneration. Its mechanisms are not yet fully understood. We performed a Yeast-2-Hybrid screen using human full-length progranulin as bait to assess the interactions of progranulin. Progranulin was screened against human fetal brain and human bone marrow libraries using the standard Matchmaker technology (Clontech. This article contains the full Y2H data table, including blast results and sequences, a sorted table according to selection criteria for likely positive, putatively positive, likely false and false preys, and tables showing the gene ontology terms associated with the likely and putative preys of the brain and bone marrow libraries. The interactions with autophagy proteins were confirmed and functionally analyzed in "Progranulin overexpression in sensory neurons attenuates neuropathic pain in mice: Role of autophagy" (C. Altmann, S. Hardt, C. Fischer, J. Heidler, H.Y. Lim, A. Haussler, B. Albuquerque, B. Zimmer, C. Moser, C. Behrends, F. Koentgen, I. Wittig, M.H. Schmidt, A.M. Clement, T. Deller, I. Tegeder, 2016 [1].
Restoring neuronal progranulin reverses deficits in a mouse model of frontotemporal dementia.
Arrant, Andrew E; Filiano, Anthony J; Unger, Daniel E; Young, Allen H; Roberson, Erik D
2017-05-01
Loss-of-function mutations in progranulin (GRN), a secreted glycoprotein expressed by neurons and microglia, are a common autosomal dominant cause of frontotemporal dementia, a neurodegenerative disease commonly characterized by disrupted social and emotional behaviour. GRN mutations are thought to cause frontotemporal dementia through progranulin haploinsufficiency, therefore, boosting progranulin expression from the intact allele is a rational treatment strategy. However, this approach has not been tested in an animal model of frontotemporal dementia and it is unclear if boosting progranulin could correct pre-existing deficits. Here, we show that adeno-associated virus-driven expression of progranulin in the medial prefrontal cortex reverses social dominance deficits in Grn+/- mice, an animal model of frontotemporal dementia due to GRN mutations. Adeno-associated virus-progranulin also corrected lysosomal abnormalities in Grn+/- mice. The adeno-associated virus-progranulin vector only transduced neurons, suggesting that restoring neuronal progranulin is sufficient to correct deficits in Grn+/- mice. To further test the role of neuronal progranulin in the development of frontotemporal dementia-related deficits, we generated two neuronal progranulin-deficient mouse lines using CaMKII-Cre and Nestin-Cre. Measuring progranulin levels in these lines indicated that most brain progranulin is derived from neurons. Both neuronal progranulin-deficient lines developed social dominance deficits similar to those in global Grn+/- mice, showing that neuronal progranulin deficiency is sufficient to disrupt social behaviour. These data support the concept of progranulin-boosting therapies for frontotemporal dementia and highlight an important role for neuron-derived progranulin in maintaining normal social function. © The Author (2017). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Progranulin as a biomarker and potential therapeutic agent.
Abella, Vanessa; Pino, Jesús; Scotece, Morena; Conde, Javier; Lago, Francisca; Gonzalez-Gay, Miguel Angel; Mera, Antonio; Gómez, Rodolfo; Mobasheri, Ali; Gualillo, Oreste
2017-10-01
Progranulin is a cysteine-rich secreted protein with diverse pleiotropic actions and participates in several processes, such as inflammation or tumorigenesis. Progranulin was first identified as a growth factor and, recently, it was characterised as an adipokine implicated in obesity, insulin resistance and rheumatic disease. At a central level, progranulin acts as a neurotropic and neuroprotective factor and protects from neural degeneration. In this review, we summarise the most recent research advances concerning the potential role of progranulin as a therapeutic target and biomarker in cancer, neurodegenerative and inflammatory diseases. Copyright © 2017 Elsevier Ltd. All rights reserved.
Progranulin expression in breast cancer with different intrinsic subtypes.
Li, Li Qin; Min, Li Shan; Jiang, Qun; Ping, Jin Liang; Li, Jing; Dai, Li Cheng
2012-04-15
Progranulin is a newly discovered 88-kDa glycoprotein originally purified from the highly tumorigenic mouse teratoma-derived cell line PC. We found that high progranulin expression was associated with higher breast carcinoma angiogenesis, reflected by increased vascular endothelial growth factor expression and higher microvessel density. However, no immunohistochemical evidence currently exists to correlate progranulin expression with clinicopathological features in different intrinsic subtypes of breast carcinoma biopsies. The aim of this study was to investigate the progranulin expression profiles in the intrinsic subtypes of breast carcinomas and their relevance to histopathological and clinicopathological features. Tissue blocks containing 264 cases of breast carcinomas from 2006 to 2009 were classified as different intrinsic subtypes. Tissues of four intrinsic subtypes were immunostained for progranulin, vascular endothelial growth factor and CD105. Their relevance to histopathological and clinicopathological features was also analyzed. Twenty tissue samples from breast fibroadenomas were included in this study. Progranulin expression showed no significant differences in different intrinsic subtypes, although an increasing tendency could be found in the triple-negative breast cancer (TNBC) subgroup (χ(2)=5.00, df=3, p=0.17). However, differences were significant when pathologically node metastasis-positive (pN(+)) TNBC were excluded (χ(2)=17.84, df=3, pprogranulin in pathologically node metastasis-negative (pN(-)) TNBC. It was noted that the EGFR expression level of the pN(-) TNBC subtype was significantly higher in cases with strong progranulin expression than in cases with weak progranulin expression (χ(2)=11.26, df=1, pprogranulin in pN(-) TNBC suggests that progranulin is a promising new target for pN(-) TNBC treatment. Strong expression of progranulin correlates with positive EGFR expression in the pN(-) TNBC subtype. The close relationship between
Microglial upregulation of progranulin as a marker of motor neuron degeneration.
Philips, T.; Muynck, L. De; Thu, H.N.; Weynants, B.; Vanacker, P.; Dhondt, J.; Sleegers, K.; Schelhaas, H.J.; Verbeek, M.M.; Vandenberghe, R.; Sciot, R.; Broeckhoven, C. van; Lambrechts, D.; Leuven, F. Van; Bosch, L.; Robberecht, W.; Damme, P. van
2010-01-01
Frontotemporal lobar degeneration (FTLD) and amyotrophic lateral sclerosis (ALS) are overlapping neurodegenerative disorders. Mutations in the growth factor progranulin (PGRN) gene cause FTLD, sometimes in conjunction with ALS; such mutations are also observed in some ALS patients. Most PGRN
Rubino, Elisa; Vacca, Alessandro; Gallone, Salvatore; Govone, Flora; Zucca, Milena; Gai, Annalisa; Ferrero, Patrizia; Fenoglio, Pierpaola; Giordana, Maria Teresa; Rainero, Innocenzo
2017-11-01
Bipolar disorder is a chronic psychiatric illness characterised by fluctuation in mood state, with a relapsing and remitting course. Frontotemporal dementia (FTD) is a clinically and genetically heterogeneous syndrome, with the most frequent phenotype being behavioural variant frontotemporal dementia (bvFTD). Here, we report the case of an Italian male presenting with late-onset bipolar disorder that developed into bvFTD over time, carrying a mutation in the GRN gene. Interestingly, the patient carried the c.1639 C > T variant in the GRN gene, resulting in a R547C substitution. Our case report further corroborates the notion that, in addition to FTD, progranulin may be involved in the neurobiology of bipolar disorder type 1, and suggests to screen patients with late-onset bipolar disorder for GRN mutations.
Progranulin Levels in Plasma and Cerebrospinal Fluid in Granulin Mutation Carriers
L.H.H. Meeter (Lieke H.H.); Patzke, H. (Holger); Loewen, G. (Gordon); E.G.P. Dopper (Elise); Y. Pijnenburg (Yolande); A.S. Thornton (Andrew); J.C. van Swieten (John)
2016-01-01
textabstractBackground: Pathogenic mutations in the granulin gene (GRN) are causative in 5-10% of patients with frontotemporal dementia (FTD), mostly leading to reduced progranulin protein (PGRN) levels. Upcoming therapeutic trials focus on enhancing PGRN levels. Methods: Fluctuations in plasma PGRN
Mechanisms of Progranulin Action and Regulation in Genitourinary Cancers.
Tanimoto, Ryuta; Lu, Kuojung G; Xu, Shi-Qiong; Buraschi, Simone; Belfiore, Antonino; Iozzo, Renato V; Morrione, Andrea
2016-01-01
The growth factor progranulin has emerged in recent years as a critical regulator of transformation in several cancer models, including breast cancer, glioblastomas, leukemias, and hepatocellular carcinomas. Several laboratories, including ours, have also demonstrated an important role of progranulin in several genitourinary cancers, including ovarian, endometrial, cervical, prostate, and bladder tumors, where progranulin acts as an autocrine growth factor thereby modulating motility and invasion of transformed cells. In this review, we will focus on the mechanisms of action and regulation of progranulin signaling in genitourinary cancers with a special emphasis on prostate and bladder tumors.
Progranulin concentration in relation to bone mineral density among obese individuals.
Milajerdi, Alireza; Maghbooli, Zhila; Mohammadi, Farzad; Hosseini, Banafsheh; Mirzaei, Khadijeh
2018-01-01
Adipose tissue, particularly visceral adipose tissue, secretes a variety of cytokines, among which progranulin is a glycoprotein related to the immune system. Along with other secreted proteins, progranulin may be associated with bone mineral density. The aim of this study was to find out whether there are associations between the progranulin and bone mineral density among obese people. This cross-sectional study was conducted on 244 obese participants (aged 22-52). Serum progranulin, high sensitive C-reactive protein, oxidised-low dencity lipoprotein, tumor necrosis factor-α, parathormone, vitamin D, and interleukins of 1 β, 4, 6, 10, 13, and 17 concentrations were measured. Anthropometric measurements, body composition and bone mineral density were also assessed. Serum progranulin was directly associated with interleukin-6 and interleukin-1β, while it had a negative association with interleukin-17 and tumor necrosis factor-α. We also observed a statistically significant direct association between progranulin concentration and visceral fat, abdominal fat, waist, abdominal and hip circumferences, hip T-score, and Z-score and T-score for the lumbar region. A partial correlation test has also shown a significant positive correlation regarding serum progranulin and the hip Z-score. Moreover, progranulin level is inversely associated with ospteopenia (P = 0.04 and CI: 0.17,0.96). Our study revealed that central obesity may be related to increased progranulin concentration. In addition, progranulin concentration was directly related to bone formation parameters, which indicates the protective effects of progranulin on bone density. Further studies are needed to clarify the exact mechanisms underlying these associations.
Minami, S Sakura; Shen, Vivian; Le, David; Krabbe, Grietje; Asgarov, Rustam; Perez-Celajes, Liberty; Lee, Chih-Hung; Li, Jinhe; Donnelly-Roberts, Diana; Gan, Li
2015-10-15
Mutations in the progranulin gene cause frontotemporal dementia (FTD), a debilitating neurodegenerative disease that involves atrophy of the frontal and temporal lobes and affects personality, behavior, and language. Progranulin-deficient mouse models of FTD exhibit deficits in compulsive and social behaviors reminiscent of patients with FTD, and develop excessive microgliosis and increased release of inflammatory cytokines. Activation of nicotinic acetylcholine receptors (nAChRs) by nicotine or specific α7 nAChR agonists reduces neuroinflammation. Here, we investigated whether activation of nAChRs by nicotine or α7 agonists improved the excessive inflammatory and behavioral phenotypes of a progranulin-deficient FTD mouse model. We found that treatment with selective α7 agonists, PHA-568487 or ABT-107, strongly suppressed the activation of NF-κB in progranulin-deficient cells. Treatment with ABT-107 also reduced microgliosis, decreased TNFα levels, and reduced compulsive behavior in progranulin-deficient mice. Collectively, these data suggest that targeting activation of the α7 nAChR pathway may be beneficial in decreasing neuroinflammation and reversing some of the behavioral deficits observed in progranulin-deficient FTD. Copyright © 2015. Published by Elsevier Inc.
Progranulin serum levels in human kidney transplant recipients: A longitudinal study.
Nicoletto, Bruna Bellincanta; Pedrollo, Elis Forcellini; Carpes, Larissa Salomoni; Coloretti, Natália Gomes; Krolikowski, Thaiana Cirino; Souza, Gabriela Corrêa; Gonçalves, Luiz Felipe Santos; Manfro, Roberto Ceratti; Canani, Luis Henrique
2018-01-01
The adipokine progranulin has metabolic proprieties, playing a role in obesity and insulin resistance. Its levels seems to be dependent of renal function, since higher progranulin concentration is observed in patients with end-stage kidney disease. However, the effect of kidney transplantation on progranulin remains unknown. To assess the serum progranulin levels in kidney transplant recipients before and after kidney transplantation. Forty-six prospective kidney transplant recipients were included in this longitudinal study. They were evaluated before transplantation and at three and twelve months after transplantation. Clinical, anthropometric and laboratorial measurements were assessed. Progranulin was determined with enzyme-linked immunosorbent assays. Serum progranulin significantly decreased in the early period after transplantation (from 72.78 ± 2.86 ng/mL before transplantation to 40.65 ± 1.49 ng/mL at three months; pProgranulin was associated with waist circumference and fasting plasma glucose after adjusted for age, gender, study period, glomerular filtration rate, interleukin-6, high sensitivity C reactive protein and adiponectin. Progranulin serum levels are increased before transplantation and a reduction is observed in the early period after transplantation, possibly attributed to an improvement in renal function. At one year after transplantation, an increment in progranulin is observed, seems to be independent of glomerular filtration, and remained significantly lower than before transplantation.
Mechanisms of Progranulin Action and Regulation in Genitourinary Cancers
Directory of Open Access Journals (Sweden)
Ryuta Tanimoto
2016-07-01
Full Text Available The growth factor progranulin has emerged in recent years as a critical regulator of transformation in several cancer models, including breast cancer, glioblastomas, leukemias and hepatocellular carcinomas. Several laboratories, including ours, have also demonstrated an important role of progranulin in several genitourinary cancers, including ovarian, endometrial, cervical, prostate and bladder tumors, where progranulin acts as an autocrine growth factor thereby modulating motility and invasion of transformed cells.In this review we will focus on the mechanisms of action and regulation of progranulin signaling in genitourinary cancers with a special emphasis on prostate and bladder tumors.
D. Galimberti (Daniela); Fumagalli, G.G. (Giorgio G.); C. Fenoglio (Chiara); Cioffi, S.M.G. (Sara M.G.); A. Arighi (Andrea); M. Serpente (Maria); B. Borroni (Barbara); A. Padovani (Alessandro); F. Tagliavini (Fabrizio); M. Masellis (Mario); M.C. Tartaglia (Maria Carmela); J.C. van Swieten (John); L.H.H. Meeter (Lieke H.H.); C. Graff (Caroline); A. De Mendonça (Alexandre); M. Bocchetta (Martina); J.D. Rohrer (Jonathan Daniel); Scarpini, E. (Elio)
2017-01-01
textabstractWe investigated whether progranulin plasma levels are predictors of the presence of progranulin gene (GRN) null mutations or of the development of symptoms in asymptomatic at risk members participating in the Genetic Frontotemporal Dementia Initiative, including 19 patients, 64
Serum Levels of Progranulin Do Not Reflect Cerebrospinal Fluid Levels in Neurodegenerative Disease.
Wilke, Carlo; Gillardon, Frank; Deuschle, Christian; Dubois, Evelyn; Hobert, Markus A; Müller vom Hagen, Jennifer; Krüger, Stefanie; Biskup, Saskia; Blauwendraat, Cornelis; Hruscha, Michael; Kaeser, Stephan A; Heutink, Peter; Maetzler, Walter; Synofzik, Matthis
2016-01-01
Altered progranulin levels play a major role in neurodegenerative diseases, like Alzheimer's dementia (AD), frontotemporal dementia (FTD) and amyotrophic lateral sclerosis (ALS), even in the absence of GRN mutations. Increasing progranulin levels could hereby provide a novel treatment strategy. However, knowledge on progranulin regulation in neurodegenerative diseases remains limited. We here demonstrate that cerebrospinal fluid progranulin levels do not correlate with its serum levels in AD, FTD and ALS, indicating a differential regulation of its central and peripheral levels in neurodegeneration. Blood progranulin levels thus do not reliably predict central nervous progranulin levels and their response to future progranulin-increasing therapeutics.
Serum progranulin levels in relation to insulin resistance in childhood obesity.
Alissa, Eman M; Sutaih, Rima H; Kamfar, Hayat Z; Alagha, Abdulmoeen E; Marzouki, Zuhair M
2017-11-27
Progranulin is an adipokine that is involved in the inflammatory response, glucose metabolism, insulin resistance, and may therefore be involved in chronic subclinical inflammation associated with the pathogenesis of childhood obesity. We aimed to investigate the association of circulating progranulin levels with metabolic parameters in children and to assess the importance of progranulin as a biomarker for metabolic diseases. A total of 150 children were consecutively recruited from the Pediatric Nutrition Clinics at King Abdulaziz University Hospital in Jeddah, Saudi Arabia. Children were classified into four groups based on quartile for serum progranulin. Anthropometric variables were measured in all study subjects. Fasting blood samples were collected for measurement of blood glucose, insulin and lipid profile. Children within the upper quartile for serum progranulin concentration were heavier, more insulin resistant and had higher concentrations of serum total cholesterol, triglycerides, insulin and high sensitivity C reactive protein compared to those in the lower quartile. On correlation analysis, serum progranulin concentrations were significantly related to general and central adiposity, metabolic parameters, markers of inflammation and insulin resistance. Stepwise multiple regression showed that 26.6% of the variability in serum progranulin could be explained by measures of adiposity. The increased serum progranulin concentrations were closely related to measures of adiposity, metabolic parameters, inflammatory marker and insulin resistance indices, suggesting that progranulin may be an excellent biomarker for obesity in childhood.
Serum and Urinary Progranulin in Diabetic Kidney Disease.
Nicoletto, Bruna Bellincanta; Krolikowski, Thaiana Cirino; Crispim, Daisy; Canani, Luis Henrique
2016-01-01
Progranulin has been recognized as an adipokine related to obesity, insulin resistance and type 2 diabetes mellitus (T2DM). There are scarce data regarding progranulin and kidney disease, but there are some data linking diabetic kidney disease (DKD) and increased progranulin levels. We aimed to better describe the relationship between serum and urinary progranulin levels and DKD in T2DM. This is a case-control study including four groups of subjects: 1) Advanced DKD cases: T2DM patients with estimated glomerular filtration rate (eGFR) Progranulin was determined by enzyme-linked immunosorbent assay. One hundred and fourteen patients were included (23 advanced DKD cases, 25 albuminuric DKD cases, 40 diabetic controls and 26 non-diabetic controls). Serum progranulin was increased in advanced DKD compared to other groups [70.84 (59.04-83.16) vs. albuminuric cases 57.16 (42.24-67.38), diabetic controls 57.28 (42.08-70.47) and non-diabetic controls 44.54 (41.44-53.32) ng/mL; pprogranulin was decreased in advanced DKD cases compared to albuminuric cases [10.62 (6.30-16.08) vs. 20.94 (12.35-30.22); diabetic controls 14.06 (9.88-20.82) and non-diabetic controls 13.51 (7.94-24.36) ng/mL; p = 0.017]. There was a positive correlation between serum progranulin and body mass index (r = 0.27; p = 0.004), waist circumference (r = 0.25; p = 0.007); body fat percentage (r = 0.20; p = 0.042), high-sensitive C reactive protein (r = 0.35; pprogranulin was positively associated with albuminuria (r = 0.25; p = 0.010). In conclusion, progranulin is affected by a decrease in eGFR, being at a higher concentration in serum and lower in urine of DKD patients with T2DM and eGFR <60 mL/min/1.73m2. It is also associated with markers of obesity and inflammation.
Buraschi, Simone; Xu, Shi-Qiong; Stefanello, Manuela; Moskalev, Igor; Morcavallo, Alaide; Genua, Marco; Tanimoto, Ryuta; Birbe, Ruth; Peiper, Stephen C; Gomella, Leonard G; Belfiore, Antonino; Black, Peter C; Iozzo, Renato V; Morrione, Andrea
2016-06-28
We have recently demonstrated a critical role for progranulin in bladder cancer. Progranulin contributes, as an autocrine growth factor, to the transformed phenotype by modulating Akt-and MAPK-driven motility, invasion and anchorage-independent growth. Progranulin also induces F-actin remodeling by interacting with the F-actin binding protein drebrin. In addition, progranulin is overexpressed in invasive bladder cancer compared to normal tissue controls, suggesting that progranulin might play a key role in driving the transition to the invasive phenotype of urothelial cancer. However, it is not established whether targeting progranulin could have therapeutic effects on bladder cancer. In this study, we stably depleted urothelial cancer cells of endogenous progranulin by shRNA approaches and determined that progranulin depletion severely inhibited the ability of tumorigenic urothelial cancer cells to migrate, invade and grow in anchorage-independency. We further demonstrate that progranulin expression is critical for tumor growth in vivo, in both xenograft and orthotopic tumor models. Notably, progranulin levels correlated with response to cisplatin treatment and were upregulated in bladder tumors. Our data indicate that progranulin may constitute a novel target for therapeutic intervention in bladder tumors. In addition, progranulin may serve as a novel biomarker for bladder cancer.
A novel role for drebrin in regulating progranulin bioactivity in bladder cancer.
Xu, Shi-Qiong; Buraschi, Simone; Morcavallo, Alaide; Genua, Marco; Shirao, Tomoaki; Peiper, Stephen C; Gomella, Leonard G; Birbe, Ruth; Belfiore, Antonino; Iozzo, Renato V; Morrione, Andrea
2015-05-10
We recently established a critical role for the growth factor progranulin in bladder cancer insofar as progranulin promotes urothelial cancer cell motility and contributes, as an autocrine growth factor, to the transformed phenotype by modulating invasion and anchorage-independent growth. In addition, progranulin expression is upregulated in invasive bladder cancer tissues compared to normal controls. However, the molecular mechanisms of progranulin action in bladder cancer have not been fully elucidated. In this study, we searched for novel progranulin-interacting proteins using pull-down assays with recombinant progranulin and proteomics. We discovered that drebrin, an F-actin binding protein, bound progranulin in urothelial cancer cells. We characterized drebrin function in urothelial cancer cell lines and showed that drebrin is critical for progranulin-dependent activation of the Akt and MAPK pathways and modulates motility, invasion and anchorage-independent growth. In addition, drebrin regulates tumor formation in vivo and its expression is upregulated in bladder cancer tissues compared to normal tissue controls. Our data are translationally relevant as indicate that drebrin exerts an essential functional role in the regulation of progranulin action and may constitute a novel target for therapeutic intervention in bladder tumors. In addition, drebrin may serve as novel biomarker for bladder cancer.
Frampton, Gabriel; Invernizzi, Pietro; Bernuzzi, Francesca; Pae, Hae Yong; Quinn, Matthew; Horvat, Darijana; Galindo, Cheryl; Huang, Li; McMillin, Matthew; Cooper, Brandon; Rimassa, Lorenza; DeMorrow, Sharon
2012-02-01
Cholangiocarcinoma is a devastating cancer of biliary origin with limited treatment options. The growth factor, progranulin, is overexpressed in a number of tumours. The study aims were to assess the expression of progranulin in cholangiocarcinoma and to determine its effects on tumour growth. The expression and secretion of progranulin were evaluated in multiple cholangiocarcinoma cell lines and in clinical samples from patients with cholangiocarcinoma. The role of interleukin 6 (IL-6)-mediated signalling in the expression of progranulin was assessed using a combination of specific inhibitors and shRNA knockdown techniques. The effect of progranulin on proliferation and Akt activation and subsequent effects of FOXO1 phosphorylation were assessed in vitro. Progranulin knockdown cell lines were established, and the effects on cholangiocarcinoma growth were determined. Progranulin expression and secretion were upregulated in cholangiocarcinoma cell lines and tissue, which were in part via IL-6-mediated activation of the ERK1/2/RSK1/C/EBPβ pathway. Blocking any of these signalling molecules, by either pharmacological inhibitors or shRNA, prevented the IL-6-dependent activation of progranulin expression. Treatment of cholangiocarcinoma cells with recombinant progranulin increased cell proliferation in vitro by a mechanism involving Akt phosphorylation leading to phosphorylation and nuclear extrusion of FOXO1. Knockdown of progranulin expression in cholangiocarcinoma cells decreased the expression of proliferating cellular nuclear antigen, a marker of proliferative capacity, and slowed tumour growth in vivo. Evidence is presented for a role for progranulin as a novel growth factor regulating cholangiocarcinoma growth. Specific targeting of progranulin may represent an alternative for the development of therapeutic strategies.
Progranulin increases phagocytosis by retinal pigment epithelial cells in culture.
Murase, Hiromi; Tsuruma, Kazuhiro; Kuse, Yoshiki; Shimazawa, Masamitsu; Hara, Hideaki
2017-12-01
Retinal pigment epithelium (RPE) cells take part in retinal preservation, such as phagocytizing the shed photoreceptor outer segments (POS), every day. The incomplete phagocytic function accelerates RPE degeneration and formation of the toxic by-product lipofuscin. Excessive lipofuscin accumulation is characteristic of various blinding diseases in the human eye. Progranulin is a cysteine-rich protein that has multiple biological activities, and it has a high presence in the retina. Progranulin has been recognized to be involved in macrophage phagocytosis in the brain. The purpose of this study is to determine whether progranulin influences phagocytosis by RPE cells. All experiments were performed on primary human RPE (hRPE) cells in culture. pHrodo was used to label the isolated porcine POS, and quantification of pHrodo fluorescence was used to determine the degree of phagocytosis. Western blotting and immunohistochemistry of key proteins involved in phagocytosis were used to clarify the mechanism of progranulin. Progranulin increased RPE phagocytosis in hydrogen peroxide-treated and nontreated RPE cells. The phosphorylated form of Mer tyrosine kinase, which is important for POS internalization, was significantly increased in the progranulin-exposed cells. This increase was attenuated by SU11274, an inhibitor of hepatic growth factor receptor. Under the oxidative stress condition, exposure to progranulin led to an approximately twofold increase in integrin alpha-v, which is associated with the first step in recognition of POS by RPE cells. These results suggest that progranulin could be an effective stimulator for RPE phagocytosis and could repair RPE function. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Korolczuk, Agnieszka; Bełtowski, Jerzy
2017-01-01
Progranulin is a multifunctional regulatory protein with growth-promoting, neuroprotective and antiinflammatory activities. Recent studies indicate that progranulin is one of the adipose tissue hormones (adipokines). Progranulin expression in visceral adipose tissue and circulating progranulin concentration are increased in obesity and hyperprogranulinemia is involved in the pathogenesis of obesity-associated insulin resistance. Progranulin impairs insulin signaling and reduces insulin-induced glucose uptake both in vitro and in vivo whereas progranulin deficiency protects from high fat diet-induced insulin resistance. Several studies, including some prospective ones, have demonstrated the association between high progranulin and type 2 diabetes and its complications such as nephro- and retinopathy as well as non-alcoholic fatty liver disease. It is quite well established that progranulin contributes to insulin resistance and resulting deterioration of carbohydrate metabolism. In addition, progranulin may be associated with the development of diabetic microangiopathy, fatty liver disease and possibly with the increased risk of cancer in subjects with the metabolic syndrome. On the other hand, progranulin augments vasorelaxation, inhibits inflammatory reaction, is neuroprotective and reduces ischemiareperfusion injury. Progranulin has both detrimental and beneficial effects. More clinical studies including prospective ones are needed to clarify the role of progranulin in obesity-associated pathologies such as diabetes, hyperlipidemia, hypertension and atherosclerosis. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Serum Progranulin Levels in Type 2 Diabetic Patients with Metabolic Syndrome.
Shafaei, Azam; Marjani, Abdoljalal; Khoshnia, Masoud
2016-12-01
The role of progranulin in individuals with metabolic syndrome is not exactly clear.We aimed to assess the serum level of progranulin in type 2 diabetic patients with and without metabolic syndrome and compare them with healthy controls. The study included 60 patients with type 2 diabetes and 30 healthy individuals as control groups. Biochemical parameters and progranulin levels were determined. Subjects with metabolic syndrome showed significantly higher levels of triglyceride, waist circumference, BMI, systolic and diastolic blood pressure than subjects without metabolic syndrome and the control groups, while HDL-cholesterol level was significantly lower in subjects with metabolic syndrome. Fasting blood sugar was significantly higher in type 2 diabetic patients than in the control groups. Serum level of progranulin was slightly increased in subjects with metabolic syndrome. Serum progranulin level had no significant relationship with metabolic syndrome components. Serum progranulin was also not dependent on cardiometabolic risk factors for subjects with metabolic syndrome, but it could be considered for the management of type 2 diabetes mellitus. Further studies are recommended to explain the effect of progranulin on the pathogenesis of metabolic risk factors.
Progranulin Plays a Central Role in Host Defense during Sepsis by Promoting Macrophage Recruitment.
Song, Zhixin; Zhang, Xuemei; Zhang, Liping; Xu, Fang; Tao, Xintong; Zhang, Hua; Lin, Xue; Kang, Lihua; Xiang, Yu; Lai, Xaiofei; Zhang, Qun; Huang, Kun; Dai, Yubing; Yin, Yibing; Cao, Ju
2016-11-15
Progranulin, a widely expressed protein, has multiple physiological functions. The functional role of progranulin in the host response to sepsis remains unknown. To assess the role of progranulin in the host response to sepsis. Effects of progranulin on host response to sepsis were determined. Progranulin concentrations were significantly elevated in adult (n = 74) and pediatric (n = 26) patients with sepsis relative to corresponding healthy adult (n = 36) and pediatric (n = 17) control subjects, respectively. By using a low-lethality model of nonsevere sepsis, we observed that progranulin deficiency not only increased mortality but also decreased bacterial clearance during sepsis. The decreased host defense to sepsis in progranulin-deficient mice was associated with reduced macrophage recruitment, with correspondingly impaired chemokine CC receptor ligand 2 (CCL2) production in peritoneal lavages during the early phase of sepsis. Progranulin derived from hematopoietic cells contributed to host defense in sepsis. Therapeutic administration of recombinant progranulin not only rescued impaired host defense in progranulin-deficient mice after nonsevere sepsis but also protected wild-type mice against a high-lethality model of severe sepsis. Progranulin-mediated protection against sepsis was closely linked to improved peritoneal macrophage recruitment. In addition, CCL2 treatment of progranulin-deficient mice improved survival and decreased peritoneal bacterial loads during sepsis, at least in part through promotion of peritoneal macrophage recruitment. This proof-of-concept study supports a central role of progranulin-dependent macrophage recruitment in host defense to sepsis, opening new opportunities to host-directed therapeutic strategy that manipulate host immune response in the treatment of sepsis.
Progranulin serum levels in human kidney transplant recipients: A longitudinal study.
Directory of Open Access Journals (Sweden)
Bruna Bellincanta Nicoletto
Full Text Available The adipokine progranulin has metabolic proprieties, playing a role in obesity and insulin resistance. Its levels seems to be dependent of renal function, since higher progranulin concentration is observed in patients with end-stage kidney disease. However, the effect of kidney transplantation on progranulin remains unknown.To assess the serum progranulin levels in kidney transplant recipients before and after kidney transplantation.Forty-six prospective kidney transplant recipients were included in this longitudinal study. They were evaluated before transplantation and at three and twelve months after transplantation. Clinical, anthropometric and laboratorial measurements were assessed. Progranulin was determined with enzyme-linked immunosorbent assays.Serum progranulin significantly decreased in the early period after transplantation (from 72.78 ± 2.86 ng/mL before transplantation to 40.65 ± 1.49 ng/mL at three months; p<0.01 and increased at one year (53.15 ± 2.55 ng/mL; p<0.01 vs. three months, remaining significantly lower than before transplantation (p<0.01 (pover time<0.01. At one year after transplantation, there was a significant increase in body mass index, trunk fat and waist circumference compared to immediate period after transplantation. Progranulin was associated with waist circumference and fasting plasma glucose after adjusted for age, gender, study period, glomerular filtration rate, interleukin-6, high sensitivity C reactive protein and adiponectin.Progranulin serum levels are increased before transplantation and a reduction is observed in the early period after transplantation, possibly attributed to an improvement in renal function. At one year after transplantation, an increment in progranulin is observed, seems to be independent of glomerular filtration, and remained significantly lower than before transplantation.
Serum progranulin as an indicator of neutrophilic airway inflammation and asthma severity.
Park, So Young; Hong, Gyong Hwa; Park, Sunjoo; Shin, Bomi; Yoon, Sun-Young; Kwon, Hyouk-Soo; Kim, Tae-Bum; Moon, Hee-Bom; Cho, You Sook
2016-12-01
Progranulin, a protein secreted from the airway epithelium, is known to attenuate the downstream cascade of neutrophilic inflammation in particular. We hypothesized that progranulin may have a role in inflammatory regulation in asthma. To investigate the association between serum progranulin levels and various clinical features in patients with asthma. Serum samples and clinical data of 475 patients with asthma and 35 healthy controls at a tertiary referral hospital and its affiliated health promotion center were collected. Serum progranulin levels were compared between patients with asthma and healthy controls and then were compared within the patients with asthma in terms of pulmonary function and measures of inflammatory status. Univariate and multivariate analyses were performed to identify factors associated with severity of asthma. Serum progranulin levels were significantly lower in the asthma group than in healthy group and were positively correlated with prebronchodilator forced expiratory volume in 1 second predicted within patients with asthma. We found a negative correlation between serum progranulin levels and blood neutrophil counts. Multivariate analysis revealed that higher serum progranulin levels were associated with a lower risk of severe asthma (odds ratio, 0.888; 95% confidence interval, 0.846-0.932; P progranulin remains unknown, we suggest that serum progranulin may be an indicator of severe asthma with airflow limitation. Future studies with comprehensive airway sampling strategies are warranted to clarify its role, particularly in neutrophilic asthma. Copyright © 2016 American College of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.
Progranulin contributes to endogenous mechanisms of pain defense after nerve injury in mice.
Lim, Hee-Young; Albuquerque, Boris; Häussler, Annett; Myrczek, Thekla; Ding, Aihao; Tegeder, Irmgard
2012-04-01
Progranulin haploinsufficiency is associated with frontotemporal dementia in humans. Deficiency of progranulin led to exaggerated inflammation and premature aging in mice. The role of progranulin in adaptations to nerve injury and neuropathic pain are still unknown. Here we found that progranulin is up-regulated after injury of the sciatic nerve in the mouse ipsilateral dorsal root ganglia and spinal cord, most prominently in the microglia surrounding injured motor neurons. Progranulin knockdown by continuous intrathecal spinal delivery of small interfering RNA after sciatic nerve injury intensified neuropathic pain-like behaviour and delayed the recovery of motor functions. Compared to wild-type mice, progranulin-deficient mice developed more intense nociceptive hypersensitivity after nerve injury. The differences escalated with aging. Knockdown of progranulin reduced the survival of dissociated primary neurons and neurite outgrowth, whereas addition of recombinant progranulin rescued primary dorsal root ganglia neurons from cell death induced by nerve growth factor withdrawal. Thus, up-regulation of progranulin after neuronal injury may reduce neuropathic pain and help motor function recovery, at least in part, by promoting survival of injured neurons and supporting regrowth. A deficiency in this mechanism may increase the risk for injury-associated chronic pain. © 2011 The Authors Journal of Cellular and Molecular Medicine © 2011 Foundation for Cellular and Molecular Medicine/Blackwell Publishing Ltd.
Buraschi, Simone; Xu, Shi-Qiong; Stefanello, Manuela; Moskalev, Igor; Morcavallo, Alaide; Genua, Marco; Tanimoto, Ryuta; Birbe, Ruth; Peiper, Stephen C.; Gomella, Leonard G.; Belfiore, Antonino; Black, Peter C.; Iozzo, Renato V.; Morrione, Andrea
2016-01-01
We have recently demonstrated a critical role for progranulin in bladder cancer. Progranulin contributes, as an autocrine growth factor, to the transformed phenotype by modulating Akt-and MAPK-driven motility, invasion and anchorage-independent growth. Progranulin also induces F-actin remodeling by interacting with the F-actin binding protein drebrin. In addition, progranulin is overexpressed in invasive bladder cancer compared to normal tissue controls, suggesting that progranulin might play...
Serum Levels of the Adipokine Progranulin Depend on Renal Function
Richter, Judit; Focke, Denise; Ebert, Thomas; Kovacs, Peter; Bachmann, Anette; Lössner, Ulrike; Kralisch, Susan; Kratzsch, Jürgen; Beige, Joachim; Anders, Matthias; Bast, Ingolf; Blüher, Matthias; Stumvoll, Michael; Fasshauer, Mathias
2013-01-01
OBJECTIVE Progranulin has recently been introduced as a novel adipokine inducing insulin resistance and obesity. In the current study, we investigated renal elimination, as well as association of the adipokine with markers of the metabolic syndrome. RESEARCH DESIGN AND METHODS Progranulin serum levels were quantified by enzyme-linked immunosorbent assay and correlated to anthropometric and biochemical parameters of renal function and glucose and lipid metabolism, as well as inflammation, in 532 patients with stages 1–5 of chronic kidney disease (CKD). RESULTS Median serum progranulin levels adjusted for age, sex, and BMI were significantly different between CKD stages with highest values detectable in stage 5 (stage 1, 58.3 µg/L; stage 2, 63.0 µg/L; stage 3, 65.4 µg/L; stage 4, 68.8 µg/L; and stage 5, 90.6 µg/L). Furthermore, CKD stage was the strongest independent predictor of circulating progranulin in our cohort. In addition, high-sensitivity interleukin-6 and adiponectin remained significantly and independently correlated with the adipokine. CONCLUSIONS We demonstrate that progranulin serum levels increase with deteriorating renal function. These findings are in accordance with the hypothesis that renal clearance is a major elimination route for circulating progranulin. Furthermore, the adipokine is positively and independently associated with markers of inflammation and adiponectin. PMID:23033238
Progranulin inhibits platelet aggregation and prolongs bleeding time in rats.
Al-Yahya, A M; Al-Masri, A A; El Eter, E A; Hersi, A; Lateef, R; Mawlana, O
2018-05-01
Several adipokines secreted by adipose tissue have an anti-thrombotic and anti-atherosclerotic function. Recently identified adipokine progranulin was found to play a protective role in atherosclerosis. Bearing in mind the central role of platelets in inflammation and atherosclerosis, we aimed, in this study, to examine the effect of progranulin on platelet function and coagulation profile in rats. Healthy male albino Wistar rats weighing (250-300 g) were divided into 4 groups. Three groups were given increasing doses of progranulin (0.001 µg, 0.01 µg, and 0.1 µg) intraperitoneally, while the control group received phosphate-buffered saline (PBS). Bleeding time, prothrombin time, activated partial thromboplastin time and platelet aggregation responses to adenosine diphosphate and arachidonic acid were assessed. Administration of progranulin resulted in a significant inhibition of platelet aggregation in response to both adenosine diphosphate, and arachidonic acid. Bleeding time, prothrombin time and activated partial thromboplastin time were significantly prolonged in all groups that received progranulin, in particular, the 0.1 µg dose, in comparison to the control group. This preliminary data is first suggesting that the antiplatelet and anticoagulant action of progranulin could have a physiological protective function against thrombotic disorders associated with obesity and atherosclerosis. However, these results merit further exploration.
Progranulin gene delivery protects dopaminergic neurons in a mouse model of Parkinson's disease.
Directory of Open Access Journals (Sweden)
Jackalina M Van Kampen
Full Text Available Parkinson's disease (PD is a progressive neurodegenerative disorder characterized by tremor, rigidity and akinesia/bradykinesia resulting from the progressive loss of nigrostriatal dopaminergic neurons. To date, only symptomatic treatment is available for PD patients, with no effective means of slowing or stopping the progression of the disease. Progranulin (PGRN is a 593 amino acid multifunction protein that is widely distributed throughout the CNS, localized primarily in neurons and microglia. PGRN has been demonstrated to be a potent regulator of neuroinflammation and also acts as an autocrine neurotrophic factor, important for long-term neuronal survival. Thus, enhancing PGRN expression may strengthen the cells resistance to disease. In the present study, we have used the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP model of PD to investigate the possible use of PGRN gene delivery as a therapy for the prevention or treatment of PD. Viral vector delivery of the PGRN gene was an effective means of elevating PGRN expression in nigrostriatal neurons. When PGRN expression was elevated in the SNC, nigrostriatal neurons were protected from MPTP toxicity in mice, along with a preservation of striatal dopamine content and turnover. Further, protection of nigrostriatal neurons by PGRN gene therapy was accompanied by reductions in markers of MPTP-induced inflammation and apoptosis as well as a complete preservation of locomotor function. We conclude that PGRN gene therapy may have beneficial effects in the treatment of PD.
Progranulin deficiency causes the retinal ganglion cell loss during development.
Kuse, Yoshiki; Tsuruma, Kazuhiro; Mizoguchi, Takahiro; Shimazawa, Masamitsu; Hara, Hideaki
2017-05-10
Astrocytes are glial cells that support and protect neurons in the central nervous systems including the retina. Retinal ganglion cells (RGCs) are in contact with the astrocytes and our earlier findings showed the reduction of the number of cells in the ganglion cell layer in adult progranulin deficient mice. In the present study, we focused on the time of activation of the astrocytes and the alterations in the number of RGCs in the retina and optic nerve in progranulin deficient mice. Our findings showed that the number of Brn3a-positive cells was reduced and the expression of glial fibrillary acidic protein (GFAP) was increased in progranulin deficient mice. The progranulin deficient mice had a high expression of GFAP on postnatal day 9 (P9) but not on postnatal day 1. These mice also had a decrease in the number of the Brn3a-positive cells on P9. Taken together, these findings indicate that the absence of progranulin can affect the survival of RGCs subsequent the activation of astrocytes during retinal development.
Molgaard, Simon; Demontis, Ditte; Nicholson, Alexandra M; Finch, Nicole A; Petersen, Ronald C; Petersen, Claus M; Rademakers, Rosa; Nykjaer, Anders; Glerup, Simon
2016-11-01
Mutations in progranulin are a major cause of frontotemporal lobe degeneration (FTLD). Hence, plasma progranulin is an attractive biomarker in FTLD but poorly reflects levels in cerebrospinal fluid (CSF), suggesting tissue-specific regulation of progranulin levels. Sortilin was recently identified as a progranulin scavenger receptor that destines it for lysosomal degradation. Proteolysis or alternative splicing generates soluble sortilin variants that retain progranulin binding and potentially functions as a decoy receptor. In the present study, we analyzed soluble sortilin and progranulin in plasma and CSF in 341 aging individuals. We found that soluble sortilin exists in CSF in ten-fold molar excess compared to progranulin and observed a highly significant positive correlation between soluble sortilin and progranulin levels in CSF but not in plasma. However, carriers of the minor allele of SNP rs646776 in SORT1 encoding sortilin displayed significantly increased soluble sortilin and reduced progranulin specifically in plasma but not in CSF. Taken together, our findings suggest that soluble sortilin may affect progranulin levels in both a tissue-specific and genotype-dependent manner. Copyright © 2016 Elsevier Inc. All rights reserved.
Li, Bo; He, Yue; Xu, Liang; Hu, Qin; Tang, Junjia; Chen, Yujie; Tang, Jiping; Feng, Hua; Zhang, John H
2015-08-01
Progranulin has been reported to have neuroprotective actions in cultured neurons. This study investigated the effect of recombinant rat progranulin on early brain injury after subarachnoid hemorrhage. Controlled in vivo laboratory study. Animal research laboratory. Two hundred thirty adult male Sprague-Dawley rats weighing 280-320 g. Subarachnoid hemorrhage was induced in rats by endovascular perforation. Rat recombinant progranulin (1 and 3 ng) was administrated intracerebroventricularly at 1.5 hours after subarachnoid hemorrhage. Progranulin small interfering RNA was administrated by intracerebroventricularly at 1 day before subarachnoid hemorrhage induction. Subarachnoid hemorrhage grade, neurologic score, and brain water content were measured at 24 and 72 hours after subarachnoid hemorrhage. Neural apoptosis was evaluated by double immunofluorescence staining using terminal deoxynucleotidyl transferase-mediated uridine 5'-triphosphate-biotin nick-end labeling and neuronal nuclei. For mechanistic study, the expression of progranulin, phosphorylated Akt, Akt, p-Erk, Erk, Bcl-2, and cleaved caspase-3 were analyzed by Western blot at 24 hours after subarachnoid hemorrhage. siRNA for sortilin 1 (a progranulin receptor) was used to intervene the downstream pathway. The expression of progranulin decreased and reached the lowest point at 24 hours after subarachnoid hemorrhage. Administration of rat recombinant progranulin decreased brain water content and improved neurologic functions at both 24 and 72 hours after subarachnoid hemorrhage, while knockdown of endogenous progranulin aggravated neurologic deficits after subarachnoid hemorrhage. Rat recombinant progranulin treatment reduced neuronal apoptosis, while progranulin deficiency promoted neuronal apoptosis at 24 hours after subarachnoid hemorrhage. Rat recombinant progranulin promoted Akt activation, increased Bcl-2 level, but reduced caspase-3 level. Knockdown of progranulin binding factor sortilin 1
Cenik, Basar; Sephton, Chantelle F.; Kutluk Cenik, Bercin; Herz, Joachim; Yu, Gang
2012-01-01
GRN mutations cause frontotemporal lobar degeneration with TDP-43-positive inclusions. The mechanism of pathogenesis is haploinsufficiency. Recently, homozygous GRN mutations were detected in two patients with neuronal ceroid lipofuscinosis, a lysosomal storage disease. It is unknown whether the pathogenesis of these two conditions is related. Progranulin is cleaved into smaller peptides called granulins. Progranulin and granulins are attributed with roles in cancer, inflammation, and neuronal physiology. Cell surface receptors for progranulin, but not granulin peptides, have been reported. Revealing the cell surface receptors and the intracellular functions of granulins and progranulin is crucial for understanding their contributions to neurodegeneration. PMID:22859297
Low plasma progranulin levels in children with autism
AL-Ayadhi, Laila Y; Mostafa, Gehan A
2011-01-01
Abstract Background Autoimmunity to brain may play a pathogenic role in autism. In autoimmune disorders, the formation of antigen-antibody complexes triggers an inflammatory response by inducing the infiltration of neutrophils. Local administration of recombinant progranulin, which is an anti-inflammatory neurotrophic factor, potently inhibit neutrophilic inflammation in vivo, demonstrating that progranulin represents a crucial inflammation-suppressing mediator. We are the first to measure pl...
Altmann, Christine; Hardt, Stefanie; Fischer, Caroline; Heidler, Juliana; Lim, Hee-Young; Häussler, Annett; Albuquerque, Boris; Zimmer, Béla; Möser, Christine; Behrends, Christian; Koentgen, Frank; Wittig, Ilka; Schmidt, Mirko H H; Clement, Albrecht M; Deller, Thomas; Tegeder, Irmgard
2016-12-01
Peripheral or central nerve injury is a frequent cause of chronic pain and the mechanisms are not fully understood. Using newly generated transgenic mice we show that progranulin overexpression in sensory neurons attenuates neuropathic pain after sciatic nerve injury and accelerates nerve healing. A yeast-2-hybrid screen revealed putative interactions of progranulin with autophagy-related proteins, ATG12 and ATG4b. This was supported by colocalization and proteomic studies showing regulations of ATG13 and ATG4b and other members of the autophagy network, lysosomal proteins and proteins involved in endocytosis. The association of progranulin with the autophagic pathway was functionally confirmed in primary sensory neurons. Autophagy and survival were impaired in progranulin-deficient neurons and improved in progranulin overexpressing neurons. Nerve injury in vivo caused an accumulation of LC3b-EGFP positive bodies in neurons of the dorsal root ganglia and nerves suggesting an impairment of autophagic flux. Overexpression of progranulin in these neurons was associated with a reduction of the stress marker ATF3, fewer protein aggregates in the injured nerve and enhanced stump healing. At the behavioral level, further inhibition of the autophagic flux by hydroxychloroquine intensified cold and heat nociception after sciatic nerve injury and offset the pain protection provided by progranulin. We infer that progranulin may assist in removal of protein waste and thereby helps to resolve neuropathic pain after nerve injury. Copyright © 2016 Elsevier Inc. All rights reserved.
Progranulin haploinsufficiency causes biphasic social dominance abnormalities in the tube test.
Arrant, A E; Filiano, A J; Warmus, B A; Hall, A M; Roberson, E D
2016-07-01
Loss-of-function mutations in progranulin (GRN) are a major autosomal dominant cause of frontotemporal dementia (FTD), a neurodegenerative disorder in which social behavior is disrupted. Progranulin-insufficient mice, both Grn(+/-) and Grn(-/-) , are used as models of FTD due to GRN mutations, with Grn(+/-) mice mimicking the progranulin haploinsufficiency of FTD patients with GRN mutations. Grn(+/-) mice have increased social dominance in the tube test at 6 months of age, although this phenotype has not been reported in Grn(-/-) mice. In this study, we investigated how the tube test phenotype of progranulin-insufficient mice changes with age, determined its robustness under several testing conditions, and explored the associated cellular mechanisms. We observed biphasic social dominance abnormalities in Grn(+/-) mice: at 6-8 months, Grn(+/-) mice were more dominant than wild-type littermates, while after 9 months of age, Grn(+/-) mice were less dominant. In contrast, Grn(-/-) mice did not exhibit abnormal social dominance, suggesting that progranulin haploinsufficiency has distinct effects from complete progranulin deficiency. The biphasic tube test phenotype of Grn(+/-) mice was associated with abnormal cellular signaling and neuronal morphology in the amygdala and prefrontal cortex. At 6-9 months, Grn(+/-) mice exhibited increased mTORC2/Akt signaling in the amygdala and enhanced dendritic arbors in the basomedial amygdala, and at 9-16 months Grn(+/-) mice exhibited diminished basal dendritic arbors in the prelimbic cortex. These data show a progressive change in tube test dominance in Grn(+/-) mice and highlight potential underlying mechanisms by which progranulin insufficiency may disrupt social behavior. © 2016 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.
Stubert, Johannes; Schattenberg, Florian; Richter, Dagmar-Ulrike; Dieterich, Max; Briese, Volker
2012-05-13
The expression of the anti-inflammatory glycoprotein progranulin and the hypoxia-induced transcription factor 1α (HIF-1α) in the villous trophoblast was compared between placentae from patients with preeclampsia (PE), fetal growth restriction (FGR), and normal controls. Matched pairs analysis of third trimester placentae specimens (mean gestational age 36+2) was performed by semiquantitative measurements of the immunohistochemical staining intensities for progranulin and HIF-1α expression (PE n=13, FGR n=9 and controls n=11). Further, placental progranulin mRNA expression was analyzed by qRT-PCR on term placentae (n=3 for each group). Compared to controls, villous trophoblast revealed a significantly higher expression of progranulin in cases of PE (Pprogranulin protein was not accompanied by an increase of the progranulin mRNA in term placentae. Increased expression of progranulin protein in villous trophoblast cells in cases of PE and FGR may result from disturbed placental development and, therefore, may be of pathogenetic importance. The increase was correlated to HIF-1α expression. Further evaluation of this potential mechanism of regulation is required.
Körtvelyessy, Peter; Huchtemann, Tessa; Heinze, Hans-Jochen; Bittner, Daniel M
2017-02-24
The current knowledge about neuroprotective mechanisms in humans after status epilepticus is scarce. One reason is the difficulty to measure possible mediators of these neuroprotective mechanisms. The dawn of microRNA detection in the cerebrospinal fluid (CSF) and the recent advancements in measuring proteins in the CSF such as progranulin, which is, e.g., responsible for neurite outgrowth and limiting exceeding neuroinflammatory responses, have given us new insights into putative neuroprotective mechanisms following status epilepticus. This should complement the animal data. In this review, we cover what is known about the role of progranulin as well as the links between microRNA changes and the progranulin pathway following status epilepticus in humans and animals hypothesizing neuroprotective and neurorehabilitative effects. Progranulin has also been found to feature prominently in the neuroprotective processes under hypoxic conditions and initiating neurorehabilitative processes. These properties may be used therapeutically, e.g., through drugs that raise the progranulin levels and therefore the cerebral progranulin levels as well with the goal of improving the outcome after status epilepticus.
Directory of Open Access Journals (Sweden)
Peter Körtvelyessy
2017-02-01
Full Text Available The current knowledge about neuroprotective mechanisms in humans after status epilepticus is scarce. One reason is the difficulty to measure possible mediators of these neuroprotective mechanisms. The dawn of microRNA detection in the cerebrospinal fluid (CSF and the recent advancements in measuring proteins in the CSF such as progranulin, which is, e.g., responsible for neurite outgrowth and limiting exceeding neuroinflammatory responses, have given us new insights into putative neuroprotective mechanisms following status epilepticus. This should complement the animal data. In this review, we cover what is known about the role of progranulin as well as the links between microRNA changes and the progranulin pathway following status epilepticus in humans and animals hypothesizing neuroprotective and neurorehabilitative effects. Progranulin has also been found to feature prominently in the neuroprotective processes under hypoxic conditions and initiating neurorehabilitative processes. These properties may be used therapeutically, e.g., through drugs that raise the progranulin levels and therefore the cerebral progranulin levels as well with the goal of improving the outcome after status epilepticus.
Wex, Thomas; Kuester, Doerthe; Schönberg, Cornelius; Schindele, Daniel; Treiber, Gerhard; Malfertheiner, Peter
2011-05-26
Mucosal levels of Secretory Leukocyte Protease Inhibitor (SLPI) are specifically reduced in relation to H. pylori-induced gastritis. Progranulin is an epithelial growth factor that is proteolytically degraded into fragments by elastase (the main target of SLPI). Considering the role of SLPI for regulating the activity of elastase, we studied whether the H. pylori-induced reduction of SLPI and the resulting increase of elastase-derived activity would reduce the Progranulin protein levels both ex vivo and in vitro. The expression of Progranulin was studied in biopsies of H. pylori-positive, -negative and -eradicated subjects as well as in the gastric tumor cell line AGS by ELISA, immunohistochemistry and real-time RT-PCR. H. pylori-infected subjects had about 2-fold increased antral Progranulin expression compared to H. pylori-negative and -eradicated subjects (P Progranulin and SLPI levels were identified. Immunohistochemical analysis confirmed the upregulation of Progranulin in relation to H. pylori infection; both epithelial and infiltrating immune cells contributed to the higher Progranulin expression levels. The H. pylori-induced upregulation of Progranulin was verified in AGS cells infected by H. pylori. The down-regulation of endogenous SLPI expression in AGS cells by siRNA methodology did not affect the Progranulin expression independent of the infection by H. pylori. Taken together, Progranulin was identified as novel molecule that is upregulated in context to H. pylori infection. In contrast to other diseases, SLPI seems not to have a regulatory role for Progranulin in H. pylori-mediated gastritis.
Serum Progranulin Levels in Type 2 Diabetic Patients with Metabolic Syndrome
Directory of Open Access Journals (Sweden)
Shafaei Azam
2016-12-01
Full Text Available Introduction. The role of progranulin in individuals with metabolic syndrome is not exactly clear.We aimed to assess the serum level of progranulin in type 2 diabetic patients with and without metabolic syndrome and compare them with healthy controls.
Progranulin levels in status epilepticus as a marker of neuronal recovery and neuroprotection.
Huchtemann, T; Körtvélyessy, P; Feistner, H; Heinze, H J; Bittner, D
2015-08-01
Recently, a mouse model showed that progranulin, a mediator in neuroinflammation and a neuronal growth factor, was elevated in the hippocampus after status epilepticus (SE). This elevated level might mirror compensating neuronal mechanisms after SE. Studies concerning neuronal recovery and neuroprotective mechanisms after SE in humans are scarce, so we tested for progranulinin the cerebrospinal fluid (CSF) after various types of SE. We performed a retrospective analysis of progranulin levels in CSF in patients (n = 24) who underwent lumbar puncture as part of diagnostic workup after having SE and in patients after having one single tonic-clonic seizure who comprised the control group (n = 8). In our group with SE, progranulin levels in CSF were not significantly elevated compared to our control group. Furthermore, there was no correlation between progranulin levels and the time interval between lumbar puncture and SE. Additionally, in cases of higher CSF progranulin levels, we found no impact on the clinical outcome after SE. Although our cohort is heterogeneous and not fully sufficient, we conclude that progranulin in CSF is not elevated after SE in our cohort. Therefore, our results do not suggest a change in cerebral progranulin metabolism as a possible neuroregenerative or neuroprotective mechanism in humans after SE in acute and subacute phases. A larger cohort study is needed to further strengthen this result. This article is part of a Special Issue entitled "Status Epilepticus". Copyright © 2015 Elsevier Inc. All rights reserved.
Hwang, Hwan-Jin; Jung, Tae Woo; Hong, Ho Cheol; Choi, Hae Yoon; Seo, Ji-A; Kim, Sin Gon; Kim, Nan Hee; Choi, Kyung Mook; Choi, Dong Seop; Baik, Sei Hyun; Yoo, Hye Jin
2013-01-01
Atherosclerosis is considered a chronic inflammatory disease, initiated by activation and dysfunction of the endothelium. Recently, progranulin has been regarded as an important modulator of inflammatory processes; however, the role for prgranulin in regulating inflammation in vascular endothelial cells has not been described. Signaling pathways mediated by progranulin were analyzed in human umbilical vein endothelial cells (HUVECs) treated with progranulin. Progranulin significantly induced Akt and endothelial nitric oxide synthase (eNOS) phosphorylation in HUVECs, an effect that was blocked with Akt inhibitor. Furthermore, nitric oxide (NO) level, the end product of Akt/eNOS pathway, was significantly upregulated after progranulin treatment. Next, we showed that progranulin efficiently inhibited lipopolysaccharide (LPS)-mediated pro-inflammatory signaling. LPS-induced phosphorylation of IκB and nuclear factor-κB (NF-κB) levels decreased after progranulin treatment. Also, progranulin blocked translocation of NF-κB from the cytosol to the nucleus. In addition, progranulin significantly reduced the expression of vascular cell adhesion molecule-1 (VCAM-1) and intercellular adhesion molecule-1 (ICAM-1) by inhibiting binding of NF- κB to their promoter regions and blocked attachment of monocytes to HUVECs. Progranulin also significantly reduced the expression of tumor necrosis factor receptor-α (TNF-α) and monocyte chemo-attractant protein-1 (MCP-1), the crucial inflammatory molecules known to aggravate atherosclerosis. Progranulin efficiently inhibited LPS-mediated pro-inflammatory signaling in endothelial cells through activation of the Akt/eNOS pathway and attenuation of the NF-κB pathway, suggesting its protective roles in vascular endothelium against inflammatory reaction underlying atherosclerosis.
Manic behavior and asymmetric right frontotemporal dementia from a novel progranulin mutation
Directory of Open Access Journals (Sweden)
Mendez MF
2018-02-01
Full Text Available Mario F Mendez1–3 1Department of Neurology, 2Department of Psychiatry & Biobehavioral Sciences, David Geffen School of Medicine, University of California at Los Angeles, Los Angeles, CA, USA; 3Neurology Service, VA Greater Los Angeles Healthcare System, Los Angeles, CA, USA Abstract: Studies suggest a relationship of manic behavior and bipolar disorder (BD with behavioral variant frontotemporal dementia (bvFTD. The nature of this relationship is unclear. This report presents a patient with initial manic behavior as the main manifestation of familial bvFTD from a novel progranulin (GRN mutation. In contrast, there are other reports of a long background of BD preceding a diagnosis of bvFTD. A review of the literature and this patient suggest that manic symptoms result from damage to right frontotemporal neural structures from longstanding BD, as well as from bvFTD and other focal neurological disorders. In addition, there is a subgroup of patients with a probable genetic predisposition to both BD and bvFTD. Keywords: frontotemporal dementia, mania, bipolar disorder, progranulin mutation
Berghoff, Martin; Hochberg, Alexandra; Schmid, Andreas; Schlegel, Jutta; Karrasch, Thomas; Kaps, Manfred; Schäffler, Andreas
2016-01-01
Adipokines bearing the potential to cross the blood-brain barrier (BBB) are promising candidates for the endocrine regulation of central nervous processes and of a postulated fat-brain axis. Resistin and progranulin concentrations in paired serum and cerebrospinal fluid (CSF) samples of patients undergoing neurological evaluation and spinal puncture were investigated. Samples of n = 270 consecutive patients with various neurological diseases were collected without prior selection. Adipokine serum and CSF concentrations were measured by enzyme-linked immunosorbent assay and serum and CSF routine parameters by standard procedures. Anthropometric data, medication and patient history were available. Serum levels of resistin and progranulin were positively correlated among each other, with respective CSF levels, low-density lipoprotein cholesterol levels and markers of systemic inflammation. CSF resistin concentrations were generally low. Progranulin CSF concentrations and CSF/serum progranulin ratio were significantly higher in patients with infectious diseases, with disturbed BBB function and with elevated CSF cell count and presence of oligoclonal bands. Both adipokines are able to cross the BBB depending on a differing patency that increases with increasing grade of barrier dysfunction. Whereas resistin represents a systemic marker of inflammation, CSF progranulin levels strongly depend on the underlying disease and dysfunction of blood-CSF barrier. Resistin and progranulin represent novel and putative regulators of the fat-brain axis by their ability to cross the BBB under physiological and pathophysiological conditions. The presented data provide insight into the characteristics of BBB function regarding progranulin and resistin and the basis for future establishment of normal values for CSF concentrations and CSF/serum ratios. © 2015 Stichting European Society for Clinical Investigation Journal Foundation.
NG2/CSPG4 and progranulin in the posttraumatic glial scar.
Schäfer, Michael K E; Tegeder, Irmgard
2018-08-01
Traumatic injury of the central nervous system is one of the leading causes of death and disability in young adults. Failure of regeneration is caused by autonomous neuronal obstacles and by formation of the glial scar, which is essential to seal the injury but also constitutes a barrier for regrowing axons. The scar center is highly inflammatory and populated by NG2+ glia, whereas astrocytes form the sealing border and trap regrowing axons, suggesting that the non-permissive environment of activated astrocytes and extracellular matrix components is one of the reasons for the regenerative failure. Particularly, secreted chondroitin-sulfate proteoglycans, CSPGs, of the lectican family hinder axonal regrowth. In contrast, the transmembrane CSPG, NG2/CSPG4, appears to be functionally closer related to axon growth permissive heparan sulfate proteoglycans, HSPGs, and synaptic adhesion molecules, which all regulate synaptic signaling and plasticity upon alpha-secretase mediated shedding. Consequently, knockout of NG2/CSPG4 aggravates tissue loss, inflammation and neurologic deficits after brain injury, a phenotype partly mimicked by deletion of HSPG-binding proteins such as the HSPG2/perlecan-interacting protein, progranulin that is also a functional ligand of Notch and Eph2a. Indeed, structural features or progranulin's targets and NG2 may point to direct reciprocal regulations that may act in concert to overcome injury-evoked inflammation and neuronal dystrophy. This review provides an overview of the pathophysiology of the glial scar after brain injury, with a specific focus on NG2/CSPG4, its functions before and after shedding and putative reciprocal influences with the glycoprotein progranulin. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Hwan-Jin Hwang
Full Text Available OBJECTIVE: Atherosclerosis is considered a chronic inflammatory disease, initiated by activation and dysfunction of the endothelium. Recently, progranulin has been regarded as an important modulator of inflammatory processes; however, the role for prgranulin in regulating inflammation in vascular endothelial cells has not been described. METHOD AND RESULTS: Signaling pathways mediated by progranulin were analyzed in human umbilical vein endothelial cells (HUVECs treated with progranulin. Progranulin significantly induced Akt and endothelial nitric oxide synthase (eNOS phosphorylation in HUVECs, an effect that was blocked with Akt inhibitor. Furthermore, nitric oxide (NO level, the end product of Akt/eNOS pathway, was significantly upregulated after progranulin treatment. Next, we showed that progranulin efficiently inhibited lipopolysaccharide (LPS-mediated pro-inflammatory signaling. LPS-induced phosphorylation of IκB and nuclear factor-κB (NF-κB levels decreased after progranulin treatment. Also, progranulin blocked translocation of NF-κB from the cytosol to the nucleus. In addition, progranulin significantly reduced the expression of vascular cell adhesion molecule-1 (VCAM-1 and intercellular adhesion molecule-1 (ICAM-1 by inhibiting binding of NF- κB to their promoter regions and blocked attachment of monocytes to HUVECs. Progranulin also significantly reduced the expression of tumor necrosis factor receptor-α (TNF-α and monocyte chemo-attractant protein-1 (MCP-1, the crucial inflammatory molecules known to aggravate atherosclerosis. CONCLUSION: Progranulin efficiently inhibited LPS-mediated pro-inflammatory signaling in endothelial cells through activation of the Akt/eNOS pathway and attenuation of the NF-κB pathway, suggesting its protective roles in vascular endothelium against inflammatory reaction underlying atherosclerosis.
G?bel, Maria; Eisele, Lewin; M?llmann, Michael; H?ttmann, Andreas; Johansson, Patricia; Scholtysik, Ren?; Bergmann, Manuela; Busch, Raymonde; D?hner, Hartmut; Hallek, Michael; Seiler, Till; Stilgenbauer, Stephan; Klein-Hitpass, Ludger; D?hrsen, Ulrich; D?rig, Jan
2013-01-01
Progranulin (Pgrn) is a 88 kDa secreted protein with pleiotropic functions including regulation of cell cycle progression, cell motility, wound repair and tumorigenesis. Using microarray based gene expression profiling we have recently demonstrated that the gene for Pgrn, granulin (GRN), is significantly higher expressed in aggressive CD38(+)ZAP-70(+) as compared to indolent CD38(-)ZAP-70(-) chronic lymphocytic leukemia (CLL) cases. Here, we measured Pgrn plasma concentrations by enzyme-linke...
Directory of Open Access Journals (Sweden)
Treiber Gerhard
2011-05-01
Full Text Available Abstract Background Mucosal levels of Secretory Leukocyte Protease Inhibitor (SLPI are specifically reduced in relation to H. pylori-induced gastritis. Progranulin is an epithelial growth factor that is proteolytically degraded into fragments by elastase (the main target of SLPI. Considering the role of SLPI for regulating the activity of elastase, we studied whether the H. pylori-induced reduction of SLPI and the resulting increase of elastase-derived activity would reduce the Progranulin protein levels both ex vivo and in vitro. Methods The expression of Progranulin was studied in biopsies of H. pylori-positive, -negative and -eradicated subjects as well as in the gastric tumor cell line AGS by ELISA, immunohistochemistry and real-time RT-PCR. Results H. pylori-infected subjects had about 2-fold increased antral Progranulin expression compared to H. pylori-negative and -eradicated subjects (P H. pylori infection; both epithelial and infiltrating immune cells contributed to the higher Progranulin expression levels. The H. pylori-induced upregulation of Progranulin was verified in AGS cells infected by H. pylori. The down-regulation of endogenous SLPI expression in AGS cells by siRNA methodology did not affect the Progranulin expression independent of the infection by H. pylori. Conclusions Taken together, Progranulin was identified as novel molecule that is upregulated in context to H. pylori infection. In contrast to other diseases, SLPI seems not to have a regulatory role for Progranulin in H. pylori-mediated gastritis.
Guo, Qinyue; Xu, Lin; Li, Huixia; Sun, Hongzhi; Liu, Jiali; Wu, Shufang; Zhou, Bo
2017-01-31
Progranulin (PGRN) has recently emerged as an important regulator for insulin resistance. However, the direct effect of progranulin in adipose insulin resistance associated with the autophagy mechanism is not fully understood. In the present study, progranulin was administered to 3T3-L1 adipocytes and C57BL/6 J mice with/without specific inhibitors of oxidative stress and endoplasmic reticulum stress, and metabolic parameters, oxidative stress, endoplasmic reticulum stress and autophagy markers were assessed. Progranulin treatment increased iNOS expression, NO synthesis and ROS generation, and elevated protein expressions of CHOP, GRP78 and the phosphorylation of PERK, and caused a significant increase in Atg7 and LC3-II protein expression and a decreased p62 expression, and decreased insulin-stimulated tyrosine phosphorylation of IRS-1 and glucose uptake, demonstrating that progranulin activated oxidative stress and ER stress, elevated autophagy and induced insulin insensitivity in adipocytes and adipose tissue of mice. Interestingly, inhibition of iNOS and ER stress both reversed progranulin-induced stress response and increased autophagy, protecting against insulin resistance in adipocytes. Furthermore, the administration of the ER stress inhibitor 4-phenyl butyric acid reversed the negative effect of progranulin in vivo. Our findings showed the clinical potential of the novel adipokine progranulin in the regulation of insulin resistance, suggesting that progranulin might mediate adipose insulin resistance, at least in part, by inducing autophagy via activated oxidative stress and ER stress.
Stubert, Johannes; Waldmann, Kathrin; Dieterich, Max; Richter, Dagmar-Ulrike; Briese, Volker
2014-11-01
The glycoprotein progranulin directly binds to TNF-receptors and thereby can antagonize the inflammatory effects of TNF-α. Here we analyzed the impact of both cytokines on cytotoxicity and viability of trophoblast cells. Isolated villous first trimester human trophoblast cells and the human choriocarcinoma cell line BeWo were treated with recombinant human progranulin and TNF-α. Analyses were performed by LDH- and MTT-assay and measurement of caspase-8-activity. Progranulin treatment showed some cytoprotective effects on isolated trophoblast cells. However, TNF-α-induced apoptosis was not antagonized by addition of progranulin. Effects were similar, but more pronounced in BeWo cells. The cytoprotective activity of progranulin on trophoblast cells in vitro was only weak and of doubtful biologic relevance. It was not able to antagonize TNF-α. Future studies should focus on possible paracrine activities of progranulin.
Yilmaz, Yusuf; Eren, Fatih; Yonal, Oya; Polat, Zulfikar; Bacha, Mohammad; Kurt, Ramazan; Ozturk, Oguzhan; Avsar, Erol
2011-01-01
Background: Elevated progranulin levels are associated with visceral obesity, elevated plasma glucose, and dyslipidemia. Progranulin has not been previously investigated as a biomarker of nonalcoholic fatty liver disease (NAFLD). We sought to determine whether serum progranulin levels are altered in patients with biopsy-proven NAFLD and if they are associated with their clinical, biochemical, and histological characteristics. Subjects and methods: We measured serum progranulin levels in 95 pa...
Redaelli, Veronica; Rossi, Giacomina; Maderna, Emanuela; Kovacs, Gabor G; Piccoli, Elena; Caroppo, Paola; Cacciatore, Francesca; Spinello, Sonia; Grisoli, Marina; Sozzi, Giuliano; Salmaggi, Andrea; Tagliavini, Fabrizio; Giaccone, Giorgio
2018-01-01
Null mutations in progranulin gene (GRN) reduce the progranulin production resulting in haploinsufficiency and are tightly associated with tau-negative frontotemporal lobar degeneration with TAR DNA-binding protein 43-positive inclusions (FTLD-TDP). Missense mutations of GRN were also identified, but their effects are not completely clear, in particular unanswered is the question of what neuropathology they elicit, also considering that their occurrence has been reported in patients with typical clinical features of Alzheimer disease. They describe two fraternal twins carrying the missense GRN Cys139Arg mutation affected by late-onset dementia and we report the neuropathological study of one of them. Both patients were examined by neuroimaging, neuropsychological assessment and genetic analysis of GRN and other genes associated with dementia. The brain of one was obtained at autopsy and examined neuropathologically. One sister presented clinical and MRI features leading to the diagnosis of Alzheimer disease. The other underwent autopsy and the brain showed neuropathological hallmarks of Alzheimer disease with abundant Aβ-amyloid deposition and Braak stage V of neurofibrillary pathology, in the absence of the hallmark lesions of FTLD-TDP. Their findings may contribute to better clarify the role of progranulin in neurodegenerative diseases indicating that some GRN mutations, in particular missense ones, may act as strong risk factor for Alzheimer disease rather than induce FTLD-TDP. © 2016 International Society of Neuropathology.
Almeida, Sandra; Zhang, Zhijun; Coppola, Giovanni; Mao, Wenjie; Futai, Kensuke; Karydas, Anna; Geschwind, Michael D.; Tartaglia, M. Carmela; Gao, Fuying; Gianni, Davide; Sena-Esteves, Miguel; Geschwind, Daniel H.; Miller, Bruce L.; Farese, Robert V.; Gao, Fen-Biao
2012-01-01
SUMMARY The pathogenic mechanisms of frontotemporal dementia (FTD) remain poorly understood. Here we generated multiple induced pluripotent stem cell (iPSC) lines from a control subject, a patient with sporadic FTD, and an FTD patient with a novel GRN mutation (PGRN S116X). In neurons and microglia differentiated from PGRN S116X iPSCs, the levels of intracellular and secreted progranulin were reduced, establishing patient-specific cellular models of progranulin haploinsufficiency. Through a systematic screen of inducers of cellular stress, we found that PGRN S116X neurons, but not sporadic FTD neurons, exhibited increased sensitivity to staurosporine and other kinase inhibitors. Moreover, the serine/threonine kinase S6K2, a component of the PI3K and MAPK pathways, was specifically downregulated in PGRN S116X neurons. Both increased sensitivity to kinase inhibitors and reduced S6K2 were rescued by progranulin expression. Our findings identify cell-autonomous, reversible defects in patient neurons with progranulin deficiency and provide a new model for studying progranulin-dependent pathogenic mechanisms and testing potential therapies. PMID:23063362
Progranulin and the receptor tyrosine kinase EphA2, partners in crime?
Chitramuthu, Babykumari; Bateman, Andrew
2016-01-01
Progranulin is a secreted protein with roles in tumorigenesis, inflammation, and neurobiology, but its signaling receptors have remained unclear. In this issue, Neill et al. (2016. J. Cell Biol. https://doi.org/10.1083/jcb.201603079) identify the tyrosine kinase EphA2 as a strong candidate for such a receptor, providing insight into progranulin and EphA2 signaling. PMID:27903608
Partial Tmem106b reduction does not correct abnormalities due to progranulin haploinsufficiency.
Arrant, Andrew E; Nicholson, Alexandra M; Zhou, Xiaolai; Rademakers, Rosa; Roberson, Erik D
2018-06-22
Loss of function mutations in progranulin (GRN) are a major cause of frontotemporal dementia (FTD). Progranulin is a secreted glycoprotein that localizes to lysosomes and is critical for proper lysosomal function. Heterozygous GRN mutation carriers develop FTD with TDP-43 pathology and exhibit signs of lysosomal dysfunction in the brain, with increased levels of lysosomal proteins and lipofuscin accumulation. Homozygous GRN mutation carriers develop neuronal ceroid lipofuscinosis (NCL), an earlier-onset lysosomal storage disorder caused by severe lysosomal dysfunction. Multiple genome-wide association studies have shown that risk of FTD in GRN mutation carriers is modified by polymorphisms in TMEM106B, which encodes a lysosomal membrane protein. Risk alleles of TMEM106B may increase TMEM106B levels through a variety of mechanisms. Brains from FTD patients with GRN mutations exhibit increased TMEM106B expression, and protective TMEM106B polymorphisms are associated with decreased TMEM106B expression. Together, these data raise the possibility that reduction of TMEM106B levels may protect against the pathogenic effects of progranulin haploinsufficiency. We crossed Tmem106b +/- mice with Grn +/- mice, which model the progranulin haploinsufficiency of GRN mutation carriers and develop age-dependent social deficits and lysosomal abnormalities in the brain. We tested whether partial Tmem106b reduction could normalize the social deficits and lysosomal abnormalities of Grn +/- mice. Partial reduction of Tmem106b levels did not correct the social deficits of Grn +/- mice. Tmem106b reduction also failed to normalize most lysosomal abnormalities of Grn +/- mice, except for β-glucuronidase activity, which was suppressed by Tmem106b reduction and increased by progranulin insufficiency. These data do not support the hypothesis that Tmem106b reduction protects against the pathogenic effects of progranulin haploinsufficiency, but do show that Tmem106b reduction normalizes some
Cortical atrophy and language network reorganization associated with a novel progranulin mutation.
Cruchaga, Carlos; Fernández-Seara, Maria A; Seijo-Martínez, Manuel; Samaranch, Lluis; Lorenzo, Elena; Hinrichs, Anthony; Irigoyen, Jaione; Maestro, Cristina; Prieto, Elena; Martí-Climent, Josep M; Arbizu, Javier; Pastor, Maria A; Pastor, Pau
2009-08-01
Progressive nonfluent aphasia (PNFA) is an early stage of frontotemporal degeneration. We identified a novel Cys521Tyr progranulin gene variant in a PNFA family that potentially disrupts disulphide bridging causing protein misfolding. To identify early neurodegeneration changes, we performed neuropsychological and neuroimaging studies in 6 family members (MRI [magnetic resonance imaging], fMRI [functional MRI], and 18f-fluorodeoxygenlucose positron emission tomography, including 4 mutation carriers, and in 9 unrelated controls. Voxel-based morphometry (VBM) of the carriers compared with controls showed significant cortical atrophy in language areas. Grey matter loss was distributed mainly in frontal lobes, being more prominent on the left. Clusters were located in the superior frontal gyri, left inferior frontal gyrus, left middle frontal gyrus, left middle temporal gyri and left posterior parietal areas, concordant with (18)FDG-PET hypometabolic areas. fMRI during semantic and phonemic covert word generation (CWGTs) and word listening tasks (WLTs) showed recruitment of attentional and working memory networks in the carriers indicative of functional reorganization. During CWGTs, activation in left prefrontal cortex and bilateral anterior insulae was present whereas WLT recruited mesial prefrontal and anterior temporal cortex. These findings suggest that Cys521Tyr could be associated with early brain impairment not limited to language areas and compensated by recruitment of bilateral auxiliary cortical areas.
Chen, Jiaxi; Li, Shuang; Shi, Jianfeng; Zhang, Lili; Li, Jun; Chen, Shiyong; Wu, Chunlong; Shen, Bo
2016-03-01
Soluble progranulin (PGRN) is known to directly regulate regulatory T cells; however, whether PGRN levels are elevated in patients with rheumatoid arthritis and affect the regulatory subsets of B cells remain unknown. In this study, a total of 80 RA patients and 60 healthy controls were studied. Serum progranulin levels were determined using enzyme-linked immune-sorbent assay. A receiver operating characteristic (ROC) curve was used to evaluate the feasibility of serum PGRN as a biomarker for distinguishing patients with RA. CD19(+)CD5(+)GrB(+) B cells were analyzed by flow cytometry in peripheral blood mononuclear cells (PBMCs). Serum progranulin levels in RA patients (median, 59.4 ng/mL) and in RA patients DAS28 > 5.1 (median, 71.98 ng/mL) were much higher than those in normal controls (median, 46.3 ng/mL; P progranulin levels was 0.705 for RA versus normal controls and the area under the ROC curve for progranulin levels in RA patients DAS28 > 5.1 was 0.977 versus normal controls (P progranulin and DAS28, CRP, ESR were all positively correlated in RA patients (P 0.05). Our findings indicated that induction of PGRN expression may play a role in RA immune reaction and PGRN levels could be a useful biomarker in RA inflammatory response, but irrelated with Breg cell levels.
Directory of Open Access Journals (Sweden)
Yusuf Yilmaz
2011-01-01
Full Text Available Background: Elevated progranulin levels are associated with visceral obesity, elevated plasma glucose, and dyslipidemia. Progranulin has not been previously investigated as a biomarker of nonalcoholic fatty liver disease (NAFLD. We sought to determine whether serum progranulin levels are altered in patients with biopsy-proven NAFLD and if they are associated with their clinical, biochemical, and histological characteristics.
Progranulin and its biological effects in cancer.
Arechavaleta-Velasco, Fabian; Perez-Juarez, Carlos Eduardo; Gerton, George L; Diaz-Cueto, Laura
2017-11-07
Cancer cells have defects in regulatory mechanisms that usually control cell proliferation and homeostasis. Different cancer cells share crucial alterations in cell physiology, which lead to malignant growth. Tumorigenesis or tumor growth requires a series of events that include constant cell proliferation, promotion of metastasis and invasion, stimulation of angiogenesis, evasion of tumor suppressor factors, and avoidance of cell death pathways. All these events in tumor progression may be regulated by growth factors produced by normal or malignant cells. The growth factor progranulin has significant biological effects in different types of cancer. This protein is a regulator of tumorigenesis because it stimulates cell proliferation, migration, invasion, angiogenesis, malignant transformation, resistance to anticancer drugs, and immune evasion. This review focuses on the biological effects of progranulin in several cancer models and provides evidence that this growth factor should be considered as a potential biomarker and target in cancer treatment.
Vercellino, Marco; Fenoglio, Chiara; Galimberti, Daniela; Mattioda, Alessandra; Chiavazza, Carlotta; Binello, Eleonora; Pinessi, Lorenzo; Giobbe, Dario; Scarpini, Elio; Cavalla, Paola
2016-07-01
Progranulin (GRN) is a multifunctional protein involved in inflammation and repair, and also a neurotrophic factor critical for neuronal survival. Progranulin is strongly expressed in multiple sclerosis (MS) brains by macrophages and microglia. In this study we evaluated GRN genetic variability in 400 MS patients, in correlation with clinical variables such as disease severity and relapse recovery. We also evaluated serum progranulin levels in the different groups of GRN variants carriers. We found that incomplete recovery after a relapse is correlated with an increased frequency of the rs9897526 A allele (odds ratio (OR) 4.367, p = 0.005). A more severe disease course (Multiple Sclerosis Severity Score > 5) is correlated with an increased frequency of the rs9897526 A allele (OR 1.886, p = 0.002) and of the rs5848 T allele (OR 1.580, p = 0.019). Carriers of the variants associated with a more severe disease course (rs9897526 A, rs5848 T) have significantly lower levels of circulating progranulin (80.5 ± 9.1 ng/mL vs. 165.7 ng/mL, p = 0.01). GRN genetic polymorphisms likely influence disease course and relapse recovery in MS. © The Author(s), 2015.
Zhou, Xiaolai; Sun, Lirong; Brady, Owen Adam; Murphy, Kira A; Hu, Fenghua
2017-01-26
Mutations resulting in haploinsufficiency of progranulin (PGRN) cause frontotemporal lobar degeneration with TDP-43-positive inclusions (FTLD-TDP), a devastating neurodegenerative disease. Accumulating evidence suggest a crucial role of progranulin in maintaining proper lysosomal function during aging. TMEM106B has been identified as a risk factor for frontotemporal lobar degeneration with progranulin mutations and elevated mRNA and protein levels of TMEM106B are associated with increased risk for frontotemporal lobar degeneration. Increased levels of TMEM106B alter lysosomal morphology and interfere with lysosomal degradation. However, how progranulin and TMEM106B interact to regulate lysosomal function and frontotemporal lobar degeneration (FTLD) disease progression is still unclear. Here we report that progranulin deficiency leads to increased TMEM106B protein levels in the mouse cortex with aging. To mimic elevated levels of TMEM106B in frontotemporal lobar degeneration (FTLD) cases, we generated transgenic mice expressing TMEM106B under the neuronal specific promoter, CamKII. Surprisingly, we found that the total protein levels of TMEM106B are not altered despite the expression of the TMEM106B transgene at mRNA and protein levels, suggesting a tight regulation of TMEM106B protein levels in the mouse brain. However, progranulin deficiency results in accumulation of TMEM106B protein from the transgene expression during aging, which is accompanied by exaggerated lysosomal abnormalities and increased lipofuscin accumulation. In summary, our mouse model nicely recapitulates the interaction between progranulin and TMEM106B in human patients and supports a critical role of lysosomal dysfunction in the frontotemporal lobar degeneration (FTLD) disease progression.
Progranulin in frontotemporal lobar degeneration and neuroinflammation
Directory of Open Access Journals (Sweden)
Hutton Michael L
2007-02-01
Full Text Available Abstract Progranulin (PGRN is a pleiotropic protein that has gained the attention of the neuroscience community with recent discoveries of mutations in the gene for PGRN that cause frontotemporal lobar degeneration (FTLD. Pathogenic mutations in PGRN result in null alleles, and the disease is likely the result of haploinsufficiency. Little is known about the normal function of PGRN in the central nervous system apart from a role in brain development. It is expressed by microglia and neurons. In the periphery, PGRN is involved in wound repair and inflammation. High PGRN expression has been associated with more aggressive growth of various tumors. The properties of full length PGRN are distinct from those of proteolytically derived peptides, referred to as granulins (GRNs. While PGRN has trophic properties, GRNs are more akin to inflammatory mediators such as cytokines. Loss of the neurotrophic properties of PGRN may play a role in selective neuronal degeneration in FTLD, but neuroinflammation may also be important. Gene expression studies suggest that PGRN is up-regulated in a variety of neuroinflammatory conditions, and increased PGRN expression by microglia may play a pivotal role in the response to brain injury, neuroinflammation and neurodegeneration.
Association Between Progranulin and Gaucher Disease.
Jian, Jinlong; Zhao, Shuai; Tian, Qing-Yun; Liu, Helen; Zhao, Yunpeng; Chen, Wen-Chi; Grunig, Gabriele; Torres, Paola A; Wang, Betty C; Zeng, Bai; Pastores, Gregory; Tang, Wei; Sun, Ying; Grabowski, Gregory A; Kong, Max Xiangtian; Wang, Guilin; Chen, Ying; Liang, Fengxia; Overkleeft, Herman S; Saunders-Pullman, Rachel; Chan, Gerald L; Liu, Chuan-Ju
2016-09-01
Gaucher disease (GD) is a genetic disease caused by mutations in the GBA1 gene which result in reduced enzymatic activity of β-glucocerebrosidase (GCase). This study identified the progranulin (PGRN) gene (GRN) as another gene associated with GD. Serum levels of PGRN were measured from 115 GD patients and 99 healthy controls, whole GRN gene from 40 GD patients was sequenced, and the genotyping of 4 SNPs identified in GD patients was performed in 161 GD and 142 healthy control samples. Development of GD in PGRN-deficient mice was characterized, and the therapeutic effect of rPGRN on GD analyzed. Serum PGRN levels were significantly lower in GD patients (96.65±53.45ng/ml) than those in healthy controls of the general population (164.99±43.16ng/ml, pGaucher-like cells in lung, spleen, and bone marrow. Moreover, lysosomes in PGRN KO mice exhibit a tubular-like appearance. PGRN is required for the lysosomal appearance of GCase and its deficiency leads to GCase accumulation in the cytoplasm. More importantly, recombinant PGRN is therapeutic in various animal models of GD and human fibroblasts from GD patients. Our data demonstrates an unknown association between PGRN and GD and identifies PGRN as an essential factor for GCase's lysosomal localization. These findings not only provide new insight into the pathogenesis of GD, but may also have implications for diagnosis and alternative targeted therapies for GD. Copyright © 2016 Forschungsgesellschaft für Arbeitsphysiologie und Arbeitschutz e.V. Published by Elsevier B.V. All rights reserved.
Moxibustion upregulates hippocampal progranulin expression
Directory of Open Access Journals (Sweden)
Tao Yi
2016-01-01
Full Text Available In China, moxibustion is reported to be useful and has few side effects for chronic fatigue syndrome, but its mechanisms are largely unknown. More recently, the focus has been on the wealth of information supporting stress as a factor in chronic fatigue syndrome, and largely concerns dysregulation in the stress-related hypothalamic-pituitary-adrenal axis. In the present study, we aimed to determine the effect of moxibustion on behavioral symptoms in chronic fatigue syndrome rats and examine possible mechanisms. Rats were subjected to a combination of chronic restraint stress and forced swimming to induce chronic fatigue syndrome. The acupoints Guanyuan (CV4 and Zusanli (ST36, bilateral were simultaneously administered moxibustion. Untreated chronic fatigue syndrome rats and normal rats were used as controls. Results from the forced swimming test, open field test, tail suspension test, real-time PCR, enzyme-linked immunosorbent assay, and western blot assay showed that moxibustion treatment decreased mRNA expression of corticotropin-releasing hormone in the hypothalamus, and adrenocorticotropic hormone and corticosterone levels in plasma, and markedly increased progranulin mRNA and protein expression in the hippocampus. These findings suggest that moxibustion may relieve the behavioral symptoms of chronic fatigue syndrome, at least in part, by modulating the hypothalamic-pituitary-adrenal axis and upregulating hippocampal progranulin.
Directory of Open Access Journals (Sweden)
Samad Akbarzadeh
2013-09-01
Full Text Available Background: Poly Cystic Ovary Syndrome (PCOS is the most commonly encountered endocrine gland disease affecting 5-10 present of women at their reproductive age. This syndrome is associated with type 2 diabetes, dyslipidemia, and obesity. Progranulin and relaxin are adipokins that are related with carbohydrate and lipid metabolism. Due to limited data about progranulin and relaxin plasma levels´ in women with PCOS and normal BMI, this study was conducted. Material and Methods: This study is a cross-sectional. During the study 39 women with PCOS and BMI< 25 on the basis of Rotterdam criteria were chosen as the patient group and 38 healthy women were selected as the control group. The concentration of progranulin and relaxin were measured by ELISA technique. Results: The difference in Plasma concentration of progranulin and relaxin, and also some of the biochemical parameters in the patient group versus to the control group was not significant, but there was significant difference in the concentrations of VLDL, triglyceride (p=0.046, insulin (p=0.016, HOMA-IR (p=0.015, testosterone (p=0.01, and DHEAS (p=0.034 in the patients group compared to the control group. Conclusion: In this study, the difference in Plasma concentration of progranulin and relaxin in the patient group compared to the control group was not significant. It could be inferred that lack of change in plasma level of progranulin and relaxin in women with PCOS is related to BMI<25 and FBS<110. Moreoverestosterones, insulin, DHEAS and HOMA-IR changes could be better predictors of PCOS and its associated diabetes.
Ersoy, Ali Ozgur; Tokmak, Aytekin; Ozler, Sibel; Oztas, Efser; Ersoy, Ebru; Celik, Huseyin Tugrul; Erdamar, Husamettin; Yilmaz, Nafiye
2016-08-01
Polycystic ovary syndrome (PCOS) is an important disease that may alter metabolic balances of the whole body. Progranulin is a growth factor which is related to epithelial, neuronal growth and oogenesis. Here, we aimed to investigate the diagnostic value of the levels of Progranulin in the clinical setting of PCOS, and its metabolic effects. Forty-one adolescents and young women with PCOS and 39 age and body mass index matched adolescents and young women as a control group who attended to the youth center of a tertiary referral center were included in this cross-sectional case-control study. Progranulin levels, indices of insulin sensitivity, lipidemic markers, metabolic syndrome (MetS) criteria were compared between the groups. Progranulin levels in patients with PCOS (7.48 ± 1.93 ng/mL) were significantly higher than in the control group (6.25 ± 1.98 ng/mL) (p = 0.006). Luteinizing hormone (LH) levels, LH/Follicle stimulating hormone (FSH) ratios, free testosterone, dehydroepiandrosterone sulfate (DHEAS), C-reactive protein (CRP) levels in patients with PCOS were significantly higher than in the control group (p progranulin levels of patients diagnosed with PCOS (p = 0.008). Progranulin may be a novel biomarker for cardiovascular risk in patients with PCOS, thus these cases should be directed to close follow-up for possible cardiovascular diseases. Future larger studies should focus on this entity.
Directory of Open Access Journals (Sweden)
Hua Qu
2013-01-01
Full Text Available Insulin resistance (IR is considered to be one of the most important pathogenesis of glycolipid metabolism disorders. However, the molecular mechanism responsible for IR is not fully understood. Recently, the chronic inflammation has been proposed to be involved in the pathogenesis of IR. In this study, we aim to investigate the concentrations of plasma progranulin in Chinese patients with obesity (OB and type 2 diabetes mellitus (T2DM, and its relationship to IR. Plasma progranulin concentrations were significantly higher in the T2DM patients than in the normal glucose tolerant (NGT subjects (. Within the T2DM and the NGT patients, the concentrations of progranulin were significantly higher in obese subjects than that in the normal weight subjects (225.22 ± 34.39 ng/mL versus 195.59 ± 50.47 ng/mL and 183.79 ± 61.63 ng/mL versus 148.69 ± 55.27 ng/mL, . Plasma progranulin concentrations correlated positively with weight, waist circumferences, BMI, HbA1c, TG, IL-6, FINS and HOMA-IR (, while correlated negatively with HOMA-β (. Multiple linear regression analysis showed that BMI, HbA1c, IL-6 and TG correlated independently with circulating progranulin concentrations (. These results suggested that Plasma progranulin concentrations were higher in Chinese patients with type 2 diabetes and obesity and correlated closely with glycolipid metabolism, chronic inflammation and IR.
Directory of Open Access Journals (Sweden)
Jackalina M Van Kampen
Full Text Available Progranulin (PGRN is a multifunctional protein that is widely expressed throughout the brain, where it has been shown to act as a critical regulator of CNS inflammation and also functions as an autocrine neuronal growth factor, important for long-term neuronal survival. PGRN has been shown to activate cell signaling pathways regulating excitoxicity, oxidative stress, and synaptogenesis, as well as amyloidogenesis. Together, these critical roles in the CNS suggest that PGRN has the potential to be an important therapeutic target for the treatment of various neurodegenerative disorders, particularly Alzheimer's disease (AD. AD is the leading cause of dementia and is marked by the appearance of extracellular plaques consisting of aggregates of amyloid-β (Aβ, as well as neuroinflammation, oxidative stress, neuronal loss and synaptic atrophy. The ability of PGRN to target multiple key features of AD pathophysiology suggests that enhancing its expression may benefit this disease. Here, we describe the application of PGRN gene transfer using in vivo delivery of lentiviral expression vectors in a transgenic mouse model of AD. Viral vector delivery of the PGRN gene effectively enhanced PGRN expression in the hippocampus of Tg2576 mice. This elevated PGRN expression significantly reduced amyloid plaque burden in these mice, accompanied by reductions in markers of inflammation and synaptic atrophy. The overexpression of PGRN was also found to increase activity of neprilysin, a key amyloid beta degrading enzyme. PGRN regulation of neprilysin activity could play a major role in the observed alterations in plaque burden. Thus, PGRN may be an effective therapeutic target for the treatment of AD.
Alici Davutoğlu, Ebru; Akkaya Firat, Asuman; Ozel, Ayşegül; Yılmaz, Nevin; Uzun, Isil; Temel Yuksel, Ilkbal; Madazlı, Riza
2018-08-01
To determine the serum levels of HIF-1 α, progranulin, and syndecan-1 in preeclampsia (PE) and normal pregnancy, and to compare whether these markers demonstrate any difference between early-onset PE (EO-PE) and late-onset PE (LO-PE). This cross-sectional study was conducted on 27 women with EO-PE, 27 women with LO-PE, and 26 healthy normotensive pregnant controls matched for gestational age. Maternal levels of serum HIF-1 α, progranulin, and syndecan-1 were measured with the use of an enzyme-linked immunosorbent assay kit. Statistical analysis revealed significant differences between the control and the PE groups in progranulin (p progranulin levels were significantly higher in LO-PE compared with the other two groups (EO-PE versus LO-PE and LO-PE versus controls p = .000). Control group presented significantly higher syndecan-1 levels, than EO and LO-PE (p progranulin levels (r = .439, p= .000). Serum progranulin may have potential to be used as a biomarker for the differentiation of EO-PE and LO-PE. The co-operative action between HIF-1 α and progranulin might play a key role in the pathogenesis of LO-PE. The predominant feature of LO-PE seems to be an inflammatory process, whereas in EO-PE placentation problem seems to be the main pathology.
Toh, Huishi; Cao, Mingju; Daniels, Eugene; Bateman, Andrew
2013-01-01
Progranulin is a secreted glycoprotein that regulates cell proliferation, migration and survival. It has roles in development, tumorigenesis, wound healing, neurodegeneration and inflammation. Endothelia in tumors, wounds and placenta express elevated levels of progranulin. In culture, progranulin activates endothelial proliferation and migration. This suggested that progranulin might regulate angiogenesis. It was, however, unclear how elevated endothelial progranulin levels influence vascular growth in vivo. To address this issue, we generated mice with progranulin expression targeted specifically to developing endothelial cells using a Tie2-promoter/enhancer construct. Three Tie2-Grn mouse lines were generated with varying Tie2-Grn copy number, and were called GrnLo, GrnMid, and GrnHi. All three lines showed increased mortality that correlates with Tie2-Grn copy number, with greatest mortality and lowest germline transmission in the GrnHi line. Death of the transgenic animals occurred around birth, and continued for three days after birth. Those that survived beyond day 3 survived into adulthood. Transgenic neonates that died showed vascular abnormalities of varying severity. Some exhibited bleeding into body cavities such as the pericardial space. Smaller localized hemorrhages were seen in many organs. Blood vessels were often dilated and thin-walled. To establish the development of these abnormalities, we examined mice at early (E10.5-14.5) and later (E15.5-17.5) developmental phases. Early events during vasculogenesis appear unaffected by Tie2-Grn as apparently normal primary vasculature had been established at E10.5. The earliest onset of vascular abnormality was at E15.5, with focal cerebral hemorrhage and enlarged vessels in various organs. Aberrant Tie2-Grn positive vessels showed thinning of the basement membrane and reduced investiture with mural cells. We conclude that progranulin promotes exaggerated vessel growth in vivo, with subsequent effects in
Directory of Open Access Journals (Sweden)
Huishi Toh
Full Text Available Progranulin is a secreted glycoprotein that regulates cell proliferation, migration and survival. It has roles in development, tumorigenesis, wound healing, neurodegeneration and inflammation. Endothelia in tumors, wounds and placenta express elevated levels of progranulin. In culture, progranulin activates endothelial proliferation and migration. This suggested that progranulin might regulate angiogenesis. It was, however, unclear how elevated endothelial progranulin levels influence vascular growth in vivo. To address this issue, we generated mice with progranulin expression targeted specifically to developing endothelial cells using a Tie2-promoter/enhancer construct. Three Tie2-Grn mouse lines were generated with varying Tie2-Grn copy number, and were called GrnLo, GrnMid, and GrnHi. All three lines showed increased mortality that correlates with Tie2-Grn copy number, with greatest mortality and lowest germline transmission in the GrnHi line. Death of the transgenic animals occurred around birth, and continued for three days after birth. Those that survived beyond day 3 survived into adulthood. Transgenic neonates that died showed vascular abnormalities of varying severity. Some exhibited bleeding into body cavities such as the pericardial space. Smaller localized hemorrhages were seen in many organs. Blood vessels were often dilated and thin-walled. To establish the development of these abnormalities, we examined mice at early (E10.5-14.5 and later (E15.5-17.5 developmental phases. Early events during vasculogenesis appear unaffected by Tie2-Grn as apparently normal primary vasculature had been established at E10.5. The earliest onset of vascular abnormality was at E15.5, with focal cerebral hemorrhage and enlarged vessels in various organs. Aberrant Tie2-Grn positive vessels showed thinning of the basement membrane and reduced investiture with mural cells. We conclude that progranulin promotes exaggerated vessel growth in vivo, with
Gene cluster statistics with gene families.
Raghupathy, Narayanan; Durand, Dannie
2009-05-01
Identifying genomic regions that descended from a common ancestor is important for understanding the function and evolution of genomes. In distantly related genomes, clusters of homologous gene pairs are evidence of candidate homologous regions. Demonstrating the statistical significance of such "gene clusters" is an essential component of comparative genomic analyses. However, currently there are no practical statistical tests for gene clusters that model the influence of the number of homologs in each gene family on cluster significance. In this work, we demonstrate empirically that failure to incorporate gene family size in gene cluster statistics results in overestimation of significance, leading to incorrect conclusions. We further present novel analytical methods for estimating gene cluster significance that take gene family size into account. Our methods do not require complete genome data and are suitable for testing individual clusters found in local regions, such as contigs in an unfinished assembly. We consider pairs of regions drawn from the same genome (paralogous clusters), as well as regions drawn from two different genomes (orthologous clusters). Determining cluster significance under general models of gene family size is computationally intractable. By assuming that all gene families are of equal size, we obtain analytical expressions that allow fast approximation of cluster probabilities. We evaluate the accuracy of this approximation by comparing the resulting gene cluster probabilities with cluster probabilities obtained by simulating a realistic, power-law distributed model of gene family size, with parameters inferred from genomic data. Surprisingly, despite the simplicity of the underlying assumption, our method accurately approximates the true cluster probabilities. It slightly overestimates these probabilities, yielding a conservative test. We present additional simulation results indicating the best choice of parameter values for data
Tsuruma, Kazuhiro; Yamauchi, Mika; Sugitani, Sou; Otsuka, Tomohiro; Ohno, Yuta; Nagahara, Yuki; Ikegame, Yuka; Shimazawa, Masamitsu; Yoshimura, Shinichi; Iwama, Toru; Hara, Hideaki
2014-01-01
Adipose tissue stromal vascular fraction contains mesenchymal stem cells, which show protective effects when administered to damaged tissues, mainly through secreted trophic factors. We examined the protective effects of adipose-derived stem cells (ASCs) and ASC-conditioned medium (ASC-CM) against retinal damage and identified the neuroprotective factors in ASC-CM. ASCs and mature adipocytes were isolated from mouse subcutaneous tissue. ASCs were injected intravitreally in a mouse model of light-induced retinal damage, and ASC injection recovered retinal function as measured by electroretinogram and inhibited outer nuclear layer, thinning, without engraftment of ASCs. ASC-CM and mature adipocyte-conditioned medium were collected after 72 hours of culture. In vitro, H2O2- and light-induced cell death was reduced in a photoreceptor cell line with ASC-CM but not with mature adipocyte-conditioned medium. In vivo, light-induced photoreceptor damage was evaluated by measurement of outer nuclear layer thickness at 5 days after light exposure and by electroretinogram recording. ASC-CM significantly inhibited photoreceptor degeneration and retinal dysfunction after light exposure. Progranulin was identified as a major secreted protein of ASCs that showed protective effects against retinal damage in vitro and in vivo. Furthermore, progranulin phosphorylated extracellular signal-regulated kinase, cAMP response element binding protein, and hepatocyte growth factor receptor, and protein kinase C signaling pathways were involved in the protective effects of progranulin. These findings suggest that ASC-CM and progranulin have neuroprotective effects in the light-induced retinal-damage model. Progranulin may be a potential target for the treatment of the degenerative diseases of the retina.
Uesaka, Naofumi; Abe, Manabu; Konno, Kohtarou; Yamazaki, Maya; Sakoori, Kazuto; Watanabe, Takaki; Kao, Tzu-Huei; Mikuni, Takayasu; Watanabe, Masahiko; Sakimura, Kenji; Kano, Masanobu
2018-02-21
Elimination of redundant synapses formed early in development and strengthening of necessary connections are crucial for shaping functional neural circuits. Purkinje cells (PCs) in the neonatal cerebellum are innervated by multiple climbing fibers (CFs) with similar strengths. A single CF is strengthened whereas the other CFs are eliminated in each PC during postnatal development. The underlying mechanisms, particularly for the strengthening of single CFs, are poorly understood. Here we report that progranulin, a multi-functional growth factor implicated in the pathogenesis of frontotemporal dementia, strengthens developing CF synaptic inputs and counteracts their elimination from postnatal day 11 to 16. Progranulin derived from PCs acts retrogradely onto its putative receptor Sort1 on CFs. This effect is independent of semaphorin 3A, another retrograde signaling molecule that counteracts CF synapse elimination. We propose that progranulin-Sort1 signaling strengthens and maintains developing CF inputs, and may contribute to selection of single "winner" CFs that survive synapse elimination. Copyright © 2018 Elsevier Inc. All rights reserved.
The Caenorhabditis chemoreceptor gene families
Directory of Open Access Journals (Sweden)
Robertson Hugh M
2008-10-01
Full Text Available Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Conclusion Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.
The Caenorhabditis chemoreceptor gene families.
Thomas, James H; Robertson, Hugh M
2008-10-06
Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.
Daxer, Johann; Herttrich, Theresa; Zhao, Ying Y; Vogel, Mandy; Hiemisch, Andreas; Scheuermann, Kathrin; Körner, Antje; Kratzsch, Jürgen; Kiess, Wieland; Quante, Mirja
2017-01-01
Adipokines have been implicated in obesity, insulin resistance and sleep regulation. However, the role of chemerin and progranulin, two recently described adipokines, in the context of sleep remains unclear. The aim of this study was to compare nocturnal serum chemerin and progranulin levels between overweight/obese and normal-weight adolescents and to assess variations by sex, across different sleep stages and in relation to glucose metabolism. The study sample included 34 overweight/obese and 32 normal-weight adolescents from secondary schools and the Leipzig Research Center for Civilization Diseases (LIFE) Child study cohort. We obtained longitudinal serum adipokine levels during in-laboratory polysomnography followed by an oral glucose tolerance test. Overweight/obese adolescents had significantly higher mean nocturnal serum chemerin area under the curve (AUC) levels (348.2±133.3 vs. 241.7±67.7 vs. ng/mL×h, pprogranulin AUC was found between the groups. However, when assessing sex-specific levels, serum progranulin AUC levels were ~30% higher in overweight/obese males compared to overweight/obese females. Of note, nocturnal serum chemerin and progranulin AUC did not exhibit a correlation with markers of glucose metabolism or sleep stages. Collectively, we report a sexual dimorphism in nocturnal progranulin and chemerin levels, which may help explain underlying differences in energy balance and body composition between males and females in the context of obesity.
Genetic and Clinical Features of Progranulin-Associated Frontotemporal Lobar Degeneration
Chen-Plotkin, A.S.; Martinez-Lage, M.; Sleiman, P.M.A.; Hu, W.; Greene, R.; Wood, E.M.; Bing, S.X.; Grossman, M.; Schellenberg, G.D.; Hatanpaa, K.J.; Weiner, M.F.; White, C.L.; Brooks, W.S.; Halliday, G.M.; Kril, J.J.; Gearing, M.; Beach, T.G.; Graff-Radford, N.R.; Dickson, D.W.; Rademakers, R.; Boeve, B.F.; Pickering-Brown, S.M.; Snowden, J.; van Swieten, J.C.; Heutink, P.; Seelaar, H.; Murrell, J.R.; Ghetti, B.; Spina, S.; Grafman, J.; Kaye, J.A.; Woltjer, R.L.; Mesulam, M.; Bigio, E.; Llado, A.; Miller, B.L.; Alzualde, A.; Moreno, F.; Rohrer, J.D.; Mackenzie, I.R.A.; Feldman, H.H.; Hamilton, R.L.; Cruts, M.; Engelborghs, S.; de Deyn, P.P.; Van Broeckhoven, C.; Bird, T.D.; Cairns, N.J.; Goate, A.; Frosch, M.P.; Riederer, P.F.; Bogdanovic, N.; Lee, V.M.Y.; Trojanowski, J.Q.; Van Deerlin, V.M.
2011-01-01
Objective: To assess the relative frequency of unique mutations and their associated characteristics in 97 individuals with mutations in progranulin (GRN), an important cause of frontotemporal lobar degeneration (FTLD). Participants and Design: A 46-site International Frontotemporal Lobar
Genome-Wide Comparative Gene Family Classification
Frech, Christian; Chen, Nansheng
2010-01-01
Correct classification of genes into gene families is important for understanding gene function and evolution. Although gene families of many species have been resolved both computationally and experimentally with high accuracy, gene family classification in most newly sequenced genomes has not been done with the same high standard. This project has been designed to develop a strategy to effectively and accurately classify gene families across genomes. We first examine and compare the performance of computer programs developed for automated gene family classification. We demonstrate that some programs, including the hierarchical average-linkage clustering algorithm MC-UPGMA and the popular Markov clustering algorithm TRIBE-MCL, can reconstruct manual curation of gene families accurately. However, their performance is highly sensitive to parameter setting, i.e. different gene families require different program parameters for correct resolution. To circumvent the problem of parameterization, we have developed a comparative strategy for gene family classification. This strategy takes advantage of existing curated gene families of reference species to find suitable parameters for classifying genes in related genomes. To demonstrate the effectiveness of this novel strategy, we use TRIBE-MCL to classify chemosensory and ABC transporter gene families in C. elegans and its four sister species. We conclude that fully automated programs can establish biologically accurate gene families if parameterized accordingly. Comparative gene family classification finds optimal parameters automatically, thus allowing rapid insights into gene families of newly sequenced species. PMID:20976221
Diaz-Cueto, Laura; Arechavaleta-Velasco, Fabian; Diaz-Arizaga, Adriana; Dominguez-Lopez, Pablo; Robles-Flores, Martha
2012-07-01
Overexpression of progranulin (also named acrogranin, PC-cell-derived growth factor, or granulin-epithelin precursor) is associated with ovarian cancer, specifically with cell proliferation, malignancy, chemoresistance, and shortened overall survival. The objective of the current study is to identify the signaling pathways involved in the regulation of progranulin expression in ovarian cancer cell lines. We studied the relation of protein kinase C (PKC), phosphatidylinositol 3-kinase, protein kinase A, P38, extracellular signal-regulated kinase, and Akt pathways on the modulation of progranulin expression levels in NIH-OVCAR-3 and SK-OV-3 ovarian cancer cell lines. The different pathways were examined using pharmacological inhibitors (calphostin C, LY294002, H89, SB203580, PD98059, and Akt Inhibitor), and mRNA and protein progranulin expression were analyzed by reverse transcriptase polymerase chain reaction and Western blot techniques, respectively. Inhibition of PKC signal transduction pathway by calphostin C decreased in a dose-dependent manner protein but not mRNA levels of progranulin in both ovarian cancer cell lines. LY294002 but not wortmannin, which are phosphatidylinositol 3-kinase inhibitors, also diminished the expression of progranulin in both cell lines. In addition, LY294002 treatment produced a significant reduction in cell viability. Inhibition of protein kinase A, P38, extracellular signal-regulated kinase, and Akt did not affect progranulin protein expression. These results suggest that the PKC signaling is involved in the regulation of progranulin protein expression in 2 different ovarian cancer cell lines. Inhibiting these intracellular signal transduction pathways may provide a future therapeutic target for hindering the cellular proliferation and invasion in ovarian cancer produced by progranulin.
Hafler, Brian P.; Klein, Zoe A.; Zhou, Z. Jimmy; Strittmatter, Stephen M.
2014-01-01
Prior investigations have shown that patients with neuronal ceroid lipofuscinosis (NCL) develop neurodegeneration characterized by vision loss, motor dysfunction, seizures, and often early death. Neuropathological analysis of patients with NCL shows accumulation of intracellular autofluorescent storage material, lipopigment, throughout neurons in the central nervous system including in the retina. A recent study of a sibling pair with adult onset NCL and retinal degeneration showed linkage to the region of the progranulin (GRN) locus and a homozygous mutation was demonstrated in GRN. In particular, the sibling pair with a mutation in GRN developed retinal degeneration and optic atrophy. This locus for this form of adult onset neuronal ceroid lipofuscinosis was designated neuronal ceroid lipofuscinosis-11 (CLN11). Based on these clinical observations, we wished to determine whether Grn-null mice develop accumulation of autofluorescent particles and retinal degeneration. Retinas of both wild-type and Progranulin deficient mice were examined by immunostaining and autofluorescence. Accumulation of autofluorescent material was present in Progranulin deficient mice at 12 months. Degeneration of multiple classes of neurons including photoreceptors and retinal ganglion cells was noted in mice at 12 and 18 months. Our data shows that Grn−/− mice develop degenerative pathology similar to features of human CLN11. PMID:25234724
Directory of Open Access Journals (Sweden)
Rosalia E Napitupulu
2013-08-01
Full Text Available BACKGROUND: Obesity is closely related to chronic, low grade systemic inflammation (metaflammation and it leads to further metabolic complications such as hypertension, atherosclerosis, and type 2 diabetes due to the adipocytokine imbalance. This study was carried out to assess the correlation between progranulin, granulin, adiponectin and visceral adipose tissue-derived serine protease inhibitor (Vaspin with metaflammation (high sensitivity C-reactive protein (hs-CRP in centrally obese men. METHODS: This study was observational with a cross sectional design involving 60 men aged 30-60 years, consisted of 43 obese men (waist circumference (WC ≥90 cm and 13 non obese men (WC 105 cm. CONCLUSIONS: We found metaflammation (hs-CRP was significantly correlated with Vaspin, but not with progranulin, granulin and adiponectin, in obese men. We suggest the possibility of a dynamic expression of adipokines related to WC that are subjected to adipocytes hypertrophy-hyperplasia phenomenon. KEYWORDS: progranulin, granulin, adiponectin, Vaspin, hs-CRP, metaflammation, central obesity.
Yoo, Hye Jin; Hwang, Soon Young; Hong, Ho Cheol; Choi, Hae Yoon; Yang, Sae Jeong; Choi, Dong Seop; Baik, Sei Hyun; Blüher, Matthias; Youn, Byung-Soo; Choi, Kyung Mook
2013-01-01
Progranulin and C1q/TNF-related protein-3 (CTRP3) were recently discovered as novel adipokines which may link obesity with altered regulation of glucose metabolism, chronic inflammation and insulin resistance. We examined circulating progranulin and CTRP3 concentrations in 127 subjects with (n = 44) or without metabolic syndrome (n = 83). Furthermore, we evaluated the relationship of progranulin and CTRP3 levels with inflammatory markers and cardiometabolic risk factors, including high-sensitivity C-reactive protein (hsCRP), interleukin-6 (IL-6), estimated glomerular filtration rate (eGFR), and adiponectin serum concentrations, as well as carotid intima-media thickness (CIMT). Circulating progranulin levels are significantly related with inflammatory markers, hsCRP (r = 0.30, P = 0.001) and IL-6 (r = 0.30, P = 0.001), whereas CTRP3 concentrations exhibit a significant association with cardiometabolic risk factors, including waist circumference (r = -0.21), diastolic blood pressure (r = -0.21), fasting glucose (r = -0.20), triglyceride (r = -0.34), total cholesterol (r = -0.25), eGFR (r = 0.39) and adiponectin (r = 0.26) levels. Serum progranulin concentrations were higher in patients with metabolic syndrome than those of the control group (199.55 [179.33, 215.53] vs. 185.10 [160.30, 204.90], P = 0.051) and the number of metabolic syndrome components had a significant positive correlation with progranulin levels (r = 0.227, P = 0.010). In multiple regression analysis, IL-6 and triglyceride levels were significant predictors of serum progranulin levels (R(2) = 0.251). Furthermore, serum progranulin level was an independent predictor for increased CIMT in subjects without metabolic syndrome after adjusting for other cardiovascular risk factors (R(2) = 0.365). Serum progranulin levels are significantly associated with systemic inflammatory markers and were an independent predictor for
Directory of Open Access Journals (Sweden)
Hye Jin Yoo
Full Text Available Progranulin and C1q/TNF-related protein-3 (CTRP3 were recently discovered as novel adipokines which may link obesity with altered regulation of glucose metabolism, chronic inflammation and insulin resistance.We examined circulating progranulin and CTRP3 concentrations in 127 subjects with (n = 44 or without metabolic syndrome (n = 83. Furthermore, we evaluated the relationship of progranulin and CTRP3 levels with inflammatory markers and cardiometabolic risk factors, including high-sensitivity C-reactive protein (hsCRP, interleukin-6 (IL-6, estimated glomerular filtration rate (eGFR, and adiponectin serum concentrations, as well as carotid intima-media thickness (CIMT.Circulating progranulin levels are significantly related with inflammatory markers, hsCRP (r = 0.30, P = 0.001 and IL-6 (r = 0.30, P = 0.001, whereas CTRP3 concentrations exhibit a significant association with cardiometabolic risk factors, including waist circumference (r = -0.21, diastolic blood pressure (r = -0.21, fasting glucose (r = -0.20, triglyceride (r = -0.34, total cholesterol (r = -0.25, eGFR (r = 0.39 and adiponectin (r = 0.26 levels. Serum progranulin concentrations were higher in patients with metabolic syndrome than those of the control group (199.55 [179.33, 215.53] vs. 185.10 [160.30, 204.90], P = 0.051 and the number of metabolic syndrome components had a significant positive correlation with progranulin levels (r = 0.227, P = 0.010. In multiple regression analysis, IL-6 and triglyceride levels were significant predictors of serum progranulin levels (R(2 = 0.251. Furthermore, serum progranulin level was an independent predictor for increased CIMT in subjects without metabolic syndrome after adjusting for other cardiovascular risk factors (R(2 = 0.365.Serum progranulin levels are significantly associated with systemic inflammatory markers and were an independent predictor for atherosclerosis in
Learning and memory in mice with neuropathic pain: impact of old age and progranulin deficiency
Directory of Open Access Journals (Sweden)
Boris eAlbuquerque
2013-11-01
Full Text Available Persistent neuropathic pain is a frequent consequence of peripheral nerve injuries, particularly in the elderly. Using the IntelliCage we studied if a sciatic nerve injury obstructed learning and memory in young and aged mice, each in wild type and progranulin deficient mice, which develop premature signs of brain aging and are more susceptible to nerve injury evoked nociceptive hypersensitivity and hence allow to assess a potential mutual aggravation of pain and old age. Both young and aged mice developed long-term nerve injury-evoked hyperalgesia and allodynia but, in both genotypes, only aged mice with neuropathic pain showed high error rates in place avoidance acquisition tasks. Once learnt however, aged mice with neuropathic pain maintained the aversive memory longer, i.e. the extinction was significantly slowed. In addition, nerve injury in progranulin deficient mice impaired the learning of spatial sequences of awarded places, particularly in aged mice, whereas easy place preference learning was not affected by nerve injury or progranulin deficiency. The sequencing task required a discrimination of clockwise and anti-clockwise sequences and spatial flexibility to re-learn a novel sequence. The loss of spatial flexibility did not occur in sham operated mice, i.e. was a consequence of nerve injury and suggests that neuropathic pain accelerates manifestations of old age and progranulin deficiency. Neuropathic pain at old age, irrespective of the genotype, resulted in a long maintenance of aversive memory suggesting a negative alliance and possibly mutual aggravation of chronic neuropathic pain and aversive memory at old age.
Lipidomic and Transcriptomic Basis of Lysosomal Dysfunction in Progranulin Deficiency
Directory of Open Access Journals (Sweden)
Bret M. Evers
2017-09-01
Full Text Available Defective lysosomal function defines many neurodegenerative diseases, such as neuronal ceroid lipofuscinoses (NCL and Niemann-Pick type C (NPC, and is implicated in Alzheimer’s disease (AD and frontotemporal lobar degeneration (FTLD-TDP with progranulin (PGRN deficiency. Here, we show that PGRN is involved in lysosomal homeostasis and lipid metabolism. PGRN deficiency alters lysosome abundance and morphology in mouse neurons. Using an unbiased lipidomic approach, we found that brain lipid composition in humans and mice with PGRN deficiency shows disease-specific differences that distinguish them from normal and other pathologic groups. PGRN loss leads to an accumulation of polyunsaturated triacylglycerides, as well as a reduction of diacylglycerides and phosphatidylserines in fibroblast and enriched lysosome lipidomes. Transcriptomic analysis of PGRN-deficient mouse brains revealed distinct expression patterns of lysosomal, immune-related, and lipid metabolic genes. These findings have implications for the pathogenesis of FTLD-TDP due to PGRN deficiency and suggest lysosomal dysfunction as an underlying mechanism.
Directory of Open Access Journals (Sweden)
Cui Liu
Full Text Available Atsttrin, a progranulin (PGRN-derived molecule composed of three TNFR-binding domains of PGRN, binds to TNF receptors (TNFR and is therapeutic against inflammatory arthritis. Here we screened the associations of Atsttrin and other members in TNFR subfamily, which led to the discovery of TNFRSF25 (DR3 as an additional Atsttrin-interacting member in TNFR family. Similar to TNFR1 and TNFR2, DR3 also directly bound to Atsttrin. The first three cysteine-rich domains (CRD in the extracellular portion of DR3 were required for this interaction. Atsttrin inhibited the interaction between DR3 and its TNF-Like Ligand 1A (TL1A. In addition, Atsttrin inhibited TL1A-stimulated target gene expressions and neutralized TL1A-enhanced osteoclastogenesis in vitro. Furthermore, Atsttrin ameliorated the pathology in dextran sulfate sodium induced colitis. Taken together, these findings not only provide the new insights into Atsttrin's therapeutic action in inflammatory arthritis, but may also present Atsttrin as a novel biological agent for treating various types of diseases associated with TL1A/DR3 pathway.
Sortilin-Mediated Endocytosis Determines Levels of the Fronto-Temporal Dementia Protein, Progranulin
DEFF Research Database (Denmark)
Hu, Fenghua; Padukkavidana, Thihan; Vægter, Christian Bjerggaard
2010-01-01
The most common inherited form of Fronto-Temporal Lobar Degeneration (FTLD) known stems from Progranulin (GRN) mutation, and exhibits TDP-43 plus ubiquitin protein aggregates in brain. Despite the causative role of GRN haploinsufficiency in FTLD-TDP, the neurobiology of this secreted glycoprotein...
Directory of Open Access Journals (Sweden)
Spalletta Gianfranco
2011-06-01
Full Text Available Abstract The progranulin gene (PGRN encodes a pleiotropic molecule with anti-inflammatory actions and neuronal protective effects. Accordingly, PGRN-deficient mice have been demonstrated to develop enhanced inflammation and progressive neurodegeneration. Loss of function mutations of the PGRN gene have been also reported to cause frontotemporal lobar degeneration (FTLD, a neurodegenerative disease leading to dementia generally in the presenium. Since neurodegeneration might be negatively impacted by chronic inflammation, the possible influence of PGRN defects on inflammatory pathways appears to be of great relevance for the understanding of neurodegeneration pathogenic processes in those patients. However, no data about the inflammatory profile of PGRN-defective subjects have been so far provided. In this study, we analyzed serum levels of the pro-inflammatory mediators IL-6, TNF-α and IL-18 in FTLD patients with or without PGRN mutations, at both pre-symptomatic and symptomatic stages. We provide evidence that circulating IL-6 is increased in PGRN-mutated FTLD patients, as compared to both PGRN non-mutated FTLD patients and controls. In contrast, levels of IL-6 were not altered in asymptomatic subjects carrying the PGRN mutations. Finally, TNF-α and IL-18 serum levels did not differ among all groups of included subjects. We conclude that the profile of circulating pro-inflammatory cytokines is altered in PGRN-related symptomatic FTLD. Thus, our findings point to IL-6 as a possible specific mediator and a potential therapeutic target in this monogenic disease, suggesting that an enhanced inflammatory response might be indeed involved in its progression.
Progranulin regulates lysosomal function and biogenesis through acidification of lysosomes.
Tanaka, Yoshinori; Suzuki, Genjiro; Matsuwaki, Takashi; Hosokawa, Masato; Serrano, Geidy; Beach, Thomas G; Yamanouchi, Keitaro; Hasegawa, Masato; Nishihara, Masugi
2017-03-01
Progranulin (PGRN) haploinsufficiency resulting from loss-of-function mutations in the PGRN gene causes frontotemporal lobar degeneration accompanied by TDP-43 accumulation, and patients with homozygous mutations in the PGRN gene present with neuronal ceroid lipofuscinosis. Although it remains unknown why PGRN deficiency causes neurodegenerative diseases, there is increasing evidence that PGRN is implicated in lysosomal functions. Here, we show PGRN is a secretory lysosomal protein that regulates lysosomal function and biogenesis by controlling the acidification of lysosomes. PGRN gene expression and protein levels increased concomitantly with the increase of lysosomal biogenesis induced by lysosome alkalizers or serum starvation. Down-regulation or insufficiency of PGRN led to the increased lysosomal gene expression and protein levels, while PGRN overexpression led to the decreased lysosomal gene expression and protein levels. In particular, the level of mature cathepsin D (CTSDmat) dramatically changed depending upon PGRN levels. The acidification of lysosomes was facilitated in cells transfected with PGRN. Then, this caused degradation of CTSDmat by cathepsin B. Secreted PGRN is incorporated into cells via sortilin or cation-independent mannose 6-phosphate receptor, and facilitated the acidification of lysosomes and degradation of CTSDmat. Moreover, the change of PGRN levels led to a cell-type-specific increase of insoluble TDP-43. In the brain tissue of FTLD-TDP patients with PGRN deficiency, CTSD and phosphorylated TDP-43 accumulated in neurons. Our study provides new insights into the physiological function of PGRN and the role of PGRN insufficiency in the pathogenesis of neurodegenerative diseases. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Nguyen, Andrew D; Nguyen, Thi A; Zhang, Jiasheng; Devireddy, Swathi; Zhou, Ping; Karydas, Anna M; Xu, Xialian; Miller, Bruce L; Rigo, Frank; Ferguson, Shawn M; Huang, Eric J; Walther, Tobias C; Farese, Robert V
2018-03-20
Frontotemporal dementia (FTD) is the most common neurodegenerative disorder in individuals under age 60 and has no treatment or cure. Because many cases of FTD result from GRN nonsense mutations, an animal model for this type of mutation is highly desirable for understanding pathogenesis and testing therapies. Here, we generated and characterized Grn R493X knockin mice, which model the most common human GRN mutation, a premature stop codon at arginine 493 (R493X). Homozygous Grn R493X mice have markedly reduced Grn mRNA levels, lack detectable progranulin protein, and phenocopy Grn knockout mice, with CNS microgliosis, cytoplasmic TDP-43 accumulation, reduced synaptic density, lipofuscinosis, hyperinflammatory macrophages, excessive grooming behavior, and reduced survival. Inhibition of nonsense-mediated mRNA decay (NMD) by genetic, pharmacological, or antisense oligonucleotide-based approaches showed that NMD contributes to the reduced mRNA levels in Grn R493X mice and cell lines and in fibroblasts from patients containing the GRN R493X mutation. Moreover, the expressed truncated R493X mutant protein was functional in several assays in progranulin-deficient cells. Together, these findings establish a murine model for in vivo testing of NMD inhibition or other therapies as potential approaches for treating progranulin deficiency caused by the R493X mutation. Copyright © 2018 the Author(s). Published by PNAS.
Progranulin regulates neurogenesis in the developing vertebrate retina.
Walsh, Caroline E; Hitchcock, Peter F
2017-09-01
We evaluated the expression and function of the microglia-specific growth factor, Progranulin-a (Pgrn-a) during developmental neurogenesis in the embryonic retina of zebrafish. At 24 hpf pgrn-a is expressed throughout the forebrain, but by 48 hpf pgrn-a is exclusively expressed by microglia and/or microglial precursors within the brain and retina. Knockdown of Pgrn-a does not alter the onset of neurogenic programs or increase cell death, however, in its absence, neurogenesis is significantly delayed-retinal progenitors fail to exit the cell cycle at the appropriate developmental time and postmitotic cells do not acquire markers of terminal differentiation, and microglial precursors do not colonize the retina. Given the link between Progranulin and cell cycle regulation in peripheral tissues and transformed cells, we analyzed cell cycle kinetics among retinal progenitors following Pgrn-a knockdown. Depleting Pgrn-a results in a significant lengthening of the cell cycle. These data suggest that Pgrn-a plays a dual role during nervous system development by governing the rate at which progenitors progress through the cell cycle and attracting microglial progenitors into the embryonic brain and retina. Collectively, these data show that Pgrn-a governs neurogenesis by regulating cell cycle kinetics and the transition from proliferation to cell cycle exit and differentiation. © 2017 The Authors. Developmental Neurobiology Published by Wiley Periodicals, Inc. Develop Neurobiol 77: 1114-1129, 2017. © 2017 The Authors. Developmental Neurobiology Published by Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Maria V. Fernández
2018-04-01
Full Text Available Gene-based tests to study the combined effect of rare variants on a particular phenotype have been widely developed for case-control studies, but their evolution and adaptation for family-based studies, especially studies of complex incomplete families, has been slower. In this study, we have performed a practical examination of all the latest gene-based methods available for family-based study designs using both simulated and real datasets. We examined the performance of several collapsing, variance-component, and transmission disequilibrium tests across eight different software packages and 22 models utilizing a cohort of 285 families (N = 1,235 with late-onset Alzheimer disease (LOAD. After a thorough examination of each of these tests, we propose a methodological approach to identify, with high confidence, genes associated with the tested phenotype and we provide recommendations to select the best software and model for family-based gene-based analyses. Additionally, in our dataset, we identified PTK2B, a GWAS candidate gene for sporadic AD, along with six novel genes (CHRD, CLCN2, HDLBP, CPAMD8, NLRP9, and MAS1L as candidate genes for familial LOAD.
Progranulin Levels in Plasma and Cerebrospinal Fluid in Granulin Mutation Carriers
Directory of Open Access Journals (Sweden)
Lieke H.H. Meeter
2016-07-01
Full Text Available Background: Pathogenic mutations in the granulin gene (GRN are causative in 5-10% of patients with frontotemporal dementia (FTD, mostly leading to reduced progranulin protein (PGRN levels. Upcoming therapeutic trials focus on enhancing PGRN levels. Methods: Fluctuations in plasma PGRN (n = 41 and its relationship with cerebrospinal fluid (CSF, n = 32 and specific single nucleotide polymorphisms were investigated in pre- and symptomatic GRN mutation carriers and controls. Results: Plasma PGRN levels were lower in carriers than in controls and showed a mean coefficient of variation of 5.3% in carriers over 1 week. Although plasma PGRN correlated with CSF PGRN in carriers (r = 0.54, p = 0.02, plasma only explained 29% of the variability in CSF PGRN. rs5848, rs646776 and rs1990622 genotypes only partly explained the variability of PGRN levels between subjects. Conclusions: Plasma PGRN is relatively stable over 1 week and therefore seems suitable for treatment monitoring of PGRN-enhancing agents. Since plasma PGRN only moderately correlated with CSF PGRN, CSF sampling will additionally be needed in therapeutic trials.
The role of retrotransposons in gene family expansions: insights from the mouse Abp gene family.
Janoušek, Václav; Karn, Robert C; Laukaitis, Christina M
2013-05-29
Retrotransposons have been suggested to provide a substrate for non-allelic homologous recombination (NAHR) and thereby promote gene family expansion. Their precise role, however, is controversial. Here we ask whether retrotransposons contributed to the recent expansions of the Androgen-binding protein (Abp) gene families that occurred independently in the mouse and rat genomes. Using dot plot analysis, we found that the most recent duplication in the Abp region of the mouse genome is flanked by L1Md_T elements. Analysis of the sequence of these elements revealed breakpoints that are the relicts of the recombination that caused the duplication, confirming that the duplication arose as a result of NAHR using L1 elements as substrates. L1 and ERVII retrotransposons are considerably denser in the Abp regions than in one Mb flanking regions, while other repeat types are depleted in the Abp regions compared to flanking regions. L1 retrotransposons preferentially accumulated in the Abp gene regions after lineage separation and roughly followed the pattern of Abp gene expansion. By contrast, the proportion of shared vs. lineage-specific ERVII repeats in the Abp region resembles the rest of the genome. We confirmed the role of L1 repeats in Abp gene duplication with the identification of recombinant L1Md_T elements at the edges of the most recent mouse Abp gene duplication. High densities of L1 and ERVII repeats were found in the Abp gene region with abrupt transitions at the region boundaries, suggesting that their higher densities are tightly associated with Abp gene duplication. We observed that the major accumulation of L1 elements occurred after the split of the mouse and rat lineages and that there is a striking overlap between the timing of L1 accumulation and expansion of the Abp gene family in the mouse genome. Establishing a link between the accumulation of L1 elements and the expansion of the Abp gene family and identification of an NAHR-related breakpoint in
Goossens, Joery; Bjerke, Maria; Van Mossevelde, Sara; Van den Bossche, Tobi; Goeman, Johan; De Vil, Bart; Sieben, Anne; Martin, Jean-Jacques; Cras, Patrick; De Deyn, Peter Paul; Van Broeckhoven, Christine; van der Zee, Julie; Engelborghs, Sebastiaan
2018-03-20
We explored the diagnostic performance of cerebrospinal fluid (CSF) biomarkers in allowing differentiation between frontotemporal lobar degeneration (FTLD) and Alzheimer's disease (AD), as well as between FTLD pathological subtypes. CSF levels of routine AD biomarkers (phosphorylated tau (p-tau 181 ), total tau (t-tau), and amyloid-beta (Aβ) 1-42 ) and neurofilament proteins, as well as progranulin levels in both CSF and serum were quantified in definite FTLD (n = 46), clinical AD (n = 45), and cognitively healthy controls (n = 20). FTLD subgroups were defined by genetic carrier status and/or postmortem neuropathological confirmation (FTLD-TDP: n = 34, including FTLD-C9orf72: n = 19 and FTLD-GRN: n = 9; FTLD-tau: n = 10). GRN mutation carriers had significantly lower progranulin levels compared to other FTLD patients, AD, and controls. Both t-tau and p-tau 181 were normal in FTLD patients, even in FTLD-tau. Aβ 1-42 levels were very variable in FTLD. Neurofilament light chain (Nf-L) was significantly higher in FTLD compared with AD and controls. The reference logistic regression model based on the established AD biomarkers could be improved by the inclusion of CSF Nf-L, which was also important for the differentiation between FTLD and controls. Within the FTLD cohort, no significant differences were found between FTLD-TDP and FTLD-tau, but GRN mutation carriers had higher t-tau and Nf-L levels than C9orf72 mutation carriers and FTLD-tau patients. There is an added value for Nf-L in the differential diagnosis of FTLD. Progranulin levels in CSF depend on mutation status, and GRN mutation carriers seem to be affected by more severe neurodegeneration.
Di, Chao; Xu, Wenying; Su, Zhen; Yuan, Joshua S
2010-10-07
PHB (Prohibitin) gene family is involved in a variety of functions important for different biological processes. PHB genes are ubiquitously present in divergent species from prokaryotes to eukaryotes. Human PHB genes have been found to be associated with various diseases. Recent studies by our group and others have shown diverse function of PHB genes in plants for development, senescence, defence, and others. Despite the importance of the PHB gene family, no comprehensive gene family analysis has been carried to evaluate the relatedness of PHB genes across different species. In order to better guide the gene function analysis and understand the evolution of the PHB gene family, we therefore carried out the comparative genome analysis of the PHB genes across different kingdoms. The relatedness, motif distribution, and intron/exon distribution all indicated that PHB genes is a relatively conserved gene family. The PHB genes can be classified into 5 classes and each class have a very deep evolutionary origin. The PHB genes within the class maintained the same motif patterns during the evolution. With Arabidopsis as the model species, we found that PHB gene intron/exon structure and domains are also conserved during the evolution. Despite being a conserved gene family, various gene duplication events led to the expansion of the PHB genes. Both segmental and tandem gene duplication were involved in Arabidopsis PHB gene family expansion. However, segmental duplication is predominant in Arabidopsis. Moreover, most of the duplicated genes experienced neofunctionalization. The results highlighted that PHB genes might be involved in important functions so that the duplicated genes are under the evolutionary pressure to derive new function. PHB gene family is a conserved gene family and accounts for diverse but important biological functions based on the similar molecular mechanisms. The highly diverse biological function indicated that more research needs to be carried out
Gene family size conservation is a good indicator of evolutionary rates.
Chen, Feng-Chi; Chen, Chiuan-Jung; Li, Wen-Hsiung; Chuang, Trees-Juen
2010-08-01
The evolution of duplicate genes has been a topic of broad interest. Here, we propose that the conservation of gene family size is a good indicator of the rate of sequence evolution and some other biological properties. By comparing the human-chimpanzee-macaque orthologous gene families with and without family size conservation, we demonstrate that genes with family size conservation evolve more slowly than those without family size conservation. Our results further demonstrate that both family expansion and contraction events may accelerate gene evolution, resulting in elevated evolutionary rates in the genes without family size conservation. In addition, we show that the duplicate genes with family size conservation evolve significantly more slowly than those without family size conservation. Interestingly, the median evolutionary rate of singletons falls in between those of the above two types of duplicate gene families. Our results thus suggest that the controversy on whether duplicate genes evolve more slowly than singletons can be resolved when family size conservation is taken into consideration. Furthermore, we also observe that duplicate genes with family size conservation have the highest level of gene expression/expression breadth, the highest proportion of essential genes, and the lowest gene compactness, followed by singletons and then by duplicate genes without family size conservation. Such a trend accords well with our observations of evolutionary rates. Our results thus point to the importance of family size conservation in the evolution of duplicate genes.
Directory of Open Access Journals (Sweden)
Baumgarten Andrew
2004-06-01
Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.
Hosaka, Takashi; Ishii, Kazuhiro; Miura, Takeshi; Mezaki, Naomi; Kasuga, Kensaku; Ikeuchi, Takeshi; Tamaoka, Akira
2017-09-15
Progranulin gene (GRN) mutations are major causes of frontotemporal lobar degeneration. To date, 68 pathogenic GRN mutations have been identified. However, very few of these mutations have been reported in Asians. Moreover, some GRN mutations manifest with familial phenotypic heterogeneity. Here, we present a novel GRN mutation resulting in frontotemporal lobar degeneration with a distinct clinical phenotype, and we review reports of GRN mutations associated with familial phenotypic heterogeneity. We describe the case of a 74-year-old woman with left frontotemporal lobe atrophy who presented with progressive anarthria and non-fluent aphasia. Her brother had been diagnosed with corticobasal syndrome (CBS) with right-hand limb-kinetic apraxia, aphasia, and a similar pattern of brain atrophy. Laboratory blood examinations did not reveal abnormalities that could have caused cognitive dysfunction. In the cerebrospinal fluid, cell counts and protein concentrations were within normal ranges, and concentrations of tau protein and phosphorylated tau protein were also normal. Since similar familial cases due to mutation of GRN and microtubule-associated protein tau gene (MAPT) were reported, we performed genetic analysis. No pathological mutations of MAPT were identified, but we identified a novel GRN frameshift mutation (c.1118_1119delCCinsG: p.Pro373ArgX37) that resulted in progranulin haploinsufficiency. This is the first report of a GRN mutation associated with familial phenotypic heterogeneity in Japan. Literature review of GRN mutations associated with familial phenotypic heterogeneity revealed no tendency of mutation sites. The role of progranulin has been reported in this and other neurodegenerative diseases, and the analysis of GRN mutations may lead to the discovery of a new therapeutic target.
Progranulin acts as a shared chaperone and regulates multiple lysosomal enzymes
Directory of Open Access Journals (Sweden)
Jinlong Jian
2017-09-01
Full Text Available Multifunctional factor progranulin (PGRN plays an important role in lysosomes, and its mutations and insufficiency are associated with lysosomal storage diseases, including neuronal ceroid lipofuscinosis and Gaucher disease (GD. The first breakthrough in understanding the molecular mechanisms of PGRN as regulator of lysosomal storage diseases came unexpectedly while investigating the role of PGRN in inflammation. Challenged PGRN null mice displayed typical features of GD. In addition, GRN gene variants were identified in GD patients and the serum levels of PGRN were significantly lower in GD patients. PGRN directly binds to and functions as a chaperone of the lysosomal enzyme β-glucocerebrosidase (GCaase, whose mutations cause GD. In addition, its C-terminus containing granulin E domain, termed Pcgin (PGRN C-terminus for GCase Interaction, is required for the association between PGRN and GCase. The concept that PGRN acts as a chaperone of lysosomal enzymes was further supported and extended by a recent article showing that PGRN acts as a chaperone molecule of lysosomal enzyme cathepsin D (CSTD, and the association between PGRN and CSTD is also mediated by PGRN's C-terminal granulin E domain. Collectively, these reports suggest that PGRN may act as a shared chaperone and regulates multiple lysosomal enzymes.
Directory of Open Access Journals (Sweden)
Carolina Alquezar
Full Text Available BACKGROUND: Mutations in the progranulin (PGRN gene, leading to haploinsufficiency, cause familial frontotemporal lobar degeneration (FTLD-TDP, although the pathogenic mechanism of PGRN deficit is largely unknown. Allelic loss of PGRN was previously shown to increase the activity of cyclin-dependent kinase (CDK CDK6/pRb pathway in lymphoblasts expressing the c.709-1G>A PGRN mutation. Since members of the CDK family appear to play a role in neurodegenerative disorders and in apoptotic death of neurons subjected to various insults, we investigated the role of CDK6/pRb in cell survival/death mechanisms following serum deprivation. METHODOLOGY/PRINCIPAL FINDINGS: We performed a comparative study of cell viability after serum withdrawal of established lymphoblastoid cell lines from control and carriers of c.709-1G>A PGRN mutation, asymptomatic and FTLD-TDP diagnosed individuals. Our results suggest that the CDK6/pRb pathway is enhanced in the c.709-1G>A bearing lymphoblasts. Apparently, this feature allows PGRN-deficient cells to escape from serum withdrawal-induced apoptosis by decreasing the activity of executive caspases and lowering the dissipation of mitochondrial membrane potential and the release of cytochrome c from the mitochondria. Inhibitors of CDK6 expression levels like sodium butyrate or the CDK6 activity such as PD332991 were able to restore the vulnerability of lymphoblasts from FTLD-TDP patients to trophic factor withdrawal. CONCLUSION/SIGNIFICANCE: The use of PGRN-deficient lymphoblasts from FTLD-TDP patients may be a useful model to investigate cell biochemical aspects of this disease. It is suggested that CDK6 could be potentially a therapeutic target for the treatment of the FTLD-TDP.
Interferon induced IFIT family genes in host antiviral defense.
Zhou, Xiang; Michal, Jennifer J; Zhang, Lifan; Ding, Bo; Lunney, Joan K; Liu, Bang; Jiang, Zhihua
2013-01-01
Secretion of interferons (IFNs) from virus-infected cells is a hallmark of host antiviral immunity and in fact, IFNs exert their antiviral activities through the induction of antiviral proteins. The IFN-induced protein with tetratricopeptide repeats (IFITs) family is among hundreds of IFN-stimulated genes. This family contains a cluster of duplicated loci. Most mammals have IFIT1, IFIT2, IFIT3 and IFIT5; however, bird, marsupial, frog and fish have only IFIT5. Regardless of species, IFIT5 is always adjacent to SLC16A12. IFIT family genes are predominantly induced by type I and type III interferons and are regulated by the pattern recognition and the JAK-STAT signaling pathway. IFIT family proteins are involved in many processes in response to viral infection. However, some viruses can escape the antiviral functions of the IFIT family by suppressing IFIT family genes expression or methylation of 5' cap of viral molecules. In addition, the variants of IFIT family genes could significantly influence the outcome of hepatitis C virus (HCV) therapy. We believe that our current review provides a comprehensive picture for the community to understand the structure and function of IFIT family genes in response to pathogens in human, as well as in animals.
The Caenorhabditis chemoreceptor gene families
Robertson Hugh M; Thomas James H
2008-01-01
Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-...
Molecular cloning of RBCS genes in Selaginella and the evolution of the rbcS gene family
Directory of Open Access Journals (Sweden)
Wang Bo
2015-01-01
Full Text Available Rubisco small subunits (RBCS are encoded by a nuclear rbcS multigene family in higher plants and green algae. However, owing to the lack of rbcS sequences in lycophytes, the characteristics of rbcS genes in lycophytes is unclear. Recently, the complete genome sequence of the lycophyte Selaginella moellendorffii provided the first insight into the rbcS gene family in lycophytes. To understand further the characteristics of rbcS genes in other Selaginella, the full length of rbcS genes (rbcS1 and rbcS2 from two other Selaginella species were isolated. Both rbcS1 and rbcS2 genes shared more than 97% identity among three Selaginella species. RBCS proteins from Selaginella contained the Pfam RBCS domain F00101, which was a major domain of other plant RBCS proteins. To explore the evolution of the rbcS gene family across Selaginella and other plants, we identified and performed comparative analysis of the rbcS gene family among 16 model plants based on a genome-wide analysis. The results showed that (i two rbcS genes were obtained in Selaginella, which is the second fewest number of rbcS genes among the 16 representative plants; (ii an expansion of rbcS genes occurred in the moss Physcomitrella patens; (iii only RBCS proteins from angiosperms contained the Pfam PF12338 domains, and (iv a pattern of concerted evolution existed in the rbcS gene family. Our study provides new insights into the evolution of the rbcS gene family in Selaginella and other plants.
Like IGF-I, progranulin (pgrn) is a growth factor involved in tumorigenesis and wound healing. We report here the identification and characterization of pgrn cDNA in tilapia and the regulation of its expression by growth hormone(GH). The tilapia pgrn cDNA was cloned by RT-PCR ampliWcation, using g...
Karn, Robert C; Laukaitis, Christina M
2012-01-01
Three proteinaceous pheromone families, the androgen-binding proteins (ABPs), the exocrine-gland secreting peptides (ESPs) and the major urinary proteins (MUPs) are encoded by large gene families in the genomes of Mus musculus and Rattus norvegicus. We studied the evolutionary histories of the Mup and Esp genes and compared them with what is known about the Abp genes. Apparently gene conversion has played little if any role in the expansion of the mouse Class A and Class B Mup genes and pseudogenes, and the rat Mups. By contrast, we found evidence of extensive gene conversion in many Esp genes although not in all of them. Our studies of selection identified at least two amino acid sites in β-sheets as having evolved under positive selection in the mouse Class A and Class B MUPs and in rat MUPs. We show that selection may have acted on the ESPs by determining K(a)/K(s) for Exon 3 sequences with and without the converted sequence segment. While it appears that purifying selection acted on the ESP signal peptides, the secreted portions of the ESPs probably have undergone much more rapid evolution. When the inner gene converted fragment sequences were removed, eleven Esp paralogs were present in two or more pairs with K(a)/K(s) >1.0 and thus we propose that positive selection is detectable by this means in at least some mouse Esp paralogs. We compare and contrast the evolutionary histories of all three mouse pheromone gene families in light of their proposed functions in mouse communication.
Directory of Open Access Journals (Sweden)
Hyeon-Sook Suh
Full Text Available The essential role of progranulin (PGRN as a neurotrophic factor has been demonstrated by the discovery that haploinsufficiency due to GRN gene mutations causes frontotemporal lobar dementia. In addition to neurons, microglia in vivo express PGRN, but little is known about the regulation of PGRN expression by microglia.In the current study, we examined the regulation of expression and function of PGRN, its proteolytic enzyme macrophage elastase (MMP-12, as well as the inhibitor of PGRN proteolysis, secretory leukocyte protease inhibitor (SLPI, in human CNS cells.Cultures of primary human microglia and astrocytes were stimulated with the TLR ligands (LPS or poly IC, Th1 cytokines (IL-1/IFNγ, or Th2 cytokines (IL-4, IL-13. Results were analyzed by Q-PCR, immunoblotting or ELISA. The roles of MMP-12 and SLPI in PGRN cleavage were also examined.Unstimulated microglia produced nanogram levels of PGRN, and PGRN release from microglia was suppressed by the TLR ligands or IL-1/IFNγ, but increased by IL-4 or IL-13. Unexpectedly, while astrocytes stimulated with proinflammatory factors released large amounts of SLPI, none were detected in microglial cultures. We also identified MMP-12 as a PGRN proteolytic enzyme, and SLPI as an inhibitor of MMP-12-induced PGRN proteolysis. Experiments employing PGRN siRNA demonstrated that microglial PGRN was involved in the cytokine and chemokine production following TLR3/4 activation, with its effect on TNFα being the most conspicuous.Our study is the first detailed examination of PGRN in human microglia. Our results establish microglia as a significant source of PGRN, and MMP-12 and SLPI as modulators of PGRN proteolysis. Negative and positive regulation of microglial PGRN release by the proinflammatory/Th1 and the Th2 stimuli, respectively, suggests a fundamentally different aspect of PGRN regulation compared to other known microglial activation products. Microglial PGRN appears to function as an endogenous
A neurodegenerative disease mutation that accelerates the clearance of apoptotic cells.
Kao, Aimee W; Eisenhut, Robin J; Martens, Lauren Herl; Nakamura, Ayumi; Huang, Anne; Bagley, Josh A; Zhou, Ping; de Luis, Alberto; Neukomm, Lukas J; Cabello, Juan; Farese, Robert V; Kenyon, Cynthia
2011-03-15
Frontotemporal lobar degeneration is a progressive neurodegenerative syndrome that is the second most common cause of early-onset dementia. Mutations in the progranulin gene are a major cause of familial frontotemporal lobar degeneration [Baker M, et al. (2006) Nature 442:916-919 and Cruts M, et al. (2006) Nature 442:920-924]. Although progranulin is involved in wound healing, inflammation, and tumor growth, its role in the nervous system and the mechanism by which insufficient levels result in neurodegeneration are poorly understood [Eriksen and Mackenzie (2008) J Neurochem 104:287-297]. We have characterized the normal function of progranulin in the nematode Caenorhabditis elegans. We found that mutants lacking pgrn-1 appear grossly normal, but exhibit fewer apoptotic cell corpses during development. This reduction in corpse number is not caused by reduced apoptosis, but instead by more rapid clearance of dying cells. Likewise, we found that macrophages cultured from progranulin KO mice displayed enhanced rates of apoptotic-cell phagocytosis. Although most neurodegenerative diseases are thought to be caused by the toxic effects of aggregated proteins, our findings suggest that susceptibility to neurodegeneration may be increased by a change in the kinetics of programmed cell death. We propose that cells that might otherwise recover from damage or injury are destroyed in progranulin mutants, which in turn facilitates disease progression.
Recurrent APC gene mutations in Polish FAP families
Directory of Open Access Journals (Sweden)
Pławski Andrzej
2007-12-01
Full Text Available Abstract The molecular diagnostics of genetically conditioned disorders is based on the identification of the mutations in the predisposing genes. Hereditary cancer disorders of the gastrointestinal tracts are caused by mutations of the tumour suppressor genes or the DNA repair genes. Occurrence of recurrent mutation allows improvement of molecular diagnostics. The mutation spectrum in the genes causing hereditary forms of colorectal cancers in the Polish population was previously described. In the present work an estimation of the frequency of the recurrent mutations of the APC gene was performed. Eight types of mutations occurred in 19.4% of our FAP families and these constitute 43% of all Polish diagnosed families.
The IQD gene family in soybean: structure, phylogeny, evolution and expression.
Directory of Open Access Journals (Sweden)
Lin Feng
Full Text Available Members of the plant-specific IQ67-domain (IQD protein family are involved in plant development and the basal defense response. Although systematic characterization of this family has been carried out in Arabidopsis, tomato (Solanum lycopersicum, Brachypodium distachyon and rice (Oryza sativa, systematic analysis and expression profiling of this gene family in soybean (Glycine max have not previously been reported. In this study, we identified and structurally characterized IQD genes in the soybean genome. A complete set of 67 soybean IQD genes (GmIQD1-67 was identified using Blast search tools, and the genes were clustered into four subfamilies (IQD I-IV based on phylogeny. These soybean IQD genes are distributed unevenly across all 20 chromosomes, with 30 segmental duplication events, suggesting that segmental duplication has played a major role in the expansion of the soybean IQD gene family. Analysis of the Ka/Ks ratios showed that the duplicated genes of the GmIQD family primarily underwent purifying selection. Microsynteny was detected in most pairs: genes in clade 1-3 might be present in genome regions that were inverted, expanded or contracted after the divergence; most gene pairs in clade 4 showed high conservation with little rearrangement among these gene-residing regions. Of the soybean IQD genes examined, six were most highly expressed in young leaves, six in flowers, one in roots and two in nodules. Our qRT-PCR analysis of 24 soybean IQD III genes confirmed that these genes are regulated by MeJA stress. Our findings present a comprehensive overview of the soybean IQD gene family and provide insights into the evolution of this family. In addition, this work lays a solid foundation for further experiments aimed at determining the biological functions of soybean IQD genes in growth and development.
PlantTribes: a gene and gene family resource for comparative genomics in plants
Wall, P. Kerr; Leebens-Mack, Jim; Müller, Kai F.; Field, Dawn; Altman, Naomi S.; dePamphilis, Claude W.
2007-01-01
The PlantTribes database (http://fgp.huck.psu.edu/tribe.html) is a plant gene family database based on the inferred proteomes of five sequenced plant species: Arabidopsis thaliana, Carica papaya, Medicago truncatula, Oryza sativa and Populus trichocarpa. We used the graph-based clustering algorithm MCL [Van Dongen (Technical Report INS-R0010 2000) and Enright et al. (Nucleic Acids Res. 2002; 30: 1575–1584)] to classify all of these species’ protein-coding genes into putative gene families, ca...
International Nuclear Information System (INIS)
Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles
2000-01-01
A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society
Energy Technology Data Exchange (ETDEWEB)
Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles
2000-09-18
A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.
Ultra Large Gene Families: A Matter of Adaptation or Genomic Parasites?
Directory of Open Access Journals (Sweden)
Philipp H. Schiffer
2016-08-01
Full Text Available Gene duplication is an important mechanism of molecular evolution. It offers a fast track to modification, diversification, redundancy or rescue of gene function. However, duplication may also be neutral or (slightly deleterious, and often ends in pseudo-geneisation. Here, we investigate the phylogenetic distribution of ultra large gene families on long and short evolutionary time scales. In particular, we focus on a family of NACHT-domain and leucine-rich-repeat-containing (NLR-genes, which we previously found in large numbers to occupy one chromosome arm of the zebrafish genome. We were interested to see whether such a tight clustering is characteristic for ultra large gene families. Our data reconfirm that most gene family inflations are lineage-specific, but we can only identify very few gene clusters. Based on our observations we hypothesise that, beyond a certain size threshold, ultra large gene families continue to proliferate in a mechanism we term “run-away evolution”. This process might ultimately lead to the failure of genomic integrity and drive species to extinction.
The ALMT Gene Family Performs Multiple Functions in Plants
Directory of Open Access Journals (Sweden)
Jie Liu
2018-02-01
Full Text Available The aluminium activated malate transporter (ALMT gene family is named after the first member of the family identified in wheat (Triticum aestivum L.. The product of this gene controls resistance to aluminium (Al toxicity. ALMT genes encode transmembrane proteins that function as anion channels and perform multiple functions involving the transport of organic anions (e.g., carboxylates and inorganic anions in cells. They share a PF11744 domain and are classified in the Fusaric acid resistance protein-like superfamily, CL0307. The proteins typically have five to seven transmembrane regions in the N-terminal half and a long hydrophillic C-terminal tail but predictions of secondary structure vary. Although widely spread in plants, relatively little information is available on the roles performed by other members of this family. In this review, we summarized functions of ALMT gene families, including Al resistance, stomatal function, mineral nutrition, microbe interactions, fruit acidity, light response and seed development.
Repeat-associated plasticity in the Helicobacter pylori RD gene family.
Shak, Joshua R; Dick, Jonathan J; Meinersmann, Richard J; Perez-Perez, Guillermo I; Blaser, Martin J
2009-11-01
The bacterium Helicobacter pylori is remarkable for its ability to persist in the human stomach for decades without provoking sterilizing immunity. Since repetitive DNA can facilitate adaptive genomic flexibility via increased recombination, insertion, and deletion, we searched the genomes of two H. pylori strains for nucleotide repeats. We discovered a family of genes with extensive repetitive DNA that we have termed the H. pylori RD gene family. Each gene of this family is composed of a conserved 3' region, a variable mid-region encoding 7 and 11 amino acid repeats, and a 5' region containing one of two possible alleles. Analysis of five complete genome sequences and PCR genotyping of 42 H. pylori strains revealed extensive variation between strains in the number, location, and arrangement of RD genes. Furthermore, examination of multiple strains isolated from a single subject's stomach revealed intrahost variation in repeat number and composition. Despite prior evidence that the protein products of this gene family are expressed at the bacterial cell surface, enzyme-linked immunosorbent assay and immunoblot studies revealed no consistent seroreactivity to a recombinant RD protein by H. pylori-positive hosts. The pattern of repeats uncovered in the RD gene family appears to reflect slipped-strand mispairing or domain duplication, allowing for redundancy and subsequent diversity in genotype and phenotype. This novel family of hypervariable genes with conserved, repetitive, and allelic domains may represent an important locus for understanding H. pylori persistence in its natural host.
MiR-145 mediates zebrafish hepatic outgrowth through progranulin A signaling.
Directory of Open Access Journals (Sweden)
Ya-Wen Li
Full Text Available MicroRNAs (miRs are mRNA-regulatory molecules that fine-tune gene expression and modulate both processes of development and tumorigenesis. Our previous studies identified progranulin A (GrnA as a growth factor which induces zebrafish hepatic outgrowth through MET signaling. We also found that miR-145 is one of potential fine-tuning regulators of GrnA involved in embryonic hepatic outgrowth. The low level of miR-145 seen in hepatocarinogenesis has been shown to promote pathological liver growth. However, little is known about the regulatory mechanism of miR-145 in embryonic liver development. In this study, we demonstrate a significant decrease in miR-145 expression during hepatogenesis. We modulate miR-145 expression in zebrafish embryos by injection with a miR-145 mimic or a miR-145 hairpin inhibitor. Altered embryonic liver outgrowth is observed in response to miR-145 expression modulation. We also confirm a critical role of miR-145 in hepatic outgrowth by using whole-mount in situ hybridization. Loss of miR-145 expression in embryos results in hepatic cell proliferation, and vice versa. Furthermore, we demonstrate that GrnA is a target of miR-145 and GrnA-induced MET signaling is also regulated by miR-145 as determined by luciferase reporter assay and gene expression analysis, respectively. In addition, co-injection of GrnA mRNA with miR-145 mimic or MO-GrnA with miR-145 inhibitor restores the liver defects caused by dysregulation of miR-145 expression. In conclusion, our findings suggest an important role of miR-145 in regulating GrnA-dependent hepatic outgrowth in zebrafish embryonic development.
International Nuclear Information System (INIS)
Shen, A.; Humphries, C.; Tucker, P.; Blattner, F.
1987-01-01
The authors have identified a family of human immunoglobulin heavy-chain variable-region (V/sub H/) genes, one member of which is rearranged in two affected members of a family in which the father and four of five siblings developed chronic lymphocytic leukemia. Cloning and sequencing of the rearranged V/sub H/ genes from leukemic lymphocytes of three affected siblings showed that two siblings had rearranged V/sub H/ genes (V/sub H/TS1 and V/sub H/WS1) that were 90% homologous. The corresponding germ-line gene, V/sub H/251, was found to part of a small (four gene) V/sub H/ gene family, which they term V/sub H/V. The DNA sequence homology to V/sub H/WS1 (95%) and V/sub H/TS1 (88%) and identical restriction sites on the 5' side of V/sub H/ confirm that rearrangement of V/sub H/251 followed by somatic mutation produced the identical V/sub H/ gene rearrangements in the two siblings. V/sub H/TS1 is not a functional V/sub H/ gene; a functional V/sub H/ rearrangement was found on the other chromosome of this patient. The other two siblings had different V/sub H/ gene rearrangements. All used different diversity genes. Mechanisms proposed for nonrandom selection of a single V/sub H/ gene include developmental regulation of this V/sub H/ gene rearrangement or selection of a subpopulation of B cells in which this V/sub H/ has been rearranged
The SPINK gene family and celiac disease susceptibility
Wapenaar, M.C.; Monsuur, A.J.; Poell, J.; Slot, R. van 't; Meijer, J.W.R.; Meijer, G.A.; Mulder, C.J.; Mearin, M.L.; Wijmenga, C.
2007-01-01
The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was
The SPINK gene family and celiac disease susceptibility
Wapenaar, Martin C.; Monsuur, Alienke J.; Poell, Jos; Slot, Ruben Van 't; Meijer, Jos W. R.; Meijer, Gerrit A.; Mulder, Chris J.; Mearin, Maria Luisa; Wijmenga, Cisca
The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was
Characterization of the MLO gene family in Rosaceae and gene expression analysis in Malus domestica.
Pessina, Stefano; Pavan, Stefano; Catalano, Domenico; Gallotta, Alessandra; Visser, Richard G F; Bai, Yuling; Malnoy, Mickael; Schouten, Henk J
2014-07-22
Powdery mildew (PM) is a major fungal disease of thousands of plant species, including many cultivated Rosaceae. PM pathogenesis is associated with up-regulation of MLO genes during early stages of infection, causing down-regulation of plant defense pathways. Specific members of the MLO gene family act as PM-susceptibility genes, as their loss-of-function mutations grant durable and broad-spectrum resistance. We carried out a genome-wide characterization of the MLO gene family in apple, peach and strawberry, and we isolated apricot MLO homologs through a PCR-approach. Evolutionary relationships between MLO homologs were studied and syntenic blocks constructed. Homologs that are candidates for being PM susceptibility genes were inferred by phylogenetic relationships with functionally characterized MLO genes and, in apple, by monitoring their expression following inoculation with the PM causal pathogen Podosphaera leucotricha. Genomic tools available for Rosaceae were exploited in order to characterize the MLO gene family. Candidate MLO susceptibility genes were identified. In follow-up studies it can be investigated whether silencing or a loss-of-function mutations in one or more of these candidate genes leads to PM resistance.
Progranulin facilitates conversion and function of regulatory T cells under inflammatory conditions.
Directory of Open Access Journals (Sweden)
Fanhua Wei
Full Text Available The progranulin (PGRN is known to protect regulatory T cells (Tregs from a negative regulation by TNF-α, and its levels are elevated in various kinds of autoimmune diseases. Whether PGRN directly regulates the conversion of CD4+CD25-T cells into Foxp3-expressing regulatory T cells (iTreg, and whether PGRN affects the immunosuppressive function of Tregs, however, remain unknown. In this study we provide evidences demonstrating that PGRN is able to stimulate the conversion of CD4+CD25-T cells into iTreg in a dose-dependent manner in vitro. In addition, PGRN showed synergistic effects with TGF-β1 on the induction of iTreg. PGRN was required for the immunosuppressive function of Tregs, since PGRN-deficient Tregs have a significant decreased ability to suppress the proliferation of effector T cells (Teff. In addition, PGRN deficiency caused a marked reduction in Tregs number in the course of inflammatory arthritis, although no significant difference was observed in the numbers of Tregs between wild type and PGRN deficient mice during development. Furthermore, PGRN deficiency led to significant upregulation of the Wnt receptor gene Fzd2. Collectively, this study reveals that PGRN directly regulates the numbers and function of Tregs under inflammatory conditions, and provides new insight into the immune regulatory mechanism of PGRN in the pathogenesis of inflammatory and immune-related diseases.
Molecular evolution of the major chemosensory gene families in insects.
Sánchez-Gracia, A; Vieira, F G; Rozas, J
2009-09-01
Chemoreception is a crucial biological process that is essential for the survival of animals. In insects, olfaction allows the organism to recognise volatile cues that allow the detection of food, predators and mates, whereas the sense of taste commonly allows the discrimination of soluble stimulants that elicit feeding behaviours and can also initiate innate sexual and reproductive responses. The most important proteins involved in the recognition of chemical cues comprise moderately sized multigene families. These families include odorant-binding proteins (OBPs) and chemosensory proteins (CSPs), which are involved in peripheral olfactory processing, and the chemoreceptor superfamily formed by the olfactory receptor (OR) and gustatory receptor (GR) families. Here, we review some recent evolutionary genomic studies of chemosensory gene families using the data from fully sequenced insect genomes, especially from the 12 newly available Drosophila genomes. Overall, the results clearly support the birth-and-death model as the major mechanism of evolution in these gene families. Namely, new members arise by tandem gene duplication, progressively diverge in sequence and function, and can eventually be lost from the genome by a deletion or pseudogenisation event. Adaptive changes fostered by environmental shifts are also observed in the evolution of chemosensory families in insects and likely involve reproductive, ecological or behavioural traits. Consequently, the current size of these gene families is mainly a result of random gene gain and loss events. This dynamic process may represent a major source of genetic variation, providing opportunities for FUTURE specific adaptations.
Progranulin regulates neuronal outgrowth independent of Sortilin
Directory of Open Access Journals (Sweden)
Gass Jennifer
2012-07-01
Full Text Available Abstract Background Progranulin (PGRN, a widely secreted growth factor, is involved in multiple biological functions, and mutations located within the PGRN gene (GRN are a major cause of frontotemporal lobar degeneration with TDP-43-positive inclusions (FLTD-TDP. In light of recent reports suggesting PGRN functions as a protective neurotrophic factor and that sortilin (SORT1 is a neuronal receptor for PGRN, we used a Sort1-deficient (Sort1−/− murine primary hippocampal neuron model to investigate whether PGRN’s neurotrophic effects are dependent on SORT1. We sought to elucidate this relationship to determine what role SORT1, as a regulator of PGRN levels, plays in modulating PGRN’s neurotrophic effects. Results As the first group to evaluate the effect of PGRN loss in Grn knockout primary neuronal cultures, we show neurite outgrowth and branching are significantly decreased in Grn−/− neurons compared to wild-type (WT neurons. More importantly, we also demonstrate that PGRN overexpression can rescue this phenotype. However, the recovery in outgrowth is not observed following treatment with recombinant PGRN harboring missense mutations p.C139R, p.P248L or p.R432C, indicating that these mutations adversely affect the neurotrophic properties of PGRN. In addition, we also present evidence that cleavage of full-length PGRN into granulin peptides is required for increased neuronal outgrowth, suggesting that the neurotrophic functions of PGRN are contained within certain granulins. To further characterize the mechanism by which PGRN impacts neuronal morphology, we assessed the involvement of SORT1. We demonstrate that PGRN induced-outgrowth occurs in the absence of SORT1 in Sort1−/− cultures. Conclusion We demonstrate that loss of PGRN impairs proper neurite outgrowth and branching, and that exogenous PGRN alleviates this impairment. Furthermore, we determined that exogenous PGRN induces outgrowth independent of SORT1, suggesting another
The nitrate transporter (NRT gene family in poplar.
Directory of Open Access Journals (Sweden)
Hua Bai
Full Text Available Nitrate is an important nutrient required for plant growth. It also acts as a signal regulating plant development. Nitrate is actively taken up and transported by nitrate transporters (NRT, which form a large family with many members and distinct functions. In contrast to Arabidopsis and rice there is little information about the NRT family in woody plants such as Populus. In this study, a comprehensive analysis of the Populus NRT family was performed. Sixty-eight PtNRT1/PTR, 6 PtNRT2, and 5 PtNRT3 genes were identified in the P. trichocarpa genome. Phylogenetic analysis confirmed that the genes of the NRT family are divided into three clades: NRT1/PTR with four subclades, NRT2, and NRT3. Topological analysis indicated that all members of PtNRT1/PTR and PtNRT2 have 8 to 12 trans-membrane domains, whereas the PtNRT3 proteins have no or up to two trans-membrane domains. Four PtNRT3 members were predicted as secreted proteins. Microarray analyses revealed tissue-specific expression patterns of PtNRT genes with distinct clusters of NRTs for roots, for the elongation zone of the apical stem segment and the developing xylem and a further cluster for leaves, bark and wood. A comparison of different poplar species (P. trichocarpa, P. tremula, P. euphratica, P. fremontii x P. angustifolia, and P. x canescens showed that the tissue-specific patterns of the NRT genes varied to some extent with species. Bioinformatic analysis of putative cis-regulatory elements in the promoter regions of PtNRT family retrieved motifs suggesting the regulation of the NRT genes by N metabolism, by energy and carbon metabolism, and by phytohormones and stress. Multivariate analysis suggested that the combination and abundance of motifs in distinct promoters may lead to tissue-specificity. Our genome wide analysis of the PtNRT genes provides a valuable basis for functional analysis towards understanding the role of nitrate transporters for tree growth.
Genetics of Frontotemporal Lobar Degeneration
Directory of Open Access Journals (Sweden)
Daniela eGalimberti
2012-04-01
Full Text Available Frontotemporal Lobar Degeneration (FTLD is the most frequent neurodegenerative disorder with a presenile onset. It presents with a spectrum of clinical manifestations, ranging from behavioural and executive impairment to language disorders and motor dysfunction. Familial aggregation is frequently reported in FTLD, and about 10% of cases have an autosomal dominant transmission. Microtubule Associated Protein Tau gene (MAPT mutations have been the first ones identified and are generally associated with early onset behavioural variant Frontotemporal Dementia (bvFTD phenotype. More recently, progranulin gene (GRN mutations were recognized in association with familial form of FTLD. In addition, other genes are linked to rare cases of familial FTLD. Lastly, a number of genetic risk factors for sporadic forms have also been identified.
Directory of Open Access Journals (Sweden)
Parker Nadeene
2004-01-01
Full Text Available Abstract Background The human 6–16 and ISG12 genes are transcriptionally upregulated in a variety of cell types in response to type I interferon (IFN. The predicted products of these genes are small (12.9 and 11.5 kDa respectively, hydrophobic proteins that share 36% overall amino acid identity. Gene disruption and over-expression studies have so far failed to reveal any biochemical or cellular roles for these proteins. Results We have used in silico analyses to identify a novel family of genes (the ISG12 gene family related to both the human 6–16 and ISG12 genes. Each ISG12 family member codes for a small hydrophobic protein containing a conserved ~80 amino-acid motif (the ISG12 motif. So far we have detected 46 family members in 25 organisms, ranging from unicellular eukaryotes to humans. Humans have four ISG12 genes: the 6–16 gene at chromosome 1p35 and three genes (ISG12(a, ISG12(b and ISG12(c clustered at chromosome 14q32. Mice have three family members (ISG12(a, ISG12(b1 and ISG12(b2 clustered at chromosome 12F1 (syntenic with human chromosome 14q32. There does not appear to be a murine 6–16 gene. On the basis of phylogenetic analyses, genomic organisation and intron-alignments we suggest that this family has arisen through divergent inter- and intra-chromosomal gene duplication events. The transcripts from human and mouse genes are detectable, all but two (human ISG12(b and ISG12(c being upregulated in response to type I IFN in the cell lines tested. Conclusions Members of the eukaryotic ISG12 gene family encode a small hydrophobic protein with at least one copy of a newly defined motif of ~80 amino-acids (the ISG12 motif. In higher eukaryotes, many of the genes have acquired a responsiveness to type I IFN during evolution suggesting that a role in resisting cellular or environmental stress may be a unifying property of all family members. Analysis of gene-function in higher eukaryotes is complicated by the possibility of
Directory of Open Access Journals (Sweden)
Nishida Mutsumi
2007-11-01
Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.
Evolutionary history of chordate PAX genes: dynamics of change in a complex gene family.
Directory of Open Access Journals (Sweden)
Vanessa Rodrigues Paixão-Côrtes
Full Text Available Paired box (PAX genes are transcription factors that play important roles in embryonic development. Although the PAX gene family occurs in animals only, it is widely distributed. Among the vertebrates, its 9 genes appear to be the product of complete duplication of an original set of 4 genes, followed by an additional partial duplication. Although some studies of PAX genes have been conducted, no comprehensive survey of these genes across the entire taxonomic unit has yet been attempted. In this study, we conducted a detailed comparison of PAX sequences from 188 chordates, which revealed restricted variation. The absence of PAX4 and PAX8 among some species of reptiles and birds was notable; however, all 9 genes were present in all 74 mammalian genomes investigated. A search for signatures of selection indicated that all genes are subject to purifying selection, with a possible constraint relaxation in PAX4, PAX7, and PAX8. This result indicates asymmetric evolution of PAX family genes, which can be associated with the emergence of adaptive novelties in the chordate evolutionary trajectory.
Evolution of the YABBY gene family in seed plants.
Finet, Cédric; Floyd, Sandra K; Conway, Stephanie J; Zhong, Bojian; Scutt, Charles P; Bowman, John L
2016-01-01
Members of the YABBY gene family of transcription factors in angiosperms have been shown to be involved in the initiation of outgrowth of the lamina, the maintenance of polarity, and establishment of the leaf margin. Although most of the dorsal-ventral polarity genes in seed plants have homologs in non-spermatophyte lineages, the presence of YABBY genes is restricted to seed plants. To gain insight into the origin and diversification of this gene family, we reconstructed the evolutionary history of YABBY gene lineages in seed plants. Our findings suggest that either one or two YABBY genes were present in the last common ancestor of extant seed plants. We also examined the expression of YABBY genes in the gymnosperms Ephedra distachya (Gnetales), Ginkgo biloba (Ginkgoales), and Pseudotsuga menziesii (Coniferales). Our data indicate that some YABBY genes are expressed in a polar (abaxial) manner in leaves and female cones in gymnosperms. We propose that YABBY genes already acted as polarity genes in the last common ancestor of extant seed plants. © 2016 Wiley Periodicals, Inc.
Identification of a novel Gig2 gene family specific to non-amniote vertebrates.
Directory of Open Access Journals (Sweden)
Yi-Bing Zhang
Full Text Available Gig2 (grass carp reovirus (GCRV-induced gene 2 is first identified as a novel fish interferon (IFN-stimulated gene (ISG. Overexpression of a zebrafish Gig2 gene can protect cultured fish cells from virus infection. In the present study, we identify a novel gene family that is comprised of genes homologous to the previously characterized Gig2. EST/GSS search and in silico cloning identify 190 Gig2 homologous genes in 51 vertebrate species ranged from lampreys to amphibians. Further large-scale search of vertebrate and invertebrate genome databases indicate that Gig2 gene family is specific to non-amniotes including lampreys, sharks/rays, ray-finned fishes and amphibians. Phylogenetic analysis and synteny analysis reveal lineage-specific expansion of Gig2 gene family and also provide valuable evidence for the fish-specific genome duplication (FSGD hypothesis. Although Gig2 family proteins exhibit no significant sequence similarity to any known proteins, a typical Gig2 protein appears to consist of two conserved parts: an N-terminus that bears very low homology to the catalytic domains of poly(ADP-ribose polymerases (PARPs, and a novel C-terminal domain that is unique to this gene family. Expression profiling of zebrafish Gig2 family genes shows that some duplicate pairs have diverged in function via acquisition of novel spatial and/or temporal expression under stresses. The specificity of this gene family to non-amniotes might contribute to a large extent to distinct physiology in non-amniote vertebrates.
Early evolution of the LIM homeobox gene family
Energy Technology Data Exchange (ETDEWEB)
Srivastava, Mansi; Larroux, Claire; Lu, Daniel R; Mohanty, Kareshma; Chapman, Jarrod; Degnan, Bernard M; Rokhsar, Daniel S
2010-01-01
LIM homeobox (Lhx) transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons) indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In Nematostella, Lhx gene expression is correlated with neural
Early evolution of the LIM homeobox gene family
Directory of Open Access Journals (Sweden)
Degnan Bernard M
2010-01-01
Full Text Available Abstract Background LIM homeobox (Lhx transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. Results We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. Conclusions The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In
TreeFam: a curated database of phylogenetic trees of animal gene families
DEFF Research Database (Denmark)
Li, Heng; Coghlan, Avril; Ruan, Jue
2006-01-01
TreeFam is a database of phylogenetic trees of gene families found in animals. It aims to develop a curated resource that presents the accurate evolutionary history of all animal gene families, as well as reliable ortholog and paralog assignments. Curated families are being added progressively......, based on seed alignments and trees in a similar fashion to Pfam. Release 1.1 of TreeFam contains curated trees for 690 families and automatically generated trees for another 11 646 families. These represent over 128 000 genes from nine fully sequenced animal genomes and over 45 000 other animal proteins...
Directory of Open Access Journals (Sweden)
Susanna Raitano
2015-01-01
Full Text Available To understand how haploinsufficiency of progranulin (PGRN causes frontotemporal dementia (FTD, we created induced pluripotent stem cells (iPSCs from patients carrying the GRNIVS1+5G > C mutation (FTD-iPSCs. FTD-iPSCs were fated to cortical neurons, the cells most affected in FTD. Although generation of neuroprogenitors was unaffected, their further differentiation into CTIP2-, FOXP2-, or TBR1-TUJ1 double-positive cortical neurons, but not motorneurons, was significantly decreased in FTD-neural progeny. Zinc finger nuclease-mediated introduction of GRN cDNA into the AAVS1 locus corrected defects in cortical neurogenesis, demonstrating that PGRN haploinsufficiency causes inefficient cortical neuron generation. RNA sequencing analysis confirmed reversal of the altered gene expression profile following genetic correction. We identified the Wnt signaling pathway as one of the top defective pathways in FTD-iPSC-derived neurons, which was reversed following genetic correction. Differentiation of FTD-iPSCs in the presence of a WNT inhibitor mitigated defective corticogenesis. Therefore, we demonstrate that PGRN haploinsufficiency hampers corticogenesis in vitro.
Enamelin/ameloblastin gene polymorphisms in autosomal amelogenesis imperfecta among Syrian families.
Dashash, Mayssoon; Bazrafshani, Mohamed Riza; Poulton, Kay; Jaber, Saaed; Naeem, Emad; Blinkhorn, Anthony Stevenson
2011-02-01
This study was undertaken to investigate whether a single G deletion within a series of seven G residues (codon 196) at the exon 9-intron 9 boundary of the enamelin gene ENAM and a tri-nucleotide deletion at codon 180 in exon 7 (GGA vs deletion) of ameloblastin gene AMBN could have a role in autosomal amelogenesis imperfecta among affected Syrian families. A new technique - size-dependent, deletion screening - was developed to detect nucleotide deletion in ENAM and AMBN genes. Twelve Syrian families with autosomal-dominant or -recessive amelogenesis imperfecta were included. A homozygous/heterozygous mutation in the ENAM gene (152/152, 152/153) was identified in affected members of three families with autosomal-dominant amelogenesis imperfecta and one family with autosomal-recessive amelogenesis imperfecta. A heterozygous mutation (222/225) in the AMBN gene was identified. However, no disease causing mutations was found. The present findings provide useful information for the implication of ENAM gene polymorphism in autosomal-dominant/-recessive amelogenesis imperfecta. Further investigations are required to identify other genes responsible for the various clinical phenotypes. © 2010 Blackwell Publishing Asia Pty Ltd.
Directory of Open Access Journals (Sweden)
Kocerha Jannet
2011-10-01
Full Text Available Abstract Background Frontotemporal lobar degeneration (FTLD is a progressive neurodegenerative disorder that can be triggered through genetic or sporadic mechanisms. MicroRNAs (miRNAs have become a major therapeutic focus as their pervasive expression and powerful regulatory roles in disease pathogenesis become increasingly apparent. Here we examine the role of miRNAs in FTLD patients with TAR DNA-binding protein 43 pathology (FTLD-TDP caused by genetic mutations in the progranulin (PGRN gene. Results Using miRNA array profiling, we identified the 20 miRNAs that showed greatest evidence (unadjusted P PGRN mutations when compared to 32 FTLD-TDP patients with no apparent genetic abnormalities. Quantitative real-time PCR (qRT-PCR analyses provided technical validation of the differential expression for 9 of the 20 miRNAs in frontal cortex. Additional qRT-PCR analyses showed that 5 out of 9 miRNAs (miR-922, miR-516a-3p, miR-571, miR-548b-5p, and miR-548c-5p were also significantly dysregulated (unadjusted P PGRN mutation carriers, consistent with a systemic reduction in PGRN levels. We developed a list of gene targets for the 5 candidate miRNAs and found 18 genes dysregulated in a reported FTLD mRNA study to exhibit anti-correlated miRNA-mRNA patterns in affected cortex and cerebellar tissue. Among the targets is brain-specific angiogenesis inhibitor 3, which was recently identified as an important player in synapse biology. Conclusions Our study suggests that miRNAs may contribute to the pathogenesis of FTLD-TDP caused by PGRN mutations and provides new insight into potential future therapeutic options.
Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.
Petrov, Petar; Syrjänen, Riikka; Smith, Jacqueline; Gutowska, Maria Weronika; Uchida, Tatsuya; Vainio, Olli; Burt, David W
2015-01-01
"Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.
Prevalence of variations in melanoma susceptibility genes among Slovenian melanoma families
Directory of Open Access Journals (Sweden)
Besic Nikola
2008-09-01
Full Text Available Abstract Background Two high-risk genes have been implicated in the development of CM (cutaneous melanoma. Germline mutations of the CDKN2A gene are found in CDK4 gene reported to date. Beside those high penetrance genes, certain allelic variants of the MC1R gene modify the risk of developing the disease. The aims of our study were: to determine the prevalence of germline CDKN2A mutations and variants in members of families with familial CM and in patients with multiple primary CM; to search for possible CDK4 mutations, and to determine the frequency of variations in the MC1R gene. Methods From January 2001 until January 2007, 64 individuals were included in the study. The group included 28 patients and 7 healthy relatives belonging to 25 families, 26 patients with multiple primary tumors and 3 children with CM. Additionally 54 healthy individuals were included as a control group. Mutations and variants of the melanoma susceptibility genes were identified by direct sequencing. Results Seven families with CDKN2A mutations were discovered (7/25 or 28.0%. The L94Q mutation found in one family had not been previously reported in other populations. The D84N variant, with possible biological impact, was discovered in the case of patient without family history but with multiple primary CM. Only one mutation carrier was found in the control group. Further analysis revealed that c.540C>T heterozygous carriers were more common in the group of CM patients and their healthy relatives (11/64 vs. 2/54. One p14ARF variant was discovered in the control group and no mutations of the CDK4 gene were found. Most frequently found variants of the MC1R gene were T314T, V60L, V92M, R151C, R160W and R163Q with frequencies slightly higher in the group of patients and their relatives than in the group of controls, but the difference was statistically insignificant. Conclusion The present study has shown high prevalence of p16INK4A mutations in Slovenian population of
Analysis of factor VIII gene inversions in 164 unrelated hemophilia A families
Energy Technology Data Exchange (ETDEWEB)
Vnencak-Jones, L.; Phillips, J.A. III; Janco, R.L. [Vanderbilt Univ. School of Medicine, Nashville, TN (United States)] [and others
1994-09-01
Hemophilia A is an X-linked recessive disease with variable phenotype and both heterogeneous and wide spread mutations in the factor VIII (F8) gene. As a result, diagnostic carrier or prenatal testing often relies upon laborious DNA linkage analysis. Recently, inversion mutations resulting from an intrachromosomal recombination between DNA sequences in one of two A genes {approximately}500 kb upstream from the F8 gene and a homologous A gene in intron 22 of the F8 gene were identified and found in 45% of severe hemophiliacs. We have analyzed banked DNA collected since 1986 from affected males or obligate carrier females representing 164 unrelated hemophilia A families. The disease was sporadic in 37%, familial in 54% and in 10% of families incomplete information was given. A unique deletion was identified in 1/164, a normal pattern was observed in 110/164 (67%), and 53/164 (32%) families had inversion mutations with 43/53 (81%) involving the distal A gene (R3 pattern) and 10/53 (19%) involving the proximal A gene (R2 pattern). While 19% of all rearrangements were R2, in 35 families with severe disease (< 1% VIII:C activity) all 16 rearrangements seen were R3. In 18 families with the R3 pattern and known activities, 16 (89%) had levels < 1%, with the remaining 2 families having {le} 2.4% activity. Further, 18 referrals specifically noted the production of inhibitors and 8/18 (45%) had the R3 pattern. Our findings demonstrate that the R3 inversion mutation patterns is (1) only seen with VIII:C activity levels of {le} 2.4%, (2) seen in 46% of families with severe hemophilia, (3) seen in 45% of hemophiliacs known to have inhibitors, (4) not correlated with sporadic or familial disease and (5) not in disequilibrium with the Bcl I or Taq I intron 18 or ST14 polymorphisms. Finally, in families positive for an inversion mutation, direct testing offers a highly accurate and less expensive alternative to DNA linkage analysis.
The human protein disulfide isomerase gene family
Directory of Open Access Journals (Sweden)
Galligan James J
2012-07-01
Full Text Available Abstract Enzyme-mediated disulfide bond formation is a highly conserved process affecting over one-third of all eukaryotic proteins. The enzymes primarily responsible for facilitating thiol-disulfide exchange are members of an expanding family of proteins known as protein disulfide isomerases (PDIs. These proteins are part of a larger superfamily of proteins known as the thioredoxin protein family (TRX. As members of the PDI family of proteins, all proteins contain a TRX-like structural domain and are predominantly expressed in the endoplasmic reticulum. Subcellular localization and the presence of a TRX domain, however, comprise the short list of distinguishing features required for gene family classification. To date, the PDI gene family contains 21 members, varying in domain composition, molecular weight, tissue expression, and cellular processing. Given their vital role in protein-folding, loss of PDI activity has been associated with the pathogenesis of numerous disease states, most commonly related to the unfolded protein response (UPR. Over the past decade, UPR has become a very attractive therapeutic target for multiple pathologies including Alzheimer disease, Parkinson disease, alcoholic and non-alcoholic liver disease, and type-2 diabetes. Understanding the mechanisms of protein-folding, specifically thiol-disulfide exchange, may lead to development of a novel class of therapeutics that would help alleviate a wide range of diseases by targeting the UPR.
DEFF Research Database (Denmark)
Hansen, Martin A; Nielsen, John E; Retelska, Dorota
2008-01-01
, sequences corresponding to the shared promoter region of the CYPT family were identified at 39 loci. Most loci were located immediately upstream of genes belonging to the VCX/Y, SPANX, or CSAG gene families. Sequence comparison of the loci revealed a conserved CYPT promoter-like (CPL) element featuring TATA...... cell types. The genomic regions harboring the gene families were rich in direct and inverted segmental duplications (SD), which may facilitate gene conversion and rapid evolution. The conserved CPL and the common expression profiles suggest that the human VCX/Y, SPANX, and CSAG2 gene families together......Many testis-specific genes from the sex chromosomes are subject to rapid evolution, which can make it difficult to identify murine genes in the human genome. The murine CYPT gene family includes 15 members, but orthologs were undetectable in the human genome. However, using refined homology search...
Dichotomy in the NRT gene families of dicots and grass species.
Directory of Open Access Journals (Sweden)
Darren Plett
Full Text Available A large proportion of the nitrate (NO(3(- acquired by plants from soil is actively transported via members of the NRT families of NO(3(- transporters. In Arabidopsis, the NRT1 family has eight functionally characterised members and predominantly comprises low-affinity transporters; the NRT2 family contains seven members which appear to be high-affinity transporters; and there are two NRT3 (NAR2 family members which are known to participate in high-affinity transport. A modified reciprocal best hit (RBH approach was used to identify putative orthologues of the Arabidopsis NRT genes in the four fully sequenced grass genomes (maize, rice, sorghum, Brachypodium. We also included the poplar genome in our analysis to establish whether differences between Arabidopsis and the grasses may be generally applicable to monocots and dicots. Our analysis reveals fundamental differences between Arabidopsis and the grass species in the gene number and family structure of all three families of NRT transporters. All grass species possessed additional NRT1.1 orthologues and appear to lack NRT1.6/NRT1.7 orthologues. There is significant separation in the NRT2 phylogenetic tree between NRT2 genes from dicots and grass species. This indicates that determination of function of NRT2 genes in grass species will not be possible in cereals based simply on sequence homology to functionally characterised Arabidopsis NRT2 genes and that proper functional analysis will be required. Arabidopsis has a unique NRT3.2 gene which may be a fusion of the NRT3.1 and NRT3.2 genes present in all other species examined here. This work provides a framework for future analysis of NO(3(- transporters and NO(3(- transport in grass crop species.
Saltatory Evolution of the Ectodermal Neural Cortex Gene Family at the Vertebrate Origin
Feiner, Nathalie; Murakami, Yasunori; Breithut, Lisa; Mazan, Sylvie; Meyer, Axel; Kuraku, Shigehiro
2013-01-01
The ectodermal neural cortex (ENC) gene family, whose members are implicated in neurogenesis, is part of the kelch repeat superfamily. To date, ENC genes have been identified only in osteichthyans, although other kelch repeat-containing genes are prevalent throughout bilaterians. The lack of elaborate molecular phylogenetic analysis with exhaustive taxon sampling has obscured the possible link of the establishment of this gene family with vertebrate novelties. In this study, we identified ENC homologs in diverse vertebrates by means of database mining and polymerase chain reaction screens. Our analysis revealed that the ENC3 ortholog was lost in the basal eutherian lineage through single-gene deletion and that the triplication between ENC1, -2, and -3 occurred early in vertebrate evolution. Including our original data on the catshark and the zebrafish, our comparison revealed high conservation of the pleiotropic expression pattern of ENC1 and shuffling of expression domains between ENC1, -2, and -3. Compared with many other gene families including developmental key regulators, the ENC gene family is unique in that conventional molecular phylogenetic inference could identify no obvious invertebrate ortholog. This suggests a composite nature of the vertebrate-specific gene repertoire, consisting not only of de novo genes introduced at the vertebrate origin but also of long-standing genes with no apparent invertebrate orthologs. Some of the latter, including the ENC gene family, may be too rapidly evolving to provide sufficient phylogenetic signals marking orthology to their invertebrate counterparts. Such gene families that experienced saltatory evolution likely remain to be explored and might also have contributed to phenotypic evolution of vertebrates. PMID:23843192
Undefined familial colorectal cancer and the role of pleiotropism in cancer susceptibility genes.
Dobbins, Sara E; Broderick, Peter; Chubb, Daniel; Kinnersley, Ben; Sherborne, Amy L; Houlston, Richard S
2016-10-01
Although family history is a major risk factor for colorectal cancer (CRC) a genetic diagnosis cannot be obtained in over 50 % of familial cases when screened for known CRC cancer susceptibility genes. The genetics of undefined-familial CRC is complex and recent studies have implied additional clinically actionable mutations for CRC in susceptibility genes for other cancers. To clarify the contribution of non-CRC susceptibility genes to undefined-familial CRC we conducted a mutational screen of 114 cancer susceptibility genes in 847 patients with early-onset undefined-familial CRC and 1609 controls by analysing high-coverage exome sequencing data. We implemented American College of Medical Genetics and Genomics standards and guidelines for assigning pathogenicity to variants. Globally across all 114 cancer susceptibility genes no statistically significant enrichment of likely pathogenic variants was shown (6.7 % cases 57/847, 5.3 % controls 85/1609; P = 0.15). Moreover there was no significant enrichment of mutations in genes such as TP53 or BRCA2 which have been proposed for clinical testing in CRC. In conclusion, while we identified genes that may be considered interesting candidates as determinants of CRC risk warranting further research, there is currently scant evidence to support a role for genes other than those responsible for established CRC syndromes in the clinical management of familial CRC.
Aux/IAA Gene Family in Plants: Molecular Structure, Regulation, and Function
Directory of Open Access Journals (Sweden)
Jie Luo
2018-01-01
Full Text Available Auxin plays a crucial role in the diverse cellular and developmental responses of plants across their lifespan. Plants can quickly sense and respond to changes in auxin levels, and these responses involve several major classes of auxin-responsive genes, including the Auxin/Indole-3-Acetic Acid (Aux/IAA family, the auxin response factor (ARF family, small auxin upregulated RNA (SAUR, and the auxin-responsive Gretchen Hagen3 (GH3 family. Aux/IAA proteins are short-lived nuclear proteins comprising several highly conserved domains that are encoded by the auxin early response gene family. These proteins have specific domains that interact with ARFs and inhibit the transcription of genes activated by ARFs. Molecular studies have revealed that Aux/IAA family members can form diverse dimers with ARFs to regulate genes in various ways. Functional analyses of Aux/IAA family members have indicated that they have various roles in plant development, such as root development, shoot growth, and fruit ripening. In this review, recently discovered details regarding the molecular characteristics, regulation, and protein–protein interactions of the Aux/IAA proteins are discussed. These details provide new insights into the molecular basis of the Aux/IAA protein functions in plant developmental processes.
Lawton, Jennifer
2012-03-29
Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein
Directory of Open Access Journals (Sweden)
Lawton Jennifer
2012-03-01
Full Text Available Abstract Background The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required. Results The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages. Conclusions In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family
Lawton, Jennifer; Brugat, Thibaut; Yan, Yam Xue; Reid, Adam James; Bö hme, Ulrike; Otto, Thomas Dan; Pain, Arnab; Jackson, Andrew; Berriman, Matthew; Cunningham, Deirdre; Preiser, Peter; Langhorne, Jean
2012-01-01
Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein
Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.
Directory of Open Access Journals (Sweden)
Petar Petrov
Full Text Available "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.
Plant ion channels: gene families, physiology, and functional genomics analyses.
Ward, John M; Mäser, Pascal; Schroeder, Julian I
2009-01-01
Distinct potassium, anion, and calcium channels in the plasma membrane and vacuolar membrane of plant cells have been identified and characterized by patch clamping. Primarily owing to advances in Arabidopsis genetics and genomics, and yeast functional complementation, many of the corresponding genes have been identified. Recent advances in our understanding of ion channel genes that mediate signal transduction and ion transport are discussed here. Some plant ion channels, for example, ALMT and SLAC anion channel subunits, are unique. The majority of plant ion channel families exhibit homology to animal genes; such families include both hyperpolarization- and depolarization-activated Shaker-type potassium channels, CLC chloride transporters/channels, cyclic nucleotide-gated channels, and ionotropic glutamate receptor homologs. These plant ion channels offer unique opportunities to analyze the structural mechanisms and functions of ion channels. Here we review gene families of selected plant ion channel classes and discuss unique structure-function aspects and their physiological roles in plant cell signaling and transport.
Global Analysis of miRNA Gene Clusters and Gene Families Reveals Dynamic and Coordinated Expression
Directory of Open Access Journals (Sweden)
Li Guo
2014-01-01
Full Text Available To further understand the potential expression relationships of miRNAs in miRNA gene clusters and gene families, a global analysis was performed in 4 paired tumor (breast cancer and adjacent normal tissue samples using deep sequencing datasets. The compositions of miRNA gene clusters and families are not random, and clustered and homologous miRNAs may have close relationships with overlapped miRNA species. Members in the miRNA group always had various expression levels, and even some showed larger expression divergence. Despite the dynamic expression as well as individual difference, these miRNAs always indicated consistent or similar deregulation patterns. The consistent deregulation expression may contribute to dynamic and coordinated interaction between different miRNAs in regulatory network. Further, we found that those clustered or homologous miRNAs that were also identified as sense and antisense miRNAs showed larger expression divergence. miRNA gene clusters and families indicated important biological roles, and the specific distribution and expression further enrich and ensure the flexible and robust regulatory network.
Novel genetic variants in miR-191 gene and familial ovarian cancer
International Nuclear Information System (INIS)
Shen, Jie; DiCioccio, Richard; Odunsi, Kunle; Lele, Shashikant B; Zhao, Hua
2010-01-01
Half of the familial aggregation of ovarian cancer can't be explained by any known risk genes, suggesting the existence of other genetic risk factors. Some of these unknown factors may not be traditional protein encoding genes. MicroRNA (miRNA) plays a critical role in tumorigenesis, but it is still unknown if variants in miRNA genes lead to predisposition to cancer. Considering the fact that miRNA regulates a number of tumor suppressor genes (TSGs) and oncogenes, genetic variations in miRNA genes could affect the levels of expression of TSGs or oncogenes and, thereby, cancer risk. To test this hypothesis in familial ovarian cancer, we screened for genetic variants in thirty selected miRNA genes, which are predicted to regulate key ovarian cancer genes and are reported to be misexpressed in ovarian tumor tissues, in eighty-three patients with familial ovarian cancer. All of the patients are non-carriers of any known BRCA1/2 or mismatch repair (MMR) gene mutations. Seven novel genetic variants were observed in four primary or precursor miRNA genes. Among them, three rare variants were found in the precursor or primary precursor of the miR-191 gene. In functional assays, the one variant located in the precursor of miR-191 resulted in conformational changes in the predicted secondary structures, and consequently altered the expression of mature miR-191. In further analysis, we found that this particular variant exists in five family members who had ovarian cancer. Our findings suggest that there are novel genetic variants in miRNA genes, and those certain genetic variants in miRNA genes can affect the expression of mature miRNAs and, consequently, might alter the regulation of TSGs or oncogenes. Additionally, the variant might be potentially associated with the development of familial ovarian cancer
Molecular analysis of the NDP gene in two families with Norrie disease.
Rivera-Vega, M Refugio; Chiñas-Lopez, Silvet; Vaca, Ana Luisa Jimenez; Arenas-Sordo, M Luz; Kofman-Alfaro, Susana; Messina-Baas, Olga; Cuevas-Covarrubias, Sergio Alberto
2005-04-01
To describe the molecular defects in the Norrie disease protein (NDP) gene in two families with Norrie disease (ND). We analysed two families with ND at molecular level through polymerase chain reaction, DNA sequence analysis and GeneScan. Two molecular defects found in the NDP gene were: a missense mutation (265C > G) within codon 97 that resulted in the interchange of arginine by proline, and a partial deletion in the untranslated 3' region of exon 3 of the NDP gene. Clinical findings were more severe in the family that presented the partial deletion. We also diagnosed the carrier status of one daughter through GeneScan; this method proved to be a useful tool for establishing female carriers of ND. Here we report two novel mutations in the NDP gene in Mexican patients and propose that GeneScan is a viable mean of establishing ND carrier status.
Ancient signals: comparative genomics of plant MAPK and MAPKK gene families
DEFF Research Database (Denmark)
Hamel, Louis-Philippe; Nicole, Marie-Claude; Sritubtim, Somrudee
2006-01-01
MAPK signal transduction modules play crucial roles in regulating many biological processes in plants, and their components are encoded by highly conserved genes. The recent availability of genome sequences for rice and poplar now makes it possible to examine how well the previously described...... Arabidopsis MAPK and MAPKK gene family structures represent the broader evolutionary situation in plants, and analysis of gene expression data for MPK and MKK genes in all three species allows further refinement of those families, based on functionality. The Arabidopsis MAPK nomenclature appears sufficiently...
Evolution of the vertebrate insulin receptor substrate (Irs) gene family.
Al-Salam, Ahmad; Irwin, David M
2017-06-23
Insulin receptor substrate (Irs) proteins are essential for insulin signaling as they allow downstream effectors to dock with, and be activated by, the insulin receptor. A family of four Irs proteins have been identified in mice, however the gene for one of these, IRS3, has been pseudogenized in humans. While it is known that the Irs gene family originated in vertebrates, it is not known when it originated and which members are most closely related to each other. A better understanding of the evolution of Irs genes and proteins should provide insight into the regulation of metabolism by insulin. Multiple genes for Irs proteins were identified in a wide variety of vertebrate species. Phylogenetic and genomic neighborhood analyses indicate that this gene family originated very early in vertebrae evolution. Most Irs genes were duplicated and retained in fish after the fish-specific genome duplication. Irs genes have been lost of various lineages, including Irs3 in primates and birds and Irs1 in most fish. Irs3 and Irs4 experienced an episode of more rapid protein sequence evolution on the ancestral mammalian lineage. Comparisons of the conservation of the proteins sequences among Irs paralogs show that domains involved in binding to the plasma membrane and insulin receptors are most strongly conserved, while divergence has occurred in sequences involved in interacting with downstream effector proteins. The Irs gene family originated very early in vertebrate evolution, likely through genome duplications, and in parallel with duplications of other components of the insulin signaling pathway, including insulin and the insulin receptor. While the N-terminal sequences of these proteins are conserved among the paralogs, changes in the C-terminal sequences likely allowed changes in biological function.
Polymorphism in the interferon-{alpha} gene family
Energy Technology Data Exchange (ETDEWEB)
Golovleva, I.; Lundgren, E.; Beckman, L. [Univ. of Umea (Sweden); Kandefer-Szerszen, M. [Maria Curie-Sklodowska Univ., Lublin (Poland)
1996-09-01
A pronounced genetic polymorphism of the interferon type I gene family has been assumed on the basis of RFLP analysis of the genomic region as well as the large number of sequences published compared to the number of loci. However, IFNA2 is the only locus that has been carefully analyzed concerning gene frequency, and only naturally occurring rare alleles have been found. We have extended the studies on a variation of expressed sequences by studying the IFNA1, IFNA2, IFNA10, IFNA13, IFNA14, and IFNA17 genes. Genomic white-blood-cell DNA from a population sample of blood donors and from a family material were screened by single-nucleotide primer extension (allele-specific primer extension) of PCR fragments. Because of sequence similarities, in some cases {open_quotes}nested{close_quotes} PCR was used, and, when applicable, restriction analysis or control sequencing was performed. All individuals carried the interferon-{alpha} 1 and interferon-{alpha} 13 variants but not the LeIF D variant. At the IFNA2 and IFNA14 loci only one sequence variant was found, while in the IFNA10 and IFNA17 groups two alleles were detected in each group. The IFNA10 and IFNA17 alleles segregated in families and showed a close fit to the Hardy-Weinberg equilibrium. There was a significant linkage disequilibrium between IFNA10 and IFNA17 alleles. The fact that the extent of genetic polymorphism was lower than expected suggests that a majority of the previously described gene sequences represent nonpolymorphic rare mutants that may have arisen in tumor cell lines. 44 refs., 4 figs., 4 tabs.
msh/Msx gene family in neural development.
Ramos, Casto; Robert, Benoît
2005-11-01
The involvement of Msx homeobox genes in skull and tooth formation has received a great deal of attention. Recent studies also indicate a role for the msh/Msx gene family in development of the nervous system. In this article, we discuss the functions of these transcription factors in neural-tissue organogenesis. We will deal mainly with the interactions of the Drosophila muscle segment homeobox (msh) gene with other homeobox genes and the repressive cascade that leads to neuroectoderm patterning; the role of Msx genes in neural-crest induction, focusing especially on the differences between lower and higher vertebrates; their implication in patterning of the vertebrate neural tube, particularly in diencephalon midline formation. Finally, we will examine the distinct activities of Msx1, Msx2 and Msx3 genes during neurogenesis, taking into account their relationships with signalling molecules such as BMP.
Genome-Wide Identification and Analysis of the TIFY Gene Family in Grape
Zhang, Yucheng; Gao, Min; Singer, Stacy D.; Fei, Zhangjun; Wang, Hua; Wang, Xiping
2012-01-01
Background The TIFY gene family constitutes a plant-specific group of genes with a broad range of functions. This family encodes four subfamilies of proteins, including ZML, TIFY, PPD and JASMONATE ZIM-Domain (JAZ) proteins. JAZ proteins are targets of the SCFCOI1 complex, and function as negative regulators in the JA signaling pathway. Recently, it has been reported in both Arabidopsis and rice that TIFY genes, and especially JAZ genes, may be involved in plant defense against insect feeding, wounding, pathogens and abiotic stresses. Nonetheless, knowledge concerning the specific expression patterns and evolutionary history of plant TIFY family members is limited, especially in a woody species such as grape. Methodology/Principal Findings A total of two TIFY, four ZML, two PPD and 11 JAZ genes were identified in the Vitis vinifera genome. Phylogenetic analysis of TIFY protein sequences from grape, Arabidopsis and rice indicated that the grape TIFY proteins are more closely related to those of Arabidopsis than those of rice. Both segmental and tandem duplication events have been major contributors to the expansion of the grape TIFY family. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologues of several grape TIFY genes were found in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of lineages that led to grape and Arabidopsis. Analyses of microarray and quantitative real-time RT-PCR expression data revealed that grape TIFY genes are not a major player in the defense against biotrophic pathogens or viruses. However, many of these genes were responsive to JA and ABA, but not SA or ET. Conclusion The genome-wide identification, evolutionary and expression analyses of grape TIFY genes should facilitate further research of this gene family and provide new insights regarding their evolutionary history and regulatory control. PMID:22984514
Zou, Zhi; Yang, Lifu; Wang, Danhua; Huang, Qixing; Mo, Yeyong; Xie, Guishui
2016-01-01
WRKY proteins comprise one of the largest transcription factor families in plants and form key regulators of many plant processes. This study presents the characterization of 58 WRKY genes from the castor bean (Ricinus communis L., Euphorbiaceae) genome. Compared with the automatic genome annotation, one more WRKY-encoding locus was identified and 20 out of the 57 predicted gene models were manually corrected. All RcWRKY genes were shown to contain at least one intron in their coding sequences. According to the structural features of the present WRKY domains, the identified RcWRKY genes were assigned to three previously defined groups (I-III). Although castor bean underwent no recent whole-genome duplication event like physic nut (Jatropha curcas L., Euphorbiaceae), comparative genomics analysis indicated that one gene loss, one intron loss and one recent proximal duplication occurred in the RcWRKY gene family. The expression of all 58 RcWRKY genes was supported by ESTs and/or RNA sequencing reads derived from roots, leaves, flowers, seeds and endosperms. Further global expression profiles with RNA sequencing data revealed diverse expression patterns among various tissues. Results obtained from this study not only provide valuable information for future functional analysis and utilization of the castor bean WRKY genes, but also provide a useful reference to investigate the gene family expansion and evolution in Euphorbiaceus plants.
Directory of Open Access Journals (Sweden)
Fermin Moreno
Full Text Available The co-occurrence of the c.709-1G>A GRN mutation and the p.A152T MAPT variant has been identified in 18 Basque families affected by frontotemporal dementia (FTD. We aimed to investigate the influence of the p.A152T MAPT variant on the clinical and neuropathological features of these Basque GRN families.We compared clinical characteristics of 14 patients who carried the c.709-1G>A GRN mutation (GRN+/A152T- with 21 patients who carried both the c.709-1G>A GRN mutation and the p.A152T MAPT variant (GRN+/A152T+. Neuropsychological data (n = 17 and plasma progranulin levels (n = 23 were compared between groups, and 7 subjects underwent neuropathological studies. We genotyped six short tandem repeat markers in the two largest families. By the analysis of linkage disequilibrium decay in the haplotype block we estimated the time when the first ancestor to carry both genetic variants emerged. GRN+/A152T+ and GRN+/A152T- patients shared similar clinical and neuropsychological features and plasma progranulin levels. All were diagnosed with an FTD disorder, including behavioral variant FTD or non fluent / agrammatic variant primary progressive aphasia, and shared a similar pattern of neuropsychological deficits, predominantly in executive function, memory, and language. All seven participants with available brain autopsies (6 GRN+/A152T+, 1 GRN+/A152T- showed frontotemporal lobar degeneration with TDP-43 inclusions (type A classification, which is characteristic of GRN carriers. Additionally, all seven showed mild to moderate tau inclusion burden: five cases lacked β-amyloid pathology and two cases had Alzheimer's pathology. The co-occurrence of both genes within one individual is recent, with the birth of the first GRN+/A152T+ individual estimated to be within the last 50 generations (95% probability.In our sample, the p.A152T MAPT variant does not appear to show a discernible influence on the clinical phenotype of GRN carriers. Whether p.A152T confers a
Genome-wide identification of the SWEET gene family in wheat.
Gao, Yue; Wang, Zi Yuan; Kumar, Vikranth; Xu, Xiao Feng; Yuan, De Peng; Zhu, Xiao Feng; Li, Tian Ya; Jia, Baolei; Xuan, Yuan Hu
2018-02-05
The SWEET (sugars will eventually be exported transporter) family is a newly characterized group of sugar transporters. In plants, the key roles of SWEETs in phloem transport, nectar secretion, pollen nutrition, stress tolerance, and plant-pathogen interactions have been identified. SWEET family genes have been characterized in many plant species, but a comprehensive analysis of SWEET members has not yet been performed in wheat. Here, 59 wheat SWEETs (hereafter TaSWEETs) were identified through homology searches. Analyses of phylogenetic relationships, numbers of transmembrane helices (TMHs), gene structures, and motifs showed that TaSWEETs carrying 3-7 TMHs could be classified into four clades with 10 different types of motifs. Examination of the expression patterns of 18 SWEET genes revealed that a few are tissue-specific while most are ubiquitously expressed. In addition, the stem rust-mediated expression patterns of SWEET genes were monitored using a stem rust-susceptible cultivar, 'Little Club' (LC). The resulting data showed that the expression of five out of the 18 SWEETs tested was induced following inoculation. In conclusion, we provide the first comprehensive analysis of the wheat SWEET gene family. Information regarding the phylogenetic relationships, gene structures, and expression profiles of SWEET genes in different tissues and following stem rust disease inoculation will be useful in identifying the potential roles of SWEETs in specific developmental and pathogenic processes. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
A. R. Pradeep
2012-01-01
Full Text Available Background: Obesity is considered as a strong risk factor of inflammatory periodontal tissue destruction. The purpose of this study is to determine presence of progranulin (PGRN and high sensitivity C reactive protein (hs CRP levels in serum and gingival crevicular fluid (GCF in obese subjects with chronic periodontitis and to find an association, if any.
Directory of Open Access Journals (Sweden)
Walker Angela M
2009-04-01
Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed
Identification and characterization of NF-YB family genes in tung tree.
Yang, Susu; Wang, Yangdong; Yin, Hengfu; Guo, Haobo; Gao, Ming; Zhu, Huiping; Chen, Yicun
2015-12-01
The NF-YB transcription factor gene family encodes a subunit of the CCAAT box-binding factor (CBF), a highly conserved trimeric activator that strongly binds to the CCAAT box promoter element. Studies on model plants have shown that NF-YB proteins participate in important developmental and physiological processes, but little is known about NF-YB proteins in trees. Here, we identified seven NF-YB transcription factor-encoding genes in Vernicia fordii, an important oilseed tree in China. A phylogenetic analysis separated the genes into two groups; non-LEC1 type (VfNF-YB1, 5, 7, 9, 11, 13) and LEC1-type (VfNF-YB 14). A gene structure analysis showed that VfNF-YB 5 has three introns and the other genes have no introns. The seven VfNF-YB sequences contain highly conserved domains, a disordered region at the N terminus, and two long helix structures at the C terminus. Phylogenetic analyses showed that VfNF-YB family genes are highly homologous to GmNF-YB genes, and many of them are closely related to functionally characterized NF-YBs. In expression analyses of various tissues (root, stem, leaf, and kernel) and the root during pathogen infection, VfNF-YB1, 5, and 11 were dominantly expressed in kernels, and VfNF-YB7 and 9 were expressed only in the root. Different VfNF-YB family genes showed different responses to pathogen infection, suggesting that they play different roles in the pathogen response. Together, these findings represent the first extensive evaluation of the NF-YB family in tung tree and provide a foundation for dissecting the functions of VfNF-YB genes in seed development, stress adaption, fatty acid synthesis, and pathogen response.
Fu, Wenyu; Hu, Wenhuo; Shi, Lei; Mundra, Jyoti Joshi; Xiao, GuoZhi; Dustin, Michael L.; Liu, Chuan-ju
2017-01-01
Progranulin (PGRN) restrains inflammation and is therapeutic against inflammatory arthritis; however, the underlying immunological mechanism remains unknown. In this study, we demonstrated that anti-inflammatory cytokine IL-10 was a critical mediator for PGRN-mediated anti-inflammation in collagen-induced arthritis by using PGRN and IL-10 genetically modified mouse models. IL-10 green fluorescent protein reporter mice revealed that regulatory T (Treg) cells were the predominant source of IL-10 in response to PGRN. In addition, PGRN-mediated expansion and activation of Treg cells, as well as IL-10 production, depends on JNK signaling, but not on known PGRN-activated ERK and PI3K pathways. Furthermore, microarray and chromatin immunoprecipitation sequencing screens led to the discovery of forkhead box protein O4 and signal transducer and activator of transcription 3 as the transcription factors required for PGRN induction of IL-10 in Treg cells. These findings define a previously unrecognized signaling pathway that underlies IL-10 production by PGRN in Treg cells and present new insights into the mechanisms by which PGRN resolves inflammation in inflammatory conditions and autoimmune diseases, particularly inflammatory arthritis.—Fu, W., Hu, W., Shi, L., Mundra, J. J. Xiao, G., Dustin, M. L., Liu, C. Foxo4- and Stat3-dependent IL-10 production by progranulin in regulatory T cells restrains inflammatory arthritis. PMID:28011648
Duplications and losses in gene families of rust pathogens highlight putative effectors.
Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M
2014-01-01
Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.
Genomewide analysis of TCP transcription factor gene family in ...
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics; Volume 93; Issue 3. Genomewide ... Teosinte branched1/cycloidea/proliferating cell factor1 (TCP) proteins are a large family of transcriptional regulators in angiosperms. They are ... To the best of our knowledge, this is the first study of a genomewide analysis of apple TCP gene family.
Directory of Open Access Journals (Sweden)
Mohammad H Dezfulian
Full Text Available The Arabidopsis thaliana genome encodes several families of polypeptides that are known or predicted to participate in the formation of the SCF-class of E3-ubiquitin ligase complexes. One such gene family encodes the Skp1-like class of polypeptide subunits, where 21 genes have been identified and are known to be expressed in Arabidopsis. Phylogenetic analysis based on deduced polypeptide sequence organizes the family of ASK proteins into 7 clades. The complexity of the ASK gene family, together with the close structural similarity among its members raises the prospect of significant functional redundancy among select paralogs. We have assessed the potential for functional redundancy within the ASK gene family by analyzing an expanded set of criteria that define redundancy with higher resolution. The criteria used include quantitative expression of locus-specific transcripts using qRT-PCR, assessment of the sub-cellular localization of individual ASK:YFP auto-fluorescent fusion proteins expressed in vivo as well as the in planta assessment of individual ASK-F-Box protein interactions using bimolecular fluorescent complementation techniques in combination with confocal imagery in live cells. The results indicate significant functional divergence of steady state transcript abundance and protein-protein interaction specificity involving ASK proteins in a pattern that is poorly predicted by sequence-based phylogeny. The information emerging from this and related studies will prove important for defining the functional intersection of expression, localization and gene product interaction that better predicts the formation of discrete SCF complexes, as a prelude to investigating their molecular mode of action.
Davarniya, Behzad; Hu, Hao; Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Hosseini, Masoumeh; Maqsoud, Fariba; Farajollahi, Reza; Wienker, Thomas F; Ropers, H Hilger; Najmabadi, Hossein
2015-01-01
Cognitive impairment or intellectual disability (ID) is a widespread neurodevelopmental disorder characterized by low IQ (below 70). ID is genetically heterogeneous and is estimated to affect 1-3% of the world's population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID), we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831), encodes the metabotropic glutamate receptor1 (mGluR1). This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011). We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder.
Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants.
Rawal, H C; Singh, N K; Sharma, T R
2013-01-01
Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL) and peroxidase A (POX A) enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula), fruits (Vitis vinifera), cereals (Sorghum bicolor, Zea mays, and Oryza sativa), trees (Populus trichocarpa), and model dicot (Arabidopsis thaliana) and monocot (Brachypodium distachyon) species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.
Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants
Directory of Open Access Journals (Sweden)
H. C. Rawal
2013-01-01
Full Text Available Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL and peroxidase A (POX A enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula, fruits (Vitis vinifera, cereals (Sorghum bicolor, Zea mays, and Oryza sativa, trees (Populus trichocarpa, and model dicot (Arabidopsis thaliana and monocot (Brachypodium distachyon species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.
Progranulin expression in advanced human atherosclerotic plaque.
Kojima, Yoji; Ono, Koh; Inoue, Katsumi; Takagi, Yasushi; Kikuta, Ken-ichiro; Nishimura, Masaki; Yoshida, Yoshinori; Nakashima, Yasuhiro; Matsumae, Hironobu; Furukawa, Yutaka; Mikuni, Nobuhiro; Nobuyoshi, Masakiyo; Kimura, Takeshi; Kita, Toru; Tanaka, Makoto
2009-09-01
Progranulin (PGRN) is a unique growth factor that plays an important role in cutaneous wound healing. It has an anti-inflammatory effect and promotes cell proliferation. However, when it is degraded to granulin peptides (GRNs) by neutrophil proteases, a pro-inflammatory reaction occurs. Since injury, inflammation and repair are common features in the progression of atherosclerosis, it is conceivable that PGRN plays a role in atherogenesis. Immunohistochemical analysis of human carotid endoatherectomy specimens indicated that vascular smooth muscle cells (vSMCs) in the intima expressed PGRN. Some macrophages in the plaque also expressed PGRN. We assessed the effect of PGRN on a human monocytic leukemia cell line (THP-1) and human aortic smooth muscle cells (HASMCs). PGRN alone had no effect on HASMC or THP-1 proliferation or migration. However, when THP-1 cells were stimulated with MCP-1, the number of migrated cells decreased in a PGRN-dose-dependent manner. TNF-alpha-induced HASMC migration was enhanced only at 10nM of PGRN. Interleukin-8 (IL-8) secretion from HASMCs was reduced by forced expression of PGRN and increased by RNAi-mediated knockdown of PGRN. While exogenous treatment with recombinant PGRN decreased IL-8 secretion, degraded recombinant GRNs increased IL-8 secretion from HASMCs. The expression of PGRN mainly reduces inflammation and its degradation into GRNs enhances inflammation in atherosclerotic plaque and may contribute to the progression of atherosclerosis.
Shiao, S Pamela K; Grayson, James; Yu, Chong Ho; Wasek, Brandi; Bottiglieri, Teodoro
2018-02-16
For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene-environment interactions and predictors of colorectal cancer (CRC) by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black). We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls ( p relation to gene-environment interactions in the prevention of CRC.
Genomewide analysis of MATE-type gene family in maize reveals ...
Indian Academy of Sciences (India)
Huasheng Zhu and Jiandong Wu contributed equally to this work. As a group of secondary active transporters, the MATE gene family consists of multiple genes that widely exist in ..... Roots of the stress-treated plants were collected at 0,.
Genome-wide identification and characterization of WRKY gene family in Salix suchowensis.
Bi, Changwei; Xu, Yiqing; Ye, Qiaolin; Yin, Tongming; Ye, Ning
2016-01-01
WRKY proteins are the zinc finger transcription factors that were first identified in plants. They can specifically interact with the W-box, which can be found in the promoter region of a large number of plant target genes, to regulate the expressions of downstream target genes. They also participate in diverse physiological and growing processes in plants. Prior to this study, a plenty of WRKY genes have been identified and characterized in herbaceous species, but there is no large-scale study of WRKY genes in willow. With the whole genome sequencing of Salix suchowensis, we have the opportunity to conduct the genome-wide research for willow WRKY gene family. In this study, we identified 85 WRKY genes in the willow genome and renamed them from SsWRKY1 to SsWRKY85 on the basis of their specific distributions on chromosomes. Due to their diverse structural features, the 85 willow WRKY genes could be further classified into three main groups (group I-III), with five subgroups (IIa-IIe) in group II. With the multiple sequence alignment and the manual search, we found three variations of the WRKYGQK heptapeptide: WRKYGRK, WKKYGQK and WRKYGKK, and four variations of the normal zinc finger motif, which might execute some new biological functions. In addition, the SsWRKY genes from the same subgroup share the similar exon-intron structures and conserved motif domains. Further studies of SsWRKY genes revealed that segmental duplication events (SDs) played a more prominent role in the expansion of SsWRKY genes. Distinct expression profiles of SsWRKY genes with RNA sequencing data revealed that diverse expression patterns among five tissues, including tender roots, young leaves, vegetative buds, non-lignified stems and barks. With the analyses of WRKY gene family in willow, it is not only beneficial to complete the functional and annotation information of WRKY genes family in woody plants, but also provide important references to investigate the expansion and evolution of
Duplications and losses in gene families of rust pathogens highlight putative effectors
Directory of Open Access Journals (Sweden)
Amanda L. Pendleton
2014-06-01
Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.
Mutation analysis of pre-mRNA splicing genes in Chinese families with retinitis pigmentosa
Pan, Xinyuan; Chen, Xue; Liu, Xiaoxing; Gao, Xiang; Kang, Xiaoli; Xu, Qihua; Chen, Xuejuan; Zhao, Kanxing; Zhang, Xiumei; Chu, Qiaomei; Wang, Xiuying
2014-01-01
Purpose Seven genes involved in precursor mRNA (pre-mRNA) splicing have been implicated in autosomal dominant retinitis pigmentosa (adRP). We sought to detect mutations in all seven genes in Chinese families with RP, to characterize the relevant phenotypes, and to evaluate the prevalence of mutations in splicing genes in patients with adRP. Methods Six unrelated families from our adRP cohort (42 families) and two additional families with RP with uncertain inheritance mode were clinically characterized in the present study. Targeted sequence capture with next-generation massively parallel sequencing (NGS) was performed to screen mutations in 189 genes including all seven pre-mRNA splicing genes associated with adRP. Variants detected with NGS were filtered with bioinformatics analyses, validated with Sanger sequencing, and prioritized with pathogenicity analysis. Results Mutations in pre-mRNA splicing genes were identified in three individual families including one novel frameshift mutation in PRPF31 (p.Leu366fs*1) and two known mutations in SNRNP200 (p.Arg681His and p.Ser1087Leu). The patients carrying SNRNP200 p.R681H showed rapid disease progression, and the family carrying p.S1087L presented earlier onset ages and more severe phenotypes compared to another previously reported family with p.S1087L. In five other families, we identified mutations in other RP-related genes, including RP1 p. Ser781* (novel), RP2 p.Gln65* (novel) and p.Ile137del (novel), IMPDH1 p.Asp311Asn (recurrent), and RHO p.Pro347Leu (recurrent). Conclusions Mutations in splicing genes identified in the present and our previous study account for 9.5% in our adRP cohort, indicating the important role of pre-mRNA splicing deficiency in the etiology of adRP. Mutations in the same splicing gene, or even the same mutation, could correlate with different phenotypic severities, complicating the genotype–phenotype correlation and clinical prognosis. PMID:24940031
The Eucalyptus terpene synthase gene family.
Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J
2015-06-11
Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.
DEFF Research Database (Denmark)
Christiansen, Michael W; Gregersen, Per L.
2014-01-01
-expressed with members of the NAC gene family. In conclusion, a list of up to 15 NAC genes from barley that are strong candidates for being regulatory factors of importance for senescence and biotic stress-related traits affecting the productivity of cereal crop plants has been generated. Furthermore, a list of 71...... in the NAC transcription factor family during senescence of barley flag leaves was studied. Several members of the NAC transcription factor gene family were up-regulated during senescence in a microarray experiment, together with a large range of senescence-associated genes, reflecting the coordinated...... activation of degradation processes in senescing barley leaf tissues. This picture was confirmed in a detailed quantitative reverse transcription–PCR (qRT–PCR) experiment, which also showed distinct gene expression patterns for different members of the NAC gene family, suggesting a group of ~15 out of the 47...
Directory of Open Access Journals (Sweden)
Paola ePiscopo
2016-05-01
Full Text Available Progranulin (PGRN is a secreted protein expressed ubiquitously throughout the body, including the brain, where it localizes in neurons and activated microglia. Loss-of-function mutations in the GRN gene are an important cause of familial Frontotemporal Lobar Degeneration (FTLD. PGRN has a neurotrophic and anti-inflammatory activity, and it is neuroprotective in several injury conditions, such as oxygen or glucose deprivation, oxidative injury, and hypoxic stress. Indeed, we have previously demonstrated that hypoxia induces the up-regulation of GRN transcripts. Several studies have shown microRNAs involvement in hypoxia. Moreover, in FTLD patients with a genetic variant of GRN (rs5848, the reinforcement of miR-659-3p binding site has been suggested to be a risk factor. Here, we report that miR-659-3p interacts directly with GRN 3’UTR as shown by luciferase assay in HeLa cells and ELISA and Western Blot analysis in HeLa and Kelly cells. Moreover, we demonstrate the physical binding between GRN mRNA and miR-659-3p employing a miRNA capture-affinity technology in SK-N-BE and Kelly cells. In order to study miRNAs involvement in hypoxia-mediated up-regulation of GRN, we evaluated miR-659-3p levels in SK-N-BE cells after 24h of hypoxic treatment, finding them inversely correlated to GRN transcripts. Furthermore, we analyzed an animal model of asphyxia, finding that GRN mRNA levels increased at post-natal day (pnd 1 and pnd 4 in rat cortices subjected to asphyxia in comparison to control rats and miR-659-3p decreased at pnd 4 just when GRN reached the highest levels. Our results demonstrate the interaction between miR-659-3p and GRN transcript and the involvement of miR-659-3p in GRN up-regulation mediated by hypoxic/ischemic insults.
Directory of Open Access Journals (Sweden)
Behzad Davarniya
Full Text Available Cognitive impairment or intellectual disability (ID is a widespread neurodevelopmental disorder characterized by low IQ (below 70. ID is genetically heterogeneous and is estimated to affect 1-3% of the world's population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID, we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831, encodes the metabotropic glutamate receptor1 (mGluR1. This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011. We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder.
Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Hosseini, Masoumeh; Maqsoud, Fariba; Farajollahi, Reza; Wienker, Thomas F.; Ropers, H. Hilger; Najmabadi, Hossein
2015-01-01
Cognitive impairment or intellectual disability (ID) is a widespread neurodevelopmental disorder characterized by low IQ (below 70). ID is genetically heterogeneous and is estimated to affect 1–3% of the world’s population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID), we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831), encodes the metabotropic glutamate receptor1 (mGluR1). This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011). We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder. PMID:26308914
The ACBP gene family in Rhodnius prolixus
DEFF Research Database (Denmark)
Majerowicz, David; Hannibal-Bach, Hans K; Castro, Rodolfo S C
2016-01-01
The acyl-CoA-binding proteins (ACBP) constitute a family of conserved proteins that bind acyl-CoA with high affinity and protect it from hydrolysis. Thus, ACBPs may have essential roles in basal cellular lipid metabolism. The genome of the insect Rhodnius prolixus encodes five ACBP genes similar...
Identification of the 14-3-3 gene family in Rafflesia cantleyi
Rosli, Khadijah; Wan, Kiew-Lian
2018-04-01
Rafflesia is known to be the largest flower in the world. Due to its size and appearance, it is considered to be very unique. Little is known about the molecular biology of this rare parasitic flowering plant as it is very difficult to locate and has a short life-span as a flower. Physiological activities in plants are regulated by signalling regulators such as the members of the 14-3-3 gene family. The number of members of this gene family varies in plants and there are thirteen known members in Arabidopsis thaliana. Their role is to bind to phosphorylated targets to complete signal transduction processes. Sequence comparison using BLAST of transcriptome data from three different Rafflesia cantleyi floral bud stages against the Swissprot database revealed 27 transcripts annotated as members of this gene family. All of the transcripts were expressed during floral bud stage 1 (S1) while 14 and four transcripts were expressed during floral bud stages 2 (S2) and 3 (S3), respectively. Significant downregulation was recorded for six and nine transcripts at S1 vs. S2 and S2 vs. S3 respectively. This gene family may play a critical role as signalling regulators during the development of Rafflesia floral bud.
Chai, Wenbo; Jiang, Pengfei; Huang, Guoyu; Jiang, Haiyang; Li, Xiaoyu
2017-10-01
The TCP family is a group of plant-specific transcription factors. TCP genes encode proteins harboring bHLH structure, which is implicated in DNA binding and protein-protein interactions and known as the TCP domain. TCP genes play important roles in plant development and have been evolutionarily and functionally elaborated in various plants, however, no overall phylogenetic analysis or expression profiling of TCP genes in Zea mays has been reported. In the present study, a systematic analysis of molecular evolution and functional prediction of TCP family genes in maize ( Z . mays L.) has been conducted. We performed a genome-wide survey of TCP genes in maize, revealing the gene structure, chromosomal location and phylogenetic relationship of family members. Microsynteny between grass species and tissue-specific expression profiles were also investigated. In total, 29 TCP genes were identified in the maize genome, unevenly distributed on the 10 maize chromosomes. Additionally, ZmTCP genes were categorized into nine classes based on phylogeny and purifying selection may largely be responsible for maintaining the functions of maize TCP genes. What's more, microsynteny analysis suggested that TCP genes have been conserved during evolution. Finally, expression analysis revealed that most TCP genes are expressed in the stem and ear, which suggests that ZmTCP genes influence stem and ear growth. This result is consistent with the previous finding that maize TCP genes represses the growth of axillary organs and enables the formation of female inflorescences. Altogether, this study presents a thorough overview of TCP family in maize and provides a new perspective on the evolution of this gene family. The results also indicate that TCP family genes may be involved in development stage in plant growing conditions. Additionally, our results will be useful for further functional analysis of the TCP gene family in maize.
APC gene mutations and extraintestinal phenotype of familial adenomatous polyposis
Giardiello, F. M.; Petersen, G. M.; Piantadosi, S.; Gruber, S. B.; Traboulsi, E. I.; Offerhaus, G. J.; Muro, K.; Krush, A. J.; Booker, S. V.; Luce, M. C.; Laken, S. J.; Kinzler, K. W.; Vogelstein, B.; Hamilton, S. R.
1997-01-01
Familial adenomatous polyposis (FAP) is caused by germline mutation of the adenomatous polyposis coli (APC) gene on chromosome 5q. This study assessed genotype-phenotype correlations for extraintestinal lesions in FAP. Mutations of the APC gene were compared with the occurrence of seven
Identification and analysis of YELLOW protein family genes in the silkworm, Bombyx mori
Directory of Open Access Journals (Sweden)
Yi Yong-Zhu
2006-08-01
Full Text Available Abstract Background The major royal jelly proteins/yellow (MRJP/YELLOW family possesses several physiological and chemical functions in the development of Apis mellifera and Drosophila melanogaster. Each protein of the family has a conserved domain named MRJP. However, there is no report of MRJP/YELLOW family proteins in the Lepidoptera. Results Using the YELLOW protein sequence in Drosophila melanogaster to BLAST silkworm EST database, we found a gene family composed of seven members with a conserved MRJP domain each and named it YELLOW protein family of Bombyx mori. We completed the cDNA sequences with RACE method. The protein of each member possesses a MRJP domain and a putative cleavable signal peptide consisting of a hydrophobic sequence. In view of genetic evolution, the whole Bm YELLOW protein family composes a monophyletic group, which is distinctly separate from Drosophila melanogaster and Apis mellifera. We then showed the tissue expression profiles of Bm YELLOW protein family genes by RT-PCR. Conclusion A Bombyx mori YELLOW protein family is found to be composed of at least seven members. The low homogeneity and unique pattern of gene expression by each member among the family ensure us to prophesy that the members of Bm YELLOW protein family would play some important physiological functions in silkworm development.
Directory of Open Access Journals (Sweden)
Iva Tomalova
Full Text Available Taxonomically restricted genes (TRGs, i.e., genes that are restricted to a limited subset of phylogenetically related organisms, may be important in adaptation. In parasitic organisms, TRG-encoded proteins are possible determinants of the specificity of host-parasite interactions. In the root-knot nematode (RKN Meloidogyne incognita, the map-1 gene family encodes expansin-like proteins that are secreted into plant tissues during parasitism, thought to act as effectors to promote successful root infection. MAP-1 proteins exhibit a modular architecture, with variable number and arrangement of 58 and 13-aa domains in their central part. Here, we address the evolutionary origins of this gene family using a combination of bioinformatics and molecular biology approaches. Map-1 genes were solely identified in one single member of the phylum Nematoda, i.e., the genus Meloidogyne, and not detected in any other nematode, thus indicating that the map-1 gene family is indeed a TRG family. A phylogenetic analysis of the distribution of map-1 genes in RKNs further showed that these genes are specifically present in species that reproduce by mitotic parthenogenesis, with the exception of M. floridensis, and could not be detected in RKNs reproducing by either meiotic parthenogenesis or amphimixis. These results highlight the divergence between mitotic and meiotic RKN species as a critical transition in the evolutionary history of these parasites. Analysis of the sequence conservation and organization of repeated domains in map-1 genes suggests that gene duplication(s together with domain loss/duplication have contributed to the evolution of the map-1 family, and that some strong selection mechanism may be acting upon these genes to maintain their functional role(s in the specificity of the plant-RKN interactions.
Search for intracranial aneurysm susceptibility gene(s using Finnish families
Directory of Open Access Journals (Sweden)
Ryynänen Markku
2002-08-01
Full Text Available Abstract Background Cerebrovascular disease is the third leading cause of death in the United States, and about one-fourth of cerebrovascular deaths are attributed to ruptured intracranial aneurysms (IA. Epidemiological evidence suggests that IAs cluster in families, and are therefore probably genetic. Identification of individuals at risk for developing IAs by genetic tests will allow concentration of diagnostic imaging on high-risk individuals. We used model-free linkage analysis based on allele sharing with a two-stage design for a genome-wide scan to identify chromosomal regions that may harbor IA loci. Methods We previously estimated sibling relative risk in the Finnish population at between 9 and 16, and proceeded with a genome-wide scan for loci predisposing to IA. In 85 Finnish families with two or more affected members, 48 affected sibling pairs (ASPs were available for our genetic study. Power calculations indicated that 48 ASPs were adequate to identify chromosomal regions likely to harbor predisposing genes and that a liberal stage I lod score threshold of 0.8 provided a reasonable balance between detection of false positive regions and failure to detect real loci with moderate effect. Results Seven chromosomal regions exceeded the stage I lod score threshold of 0.8 and five exceeded 1.0. The most significant region, on chromosome 19q, had a maximum multipoint lod score (MLS of 2.6. Conclusions Our study provides evidence for the locations of genes predisposing to IA. Further studies are necessary to elucidate the genes and their role in the pathophysiology of IA, and to design genetic tests.
Expressional and Biochemical Characterization of Rice Disease Resistance Gene Xa3/Xa26 Family
Institute of Scientific and Technical Information of China (English)
Songjie Xu; Yinglong Cao; Xianghua Li; Shiping Wang
2007-01-01
The rice (Oryza sativa L.) Xa3/Xa26 gene, conferring race-specific resistance to bacterial blight disease and encoding a leucine-rich repeat (LRR) receptor kinase-like protein, belongs to a multigene family consisting of tandem clustered homologous genes, colocalizing with several uncharacterized genes for resistance to bacterial blight or fungal blast. To provide more information on the expressional and biochemical characteristics of the Xa3/Xa26 family, we analyzed the family members. Four Xa3/Xa26 family members in the indica rice variety Teqing, which carries a bacterial blight resistance gene with a chromosomal location tightly linked to Xa3/Xa26, and five Xa3/Xa26 family members in the japonica rice variety Nipponbare, which carries at least one uncharacterized blast resistance gene, were constitutively expressed in leaf tissue. The result suggests that some of the family members may be candidates of these uncharacterized resistance genes. At least five putative N-glycosylation sites in the LRR domain of XA3/XA26 protein are not glycosylated. The XA3/XA26 and its family members MRKa and MRKc all possess the consensus sequences of paired cysteines, which putatively function in dimerization of the receptor proteins for signal transduction, immediately before the first LRR and immediately after the last LRR. However, no homo-dimer between the XA3/XA26 molecules or hetero-dimer between XA3/XA26 and MRKa or MRKc were formed, indicating that XA3/XA26 protein might function either as a monomer or a hetero-dimer formed with other protein outside of the XA3/XA26 family. These results provide valuable information for further extensive investigation into this multiple protein family.
A family with X-linked anophthalmia: exclusion of SOX3 as a candidate gene.
Slavotinek, Anne; Lee, Stephen S; Hamilton, Steven P
2005-10-01
We report on a four-generation family with X-linked anophthalmia in four affected males and show that this family has LOD scores consistent with linkage to Xq27, the third family reported to be linked to the ANOP1 locus. We sequenced the SOX3 gene at Xq27 as a candidate gene for the X-linked anophthalmia based on the high homology of this gene to SOX2, a gene previously mutated in bilateral anophthlamia. However, no amino acid sequence alterations were identified in SOX3. We have improved the definition of the phenotype in males with anophthalmia linked to the ANOP1 locus, as microcephaly, ocular colobomas, and severe renal malformations have not been described in families linked to ANOP1. (c) 2005 Wiley-Liss, Inc.
Natural killer cell receptor genes in the family Equidae: not only Ly49.
Directory of Open Access Journals (Sweden)
Jan Futas
Full Text Available Natural killer (NK cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for
Natural Killer Cell Receptor Genes in the Family Equidae: Not only Ly49
Futas, Jan; Horin, Petr
2013-01-01
Natural killer (NK) cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR) and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR) represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA) and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM) domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for evolutionary biology of
[Genome-wide identification and bioinformatic analysis of PPR gene family in tomato].
Ding, Anming; Li, Ling; Qu, Xu; Sun, Tingting; Chen, Yaqiong; Zong, Peng; Li, Zunqiang; Gong, Daping; Sun, Yuhe
2014-01-01
Pentatricopeptide repeats (PPRs) genes constitute one of the largest gene families in plants, which play a broad and essential role in plant growth and development. In this study, the protein sequences annotated by the tomato (S. lycopersicum L.) genome project were screened with the Pfam PPR sequences. A total of 471 putative PPR-encoding genes were identified. Based on the motifs defined in A. thaliana L., protein structure and conserved sequences for each tomato motif were analyzed. We also analyzed phylogenetic relationship, subcellular localization, expression and GO analysis of the identified gene sequences. Our results demonstrate that tomato PPR gene family contains two subfamilies, P and PLS, each accounting for half of the family. PLS subfamily can be divided into four subclasses i.e., PLS, E, E+ and DYW. Each subclass of sequences forms a clade in the phylogenetic tree. The PPR motifs were found highly conserved among plants. The tomato PPR genes were distributed over 12 chromosomes and most of them lack introns. The majority of PPR proteins harbor mitochondrial or chloroplast localization sequences, whereas GO analysis showed that most PPR proteins participate in RNA-related biological processes.
NDP gene mutations in 14 French families with Norrie disease.
Royer, Ghislaine; Hanein, Sylvain; Raclin, Valérie; Gigarel, Nadine; Rozet, Jean-Michel; Munnich, Arnold; Steffann, Julie; Dufier, Jean-Louis; Kaplan, Josseline; Bonnefont, Jean-Paul
2003-12-01
Norrie disease is a rare X-inked recessive condition characterized by congenital blindness and occasionally deafness and mental retardation in males. This disease has been ascribed to mutations in the NDP gene on chromosome Xp11.1. Previous investigations of the NDP gene have identified largely sixty disease-causing sequence variants. Here, we report on ten different NDP gene allelic variants in fourteen of a series of 21 families fulfilling inclusion criteria. Two alterations were intragenic deletions and eight were nucleotide substitutions or splicing variants, six of them being hitherto unreported, namely c.112C>T (p.Arg38Cys), c.129C>G (p.His43Gln), c.133G>A (p.Val45Met), c.268C>T (p.Arg90Cys), c.382T>C (p.Cys128Arg), c.23479-1G>C (unknown). No NDP gene sequence variant was found in seven of the 21 families. This observation raises the issue of misdiagnosis, phenocopies, or existence of other X-linked or autosomal genes, the mutations of which would mimic the Norrie disease phenotype. Copyright 2003 Wiley-Liss, Inc.
Huson, Daniel H; Tappu, Rewati; Bazinet, Adam L; Xie, Chao; Cummings, Michael P; Nieselt, Kay; Williams, Rohan
2017-01-25
Microbiome sequencing projects typically collect tens of millions of short reads per sample. Depending on the goals of the project, the short reads can either be subjected to direct sequence analysis or be assembled into longer contigs. The assembly of whole genomes from metagenomic sequencing reads is a very difficult problem. However, for some questions, only specific genes of interest need to be assembled. This is then a gene-centric assembly where the goal is to assemble reads into contigs for a family of orthologous genes. We present a new method for performing gene-centric assembly, called protein-alignment-guided assembly, and provide an implementation in our metagenome analysis tool MEGAN. Genes are assembled on the fly, based on the alignment of all reads against a protein reference database such as NCBI-nr. Specifically, the user selects a gene family based on a classification such as KEGG and all reads binned to that gene family are assembled. Using published synthetic community metagenome sequencing reads and a set of 41 gene families, we show that the performance of this approach compares favorably with that of full-featured assemblers and that of a recently published HMM-based gene-centric assembler, both in terms of the number of reference genes detected and of the percentage of reference sequence covered. Protein-alignment-guided assembly of orthologous gene families complements whole-metagenome assembly in a new and very useful way.
Diagnosing CADASIL using MRI: evidence from families with known mutations of Notch 3 gene
International Nuclear Information System (INIS)
Chawda, S.J.; Lange, R.P.J. de; St-Clair, D.; Hourihan, M.D.; Halpin, S.F.S.
2000-01-01
Clinical data and MRI findings are presented on 18 subjects from two families with neuropathologically confirmed CADASIL. DNA analysis revealed mutations in exon 4 of Notch 3 gene in both families. All family members with mutations in Notch 3 gene had extensive abnormalities on MRI, principally lesions in the white matter of the frontal lobes and in the external capsules. Of several family members in whom a diagnosis of CADASIL was suspected on the basis of minor symptoms, one had MRI changes consistent with CADASIL; none of these cases carried a mutation in the Notch 3 gene. MRI and clinical features that may alert the radiologist to the diagnosis of CADASIL are reviewed. However, a wide differential diagnosis exists for the MRI appearances of CADASIL, including multiple sclerosis and small-vessel disease secondary to hypertension. The definitive diagnosis cannot be made on MRI alone and requires additional evidence, where available, from a positive family history and by screening DNA for mutations of Notch 3 gene. (orig.)
Evolution of the MAGUK protein gene family in premetazoan lineages
Directory of Open Access Journals (Sweden)
Ruiz-Trillo Iñaki
2010-04-01
Full Text Available Abstract Background Cell-to-cell communication is a key process in multicellular organisms. In multicellular animals, scaffolding proteins belonging to the family of membrane-associated guanylate kinases (MAGUK are involved in the regulation and formation of cell junctions. These MAGUK proteins were believed to be exclusive to Metazoa. However, a MAGUK gene was recently identified in an EST survey of Capsaspora owczarzaki, an unicellular organism that branches off near the metazoan clade. To further investigate the evolutionary history of MAGUK, we have undertook a broader search for this gene family using available genomic sequences of different opisthokont taxa. Results Our survey and phylogenetic analyses show that MAGUK proteins are present not only in Metazoa, but also in the choanoflagellate Monosiga brevicollis and in the protist Capsaspora owczarzaki. However, MAGUKs are absent from fungi, amoebozoans or any other eukaryote. The repertoire of MAGUKs in Placozoa and eumetazoan taxa (Cnidaria + Bilateria is quite similar, except for one class that is missing in Trichoplax, while Porifera have a simpler MAGUK repertoire. However, Vertebrata have undergone several independent duplications and exhibit two exclusive MAGUK classes. Three different MAGUK types are found in both M. brevicollis and C. owczarzaki: DLG, MPP and MAGI. Furthermore, M. brevicollis has suffered a lineage-specific diversification. Conclusions The diversification of the MAGUK protein gene family occurred, most probably, prior to the divergence between Metazoa+choanoflagellates and the Capsaspora+Ministeria clade. A MAGI-like, a DLG-like, and a MPP-like ancestral genes were already present in the unicellular ancestor of Metazoa, and new gene members have been incorporated through metazoan evolution within two major periods, one before the sponge-eumetazoan split and another within the vertebrate lineage. Moreover, choanoflagellates have suffered an independent MAGUK
Genome-wide analysis of the WRKY gene family in cotton.
Dou, Lingling; Zhang, Xiaohong; Pang, Chaoyou; Song, Meizhen; Wei, Hengling; Fan, Shuli; Yu, Shuxun
2014-12-01
WRKY proteins are major transcription factors involved in regulating plant growth and development. Although many studies have focused on the functional identification of WRKY genes, our knowledge concerning many areas of WRKY gene biology is limited. For example, in cotton, the phylogenetic characteristics, global expression patterns, molecular mechanisms regulating expression, and target genes/pathways of WRKY genes are poorly characterized. Therefore, in this study, we present a genome-wide analysis of the WRKY gene family in cotton (Gossypium raimondii and Gossypium hirsutum). We identified 116 WRKY genes in G. raimondii from the completed genome sequence, and we cloned 102 WRKY genes in G. hirsutum. Chromosomal location analysis indicated that WRKY genes in G. raimondii evolved mainly from segmental duplication followed by tandem amplifications. Phylogenetic analysis of alga, bryophyte, lycophyta, monocot and eudicot WRKY domains revealed family member expansion with increasing complexity of the plant body. Microarray, expression profiling and qRT-PCR data revealed that WRKY genes in G. hirsutum may regulate the development of fibers, anthers, tissues (roots, stems, leaves and embryos), and are involved in the response to stresses. Expression analysis showed that most group II and III GhWRKY genes are highly expressed under diverse stresses. Group I members, representing the ancestral form, seem to be insensitive to abiotic stress, with low expression divergence. Our results indicate that cotton WRKY genes might have evolved by adaptive duplication, leading to sensitivity to diverse stresses. This study provides fundamental information to inform further analysis and understanding of WRKY gene functions in cotton species.
Genome organization and expression of the rat ACBP gene family
DEFF Research Database (Denmark)
Mandrup, S; Andreasen, P H; Knudsen, J
1993-01-01
pool former. We have molecularly cloned and characterized the rat ACBP gene family which comprises one expressed and four processed pseudogenes. One of these was shown to exist in two allelic forms. A comprehensive computer-aided analysis of the promoter region of the expressed ACBP gene revealed...
Evolutionary relationship and structural characterization of the EPF/EPFL gene family.
Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu
2013-01-01
EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.
Directory of Open Access Journals (Sweden)
Kyu Hwan Kwack
2017-01-01
Full Text Available We have examined the effect of progranulin (PGRN on human T cell proliferation and its underlying mechanism. We show that PGRN inhibits the PHA-induced multiplication of T lymphocytes. It increases the number of iTregs when T lymphocytes are activated by PHA but does not do so in the absence of PHA. PGRN-mediated inhibition of T lymphocyte proliferation, as well as the induction of iTregs, was completely reversed by a TGF-β inhibitor or a Treg inhibitor. PGRN induced TGF-β secretion in the presence of PHA whereas it did not in the absence of PHA. Our findings indicate that PGRN suppresses T lymphocyte proliferation by enhancing the formation of iTregs from activated T lymphocytes in response to TGF-β.
[Study of gene mutation and pathogenetic mechanism for a family with Waardenburg syndrome].
Chen, Hongsheng; Liao, Xinbin; Liu, Yalan; He, Chufeng; Zhang, Hua; Jiang, Lu; Feng, Yong; Mei, Lingyun
2017-08-10
To explore the pathogenetic mechanism of a family affected with Waardenburg syndrome. Clinical data of the family was collected. Potential mutation of the MITF, SOX10 and SNAI2 genes were screened. Plasmids for wild type (WT) and mutant MITF proteins were constructed to determine their exogenous expression and subcellular distribution by Western blotting and immunofluorescence assay, respectively. A heterozygous c.763C>T (p.R255X) mutation was detected in exon 8 of the MITF gene in the proband and all other patients from the family. No pathological mutation of the SOX10 and SNAI2 genes was detected. The DNA sequences of plasmids of MITF wild and mutant MITF R255X were confirmed. Both proteins were detected with the expected size. WT MITF protein only localized in the nucleus, whereas R255X protein showed aberrant localization in the nucleus as well as the cytoplasm. The c.763C>T mutation of the MITF gene probably underlies the disease in this family. The mutation can affect the subcellular distribution of MITF proteins in vitro, which may shed light on the molecular mechanism of Waardenburg syndrome caused by mutations of the MITF gene.
A novel AVP gene mutation in a Turkish family with neurohypophyseal diabetes insipidus.
Ilhan, M; Tiryakioglu, N O; Karaman, O; Coskunpinar, E; Yildiz, R S; Turgut, S; Tiryakioglu, D; Toprak, H; Tasan, E
2016-03-01
Familial neurohypophyseal diabetes insipidus (FNDI) is a rare, autosomal dominant, inherited disorder which is characterized by severe polydipsia and polyuria generally presenting in early childhood. In the present study, we aimed to analyze the AVP gene in a Turkish family with FNDI. Four patients with neurohypophyseal diabetes insipidus and ten healthy members of the family were studied. Diabetes insipidus was diagnosed by the water deprivation test in affected family members. Mutation analysis was performed by sequencing the whole coding region of AVP-NPII gene using DNA isolated from peripheral blood samples. Urine osmolality was low (C in all patients. c.-3A>C mutation in 5'UTR of AVP gene in this family might lead to the truncation of signal peptide, aggregation of AVP in the cytoplasm instead of targeting in the endoplasmic reticulum, thereby could disrupt AVP secretion without causing neuronal cytotoxicity, which might explain the presence of bright spot. The predicted effect of this mutation should be investigated by further in vitro molecular studies.
The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion
Directory of Open Access Journals (Sweden)
Tran Lan T
2012-08-01
Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic
Linkage and candidate gene analysis of X-linked familial exudative vitreoretinopathy.
Shastry, B S; Hejtmancik, J F; Plager, D A; Hartzer, M K; Trese, M T
1995-05-20
Familial exudative vitreoretinopathy (FEVR) is a hereditary eye disorder characterized by avascularity of the peripheral retina, retinal exudates, tractional detachment, and retinal folds. The disorder is most commonly transmitted as an autosomal dominant trait, but X-linked transmission also occurs. To initiate the process of identifying the gene responsible for the X-linked disorder, linkage analysis has been performed with three previously unreported three- or four-generation families. Two-point analysis showed linkage to MAOA (Zmax = 2.1, theta max = 0) and DXS228 (Zmax = 0.5, theta max = 0.11), and this was further confirmed by multipoint analysis with these same markers (Zmax = 2.81 at MAOA), which both lie near the gene causing Norrie disease. Molecular genetic analysis further reveals a missense mutation (R121W) in the third exon of the Norrie's disease gene that perfectly cosegregates with the disease through three generations in one family. This mutation was not detected in the unaffected family members and six normal unrelated controls, suggesting that it is likely to be the pathogenic mutation. Additionally, a polymorphic missense mutation (H127R) was detected in a severely affected patient.
Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui
2015-09-01
In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.
Common mutations identified in the MLH1 gene in familial Lynch syndrome
Directory of Open Access Journals (Sweden)
Jisha Elias
2017-12-01
In this study we identified three families with Lynch syndrome from a rural cancer center in western India (KCHRC, Goraj, Gujarat, where 70-75 CRC patients are seen annually. DNA isolated from the blood of consented family members of all three families (8-10 members/family was subjected to NGS sequencing methods on an Illumina HiSeq 4000 platform. We identified unique mutations in the MLH1 gene in all three HNPCC family members. Two of the three unrelated families shared a common mutation (154delA and 156delA. Total 8 members of a family were identified as carriers for 156delA mutation of which 5 members were unaffected while 3 were affected (age of onset: 1 member <30yrs & 2 were>40yr. The family with 154delA mutation showed 2 affected members (>40yr carrying the mutations.LYS618DEL mutation found in 8 members of the third family showed that both affected and unaffected carried the mutation. Thus the common mutations identified in the MLH1 gene in two unrelated families had a high risk for lynch syndrome especially above the age of 40.
The importance of melanoma inhibitory activity gene family in the tumor progression of oral cancer.
Sasahira, Tomonori; Bosserhoff, Anja Katrin; Kirita, Tadaaki
2018-05-01
Oral squamous cell carcinoma has a high potential for locoregional invasion and nodal metastasis. Consequently, early detection of such malignancies is of immense importance. The melanoma inhibitory activity (MIA) gene family comprises MIA, MIA2, transport and Golgi organization protein 1 (TANGO), and otoraplin (OTOR). These members of the MIA gene family have a highly conserved Src homology 3 (SH3)-like structure. Although the molecules of this family share 34-45% amino acid homology and 47-59% cDNA sequence homology, those members, excluding OTOR, play different tumor-associated functions. MIA has a pivotal role in the progression and metastasis of melanoma; MIA2 and TANGO have been suggested to possess tumor-suppressive functions; and OTOR is uniquely expressed in cochlea of the inner ear. Therefore, the definite functions of the MIA gene family in cancer cells remain unclear. Since the members of the MIA gene family are secreted proteins, these molecules might be useful tumor markers that can be detected in the body fluids, including serum and saliva. In this review, we described the molecular biological functions of the MIA gene family in oral cancer. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.
Chevanne, Damien; Saupe, Sven J; Clavé, Corinne; Paoletti, Mathieu
2010-05-06
Genes involved in non-self recognition and host defence are typically capable of rapid diversification and exploit specialized genetic mechanism to that end. Fungi display a non-self recognition phenomenon termed heterokaryon incompatibility that operates when cells of unlike genotype fuse and leads to the cell death of the fusion cell. In the fungus Podospora anserina, three genes controlling this allorecognition process het-d, het-e and het-r are paralogs belonging to the same hnwd gene family. HNWD proteins are STAND proteins (signal transduction NTPase with multiple domains) that display a WD-repeat domain controlling recognition specificity. Based on genomic sequence analysis of different P. anserina isolates, it was established that repeat regions of all members of the gene family are extremely polymorphic and undergoing concerted evolution arguing for frequent recombination within and between family members. Herein, we directly analyzed the genetic instability and diversification of this allorecognition gene family. We have constituted a collection of 143 spontaneous mutants of the het-R (HNWD2) and het-E (hnwd5) genes with altered recognition specificities. The vast majority of the mutants present rearrangements in the repeat arrays with deletions, duplications and other modifications as well as creation of novel repeat unit variants. We investigate the extreme genetic instability of these genes and provide a direct illustration of the diversification strategy of this eukaryotic allorecognition gene family.
Evolutionary relationship and structural characterization of the EPF/EPFL gene family.
Directory of Open Access Journals (Sweden)
Naoki Takata
Full Text Available EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.
Directory of Open Access Journals (Sweden)
Yan Liangzhen
2012-11-01
Full Text Available Abstract Background The genomes of three major mosquito vectors of human diseases, Anopheles gambiae, Aedes aegypti, and Culex pipiens quinquefasciatus, have been previously sequenced. C. p. quinquefasciatus has the largest number of predicted protein-coding genes, which partially results from the expansion of three detoxification gene families: cytochrome P450 monooxygenases (P450, glutathione S-transferases (GST, and carboxyl/cholinesterases (CCE. However, unlike An. gambiae and Ae. aegypti, which have large amounts of gene expression data, C. p. quinquefasciatus has limited transcriptomic resources. Knowledge of complete gene expression information is very important for the exploration of the functions of genes involved in specific biological processes. In the present study, the three detoxification gene families of C. p. quinquefasciatus were analyzed for phylogenetic classification and compared with those of three other dipteran insects. Gene expression during various developmental stages and the differential expression responsible for parathion resistance were profiled using the digital gene expression (DGE technique. Results A total of 302 detoxification genes were found in C. p. quinquefasciatus, including 71 CCE, 196 P450, and 35 cytosolic GST genes. Compared with three other dipteran species, gene expansion in Culex mainly occurred in the CCE and P450 families, where the genes of α-esterases, juvenile hormone esterases, and CYP325 of the CYP4 subfamily showed the most pronounced expansion on the genome. For the five DGE libraries, 3.5-3.8 million raw tags were generated and mapped to 13314 reference genes. Among 302 detoxification genes, 225 (75% were detected for expression in at least one DGE library. One fourth of the CCE and P450 genes were detected uniquely in one stage, indicating potential developmentally regulated expression. A total of 1511 genes showed different expression levels between a parathion-resistant and a
Alvarez, José M; Bueno, Natalia; Cañas, Rafael A; Avila, Concepción; Cánovas, Francisco M; Ordás, Ricardo J
2018-02-01
WUSCHEL-RELATED HOMEOBOX (WOX) genes are key players controlling stem cells in plants and can be divided into three clades according to the time of their appearance during plant evolution. Our knowledge of stem cell function in vascular plants other than angiosperms is limited, they separated from gymnosperms ca 300 million years ago and their patterning during embryogenesis differs significantly. For this reason, we have used the model gymnosperm Pinus pinaster to identify WOX genes and perform a thorough analysis of their gene expression patterns. Using transcriptomic data from a comprehensive range of tissues and stages of development we have shown three major outcomes: that the P. pinaster genome encodes at least fourteen members of the WOX family spanning all the major clades, that the genome of gymnosperms contains a WOX gene with no homologues in angiosperms representing a transitional stage between intermediate- and WUS-clade proteins, and that we can detect discrete WUS and WOX5 transcripts for the first time in a gymnosperm. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Maria Göbel
Full Text Available Progranulin (Pgrn is a 88 kDa secreted protein with pleiotropic functions including regulation of cell cycle progression, cell motility, wound repair and tumorigenesis. Using microarray based gene expression profiling we have recently demonstrated that the gene for Pgrn, granulin (GRN, is significantly higher expressed in aggressive CD38(+ZAP-70(+ as compared to indolent CD38(-ZAP-70(- chronic lymphocytic leukemia (CLL cases. Here, we measured Pgrn plasma concentrations by enzyme-linked immunosorbent assay (ELISA in the Essen CLL cohort of 131 patients and examined Pgrn for association with established prognostic markers and clinical outcome. We found that high Pgrn plasma levels were strongly associated with adverse risk factors including unmutated IGHV status, expression of CD38 and ZAP-70, poor risk cytogenetics (11q-, 17p- as detected by flourescence in situ hybridization (FISH and high Binet stage. Pgrn as well as the aforementioned risk factors were prognostic for time to first treatment and overall survival in this series. Importantly, these results could be confirmed in the independent multicentric CLL1 cohort of untreated Binet stage A patients (n = 163. Here, multivariate analysis of time to first treatment revealed that high risk Pgrn (HR = 2.06, 95%-CI = 1.13-3.76, p = 0.018, unmutated IGHV status (HR = 5.63, 95%-CI = 3.05-10.38, p<0.001, high risk as defined by the study protocol (HR = 2.06, 95%-CI = 1.09-3.89, p = 0.026 but not poor risk cytogenetics were independent prognostic markers. In summary our results suggest that Pgrn is a novel, robust and independent prognostic marker in CLL that can be easily measured by ELISA.
Göbel, Maria; Eisele, Lewin; Möllmann, Michael; Hüttmann, Andreas; Johansson, Patricia; Scholtysik, René; Bergmann, Manuela; Busch, Raymonde; Döhner, Hartmut; Hallek, Michael; Seiler, Till; Stilgenbauer, Stephan; Klein-Hitpass, Ludger; Dührsen, Ulrich; Dürig, Jan
2013-01-01
Progranulin (Pgrn) is a 88 kDa secreted protein with pleiotropic functions including regulation of cell cycle progression, cell motility, wound repair and tumorigenesis. Using microarray based gene expression profiling we have recently demonstrated that the gene for Pgrn, granulin (GRN), is significantly higher expressed in aggressive CD38(+)ZAP-70(+) as compared to indolent CD38(-)ZAP-70(-) chronic lymphocytic leukemia (CLL) cases. Here, we measured Pgrn plasma concentrations by enzyme-linked immunosorbent assay (ELISA) in the Essen CLL cohort of 131 patients and examined Pgrn for association with established prognostic markers and clinical outcome. We found that high Pgrn plasma levels were strongly associated with adverse risk factors including unmutated IGHV status, expression of CD38 and ZAP-70, poor risk cytogenetics (11q-, 17p-) as detected by flourescence in situ hybridization (FISH) and high Binet stage. Pgrn as well as the aforementioned risk factors were prognostic for time to first treatment and overall survival in this series. Importantly, these results could be confirmed in the independent multicentric CLL1 cohort of untreated Binet stage A patients (n = 163). Here, multivariate analysis of time to first treatment revealed that high risk Pgrn (HR = 2.06, 95%-CI = 1.13-3.76, p = 0.018), unmutated IGHV status (HR = 5.63, 95%-CI = 3.05-10.38, p<0.001), high risk as defined by the study protocol (HR = 2.06, 95%-CI = 1.09-3.89, p = 0.026) but not poor risk cytogenetics were independent prognostic markers. In summary our results suggest that Pgrn is a novel, robust and independent prognostic marker in CLL that can be easily measured by ELISA.
Schuurs-Hoeijmakers, Janneke H M; Vulto-van Silfhout, Anneke T; Vissers, Lisenka E L M; van de Vondervoort, Ilse I G M; van Bon, Bregje W M; de Ligt, Joep; Gilissen, Christian; Hehir-Kwa, Jayne Y; Neveling, Kornelia; del Rosario, Marisol; Hira, Gausiya; Reitano, Santina; Vitello, Aurelio; Failla, Pinella; Greco, Donatella; Fichera, Marco; Galesi, Ornella; Kleefstra, Tjitske; Greally, Marie T; Ockeloen, Charlotte W; Willemsen, Marjolein H; Bongers, Ernie M H F; Janssen, Irene M; Pfundt, Rolph; Veltman, Joris A; Romano, Corrado; Willemsen, Michèl A; van Bokhoven, Hans; Brunner, Han G; de Vries, Bert B A; de Brouwer, Arjan P M
2013-12-01
Intellectual disability (ID) is a common neurodevelopmental disorder affecting 1-3% of the general population. Mutations in more than 10% of all human genes are considered to be involved in this disorder, although the majority of these genes are still unknown. We investigated 19 small non-consanguineous families with two to five affected siblings in order to identify pathogenic gene variants in known, novel and potential ID candidate genes. Non-consanguineous families have been largely ignored in gene identification studies as small family size precludes prior mapping of the genetic defect. Using exome sequencing, we identified pathogenic mutations in three genes, DDHD2, SLC6A8, and SLC9A6, of which the latter two have previously been implicated in X-linked ID phenotypes. In addition, we identified potentially pathogenic mutations in BCORL1 on the X-chromosome and in MCM3AP, PTPRT, SYNE1, and ZNF528 on autosomes. We show that potentially pathogenic gene variants can be identified in small, non-consanguineous families with as few as two affected siblings, thus emphasising their value in the identification of syndromic and non-syndromic ID genes.
Santos, Maria C L G; Hart, P Suzanne; Ramaswami, Mukundhan; Kanno, Cláudia M; Hart, Thomas C; Line, Sergio R P
2007-01-31
Amelogenesis imperfecta (AI) is a genetically heterogeneous group of diseases that result in defective development of tooth enamel. Mutations in several enamel proteins and proteinases have been associated with AI. The object of this study was to evaluate evidence of etiology for the six major candidate gene loci in two Brazilian families with AI. Genomic DNA was obtained from family members and all exons and exon-intron boundaries of the ENAM, AMBN, AMELX, MMP20, KLK4 and Amelotin gene were amplified and sequenced. Each family was also evaluated for linkage to chromosome regions known to contain genes important in enamel development. The present study indicates that the AI in these two families is not caused by any of the known loci for AI or any of the major candidate genes proposed in the literature. These findings indicate extensive genetic heterogeneity for non-syndromic AI.
Genome-Wide Analysis of the Aquaporin Gene Family in Chickpea (Cicer arietinum L.).
Deokar, Amit A; Tar'an, Bunyamin
2016-01-01
Aquaporins (AQPs) are essential membrane proteins that play critical role in the transport of water and many other solutes across cell membranes. In this study, a comprehensive genome-wide analysis identified 40 AQP genes in chickpea ( Cicer arietinum L.). A complete overview of the chickpea AQP (CaAQP) gene family is presented, including their chromosomal locations, gene structure, phylogeny, gene duplication, conserved functional motifs, gene expression, and conserved promoter motifs. To understand AQP's evolution, a comparative analysis of chickpea AQPs with AQP orthologs from soybean, Medicago, common bean, and Arabidopsis was performed. The chickpea AQP genes were found on all of the chickpea chromosomes, except chromosome 7, with a maximum of six genes on chromosome 6, and a minimum of one gene on chromosome 5. Gene duplication analysis indicated that the expansion of chickpea AQP gene family might have been due to segmental and tandem duplications. CaAQPs were grouped into four subfamilies including 15 NOD26-like intrinsic proteins (NIPs), 13 tonoplast intrinsic proteins (TIPs), eight plasma membrane intrinsic proteins (PIPs), and four small basic intrinsic proteins (SIPs) based on sequence similarities and phylogenetic position. Gene structure analysis revealed a highly conserved exon-intron pattern within CaAQP subfamilies supporting the CaAQP family classification. Functional prediction based on conserved Ar/R selectivity filters, Froger's residues, and specificity-determining positions suggested wide differences in substrate specificity among the subfamilies of CaAQPs. Expression analysis of the AQP genes indicated that some of the genes are tissue-specific, whereas few other AQP genes showed differential expression in response to biotic and abiotic stresses. Promoter profiling of CaAQP genes for conserved cis -acting regulatory elements revealed enrichment of cis -elements involved in circadian control, light response, defense and stress responsiveness
Massive expansion of the calpain gene family in unicellular eukaryotes
Directory of Open Access Journals (Sweden)
Zhao Sen
2012-09-01
Full Text Available Abstract Background Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists. Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Results Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. Conclusions The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes.
Massive expansion of the calpain gene family in unicellular eukaryotes.
Zhao, Sen; Liang, Zhe; Demko, Viktor; Wilson, Robert; Johansen, Wenche; Olsen, Odd-Arne; Shalchian-Tabrizi, Kamran
2012-09-29
Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists). Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes.
The SOD gene family in tomato: identification, phylogenetic relationships and expression patterns
Directory of Open Access Journals (Sweden)
kun feng
2016-08-01
Full Text Available Superoxide dismutases (SODs are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L. is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants.
Bioinformatics Analysis of MAPKKK Family Genes in Medicago truncatula
Directory of Open Access Journals (Sweden)
Wei Li
2016-04-01
Full Text Available Mitogen‐activated protein kinase kinase kinase (MAPKKK is a component of the MAPK cascade pathway that plays an important role in plant growth, development, and response to abiotic stress, the functions of which have been well characterized in several plant species, such as Arabidopsis, rice, and maize. In this study, we performed genome‐wide and systemic bioinformatics analysis of MAPKKK family genes in Medicago truncatula. In total, there were 73 MAPKKK family members identified by search of homologs, and they were classified into three subfamilies, MEKK, ZIK, and RAF. Based on the genomic duplication function, 72 MtMAPKKK genes were located throughout all chromosomes, but they cluster in different chromosomes. Using microarray data and high‐throughput sequencing‐data, we assessed their expression profiles in growth and development processes; these results provided evidence for exploring their important functions in developmental regulation, especially in the nodulation process. Furthermore, we investigated their expression in abiotic stresses by RNA‐seq, which confirmed their critical roles in signal transduction and regulation processes under stress. In summary, our genome‐wide, systemic characterization and expressional analysis of MtMAPKKK genes will provide insights that will be useful for characterizing the molecular functions of these genes in M. truncatula.
Directory of Open Access Journals (Sweden)
Nordlund Henri R
2005-03-01
Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.
[Mutation analysis of FGFR3 gene in a family featuring hereditary dwarfism].
Zhang, Qiong; Jiang, Hai-ou; Quan, Qing-li; Li, Jun; He, Ting; Huang, Xue-shuang
2011-12-01
To investigate the clinical symptoms and potential mutation in FGFR3 gene for a family featuring hereditary dwarfism in order to attain diagnosis and provide prenatal diagnosis. Five patients and two unaffected relatives from the family, in addition with 100 healthy controls, were recruited. Genome DNA was extracted. Exons 10 and 13 of the FGFR3 gene were amplified using polymerase chain reaction (PCR). PCR products were sequenced in both directions. All patients had similar features including short stature, short limbs, lumbar hyperlordosis but normal craniofacial features. A heterozygous mutation G1620T (N540K) was identified in the cDNA from all patients but not in the unaffected relatives and 100 control subjects. A heterozygous G380R mutation was excluded. The hereditary dwarfism featured by this family has been caused by hypochondroplasia (HCH) due to a N540K mutation in the FGFR3 gene.
Thonberg, Håkan; Chiang, Huei-Hsin; Lilius, Lena; Forsell, Charlotte; Lindström, Anna-Karin; Johansson, Charlotte; Björkström, Jenny; Thordardottir, Steinunn; Sleegers, Kristel; Van Broeckhoven, Christine; Rönnbäck, Annica; Graff, Caroline
2017-06-09
Alzheimer disease (AD) is a progressive neurodegenerative disorder and the most common form of dementia. The majority of AD cases are sporadic, while up to 5% are families with an early onset AD (EOAD). Mutations in one of the three genes: amyloid beta precursor protein (APP), presenilin 1 (PSEN1) or presenilin 2 (PSEN2) can be disease causing. However, most EOAD families do not carry mutations in any of these three genes, and candidate genes, such as the sortilin-related receptor 1 (SORL1), have been suggested to be potentially causative. To identify AD causative variants, we performed whole-exome sequencing on five individuals from a family with EOAD and a missense variant, p.Arg1303Cys (c.3907C > T) was identified in SORL1 which segregated with disease and was further characterized with immunohistochemistry on two post mortem autopsy cases from the same family. In a targeted re-sequencing effort on independent index patients from 35 EOAD-families, a second SORL1 variant, c.3050-2A > G, was found which segregated with the disease in 3 affected and was absent in one unaffected family member. The c.3050-2A > G variant is located two nucleotides upstream of exon 22 and was shown to cause exon 22 skipping, resulting in a deletion of amino acids Gly1017- Glu1074 of SORL1. Furthermore, a third SORL1 variant, c.5195G > C, recently identified in a Swedish case control cohort included in the European Early-Onset Dementia (EU EOD) consortium study, was detected in two affected siblings in a third family with familial EOAD. The finding of three SORL1-variants that segregate with disease in three separate families with EOAD supports the involvement of SORL1 in AD pathology. The cause of these rare monogenic forms of EOAD has proven difficult to find and the use of exome and genome sequencing may be a successful route to target them.
Taghavi, Shaghayegh; Chaouni, Rita; Tafakhori, Abbas; Azcona, Luis J; Firouzabadi, Saghar Ghasemi; Omrani, Mir Davood; Jamshidi, Javad; Emamalizadeh, Babak; Shahidi, Gholam Ali; Ahmadi, Mona; Habibi, Seyed Amir Hassan; Ahmadifard, Azadeh; Fazeli, Atena; Motallebi, Marzieh; Petramfar, Peyman; Askarpour, Saeed; Askarpour, Shiva; Shahmohammadibeni, Hossein Ali; Shahmohammadibeni, Neda; Eftekhari, Hajar; Shafiei Zarneh, Amir Ehtesham; Mohammadihosseinabad, Saeed; Khorrami, Mehdi; Najmi, Safa; Chitsaz, Ahmad; Shokraeian, Parasto; Ehsanbakhsh, Hossein; Rezaeidian, Jalal; Ebrahimi Rad, Reza; Madadi, Faranak; Andarva, Monavvar; Alehabib, Elham; Atakhorrami, Minoo; Mortazavi, Seyed Erfan; Azimzadeh, Zahra; Bayat, Mahdis; Besharati, Amir Mohammad; Harati-Ghavi, Mohammad Ali; Omidvari, Samareh; Dehghani-Tafti, Zahra; Mohammadi, Faraz; Mohammad Hossein Pour, Banafsheh; Noorollahi Moghaddam, Hamid; Esmaili Shandiz, Ehsan; Habibi, Arman; Taherian-Esfahani, Zahra; Darvish, Hossein; Paisán-Ruiz, Coro
2018-04-01
In this study, the role of known Parkinson's disease (PD) genes was examined in families with autosomal recessive (AR) parkinsonism to assist with the differential diagnosis of PD. Some families without mutations in known genes were also subject to whole genome sequencing with the objective to identify novel parkinsonism-related genes. Families were selected from 4000 clinical files of patients with PD or parkinsonism. AR inheritance pattern, consanguinity, and a minimum of two affected individuals per family were used as inclusion criteria. For disease gene/mutation identification, multiplex ligation-dependent probe amplification, quantitative PCR, linkage, and Sanger and whole genome sequencing assays were carried out. A total of 116 patients (50 families) were examined. Fifty-four patients (46.55%; 22 families) were found to carry pathogenic mutations in known genes while a novel gene, not previously associated with parkinsonism, was found mutated in a single family (2 patients). Pathogenic mutations, including missense, nonsense, frameshift, and exon rearrangements, were found in Parkin, PINK1, DJ-1, SYNJ1, and VAC14 genes. In conclusion, variable phenotypic expressivity was seen across all families.
Phylogenetic analysis of the expansion of the MATH-BTB gene family in the grasses.
Juranić, Martina; Dresselhaus, Thomas
2014-01-01
MATH-BTB proteins are known to act as substrate-specific adaptors of cullin3 (CUL3)-based ubiquitin E3 ligases to target protein for ubiquitination. In a previous study we reported the presence of 31 MATH-BTB genes in the maize genome and determined the regulatory role of the MATH-BTB protein MAB1 during meiosis to mitosis transition. In contrast to maize, there are only 6 homologous genes in the model plant Arabidopsis, while this family has largely expanded in grasses. Here, we report a phylogenetic analysis of the MATH-BTB gene family in 9 land plant species including various mosses, eudicots, and grasses. We extend a previous classification of the plant MATH-BTB family and additionally arrange the expanded group into 5 grass-specific clades. Synteny studies indicate that expansion occurred to a large extent due to local gene duplications. Expression studies of 3 closely related MATH-BTB genes in maize (MAB1-3) indicate highly specific expression pattern. In summary, this work provides a solid base for further studies comparing genetic and functional information of the MATH-BTB family especially in the grasses.
DEFF Research Database (Denmark)
Davis, Margaret R.; Andersson, Robin; Severin, Jessica
2014-01-01
in the structure of the extracellular matrix and controlling the bioavailability of TGFβ family members. Genes encoding these proteins show differential expression in mesenchymal cell types which synthesize the extracellular matrix. We have investigated the promoter regions of the seven gene family members using...... of the family members were expressed in a range of mesenchymal and other cell types, often associated with use of alternative promoters or transcription start sites within a promoter in different cell types. FBN3 was the lowest expressed gene, and was found only in embryonic and fetal tissues. The different...
Genome-wide analysis of the GRAS gene family in Prunus mume.
Lu, Jiuxing; Wang, Tao; Xu, Zongda; Sun, Lidan; Zhang, Qixiang
2015-02-01
Prunus mume is an ornamental flower and fruit tree in Rosaceae. We investigated the GRAS gene family to improve the breeding and cultivation of P. mume and other Rosaceae fruit trees. The GRAS gene family encodes transcriptional regulators that have diverse functions in plant growth and development, such as gibberellin and phytochrome A signal transduction, root radial patterning, and axillary meristem formation and gametogenesis in the P. mume genome. Despite the important roles of these genes in plant growth regulation, no findings on the GRAS genes of P. mume have been reported. In this study, we discerned phylogenetic relationships of P. mume GRAS genes, and their locations, structures in the genome and expression levels of different tissues. Out of 46 identified GRAS genes, 45 were located on the 8 P. mume chromosomes. Phylogenetic results showed that these genes could be classified into 11 groups. We found that Group X was P. mume-specific, and three genes of Group IX clustered with the rice-specific gene Os4. We speculated that these genes existed before the divergence of dicotyledons and monocotyledons and were lost in Arabidopsis. Tissue expression analysis indicated that 13 genes showed high expression levels in roots, stems, leaves, flowers and fruits, and were related to plant growth and development. Functional analysis of 24 GRAS genes and an orthologous relationship analysis indicated that many functioned during plant growth and flower and fruit development. Our bioinformatics analysis provides valuable information to improve the economic, agronomic and ecological benefits of P. mume and other Rosaceae fruit trees.
[Gene mutation analysis and prenatal diagnosis of a family with Bartter syndrome].
Li, Long; Ma, Na; Li, Xiu-Rong; Gong, Fei; DU, Juan
2016-08-01
To investigate the mutation of related genes and prenatal diagnosis of a family with Bartter syndrome (BS). The high-throughput capture sequencing technique and PCR-Sanger sequencing were used to detect pathogenic genes in the proband of this family and analyze the whole family at the genomic level. After the genetic cause was clarified, the amniotic fluid was collected from the proband's mother who was pregnant for 5 months for prenatal diagnosis. The proband carried compound heterozygous mutations of c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene; c.88C>T(p.Arg30*) had been reported as a pathogenic mutation, and c.968+2T>A was a new mutation. Pedigree analysis showed that the two mutations were inherited from the mother and father, respectively. Prenatal diagnosis showed that the fetus did not inherit the mutations from parents and had no mutations at the two loci. The follow-up visit confirmed that the infant was in a healthy state, which proved the accuracy of genetic diagnosis and prenatal diagnosis. The compound heterozygous mutations c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene are the cause of BS in the proband, and prenatal diagnosis can prevent the risk of recurrence of BS in this family.
Vaszkó, Tibor; Papp, János; Krausz, Csilla; Casamonti, Elena; Géczi, Lajos; Olah, Edith
2016-01-01
Due to its palindromic setup, AZFc (Azoospermia Factor c) region of chromosome Y is one of the most unstable regions of the human genome. It contains eight gene families expressed mainly in the testes. Several types of rearrangement resulting in changes in the cumulative copy number of the gene families were reported to be associated with diseases such as male infertility and testicular germ cell tumors. The best studied AZFc rearrangement is gr/gr deletion. Its carriers show widespread phenotypic variation from azoospermia to normospermia. This phenomenon was initially attributed to different gr/gr subtypes that would eliminate distinct members of the affected gene families. However, studies conducted to confirm this hypothesis have brought controversial results, perhaps, in part, due to the shortcomings of the utilized subtyping methodology. This proof-of-concept paper is meant to introduce here a novel method aimed at subtyping AZFc rearrangements. It is able to differentiate the partial deletion and partial duplication subtypes of the Deleted in Azoospermia (DAZ) gene family. The keystone of the method is the determination of the copy number of the gene family member-specific variant(s) in a series of sequence family variant (SFV) positions. Most importantly, we present a novel approach for the correct interpretation of the variant copy number data to determine the copy number of the individual DAZ family members in the context of frequent interloci gene conversion.Besides DAZ1/DAZ2 and DAZ3/DAZ4 deletions, not yet described rearrangements such as DAZ2/DAZ4 deletion and three duplication subtypes were also found by the utilization of the novel approach. A striking feature is the extremely high concordance among the individual data pointing to a certain type of rearrangement. In addition to being able to identify DAZ deletion subtypes more reliably than the methods used previously, this approach is the first that can discriminate DAZ duplication subtypes as well
Huang, Qin; Wang, Meiping; Xia, Zongliang
2018-01-01
Sulfur is an essential macronutrient required for plant growth, development and stress responses. The family of sulfate transporters (SULTRs) mediates the uptake and translocation of sulfate in higher plants. However, basic knowledge of the SULTR gene family in maize (Zea mays L.) is scarce. In this study, a genome-wide bioinformatic analysis of SULTR genes in maize was conducted, and the developmental expression patterns of the genes and their responses to sulfate starvation and abiotic stress were further investigated. The ZmSULTR family includes eight putative members in the maize genome and is clustered into four groups in the phylogenetic tree. These genes displayed differential expression patterns in various organs of maize. For example, expression of ZmSULTR1;1 and ZmSULTR4;1 was high in roots, and transcript levels of ZmSULTR3;1 and ZmSULTR3;3 were high in shoots. Expression of ZmSULTR1;2, ZmSULTR2;1, ZmSULTR3;3, and ZmSULTR4;1 was high in flowers. Also, these eight genes showed differential responses to sulfate deprivation in roots and shoots of maize seedlings. Transcript levels of ZmSULTR1;1, ZmSULTR1;2, and ZmSULTR3;4 were significantly increased in roots during 12-day-sulfate starvation stress, while ZmSULTR3;3 and ZmSULTR3;5 only showed an early response pattern in shoots. In addition, dynamic transcriptional changes determined via qPCR revealed differential expression profiles of these eight ZmSULTR genes in response to environmental stresses such as salt, drought, and heat stresses. Notably, all the genes, except for ZmSULTR3;3, were induced by drought and heat stresses. However, a few genes were induced by salt stress. Physiological determination showed that two important thiol-containing compounds, cysteine and glutathione, increased significantly under these abiotic stresses. The results suggest that members of the SULTR family might function in adaptations to sulfur deficiency stress and adverse growing environments. This study will lay a
PROGRANULIN MUTATIONS AFFECTS BRAIN OSCILLATORY ACTIVITY IN FRONTO-TEMPORAL DEMENTIA
Directory of Open Access Journals (Sweden)
Davide Vito Moretti
2016-02-01
Full Text Available Background: mild cognitive impairment (MCI is a clinical stage indicating a prodromal phase of dementia. This practical concept could be used also for fronto-temporal dementia (FTD. Progranulin (PGRN has been recently recognized as a useful diagnostic biomarker for fronto-temporal lobe degeneration (FTLD due to GRN null mutations. Electroencephalography (EEG is a reliable tool in detecting brain networks changes. The working hypothesis of the present study is that EEG oscillations could detect different modifications among FTLD stages (FTD-MCI versus overt FTD as well as differences between GRN mutation carriers versus non carriers in patients with overt FTD. Methods: EEG in all patients and PGRN dosage in patients with a clear FTD were detected. The cognitive state has been investigated through mini mental state examination (MMSE. Results: MCI-FTD showed a significant lower spectral power in both alpha and theta oscillations as compared to overt FTD. GRN mutations carriers affected by FTLD show an increase in high alpha and decrease in theta oscillations as compared to non-carriers.Conclusion: EEG frequency rhythms are sensible to different stage of FTD and could detect changes in brain oscillatory activity affected by GRN mutations
The sieve element occlusion gene family in dicotyledonous plants.
Ernst, Antonia M; Rüping, Boris; Jekat, Stephan B; Nordzieke, Steffen; Reineke, Anna R; Müller, Boje; Bornberg-Bauer, Erich; Prüfer, Dirk; Noll, Gundula A
2011-01-01
Sieve element occlusion (SEO) genes encoding forisome subunits have been identified in Medicago truncatula and other legumes. Forisomes are structural phloem proteins uniquely found in Fabaceae sieve elements. They undergo a reversible conformational change after wounding, from a condensed to a dispersed state, thereby blocking sieve tube translocation and preventing the loss of photoassimilates. Recently, we identified SEO genes in several non-Fabaceae plants (lacking forisomes) and concluded that they most probably encode conventional non-forisome P-proteins. Molecular and phylogenetic analysis of the SEO gene family has identified domains that are characteristic for SEO proteins. Here, we extended our phylogenetic analysis by including additional SEO genes from several diverse species based on recently published genomic data. Our results strengthen the original assumption that SEO genes seem to be widespread in dicotyledonous angiosperms, and further underline the divergent evolution of SEO genes within the Fabaceae.
X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes.
Hu, H; Haas, S A; Chelly, J; Van Esch, H; Raynaud, M; de Brouwer, A P M; Weinert, S; Froyen, G; Frints, S G M; Laumonnier, F; Zemojtel, T; Love, M I; Richard, H; Emde, A-K; Bienek, M; Jensen, C; Hambrock, M; Fischer, U; Langnick, C; Feldkamp, M; Wissink-Lindhout, W; Lebrun, N; Castelnau, L; Rucci, J; Montjean, R; Dorseuil, O; Billuart, P; Stuhlmann, T; Shaw, M; Corbett, M A; Gardner, A; Willis-Owen, S; Tan, C; Friend, K L; Belet, S; van Roozendaal, K E P; Jimenez-Pocquet, M; Moizard, M-P; Ronce, N; Sun, R; O'Keeffe, S; Chenna, R; van Bömmel, A; Göke, J; Hackett, A; Field, M; Christie, L; Boyle, J; Haan, E; Nelson, J; Turner, G; Baynam, G; Gillessen-Kaesbach, G; Müller, U; Steinberger, D; Budny, B; Badura-Stronka, M; Latos-Bieleńska, A; Ousager, L B; Wieacker, P; Rodríguez Criado, G; Bondeson, M-L; Annerén, G; Dufke, A; Cohen, M; Van Maldergem, L; Vincent-Delorme, C; Echenne, B; Simon-Bouy, B; Kleefstra, T; Willemsen, M; Fryns, J-P; Devriendt, K; Ullmann, R; Vingron, M; Wrogemann, K; Wienker, T F; Tzschach, A; van Bokhoven, H; Gecz, J; Jentsch, T J; Chen, W; Ropers, H-H; Kalscheuer, V M
2016-01-01
X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of these males were previously tested negative for copy number variations and for mutations in a subset of known XLID genes by Sanger sequencing. In total, 745 X-chromosomal genes were screened. After stringent filtering, a total of 1297 non-recurrent exonic variants remained for prioritization. Co-segregation analysis of potential clinically relevant changes revealed that 80 families (20%) carried pathogenic variants in established XLID genes. In 19 families, we detected likely causative protein truncating and missense variants in 7 novel and validated XLID genes (CLCN4, CNKSR2, FRMPD4, KLHL15, LAS1L, RLIM and USP27X) and potentially deleterious variants in 2 novel candidate XLID genes (CDK16 and TAF1). We show that the CLCN4 and CNKSR2 variants impair protein functions as indicated by electrophysiological studies and altered differentiation of cultured primary neurons from Clcn4(-/-) mice or after mRNA knock-down. The newly identified and candidate XLID proteins belong to pathways and networks with established roles in cognitive function and intellectual disability in particular. We suggest that systematic sequencing of all X-chromosomal genes in a cohort of patients with genetic evidence for X-chromosome locus involvement may resolve up to 58% of Fragile X-negative cases.
Embryonic expression of zebrafish MiT family genes tfe3b, tfeb, and tfec.
Lister, James A; Lane, Brandon M; Nguyen, Anhthu; Lunney, Katherine
2011-11-01
The MiT family comprises four genes in mammals: Mitf, Tfe3, Tfeb, and Tfec, which encode transcription factors of the basic-helix-loop-helix/leucine zipper class. Mitf is well-known for its essential role in the development of melanocytes, however the functions of the other members of this family, and of interactions between them, are less well understood. We have now characterized the complete set of MiT genes from zebrafish, which totals six instead of four. The zebrafish genome contain two mitf (mitfa and mitfb), two tfe3 (tfe3a and tfe3b), and single tfeb and tfec genes; this distribution is shared with other teleosts. We present here the sequence and embryonic expression patterns for the zebrafish tfe3b, tfeb, and tfec genes, and identify a new isoform of tfe3a. These findings will assist in elucidating the roles of the MiT gene family over the course of vertebrate evolution. Copyright © 2011 Wiley-Liss, Inc.
Characterization of vNr-13, the first alphaherpesvirus gene of the bcl-2 family
International Nuclear Information System (INIS)
Aouacheria, Abdel; Banyai, Michelle; Rigal, Dominique; Schmidt, Carl J.; Gillet, Germain
2003-01-01
The Bcl-2 family, including antiapoptotic and proapoptotic members, plays key regulating roles in programmed cell death. We report the characterization of a new member of the bcl-2 family, encoded by herpesvirus of turkeys (HVT). The product of this gene shares 80% homology with Nr-13, an apoptosis inhibitor, which is overexpressed in avian cells transformed by the v-src oncogene. This new gene, that we propose to call vnr-13, is the first member of the bcl-2 family to be isolated among α-herpesviruses. Results from cells expressing the HVT-vnr-13 gene product show that the encoded protein inhibits apoptosis and also reduces the rate of cellular proliferation. Contrary to all bcl-2 homologues found in γ-herpesvirus, which are intronless, vnr-13 has the same organization as the cellular nr-13 gene. Hence, the HVT vnr-13 gene may have been acquired from a reverse transcriptase product of an unspliced precursor RNA, or via direct recombination with the host chromosomal DNA
Characterization of the Pichia pastoris protein-O-mannosyltransferase gene family.
Directory of Open Access Journals (Sweden)
Juergen H Nett
Full Text Available The methylotrophic yeast, Pichiapastoris, is an important organism used for the production of therapeutic proteins. However, the presence of fungal-like glycans, either N-linked or O-linked, can elicit an immune response or enable the expressed protein to bind to mannose receptors, thus reducing their efficacy. Previously we have reported the elimination of β-linked glycans in this organism. In the current report we have focused on reducing the O-linked mannose content of proteins produced in P. pastoris, thereby reducing the potential to bind to mannose receptors. The initial step in the synthesis of O-linked glycans in P. pastoris is the transfer of mannose from dolichol-phosphomannose to a target protein in the yeast secretory pathway by members of the protein-O-mannosyltransferase (PMT family. In this report we identify and characterize the members of the P. pastoris PMT family. Like Candida albicans, P. pastoris has five PMT genes. Based on sequence homology, these PMTs can be grouped into three sub-families, with both PMT1 and PMT2 sub-families possessing two members each (PMT1 and PMT5, and PMT2 and PMT6, respectively. The remaining sub-family, PMT4, has only one member (PMT4. Through gene knockouts we show that PMT1 and PMT2 each play a significant role in O-glycosylation. Both, by gene knockouts and the use of Pmt inhibitors we were able to significantly reduce not only the degree of O-mannosylation, but also the chain-length of these glycans. Taken together, this reduction of O-glycosylation represents an important step forward in developing the P. pastoris platform as a suitable system for the production of therapeutic glycoproteins.
Lin, Yanping; Wang, Kangyu; Li, Xiangyu; Sun, Chunyu; Yin, Rui; Wang, Yanfang; Wang, Yi; Zhang, Meiping
2018-02-21
Most genes in a genome exist in the form of a gene family; therefore, it is necessary to have knowledge of how a gene family functions to comprehensively understand organismal biology. The receptor-like kinase (RLK)-encoding gene family is one of the most important gene families in plants. It plays important roles in biotic and abiotic stress tolerances, and growth and development. However, little is known about the functional differentiation and relationships among the gene members within a gene family in plants. This study has isolated 563 RLK genes (designated as PgRLK genes) expressed in Jilin ginseng (Panax ginseng C.A. Meyer), investigated their evolution, and deciphered their functional diversification and relationships. The PgRLK gene family is highly diverged and formed into eight types. The LRR type is the earliest and most prevalent, while only the Lec type originated after P. ginseng evolved. Furthermore, although the members of the PgRLK gene family all encode receptor-like protein kinases and share conservative domains, they are functionally very diverse, participating in numerous biological processes. The expressions of different members of the PgRLK gene family are extremely variable within a tissue, at a developmental stage and in the same cultivar, but most of the genes tend to express correlatively, forming a co-expression network. These results not only provide a deeper and comprehensive understanding of the evolution, functional differentiation and correlation of a gene family in plants, but also an RLK genic resource useful for enhanced ginseng genetic improvement.
A Patient With Desmoid Tumors and Familial FAP Having Frame Shift Mutation of the APC Gene
Directory of Open Access Journals (Sweden)
Sanambar Sadighi
2017-02-01
Full Text Available Desmoids tumors, characterized by monoclonal proliferation of myofibroblasts, could occur in 5-10% of patients with familial adenomatous polyposis (FAP as an extra-colonic manifestation of the disease. FAP can develop when there is a germ-line mutation in the adenomatous polyposis coli gene. Although mild or attenuated FAP may follow mutations in 5΄ extreme of the gene, it is more likely that 3΄ extreme mutations haveamore severe manifestation of thedisease. A 28-year-old woman was admitted to the Cancer Institute of Iran with an abdominal painful mass. She had strong family history of FAP and underwent prophylactic total colectomy. Pre-operative CT scans revealed a large mass. Microscopic observation showed diffuse fibroblast cell infiltration of the adjacent tissue structures. Peripheral blood DNA extraction followed by adenomatous polyposis coli gene exon by exon sequencing was performed to investigate the mutation in adenomatous polyposis coli gene. Analysis of DNA sequencing demonstrated a mutation of 4 bpdeletions at codon 1309-1310 of the exon 16 of adenomatous polyposis coli gene sequence which was repeated in 3 members of the family. Some of them had desmoid tumor without classical FAP history. Even when there is no familial history of adenomatous polyposis, the adenomatous polyposis coli gene mutation should be investigated in cases of familial desmoids tumors for a suitable prevention. The 3΄ extreme of the adenomatous polyposis coli gene is still the best likely location in such families.
Genomewide analysis of TCP transcription factor gene family in ...
Indian Academy of Sciences (India)
2014-12-09
Dec 9, 2014 ... study of a genomewide analysis of apple TCP gene family. These results provide .... synthesize the first-strand cDNA using the PrimeScript First. Strand cDNA ..... only detected in the stem, leaf and fruit (figure 8). When.
Deb, Rajib; Sajjanar, Basavaraj; Singh, Umesh; Alex, Rani; Raja, T V; Alyethodi, Rafeeque R; Kumar, Sushil; Sengar, Gyanendra; Sharma, Sheetal; Singh, Rani; Prakash, B
2015-12-01
Na+/K+-ATPase is an integral membrane protein composed of a large catalytic subunit (alpha), a smaller glycoprotein subunit (beta), and gamma subunit. The beta subunit is essential for ion recognition as well as maintenance of the membrane integrity. Present study was aimed to analyze the expression pattern of ATPase beta subunit genes (ATPase B1, ATPase B2, and ATPase B3) among the crossbred bulls under different ambient temperatures (20-44 °C). The present study was also aimed to look into the relationship of HSP70 with the ATPase beta family genes. Our results demonstrated that among beta family genes, transcript abundance of ATPase B1 and ATPase B2 is significantly (P ATPase Β1, ATPase B2, and ATPase B3 is highly correlated (P ATPase beta family genes for cellular thermotolerance in cattle.
Directory of Open Access Journals (Sweden)
Glen Peter
2009-12-01
Full Text Available Abstract Background In recent years, the relaxin family of signaling molecules has been shown to play diverse roles in mammalian physiology, but little is known about its diversity or physiology in teleosts, an infraclass of the bony fishes comprising ~ 50% of all extant vertebrates. In this paper, 32 relaxin family sequences were obtained by searching genomic and cDNA databases from eight teleost species; phylogenetic, molecular evolutionary, and syntenic data analyses were conducted to understand the relationship and differential patterns of evolution of relaxin family genes in teleosts compared with mammals. Additionally, real-time quantitative PCR was used to confirm and assess the tissues of expression of five relaxin family genes in Danio rerio and in situ hybridization used to assess the site-specific expression of the insulin 3-like gene in D. rerio testis. Results Up to six relaxin family genes were identified in each teleost species. Comparative syntenic mapping revealed that fish possess two paralogous copies of human RLN3, which we call rln3a and rln3b, an orthologue of human RLN2, rln, two paralogous copies of human INSL5, insl5a and insl5b, and an orthologue of human INSL3, insl3. Molecular evolutionary analyses indicated that: rln3a, rln3b and rln are under strong evolutionary constraint, that insl3 has been subject to moderate rates of sequence evolution with two amino acids in insl3/INSL3 showing evidence of positively selection, and that insl5b exhibits a higher rate of sequence evolution than its paralogue insl5a suggesting that it may have been neo-functionalized after the teleost whole genome duplication. Quantitative PCR analyses in D. rerio indicated that rln3a and rln3b are expressed in brain, insl3 is highly expressed in gonads, and that there was low expression of both insl5 genes in adult zebrafish. Finally, in situ hybridization of insl3 in D. rerio testes showed highly specific hybridization to interstitial Leydig
Huang, Zejun; Van Houten, Jason; Gonzalez, Geoffrey; Xiao, Han; van der Knaap, Esther
2013-04-01
Members of the plant-specific gene families IQD/SUN, OFP and YABBY are thought to play important roles in plant growth and development. YABBY family members are involved in lateral organ polarity and growth; OFP members encode transcriptional repressors, whereas the role of IQD/SUN members is less clear. The tomato fruit shape genes SUN, OVATE, and FASCIATED belong to IQD/SUN, OFP and the YABBY gene family, respectively. A gene duplication resulting in high expression of SUN leads to elongated fruit, whereas a premature stop codon in OVATE and a large inversion within FASCIATED control fruit elongation and a flat fruit shape, respectively. In this study, we identified 34 SlSUN, 31 SlOFP and 9 SlYABBY genes in tomato and identified their position on 12 chromosomes. Genome mapping analysis showed that the SlSUN, SlOFP, and SlYABBY genes were enriched on the top and bottom segments of several chromosomes. In particular, on chromosome 10, a cluster of SlOFPs were found to originate from tandem duplication events. We also constructed three phylogenetic trees based on the protein sequences of the IQ67, OVATE and YABBY domains, respectively, from members of these families in Arabidopsis and tomato. The closest putative orthologs of the Arabidopsis and tomato genes were determined by the position on the phylogenetic tree and sequence similarity. Furthermore, expression analysis showed that some family members exhibited tissue-specific expression, whereas others were more ubiquitously expressed. Also, certain family members overlapped with known QTLs controlling fruit shape in Solanaceous plants. Combined, these results may help elucidate the roles of SUN, OFP and YABBY family members in plant growth and development.
Evaluation of the norrie disease gene in a family with incontinentia pigmenti.
Shastry, B S; Trese, M T
2000-01-01
Incontinentia pigmenti (IP) is an ectodermal multisystem disorder which can affect dental, ocular, cardiac and neurologic structures. The ocular changes of IP can have a very similar appearance to the retinal detachment of X-linked familial exudative vitreoretinopathy, which has been shown to be caused by the mutations in the Norrie disease gene. Therefore, it is of interest to determine whether similar mutations in the gene can account for the retinal pathology in patients with IP. To test our hypothesis, we have analyzed the entire Norrie disease gene for a family with IP, by single strand conformational polymorphism followed by DNA sequencing. The sequencing data revealed no disease-specific sequence alterations. These data suggest that ocular findings of IP are perhaps associated with different genes and there is no direct relationship between the genotype and phenotype. Copyright 2000 S. Karger AG, Basel
The claudin gene family: expression in normal and neoplastic tissues
International Nuclear Information System (INIS)
Hewitt, Kyle J; Agarwal, Rachana; Morin, Patrice J
2006-01-01
The claudin (CLDN) genes encode a family of proteins important in tight junction formation and function. Recently, it has become apparent that CLDN gene expression is frequently altered in several human cancers. However, the exact patterns of CLDN expression in various cancers is unknown, as only a limited number of CLDN genes have been investigated in a few tumors. We identified all the human CLDN genes from Genbank and we used the large public SAGE database to ascertain the gene expression of all 21 CLDN in 266 normal and neoplastic tissues. Using real-time RT-PCR, we also surveyed a subset of 13 CLDN genes in 24 normal and 24 neoplastic tissues. We show that claudins represent a family of highly related proteins, with claudin-16, and -23 being the most different from the others. From in silico analysis and RT-PCR data, we find that most claudin genes appear decreased in cancer, while CLDN3, CLDN4, and CLDN7 are elevated in several malignancies such as those originating from the pancreas, bladder, thyroid, fallopian tubes, ovary, stomach, colon, breast, uterus, and the prostate. Interestingly, CLDN5 is highly expressed in vascular endothelial cells, providing a possible target for antiangiogenic therapy. CLDN18 might represent a biomarker for gastric cancer. Our study confirms previously known CLDN gene expression patterns and identifies new ones, which may have applications in the detection, prognosis and therapy of several human cancers. In particular we identify several malignancies that express CLDN3 and CLDN4. These cancers may represent ideal candidates for a novel therapy being developed based on CPE, a toxin that specifically binds claudin-3 and claudin-4
Genome-wide identification and expression analysis of the WRKY gene family in cassava
Directory of Open Access Journals (Sweden)
Yunxie eWei
2016-02-01
Full Text Available The WRKY family, a large family of transcription factors (TFs found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta. In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing 3 exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.
Genome-Wide Identification and Expression Analysis of the WRKY Gene Family in Cassava.
Wei, Yunxie; Shi, Haitao; Xia, Zhiqiang; Tie, Weiwei; Ding, Zehong; Yan, Yan; Wang, Wenquan; Hu, Wei; Li, Kaimian
2016-01-01
The WRKY family, a large family of transcription factors (TFs) found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta). In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing three exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.
Directory of Open Access Journals (Sweden)
LISTYA UTAMI KARMAWAN
2009-03-01
Full Text Available Musa acuminata cultivar pisang ambon lumut is a native climacteric fruit from Indonesia. Climacteric fruit ripening process is triggered by the gaseous plant hormone ethylene. The rate limiting enzyme involved in ethylene biosynthesis is ACC synthase (ACS which is encoded by ACS gene family. The objective of this study is to identify MA-ACS gene family in M. acuminata cultivar pisang ambon lumut and to study the MA-ACS1 gene expression. The result showed that there were nine M. acuminata ACS gene family members called MA-ACS1–9. Two of them (MA-ACS1 and MA-ACS2 were assessed using reverse transcriptase PCR (RT-PCR for gene expression study and it was only MA-ACS1 correlated with fruit ripening. The MA-ACS1 gene fragment has been successfully isolated and characterized and it has three introns, four exons, and one stop codon. It also shows highest homology with MACS1 gene from M. acuminata cultivar Hsian Jien Chiao (GenBank accession number AF056164. Expression analysis of MA-ACS1 using quantitative PCR (qPCR showed that MA-ACS1 gene expression increased significantly in the third day, reached maximum at the fifth day, and then decreased in the seventh day after harvesting. The qPCR expression analysis result correlated with the result of physical analysis during fruit ripening.
FGF: A web tool for Fishing Gene Family in a whole genome database
DEFF Research Database (Denmark)
Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong
2007-01-01
to efficiently search for and identify gene families. The FGF output displays the results as visual phylogenetic trees including information on gene structure, chromosome position, duplication fate and selective pressure. It is particularly useful to identify pseudogenes and detect changes in gene structure. FGF...
Diverse roles of ERECTA family genes in plant development.
Shpak, Elena D
2013-12-01
Multiple receptor-like kinases (RLKs) enable intercellular communication that coordinates growth and development of plant tissues. ERECTA family receptors (ERfs) are an ancient family of leucine-rich repeat RLKs that in Arabidopsis consists of three genes: ERECTA, ERL1, and ERL2. ERfs sense secreted cysteine-rich peptides from the EPF/EPFL family and transmit the signal through a MAP kinase cascade. This review discusses the functions of ERfs in stomata development, in regulation of longitudinal growth of aboveground organs, during reproductive development, and in the shoot apical meristem. In addition the role of ERECTA in plant responses to biotic and abiotic factors is examined. Elena D. Shpak (Corresponding author). © 2013 Institute of Botany, Chinese Academy of Sciences.
Directory of Open Access Journals (Sweden)
Atanassova Rossitza
2010-11-01
Full Text Available Abstract Background In higher plants, sugars are not only nutrients but also important signal molecules. They are distributed through the plant via sugar transporters, which are involved not only in sugar long-distance transport via the loading and the unloading of the conducting complex, but also in sugar allocation into source and sink cells. The availability of the recently released grapevine genome sequence offers the opportunity to identify sucrose and monosaccharide transporter gene families in a woody species and to compare them with those of the herbaceous Arabidopsis thaliana using a phylogenetic analysis. Results In grapevine, one of the most economically important fruit crop in the world, it appeared that sucrose and monosaccharide transporter genes are present in 4 and 59 loci, respectively and that the monosaccharide transporter family can be divided into 7 subfamilies. Phylogenetic analysis of protein sequences has indicated that orthologs exist between Vitis and Arabidospis. A search for cis-regulatory elements in the promoter sequences of the most characterized transporter gene families (sucrose, hexoses and polyols transporters, has revealed that some of them might probably be regulated by sugars. To profile several genes simultaneously, we created a macroarray bearing cDNA fragments specific to 20 sugar transporter genes. This macroarray analysis has revealed that two hexose (VvHT1, VvHT3, one polyol (VvPMT5 and one sucrose (VvSUC27 transporter genes, are highly expressed in most vegetative organs. The expression of one hexose transporter (VvHT2 and two tonoplastic monosaccharide transporter (VvTMT1, VvTMT2 genes are regulated during berry development. Finally, three putative hexose transporter genes show a preferential organ specificity being highly expressed in seeds (VvHT3, VvHT5, in roots (VvHT2 or in mature leaves (VvHT5. Conclusions This study provides an exhaustive survey of sugar transporter genes in Vitis vinifera and
Lemery-Chalfant, Kathryn; Kao, Karen; Swann, Gregory; Goldsmith, H Hill
2013-02-01
Biological parents pass on genotypes to their children, as well as provide home environments that correlate with their genotypes; thus, the association between the home environment and children's temperament can be genetically (i.e., passive gene-environment correlation) or environmentally mediated. Furthermore, family environments may suppress or facilitate the heritability of children's temperament (i.e., gene-environment interaction). The sample comprised 807 twin pairs (mean age = 7.93 years) from the longitudinal Wisconsin Twin Project. Important passive gene-environment correlations emerged, such that home environments were less chaotic for children with high effortful control, and this association was genetically mediated. Children with high extraversion/surgency experienced more chaotic home environments, and this correlation was also genetically mediated. In addition, heritability of children's temperament was moderated by home environments, such that effortful control and extraversion/surgency were more heritable in chaotic homes, and negative affectivity was more heritable under crowded or unsafe home conditions. Modeling multiple types of gene-environment interplay uncovered the complex role of genetic factors and the hidden importance of the family environment for children's temperament and development more generally.
Directory of Open Access Journals (Sweden)
Preeti Arya
Full Text Available Nucleotide binding site leucine-rich repeats (NBS-LRR disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR and coiled coil (CC (1 ∶ 1 was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.
Arya, Preeti; Kumar, Gulshan; Acharya, Vishal; Singh, Anil K
2014-01-01
Nucleotide binding site leucine-rich repeats (NBS-LRR) disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR) and coiled coil (CC) (1 ∶ 1) was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR) revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.
Molecular study of the perforin gene in familial hematological malignancies
Directory of Open Access Journals (Sweden)
El Abed Rim
2011-09-01
Full Text Available Abstract Perforin gene (PRF1 mutations have been identified in some patients diagnosed with the familial form of hemophagocytic lymphohistiocytosis (HLH and in patients with lymphoma. The aim of the present study was to determine whether patients with a familial aggregation of hematological malignancies harbor germline perforin gene mutations. For this purpose, 81 unrelated families from Tunisia and France with aggregated hematological malignancies were investigated. The variants detected in the PRF1 coding region amounted to 3.7% (3/81. Two of the three variants identified were previously described: the p.Ala91Val pathogenic mutation and the p.Asn252Ser polymorphism. A new p.Ala 211Val missense substitution was identified in two related Tunisian patients. In order to assess the pathogenicity of this new variation, bioinformatic tools were used to predict its effects on the perforin protein structure and at the mRNA level. The segregation of the mutant allele was studied in the family of interest and a control population was screened. The fact that this variant was not found to occur in 200 control chromosomes suggests that it may be pathogenic. However, overexpression of mutated PRF1 in rat basophilic leukemia cells did not affect the lytic function of perforin differently from the wild type protein.
Evolution of the defensin-like gene family in grass genomes
Indian Academy of Sciences (India)
that the DEFL gene family is subjected to purifying selection. However, sliding window analysis .... sorghum from DOE-JGI Community Sequencing Program ..... This work was supported by the National Key Technologies Re- search and ...
Directory of Open Access Journals (Sweden)
N. Priyanka
2013-01-01
Full Text Available Introduction. This study was designed to correlate the serum and gingival crevicular fluid (GCF levels of progranulin (PGRN and high sensitivity C-reactive protein (hs CRP in chronic periodontitis and type 2 diabetes mellitus (DM. Design. PGRN and hs CRP levels were estimated in 3 groups: healthy, chronic periodontitis, and type 2 DM with chronic periodontitis. Results. The mean PGRN and hs CRP concentrations in serum and GCF were the highest for group 3 followed by group 2 and the least in group 1. Conclusion. PGRN and hs CRP may be biomarkers of the inflammatory response in type 2 DM and chronic periodontitis.
Priyanka, N.; Kumari, Minal; Kalra, Nitish; Arjun, P.; Naik, Savitha B.; Pradeep, A. R.
2013-01-01
Introduction. This study was designed to correlate the serum and gingival crevicular fluid (GCF) levels of progranulin (PGRN) and high sensitivity C-reactive protein (hs CRP) in chronic periodontitis and type 2 diabetes mellitus (DM). Design. PGRN and hs CRP levels were estimated in 3 groups: healthy, chronic periodontitis, and type 2 DM with chronic periodontitis. Results. The mean PGRN and hs CRP concentrations in serum and GCF were the highest for group 3 followed by group 2 and the least in group 1. Conclusion. PGRN and hs CRP may be biomarkers of the inflammatory response in type 2 DM and chronic periodontitis. PMID:24191130
Genome-Wide Analysis of the RNA Helicase Gene Family in Gossypium raimondii
Directory of Open Access Journals (Sweden)
Jie Chen
2014-03-01
Full Text Available The RNA helicases, which help to unwind stable RNA duplexes, and have important roles in RNA metabolism, belong to a class of motor proteins that play important roles in plant development and responses to stress. Although this family of genes has been the subject of systematic investigation in Arabidopsis, rice, and tomato, it has not yet been characterized in cotton. In this study, we identified 161 putative RNA helicase genes in the genome of the diploid cotton species Gossypium raimondii. We classified these genes into three subfamilies, based on the presence of either a DEAD-box (51 genes, DEAH-box (52 genes, or DExD/H-box (58 genes in their coding regions. Chromosome location analysis showed that the genes that encode RNA helicases are distributed across all 13 chromosomes of G. raimondii. Syntenic analysis revealed that 62 of the 161 G. raimondii helicase genes (38.5% are within the identified syntenic blocks. Sixty-six (40.99% helicase genes from G. raimondii have one or several putative orthologs in tomato. Additionally, GrDEADs have more conserved gene structures and more simple domains than GrDEAHs and GrDExD/Hs. Transcriptome sequencing data demonstrated that many of these helicases, especially GrDEADs, are highly expressed at the fiber initiation stage and in mature leaves. To our knowledge, this is the first report of a genome-wide analysis of the RNA helicase gene family in cotton.
Wen, Feng; Zhu, Hong; Li, Peng; Jiang, Min; Mao, Wenqing; Ong, Chermaine; Chu, Zhaoqing
2014-06-01
Members of plant WRKY gene family are ancient transcription factors that function in plant growth and development and respond to biotic and abiotic stresses. In our present study, we have investigated WRKY family genes in Brachypodium distachyon, a new model plant of family Poaceae. We identified a total of 86 WRKY genes from B. distachyon and explored their chromosomal distribution and evolution, domain alignment, promoter cis-elements, and expression profiles. Combining the analysis of phylogenetic tree of BdWRKY genes and the result of expression profiling, results showed that most of clustered gene pairs had higher similarities in the WRKY domain, suggesting that they might be functionally redundant. Neighbour-joining analysis of 301 WRKY domains from Oryza sativa, Arabidopsis thaliana, and B. distachyon suggested that BdWRKY domains are evolutionarily more closely related to O. sativa WRKY domains than those of A. thaliana. Moreover, tissue-specific expression profile of BdWRKY genes and their responses to phytohormones and several biotic or abiotic stresses were analysed by quantitative real-time PCR. The results showed that the expression of BdWRKY genes was rapidly regulated by stresses and phytohormones, and there was a strong correlation between promoter cis-elements and the phytohormones-induced BdWRKY gene expression. © The Author 2014. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
A comprehensive family-based replication study of schizophrenia genes
DEFF Research Database (Denmark)
Aberg, Karolina A; Liu, Youfang; Bukszár, Jozsef
2013-01-01
768 control subjects from 6 databases and, after quality control 6298 individuals (including 3286 cases) from 1811 nuclear families. MAIN OUTCOMES AND MEASURES Case-control status for SCZ. RESULTS Replication results showed a highly significant enrichment of SNPs with small P values. Of the SNPs...... in an independent family-based replication study that, after quality control, consisted of 8107 SNPs. SETTING Linkage meta-analysis, brain transcriptome meta-analysis, candidate gene database, OMIM, relevant mouse studies, and expression quantitative trait locus databases. PATIENTS We included 11 185 cases and 10...
X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes
Hu, H.; Haas, S.A.; Chelly, J.; Van Esch, H.; Raynaud, M.; de Brouwer, A.P.M.; Weinert, S.; Froyen, G.; Frints, S.G.M.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.
2016-01-01
X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of ...
Distinct Gene Expression Signatures in Lynch Syndrome and Familial Colorectal Cancer Type X
DEFF Research Database (Denmark)
Valentin, Mev; Therkildsen, Christina; Veerla, Srinivas
2013-01-01
Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects.......Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects....
Small Mutations of the DMD Gene in Taiwanese Families
Directory of Open Access Journals (Sweden)
Hsiao-Lin Hwa
2008-06-01
Conclusion: Most identified mutations either led to a predictable premature stop codon or resulted in splicing defects, which caused defective function of dystrophin. Our findings extend the mutation spectrum of the DMD gene. Molecular characterization of the affected families is important for genetic counseling and prenatal diagnosis.
Whole genome duplications and expansion of the vertebrate GATA transcription factor gene family
Directory of Open Access Journals (Sweden)
Bowerman Bruce
2009-08-01
Full Text Available Abstract Background GATA transcription factors influence many developmental processes, including the specification of embryonic germ layers. The GATA gene family has significantly expanded in many animal lineages: whereas diverse cnidarians have only one GATA transcription factor, six GATA genes have been identified in many vertebrates, five in many insects, and eleven to thirteen in Caenorhabditis nematodes. All bilaterian animal genomes have at least one member each of two classes, GATA123 and GATA456. Results We have identified one GATA123 gene and one GATA456 gene from the genomic sequence of two invertebrate deuterostomes, a cephalochordate (Branchiostoma floridae and a hemichordate (Saccoglossus kowalevskii. We also have confirmed the presence of six GATA genes in all vertebrate genomes, as well as additional GATA genes in teleost fish. Analyses of conserved sequence motifs and of changes to the exon-intron structure, and molecular phylogenetic analyses of these deuterostome GATA genes support their origin from two ancestral deuterostome genes, one GATA 123 and one GATA456. Comparison of the conserved genomic organization across vertebrates identified eighteen paralogous gene families linked to multiple vertebrate GATA genes (GATA paralogons, providing the strongest evidence yet for expansion of vertebrate GATA gene families via genome duplication events. Conclusion From our analysis, we infer the evolutionary birth order and relationships among vertebrate GATA transcription factors, and define their expansion via multiple rounds of whole genome duplication events. As the genomes of four independent invertebrate deuterostome lineages contain single copy GATA123 and GATA456 genes, we infer that the 0R (pre-genome duplication invertebrate deuterostome ancestor also had two GATA genes, one of each class. Synteny analyses identify duplications of paralogous chromosomal regions (paralogons, from single ancestral vertebrate GATA123 and GATA456
Progranulin Recruits HSP70 to β-Glucocerebrosidase and Is Therapeutic Against Gaucher Disease
Directory of Open Access Journals (Sweden)
Jinlong Jian
2016-11-01
Full Text Available Gaucher disease (GD, the most common lysosomal storage disease, is caused by mutations in GBA1 encoding of β-glucocerebrosidase (GCase. Recently it was reported that progranulin (PGRN insufficiency and deficiency associated with GD in human and mice, respectively. However the underlying mechanisms remain unknown. Here we report that PGRN binds directly to GCase and its deficiency results in aggregation of GCase and its receptor LIMP2. Mass spectrometry approaches identified HSP70 as a GCase/LIMP2 complex-associated protein upon stress, with PGRN as an indispensable adaptor. Additionally, 98 amino acids of C-terminal PGRN, referred to as Pcgin, are required and sufficient for the binding to GCase and HSP70. Pcgin effectively ameliorates the disease phenotype in GD patient fibroblasts and animal models. These findings not only demonstrate that PGRN is a co-chaperone of HSP70 and plays an important role in GCase lysosomal localization, but may also provide new therapeutic interventions for lysosomal storage diseases, in particular GD.
Cytokinin Regulation of Gene Expression in the AHP Gene Family in Arabidopsis thaliana
Czech Academy of Sciences Publication Activity Database
Hradilová, Jana; Malbeck, Jiří; Brzobohatý, Břetislav
2007-01-01
Roč. 26, č. 3 (2007), s. 229-244 ISSN 0721-7595 R&D Projects: GA MŠk LN00A081; GA MŠk 1M06030; GA MŠk(CZ) LC06034; GA AV ČR(CZ) IAA600380507; GA AV ČR IAA600040612 Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50040702 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : gene expression * AHP gene family * cytokinin signal transduction Subject RIV: EF - Botanics Impact factor: 2.220, year: 2007
GDNF gene is associated with tourette syndrome in a family study.
Huertas-Fernández, Ismael; Gómez-Garre, Pilar; Madruga-Garrido, Marcos; Bernal-Bernal, Inmaculada; Bonilla-Toribio, Marta; Martín-Rodríguez, Juan Francisco; Cáceres-Redondo, María Teresa; Vargas-González, Laura; Carrillo, Fátima; Pascual, Alberto; Tischfield, Jay A; King, Robert A; Heiman, Gary A; Mir, Pablo
2015-07-01
Tourette syndrome is a disorder characterized by persistent motor and vocal tics, and frequently accompanied by the comorbidities attention deficit hyperactivity disorder and obsessive-compulsive disorder. Impaired synaptic neurotransmission has been implicated in its pathogenesis. Our aim was to investigate the association of 28 candidate genes, including genes related to synaptic neurotransmission and neurotrophic factors, with Tourette syndrome. We genotyped 506 polymorphisms in a discovery cohort from the United States composed of 112 families and 47 unrelated singletons with Tourette syndrome (201 cases and 253 controls). Genes containing significant polymorphisms were imputed to fine-map the signal(s) to potential causal variants. Allelic analyses in Tourette syndrome cases were performed to check the role in attention deficit hyperactivity disorder and obsessive-compulsive disorder comorbidities. Target polymorphisms were further studied in a replication cohort from southern Spain composed of 37 families and three unrelated singletons (44 cases and 73 controls). The polymorphism rs3096140 in glial cell line-derived neurotrophic factor gene (GDNF) was significant in the discovery cohort after correction (P = 1.5 × 10(-4) ). No linkage disequilibrium was found between rs3096140 and other functional variants in the gene. We selected rs3096140 as target polymorphism, and the association was confirmed in the replication cohort (P = 0.01). No association with any comorbidity was found. As a conclusion, a common genetic variant in GDNF is associated with Tourette syndrome. A defect in the production of GDNF could compromise the survival of parvalbumin interneurons, thus altering the excitatory/inhibitory balance in the corticostriatal circuitry. Validation of this variant in other family cohorts is necessary. © 2015 International Parkinson and Movement Disorder Society.
GDNF Gene Is Associated With Tourette Syndrome in a Family Study
Huertas-Fernández, Ismael; Gómez-Garre, Pilar; Madruga-Garrido, Marcos; Bernal-Bernal, Inmaculada; Bonilla-Toribio, Marta; Martín-Rodríguez, Juan Francisco; Cáceres-Redondo, María Teresa; Vargas-González, Laura; Carrillo, Fátima; Pascual, Alberto; Tischfield, Jay A.; King, Robert A.; Heiman, Gary A.; Mir, Pablo
2016-01-01
Background Tourette syndrome is a disorder characterized by persistent motor and vocal tics, and frequently accompanied by the comorbidities attention deficit hyperactivity disorder and obsessive-compulsive disorder. Impaired synaptic neurotransmission has been implicated in its pathogenesis. Our aim was to investigate the association of 28 candidate genes, including genes related to synaptic neurotransmission and neurotrophic factors, with Tourette syndrome. Methods We genotyped 506 polymorphisms in a discovery cohort from the United States composed of 112 families and 47 unrelated singletons with Tourette syndrome (201 cases and 253 controls). Genes containing significant polymorphisms were imputed to fine-map the signal(s) to potential causal variants. Allelic analyses in Tourette syndrome cases were performed to check the role in attention deficit hyperactivity disorder and obsessive-compulsive disorder comorbidities. Target polymorphisms were further studied in a replication cohort from southern Spain composed of 37 families and three unrelated singletons (44 cases and 73 controls). Results The polymorphism rs3096140 in glial cell line–derived neurotrophic factor gene (GDNF) was significant in the discovery cohort after correction (P = 1.5 × 10−4). No linkage disequilibrium was found between rs3096140 and other functional variants in the gene. We selected rs3096140 as target polymorphism, and the association was confirmed in the replication cohort (P = 0.01). No association with any comorbidity was found. Conclusions As a conclusion, a common genetic variant in GDNF is associated with Tourette syndrome. A defect in the production of GDNF could compromise the survival of parvalbumin interneurons, thus altering the excitatory/inhibitory balance in the corticostriatal circuitry. Validation of this variant in other family cohorts is necessary. PMID:26096985
Directory of Open Access Journals (Sweden)
S. Pamela K. Shiao
2018-02-01
Full Text Available For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene–environment interactions and predictors of colorectal cancer (CRC by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black. We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls (p < 0.05, on MTHFR C677T, MTR A2756G, MTRR A66G, and DHFR 19 bp except MTHFR A1298C. Four racial groups presented different polymorphism rates for four genes (all p < 0.05 except MTHFR A1298C. Following the ensemble method, the most influential factors were identified, and the best predictive models were generated by using the generalized regression models, with Akaike’s information criterion and leave-one-out cross validation methods. Body mass index (BMI and gender were consistent predictors of CRC for both models when individual genes versus total polymorphism counts were used, and alcohol use was interactive with BMI status. Body mass index status was also interactive with both gender and MTHFR C677T gene polymorphism, and the exposure to environmental pollutants was an additional predictor. These results point to the important roles of environmental and modifiable factors in relation to gene–environment interactions in the prevention of CRC.
[The mutation analysis of PAH gene and prenatal diagnosis in classical phenylketonuria family].
Yan, Yousheng; Hao, Shengju; Yao, Fengxia; Sun, Qingmei; Zheng, Lei; Zhang, Qinghua; Zhang, Chuan; Yang, Tao; Huang, Shangzhi
2014-12-01
To characterize the mutation spectrum of phenylalanine hydroxylase (PAH) gene and perform prenatal diagnosis for families with classical phenylketonuria. By stratified sequencing, mutations were detected in the exons and flaking introns of PAH gene of 44 families with classical phenylketonuria. 47 fetuses were diagnosed by combined sequencing with linkage analysis of three common short tandem repeats (STR) (PAH-STR, PAH-26 and PAH-32) in the PAH gene. Thirty-one types of mutations were identified. A total of 84 mutations were identified in 88 alleles (95.45%), in which the most common mutation have been R243Q (21.59%), EX6-96A>G (6.82%), IVS4-1G>A (5.86%) and IVS7+2T>A (5.86%). Most mutations were found in exons 3, 5, 6, 7, 11 and 12. The polymorphism information content (PIC) of these three STR markers was 0.71 (PAH-STR), 0.48 (PAH-26) and 0.40 (PAH-32), respectively. Prenatal diagnosis was performed successfully with the combined method in 47 fetuses of 44 classical phenylketonuria families. Among them, 11 (23.4%) were diagnosed as affected, 24 (51.1%) as carriers, and 12 (25.5%) as unaffected. Prenatal diagnosis can be achieved efficiently and accurately by stratified sequencing of PAH gene and linkage analysis of STR for classical phenylketonuria families.
Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes
Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.
2003-01-01
Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650
Gene screening in a Chinese family with Marfan syndrome
Directory of Open Access Journals (Sweden)
Wen-Jiao Xia
2016-05-01
Full Text Available AIM:To analyze the causative gene mutation for Marfan syndrome(MFSwith autosomal dominant hereditary in a Chinese family in Liaoning Province,China. METHODS: Venous blood was collected and candidate gene was selected to design primers according to the clinical phenotype. With genomic polymerase chain reaction(PCRperformed, the coding exons and their flanking intron in sequences of candidate gene were sequenced,DNA fragments separated by agarose gel electrophoresis and direct sequencing method was used to determine the pathogenic gene.RESULTS:Phenotype of the proband was presented as ectopic lentis. Sequencing of the coding regions of FBN1 gene showed the presence of a heterozygous A→G transversion at nucleotide 640 in the 7 exon of FBN1 and the missense mutation made for Glycine into Serine(G214S. CONCLUSION:A heterozygous mutation of FBN1 c.A640G(p.G214Sis responsible for the Marfan syndrome in the four generation Chinese pedigree.
Molecular characterization and expression analysis of WRKY family genes in Dendrobium officinale.
Wang, Tao; Song, Zheng; Wei, Li; Li, Lubin
2018-03-01
The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators, and the members regulate multiple biological processes. However, there is limited information on WRKYs in Dendrobium officinale. In this study, 52 WRKY family genes of D. officinale were surveyed for the first time. Conserved domain, phylogenetic, exon-intron construction, and expression analyses were performed for the DoWRKY genes. Two major types of intron splicing (PR and VQR introns) were found, and the intron insertion position was observed to be relatively conserved in the conserved DoWRKY domains. The expression profiles of nine DoWRKYs were analyzed in cold- and methyl jasmonate (MeJA)-treated D. officinale seedlings; the DoWRKYs showed significant expression changes at different levels, which suggested their vital roles in stress tolerance. Moreover, the expression trends of most of the DoWRKYs after the simultaneous cold stress and MeJA treatment were the opposite of those of DoWRKYs after the individual cold stress and MeJA treatments, suggesting that the two stresses might have antagonistic effects and affect the adaptive capacity of the plants to stresses. Twelve DoWRKY genes were differentially expressed between symbiotic and asymbiotic germinated seeds; all were upregulated in the symbiotic germinated seeds except DoWRKY16. These differences in expression of DoWRKYs might be involved in promoting in vitro symbiotic germination of seeds with Tulasnella-like fungi. Our findings will be useful for further studies on the WRKY family genes in orchids.
He, Chunmei; Teixeira da Silva, Jaime A; Tan, Jianwen; Zhang, Jianxia; Pan, Xiaoping; Li, Mingzhi; Luo, Jianping; Duan, Jun
2017-08-23
The WRKY family, one of the largest families of transcription factors, plays important roles in the regulation of various biological processes, including growth, development and stress responses in plants. In the present study, 63 DoWRKY genes were identified from the Dendrobium officinale genome. These were classified into groups I, II, III and a non-group, each with 14, 28, 10 and 11 members, respectively. ABA-responsive, sulfur-responsive and low temperature-responsive elements were identified in the 1-k upstream regulatory region of DoWRKY genes. Subsequently, the expression of the 63 DoWRKY genes under cold stress was assessed, and the expression profiles of a large number of these genes were regulated by low temperature in roots and stems. To further understand the regulatory mechanism of DoWRKY genes in biological processes, potential WRKY target genes were investigated. Among them, most stress-related genes contained multiple W-box elements in their promoters. In addition, the genes involved in polysaccharide synthesis and hydrolysis contained W-box elements in their 1-k upstream regulatory regions, suggesting that DoWRKY genes may play a role in polysaccharide metabolism. These results provide a basis for investigating the function of WRKY genes and help to understand the downstream regulation network in plants within the Orchidaceae.
Bai, Y; Liu, N; Kong, X D; Yan, J; Qin, Z B; Wang, B
2016-12-07
Objective: To analyze the mutations of PAX3 gene in two Waardenburg syndrome type Ⅰ (WS1) pedigrees and make prenatal diagnosis for the high-risk 18-week-old fetus. Methods: PAX3 gene was first analyzed by Sanger sequencing and multiplex ligation-dependent probe amplification(MLPA) for detecting pathogenic mutation of the probands of the two pedigrees. The mutations were confirmed by MLPA and Sanger in parents and unrelated healthy individuals.Prenatal genetic diagnosis for the high-risk fetus was performed by amniotic fluid cell after genotyping. Results: A heterozygous PAX3 gene gross deletion (E7 deletion) was identified in all patients from WS1-01 family, and not found in 20 healthy individuals.Prenatal diagnosis in WS1-01 family indicated that the fetus was normal. Molecular studies identified a novel deletion mutation c. 1385_1386delCT within the PAX3 gene in all affected WS1-02 family members, but in none of the unaffected relatives and 200 healthy individuals. Conclusions: PAX3 gene mutation is etiological for two WS1 families. Sanger sequencing plus MLPA is effective and accurate for making gene diagnosis and prenatal diagnosis.
Wang, Dan; Zhang, Lin; Hu, JunFeng; Gao, Dianshuai; Liu, Xin; Sha, Yan
2018-04-01
Lipases are physiologically important and ubiquitous enzymes that share a conserved domain and are classified into eight different families based on their amino acid sequences and fundamental biological properties. The Lipase3 family of lipases was reported to possess a canonical fold typical of α/β hydrolases and a typical catalytic triad, suggesting a distinct evolutionary origin for this family. Genes in the Lipase3 family do not have the same functions, but maintain the conserved Lipase3 domain. There have been extensive studies of Lipase3 structures and functions, but little is known about their evolutionary histories. In this study, all lipases within five plant species were identified, and their phylogenetic relationships and genetic properties were analyzed and used to group them into distinct evolutionary families. Each identified lipase family contained at least one dicot and monocot Lipase3 protein, indicating that the gene family was established before the split of dicots and monocots. Similar intron/exon numbers and predicted protein sequence lengths were found within individual groups. Twenty-four tandem Lipase3 gene duplications were identified, implying that the distinctive function of Lipase3 genes appears to be a consequence of translocation and neofunctionalization after gene duplication. The functional genes EDS1, PAD4, and SAG101 that are reportedly involved in pathogen response were all located in the same group. The nucleotide diversity (Dxy) and the ratio of nonsynonymous to synonymous nucleotide substitutions rates (Ka/Ks) of the three genes were significantly greater than the average across the genomes. We further observed evidence for selection maintaining diversity on three genes in the Toll-Interleukin-1 receptor type of nucleotide binding/leucine-rich repeat immune receptor (TIR-NBS LRR) immunity-response signaling pathway, indicating that they could be vulnerable to pathogen effectors.
Sun, Tingting; Li, Mingjun; Shao, Yun; Yu, Lingyan; Ma, Fengwang
2017-01-01
Elemental phosphorus (Pi) is essential to plant growth and development. The family of phosphate transporters (PHTs) mediates the uptake and translocation of Pi inside the plants. Members include five sub-cellular phosphate transporters that play different roles in Pi uptake and transport. We searched the Genome Database for Rosaceae and identified five clusters of phosphate transporters in apple ( Malus domestica ), including 37 putative genes. The MdPHT1 family contains 14 genes while MdPHT2 has two, MdPHT3 has seven, MdPHT4 has 11, and MdPHT5 has three. Our overview of this gene family focused on structure, chromosomal distribution and localization, phylogenies, and motifs. These genes displayed differential expression patterns in various tissues. For example, expression was high for MdPHT1;12, MdPHT3;6 , and MdPHT3;7 in the roots, and was also increased in response to low-phosphorus conditions. In contrast, MdPHT4;1, MdPHT4;4 , and MdPHT4;10 were expressed only in the leaves while transcript levels of MdPHT1;4, MdPHT1;12 , and MdPHT5;3 were highest in flowers. In general, these 37 genes were regulated significantly in either roots or leaves in response to the imposition of phosphorus and/or drought stress. The results suggest that members of the PHT family function in plant adaptations to adverse growing environments. Our study will lay a foundation for better understanding the PHT family evolution and exploring genes of interest for genetic improvement in apple.
Mutation analysis of the cathepsin C gene in Indian families with Papillon-Lefèvre syndrome
Directory of Open Access Journals (Sweden)
Srivastava Satish
2003-07-01
Full Text Available Abstract Background PLS is a rare autosomal recessive disorder characterized by early onset periodontopathia and palmar plantar keratosis. PLS is caused by mutations in the cathepsin C (CTSC gene. Dipeptidyl-peptidase I encoded by the CTSC gene removes dipeptides from the amino-terminus of protein substrates and mainly plays an immune and inflammatory role. Several mutations have been reported in this gene in patients from several ethnic groups. We report here mutation analysis of the CTSC gene in three Indian families with PLS. Methods Peripheral blood samples were obtained from individuals belonging to three Indian families with PLS for genomic DNA isolation. Exon-specific intronic primers were used to amplify DNA samples from individuals. PCR products were subsequently sequenced to detect mutations. PCR-SCCP and ASOH analyses were used to determine if mutations were present in normal control individuals. Results All patients from three families had a classic PLS phenotype, which included palmoplantar keratosis and early-onset severe periodontitis. Sequence analysis of the CTSC gene showed three novel nonsense mutations (viz., p.Q49X, p.Q69X and p.Y304X in homozygous state in affected individuals from these Indian families. Conclusions This study reported three novel nonsense mutations in three Indian families. These novel nonsense mutations are predicted to produce truncated dipeptidyl-peptidase I causing PLS phenotype in these families. A review of the literature along with three novel mutations reported here showed that the total number of mutations in the CTSC gene described to date is 41 with 17 mutations being located in exon 7.
Distribution of mutations in the PEX gene in families with X-linked hypophosphataemic rickets (HYP).
Rowe, P S; Oudet, C L; Francis, F; Sinding, C; Pannetier, S; Econs, M J; Strom, T M; Meitinger, T; Garabedian, M; David, A; Macher, M A; Questiaux, E; Popowska, E; Pronicka, E; Read, A P; Mokrzycki, A; Glorieux, F H; Drezner, M K; Hanauer, A; Lehrach, H; Goulding, J N; O'Riordan, J L
1997-04-01
Mutations in the PEX gene at Xp22.1 (phosphate-regulating gene with homologies to endopeptidases, on the X-chromosome), are responsible for X-linked hypophosphataemic rickets (HYP). Homology of PEX to the M13 family of Zn2+ metallopeptidases which include neprilysin (NEP) as prototype, has raised important questions regarding PEX function at the molecular level. The aim of this study was to analyse 99 HYP families for PEX gene mutations, and to correlate predicted changes in the protein structure with Zn2+ metallopeptidase gene function. Primers flanking 22 characterised exons were used to amplify DNA by PCR, and SSCP was then used to screen for mutations. Deletions, insertions, nonsense mutations, stop codons and splice mutations occurred in 83% of families screened for in all 22 exons, and 51% of a separate set of families screened in 17 PEX gene exons. Missense mutations in four regions of the gene were informative regarding function, with one mutation in the Zn2+-binding site predicted to alter substrate enzyme interaction and catalysis. Computer analysis of the remaining mutations predicted changes in secondary structure, N-glycosylation, protein phosphorylation and catalytic site molecular structure. The wide range of mutations that align with regions required for protease activity in NEP suggests that PEX also functions as a protease, and may act by processing factor(s) involved in bone mineral metabolism.
AHSG gene polymorphisms are associated with bone mineral density in Caucasian nuclear families
International Nuclear Information System (INIS)
Yang Yanjun; Wang Yanbo; Lei Shufeng; Long Jirong; Shen Hui; Zhao Lanjuan; Jiang Deke; Xiao Sumei; Chen Xiangding; Chen Yuan; Deng Hongwen
2007-01-01
Purpose. To investigate the role of alpha2-HS glycoprotein (AHSG) gene on bone mineral density (BMD) variation. Methods. A total of 665 subjects from 157 Caucasian nuclear families were genotyped at the AHSG NlaIII, SacI sites. The association and linkage between the single SNP markers and haplotypes constructed by two markers in this gene and BMDs at the spine and hip were determined by using quantitative transmission disequilibrium test (QTDT). Results. Significant within-family associations were obtained for spine BMD at both of studied markers (P = 0.036 and 0.005 at the NlaIII and SacI sites, respectively). Significant (P = 0.008 at the NlaIII locus) (P = 0.004 at the SacI locus) total associations at spine BMD were detected. Haplotype analyses confirmed those within-family and total association. Conclusions. These data suggest the polymorphisms in the AHSG gene may have effects on BMD variation in Caucasian population
[Analysis of gene mutation in a Chinese family with Norrie disease].
Zhang, Tian-xiao; Zhao, Xiu-li; Hua, Rui; Zhang, Jin-song; Zhang, Xue
2012-09-01
To detect the pathogenic mutation in a Chinese family with Norrie disease. Clinical diagnosis was based on familial history, clinical sign and B ultrasonic examination. Peripheral blood samples were obtained from all available members in a Chinese family with Norrie disease. Genomic DNA was extracted from lymphocytes by the standard SDS-proteinase K-phenol/chloroform method. Two coding exons and all intron-exon boundaries of the NDP gene were PCR amplified using three pairs of primers and subjected to automatic DNA sequence. The causative mutation was confirmed by restriction enzyme analysis and genotyping analysis in all members. Sequence analysis of NDP gene revealed a missense mutation c.220C > T (p.Arg74Cys) in the proband and his mother. Further mutation identification by restriction enzyme analysis and genotyping analysis showed that the proband was homozygote of this mutation. His mother and other four unaffected members (III3, IV4, III5 and II2) were carriers of this mutation. The mutant amino acid located in the C-terminal cystine knot-like domain, which was critical motif for the structure and function of NDP. A NDP missense mutation was identified in a Chinese family with Norrie disease.
Tang, Xin; Liu, Huawei; Chen, Quanmei; Wang, Xin; Xiong, Ying; Zhao, Ping
2016-10-03
The solute carrier 6 (SLC6) gene family, initially known as the neurotransmitter transporters, plays vital roles in the regulation of neurotransmitter signaling, nutrient absorption and motor behavior. In this study, a total of 16 candidate genes were identified as SLC6 family gene homologs in the silkworm (Bombyx mori) genome. Spatio-temporal expression patterns of silkworm SLC6 gene transcripts indicated that these genes were highly and specifically expressed in midgut, brain and gonads; moreover, these genes were expressed primarily at the feeding stage or adult stage. Levels of expression for most midgut-specific and midgut-enriched gene transcripts were down-regulated after starvation but up-regulated after re-feeding. In addition, we observed that expression levels of these genes except for BmSLC6-15 and BmGT1 were markedly up-regulated by a juvenile hormone analog. Moreover, brain-enriched genes showed differential expression patterns during wandering and mating processes, suggesting that these genes may be involved in modulating wandering and mating behaviors. Our results improve our understanding of the expression patterns and potential physiological functions of the SLC6 gene family, and provide valuable information for the comprehensive functional analysis of the SLC6 gene family.
Vears, Danya F; Dunn, Karen L; Wake, Samantha A; Scheffer, Ingrid E
2015-05-01
Recognition of the role of genetics in the epilepsies has increased dramatically, impacting on clinical practice across many epilepsy syndromes. There is limited research investigating the impact of gene identification on individuals and families with epilepsy. While research has focused on the impact of delivering genetic information to families at the time of diagnosis in genetic diseases more broadly, little is known about how genetic results in epileptic diseases influences people's lives many years after it has been conveyed. This study used qualitative methods to explore the experience of receiving a genetic result in people with familial epilepsy. Interviews were conducted with individuals with familial epilepsies in whom the underlying genetic mutation had been identified. Recorded interviews underwent thematic analysis. 20 individuals from three families with different epilepsy syndromes and causative genes were interviewed. Multiple generations within families were studied. The mean time from receiving the genetic result prior to interview was 10.9 years (range 5-14 years). Three major themes were identified: 1) living with epilepsy: an individual's experience of the severity of epilepsy in their family influenced their view. 2) Clinical utility of the test: participants expressed varying reactions to receiving a genetic result. While for some it provided helpful information and relief, others were not surprised by the finding given the familial context. Some valued the use of genetic information for reproductive decision-making, particularly in the setting of severely affected family members. While altruistic reasons for participating in genetic research were discussed, participants emphasised the benefit of participation to them and their families. 3) 'Talking about the family genes': individuals reported poor communication between family members about their epilepsy and its genetic implications. The results provide important insights into the family
Dong, Heng; Liu, Dandan; Han, Tianyu; Zhao, Yuxue; Sun, Ji; Lin, Sue; Cao, Jiashu; Chen, Zhong-Hua; Huang, Li
2015-11-24
Histone lysine methylation, controlled by the SET Domain Group (SDG) gene family, is part of the histone code that regulates chromatin function and epigenetic control of gene expression. Analyzing the SDG gene family in Brassica rapa for their gene structure, domain architecture, subcellular localization, rate of molecular evolution and gene expression pattern revealed common occurrences of subfunctionalization and neofunctionalization in BrSDGs. In comparison with Arabidopsis thaliana, the BrSDG gene family was found to be more divergent than AtSDGs, which might partly explain the rich variety of morphotypes in B. rapa. In addition, a new evolutionary pattern of the four main groups of SDGs was presented, in which the Trx group and the SUVR subgroup evolved faster than the E(z), Ash groups and the SUVH subgroup. These differences in evolutionary rate among the four main groups of SDGs are perhaps due to the complexity and variability of the regions that bind with biomacromolecules, which guide SDGs to their target loci.
Mizoshiri, N; Kishida, T; Yamamoto, K; Shirai, T; Terauchi, R; Tsuchida, S; Mori, Y; Ejima, A; Sato, Y; Arai, Y; Fujiwara, H; Yamamoto, T; Kanamura, N; Mazda, O; Kubo, T
2015-11-27
Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. Copyright © 2015 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Mizoshiri, N.; Kishida, T.; Yamamoto, K.; Shirai, T.; Terauchi, R.; Tsuchida, S.; Mori, Y.; Ejima, A.; Sato, Y.; Arai, Y.; Fujiwara, H.; Yamamoto, T.; Kanamura, N.; Mazda, O.; Kubo, T.
2015-01-01
Introduction: Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. Materials and Methods: We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. Results: As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. Discussion: The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. - Highlights: • Introducing L-myc in a combination with either Oct3/4, Oct6 or Oct9 enables the conversion of fibroblasts to osteoblasts. • A combination of L-myc with Oct3/4 or Oct9 can induce the cells to a phenotype closer to normal osteoblasts. • N-myc was considered the most appropriate Myc family gene for induction of osteoblast-like phenotype in fibroblasts. • The combination of Oct9 plus N-myc has the strongest capability of inducing osteoblast-like phenotype.
Energy Technology Data Exchange (ETDEWEB)
Mizoshiri, N. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Kishida, T. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Yamamoto, K. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Shirai, T.; Terauchi, R.; Tsuchida, S. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Mori, Y. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Ejima, A. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Sato, Y. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Arai, Y.; Fujiwara, H. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Yamamoto, T.; Kanamura, N. [Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Mazda, O., E-mail: mazda@koto.kpu-m.ac.jp [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Kubo, T. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan)
2015-11-27
Introduction: Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. Materials and Methods: We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. Results: As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. Discussion: The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. - Highlights: • Introducing L-myc in a combination with either Oct3/4, Oct6 or Oct9 enables the conversion of fibroblasts to osteoblasts. • A combination of L-myc with Oct3/4 or Oct9 can induce the cells to a phenotype closer to normal osteoblasts. • N-myc was considered the most appropriate Myc family gene for induction of osteoblast-like phenotype in fibroblasts. • The combination of Oct9 plus N-myc has the strongest capability of inducing osteoblast-like phenotype.
Directory of Open Access Journals (Sweden)
Jinlong Jian
2018-02-01
Full Text Available We recently reported that progranulin (PGRN is a novel regulator of glucocerebrosidase and its deficiency associates with Gaucher Diseases (GD (Jian et al., 2016a; Jian et al., 2018. To isolate the relevant downstream molecules, we performed a whole genome microarray and mass spectrometry analysis, which led to the isolation of Chitinase-3-like-1 (CHI3L1 as one of the up-regulated genes in PGRN null mice. Elevated levels of CHI3L1 were confirmed by immunoblotting and immunohistochemistry. In contrast, treatment with recombinant Pcgin, a derivative of PGRN, as well as imigluerase, significantly reduced the expressions of CHI3L1 in both PGRN null GD model and the fibroblasts from GD patients. Serum levels of CHIT1, a clinical biomarker for GD, were significantly higher in GD patients than healthy controls (51.16 ± 2.824 ng/ml vs 35.07 ± 2.099 ng/ml, p < 0.001. Similar to CHIT1, serum CHI3L1 was also significantly increased in GD patients compared with healthy controls (1736 ± 152.1 pg/ml vs 684.7 ± 68.20 pg/ml, p < 0.001. Whereas the PGRN level is significantly reduced in GD patients as compared to the healthy control (91.56 ± 3.986 ng/ml vs 150.6 ± 4.501, p < 0.001. Collectively, these results indicate that CHI3L1 may be a previously unrecognized biomarker for diagnosing GD and for evaluating the therapeutic effects of new GD drug(s.
Evolutionary Relationship and Structural Characterization of the EPF/EPFL Gene Family
Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu
2013-01-01
EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that...
FGF: A web tool for Fishing Gene Family in a whole genome database
DEFF Research Database (Denmark)
Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong
2007-01-01
Gene duplication is an important process in evolution. The availability of genome sequences of a number of organisms has made it possible to conduct comprehensive searches for duplicated genes enabling informative studies of their evolution. We have established the FGF (Fishing Gene Family) progr...... is freely available on a web server at http://fgf.genomics.org.cn/...
Energy Technology Data Exchange (ETDEWEB)
Kang, Qing-lin [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Xu, Jia [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Zhang, Zeng [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); He, Jin-wei [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Lu, Lian-song [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Fu, Wen-zhen [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Zhang, Zhen-lin, E-mail: zzl2002@medmail.com.cn [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China)
2012-07-13
Highlights: Black-Right-Pointing-Pointer In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. Black-Right-Pointing-Pointer We identified three novel PHEX gene mutations in four unrelated families with XLH. Black-Right-Pointing-Pointer We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. Black-Right-Pointing-Pointer We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.
International Nuclear Information System (INIS)
Kang, Qing-lin; Xu, Jia; Zhang, Zeng; He, Jin-wei; Lu, Lian-song; Fu, Wen-zhen; Zhang, Zhen-lin
2012-01-01
Highlights: ► In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. ► We identified three novel PHEX gene mutations in four unrelated families with XLH. ► We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. ► We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.
Identification of Candidate Gene Variants in Korean MODY Families by Whole-Exome Sequencing.
Shim, Ye Jee; Kim, Jung Eun; Hwang, Su-Kyeong; Choi, Bong Seok; Choi, Byung Ho; Cho, Eun-Mi; Jang, Kyoung Mi; Ko, Cheol Woo
2015-01-01
To date, 13 genes causing maturity-onset diabetes of the young (MODY) have been identified. However, there is a big discrepancy in the genetic locus between Asian and Caucasian patients with MODY. Thus, we conducted whole-exome sequencing in Korean MODY families to identify causative gene variants. Six MODY probands and their family members were included. Variants in the dbSNP135 and TIARA databases for Koreans and the variants with minor allele frequencies >0.5% of the 1000 Genomes database were excluded. We selected only the functional variants (gain of stop codon, frameshifts and nonsynonymous single-nucleotide variants) and conducted a case-control comparison in the family members. The selected variants were scanned for the previously introduced gene set implicated in glucose metabolism. Three variants c.620C>T:p.Thr207Ile in PTPRD, c.559C>G:p.Gln187Glu in SYT9, and c.1526T>G:p.Val509Gly in WFS1 were respectively identified in 3 families. We could not find any disease-causative alleles of known MODY 1-13 genes. Based on the predictive program, Thr207Ile in PTPRD was considered pathogenic. Whole-exome sequencing is a valuable method for the genetic diagnosis of MODY. Further evaluation is necessary about the role of PTPRD, SYT9 and WFS1 in normal insulin release from pancreatic beta cells. © 2015 S. Karger AG, Basel.
Tan, Hua-Wei; Song, Xiao-Ming; Duan, Wei-Ke; Wang, Yan; Hou, Xi-Lin
2015-11-01
The SQUAMOSA PROMOTER BINDING PROTEIN (SBP)-box gene family contains highly conserved plant-specific transcription factors that play an important role in plant development, especially in flowering. Chinese cabbage (Brassica rapa subsp. pekinensis) is a leafy vegetable grown worldwide and is used as a model crop for research in genome duplication. The present study aimed to characterize the SBP-box transcription factor genes in Chinese cabbage. Twenty-nine SBP-box genes were identified in the Chinese cabbage genome and classified into six groups. We identified 23 orthologous and 5 co-orthologous SBP-box gene pairs between Chinese cabbage and Arabidopsis. An interaction network among these genes was constructed. Sixteen SBP-box genes were expressed more abundantly in flowers than in other tissues, suggesting their involvement in flowering. We show that the MiR156/157 family members may regulate the coding regions or 3'-UTR regions of Chinese cabbage SBP-box genes. As SBP-box genes were found to potentially participate in some plant development pathways, quantitative real-time PCR analysis was performed and showed that Chinese cabbage SBP-box genes were also sensitive to the exogenous hormones methyl jasmonic acid and salicylic acid. The SBP-box genes have undergone gene duplication and loss, evolving a more refined regulation for diverse stimulation in plant tissues. Our comprehensive genome-wide analysis provides insights into the SBP-box gene family of Chinese cabbage.
Riazuddin, S; Hussain, M; Razzaq, A; Iqbal, Z; Shahzad, M; Polla, D L; Song, Y; van Beusekom, E; Khan, A A; Tomas-Roca, L; Rashid, M; Zahoor, M Y; Wissink-Lindhout, W M; Basra, M A R; Ansar, M; Agha, Z; van Heeswijk, K; Rasheed, F; Van de Vorst, M; Veltman, J A; Gilissen, C; Akram, J; Kleefstra, T; Assir, M Z; Grozeva, D; Carss, K; Raymond, F L; O'Connor, T D; Riazuddin, S A; Khan, S N; Ahmed, Z M; de Brouwer, A P M; van Bokhoven, H; Riazuddin, S
2017-11-01
Intellectual disability (ID) is a clinically and genetically heterogeneous disorder, affecting 1-3% of the general population. Although research into the genetic causes of ID has recently gained momentum, identification of pathogenic mutations that cause autosomal recessive ID (ARID) has lagged behind, predominantly due to non-availability of sizeable families. Here we present the results of exome sequencing in 121 large consanguineous Pakistani ID families. In 60 families, we identified homozygous or compound heterozygous DNA variants in a single gene, 30 affecting reported ID genes and 30 affecting novel candidate ID genes. Potential pathogenicity of these alleles was supported by co-segregation with the phenotype, low frequency in control populations and the application of stringent bioinformatics analyses. In another eight families segregation of multiple pathogenic variants was observed, affecting 19 genes that were either known or are novel candidates for ID. Transcriptome profiles of normal human brain tissues showed that the novel candidate ID genes formed a network significantly enriched for transcriptional co-expression (P<0.0001) in the frontal cortex during fetal development and in the temporal-parietal and sub-cortex during infancy through adulthood. In addition, proteins encoded by 12 novel ID genes directly interact with previously reported ID proteins in six known pathways essential for cognitive function (P<0.0001). These results suggest that disruptions of temporal parietal and sub-cortical neurogenesis during infancy are critical to the pathophysiology of ID. These findings further expand the existing repertoire of genes involved in ARID, and provide new insights into the molecular mechanisms and the transcriptome map of ID.
DEFF Research Database (Denmark)
Bisgaard, Marie Luise; Ripa, Rasmus S; Bülow, Steffen
2004-01-01
Development of one hundred or more adenomas in the colon and rectum is diagnostic for the dominantly inherited, autosomal disease Familial Adenomatous Polyposis (FAP). It is possible to identify a mutation in the Adenomatous Polyposis Coli (APC) gene in approximately 80% of the patients, and almost...... 1,000 different pathogenic mutations have been identified in the APC gene up till now. We report 12 novel and 24' previously described germline APC mutations from 48 unrelated Danish families. Four families with the mutation localized in the 3' region of the gene showed great variance in phenotypic...
Identification of the trehalose-6-phosphate synthase gene family in ...
Indian Academy of Sciences (India)
2015-03-04
Mar 4, 2015 ... stress, however, our study mainly analysed the TPS gene family under freezing conditions in winter wheat .... size the first-strand cDNA using the Fermentas RevertAid ..... In the stem of Dongnongdongmai 1, TaTPS1, 2, 3, 4, 8,.
Phylogenetic analysis of the MS4A and TMEM176 gene families.
Directory of Open Access Journals (Sweden)
Jonathan Zuccolo
2010-02-01
Full Text Available The MS4A gene family in humans includes CD20 (MS4A1, FcRbeta (MS4A2, Htm4 (MS4A3, and at least 13 other syntenic genes encoding membrane proteins, most having characteristic tetraspanning topology. Expression of MS4A genes is variable in tissues throughout the body; however, several are limited to cells in the hematopoietic system where they have known roles in immune cell functions. Genes in the small TMEM176 group share significant sequence similarity with MS4A genes and there is evidence of immune function of at least one of the encoded proteins. In this study, we examined the evolutionary history of the MS4A/TMEM176 families as well as tissue expression of the phylogenetically earliest members, in order to investigate their possible origins in immune cells.Orthologs of human MS4A genes were found only in mammals; however, MS4A gene homologs were found in most jawed vertebrates. TMEM176 genes were found only in mammals and bony fish. Several unusual MS4A genes having 2 or more tandem MS4A sequences were identified in the chicken (Gallus gallus and early mammals (opossum, Monodelphis domestica and platypus, Ornithorhyncus anatinus. A large number of highly conserved MS4A and TMEM176 genes was found in zebrafish (Danio rerio. The most primitive organism identified to have MS4A genes was spiny dogfish (Squalus acanthus. Tissue expression of MS4A genes in S. acanthias and D. rerio showed no evidence of expression restricted to the hematopoietic system.Our findings suggest that MS4A genes first appeared in cartilaginous fish with expression outside of the immune system, and have since diversified in many species into their modern forms with expression and function in both immune and nonimmune cells.
Expression of REG family genes in human inflammatory bowel diseases and its regulation
Directory of Open Access Journals (Sweden)
Chikatsugu Tsuchida
2017-12-01
Full Text Available The pathophysiology of inflammatory bowel disease (IBD reflects a balance between mucosal injury and reparative mechanisms. Some regenerating gene (Reg family members have been reported to be expressed in Crohn's disease (CD and ulcerative colitis (UC and to be involved as proliferative mucosal factors in IBD. However, expression of all REG family genes in IBD is still unclear. Here, we analyzed expression of all REG family genes (REG Iα, REG Iβ, REG III, HIP/PAP, and REG IV in biopsy specimens of UC and CD by real-time RT-PCR. REG Iα, REG Iβ, and REG IV genes were overexpressed in CD samples. REG IV gene was also overexpressed in UC samples. We further analyzed the expression mechanisms of REG Iα, REG Iβ, and REG IV genes in human colon cells. The expression of REG Iα was significantly induced by IL-6 or IL-22, and REG Iβ was induced by IL-22. Deletion analyses revealed that three regions (− 220 to − 211, − 179 to − 156, and − 146 to − 130 in REG Iα and the region (− 274 to− 260 in REG Iβ promoter were responsible for the activation by IL-22/IL-6. The promoters contain consensus transcription factor binding sequences for MZF1, RTEF1/TEAD4, and STAT3 in REG Iα, and HLTF/FOXN2F in REG Iβ, respectively. The introduction of siRNAs for MZF1, RTEF1/TEAD4, STAT3, and HLTF/FOXN2F abolished the transcription of REG Iα and REG Iβ. The gene activation mechanisms of REG Iα/REG Iβ may play a role in colon mucosal regeneration in IBD.
Genomic Survey and Expression Profiling of the MYB Gene Family in Watermelon
Directory of Open Access Journals (Sweden)
Qing XU
2018-01-01
Full Text Available Myeloblastosis (MYB proteins constitute one of the largest transcription factor (TF families in plants. They are functionally diverse in regulating plant development, metabolism, and multiple stress responses. However, the function of watermelon MYB proteins remains elusive to date. Here, a genome-wide identification of watermelon MYB TFs was performed by bioinformatics analysis. A total of 162 MYB genes were identified from watermelon (ClaMYB. A comprehensive overview of the ClaMYB genes was undertaken, including the gene structures, chromosomal distribution, gene duplication, conserved protein motif, and phylogenetic relationship. According to the analyses, the watermelon MYB genes were categorized into three groups (R1R2R3-MYB, R2R3-MYB, and MYB-related. Amino acid alignments for all MYB motifs of ClaMYBs demonstrated high conservation. Investigation of their chromosomal localization revealed that these ClaMYB genes distributed across the 11 watermelon chromosomes. Gene duplication analyses showed that tandem duplication events contributed predominantly to the expansion of the MYB gene family in the watermelon genome. Phylogenetic comparison of the ClaMYB proteins with Arabidopsis MYB proteins revealed that watermelon MYB proteins underwent a more diverse evolution after divergence from Arabidopsis. Some watermelon MYBs were found to cluster into the functional clades of Arabidopsis MYB proteins. Expression analysis under different stress conditions identified a group of watermelon MYB proteins implicated in the plant stress responses. The comprehensive investigation of watermelon MYB genes in this study provides a useful reference for future cloning and functional analysis of watermelon MYB proteins. Keywords: watermelon, MYB transcription factor, abiotic stress, phylogenetic analysis
Directory of Open Access Journals (Sweden)
Sergey Yegorov
Full Text Available Recent progress in the analysis of whole genome sequencing data has resulted in the emergence of paleogenomics, a field devoted to the reconstruction of ancestral genomes. Ancestral karyotype reconstructions have been used primarily to illustrate the dynamic nature of genome evolution. In this paper, we demonstrate how they can also be used to study individual gene families by examining the evolutionary history of relaxin hormones (RLN/INSL and relaxin family peptide receptors (RXFP. Relaxin family hormones are members of the insulin superfamily, and are implicated in the regulation of a variety of primarily reproductive and neuroendocrine processes. Their receptors are G-protein coupled receptors (GPCR's and include members of two distinct evolutionary groups, an unusual characteristic. Although several studies have tried to elucidate the origins of the relaxin peptide family, the evolutionary origin of their receptors and the mechanisms driving the diversification of the RLN/INSL-RXFP signaling systems in non-placental vertebrates has remained elusive. Here we show that the numerous vertebrate RLN/INSL and RXFP genes are products of an ancestral receptor-ligand system that originally consisted of three genes, two of which apparently trace their origins to invertebrates. Subsequently, diversification of the system was driven primarily by whole genome duplications (WGD, 2R and 3R followed by almost complete retention of the ligand duplicates in most vertebrates but massive loss of receptor genes in tetrapods. Interestingly, the majority of 3R duplicates retained in teleosts are potentially involved in neuroendocrine regulation. Furthermore, we infer that the ancestral AncRxfp3/4 receptor may have been syntenically linked to the AncRln-like ligand in the pre-2R genome, and show that syntenic linkages among ligands and receptors have changed dynamically in different lineages. This study ultimately shows the broad utility, with some caveats, of
Genome-wide identification and characterization of the SBP-box gene family in Petunia.
Zhou, Qin; Zhang, Sisi; Chen, Feng; Liu, Baojun; Wu, Lan; Li, Fei; Zhang, Jiaqi; Bao, Manzhu; Liu, Guofeng
2018-03-12
SQUAMOSA PROMOTER BINDING PROTEIN (SBP)-box genes encode a family of plant-specific transcription factors (TFs) that play important roles in many growth and development processes including phase transition, leaf initiation, shoot and inflorescence branching, fruit development and ripening etc. The SBP-box gene family has been identified and characterized in many species, but has not been well studied in Petunia, an important ornamental genus. We identified 21 putative SPL genes of Petunia axillaris and P. inflata from the reference genome of P. axillaris N and P. inflata S6, respectively, which were supported by the transcriptome data. For further confirmation, all the 21 genes were also cloned from P. hybrida line W115 (Mitchel diploid). Phylogenetic analysis based on the highly conserved SBP domains arranged PhSPLs in eight groups, analogous to those from Arabidopsis and tomato. Furthermore, the Petunia SPL genes had similar exon-intron structure and the deduced proteins contained very similar conserved motifs within the same subgroup. Out of 21 PhSPL genes, fourteen were predicted to be potential targets of PhmiR156/157, and the putative miR156/157 response elements (MREs) were located in the coding region of group IV, V, VII and VIII genes, but in the 3'-UTR regions of group VI genes. SPL genes were also identified from another two wild Petunia species, P. integrifolia and P. exserta, based on their transcriptome databases to investigate the origin of PhSPLs. Phylogenetic analysis and multiple alignments of the coding sequences of PhSPLs and their orthologs from wild species indicated that PhSPLs were originated mainly from P. axillaris. qRT-PCR analysis demonstrated differential spatiotemperal expression patterns of PhSPL genes in petunia and many were expressed predominantly in the axillary buds and/or inflorescences. In addition, overexpression of PhSPL9a and PhSPL9b in Arabidopsis suggested that these genes play a conserved role in promoting the vegetative
Dlx homeobox gene family expression in osteoclasts.
Lézot, F; Thomas, B L; Blin-Wakkach, C; Castaneda, B; Bolanos, A; Hotton, D; Sharpe, P T; Heymann, D; Carles, G F; Grigoriadis, A E; Berdal, A
2010-06-01
Skeletal growth and homeostasis require the finely orchestrated secretion of mineralized tissue matrices by highly specialized cells, balanced with their degradation by osteoclasts. Time- and site-specific expression of Dlx and Msx homeobox genes in the cells secreting these matrices have been identified as important elements in the regulation of skeletal morphology. Such specific expression patterns have also been reported in osteoclasts for Msx genes. The aim of the present study was to establish the expression patterns of Dlx genes in osteoclasts and identify their function in regulating skeletal morphology. The expression patterns of all Dlx genes were examined during the whole osteoclastogenesis using different in vitro models. The results revealed that Dlx1 and Dlx2 are the only Dlx family members with a possible function in osteoclastogenesis as well as in mature osteoclasts. Dlx5 and Dlx6 were detected in the cultures but appear to be markers of monocytes and their derivatives. In vivo, Dlx2 expression in osteoclasts was examined using a Dlx2/LacZ transgenic mouse. Dlx2 is expressed in a subpopulation of osteoclasts in association with tooth, brain, nerve, and bone marrow volumetric growths. Altogether the present data suggest a role for Dlx2 in regulation of skeletal morphogenesis via functions within osteoclasts. (c) 2010 Wiley-Liss, Inc.
Directory of Open Access Journals (Sweden)
Yong Guo
Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.
Xu, Zongda; Zhang, Qixiang; Sun, Lidan; Du, Dongliang; Cheng, Tangren; Pan, Huitang; Yang, Weiru; Wang, Jia
2014-10-01
MADS-box genes encode transcription factors that play crucial roles in plant development, especially in flower and fruit development. To gain insight into this gene family in Prunus mume, an important ornamental and fruit plant in East Asia, and to elucidate their roles in flower organ determination and fruit development, we performed a genome-wide identification, characterisation and expression analysis of MADS-box genes in this Rosaceae tree. In this study, 80 MADS-box genes were identified in P. mume and categorised into MIKC, Mα, Mβ, Mγ and Mδ groups based on gene structures and phylogenetic relationships. The MIKC group could be further classified into 12 subfamilies. The FLC subfamily was absent in P. mume and the six tandemly arranged DAM genes might experience a species-specific evolution process in P. mume. The MADS-box gene family might experience an evolution process from MIKC genes to Mδ genes to Mα, Mβ and Mγ genes. The expression analysis suggests that P. mume MADS-box genes have diverse functions in P. mume development and the functions of duplicated genes diverged after the duplication events. In addition to its involvement in the development of female gametophytes, type I genes also play roles in male gametophytes development. In conclusion, this study adds to our understanding of the roles that the MADS-box genes played in flower and fruit development and lays a foundation for selecting candidate genes for functional studies in P. mume and other species. Furthermore, this study also provides a basis to study the evolution of the MADS-box family.
Familial Dilated Cardiomyopathy Caused by a Novel Frameshift in the BAG3 Gene.
Directory of Open Access Journals (Sweden)
Rocio Toro
Full Text Available Dilated cardiomyopathy, a major cause of chronic heart failure and cardiac transplantation, is characterized by left ventricular or biventricular heart dilatation. In nearly 50% of cases the pathology is inherited, and more than 60 genes have been reported as disease-causing. However, in 30% of familial cases the mutation remains unidentified even after comprehensive genetic analysis. This study clinically and genetically assessed a large Spanish family affected by dilated cardiomyopathy to search for novel variations.Our study included a total of 100 family members. Clinical assessment was performed in alive, and genetic analysis was also performed in alive and 1 deceased relative. Genetic screening included resequencing of 55 genes associated with sudden cardiac death, and Sanger sequencing of main disease-associated genes. Genetic analysis identified a frame-shift variation in BAG3 (p.H243Tfr*64 in 32 patients. Genotype-phenotype correlation identified substantial heterogeneity in disease expression. Of 32 genetic carriers (one deceased, 21 relatives were clinically affected, and 10 were asymptomatic. Seventeen of the symptomatic genetic carriers exhibited proto-diastolic septal knock by echocardiographic assessment.We report p.H243Tfr*64_BAG3 as a novel pathogenic variation responsible for familial dilated cardiomyopathy. This variation correlates with a more severe phenotype of the disease, mainly in younger individuals. Genetic analysis in families, even asymptomatic individuals, enables early identification of individuals at risk and allows implementation of preventive measures.
Directory of Open Access Journals (Sweden)
Babykumari P Chitramuthu
Full Text Available Progranulin (PGRN is a glycoprotein with multiple roles in normal and disease states. Mutations within the GRN gene cause frontotemporal lobar degeneration (FTLD. The affected neurons display distinctive TAR DNA binding protein 43 (TDP-43 inclusions. How partial loss of PGRN causes TDP-43 neuropathology is poorly understood. TDP-43 inclusions are also found in affected neurons of patients with other neurodegenerative diseases including amyotrophic lateral sclerosis (ALS and Alzheimer's disease. In ALS, TDP-43 inclusions are typically also immunoreactive for fused in sarcoma (FUS. Mutations within TDP-43 or FUS are themselves neuropathogenic in ALS and some cases of FTLD. We used the outgrowth of caudal primary motor neurons (MNs in zebrafish embryos to investigate the interaction of PGRN with TDP-43 and FUS in vivo. As reported previously, depletion of zebrafish PGRN-A (zfPGRN-A is associated with truncated primary MNs and impaired motor function. Here we found that depletion of zfPGRN-A results in primary MNs outgrowth stalling at the horizontal myoseptum, a line of demarcation separating the myotome into dorsal and ventral compartments that is where the final destination of primary motor is assigned. Successful axonal outgrowth beyond the horizontal myoseptum depends in part upon formation of acetylcholine receptor clusters and this was found to be disorganized upon depletion of zfPGRN-A. PGRN reversed the effects of zfPGRN-A knockdown, but a related gene, zfPGRN-1, was without effect. Both knockdown of TDP-43 or FUS, as well as expression of humanTDP-43 and FUS mutants results in MN abnormalities that are reversed by co-expression of hPGRN mRNA. Neither TDP-43 nor FUS reversed MN phenotypes caused by the depletion of PGRN. Thus TDP-43 and FUS lie upstream of PGRN in a gene complementation pathway. The ability of PGRN to override TDP-43 and FUS neurotoxicity due to partial loss of function or mutation in the corresponding genes may have
International Nuclear Information System (INIS)
Macqueen, Daniel J.; Bower, Neil I.; Johnston, Ian A.
2010-01-01
Research highlights: → The expanded akirin gene family of Atlantic salmon was characterised. → akirin paralogues are regulated between mono- and multi-nucleated muscle cells. → akirin paralogues positioned within known genetic networks controlling myogenesis. → Co-expression of akirin paralogues is evident across cell types/during myogenesis. → Selection has likely maintained common regulatory elements among akirin paralogues. -- Abstract: Vertebrate akirin genes usually form a family with one-to-three members that regulate gene expression during the innate immune response, carcinogenesis and myogenesis. We recently established that an expanded family of eight akirin genes is conserved across salmonid fish. Here, we measured mRNA levels of the akirin family of Atlantic salmon (Salmo salar L.) during the differentiation of primary myoblasts cultured from fast-skeletal muscle. Using hierarchical clustering and correlation, the data was positioned into a network of expression profiles including twenty further genes that regulate myogenesis. akirin1(2b) was not significantly regulated during the maturation of the cell culture. akirin2(1a) and 2(1b), along with IGF-II and several igfbps, were most highly expressed in mononuclear cells, then significantly and constitutively downregulated as differentiation proceeded and myotubes formed/matured. Conversely, akirin1(1a), 1(1b), 1(2a), 2(2a) and 2(2b) were expressed at lowest levels when mononuclear cells dominated the culture and highest levels when confluent layers of myotubes were evident. However, akirin1(2a) and 2(2a) were first upregulated earlier than akirin1(1a), 1(1b) and 2(2b), when rates of myoblast proliferation were highest. Interestingly, akirin1(1b), 1(2a), 2(2a) and 2(2b) formed part of a module of co-expressed genes involved in muscle differentiation, including myod1a, myog, mef2a, 14-3-3β and 14-3-3γ. All akirin paralogues were expressed ubiquitously across ten tissues, although mRNA levels
Energy Technology Data Exchange (ETDEWEB)
Macqueen, Daniel J., E-mail: djm59@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom); Bower, Neil I., E-mail: nib@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom); Johnston, Ian A., E-mail: iaj@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom)
2010-10-01
Research highlights: {yields} The expanded akirin gene family of Atlantic salmon was characterised. {yields} akirin paralogues are regulated between mono- and multi-nucleated muscle cells. {yields} akirin paralogues positioned within known genetic networks controlling myogenesis. {yields} Co-expression of akirin paralogues is evident across cell types/during myogenesis. {yields} Selection has likely maintained common regulatory elements among akirin paralogues. -- Abstract: Vertebrate akirin genes usually form a family with one-to-three members that regulate gene expression during the innate immune response, carcinogenesis and myogenesis. We recently established that an expanded family of eight akirin genes is conserved across salmonid fish. Here, we measured mRNA levels of the akirin family of Atlantic salmon (Salmo salar L.) during the differentiation of primary myoblasts cultured from fast-skeletal muscle. Using hierarchical clustering and correlation, the data was positioned into a network of expression profiles including twenty further genes that regulate myogenesis. akirin1(2b) was not significantly regulated during the maturation of the cell culture. akirin2(1a) and 2(1b), along with IGF-II and several igfbps, were most highly expressed in mononuclear cells, then significantly and constitutively downregulated as differentiation proceeded and myotubes formed/matured. Conversely, akirin1(1a), 1(1b), 1(2a), 2(2a) and 2(2b) were expressed at lowest levels when mononuclear cells dominated the culture and highest levels when confluent layers of myotubes were evident. However, akirin1(2a) and 2(2a) were first upregulated earlier than akirin1(1a), 1(1b) and 2(2b), when rates of myoblast proliferation were highest. Interestingly, akirin1(1b), 1(2a), 2(2a) and 2(2b) formed part of a module of co-expressed genes involved in muscle differentiation, including myod1a, myog, mef2a, 14-3-3{beta} and 14-3-3{gamma}. All akirin paralogues were expressed ubiquitously across ten
Chen, Z Y; Battinelli, E M; Fielder, A; Bundey, S; Sims, K; Breakefield, X O; Craig, I W
1993-10-01
Familial exudative vitreoretinopathy (FEVR) is a hereditary disorder characterized by an abnormality of the peripheral retina. Both autosomal dominant (adFEVR) and X-linked (XLFEVR) forms have been described, but the biochemical defect(s) underlying the symptoms are unknown. Molecular analysis of the Norrie gene locus (NDP) in a four generation FEVR family (shown previously to exhibit linkage to the X-chromosome markers DXS228 and MAOA (Xp11.4-p11.3)) reveals a missense mutation in the highly conserved region of the NDP gene, which caused a neutral amino acid substitution (Leu124Phe), was detected in all of the affected males, but not in the unaffected family members, nor in normal controls. The observations suggest that phenotypes of both XLFEVR and Norrie disease can result from mutations in the same gene.
Directory of Open Access Journals (Sweden)
Sierra M Li
Full Text Available Monoallelic expression is an integral component of regulation of a number of essential genes and gene families. To probe for allele-specific expression in cells of CNS origin, we used next-generation sequencing (RNA-seq to analyze four clonal neural stem cell (NSC lines derived from Mus musculus C57BL/6 (B6×Mus musculus molossinus (JF1 adult female mice. We established a JF1 cSNP library, then ascertained transcriptome-wide expression from B6 vs. JF1 alleles in the NSC lines. Validating the assay, we found that 262 of 268 X-linked genes evaluable in at least one cell line showed monoallelic expression (at least 85% expression of the predominant allele, p-value<0.05. For autosomal genes 170 of 7,198 genes (2.4% of the total showed monoallelic expression in at least 2 evaluable cell lines. The group included eight known imprinted genes with the expected pattern of allele-specific expression. Among the other autosomal genes with monoallelic expression were five members of the glutathione transferase gene superfamily, which processes xenobiotic compounds as well as carcinogens and cancer therapeutic agents. Monoallelic expression within this superfamily thus may play a functional role in the response to diverse and potentially lethal exogenous factors, as is the case for the immunoglobulin and olfactory receptor superfamilies. Other genes and gene families showing monoallelic expression include the annexin gene family and the Thy1 gene, both linked to inflammation and cancer, as well as genes linked to alcohol dependence (Gabrg1 and epilepsy (Kcnma1. The annotated set of genes will provide a resource for investigation of mechanisms underlying certain cases of these and other major disorders.
[Analysis of the NDP gene in a Chinese family with X-linked recessive Norrie disease].
Mei, Libin; Huang, Yanru; Pan, Qian; Liang, Desheng; Wu, Lingqian
2015-05-01
The purpose of the current research was to investigate the NDP (Norrie disease protein) gene in one Chinese family with Norrie disease (ND) and to characterize the related clinical features. Clinical data of the proband and his family members were collected. Complete ophthalmic examinations were carried out on the proband. Genomic DNA was extracted from peripheral blood leukocytes of 35 family members. Molecular analysis of the NDP gene was performed by polymerase chain reaction and direct sequencing of all exons and flanking regions. A hemizygous NDP missense mutation c.362G > A (p.Arg121Gln) in exon 3 was identified in the affected members, but not in any of the unaffected family individuals. The missense mutation c.362G > A in NDP is responsible for the Norrie disease in this family. This discovery will help provide the family members with accurate and reliable genetic counseling and prenatal diagnosis.
The Toll-like receptor gene family is integrated into human DNA damage and p53 networks.
Directory of Open Access Journals (Sweden)
Daniel Menendez
2011-03-01
Full Text Available In recent years the functions that the p53 tumor suppressor plays in human biology have been greatly extended beyond "guardian of the genome." Our studies of promoter response element sequences targeted by the p53 master regulatory transcription factor suggest a general role for this DNA damage and stress-responsive regulator in the control of human Toll-like receptor (TLR gene expression. The TLR gene family mediates innate immunity to a wide variety of pathogenic threats through recognition of conserved pathogen-associated molecular motifs. Using primary human immune cells, we have examined expression of the entire TLR gene family following exposure to anti-cancer agents that induce the p53 network. Expression of all TLR genes, TLR1 to TLR10, in blood lymphocytes and alveolar macrophages from healthy volunteers can be induced by DNA metabolic stressors. However, there is considerable inter-individual variability. Most of the TLR genes respond to p53 via canonical as well as noncanonical promoter binding sites. Importantly, the integration of the TLR gene family into the p53 network is unique to primates, a recurrent theme raised for other gene families in our previous studies. Furthermore, a polymorphism in a TLR8 response element provides the first human example of a p53 target sequence specifically responsible for endogenous gene induction. These findings-demonstrating that the human innate immune system, including downstream induction of cytokines, can be modulated by DNA metabolic stress-have many implications for health and disease, as well as for understanding the evolution of damage and p53 responsive networks.
Huang, Xiaoyan; Tian, Mao; Li, Jiankang; Cui, Ling; Li, Min; Zhang, Jianguo
2017-11-01
Norrie disease (ND) is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. We identified a novel missense variant (c.314C>A) located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND.
Next-generation sequencing reveals a novel NDP gene mutation in a Chinese family with Norrie disease
Directory of Open Access Journals (Sweden)
Xiaoyan Huang
2017-01-01
Full Text Available Purpose: Norrie disease (ND is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. Methods: To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. Results: We identified a novel missense variant (c.314C>A located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. Conclusion: c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND.
Molecular Evolution of the Glycosyltransferase 6 Gene Family in Primates
Directory of Open Access Journals (Sweden)
Eliane Evanovich
2016-01-01
Full Text Available Glycosyltransferase 6 gene family includes ABO, Ggta1, iGb3S, and GBGT1 genes and by three putative genes restricted to mammals, GT6m6, GTm6, and GT6m7, only the latter is found in primates. GT6 genes may encode functional and nonfunctional proteins. Ggta1 and GBGT1 genes, for instance, are pseudogenes in catarrhine primates, while iGb3S gene is only inactive in human, bonobo, and chimpanzee. Even inactivated, these genes tend to be conversed in primates. As some of the GT6 genes are related to the susceptibility or resistance to parasites, we investigated (i the selective pressure on the GT6 paralogs genes in primates; (ii the basis of the conservation of iGb3S in human, chimpanzee, and bonobo; and (iii the functional potential of the GBGT1 and GT6m7 in catarrhines. We observed that the purifying selection is prevalent and these genes have a low diversity, though ABO and Ggta1 genes have some sites under positive selection. GT6m7, a putative gene associated with aggressive periodontitis, may have regulatory function, but experimental studies are needed to assess its function. The evolutionary conservation of iGb3S in humans, chimpanzee, and bonobo seems to be the result of proximity to genes with important biological functions.
Genome-wide analysis of the WRKY gene family in physic nut (Jatropha curcas L.).
Xiong, Wangdan; Xu, Xueqin; Zhang, Lin; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang
2013-07-25
The WRKY proteins, which contain highly conserved WRKYGQK amino acid sequences and zinc-finger-like motifs, constitute a large family of transcription factors in plants. They participate in diverse physiological and developmental processes. WRKY genes have been identified and characterized in a number of plant species. We identified a total of 58 WRKY genes (JcWRKY) in the genome of the physic nut (Jatropha curcas L.). On the basis of their conserved WRKY domain sequences, all of the JcWRKY proteins could be assigned to one of the previously defined groups, I-III. Phylogenetic analysis of JcWRKY genes with Arabidopsis and rice WRKY genes, and separately with castor bean WRKY genes, revealed no evidence of recent gene duplication in JcWRKY gene family. Analysis of transcript abundance of JcWRKY gene products were tested in different tissues under normal growth condition. In addition, 47 WRKY genes responded to at least one abiotic stress (drought, salinity, phosphate starvation and nitrogen starvation) in individual tissues (leaf, root and/or shoot cortex). Our study provides a useful reference data set as the basis for cloning and functional analysis of physic nut WRKY genes. Copyright © 2013 Elsevier B.V. All rights reserved.
Complexity of rice Hsp100 gene family: lessons from rice genome ...
Indian Academy of Sciences (India)
Madhu Sudhan
2007-03-29
Mar 29, 2007 ... Chaperonins are a class of molecular chaperones found in prokaryotes and in the ... Keywords. Chaperone, gene family, Hsp100, Oryza sativa ..... Sculpting the proteome with AAA+ proteases and disassembly machines; Cell ...
Solyom, Szilvia; Winqvist, Robert; Nikkilä, Jenni; Rapakko, Katrin; Hirvikoski, Pasi; Kokkonen, Hannaleena; Pylkäs, Katri
2011-03-28
A portion of familial breast cancer cases are caused by mutations in the same genes that are inactivated in the downstream part of Fanconi anemia (FA) signaling pathway. Here we have assessed the FANCA gene for breast cancer susceptibility by examining blood DNA for aberrations from 100 Northern Finnish breast cancer families using the MLPA method. We identified a novel heterozygous deletion, removing the promoter and 12 exons of the gene in one family. This allele was absent from 124 controls. We conclude that FANCA deletions might contribute to breast cancer susceptibility, potentially in combination with other germline mutations. To our knowledge, this is the first study reporting a large deletion in an upstream FA gene in familial breast cancer. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.
Neurexin gene family variants as risk factors for autism spectrum disorder.
Wang, Jia; Gong, Jianhua; Li, Li; Chen, Yanlin; Liu, Lingfei; Gu, HuaiTing; Luo, Xiu; Hou, Fang; Zhang, Jiajia; Song, Ranran
2018-01-01
Increasing evidence suggests that abnormal synaptic function leads to neuronal developmental disorders and is an important component of the etiology of autism spectrum disorder (ASD). Neurexins are presynaptic cell-adhesion molecules that affect the function of synapses and mediate the conduction of nerve signals. Thus, neurexins are attractive candidate genes for autism. Since gene families have greater power to reveal genetic association than single genes, we designed this case-control study to investigate six genetic variants in three neurexin genes (NRXN1, NRXN2, and NRXN3) in a Chinese population including 529 ASD patients and 1,923 healthy controls. We found that two SNPs were significantly associated with ASD after false discovery rate (FDR) adjustment for multiple comparisons. The NRXN2 rs12273892 polymorphism T allele and AT genotype were significantly associated with increased risk of ASD (respectively: OR = 1.328, 95% CI = 1.133-1.557, P Autism Res 2018, 11: 37-43. © 2017 International Society for Autism Research, Wiley Periodicals, Inc. Autism spectrum disorder (ASD) is a neurodevelopmental disorder that is highly heritable, and studies have found a number of candidate genes that might contribute to ASD. Neurexins are presynaptic cell-adhesion molecules that affect the function of synapses and mediate the conduction of nerve signals, and they play an important role in normal brain development and become candidate genes for autism. The purpose of our study is to explore the association between variants of the neurexins gene family and ASD in a Chinese population through a case-control study. © 2017 International Society for Autism Research, Wiley Periodicals, Inc.
Genetic diversity of bitter taste receptor gene family in Sichuan
Indian Academy of Sciences (India)
Genetic diversity of bitter taste receptor gene family in Sichuan domestic and Tibetan chicken populations. YUAN SU DIYAN LI UMA GAUR YAN WANG NAN WU BINLONG CHEN HONGXIAN XU HUADONG YIN YAODONG HU QING ZHU. RESEARCH ARTICLE Volume 95 Issue 3 September 2016 pp 675-681 ...
X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes
Hu, H; Haas, S.A.; Chelly, J.; Esch, H. Van; Raynaud, M.; Brouwer, A.P. de; Weinert, S.; Froyen, G.; Frints, S.G.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.; Jensen, C.; Hambrock, M.; Fischer, U.; Langnick, C.; Feldkamp, M.; Wissink-Lindhout, W.; Lebrun, N.; Castelnau, L.; Rucci, J.; Montjean, R.; Dorseuil, O.; Billuart, P.; Stuhlmann, T.; Shaw, M.; Corbett, M.A.; Gardner, A.; Willis-Owen, S.; Tan, C.; Friend, K.L.; Belet, S.; Roozendaal, K.E. van; Jimenez-Pocquet, M.; Moizard, M.P.; Ronce, N.; Sun, R.; O'Keeffe, S.; Chenna, R.; Bommel, A. van; Goke, J.; Hackett, A.; Field, M.; Christie, L.; Boyle, J.; Haan, E.; Nelson, J.; Turner, G.; Baynam, G.; Gillessen-Kaesbach, G.; Muller, U.; Steinberger, D.; Budny, B.; Badura-Stronka, M.; Latos-Bielenska, A.; Ousager, L.B.; Wieacker, P.; Rodriguez Criado, G.; Bondeson, M.L.; Anneren, G.; Dufke, A.; Cohen, M.; Maldergem, L. Van; Vincent-Delorme, C.; Echenne, B.; Simon-Bouy, B.; Kleefstra, T.; Willemsen, M.H.; Fryns, J.P.; Devriendt, K.; Ullmann, R.; Vingron, M.; Wrogemann, K.; Wienker, T.F.; Tzschach, A.; Bokhoven, H. van; Gecz, J.; Jentsch, T.J.; Chen, W.; Ropers, H.H.; Kalscheuer, V.M.
2016-01-01
X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or
X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes
DEFF Research Database (Denmark)
Hu, H; Haas, S A; Chelly, J
2016-01-01
X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes...
Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.
Directory of Open Access Journals (Sweden)
Kattina Zavala
Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.
Directory of Open Access Journals (Sweden)
Carolina eRípodas
2015-01-01
Full Text Available In the past decade, plant nuclear factor Y (NF-Y genes have gained major interest due to their roles in many biological processes in plant development or adaptation to environmental conditions, particularly in the root nodule symbiosis established between legume plants and nitrogen fixing bacteria. NF-Ys are heterotrimeric transcriptional complexes composed of three subunits, NF-YA, NF-YB and NF-YC, which bind with high affinity and specificity to the CCAAT box, a cis element present in many eukaryotic promoters. In plants, NF-Y subunits consist of gene families with about ten members each. In this study, we have identified and characterized the NF-Y gene families of common bean (Phaseolus vulgaris, a grain legume of worldwide economical importance and the main source of dietary protein of developing countries. Expression analysis showed that some members of each family are up-regulated at early or late stages of the nitrogen fixing symbiotic interaction with its partner Rhizobium etli. We also showed that some genes are differentially accumulated in response to inoculation with high or less efficient R. etli strains, constituting excellent candidates to participate in the strain-specific response during symbiosis. Genes of the NF-YA family exhibit a highly structured intron-exon organization. Moreover, this family is characterized by the presence of upstream ORFs when introns in the 5' UTR are retained and miRNA target sites in their 3' UTR, suggesting that these genes might be subjected to a complex post-transcriptional regulation. Multiple protein alignments indicated the presence of highly conserved domains in each of the NF-Y families, presumably involved in subunit interactions and DNA binding. The analysis presented here constitutes a starting point to understand the regulation and biological function of individual members of the NF-Y families in different developmental processes in this grain legume.
Molecular evolution of the actin-like MreB protein gene family in wall-less bacteria.
Ku, Chuan; Lo, Wen-Sui; Kuo, Chih-Horng
2014-04-18
The mreB gene family encodes actin-like proteins that determine cell shape by directing cell wall synthesis and often exists in one to three copies in the genomes of non-spherical bacteria. Intriguingly, while most wall-less bacteria do not have this gene, five to seven mreB homologs are found in Spiroplasma and Haloplasma, which are both characterized by cell contractility. To investigate the molecular evolution of this gene family in wall-less bacteria, we sampled the available genome sequences from these two genera and other related lineages for comparative analysis. The gene phylogenies indicated that the mreB homologs in Haloplasma are more closely related to those in Firmicutes, whereas those in Spiroplasma form a separate clade. This finding suggests that the gene family expansions in these two lineages are the results of independent ancient duplications. Moreover, the Spiroplasma mreB homologs can be classified into five clades, of which the genomic positions are largely conserved. The inference of gene gains and losses suggests that there has been an overall trend to retain only one homolog from each of the five mreB clades in the evolutionary history of Spiroplasma. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Ashutosh ePandey
2016-02-01
Full Text Available The homedodomain zipper family (HD-ZIP of transcription factors is present only in plants and plays important role in the regulation of plant-specific processes. The subfamily IV of HDZ transcription factors (HD-ZIP IV has primarily been implicated in the regulation of epidermal structure development. Though this gene family is present in all lineages of land plants, members of this gene family have not been identified in banana, which is one of the major staple fruit crops. In the present work, we identified 21 HDZIV genes in banana by the computational analysis of banana genome resource. Our analysis suggested that these genes putatively encode proteins having all the characteristic domains of HDZIV transcription factors. The phylogenetic analysis of the banana HDZIV family genes further confirmed that after separation from a common ancestor, the banana and poales lineages might have followed distinct evolutionary paths. Further, we conclude that segmental duplication played a major role in the evolution of banana HDZIV genes. All the identified banana HDZIV genes expresses in different banana tissue, however at varying levels. The transcript levels of some of the banana HDZIV genes were also detected in banana fruit pulp, suggesting their putative role in fruit attributes. A large number of genes of this family showed modulated expression under drought and salinity stress. Taken together, the present work lays a foundation for elucidation of functional aspects of the banana HDZIV genes and for their possible use in the banana improvement programs.
Zhu, Dan; Bai, Xi; Luo, Xiao; Chen, Qin; Cai, Hua; Ji, Wei; Zhu, Yanming
2013-02-01
Wild soybean (Glycine soja L. G07256) exhibits a greater adaptability to soil bicarbonate stress than cultivated soybean, and recent discoveries show that TIFY family genes are involved in the response to several abiotic stresses. A genomic and transcriptomic analysis of all TIFY genes in G. soja, compared with G. max, will provide insight into the function of this gene family in plant bicarbonate stress response. This article identified and characterized 34 TIFY genes in G. soja. Sequence analyses indicated that most GsTIFY proteins had two conserved domains: TIFY and Jas. Phylogenetic analyses suggested that these GsTIFY genes could be classified into two groups. A clustering analysis of all GsTIFY transcript expression profiles from bicarbonate stress treated G. soja showed that there were five different transcript patterns in leaves and six different transcript patterns in roots when the GsTIFY family responds to bicarbonate stress. Moreover, the expression level changes of all TIFY genes in cultivated soybean, treated with bicarbonate stress, were also verified. The expression comparison analysis of TIFYs between wild and cultivated soybeans confirmed that, different from the cultivated soybean, GsTIFY (10a, 10b, 10c, 10d, 10e, 10f, 11a, and 11b) were dramatically up-regulated at the early stage of stress, while GsTIFY 1c and 2b were significantly up-regulated at the later period of stress. The frequently stress responsive and diverse expression profiles of the GsTIFY gene family suggests that this family may play important roles in plant environmental stress responses and adaptation.
[Genome-wide identification and expression analysis of the WRKY gene family in peach].
Gu, Yan-bing; Ji, Zhi-rui; Chi, Fu-mei; Qiao, Zhuang; Xu, Cheng-nan; Zhang, Jun-xiang; Zhou, Zong-shan; Dong, Qing-long
2016-03-01
The WRKY transcription factors are one of the largest families of transcriptional regulators and play diverse regulatory roles in biotic and abiotic stresses, plant growth and development processes. In this study, the WRKY DNA-binding domain (Pfam Database number: PF03106) downloaded from Pfam protein families database was exploited to identify WRKY genes from the peach (Prunus persica 'Lovell') genome using HMMER 3.0. The obtained amino acid sequences were analyzed with DNAMAN 5.0, WebLogo 3, MEGA 5.1, MapInspect and MEME bioinformatics softwares. Totally 61 peach WRKY genes were found in the peach genome. Our phylogenetic analysis revealed that peach WRKY genes were classified into three Groups: Ⅰ, Ⅱ and Ⅲ. The WRKY N-terminal and C-terminal domains of Group Ⅰ (group I-N and group I-C) were monophyletic. The Group Ⅱ was sub-divided into five distinct clades (groupⅡ-a, Ⅱ-b, Ⅱ-c, Ⅱ-d and Ⅱ-e). Our domain analysis indicated that the WRKY regions contained a highly conserved heptapeptide stretch WRKYGQK at its N-terminus followed by a zinc-finger motif. The chromosome mapping analysis showed that peach WRKY genes were distributed with different densities over 8 chromosomes. The intron-exon structure analysis revealed that structures of the WRKY gene were highly conserved in the peach. The conserved motif analysis showed that the conserved motifs 1, 2 and 3, which specify the WRKY domain, were observed in all peach WRKY proteins, motif 5 as the unknown domain was observed in group Ⅱ-d, two WRKY domains were assigned to GroupⅠ. SqRT-PCR and qRT-PCR results indicated that 16 PpWRKY genes were expressed in roots, stems, leaves, flowers and fruits at various expression levels. Our analysis thus identified the PpWRKY gene families, and future functional studies are needed to reveal its specific roles.
Genome-wide identification and expression analysis of the CIPK gene family in cassava
Directory of Open Access Journals (Sweden)
Wei eHu
2015-10-01
Full Text Available Cassava is an important food and potential biofuel crop that is tolerant to multiple abiotic stressors. The mechanisms underlying these tolerances are currently less known. CBL-interacting protein kinases (CIPKs have been shown to play crucial roles in plant developmental processes, hormone signaling transduction, and in the response to abiotic stress. However, no data is currently available about the CPK family in cassava. In this study, a total of 25 CIPK genes were identified from cassava genome based on our previous genome sequencing data. Phylogenetic analysis suggested that 25 MeCIPKs could be classified into four subfamilies, which was supported by exon-intron organizations and the architectures of conserved protein motifs. Transcriptomic analysis of a wild subspecies and two cultivated varieties showed that most MeCIPKs had different expression patterns between wild subspecies and cultivatars in different tissues or in response to drought stress. Some orthologous genes involved in CIPK interaction networks were identified between Arabidopsis and cassava. The interaction networks and co-expression patterns of these orthologous genes revealed that the crucial pathways controlled by CIPK networks may be involved in the differential response to drought stress in different accessions of cassava. Nine MeCIPK genes were selected to investigate their transcriptional response to various stimuli and the results showed the comprehensive response of the tested MeCIPK genes to osmotic, salt, cold, oxidative stressors, and ABA signaling. The identification and expression analysis of CIPK family suggested that CIPK genes are important components of development and multiple signal transduction pathways in cassava. The findings of this study will help lay a foundation for the functional characterization of the CIPK gene family and provide an improved understanding of abiotic stress responses and signaling transduction in cassava.
Progranulin Recruits HSP70 to β-Glucocerebrosidase and Is Therapeutic Against Gaucher Disease.
Jian, Jinlong; Tian, Qing-Yun; Hettinghouse, Aubryanna; Zhao, Shuai; Liu, Helen; Wei, Jianlu; Grunig, Gabriele; Zhang, Wujuan; Setchell, Kenneth D R; Sun, Ying; Overkleeft, Herman S; Chan, Gerald L; Liu, Chuan-Ju
2016-11-01
Gaucher disease (GD), the most common lysosomal storage disease, is caused by mutations in GBA1 encoding of β-glucocerebrosidase (GCase). Recently it was reported that progranulin (PGRN) insufficiency and deficiency associated with GD in human and mice, respectively. However the underlying mechanisms remain unknown. Here we report that PGRN binds directly to GCase and its deficiency results in aggregation of GCase and its receptor LIMP2. Mass spectrometry approaches identified HSP70 as a GCase/LIMP2 complex-associated protein upon stress, with PGRN as an indispensable adaptor. Additionally, 98 amino acids of C-terminal PGRN, referred to as Pcgin, are required and sufficient for the binding to GCase and HSP70. Pcgin effectively ameliorates the disease phenotype in GD patient fibroblasts and animal models. These findings not only demonstrate that PGRN is a co-chaperone of HSP70 and plays an important role in GCase lysosomal localization, but may also provide new therapeutic interventions for lysosomal storage diseases, in particular GD. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Song, Jiancheng; Jiang, Lijun; Jameson, Paula Elizabeth
2012-06-06
As the global population continues to expand, increasing yield in bread wheat is of critical importance as 20% of the world's food supply is sourced from this cereal. Several recent studies of the molecular basis of grain yield indicate that the cytokinins are a key factor in determining grain yield. In this study, cytokinin gene family members in bread wheat were isolated from four multigene families which regulate cytokinin synthesis and metabolism, the isopentenyl transferases (IPT), cytokinin oxidases (CKX), zeatin O-glucosyltransferases (ZOG), and β-glucosidases (GLU). As bread wheat is hexaploid, each gene family is also likely to be represented on the A, B and D genomes. By using a novel strategy of qRT-PCR with locus-specific primers shared among the three homoeologues of each family member, detailed expression profiles are provided of family members of these multigene families expressed during leaf, spike and seed development. The expression patterns of individual members of the IPT, CKX, ZOG, and GLU multigene families in wheat are shown to be tissue- and developmentally-specific. For instance, TaIPT2 and TaCKX1 were the most highly expressed family members during early seed development, with relative expression levels of up to 90- and 900-fold higher, respectively, than those in the lowest expressed samples. The expression of two cis-ZOG genes was sharply increased in older leaves, while an extremely high mRNA level of TaGLU1-1 was detected in young leaves. Key genes with tissue- and developmentally-specific expression have been identified which would be prime targets for genetic manipulation towards yield improvement in bread wheat breeding programmes, utilising TILLING and MAS strategies.
Chromosomal evolution of the PKD1 gene family in primates
Directory of Open Access Journals (Sweden)
Krawczak Michael
2008-09-01
Full Text Available Abstract Background The autosomal dominant polycystic kidney disease (ADPKD is mostly caused by mutations in the PKD1 (polycystic kidney disease 1 gene located in 16p13.3. Moreover, there are six pseudogenes of PKD1 that are located proximal to the master gene in 16p13.1. In contrast, no pseudogene could be detected in the mouse genome, only a single copy gene on chromosome 17. The question arises how the human situation originated phylogenetically. To address this question we applied comparative FISH-mapping of a human PKD1-containing genomic BAC clone and a PKD1-cDNA clone to chromosomes of a variety of primate species and the dog as a non-primate outgroup species. Results Comparative FISH with the PKD1-cDNA clone clearly shows that in all primate species studied distinct single signals map in subtelomeric chromosomal positions orthologous to the short arm of human chromosome 16 harbouring the master PKD1 gene. Only in human and African great apes, but not in orangutan, FISH with both BAC and cDNA clones reveals additional signal clusters located proximal of and clearly separated from the PKD1 master genes indicating the chromosomal position of PKD1 pseudogenes in 16p of these species, respectively. Indeed, this is in accordance with sequencing data in human, chimpanzee and orangutan. Apart from the master PKD1 gene, six pseudogenes are identified in both, human and chimpanzee, while only a single-copy gene is present in the whole-genome sequence of orangutan. The phylogenetic reconstruction of the PKD1-tree reveals that all human pseudogenes are closely related to the human PKD1 gene, and all chimpanzee pseudogenes are closely related to the chimpanzee PKD1 gene. However, our statistical analyses provide strong indication that gene conversion events may have occurred within the PKD1 family members of human and chimpanzee, respectively. Conclusion PKD1 must have undergone amplification very recently in hominid evolution. Duplicative
Prevention of LPS-Induced Acute Lung Injury in Mice by Progranulin
Directory of Open Access Journals (Sweden)
Zhongliang Guo
2012-01-01
Full Text Available The acute respiratory distress syndrome (ARDS, a clinical complication of severe acute lung injury (ALI in humans, is a leading cause of morbidity and mortality in critically ill patients. Despite decades of research, few therapeutic strategies for clinical ARDS have emerged. Here we carefully evaluated the effect of progranulin (PGRN in treatment of ARDS using the murine model of lipopolysaccharide (LPS-induced ALI. We reported that administration of PGRN maintained the body weight and survival of ALI mice. We revealed that administration of PGRN significantly reduced LPS-induced pulmonary inflammation, as reflected by reductions in total cell and neutrophil counts, proinflammatory cytokines, as well as chemokines in bronchoalveolar lavage (BAL fluid. Furthermore, administration of PGRN resulted in remarkable reversal of LPS-induced increases in lung permeability as assessed by reductions in total protein, albumin, and IgM in BAL fluid. Consistently, we revealed a significant reduction of histopathology changes of lung in mice received PGRN treatment. Finally, we showed that PGRN/TNFR2 interaction was crucial for the protective effect of PGRN on the LPS-induced ALI. Our findings strongly demonstrated that PGRN could effectively ameliorate the LPS-induced ALI in mice, suggesting a potential application for PGRN-based therapy to treat clinical ARDS.
Kong, Li; Zhao, Yun-Peng; Tian, Qing-Yun; Feng, Jian-Quan; Kobayashi, Tatsuya; Merregaert, Joseph; Liu, Chuan-Ju
2016-01-01
Chondrogenesis and endochondral ossification are precisely controlled by cellular interactions with surrounding matrix proteins and growth factors that mediate cellular signaling pathways. Here, we report that extracellular matrix protein 1 (ECM1) is a previously unrecognized regulator of chondrogenesis. ECM1 is induced in the course of chondrogenesis and its expression in chondrocytes strictly depends on parathyroid hormone–related peptide (PTHrP) signaling pathway. Overexpression of ECM1 suppresses, whereas suppression of ECM1 enhances, chondrocyte differentiation and hypertrophy in vitro and ex vivo. In addition, target transgene of ECM1 in chondrocytes or osteoblasts in mice leads to striking defects in cartilage development and endochondral bone formation. Of importance, ECM1 seems to be critical for PTHrP action in chondrogenesis, as blockage of ECM1 nearly abolishes PTHrP regulation of chondrocyte hypertrophy, and overexpression of ECM1 rescues disorganized growth plates of PTHrP-null mice. Furthermore, ECM1 and progranulin chondrogenic growth factor constitute an interaction network and act in concert in the regulation of chondrogenesis.—Kong, L., Zhao, Y.-P., Tian, Q.-Y., Feng, J.-Q., Kobayashi, T., Merregaert, J., Liu, C.-J. Extracellular matrix protein 1, a direct targeting molecule of parathyroid hormone–related peptide, negatively regulates chondrogenesis and endochondral ossification via associating with progranulin growth factor. PMID:27075243
Directory of Open Access Journals (Sweden)
Serbielle Céline
2012-12-01
Full Text Available Abstract Background Gene duplications have been proposed to be the main mechanism involved in genome evolution and in acquisition of new functions. Polydnaviruses (PDVs, symbiotic viruses associated with parasitoid wasps, are ideal model systems to study mechanisms of gene duplications given that PDV genomes consist of virulence genes organized into multigene families. In these systems the viral genome is integrated in a wasp chromosome as a provirus and virus particles containing circular double-stranded DNA are injected into the parasitoids’ hosts and are essential for parasitism success. The viral virulence factors, organized in gene families, are required collectively to induce host immune suppression and developmental arrest. The gene family which encodes protein tyrosine phosphatases (PTPs has undergone spectacular expansion in several PDV genomes with up to 42 genes. Results Here, we present strong indications that PTP gene family expansion occurred via classical mechanisms: by duplication of large segments of the chromosomally integrated form of the virus sequences (segmental duplication, by tandem duplications within this form and by dispersed duplications. We also propose a novel duplication mechanism specific to PDVs that involves viral circle reintegration into the wasp genome. The PTP copies produced were shown to undergo conservative evolution along with episodes of adaptive evolution. In particular recently produced copies have undergone positive selection in sites most likely involved in defining substrate selectivity. Conclusion The results provide evidence about the dynamic nature of polydnavirus proviral genomes. Classical and PDV-specific duplication mechanisms have been involved in the production of new gene copies. Selection pressures associated with antagonistic interactions with parasitized hosts have shaped these genes used to manipulate lepidopteran physiology with evidence for positive selection involved in
Directory of Open Access Journals (Sweden)
Saleha S
2016-06-01
Full Text Available Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family.
Ajmal, M; Zafar, S; Hameed, A
2016-01-01
ABSTRACT Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR) markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family. PMID:27785411
Genome-Wide Identification and Expression Analysis of WRKY Gene Family in Capsicum annuum L.
Diao, Wei-Ping; Snyder, John C; Wang, Shu-Bin; Liu, Jin-Bing; Pan, Bao-Gui; Guo, Guang-Jun; Wei, Ge
2016-01-01
The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators with members regulating multiple biological processes, especially in regulating defense against biotic and abiotic stresses. However, little information is available about WRKYs in pepper (Capsicum annuum L.). The recent release of completely assembled genome sequences of pepper allowed us to perform a genome-wide investigation for pepper WRKY proteins. In the present study, a total of 71 WRKY genes were identified in the pepper genome. According to structural features of their encoded proteins, the pepper WRKY genes (CaWRKY) were classified into three main groups, with the second group further divided into five subgroups. Genome mapping analysis revealed that CaWRKY were enriched on four chromosomes, especially on chromosome 1, and 15.5% of the family members were tandemly duplicated genes. A phylogenetic tree was constructed depending on WRKY domain' sequences derived from pepper and Arabidopsis. The expression of 21 selected CaWRKY genes in response to seven different biotic and abiotic stresses (salt, heat shock, drought, Phytophtora capsici, SA, MeJA, and ABA) was evaluated by quantitative RT-PCR; Some CaWRKYs were highly expressed and up-regulated by stress treatment. Our results will provide a platform for functional identification and molecular breeding studies of WRKY genes in pepper.
Directory of Open Access Journals (Sweden)
Tianyu Zhou
2015-01-01
Full Text Available Peroxisome proliferators-activated receptor (PPAR gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3′ UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3′ UTR are essential for PPARs evolution and diversity functions acquired.
Zhou, Tianyu; Yan, Xiping; Wang, Guosong; Liu, Hehe; Gan, Xiang; Zhang, Tao; Wang, Jiwen; Li, Liang
2015-01-01
Peroxisome proliferators-activated receptor (PPAR) gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors) domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors) are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3' UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3' UTR are essential for PPARs evolution and diversity functions acquired.
Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy
Directory of Open Access Journals (Sweden)
Muhammad I. Ullah
2017-12-01
Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.
DEFF Research Database (Denmark)
Jørgensen, H. B. H.; Sørensen, P.; Cooper, G. A.
2011-01-01
challenge) and a relatively high susceptibility (18% survival following challenge) trout family that were both split into a group exposed to virus and a non-exposed control group. In total, 939 genes were differentially expressed between infected and non-infected fish (FDR p = 0.05). Five groups of Gene...... Ontology categories were involved in immune-related processes and over-represented in infected fish: (i) stress and defense response, (ii) NFkappaB signal transduction, (iii) response to non-self, (iv) antigen processing and presentation, and (v) proteasome complexes. The first four categories were also...... over-represented among the 642 differentially expressed genes in the low-susceptibility trout family but not among the 556 differentially expressed genes in the high-susceptibility trout family. Expression profiles for most immune genes discussed showed increased transcription from day 3 post...
Phylogenetic Analysis of the MS4A and TMEM176 Gene Families
Zuccolo, Jonathan; Bau, Jeremy; Childs, Sarah J.; Goss, Greg G.; Sensen, Christoph W.; Deans, Julie P.
2010-01-01
Background The MS4A gene family in humans includes CD20 (MS4A1), FcRβ (MS4A2), Htm4 (MS4A3), and at least 13 other syntenic genes encoding membrane proteins, most having characteristic tetraspanning topology. Expression of MS4A genes is variable in tissues throughout the body; however, several are limited to cells in the hematopoietic system where they have known roles in immune cell functions. Genes in the small TMEM176 group share significant sequence similarity with MS4A genes and there is evidence of immune function of at least one of the encoded proteins. In this study, we examined the evolutionary history of the MS4A/TMEM176 families as well as tissue expression of the phylogenetically earliest members, in order to investigate their possible origins in immune cells. Principal Findings Orthologs of human MS4A genes were found only in mammals; however, MS4A gene homologs were found in most jawed vertebrates. TMEM176 genes were found only in mammals and bony fish. Several unusual MS4A genes having 2 or more tandem MS4A sequences were identified in the chicken (Gallus gallus) and early mammals (opossum, Monodelphis domestica and platypus, Ornithorhyncus anatinus). A large number of highly conserved MS4A and TMEM176 genes was found in zebrafish (Danio rerio). The most primitive organism identified to have MS4A genes was spiny dogfish (Squalus acanthus). Tissue expression of MS4A genes in S. acanthias and D. rerio showed no evidence of expression restricted to the hematopoietic system. Conclusions/Significance Our findings suggest that MS4A genes first appeared in cartilaginous fish with expression outside of the immune system, and have since diversified in many species into their modern forms with expression and function in both immune and nonimmune cells. PMID:20186339
Genome-wide analysis of Aux/IAA gene family in Solanaceae species using tomato as a model.
Wu, Jian; Peng, Zhen; Liu, Songyu; He, Yanjun; Cheng, Lin; Kong, Fuling; Wang, Jie; Lu, Gang
2012-04-01
Auxin plays key roles in a wide variety of plant activities, including embryo development, leaf formation, phototropism, fruit development and root initiation and development. Auxin/indoleacetic acid (Aux/IAA) genes, encoding short-lived nuclear proteins, are key regulators in the auxin transduction pathway. But how they work is still unknown. In order to conduct a systematic analysis of this gene family in Solanaceae species, a genome-wide search for the homologues of auxin response genes was carried out. Here, 26 and 27 non redundant AUX/IAAs were identified in tomato and potato, respectively. Using tomato as a model, a comprehensive overview of SlIAA gene family is presented, including the gene structures, phylogeny, chromosome locations, conserved motifs and cis-elements in promoter sequences. A phylogenetic tree generated from alignments of the predicted protein sequences of 31 OsIAAs, 29 AtIAAs, 31 ZmIAAs, and 26 SlIAAs revealed that these IAAs were clustered into three major groups and ten subgroups. Among them, seven subgroups were present in both monocot and dicot species, which indicated that the major functional diversification within the IAA family predated the monocot/dicot divergence. In contrast, group C and some other subgroups seemed to be species-specific. Quantitative real-time PCR (qRT-PCR) analysis showed that 19 of the 26 SlIAA genes could be detected in all tomato organs/tissues, however, seven of them were specifically expressed in some of tomato tissues. The transcript abundance of 17 SlIAA genes were increased within a few hours when the seedlings were treated with exogenous IAA. However, those of other six SlIAAs were decreased. The results of stress treatments showed that most SIIAA family genes responded to at least one of the three stress treatments, however, they exhibited diverse expression levels under different abiotic stress conditions in tomato seedlings. SlIAA20, SlIAA21 and SlIAA22 were not significantly influenced by stress