CWDPRNP: A tool for cervid prion sequence analysis in program R

Science.gov (United States)

Miller, William L.; Walter, W. David

2017-01-01

Chronic wasting disease is a fatal, neurological disease caused by an infectious prion protein, which affects economically and ecologically important members of the family Cervidae. Single nucleotide polymorphisms within the prion protein gene have been linked to differential susceptibility to the disease in many species. Wildlife managers are seeking to determine the frequencies of disease-associated alleles and genotypes and delineate spatial genetic patterns. The CWDPRNP package, implemented in program R, provides a unified framework for analyzing prion protein gene variability and spatial structure.

H-type bovine spongiform encephalopathy associated with E211K prion protein polymorphism: clinical and pathologic features in wild-type and E211K cattle following intracranial inoculation

Science.gov (United States)

In 2006 an H-type bovine spongiform encephalopathy (BSE) case was reported in an animal with an unusual polymorphism (E211K) in the prion protein gene. Although the prevalence of this polymorphism is low, cattle carrying the K211 allele are predisposed to rapid onset of H-type BSE when exposed. The ...

Sod1 deficiency reduces incubation time in mouse models of prion disease.

Directory of Open Access Journals (Sweden)

Shaheen Akhtar

Full Text Available Prion infections, causing neurodegenerative conditions such as Creutzfeldt-Jakob disease and kuru in humans, scrapie in sheep and BSE in cattle are characterised by prolonged and variable incubation periods that are faithfully reproduced in mouse models. Incubation time is partly determined by genetic factors including polymorphisms in the prion protein gene. Quantitative trait loci studies in mice and human genome-wide association studies have confirmed that multiple genes are involved. Candidate gene approaches have also been used and identified App, Il1-r1 and Sod1 as affecting incubation times. In this study we looked for an association between App, Il1-r1 and Sod1 representative SNPs and prion disease incubation time in the Northport heterogeneous stock of mice inoculated with the Chandler/RML prion strain. No association was seen with App, however, significant associations were seen with Il1-r1 (P = 0.02 and Sod1 (P<0.0001 suggesting that polymorphisms at these loci contribute to the natural variation observed in incubation time. Furthermore, following challenge with Chandler/RML, ME7 and MRC2 prion strains, Sod1 deficient mice showed highly significant reductions in incubation time of 20, 13 and 24%, respectively. No differences were detected in Sod1 expression or activity. Our data confirm the protective role of endogenous Sod1 in prion disease.

Prion protein gene analysis in three kindreds with fatal familial insomnia (FFI): Codon 178 mutation and codon 129 polymorphism

Energy Technology Data Exchange (ETDEWEB)

Medori, R.; Tritschler, H.J. (Universita di Bologna (Italy))

1993-10-01

Fatal familial insomnia (FFI) is a disease linked to a GAC(Asp) [yields] AAC(Asn) mutation in codon 178 of the prion protein (PrP) gene. FFI is characterized clinically by untreatable progressive insomnia, dysautonomia, and motor dysfunctions and is characterized pathologically by selective thalamic atrophy. The authors confirmed the 178[sup Asn] mutation in the PrP gene of a third FFI family of French ancestry. Three family members who are under 40 years of age and who inherited the mutation showed only reduced perfusion in the basal ganglia on single photon emission computerized tomography. Some FFI features differ from the clinical and neuropathologic findings associated with 178[sup Asn] reported elsewhere. However, additional intragenic mutations accounting for the phenotypic differences were not observed in two affected individuals. In other sporadic and familial forms of Creutzfeldt-Jakob disease and Gerstmann-Straeussler syndrome, Met or Val homozygosity at polymorphic codon 129 is associated with a more severe phenotype, younger age at onset, and faster progression. In FFI, young and old individuals at disease onset had 129[sup Met/Val]. Moreover, of five 178[sup Asn] individuals who are above age-at-onset range and who are well, two have 129[sup Met] and three have 129[sup Met/Val], suggesting that polymorphic site 129 does not modulate FFI phenotypic expression. Genetic heterogeneity and environment may play an important role in inter- and intrafamilial variability of the 178[sup Asn] mutation. 32 refs., 5 figs., 1 tab.

Quantitating PrP Polymorphisms Present in Prions from Heterozygous Scrapie-Infected Sheep.

Science.gov (United States)

Silva, Christopher J; Erickson-Beltran, Melissa L; Hui, Colleen; Badiola, Juan José; Nicholson, Eric M; Requena, Jesús R; Bolea, Rosa

2017-01-03

Scrapie is a prion (PrP Sc ) disease of sheep. The incubation period of sheep scrapie is strongly influenced by polymorphisms at positions 136, 154, and 171 of a sheep's normal cellular prion protein (PrP C ). Chymotrypsin was used to digest sheep recombinant PrP to identify a set of characteristic peptides [M 132 LGSXMSRPL 141 (X = A or V), Y 153 XENMY 158 (X,= H or R), and Y 166 RPVDXY 172 (X = H, K, Q, or R)] that could be used to detect and quantitate polymorphisms at positions 136, 154, and 171 of sheep PrP C or PrP Sc . These peptides were used to develop a multiple reaction monitoring method (MRM) to detect the amounts of a particular polymorphism in a sample of PrP Sc isolated from sheep heterozygous for their PrP C proteins. The limit of detection for these peptides was less than 50 attomole. Spinal cord tissue from heterozygous (ARQ/VRQ or ARH/ARQ) scrapie-infected Rasa Aragonesa sheep was analyzed using this MRM method. Both sets of heterozygotes show the presence of both polymorphisms in PrP Sc . This was true for samples containing both proteinase K (PK)-sensitive and PK-resistant PrP Sc and samples containing only the PK-resistant PrP Sc . These results show that heterozygous animals contain PrP Sc that is composed of significant amounts of both PrP polymorphisms.

Molecular Pathology of Human Prion Diseases

Directory of Open Access Journals (Sweden)

2009-03-01

Full Text Available Prion diseases are fatal neurodegenerative conditions in humans and animals. In this review, we summarize the molecular background of phenotypic variability, relation of prion protein (PrP to other proteins associated with neurodegenerative diseases, and pathogenesis of neuronal vulnerability. PrP exists in different forms that may be present in both diseased and non-diseased brain, however, abundant disease-associated PrP together with tissue pathology characterizes prion diseases and associates with transmissibility. Prion diseases have different etiological background with distinct pathogenesis and phenotype. Mutations of the prion protein gene are associated with genetic forms. The codon 129 polymorphism in combination with the Western blot pattern of PrP after proteinase K digestion serves as a basis for molecular subtyping of sporadic Creutzfeldt-Jakob disease. Tissue damage may result from several parallel, interacting or subsequent pathways that involve cellular systems associated with synapses, protein processing, oxidative stress, autophagy, and apoptosis.

Prion Protein Gene Polymorphisms in Turkish Native Goat Breeds ...

Indian Academy of Sciences (India)

Navya

In these diseases, a neuronal glycoprotein known as prion protein PrPC ... sheep or goats in Turkey, but the OIE (World Organisation for Animal Health) does not .... Turkish goat breeds was approximately 6.3%, which is a low starting point for ...

Do prion protein gene polymorphisms induce apoptosis in non ...

Indian Academy of Sciences (India)

2016-01-15

Jan 15, 2016 ... by polymerase chain reaction (PCR) using the following forward and reverse .... A P-value less than 0.05 were deemed to indicate ..... drome in PrP is required to generate a productive PrPSc-PrPC complex that leads to prion ...

Biochemical features of genetic Creutzfeldt-Jakob disease with valine-to-isoleucine substitution at codon 180 on the prion protein gene.

Science.gov (United States)

Ito, Yoko; Sanjo, Nobuo; Hizume, Masaki; Kobayashi, Atsushi; Ohgami, Tetsuya; Satoh, Katsuya; Hamaguchi, Tsuyoshi; Yamada, Masahito; Kitamoto, Tetsuyuki; Mizusawa, Hidehiro; Yokota, Takanori

2018-02-19

Valine-to-isoleucine substitution at codon 180 of the prion protein gene is only observed in patients with Creutzfeldt-Jakob disease and accounts for approximately half of all cases of genetic prion disease in Japan. In the present study, we investigated the biochemical characteristics of valine-to-isoleucine substitution at codon 180 in the prion protein gene, using samples obtained from the autopsied brains of seven patients with genetic Creutzfeldt-Jakob disease exhibiting this mutation (diagnoses confirmed via neuropathological examination). Among these patients, we observed an absence of diglycosylated and monoglycosylated forms of PrP res at codon 181. Our findings further indicated that the abnormal prion proteins were composed of at least three components, although smaller carboxyl-terminal fragments were predominant. Western blot analyses revealed large amounts of PrP res in the cerebral neocortices, where neuropathological examination revealed marked spongiosis. Relatively smaller amounts of PrP res were detected in the hippocampus, where milder spongiosis was observed, than in the cerebral neocortex. These findings indicate that abnormal prion proteins in the neocortex are associated with severe toxicity, resulting in severe spongiosis. Our findings further indicate that the valine-to-isoleucine substitution is not a polymorphism, but rather an authentic pathogenic mutation associated with specific biochemical characteristics that differ from those observed in sporadic Creutzfeldt-Jakob disease. Copyright © 2018 Elsevier Inc. All rights reserved.

Yeast prions: structure, biology, and prion-handling systems.

Science.gov (United States)

Wickner, Reed B; Shewmaker, Frank P; Bateman, David A; Edskes, Herman K; Gorkovskiy, Anton; Dayani, Yaron; Bezsonov, Evgeny E

2015-03-01

A prion is an infectious protein horizontally transmitting a disease or trait without a required nucleic acid. Yeast and fungal prions are nonchromosomal genes composed of protein, generally an altered form of a protein that catalyzes the same alteration of the protein. Yeast prions are thus transmitted both vertically (as genes composed of protein) and horizontally (as infectious proteins, or prions). Formation of amyloids (linear ordered β-sheet-rich protein aggregates with β-strands perpendicular to the long axis of the filament) underlies most yeast and fungal prions, and a single prion protein can have any of several distinct self-propagating amyloid forms with different biological properties (prion variants). Here we review the mechanism of faithful templating of protein conformation, the biological roles of these prions, and their interactions with cellular chaperones, the Btn2 and Cur1 aggregate-handling systems, and other cellular factors governing prion generation and propagation. Human amyloidoses include the PrP-based prion conditions and many other, more common amyloid-based diseases, several of which show prion-like features. Yeast prions increasingly are serving as models for the understanding and treatment of many mammalian amyloidoses. Patients with different clinical pictures of the same amyloidosis may be the equivalent of yeasts with different prion variants. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Soluble polymorphic bank vole prion proteins induced by co-expression of quiescin sulfhydryl oxidase in E. coli and their aggregation behaviors.

Science.gov (United States)

Abskharon, Romany; Dang, Johnny; Elfarash, Ameer; Wang, Zerui; Shen, Pingping; Zou, Lewis S; Hassan, Sedky; Wang, Fei; Fujioka, Hisashi; Steyaert, Jan; Mulaj, Mentor; Surewicz, Witold K; Castilla, Joaquín; Wohlkonig, Alexandre; Zou, Wen-Quan

2017-10-04

The infectious prion protein (PrP Sc or prion) is derived from its cellular form (PrP C ) through a conformational transition in animal and human prion diseases. Studies have shown that the interspecies conversion of PrP C to PrP Sc is largely swayed by species barriers, which is mainly deciphered by the sequence and conformation of the proteins among species. However, the bank vole PrP C (BVPrP) is highly susceptible to PrP Sc from different species. Transgenic mice expressing BVPrP with the polymorphic isoleucine (109I) but methionine (109M) at residue 109 spontaneously develop prion disease. To explore the mechanism underlying the unique susceptibility and convertibility, we generated soluble BVPrP by co-expression of BVPrP with Quiescin sulfhydryl oxidase (QSOX) in Escherichia coli. Interestingly, rBVPrP-109M and rBVPrP-109I exhibited distinct seeded aggregation pathways and aggregate morphologies upon seeding of mouse recombinant PrP fibrils, as monitored by thioflavin T fluorescence and electron microscopy. Moreover, they displayed different aggregation behaviors induced by seeding of hamster and mouse prion strains under real-time quaking-induced conversion. Our results suggest that QSOX facilitates the formation of soluble prion protein and provide further evidence that the polymorphism at residue 109 of QSOX-induced BVPrP may be a determinant in mediating its distinct convertibility and susceptibility.

Diagnostic and prognostic value of human prion detection in cerebrospinal fluid.

Science.gov (United States)

Foutz, Aaron; Appleby, Brian S; Hamlin, Clive; Liu, Xiaoqin; Yang, Sheng; Cohen, Yvonne; Chen, Wei; Blevins, Janis; Fausett, Cameron; Wang, Han; Gambetti, Pierluigi; Zhang, Shulin; Hughson, Andrew; Tatsuoka, Curtis; Schonberger, Lawrence B; Cohen, Mark L; Caughey, Byron; Safar, Jiri G

2017-01-01

Several prion amplification systems have been proposed for detection of prions in cerebrospinal fluid (CSF), most recently, the measurements of prion seeding activity with second-generation real-time quaking-induced conversion (RT-QuIC). The objective of this study was to investigate the diagnostic performance of the RT-QuIC prion test in the broad phenotypic spectrum of prion diseases. We performed CSF RT-QuIC testing in 2,141 patients who had rapidly progressive neurological disorders, determined diagnostic sensitivity and specificity in 272 cases that were autopsied, and evaluated the impact of mutations and polymorphisms in the PRNP gene, and type 1 or type 2 human prions on diagnostic performance. The 98.5% diagnostic specificity and 92% sensitivity of CSF RT-QuIC in a blinded retrospective analysis matched the 100% specificity and 95% sensitivity of a blind prospective study. The CSF RT-QuIC differentiated 94% of cases of sporadic Creutzfeldt-Jakob disease (sCJD) MM1 from the sCJD MM2 phenotype, and 80% of sCJD VV2 from sCJD VV1. The mixed prion type 1-2 and cases heterozygous for codon 129 generated intermediate CSF RT-QuIC patterns, whereas genetic prion diseases revealed distinct profiles for each PRNP gene mutation. The diagnostic performance of the improved CSF RT-QuIC is superior to surrogate marker tests for prion diseases such as 14-3-3 and tau proteins, and together with PRNP gene sequencing the test allows the major prion subtypes to be differentiated in vivo. This differentiation facilitates prediction of the clinicopathological phenotype and duration of the disease-two important considerations for envisioned therapeutic interventions. ANN NEUROL 2017;81:79-92. © 2016 American Neurological Association.

Low frequency of the scrapile resistance-associated allele and presence of lysine-171 allele of the prion protein gene in Italian Biellese ovine breed

NARCIS (Netherlands)

Acutis, P.L.; Sbaiz, L.; Verburg, F.J.; Riina, M.V.; Ru, G.; Moda, G.; Caramelli, M.; Bossers, A.

2004-01-01

Frequencies of polymorphisms at codons 136, 154 and 171 of the prion protein (PrP) gene were studied in 1207 pure-bred and cross-bred Italian Biellese rams, a small ovine breed of about 65 000 head in Italy. Aside from the five most common alleles (VRQ, ARQ, ARR, AHQ and ARH), the rare ARK allele

Molecular dynamics study of the dominant-negative E219K polymorphism in human prion protein

NARCIS (Netherlands)

Jahandideh, Samad; Jamalan, Mostafa; Faridounnia, Maryam|info:eu-repo/dai/nl/338666923

2015-01-01

Human prion diseases are associated with misfolding or aggregation of the Human Prion Protein (HuPrP). Missense mutations in the HuPrP gene, contribute to conversion of HuPrP(C) to HuPrP(Sc) and amyloid formation. Based on our previous comprehensive study, three missense mutations, from two

Prion Strain Characterization of a Novel Subtype of Creutzfeldt-Jakob Disease.

Science.gov (United States)

Galeno, Roberta; Di Bari, Michele Angelo; Nonno, Romolo; Cardone, Franco; Sbriccoli, Marco; Graziano, Silvia; Ingrosso, Loredana; Fiorini, Michele; Valanzano, Angelina; Pasini, Giulia; Poleggi, Anna; Vinci, Ramona; Ladogana, Anna; Puopolo, Maria; Monaco, Salvatore; Agrimi, Umberto; Zanusso, Gianluigi; Pocchiari, Maurizio

2017-06-01

In 2007, we reported a patient with an atypical form of Creutzfeldt-Jakob disease (CJD) heterozygous for methionine-valine (MV) at codon 129 who showed a novel pathological prion protein (PrP TSE ) conformation with an atypical glycoform (AG) profile and intraneuronal PrP deposition. In the present study, we further characterize the conformational properties of this pathological prion protein (PrP TSE MV AG ), showing that PrP TSE MV AG is composed of multiple conformers with biochemical properties distinct from those of PrP TSE type 1 and type 2 of MV sporadic CJD (sCJD). Experimental transmission of CJD-MV AG to bank voles and gene-targeted transgenic mice carrying the human prion protein gene (TgHu mice) showed unique transmission rates, survival times, neuropathological changes, PrP TSE deposition patterns, and PrP TSE glycotypes that are distinct from those of sCJD-MV1 and sCJD-MV2. These biochemical and experimental data suggest the presence of a novel prion strain in CJD-MV AG IMPORTANCE Sporadic Creutzfeldt-Jakob disease is caused by the misfolding of the cellular prion protein, which assumes two different major conformations (type 1 and type 2) and, together with the methionine/valine polymorphic codon 129 of the prion protein gene, contribute to the occurrence of distinct clinical-pathological phenotypes. Inoculation in laboratory rodents of brain tissues from the six possible combinations of pathological prion protein types with codon 129 genotypes results in the identification of 3 or 4 strains of prions. We report on the identification of a novel strain of Creutzfeldt-Jakob disease isolated from a patient who carried an abnormally glycosylated pathological prion protein. This novel strain has unique biochemical characteristics, does not transmit to humanized transgenic mice, and shows exclusive transmission properties in bank voles. The identification of a novel human prion strain improves our understanding of the pathogenesis of the disease and of

[Identification of new genes that affect [PSI^(+)] prion toxicity in Saccharomyces cerevisiae yeast].

Science.gov (United States)

Matveenko, A G; Belousov, M V; Bondarev, S A; Moskalenko, S E; Zhouravleva, G A

2016-01-01

Translation termination is an important step in gene expression. Its correct processing is governed by eRF1 (Sup45) and eRF3 (Sup35) proteins. In Saccharomyces cerevisiae, mutations in the corresponding genes, as well as Sup35 aggregation in [PSI^(+)] cells that propagate the prion form of Sup35 lead to inaccurate stop codon recognition and, consequently, nonsense suppression. The presence of stronger prion variants results in the more efficient suppression of nonsense mutations. Previously, we proposed a synthetic lethality test that enables the identification of genes that may influence either translation termination factors or [PSI^(+)] manifestation. This is based on the fact that the combination of sup45 mutations with the strong [PSI^(+)] prion variant in diploids is lethal. In this work, a set of genes that were previously shown to enhance nonsense suppression was analyzed. It was found that ABF1, FKH2, and REB1 overexpression decreased the growth of strains in a prion-dependent manner and, thus, might influence [PSI^(+)] prion toxicity. It was also shown that the synthetic lethality of [PSI^(+)] and sup45 mutations increased with the overexpression of GLN3 and MOT3 that encode Q/N-rich transcription factors. An analysis of the effects of their expression on the transcription of the release factors genes revealed an increase in SUP35 transcription in both cases. Since SUP35 overexpression is known to be toxic in [PSI^(+)] strains, these genes apparently enhance [PSI^(+)] toxicity via the regulation of SUP35 transcription.

Chronic wasting disease prions are not transmissible to transgenic mice overexpressing human prion protein.

Science.gov (United States)

Sandberg, Malin K; Al-Doujaily, Huda; Sigurdson, Christina J; Glatzel, Markus; O'Malley, Catherine; Powell, Caroline; Asante, Emmanuel A; Linehan, Jacqueline M; Brandner, Sebastian; Wadsworth, Jonathan D F; Collinge, John

2010-10-01

Chronic wasting disease (CWD) is a prion disease that affects free-ranging and captive cervids, including mule deer, white-tailed deer, Rocky Mountain elk and moose. CWD-infected cervids have been reported in 14 USA states, two Canadian provinces and in South Korea. The possibility of a zoonotic transmission of CWD prions via diet is of particular concern in North America where hunting of cervids is a popular sport. To investigate the potential public health risks posed by CWD prions, we have investigated whether intracerebral inoculation of brain and spinal cord from CWD-infected mule deer transmits prion infection to transgenic mice overexpressing human prion protein with methionine or valine at polymorphic residue 129. These transgenic mice have been utilized in extensive transmission studies of human and animal prion disease and are susceptible to BSE and vCJD prions, allowing comparison with CWD. Here, we show that these mice proved entirely resistant to infection with mule deer CWD prions arguing that the transmission barrier associated with this prion strain/host combination is greater than that observed with classical BSE prions. However, it is possible that CWD may be caused by multiple prion strains. Further studies will be required to evaluate the transmission properties of distinct cervid prion strains as they are characterized.

The expanded octarepeat domain selectively binds prions and disrupts homomeric prion protein interactions

NARCIS (Netherlands)

Leliveld, S. R.; Dame, R.T.; Wuite, G.J.L.; Stitz, L.; Korth, C.

2006-01-01

Insertion of additional octarepeats into the prion protein gene has been genetically linked to familial Creutzfeldt Jakob disease and hence to de novo generation of infectious prions. The pivotal event during prion formation is the conversion of the normal prion protein (PrP

The Prion Protein Preference of Sporadic Creutzfeldt-Jakob Disease Subtypes*

Science.gov (United States)

Klemm, Helen M. J.; Welton, Jeremy M.; Masters, Colin L.; Klug, Genevieve M.; Boyd, Alison; Hill, Andrew F.; Collins, Steven J.; Lawson, Victoria A.

2012-01-01

Sporadic Creutzfeldt-Jakob disease (CJD) is the most prevalent manifestation of the transmissible spongiform encephalopathies or prion diseases affecting humans. The disease encompasses a spectrum of clinical phenotypes that have been correlated with molecular subtypes that are characterized by the molecular mass of the protease-resistant fragment of the disease-related conformation of the prion protein and a polymorphism at codon 129 of the gene encoding the prion protein. A cell-free assay of prion protein misfolding was used to investigate the ability of these sporadic CJD molecular subtypes to propagate using brain-derived sources of the cellular prion protein (PrPC). This study confirmed the presence of three distinct sporadic CJD molecular subtypes with PrPC substrate requirements that reflected their codon 129 associations in vivo. However, the ability of a sporadic CJD molecular subtype to use a specific PrPC substrate was not determined solely by codon 129 as the efficiency of prion propagation was also influenced by the composition of the brain tissue from which the PrPC substrate was sourced, thus indicating that nuances in PrPC or additional factors may determine sporadic CJD subtype. The results of this study will aid in the design of diagnostic assays that can detect prion disease across the diversity of sporadic CJD subtypes. PMID:22930754

Ovine leukocyte profiles do not associate with variation in the prion gene, but are breed-dependent

Science.gov (United States)

Prion genotype in sheep confer resistance to scrapie. In cattle, lymphocyte profile has been found to be associated with prion genotype. Therefore, the aim of this study was to determine if variations in the sheep prion gene were associated with leukocyte populations as measured by complete blood ce...

Quantifying the relative amounts of PrP polymorphisms present in prions isolated from heterozygous prion-infected animals

Science.gov (United States)

Prions cause protein misfolding diseases, such as transmissible spongiform encephalopathy. They propagate infections by converting a normal cellular prion protein into a prion (PrPSc). PrPC and PrPSc are isosequential and differ only in their respective conformations. PrPC is monomeric and sensit...

Determining the relative susceptibility of four prion protein genotypes to atypical scrapie

Science.gov (United States)

Atypical scrapie is a sheep prion (PrPSc) disease whose epidemiology is consistent with a sporadic origin and is associated with specific polymorphisms of the normal cellular prion protein (PrPC). We describe a mass spectrometry-based method of detecting and quantifying the polymorphisms of sheep P...

Survival time and stability properties of disease-associated prion protein in chronic wasting disease of elk

Science.gov (United States)

Background: The Rocky Mountain elk (Cervus elaphus nelsoni) prion protein gene exhibits amino acid polymorphism at codon 132, with 132L (leucine) and 132M (methionine) allelic variants present in the population. We have previously shown that following experimental oral challenge with chronic wasting...

Do prion protein gene polymorphisms induce apoptosis in non

Indian Academy of Sciences (India)

To elucidate the relationship between the SNPs and apoptosis, TUNEL assays and active caspase-3 immunodetection techniques in brain sections of the polymorphic samples were performed. The results revealed that TUNEL-positive cells and active caspase-3-positive cells in the turtles with four polymorphisms were ...

A naturally occurring variant of the human prion protein completely prevents prion disease.

Science.gov (United States)

Asante, Emmanuel A; Smidak, Michelle; Grimshaw, Andrew; Houghton, Richard; Tomlinson, Andrew; Jeelani, Asif; Jakubcova, Tatiana; Hamdan, Shyma; Richard-Londt, Angela; Linehan, Jacqueline M; Brandner, Sebastian; Alpers, Michael; Whitfield, Jerome; Mead, Simon; Wadsworth, Jonathan D F; Collinge, John

2015-06-25

Mammalian prions, transmissible agents causing lethal neurodegenerative diseases, are composed of assemblies of misfolded cellular prion protein (PrP). A novel PrP variant, G127V, was under positive evolutionary selection during the epidemic of kuru--an acquired prion disease epidemic of the Fore population in Papua New Guinea--and appeared to provide strong protection against disease in the heterozygous state. Here we have investigated the protective role of this variant and its interaction with the common, worldwide M129V PrP polymorphism. V127 was seen exclusively on a M129 PRNP allele. We demonstrate that transgenic mice expressing both variant and wild-type human PrP are completely resistant to both kuru and classical Creutzfeldt-Jakob disease (CJD) prions (which are closely similar) but can be infected with variant CJD prions, a human prion strain resulting from exposure to bovine spongiform encephalopathy prions to which the Fore were not exposed. Notably, mice expressing only PrP V127 were completely resistant to all prion strains, demonstrating a different molecular mechanism to M129V, which provides its relative protection against classical CJD and kuru in the heterozygous state. Indeed, this single amino acid substitution (G→V) at a residue invariant in vertebrate evolution is as protective as deletion of the protein. Further study in transgenic mice expressing different ratios of variant and wild-type PrP indicates that not only is PrP V127 completely refractory to prion conversion but acts as a potent dose-dependent inhibitor of wild-type prion propagation.

Polymorphisms in the Prion Protein Gene of cattle breeds from Brazil

Directory of Open Access Journals (Sweden)

Cristiane C. Sanches

Full Text Available ABSTRACT: One of the alterations that occur in the PRNP gene in bovines is the insertion/deletion (indel of base sequences in specific regions, such as indels of 12-base pairs (bp in intron 1 and of 23- bp in the promoter region. The deletion allele of 23 bp is associated with susceptibility to bovine spongiform encephalopathy (BSE as well as the presence of the deletion allele of 12 bp. In the present study, the variability of nucleotides in the promoter region and intron 1 of the PRNP gene was genotyped for the Angus, Canchim, Nellore and Simmental bovine breeds to identify the genotype profiles of resistance and/or susceptibility to BSE in each animal. Genomic DNA was extracted for amplification of the target regions of the PRNP gene using polymerase chain reaction (PCR and specific primers. The PCR products were submitted to electrophoresis in agarose gel 3% and sequencing for genotyping. With the exception of the Angus breed, most breeds exhibited a higher frequency of deletion alleles for 12 bp and 23 bp in comparison to their respective insertion alleles for both regions. These results represent an important contribution to understanding the formation process of the Brazilian herd in relation to bovine PRNP gene polymorphisms.

MM2-Thalamic Creutzfeldt-Jacob Disease: Neuropathological, Biochemical and Transmission Studies Identify a Distinctive Prion Strain

NARCIS (Netherlands)

Moda, F.; Suardi, S.; Fede, Di G.; Indaco, A.; Limido, L.; Vimercati, C.; Ruggerone, M.; Campagnani, I.; Langeveld, J.P.M.; Terruzzi, A.; Brambilla, A.; Zerbi, P.; Fociani, P.; Bishop, T.; Will, G.W.; Manson, J.C.; Giaccone, G.; Tagliavini, F.

2012-01-01

In CreutzfeldtJakob disease (CJD), molecular typing based on the size of the protease resistant core of the disease-associated prion protein (PrPSc) and the M/V polymorphism at codon 129 of the PRNP gene correlates with the clinico-pathologic subtypes. Approximately 95% of the sporadic 129MM CJD

Panencephalopathic Creutzfeldt-Jakob disease with distinct pattern of prion protein deposition in a patient with D178N mutation and homozygosity for valine at codon 129 of the prion protein Gene.

Science.gov (United States)

Marcon, Gabriella; Indaco, Antonio; Di Fede, Giuseppe; Suardi, Silvia; Finato, Nicoletta; Moretti, Valentino; Micoli, Sandro; Fociani, Paolo; Zerbi, Pietro; Pincherle, Alessandro; Redaelli, Veronica; Tagliavini, Fabrizio; Giaccone, Giorgio

2014-03-01

Prion diseases include sporadic, acquired and genetic forms linked to mutations of the prion protein (PrP) gene (PRNP). In subjects carrying the D178N PRNP mutation, distinct phenotypes can be observed, depending on the methionine/valine codon 129 polymorphism. We present here a 53-year-old woman with D178N mutation in the PRNP gene and homozygosity for valine at codon 129. The disease started at age 47 with memory deficits, progressive cognitive impairment and ataxia. The clinical picture slowly worsened to a state of akinetic mutism in about 2 years and the disease course was 6 years. The neuropathologic examination demonstrated severe diffuse cerebral atrophy with neuronal loss, spongiosis and marked myelin loss and tissue rarefaction in the hemispheric white matter, configuring panencephalopathic Creutzfeldt-Jakob disease. PrP deposition was present in the cerebral cortex, basal ganglia and cerebellum with diffuse synaptic-type pattern of immunoreactivity and clusters of countless, small PrP deposits, particularly evident in the lower cortical layers, in the striatum and in the molecular layer of the cerebellum. Western blot analysis showed the presence of type 1 PrP(Sc) (Parchi classification). These findings underline the clear-cut distinction between the neuropathological features of Creutzfeldt-Jakob disease associated with D178N PRNP mutation and those of fatal familial insomnia. © 2013 International Society of Neuropathology.

Characterization of Variant Creutzfeldt-Jakob Disease Prions in Prion Protein-humanized Mice Carrying Distinct Codon 129 Genotypes*

Science.gov (United States)

Takeuchi, Atsuko; Kobayashi, Atsushi; Ironside, James W.; Mohri, Shirou; Kitamoto, Tetsuyuki

2013-01-01

To date, all clinical variant Creutzfeldt-Jakob disease (vCJD) patients are homozygous for methionine at polymorphic codon 129 (129M/M) of the prion protein (PrP) gene. However, the appearance of asymptomatic secondary vCJD infection in individuals with a PRNP codon 129 genotype other than M/M and transmission studies using animal models have raised the concern that all humans might be susceptible to vCJD prions, especially via secondary infection. To reevaluate this possibility and to analyze in detail the transmission properties of vCJD prions to transgenic animals carrying distinct codon 129 genotype, we performed intracerebral inoculation of vCJD prions to humanized knock-in mice carrying all possible codon 129 genotypes (129M/M, 129M/V, or 129V/V). All humanized knock-in mouse lines were susceptible to vCJD infection, although the attack rate gradually decreased from 129M/M to 129M/V and to 129V/V. The amount of PrP deposition including florid/amyloid plaques in the brain also gradually decreased from 129M/M to 129M/V and to 129V/V. The biochemical properties of protease-resistant abnormal PrP in the brain and transmissibility of these humanized mouse-passaged vCJD prions upon subpassage into knock-in mice expressing bovine PrP were not affected by the codon 129 genotype. These results indicate that individuals with the 129V/V genotype may be more susceptible to secondary vCJD infection than expected and may lack the neuropathological characteristics observed in vCJD patients with the 129M/M genotype. Besides the molecular typing of protease-resistant PrP in the brain, transmission studies using knock-in mice carrying bovine PrP may aid the differential diagnosis of secondary vCJD infection, especially in individuals with the 129V/V genotype. PMID:23792955

Characterization of variant Creutzfeldt-Jakob disease prions in prion protein-humanized mice carrying distinct codon 129 genotypes.

Science.gov (United States)

Takeuchi, Atsuko; Kobayashi, Atsushi; Ironside, James W; Mohri, Shirou; Kitamoto, Tetsuyuki

2013-07-26

To date, all clinical variant Creutzfeldt-Jakob disease (vCJD) patients are homozygous for methionine at polymorphic codon 129 (129M/M) of the prion protein (PrP) gene. However, the appearance of asymptomatic secondary vCJD infection in individuals with a PRNP codon 129 genotype other than M/M and transmission studies using animal models have raised the concern that all humans might be susceptible to vCJD prions, especially via secondary infection. To reevaluate this possibility and to analyze in detail the transmission properties of vCJD prions to transgenic animals carrying distinct codon 129 genotype, we performed intracerebral inoculation of vCJD prions to humanized knock-in mice carrying all possible codon 129 genotypes (129M/M, 129M/V, or 129V/V). All humanized knock-in mouse lines were susceptible to vCJD infection, although the attack rate gradually decreased from 129M/M to 129M/V and to 129V/V. The amount of PrP deposition including florid/amyloid plaques in the brain also gradually decreased from 129M/M to 129M/V and to 129V/V. The biochemical properties of protease-resistant abnormal PrP in the brain and transmissibility of these humanized mouse-passaged vCJD prions upon subpassage into knock-in mice expressing bovine PrP were not affected by the codon 129 genotype. These results indicate that individuals with the 129V/V genotype may be more susceptible to secondary vCJD infection than expected and may lack the neuropathological characteristics observed in vCJD patients with the 129M/M genotype. Besides the molecular typing of protease-resistant PrP in the brain, transmission studies using knock-in mice carrying bovine PrP may aid the differential diagnosis of secondary vCJD infection, especially in individuals with the 129V/V genotype.

Distinct prion-like strains of amyloid beta implicated in phenotypic diversity of Alzheimer's disease.

Science.gov (United States)

Cohen, Mark; Appleby, Brian; Safar, Jiri G

2016-01-01

Vast evidence on human prions demonstrates that variable disease phenotypes, rates of propagation, and targeting of distinct brain structures are determined by unique conformers (strains) of pathogenic prion protein (PrP(Sc)). Recent progress in the development of advanced biophysical tools that inventory structural characteristics of amyloid beta (Aβ) in the brain cortex of phenotypically diverse Alzheimer's disease (AD) patients, revealed unique spectrum of oligomeric particles in the cortex of rapidly progressive cases, implicating these structures in variable rates of propagation in the brain, and in distict disease manifestation. Since only ∼30% of phenotypic diversity of AD can be explained by polymorphisms in risk genes, these and transgenic bioassay data argue that structurally distinct Aβ particles play a major role in the diverse pathogenesis of AD, and may behave as distinct prion-like strains encoding diverse phenotypes. From these observations and our growing understanding of prions, there is a critical need for new strain-specific diagnostic strategies for misfolded proteins causing these elusive disorders. Since targeted drug therapy can induce mutation and evolution of prions into new strains, effective treatments of AD will require drugs that enhance clearance of pathogenic conformers, reduce the precursor protein, or inhibit the conversion of precursors into prion-like states.

Prion disease. The characteristics and diagnostic points in Japan

International Nuclear Information System (INIS)

Sanjo, Nobuo; Mizusawa, Hidehiro

2010-01-01

Prion disease develops when normal prion proteins change into transmissible abnormal prion proteins and the converted proteins accumulate in the brain. The Japanese Creutzfeldt-Jakob Disease (CJD) Surveillance Committee has identified 1,320 patients with prion diseases in the 10 years since 1999 (classified into 3 types: sporadic, 77.2%; hereditary, 16.7%; and environmentally acquired, 6.1%). Compared with patients in other countries, a relatively larger number of Japanese patients characteristically have dura mater graft-associated CJD and hereditary prion diseases. All the environmentally acquired cases, except 1 case of variant CJD, were acquired from dura grafts. Although most patients were diagnosed with a classical subtype of sporadic CJD (sCJD), whose features include rapidly progressing dementia, myoclonus, hyperintensity in the cerebral cortex and basal ganglia in diffusion-weighted magnetic resonance imaging, and periodic synchronous discharge in electroencephalography, the number of cases with atypical symptoms, such as MM2 (0.8%), MV2 (0.2%), VV1 (0%), and VV2 (0.2%) subtypes of sCJD cases, was not negligible. Appropriate diagnosis should be made based on clinical features, neuroradiological findings, cerebrospinal fluid (CSF) findings (14-3-3 and total tau proteins), and genetic analysis of polymorphisms. Hereditary prion diseases are classified into 3 major phenotypes: familial CJD (fCJD); Gerstmann-Straeussler-Scheinker disease (GSS), which mainly presents as spinocerebellar ataxia; and fatal familial insomnia. Many mutations of the prion protein gene have been identified, but V1801 (fCJD), P102L (GSS), and E200K (fCJD) mutations were the most common among the fCJD cases in Japan. Without a family history, genetic testing is necessary to distinguish even seemingly ''sporadic'' CJD from fCJD. Accurate diagnosis is important for clarification of the pathological process, prevention of secondary infection, and also psychological support. (author)

Implications of prion adaptation and evolution paradigm for human neurodegenerative diseases.

Science.gov (United States)

Kabir, M Enamul; Safar, Jiri G

2014-01-01

There is a growing body of evidence indicating that number of human neurodegenerative diseases, including Alzheimer disease, Parkinson disease, fronto-temporal dementias, and amyotrophic lateral sclerosis, propagate in the brain via prion-like intercellular induction of protein misfolding. Prions cause lethal neurodegenerative diseases in humans, the most prevalent being sporadic Creutzfeldt-Jakob disease (sCJD); they self-replicate and spread by converting the cellular form of prion protein (PrP(C)) to a misfolded pathogenic conformer (PrP(Sc)). The extensive phenotypic heterogeneity of human prion diseases is determined by polymorphisms in the prion protein gene, and by prion strain-specific conformation of PrP(Sc). Remarkably, even though informative nucleic acid is absent, prions may undergo rapid adaptation and evolution in cloned cells and upon crossing the species barrier. In the course of our investigation of this process, we isolated distinct populations of PrP(Sc) particles that frequently co-exist in sCJD. The human prion particles replicate independently and undergo competitive selection of those with lower initial conformational stability. Exposed to mutant substrate, the winning PrP(Sc) conformers are subject to further evolution by natural selection of the subpopulation with the highest replication rate due to the lowest stability. Thus, the evolution and adaptation of human prions is enabled by a dynamic collection of distinct populations of particles, whose evolution is governed by the selection of progressively less stable, faster replicating PrP(Sc) conformers. This fundamental biological mechanism may explain the drug resistance that some prions gained after exposure to compounds targeting PrP(Sc). Whether the phenotypic heterogeneity of other neurodegenerative diseases caused by protein misfolding is determined by the spectrum of misfolded conformers (strains) remains to be established. However, the prospect that these conformers may evolve and

Gene expression profiling en association with prion-related lesions in the medulla oblongata of symptomatic natural scrapie animals.

NARCIS (Netherlands)

Filali, H.; Martin-Burriel, I.; Harders, F.; Varona, L.; Lyahyai, J.; Zaragoza, P.; Pumarola, M.; Badiola, J.J.; Bossers, A.; Bolea, R.

2011-01-01

The pathogenesis of natural scrapie and other prion diseases remains unclear. Examining transcriptome variations in infected versus control animals may highlight new genes potentially involved in some of the molecular mechanisms of prion-induced pathology. The aim of this work was to identify

Sporadic Creutzfeldt-Jakob Disease: Prion Pathology in Medulla Oblongata-Possible Routes of Infection and Host Susceptibility.

Science.gov (United States)

Iacono, Diego; Ferrari, Sergio; Gelati, Matteo; Zanusso, Gianluigi; Mariotto, Sara; Monaco, Salvatore

2015-01-01

Sporadic Creutzfeldt-Jakob disease (sCJD), the most frequent human prion disorder, is characterized by remarkable phenotypic variability, which is influenced by the conformation of the pathologic prion protein and the methionine/valine polymorphic codon 129 of the prion protein gene. While the etiology of sCJD remains unknown, it has been hypothesized that environmental exposure to prions might occur through conjunctival/mucosal contact, oral ingestion, inhalation, or simultaneous involvement of the olfactory and enteric systems. We studied 21 subjects with definite sCJD to assess neuropathological involvement of the dorsal motor nucleus of the vagus and other medullary nuclei and to evaluate possible associations with codon 129 genotype and prion protein conformation. The present data show that prion protein deposition was detected in medullary nuclei of distinct sCJD subtypes, either valine homozygous or heterozygous at codon 129. These findings suggest that an "environmental exposure" might occur, supporting the hypothesis that external sources of contamination could contribute to sCJD in susceptible hosts. Furthermore, these novel data could shed the light on possible causes of sCJD through a "triple match" hypothesis that identify environmental exposure, host genotype, and direct exposure of specific anatomical regions as possible pathogenetic factors.

Gene Expression Profiling and Association with Prion-Related Lesions in the Medulla Oblongata of Symptomatic Natural Scrapie Animals

Science.gov (United States)

Filali, Hicham; Martin-Burriel, Inmaculada; Harders, Frank; Varona, Luis; Lyahyai, Jaber; Zaragoza, Pilar; Pumarola, Martí; Badiola, Juan J.; Bossers, Alex; Bolea, Rosa

2011-01-01

The pathogenesis of natural scrapie and other prion diseases remains unclear. Examining transcriptome variations in infected versus control animals may highlight new genes potentially involved in some of the molecular mechanisms of prion-induced pathology. The aim of this work was to identify disease-associated alterations in the gene expression profiles of the caudal medulla oblongata (MO) in sheep presenting the symptomatic phase of natural scrapie. The gene expression patterns in the MO from 7 sheep that had been naturally infected with scrapie were compared with 6 controls using a Central Veterinary Institute (CVI) custom designed 4×44K microarray. The microarray consisted of a probe set on the previously sequenced ovine tissue library by CVI and was supplemented with all of the Ovis aries transcripts that are currently publicly available. Over 350 probe sets displayed greater than 2-fold changes in expression. We identified 148 genes from these probes, many of which encode proteins that are involved in the immune response, ion transport, cell adhesion, and transcription. Our results confirm previously published gene expression changes that were observed in murine models with induced scrapie. Moreover, we have identified new genes that exhibit differential expression in scrapie and could be involved in prion neuropathology. Finally, we have investigated the relationship between gene expression profiles and the appearance of the main scrapie-related lesions, including prion protein deposition, gliosis and spongiosis. In this context, the potential impacts of these gene expression changes in the MO on scrapie development are discussed. PMID:21629698

Prion protein gene polymorphisms in Turkish native goat breeds

Indian Academy of Sciences (India)

HASAN MEYDAN

3The Roslin Institute and Royal (Dick) School of Veterinary Studies, University of ... Eighteen single-nucleotide polymorphisms were detected in the caprine PRNP .... Sampling localities, sample size (n) and sex of Turkish native goat breeds.

Classifying prion and prion-like phenomena.

Science.gov (United States)

Harbi, Djamel; Harrison, Paul M

2014-01-01

The universe of prion and prion-like phenomena has expanded significantly in the past several years. Here, we overview the challenges in classifying this data informatically, given that terms such as "prion-like", "prion-related" or "prion-forming" do not have a stable meaning in the scientific literature. We examine the spectrum of proteins that have been described in the literature as forming prions, and discuss how "prion" can have a range of meaning, with a strict definition being for demonstration of infection with in vitro-derived recombinant prions. We suggest that although prion/prion-like phenomena can largely be apportioned into a small number of broad groups dependent on the type of transmissibility evidence for them, as new phenomena are discovered in the coming years, a detailed ontological approach might be necessary that allows for subtle definition of different "flavors" of prion / prion-like phenomena.

Prion protein (PrP) gene-knockout cell lines: insight into functions of the PrP

OpenAIRE

Sakudo, Akikazu; Onodera, Takashi

2015-01-01

Elucidation of prion protein (PrP) functions is crucial to fully understand prion diseases. A major approach to studying PrP functions is the use of PrP gene-knockout (Prnp ?/?) mice. So far, six types of Prnp ?/? mice have been generated, demonstrating the promiscuous functions of PrP. Recently, other PrP family members, such as Doppel and Shadoo, have been found. However, information obtained from comparative studies of structural and functional analyses of these PrP family proteins do not ...

Loss of prion protein induces a primed state of type I interferon-responsive genes

DEFF Research Database (Denmark)

Malachin, Giulia; Reiten, Malin R.; Salvesen, Øyvind

2017-01-01

The cellular prion protein (PrPC) has been extensively studied because of its pivotal role in prion diseases; however, its functions remain incompletely understood. A unique line of goats has been identified that carries a nonsense mutation that abolishes synthesis of PrPC. In these animals, the Pr...... genotypes. About 70% of these were classified as interferon-responsive genes. In goats without PrPC, the majority of type I interferon-responsive genes were in a primed, modestly upregulated state, with fold changes ranging from 1.4 to 3.7. Among these were ISG15, DDX58 (RIG-1), MX1, MX2, OAS1, OAS2...... and DRAM1, all of which have important roles in pathogen defense, cell proliferation, apoptosis, immunomodulation and DNA damage response. Our data suggest that PrPC contributes to the fine-tuning of resting state PBMCs expression level of type I interferon-responsive genes. The molecular mechanism...

Loss of Octarepeats in Two Processed Prion Pseudogenes in the Red Squirrel, Sciurus vulgaris

Science.gov (United States)

Kortum, Timothy T.; Hupkes, Marlinda; Kohlen, Wouter; van Rheede, Teun; de Jong, Wilfried W.

2010-01-01

The N-terminal region of the mammalian prion protein (PrP) contains an ‘octapeptide’ repeat which is involved in copper binding. This eight- or nine-residue peptide is repeated four to seven times, depending on the species, and polymorphisms in repeat number do occur. Alleles with three repeats are very rare in humans and goats, and deduced PrP sequences with two repeats have only been reported in two lemur species and in the red squirrel, Sciurus vulgaris. We here describe that the red squirrel two-repeat PrP sequence actually represents a retroposed pseudogene, and that an additional and older processed pseudogene with three repeats also occurs in this species as well as in ground squirrels. We argue that repeat numbers may tend to contract rather than expand in prion retropseudogenes, and that functional prion genes with two repeats may not be viable. Electronic supplementary material The online version of this article (doi:10.1007/s00239-010-9390-7) contains supplementary material, which is available to authorized users. PMID:20878152

Inherited prion disease A117V is not simply a proteinopathy but produces prions transmissible to transgenic mice expressing homologous prion protein.

Science.gov (United States)

Asante, Emmanuel A; Linehan, Jacqueline M; Smidak, Michelle; Tomlinson, Andrew; Grimshaw, Andrew; Jeelani, Asif; Jakubcova, Tatiana; Hamdan, Shyma; Powell, Caroline; Brandner, Sebastian; Wadsworth, Jonathan D F; Collinge, John

2013-01-01

Prions are infectious agents causing fatal neurodegenerative diseases of humans and animals. In humans, these have sporadic, acquired and inherited aetiologies. The inherited prion diseases are caused by one of over 30 coding mutations in the human prion protein (PrP) gene (PRNP) and many of these generate infectious prions as evidenced by their experimental transmissibility by inoculation to laboratory animals. However, some, and in particular an extensively studied type of Gerstmann-Sträussler-Scheinker syndrome (GSS) caused by a PRNP A117V mutation, are thought not to generate infectious prions and instead constitute prion proteinopathies with a quite distinct pathogenetic mechanism. Multiple attempts to transmit A117V GSS have been unsuccessful and typical protease-resistant PrP (PrP(Sc)), pathognomonic of prion disease, is not detected in brain. Pathogenesis is instead attributed to production of an aberrant topological form of PrP, C-terminal transmembrane PrP ((Ctm)PrP). Barriers to transmission of prion strains from one species to another appear to relate to structural compatibility of PrP in host and inoculum and we have therefore produced transgenic mice expressing human 117V PrP. We found that brain tissue from GSS A117V patients did transmit disease to these mice and both the neuropathological features of prion disease and presence of PrP(Sc) was demonstrated in the brains of recipient transgenic mice. This PrP(Sc) rapidly degraded during laboratory analysis, suggesting that the difficulty in its detection in patients with GSS A117V could relate to post-mortem proteolysis. We conclude that GSS A117V is indeed a prion disease although the relative contributions of (Ctm)PrP and prion propagation in neurodegeneration and their pathogenetic interaction remains to be established.

Inherited prion disease A117V is not simply a proteinopathy but produces prions transmissible to transgenic mice expressing homologous prion protein.

Directory of Open Access Journals (Sweden)

Emmanuel A Asante

Full Text Available Prions are infectious agents causing fatal neurodegenerative diseases of humans and animals. In humans, these have sporadic, acquired and inherited aetiologies. The inherited prion diseases are caused by one of over 30 coding mutations in the human prion protein (PrP gene (PRNP and many of these generate infectious prions as evidenced by their experimental transmissibility by inoculation to laboratory animals. However, some, and in particular an extensively studied type of Gerstmann-Sträussler-Scheinker syndrome (GSS caused by a PRNP A117V mutation, are thought not to generate infectious prions and instead constitute prion proteinopathies with a quite distinct pathogenetic mechanism. Multiple attempts to transmit A117V GSS have been unsuccessful and typical protease-resistant PrP (PrP(Sc, pathognomonic of prion disease, is not detected in brain. Pathogenesis is instead attributed to production of an aberrant topological form of PrP, C-terminal transmembrane PrP ((CtmPrP. Barriers to transmission of prion strains from one species to another appear to relate to structural compatibility of PrP in host and inoculum and we have therefore produced transgenic mice expressing human 117V PrP. We found that brain tissue from GSS A117V patients did transmit disease to these mice and both the neuropathological features of prion disease and presence of PrP(Sc was demonstrated in the brains of recipient transgenic mice. This PrP(Sc rapidly degraded during laboratory analysis, suggesting that the difficulty in its detection in patients with GSS A117V could relate to post-mortem proteolysis. We conclude that GSS A117V is indeed a prion disease although the relative contributions of (CtmPrP and prion propagation in neurodegeneration and their pathogenetic interaction remains to be established.

PrionHome: a database of prions and other sequences relevant to prion phenomena.

Directory of Open Access Journals (Sweden)

Djamel Harbi

Full Text Available Prions are units of propagation of an altered state of a protein or proteins; prions can propagate from organism to organism, through cooption of other protein copies. Prions contain no necessary nucleic acids, and are important both as both pathogenic agents, and as a potential force in epigenetic phenomena. The original prions were derived from a misfolded form of the mammalian Prion Protein PrP. Infection by these prions causes neurodegenerative diseases. Other prions cause non-Mendelian inheritance in budding yeast, and sometimes act as diseases of yeast. We report the bioinformatic construction of the PrionHome, a database of >2000 prion-related sequences. The data was collated from various public and private resources and filtered for redundancy. The data was then processed according to a transparent classification system of prionogenic sequences (i.e., sequences that can make prions, prionoids (i.e., proteins that propagate like prions between individual cells, and other prion-related phenomena. There are eight PrionHome classifications for sequences. The first four classifications are derived from experimental observations: prionogenic sequences, prionoids, other prion-related phenomena, and prion interactors. The second four classifications are derived from sequence analysis: orthologs, paralogs, pseudogenes, and candidate-prionogenic sequences. Database entries list: supporting information for PrionHome classifications, prion-determinant areas (where relevant, and disordered and compositionally-biased regions. Also included are literature references for the PrionHome classifications, transcripts and genomic coordinates, and structural data (including comparative models made for the PrionHome from manually curated alignments. We provide database usage examples for both vertebrate and fungal prion contexts. Using the database data, we have performed a detailed analysis of the compositional biases in known budding-yeast prionogenic

PrionHome: a database of prions and other sequences relevant to prion phenomena.

Science.gov (United States)

Harbi, Djamel; Parthiban, Marimuthu; Gendoo, Deena M A; Ehsani, Sepehr; Kumar, Manish; Schmitt-Ulms, Gerold; Sowdhamini, Ramanathan; Harrison, Paul M

2012-01-01

Prions are units of propagation of an altered state of a protein or proteins; prions can propagate from organism to organism, through cooption of other protein copies. Prions contain no necessary nucleic acids, and are important both as both pathogenic agents, and as a potential force in epigenetic phenomena. The original prions were derived from a misfolded form of the mammalian Prion Protein PrP. Infection by these prions causes neurodegenerative diseases. Other prions cause non-Mendelian inheritance in budding yeast, and sometimes act as diseases of yeast. We report the bioinformatic construction of the PrionHome, a database of >2000 prion-related sequences. The data was collated from various public and private resources and filtered for redundancy. The data was then processed according to a transparent classification system of prionogenic sequences (i.e., sequences that can make prions), prionoids (i.e., proteins that propagate like prions between individual cells), and other prion-related phenomena. There are eight PrionHome classifications for sequences. The first four classifications are derived from experimental observations: prionogenic sequences, prionoids, other prion-related phenomena, and prion interactors. The second four classifications are derived from sequence analysis: orthologs, paralogs, pseudogenes, and candidate-prionogenic sequences. Database entries list: supporting information for PrionHome classifications, prion-determinant areas (where relevant), and disordered and compositionally-biased regions. Also included are literature references for the PrionHome classifications, transcripts and genomic coordinates, and structural data (including comparative models made for the PrionHome from manually curated alignments). We provide database usage examples for both vertebrate and fungal prion contexts. Using the database data, we have performed a detailed analysis of the compositional biases in known budding-yeast prionogenic sequences, showing

The Prion Concept and Synthetic Prions.

Science.gov (United States)

Legname, Giuseppe; Moda, Fabio

2017-01-01

Transmissible spongiform encephalopathies or prion diseases are a group of fatal neurodegenerative diseases caused by unconventional infectious agents, known as prions (PrP Sc ). Prions derive from a conformational conversion of the normally folded prion protein (PrP C ), which acquires pathological and infectious features. Moreover, PrP Sc is able to transmit the pathological conformation to PrP C through a mechanism that is still not well understood. The generation of synthetic prions, which behave like natural prions, is of fundamental importance to study the process of PrP C conversion and to assess the efficacy of therapeutic strategies to interfere with this process. Moreover, the ability of synthetic prions to induce pathology in animals confirms that the pathological properties of the prion strains are all enciphered in abnormal conformations, characterizing these infectious agents. © 2017 Elsevier Inc. All rights reserved.

Resistance to classical scrapie in experimentally challenged goats carrying mutation K222 of the prion protein gene

Directory of Open Access Journals (Sweden)

Acutis Pier Luigi

2012-02-01

Full Text Available Abstract Susceptibility of sheep to scrapie, a transmissible spongiform encephalopathy of small ruminants, is strongly influenced by polymorphisms of the prion protein gene (PRNP. Breeding programs have been implemented to increase scrapie resistance in sheep populations; though desirable, a similar approach has not yet been applied in goats. European studies have now suggested that several polymorphisms can modulate scrapie susceptibility in goats: in particular, PRNP variant K222 has been associated with resistance in case-control studies in Italy, France and Greece. In this study we investigated the resistance conferred by this variant using a natural Italian goat scrapie isolate to intracerebrally challenge five goats carrying genotype Q/Q 222 (wild type and five goats carrying genotype Q/K 222. By the end of the study, all five Q/Q 222 goats had died of scrapie after a mean incubation period of 19 months; one of the five Q/K 222 goats died after 24 months, while the other four were alive and apparently healthy up to the end of the study at 4.5 years post-challenge. All five of these animals were found to be scrapie negative. Statistical analysis showed that the probability of survival of the Q/K 222 goats versus the Q/Q 222 goats was significantly higher (p = 0.002. Our study shows that PRNP gene mutation K222 is strongly associated with resistance to classical scrapie also in experimental conditions, making it a potentially positive target for selection in the frame of breeding programs for resistance to classical scrapie in goats.

Regional brain metabolite abnormalities in inherited prion disease and asymptomatic gene carriers demonstrated in vivo by quantitative proton magnetic resonance spectroscopy

Energy Technology Data Exchange (ETDEWEB)

Waldman, A.D.; Cordery, R.J.; Godbolt, A.; Rossor, M.N. [University College London, Dementia Research Group, Department of Neurodegenerative Disease, Institute of Neurology, London (United Kingdom); Imperial College of Science, Technology and Medicine, Division of Neuroscience and Psychological Medicine, Faculty of Medicine, London (United Kingdom); MacManus, D.G. [University College London, NMR Research Unit, Department of Clinical Neurology, Institute of Neurology, London (United Kingdom); Collinge, J. [University College London, MRC Prion Unit, Department of Neurodegenerative Disease, Institute of Neurology, London (United Kingdom)

2006-06-15

Inherited prion diseases are caused by mutations in the gene which codes for prion protein (PrP), leading to proliferation of abnormal PrP isomers in the brain and neurodegeneration; they include Gerstmann-Straeussler-Scheinker disease (GSS), fatal familial insomnia (FFI) and familial Creutzfeldt-Jakob disease (fCJD). We studied two patients with symptomatic inherited prion disease (P102L) and two pre-symptomatic P102L gene carriers using quantitative magnetic resonance spectroscopy (MRS). Short echo time spectra were acquired from the thalamus, caudate region and frontal white matter, metabolite levels and ratios were measured and z-scores calculated for individual patients relative to age-matched normal controls. MRS data were compared with structural magnetic resonance imaging. One fCJD case had generalised atrophy and showed increased levels of myo-inositol (MI) in the thalamus (z=3.7). The other had decreased levels of N-acetylaspartate (z=4) and diffuse signal abnormality in the frontal white matter. Both asymptomatic gene carriers had normal imaging, but increased frontal white matter MI (z=4.3, 4.1), and one also had increased MI in the caudate (z=5.3). Isolated MI abnormalities in asymptomatic gene carriers are a novel finding and may reflect early glial proliferation, prior to significant neuronal damage. MRS provides potential non-invasive surrogate markers of early disease and progression in inherited prion disease. (orig.)

Regional brain metabolite abnormalities in inherited prion disease and asymptomatic gene carriers demonstrated in vivo by quantitative proton magnetic resonance spectroscopy

International Nuclear Information System (INIS)

Waldman, A.D.; Cordery, R.J.; Godbolt, A.; Rossor, M.N.; MacManus, D.G.; Collinge, J.

2006-01-01

Inherited prion diseases are caused by mutations in the gene which codes for prion protein (PrP), leading to proliferation of abnormal PrP isomers in the brain and neurodegeneration; they include Gerstmann-Straeussler-Scheinker disease (GSS), fatal familial insomnia (FFI) and familial Creutzfeldt-Jakob disease (fCJD). We studied two patients with symptomatic inherited prion disease (P102L) and two pre-symptomatic P102L gene carriers using quantitative magnetic resonance spectroscopy (MRS). Short echo time spectra were acquired from the thalamus, caudate region and frontal white matter, metabolite levels and ratios were measured and z-scores calculated for individual patients relative to age-matched normal controls. MRS data were compared with structural magnetic resonance imaging. One fCJD case had generalised atrophy and showed increased levels of myo-inositol (MI) in the thalamus (z=3.7). The other had decreased levels of N-acetylaspartate (z=4) and diffuse signal abnormality in the frontal white matter. Both asymptomatic gene carriers had normal imaging, but increased frontal white matter MI (z=4.3, 4.1), and one also had increased MI in the caudate (z=5.3). Isolated MI abnormalities in asymptomatic gene carriers are a novel finding and may reflect early glial proliferation, prior to significant neuronal damage. MRS provides potential non-invasive surrogate markers of early disease and progression in inherited prion disease. (orig.)

Polymorphism of amyloid fibrils formed by a peptide from the yeast prion protein Sup35: AFM and Tip-Enhanced Raman Scattering studies

Energy Technology Data Exchange (ETDEWEB)

Krasnoslobodtsev, Alexey V., E-mail: akrasnos@unomaha.edu [Department of Pharmaceutical Sciences, University of Nebraska Medical Center, 986025 Nebraska Medical Center, Omaha, NE 68198 (United States); Department of Physics, University of Nebraska Omaha, Omaha, NE 68182 (United States); Deckert-Gaudig, Tanja [IPHT-Leibniz Institute of Photonic Technology, Albert-Einstein-Str. 9, D-07745 Jena (Germany); Zhang, Yuliang [Department of Pharmaceutical Sciences, University of Nebraska Medical Center, 986025 Nebraska Medical Center, Omaha, NE 68198 (United States); Deckert, Volker [IPHT-Leibniz Institute of Photonic Technology, Albert-Einstein-Str. 9, D-07745 Jena (Germany); Institute for Physical Chemistry and Abbe Center of Photonics, University of Jena, Helmholtzweg 4, D-07743 Jena (Germany); Lyubchenko, Yuri L., E-mail: ylyubchenko@unmc.edu [Department of Pharmaceutical Sciences, University of Nebraska Medical Center, 986025 Nebraska Medical Center, Omaha, NE 68198 (United States)

2016-06-15

Aggregation of prion proteins is the cause of various prion related diseases. The infectious form of prions, amyloid aggregates, exist as multiple strains. The strains are thought to represent structurally different prion protein molecules packed into amyloid aggregates, but the knowledge on the structure of different types of aggregates is limited. Here we report on the use of AFM (Atomic Force Microscopy) and TERS (Tip-Enhanced Raman Scattering) to study morphological heterogeneity and access underlying conformational features of individual amyloid aggregates. Using AFM we identified the morphology of amyloid fibrils formed by the peptide (CGNNQQNY) from the yeast prion protein Sup35 that is critically involved in the aggregation of the full protein. TERS results demonstrate that morphologically different amyloid fibrils are composed of a distinct set of conformations. Fibrils formed at pH 5.6 are composed of a mixture of peptide conformations (β-sheets, random coil and α-helix) while fibrils formed in pH~2 solution primarily have β-sheets. Additionally, peak positions in the amide III region of the TERS spectra suggested that peptides have parallel arrangement of β-sheets for pH~2 fibrils and antiparallel arrangement for fibrils formed at pH 5.6. We also developed a methodology for detailed analysis of the peptide secondary structure by correlating intensity changes of Raman bands in different regions of TERS spectra. Such correlation established that structural composition of peptides is highly localized with large contribution of unordered secondary structures on a fibrillar surface. - Highlights: • Amyloid polymorphs were characterized by AFM and TERS. • A mixture of peptide secondary structures in fibrils were identified using TERS. • TERS recognizes packing arrangement (parallel versus antiparallel) of peptides. • TERS is a powerful tool for high resolution structural analysis of fibrils.

The contribution of different prion protein types and host polymorphisms to clinicopathological variations in Creutzfeldt-Jakob disease.

Science.gov (United States)

Head, Mark W; Ironside, James W

2012-07-01

Creutzfeldt-Jakob disease is a fatal neurodegenerative disease that primarily affects the central nervous system. In this respect, it can be considered alongside the more frequently occurring neurodegenerative diseases, such as Alzheimer's disease. Creutzfeldt-Jakob disease is perhaps the paradigmatic protein misfolding disorder, so comparisons between the mechanisms involved in Creutzfeldt-Jakob disease and other neurodegenerative diseases associated with protein misfolding (such as the tauopathies and synucleinopathies) may also be informative. Like many of these diseases, Creutzfeldt-Jakob disease occurs sporadically or can, more rarely, be associated with mutations. However, Creutzfeldt-Jakob disease can also be acquired and is experimentally transmissible. These properties have had profound public health implications and made the disease of interest to virologists, in addition to those interested in protein misfolding disorders and neurodegeneration. The possible causes for the pronounced phenotypic variation among different forms of Creutzfeldt-Jakob disease are beginning to become understood, and these appear to depend in large measure on the genetics of the host (specifically the sequence of the prion protein gene, PRNP) and the epigenetic aspects of the agent (thought to be a misfolded and aggregated form of the PRNP gene product, termed a prion). This review will examine whether this model in its present form has sufficient complexity and subtlety to account for the clinicopathological variation evident in Creutzfeldt-Jakob disease and will outline the ways in which a more complete and informative molecular definition of human prions are currently being sought. Copyright © 2012 John Wiley & Sons, Ltd.

Lack of association between PRNP 1368 polymorphism and Alzheimer's disease or vascular dementia

Directory of Open Access Journals (Sweden)

Jeong Byung-Hoon

2009-04-01

Full Text Available Abstract Background Polymorphisms of the prion protein gene (PRNP at codons 129 and 219 play an important role in the susceptibility to Creutzfeldt-Jakob disease (CJD, and might be associated with other neurodegenerative disorders. Several recent reports indicate that polymorphisms outside the coding region of PRNP modulate the expression of prion protein and are associated with sporadic CJD, although other studies failed to show an association. These reports involved the polymorphism PRNP 1368 which is located upstream from PRNP exon 1. In a case-controlled protocol, we assessed the possible association between the PRNP 1368 polymorphism and either Alzheimer's disease (AD or vascular dementia (VaD. Methods To investigate whether the PRNP 1368 polymorphism is associated with the occurrence of AD or VaD in the Korean population, we compared the genotype, allele, and haplotype frequencies of the PRNP 1368 polymorphism in 152 AD patients and 192 VaD patients with frequencies in 268 healthy Koreans. Results and conclusion Significant differences in genotype, allele and haplotype frequencies of PRNP 1368 polymorphism were not observed between AD and normal controls. There were no significant differences in the genotype and allele frequencies of the PRNP 1368 polymorphism between Korean VaD patients and normal controls. However, in the haplotype analysis, haplotype Ht5 was significantly over-represented in Korean VaD patients. This was the first genetic association study of a polymorphism outside the coding region of PRNP in relation to AD and VaD.

Immunology of Prion Protein and Prions.

Science.gov (United States)

Mabbott, Neil A

2017-01-01

Many natural prion diseases are acquired peripherally, such as following the oral consumption of contaminated food or pasture. After peripheral exposure many prion isolates initially accumulate to high levels within the host's secondary lymphoid tissues. The replication of prions within these tissues is essential for their efficient spread to the brain where they ultimately cause neurodegeneration. This chapter describes our current understanding of the critical tissues, cells, and molecules which the prions exploit to mediate their efficient propagation from the site of exposure (such as the intestine) to the brain. Interactions between the immune system and prions are not only restricted to the secondary lymphoid tissues. Therefore, an account of how the activation status of the microglial in the brain can also influence progression of prion disease pathogenesis is provided. Prion disease susceptibility may also be influenced by additional factors such as chronic inflammation, coinfection with other pathogens, and aging. Finally, the potential for immunotherapy to provide a means of safe and effective prophylactic or therapeutic intervention in these currently untreatable diseases is considered. © 2017 Elsevier Inc. All rights reserved.

Prions, prion-like prionoids, and neurodegenerative disordersVacancy

Directory of Open Access Journals (Sweden)

Ashok Verma

2016-01-01

Full Text Available Prion diseases or transmissible spongiform encephalopathies are fatal neurodegenerative diseases characterized by the aggregation and deposition of the misfolded prion protein in the brain. α-synuclein (α-syn-associated multiple system atrophy has been recently shown to be caused by a bona fide α-syn prion strain. Several other misfolded native proteins such as β-amyloid, tau and TDP-43 share some aspects of prions although none of them is shown to be transmissible in nature or in experimental animals. However, these prion-like “prionoids” are causal to a variety of neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, and amyotrophic lateral sclerosis. The remarkable recent discovery of at least two new α-syn prion strains and their transmissibility in transgenic mice and in vitro cell models raises a distinct question as to whether some specific strain of other prionoids could have the capability of disease transmission in a manner similar to prions. In this overview, we briefly describe human and other mammalian prion diseases and comment on certain similarities between prion and prionoid and the possibility of prion-like transmissibility of some prionoid strains.

Yeast prion architecture explains how proteins can be genes

Science.gov (United States)

Wickner, Reed

2013-03-01

Prions (infectious proteins) transmit information without an accompanying DNA or RNA. Most yeast prions are self-propagating amyloids that inactivate a normally functional protein. A single protein can become any of several prion variants, with different manifestations due to different amyloid structures. We showed that the yeast prion amyloids of Ure2p, Sup35p and Rnq1p are folded in-register parallel beta sheets using solid state NMR dipolar recoupling experiments, mass-per-filament-length measurements, and filament diameter measurements. The extent of beta sheet structure, measured by chemical shifts in solid-state NMR and acquired protease-resistance on amyloid formation, combined with the measured filament diameters, imply that the beta sheets must be folded along the long axis of the filament. We speculate that prion variants of a single protein sequence differ in the location of these folds. Favorable interactions between identical side chains must hold these structures in-register. The same interactions must guide an unstructured monomer joining the end of a filament to assume the same conformation as molecules already in the filament, with the turns at the same locations. In this way, a protein can template its own conformation, in analogy to the ability of a DNA molecule to template its sequence by specific base-pairing. Bldg. 8, Room 225, NIH, 8 Center Drive MSC 0830, Bethesda, MD 20892-0830, wickner@helix.nih.gov, 301-496-3452

Prions and prion-like proteins.

Science.gov (United States)

Fraser, Paul E

2014-07-18

Prions are self-replicating protein aggregates and are the primary causative factor in a number of neurological diseases in mammals. The prion protein (PrP) undergoes a conformational transformation leading to aggregation into an infectious cellular pathogen. Prion-like protein spreading and transmission of aggregates between cells have also been demonstrated for other proteins associated with Alzheimer disease and Parkinson disease. This protein-only phenomenon may therefore have broader implications in neurodegenerative disorders. The minireviews in this thematic series highlight the recent advances in prion biology and the roles these unique proteins play in disease. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Gene knockout of tau expression does not contribute to the pathogenesis of prion disease.

Science.gov (United States)

Lawson, Victoria A; Klemm, Helen M; Welton, Jeremy M; Masters, Colin L; Crouch, Peter; Cappai, Roberto; Ciccotosto, Giuseppe D

2011-11-01

Prion diseases or transmissible spongiform encephalopathies are a group of fatal and transmissible disorders affecting the central nervous system of humans and animals. The principal agent of prion disease transmission and pathogenesis is proposed to be an abnormal protease-resistant isoform of the normal cellular prion protein. The microtubule-associated protein tau is elevated in patients with Creutzfeldt-Jakob disease. To determine whether tau expression contributes to prion disease pathogenesis, tau knockout and control wild-type mice were infected with the M1000 strain of mouse-adapted human prions. Immunohistochemical analysis for total tau expression in prion-infected wild-type mice indicated tau aggregation in the cytoplasm of a subpopulation of neurons in regions associated with spongiform change. Western immunoblot analysis of brain homogenates revealed a decrease in total tau immunoreactivity and epitope-specific changes in tau phosphorylation. No significant difference in incubation period or other disease features were observed between tau knockout and wild-type mice with clinical prion disease. These results demonstrate that, in this model of prion disease, tau does not contribute to the pathogenesis of prion disease and that changes in the tau protein profile observed in mice with clinical prion disease occurs as a consequence of the prion-induced pathogenesis.

Prion protein polymorphisms affect chronic wasting disease progression.

Directory of Open Access Journals (Sweden)

Chad J Johnson

Full Text Available Analysis of the PRNP gene in cervids naturally infected with chronic wasting disease (CWD suggested that PRNP polymorphisms affect the susceptibility of deer to infection. To test this effect, we orally inoculated 12 white-tailed deer with CWD agent. Three different PRNP alleles, wild-type (wt; glutamine at amino acid 95 and glycine at 96, Q95H (glutamine to histidine at amino acid position 95 and G96S (glycine to serine at position 96 were represented in the study cohort with 5 wt/wt, 3 wt/G96S, and 1 each wt/Q95H and Q95H/G96S. Two animals were lost to follow-up due to intercurrent disease. The inoculum was prepared from Wisconsin hunter-harvested homozygous wt/wt animals. All infected deer presented with clinical signs of CWD; the orally infected wt/wt had an average survival period of 693 days post inoculation (dpi and G96S/wt deer had an average survival period of 956 dpi. The Q95H/wt and Q95H/G96S deer succumbed to CWD at 1,508 and 1,596 dpi respectively. These data show that polymorphisms in the PRNP gene affect CWD incubation period. Deer heterozygous for the PRNP alleles had extended incubation periods with the Q95H allele having the greatest effect.

Effect of Polymorphisms at Codon 146 of the Goat PRNP Gene on Susceptibility to Challenge with Classical Scrapie by Different Routes.

Science.gov (United States)

Papasavva-Stylianou, Penelope; Simmons, Marion Mathieson; Ortiz-Pelaez, Angel; Windl, Otto; Spiropoulos, John; Georgiadou, Soteria

2017-11-15

This report presents the results of experimental challenges of goats with scrapie by both the intracerebral (i.c.) and oral routes, exploring the effects of polymorphisms at codon 146 of the goat PRNP gene on resistance to disease. The results of these studies illustrate that while goats of all genotypes can be infected by i.c. challenge, the survival distribution of the animals homozygous for asparagine at codon 146 was significantly shorter than those of animals of all other genotypes (chi-square value, 10.8; P = 0.001). In contrast, only those animals homozygous for asparagine at codon 146 (NN animals) succumbed to oral challenge. The results also indicate that any cases of infection in non-NN animals can be detected by the current confirmatory test (immunohistochemistry), although successful detection with the rapid enzyme-linked immunosorbent assay (ELISA) was more variable and dependent on the polymorphism. Together with data from previous studies of goats exposed to infection in the field, these data support the previously reported observations that polymorphisms at this codon have a profound effect on susceptibility to disease. It is concluded that only animals homozygous for asparagine at codon 146 succumb to scrapie under natural conditions. IMPORTANCE In goats, like in sheep, there are PRNP polymorphisms that are associated with susceptibility or resistance to scrapie. However, in contrast to the polymorphisms in sheep, they are more numerous in goats and may be restricted to certain breeds or geographical regions. Therefore, eradication programs must be specifically designed depending on the identification of suitable polymorphisms. An initial analysis of surveillance data suggested that such a polymorphism in Cypriot goats may lie in codon 146. In this study, we demonstrate experimentally that NN animals are highly susceptible after i.c. inoculation. The presence of a D or S residue prolonged incubation periods significantly, and prions were detected

Hsp40 function in yeast prion propagation: Amyloid diversity necessitates chaperone functional complexity.

Science.gov (United States)

Sporn, Zachary A; Hines, Justin K

2015-01-01

Yeast prions are heritable protein-based elements, most of which are formed of amyloid aggregates that rely on the action of molecular chaperones for transmission to progeny. Prions can form distinct amyloid structures, known as 'strains' in mammalian systems, that dictate both pathological progression and cross-species infection barriers. In yeast these same amyloid structural polymorphisms, called 'variants', dictate the intensity of prion-associated phenotypes and stability in mitosis. We recently reported that [PSI(+)] prion variants differ in the fundamental domain requirements for one chaperone, the Hsp40/J-protein Sis1, which are mutually exclusive between 2 different yeast prions, demonstrating a functional plurality for Sis1. Here we extend that analysis to incorporate additional data that collectively support the hypothesis that Sis1 has multiple functional roles that can be accomplished by distinct sets of domains. These functions are differentially required by distinct prions and prion variants. We also present new data regarding Hsp104-mediated prion elimination and show that some Sis1 functions, but not all, are conserved in the human homolog Hdj1/DNAJB1. Importantly, of the 10 amyloid-based prions indentified to date in Saccharomyces cerevisiae, the chaperone requirements of only 4 are known, leaving a great diversity of amyloid structures, and likely modes of amyloid-chaperone interaction, largely unexplored.

A new mutation in the prion protein gene: A patient with dementia and white matter changes

NARCIS (Netherlands)

Van Harten, B.; Van Gool, W.A.; Van Langen, I.M.; Deekman, J.M.; Meijerink, P.H.S.; Weinstein, H.C.

2000-01-01

The authors describe the clinical characteristics, MRI abnormalities, and molecular findings in a patient with a novel variant of a two-octarepeat insertion mutation in the prion protein gene. This patient presented with moderately progressive dementia of presenile onset and gait ataxia. MRI showed

Scrapie susceptibility-linked polymorphisms modulate the in vitro conversion of sheep prion protein to protease-resistant forms

NARCIS (Netherlands)

Bossers, A.; Belt, P.B.G.M.; Raymond, G.J.; Caughey, B.; Vries, de R.; Smits, M.

1997-01-01

Prion diseases are natural transmissible neurodegenerative disorders in humans and animals. They are characterized by the accumulation of a protease-resistant scrapie-associated prion protein (PrPSc) of the host-encoded cellular prion protein (PrPC) mainly in the central nervous system.

Prions in yeast

OpenAIRE

Bezdíčka, Martin

2013-01-01

The thesis describes yeast prions and their biological effects on yeast in general. It defines the basic characteristics of yeast prions, that distinguish prions from other proteins. The thesis introduces various possibilities of prion formation, and propagation as well as specific types of yeast prions, including various functions of most studied types of prions. The thesis also focuses on chaperones that affect the state of yeast prions in cells. Lastly, the thesis indicates similarities be...

Emergence of two prion subtypes in ovine PrP transgenic mice infected with human MM2-cortical Creutzfeldt-Jakob disease prions.

Science.gov (United States)

Chapuis, Jérôme; Moudjou, Mohammed; Reine, Fabienne; Herzog, Laetitia; Jaumain, Emilie; Chapuis, Céline; Quadrio, Isabelle; Boulliat, Jacques; Perret-Liaudet, Armand; Dron, Michel; Laude, Hubert; Rezaei, Human; Béringue, Vincent

2016-02-05

Mammalian prions are proteinaceous pathogens responsible for a broad range of fatal neurodegenerative diseases in humans and animals. These diseases can occur spontaneously, such as Creutzfeldt-Jakob disease (CJD) in humans, or be acquired or inherited. Prions are primarily formed of macromolecular assemblies of the disease-associated prion protein PrP(Sc), a misfolded isoform of the host-encoded prion protein PrP(C). Within defined host-species, prions can exist as conformational variants or strains. Based on both the M/V polymorphism at codon 129 of PrP and the electrophoretic signature of PrP(Sc) in the brain, sporadic CJD is classified in different subtypes, which may encode different strains. A transmission barrier, the mechanism of which remains unknown, limits prion cross-species propagation. To adapt to the new host, prions have the capacity to 'mutate' conformationally, leading to the emergence of a variant with new biological properties. Here, we transmitted experimentally one rare subtype of human CJD, designated cortical MM2 (129 MM with type 2 PrP(Sc)), to transgenic mice overexpressing either human or the VRQ allele of ovine PrP(C). In marked contrast with the reported absence of transmission to knock-in mice expressing physiological levels of human PrP, this subtype transmitted faithfully to mice overexpressing human PrP, and exhibited unique strain features. Onto the ovine PrP sequence, the cortical MM2 subtype abruptly evolved on second passage, thereby allowing emergence of a pair of strain variants with distinct PrP(Sc) biochemical characteristics and differing tropism for the central and lymphoid tissues. These two strain components exhibited remarkably distinct replicative properties in cell-free amplification assay, allowing the 'physical' cloning of the minor, lymphotropic component, and subsequent isolation in ovine PrP mice and RK13 cells. Here, we provide in-depth assessment of the transmissibility and evolution of one rare subtype of

Prion protein (PrP) gene-knockout cell lines: insight into functions of the PrP

Science.gov (United States)

Sakudo, Akikazu; Onodera, Takashi

2015-01-01

Elucidation of prion protein (PrP) functions is crucial to fully understand prion diseases. A major approach to studying PrP functions is the use of PrP gene-knockout (Prnp−/−) mice. So far, six types of Prnp−/− mice have been generated, demonstrating the promiscuous functions of PrP. Recently, other PrP family members, such as Doppel and Shadoo, have been found. However, information obtained from comparative studies of structural and functional analyses of these PrP family proteins do not fully reveal PrP functions. Recently, varieties of Prnp−/− cell lines established from Prnp−/− mice have contributed to the analysis of PrP functions. In this mini-review, we focus on Prnp−/− cell lines and summarize currently available Prnp−/− cell lines and their characterizations. In addition, we introduce the recent advances in the methodology of cell line generation with knockout or knockdown of the PrP gene. We also discuss how these cell lines have provided valuable insights into PrP functions and show future perspectives. PMID:25642423

Evidence that bank vole PrP is a universal acceptor for prions.

Directory of Open Access Journals (Sweden)

Joel C Watts

2014-04-01

Full Text Available Bank voles are uniquely susceptible to a wide range of prion strains isolated from many different species. To determine if this enhanced susceptibility to interspecies prion transmission is encoded within the sequence of the bank vole prion protein (BVPrP, we inoculated Tg(M109 and Tg(I109 mice, which express BVPrP containing either methionine or isoleucine at polymorphic codon 109, with 16 prion isolates from 8 different species: humans, cattle, elk, sheep, guinea pigs, hamsters, mice, and meadow voles. Efficient disease transmission was observed in both Tg(M109 and Tg(I109 mice. For instance, inoculation of the most common human prion strain, sporadic Creutzfeldt-Jakob disease (sCJD subtype MM1, into Tg(M109 mice gave incubation periods of ∼200 days that were shortened slightly on second passage. Chronic wasting disease prions exhibited an incubation time of ∼250 days, which shortened to ∼150 days upon second passage in Tg(M109 mice. Unexpectedly, bovine spongiform encephalopathy and variant CJD prions caused rapid neurological dysfunction in Tg(M109 mice upon second passage, with incubation periods of 64 and 40 days, respectively. Despite the rapid incubation periods, other strain-specified properties of many prion isolates--including the size of proteinase K-resistant PrPSc, the pattern of cerebral PrPSc deposition, and the conformational stability--were remarkably conserved upon serial passage in Tg(M109 mice. Our results demonstrate that expression of BVPrP is sufficient to engender enhanced susceptibility to a diverse range of prion isolates, suggesting that BVPrP may be a universal acceptor for prions.

Inflammatory Gene Polymorphisms in Lung Cancer Susceptibility.

Science.gov (United States)

Eaton, Keith D; Romine, Perrin E; Goodman, Gary E; Thornquist, Mark D; Barnett, Matt J; Petersdorf, Effie W

2018-05-01

Chronic inflammation has been implicated in carcinogenesis, with increasing evidence of its role in lung cancer. We aimed to evaluate the role of genetic polymorphisms in inflammation-related genes in the risk for development of lung cancer. A nested case-control study design was used, and 625 cases and 625 well-matched controls were selected from participants in the β-Carotene and Retinol Efficacy Trial, which is a large, prospective lung cancer chemoprevention trial. The association between lung cancer incidence and survival and 23 polymorphisms descriptive of 11 inflammation-related genes (interferon gamma gene [IFNG], interleukin 10 gene [IL10], interleukin 1 alpha gene [IL1A], interleukin 1 beta gene [IL1B], interleukin 2 gene [IL2], interleukin 4 receptor gene [IL4R], interleukin 4 gene [IL4], interleukin 6 gene [IL6], prostaglandin-endoperoxide synthase 2 gene [PTGS2] (also known as COX2), transforming growth factor beta 1 gene [TGFB1], and tumor necrosis factor alpha gene [TNFA]) was evaluated. Of the 23 polymorphisms, two were associated with risk for lung cancer. Compared with individuals with the wild-type (CC) variant, individuals carrying the minor allele variants of the IL-1β-511C>T promoter polymorphism (rs16944) (CT and TT) had decreased odds of lung cancer (OR = 0.74, [95% confidence interval (CI): 0.58-0.94] and OR = 0.71 [95% CI: 0.50-1.01], respectively, p = 0.03). Similar results were observed for the IL-1β-1464 C>G promoter polymorphism (rs1143623), with presence of the minor variants CG and CC having decreased odds of lung cancer (OR = 0.75 [95% CI: 0.59-0.95] and OR = 0.69 [95% CI: 0.46-1.03], respectively, p = 0.03). Survival was not influenced by genotype. This study provides further evidence that IL1B promoter polymorphisms may modulate the risk for development of lung cancer. Copyright © 2018 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.

Human prion diseases: surgical lessons learned from iatrogenic prion transmission.

Science.gov (United States)

Bonda, David J; Manjila, Sunil; Mehndiratta, Prachi; Khan, Fahd; Miller, Benjamin R; Onwuzulike, Kaine; Puoti, Gianfranco; Cohen, Mark L; Schonberger, Lawrence B; Cali, Ignazio

2016-07-01

The human prion diseases, or transmissible spongiform encephalopathies, have captivated our imaginations since their discovery in the Fore linguistic group in Papua New Guinea in the 1950s. The mysterious and poorly understood "infectious protein" has become somewhat of a household name in many regions across the globe. From bovine spongiform encephalopathy (BSE), commonly identified as mad cow disease, to endocannibalism, media outlets have capitalized on these devastatingly fatal neurological conditions. Interestingly, since their discovery, there have been more than 492 incidents of iatrogenic transmission of prion diseases, largely resulting from prion-contaminated growth hormone and dura mater grafts. Although fewer than 9 cases of probable iatrogenic neurosurgical cases of Creutzfeldt-Jakob disease (CJD) have been reported worldwide, the likelihood of some missed cases and the potential for prion transmission by neurosurgery create considerable concern. Laboratory studies indicate that standard decontamination and sterilization procedures may be insufficient to completely remove infectivity from prion-contaminated instruments. In this unfortunate event, the instruments may transmit the prion disease to others. Much caution therefore should be taken in the absence of strong evidence against the presence of a prion disease in a neurosurgical patient. While the Centers for Disease Control and Prevention (CDC) and World Health Organization (WHO) have devised risk assessment and decontamination protocols for the prevention of iatrogenic transmission of the prion diseases, incidents of possible exposure to prions have unfortunately occurred in the United States. In this article, the authors outline the historical discoveries that led from kuru to the identification and isolation of the pathological prion proteins in addition to providing a brief description of human prion diseases and iatrogenic forms of CJD, a brief history of prion disease nosocomial transmission

Prion Diseases

Science.gov (United States)

... with facebook share with twitter share with linkedin Prion Diseases Prion diseases are a related group of ... deer and elk. Why Is the Study of Prion Diseases a Priority for NIAID? Much about TSE ...

Accelerated high fidelity prion amplification within and across prion species barriers.

Directory of Open Access Journals (Sweden)

Kristi M Green

2008-08-01

Full Text Available Experimental obstacles have impeded our ability to study prion transmission within and, more particularly, between species. Here, we used cervid prion protein expressed in brain extracts of transgenic mice, referred to as Tg(CerPrP, as a substrate for in vitro generation of chronic wasting disease (CWD prions by protein misfolding cyclic amplification (PMCA. Characterization of this infectivity in Tg(CerPrP mice demonstrated that serial PMCA resulted in the high fidelity amplification of CWD prions with apparently unaltered properties. Using similar methods to amplify mouse RML prions and characterize the resulting novel cervid prions, we show that serial PMCA abrogated a transmission barrier that required several hundred days of adaptation and subsequent stabilization in Tg(CerPrP mice. While both approaches produced cervid prions with characteristics distinct from CWD, the subtly different properties of the resulting individual prion isolates indicated that adaptation of mouse RML prions generated multiple strains following inter-species transmission. Our studies demonstrate that combined transgenic mouse and PMCA approaches not only expedite intra- and inter-species prion transmission, but also provide a facile means of generating and characterizing novel prion strains.

Yeast prions assembly and propagation: contributions of the prion and non-prion moieties and the nature of assemblies.

Science.gov (United States)

Kabani, Mehdi; Melki, Ronald

2011-01-01

Yeast prions are self-perpetuating protein aggregates that are at the origin of heritable and transmissible non-Mendelian phenotypic traits. Among these, [PSI+], [URE3] and [PIN+] are the most well documented prions and arise from the assembly of Sup35p, Ure2p and Rnq1p, respectively, into insoluble fibrillar assemblies. Fibril assembly depends on the presence of N- or C-terminal prion domains (PrDs) which are not homologous in sequence but share unusual amino-acid compositions, such as enrichment in polar residues (glutamines and asparagines) or the presence of oligopeptide repeats. Purified PrDs form amyloid fibrils that can convert prion-free cells to the prion state upon transformation. Nonetheless, isolated PrDs and full-length prion proteins have different aggregation, structural and infectious properties. In addition, mutations in the "non-prion" domains (non-PrDs) of Sup35p, Ure2p and Rnq1p were shown to affect their prion properties in vitro and in vivo. Despite these evidences, the implication of the functional non-PrDs in fibril assembly and prion propagation has been mostly overlooked. In this review, we discuss the contribution of non-PrDs to prion assemblies, and the structure-function relationship in prion infectivity in the light of recent findings on Sup35p and Ure2p assembly into infectious fibrils from our laboratory and others.

Methylenetetrahydrofolate reductase gene polymorphism in type 1 ...

African Journals Online (AJOL)

In patients with type-I diabetes mellitus folate deficiency is associated with endothelial dysfunction. So, polymorphism in genes involved in folate metabolism may have a role in vascular disease. This study was designed to evaluate the relationship between methylenetetrahydrofolate reductase (MTHFR) gene polymorphism ...

Neurotoxic Antibodies against the Prion Protein Do Not Trigger Prion Replication.

Directory of Open Access Journals (Sweden)

Karl Frontzek

Full Text Available Prions are the infectious agents causing transmissible spongiform encephalopathies (TSE, progressive, inexorably lethal neurological diseases. Antibodies targeting the globular domain (GD of the cellular prion protein PrPC trigger a neurotoxic syndrome morphologically and molecularly similar to prion disease. This phenomenon raises the question whether such antibodies induce infectious prions de novo. Here we exposed cerebellar organotypic cultured slices (COCS to the neurotoxic antibody, POM1. We then inoculated COCS homogenates into tga20 mice, which overexpress PrPC and are commonly utilized as sensitive indicators of prion infectivity. None of the mice inoculated with COCS-derived lysates developed any signs of disease, and all mice survived for at least 200 days post-inoculation. In contrast, all mice inoculated with bona fide prions succumbed to TSE after 55-95 days. Post-mortem analyses did not reveal any signs of prion pathology in mice inoculated with POM1-COCS lysates. Also, lysates from POM1-exposed COCS were unable to convert PrP by quaking. Hence, anti-GD antibodies do not catalyze the generation of prion infectivity. These data indicate that prion replication can be separated from prion toxicity, and suggest that anti-GD antibodies exert toxicity by acting downstream of prion replication.

Yeast and Fungal Prions: Amyloid-Handling Systems, Amyloid Structure, and Prion Biology.

Science.gov (United States)

Wickner, R B; Edskes, H K; Gorkovskiy, A; Bezsonov, E E; Stroobant, E E

2016-01-01

Yeast prions (infectious proteins) were discovered by their outré genetic properties and have become important models for an array of human prion and amyloid diseases. A single prion protein can become any of many distinct amyloid forms (called prion variants or strains), each of which is self-propagating, but with different biological properties (eg, lethal vs mild). The folded in-register parallel β sheet architecture of the yeast prion amyloids naturally suggests a mechanism by which prion variant information can be faithfully transmitted for many generations. The yeast prions rely on cellular chaperones for their propagation, but can be cured by various chaperone imbalances. The Btn2/Cur1 system normally cures most variants of the [URE3] prion that arise. Although most variants of the [PSI+] and [URE3] prions are toxic or lethal, some are mild in their effects. Even the most mild forms of these prions are rare in the wild, indicating that they too are detrimental to yeast. The beneficial [Het-s] prion of Podospora anserina poses an important contrast in its structure, biology, and evolution to the yeast prions characterized thus far. Copyright © 2016 Elsevier Inc. All rights reserved.

Prion protein amyloidosis with divergent phenotype associated with two novel nonsense mutations in PRNP

NARCIS (Netherlands)

Jansen, Casper; Parchi, Piero; Capellari, Sabina; Vermeij, Ad J.; Corrado, Patrizia; Baas, Frank; Strammiello, Rosaria; van Gool, Willem A.; van Swieten, John C.; Rozemuller, Annemieke J. M.

2010-01-01

Stop codon mutations in the gene encoding the prion protein (PRNP) are very rare and have thus far only been described in two patients with prion protein cerebral amyloid angiopathy (PrP-CAA). In this report, we describe the clinical, histopathological and pathological prion protein (PrPSc)

Prion infections and anti-PrP antibodies trigger converging neurotoxic pathways.

Directory of Open Access Journals (Sweden)

Uli S Herrmann

2015-02-01

Full Text Available Prions induce lethal neurodegeneration and consist of PrPSc, an aggregated conformer of the cellular prion protein PrPC. Antibody-derived ligands to the globular domain of PrPC (collectively termed GDL are also neurotoxic. Here we show that GDL and prion infections activate the same pathways. Firstly, both GDL and prion infection of cerebellar organotypic cultured slices (COCS induced the production of reactive oxygen species (ROS. Accordingly, ROS scavenging, which counteracts GDL toxicity in vitro and in vivo, prolonged the lifespan of prion-infected mice and protected prion-infected COCS from neurodegeneration. Instead, neither glutamate receptor antagonists nor inhibitors of endoplasmic reticulum calcium channels abolished neurotoxicity in either model. Secondly, antibodies against the flexible tail (FT of PrPC reduced neurotoxicity in both GDL-exposed and prion-infected COCS, suggesting that the FT executes toxicity in both paradigms. Thirdly, the PERK pathway of the unfolded protein response was activated in both models. Finally, 80% of transcriptionally downregulated genes overlapped between prion-infected and GDL-treated COCS. We conclude that GDL mimic the interaction of PrPSc with PrPC, thereby triggering the downstream events characteristic of prion infection.

Prion pathogenesis is unaltered in the absence of SIRPα-mediated "don't-eat-me" signaling.

Directory of Open Access Journals (Sweden)

Mario Nuvolone

Full Text Available Prion diseases are neurodegenerative conditions caused by misfolding of the prion protein, leading to conspicuous neuronal loss and intense microgliosis. Recent experimental evidence point towards a protective role of microglia against prion-induced neurodegeneration, possibly through elimination of prion-containing apoptotic bodies. The molecular mechanisms by which microglia recognize and eliminate apoptotic cells in the context of prion diseases are poorly defined. Here we investigated the possible involvement of signal regulatory protein α (SIRPα, a key modulator of host cell phagocytosis; SIRPα is encoded by the Sirpa gene that is genetically linked to the prion gene Prnp. We found that Sirpa transcripts are highly enriched in microglia cells within the brain. However, Sirpa mRNA levels were essentially unaltered during the course of experimental prion disease despite upregulation of other microglia-enriched transcripts. To study the involvement of SIRPα in prion pathogenesis in vivo, mice expressing a truncated SIRPα protein unable to inhibit phagocytosis were inoculated with rodent-adapted scrapie prions of the 22L strain. Homozygous and heterozygous Sirpa mutants and wild-type mice experienced similar incubation times after inoculation with either of two doses of 22L prions. Moreover, the extent of neuronal loss, microgliosis and abnormal prion protein accumulation was not significantly affected by Sirpa genotypes. Collectively, these data indicate that SIRPα-mediated phagocytosis is not a major determinant in prion disease pathogenesis. It will be important to search for additional candidates mediating prion phagocytosis, as this mechanism may represent an important target of antiprion therapies.

Mammalian prions

Science.gov (United States)

Salamat, Muhammad Khalid; Munoz-Montesino, Carola; Moudjou, Mohammed; Rezaei, Human; Laude, Hubert; Béringue, Vincent; Dron, Michel

2013-01-01

Upon prion infection, abnormal prion protein (PrPSc) self-perpetuate by conformational conversion of α-helix-rich PrPC into β sheet enriched form, leading to formation and deposition of PrPSc aggregates in affected brains. However the process remains poorly understood at the molecular level and the regions of PrP critical for conversion are still debated. Minimal amino acid substitutions can impair prion replication at many places in PrP. Conversely, we recently showed that bona fide prions could be generated after introduction of eight and up to 16 additional amino acids in the H2-H3 inter-helix loop of PrP. Prion replication also accommodated the insertions of an octapeptide at different places in the last turns of H2. This reverse genetic approach reveals an unexpected tolerance of prions to substantial sequence changes in the protease-resistant part which is associated with infectivity. It also demonstrates that conversion does not require the presence of a specific sequence in the middle of the H2-H3 area. We discuss the implications of our findings according to different structural models proposed for PrPSc and questioned the postulated existence of an N- or C-terminal prion domain in the protease-resistant region. PMID:23232499

Gene polymorphisms in chronic periodontitis

NARCIS (Netherlands)

Laine, M.L.; Loos, B.G.; Crielaard, W.

2010-01-01

We aimed to conduct a review of the literature for gene polymorphisms associated with chronic periodontitis (CP) susceptibility. A comprehensive search of the literature in English was performed using the keywords: periodontitis, periodontal disease, combined with the words genes, mutation, or

gene polymorphism and its serum lev

Indian Academy of Sciences (India)

Navya

polymorphisms and its serum level with the risk of MetS as well as their ... population for quantifying insulin resistance and β-cell function (Matthews et al. 1985). .... of IL-10 -819 C >T gene polymorphism (Co-dominant model) was significantly.

Correlation between the Insertion/Deletion Mutations of Prion Protein Gene and BSE Susceptibility and Milk Performance in Dairy Cows

Directory of Open Access Journals (Sweden)

Hu Shen-rong

2013-12-01

Full Text Available Objective To investigate the 23 bp and 12 bp insertion/deletion (indel mutations within the bovine prion protein (PRNP gene in Chinese dairy cows, and to detect the associations of two indel mutations with BSE susceptibility and milk performance.

Genomic assessment of the evolution of the prion protein gene family in vertebrates.

Science.gov (United States)

Harrison, Paul M; Khachane, Amit; Kumar, Manish

2010-05-01

Prion diseases are devastating neurological disorders caused by the propagation of particles containing an alternative beta-sheet-rich form of the prion protein (PrP). Genes paralogous to PrP, called Doppel and Shadoo, have been identified, that also have neuropathological relevance. To aid in the further functional characterization of PrP and its relatives, we annotated completely the PrP gene family (PrP-GF), in the genomes of 42 vertebrates, through combined strategic application of gene prediction programs and advanced remote homology detection techniques (such as HMMs, PSI-TBLASTN and pGenThreader). We have uncovered several previously undescribed paralogous genes and pseudogenes. We find that current high-quality genomic evidence indicates that the PrP relative Doppel, was likely present in the last common ancestor of present-day Tetrapoda, but was lost in the bird lineage, since its divergence from reptiles. Using the new gene annotations, we have defined the consensus of structural features that are characteristic of the PrP and Doppel structures, across diverse Tetrapoda clades. Furthermore, we describe in detail a transcribed pseudogene derived from Shadoo that is conserved across primates, and that overlaps the meiosis gene, SYCE1, thus possibly regulating its expression. In addition, we analysed the locus of PRNP/PRND for significant conservation across the genomic DNA of eleven mammals, and determined the phylogenetic penetration of non-coding exons. The genomic evidence indicates that the second PRNP non-coding exon found in even-toed ungulates and rodents, is conserved in all high-coverage genome assemblies of primates (human, chimp, orang utan and macaque), and is, at least, likely to have fallen out of use during primate speciation. Furthermore, we have demonstrated that the PRNT gene (at the PRNP human locus) is conserved across at least sixteen mammals, and evolves like a long non-coding RNA, fashioned from fragments of ancient, long

Yeast prions and human prion-like proteins: sequence features and prediction methods.

Science.gov (United States)

Cascarina, Sean M; Ross, Eric D

2014-06-01

Prions are self-propagating infectious protein isoforms. A growing number of prions have been identified in yeast, each resulting from the conversion of soluble proteins into an insoluble amyloid form. These yeast prions have served as a powerful model system for studying the causes and consequences of prion aggregation. Remarkably, a number of human proteins containing prion-like domains, defined as domains with compositional similarity to yeast prion domains, have recently been linked to various human degenerative diseases, including amyotrophic lateral sclerosis. This suggests that the lessons learned from yeast prions may help in understanding these human diseases. In this review, we examine what has been learned about the amino acid sequence basis for prion aggregation in yeast, and how this information has been used to develop methods to predict aggregation propensity. We then discuss how this information is being applied to understand human disease, and the challenges involved in applying yeast prediction methods to higher organisms.

Ssb1 chaperone is a [PSI+] prion-curing factor.

Science.gov (United States)

Chacinska, A; Szczesniak, B; Kochneva-Pervukhova, N V; Kushnirov, V V; Ter-Avanesyan, M D; Boguta, M

2001-04-01

Yeast SUP7' or SUP11 nonsense suppressors have no phenotypic expression in strains deficient in the isopentenylation of A37 in tRNA. Here we show that such strains spontaneously produce cells with a nonsense suppressor phenotype which is related to the cytoplasmically inherited determinant and manifests all the key features of the [PSI+] prion. A screen of a multicopy yeast genomic library for genes that inactivate the [PSI+]-related suppressor phenotype resulted in the isolation of the SSB1 gene. Moreover, we demonstrate that multicopy plasmid encoding the Ssb1 chaperone cures cells of the [PSI+] prion.

Ex vivo mammalian prions are formed of paired double helical prion protein fibrils.

Science.gov (United States)

Terry, Cassandra; Wenborn, Adam; Gros, Nathalie; Sells, Jessica; Joiner, Susan; Hosszu, Laszlo L P; Tattum, M Howard; Panico, Silvia; Clare, Daniel K; Collinge, John; Saibil, Helen R; Wadsworth, Jonathan D F

2016-05-01

Mammalian prions are hypothesized to be fibrillar or amyloid forms of prion protein (PrP), but structures observed to date have not been definitively correlated with infectivity and the three-dimensional structure of infectious prions has remained obscure. Recently, we developed novel methods to obtain exceptionally pure preparations of prions from mouse brain and showed that pathogenic PrP in these high-titre preparations is assembled into rod-like assemblies. Here, we have used precise cell culture-based prion infectivity assays to define the physical relationship between the PrP rods and prion infectivity and have used electron tomography to define their architecture. We show that infectious PrP rods isolated from multiple prion strains have a common hierarchical assembly comprising twisted pairs of short fibres with repeating substructure. The architecture of the PrP rods provides a new structural basis for understanding prion infectivity and can explain the inability to systematically generate high-titre synthetic prions from recombinant PrP. © 2016 The Authors.

Differential overexpression of SERPINA3 in human prion diseases.

Science.gov (United States)

Vanni, S; Moda, F; Zattoni, M; Bistaffa, E; De Cecco, E; Rossi, M; Giaccone, G; Tagliavini, F; Haïk, S; Deslys, J P; Zanusso, G; Ironside, J W; Ferrer, I; Kovacs, G G; Legname, G

2017-11-15

Prion diseases are fatal neurodegenerative disorders with sporadic, genetic or acquired etiologies. The molecular alterations leading to the onset and the spreading of these diseases are still unknown. In a previous work we identified a five-gene signature able to distinguish intracranially BSE-infected macaques from healthy ones, with SERPINA3 showing the most prominent dysregulation. We analyzed 128 suitable frontal cortex samples, from prion-affected patients (variant Creutzfeldt-Jakob disease (vCJD) n = 20, iatrogenic CJD (iCJD) n = 11, sporadic CJD (sCJD) n = 23, familial CJD (gCJD) n = 17, fatal familial insomnia (FFI) n = 9, Gerstmann-Sträussler-Scheinker syndrome (GSS)) n = 4), patients with Alzheimer disease (AD, n = 14) and age-matched controls (n = 30). Real Time-quantitative PCR was performed for SERPINA3 transcript, and ACTB, RPL19, GAPDH and B2M were used as reference genes. We report SERPINA3 to be strongly up-regulated in the brain of all human prion diseases, with only a mild up-regulation in AD. We show that this striking up-regulation, both at the mRNA and at the protein level, is present in all types of human prion diseases analyzed, although to a different extent for each specific disorder. Our data suggest that SERPINA3 may be involved in the pathogenesis and the progression of prion diseases, representing a valid tool for distinguishing different forms of these disorders in humans.

Prions and lymphoid organs

Science.gov (United States)

O’Connor, Tracy; Aguzzi, Adriano

2013-01-01

Prion colonization of secondary lymphoid organs (SLOs) is a critical step preceding neuroinvasion in prion pathogenesis. Follicular dendritic cells (FDCs), which depend on both tumor necrosis factor receptor 1 (TNFR1) and lymphotoxin β receptor (LTβR) signaling for maintenance, are thought to be the primary sites of prion accumulation in SLOs. However, prion titers in RML-infected TNFR1−/− lymph nodes and rates of neuroinvasion in TNFR1−/− mice remain high despite the absence of mature FDCs. Recently, we discovered that TNFR1-independent prion accumulation in lymph nodes relies on LTβR signaling. Loss of LTβR signaling in TNFR1−/− lymph nodes coincided with the de-differentiation of high endothelial venules (HEVs)—the primary sites of lymphocyte entry into lymph nodes. These findings suggest that HEVs are the sites through which prions initially invade lymph nodes from the bloodstream. Identification of HEVs as entry portals for prions clarifies a number of previous observations concerning peripheral prion pathogenesis. However, a number of questions still remain: What is the mechanism by which prions are taken up by HEVs? Which cells are responsible for delivering prions to lymph nodes? Are HEVs the main entry site for prions into lymph nodes or do alternative routes also exist? These questions and others are considered in this article. PMID:23357827

Gene and protein patterns of potential prion-related markers in the central nervous system of clinical and preclinical infected sheep

Science.gov (United States)

2013-01-01

The molecular pathogenic mechanisms of prion diseases are far from clear. Genomic analyses have revealed genetic biomarkers potentially involved in prion neuropathology in naturally scrapie-infected sheep, a good animal model of infectious prionopathies. However, these biomarkers must be validated in independent studies at different stages of the disease. The gene and protein expression profiles and protein distribution of six potential genetic biomarkers (i.e., CAPN6, COL1A2, COL3A1, GALA1, MT2A and MTNR1B) are presented here for both the early and terminal stages of scrapie in five different brain regions. Gene transcription changes were confirmed in the medulla oblongata, and the expression profiles were generally similar in other central nervous system regions. The changes were more substantial in clinical animals compared to preclinical animals. The expression of the CAPN6 protein increased in the spinal cord and cerebellum of the clinical and preclinical brains. The distribution of the GALA1 was identified in glial cells from the cerebellum of scrapie-infected animals, GALA1 protein expression was increased in clinical animals in the majority of regions, and the increase of MT2A was in agreement with previous reports. The downregulation of MTNR1B was especially marked in the Purkinje cells. Finally, although collagen genes were downregulated the protein immunostaining did not reveal significant changes between the scrapie-infected and control animals. In conclusion, this study of gene transcription and protein expression and distribution confirm CAPN6, GALA1, MTNR1B and MT2A as potential targets for further prion disease research. PMID:23497022

Polymorphism of the VEGF gene and its association with growth ...

African Journals Online (AJOL)

User

Keywords: VEGF gene, caprine, single nucleotide polymorphism (SNP), genetic variation, PCR-SSCP ... This field is strongly focusing on gene loci and polymorphisms that have ..... Enhance the efficiency of single-strand conformation polymorphism analysis by short polyacrylamide gel and modified silver staining. Anal.

Protease-sensitive synthetic prions.

Directory of Open Access Journals (Sweden)

David W Colby

2010-01-01

Full Text Available Prions arise when the cellular prion protein (PrP(C undergoes a self-propagating conformational change; the resulting infectious conformer is designated PrP(Sc. Frequently, PrP(Sc is protease-resistant but protease-sensitive (s prions have been isolated in humans and other animals. We report here that protease-sensitive, synthetic prions were generated in vitro during polymerization of recombinant (rec PrP into amyloid fibers. In 22 independent experiments, recPrP amyloid preparations, but not recPrP monomers or oligomers, transmitted disease to transgenic mice (n = 164, denoted Tg9949 mice, that overexpress N-terminally truncated PrP. Tg9949 control mice (n = 174 did not spontaneously generate prions although they were prone to late-onset spontaneous neurological dysfunction. When synthetic prion isolates from infected Tg9949 mice were serially transmitted in the same line of mice, they exhibited sPrP(Sc and caused neurodegeneration. Interestingly, these protease-sensitive prions did not shorten the life span of Tg9949 mice despite causing extensive neurodegeneration. We inoculated three synthetic prion isolates into Tg4053 mice that overexpress full-length PrP; Tg4053 mice are not prone to developing spontaneous neurological dysfunction. The synthetic prion isolates caused disease in 600-750 days in Tg4053 mice, which exhibited sPrP(Sc. These novel synthetic prions demonstrate that conformational changes in wild-type PrP can produce mouse prions composed exclusively of sPrP(Sc.

An insight into the complex prion-prion interaction network in the budding yeast Saccharomyces cerevisiae.

Science.gov (United States)

Du, Zhiqiang; Valtierra, Stephanie; Li, Liming

2014-01-01

The budding yeast Saccharomyces cerevisiae is a valuable model system for studying prion-prion interactions as it contains multiple prion proteins. A recent study from our laboratory showed that the existence of Swi1 prion ([SWI(+)]) and overproduction of Swi1 can have strong impacts on the formation of 2 other extensively studied yeast prions, [PSI(+)] and [PIN(+)] ([RNQ(+)]) (Genetics, Vol. 197, 685-700). We showed that a single yeast cell is capable of harboring at least 3 heterologous prion elements and these prions can influence each other's appearance positively and/or negatively. We also showed that during the de novo [PSI(+)] formation process upon Sup35 overproduction, the aggregation patterns of a preexisting inducer ([RNQ(+)] or [SWI(+)]) can undergo significant remodeling from stably transmitted dot-shaped aggregates to aggregates that co-localize with the newly formed Sup35 aggregates that are ring/ribbon/rod- shaped. Such co-localization disappears once the newly formed [PSI(+)] prion stabilizes. Our finding provides strong evidence supporting the "cross-seeding" model for prion-prion interactions and confirms earlier reports that the interactions among different prions and their prion proteins mostly occur at the initiation stages of prionogenesis. Our results also highlight a complex prion interaction network in yeast. We believe that elucidating the mechanism underlying the yeast prion-prion interaction network will not only provide insight into the process of prion de novo generation and propagation in yeast but also shed light on the mechanisms that govern protein misfolding, aggregation, and amyloidogenesis in higher eukaryotes.

Destabilization and recovery of a yeast prion after mild heat shock.

Science.gov (United States)

Newnam, Gary P; Birchmore, Jennifer L; Chernoff, Yury O

2011-05-06

Yeast prion [PSI(+)] is a self-perpetuating amyloid of the translational termination factor Sup35. Although [PSI(+)] propagation is modulated by heat shock proteins (Hsps), high temperature was previously reported to have little or no effect on [PSI(+)]. Our results show that short-term exposure of exponentially growing yeast culture to mild heat shock, followed by immediate resumption of growth, leads to [PSI(+)] destabilization, sometimes persisting for several cell divisions after heat shock. Prion loss occurring in the first division after heat shock is preferentially detected in a daughter cell, indicating the impairment of prion segregation that results in asymmetric prion distribution between a mother cell and a bud. Longer heat shock or prolonged incubation in the absence of nutrients after heat shock led to [PSI(+)] recovery. Both prion destabilization and recovery during heat shock depend on protein synthesis. Maximal prion destabilization coincides with maximal imbalance between Hsp104 and other Hsps such as Hsp70-Ssa. Deletions of individual SSA genes increase prion destabilization and/or counteract recovery. The dynamics of prion aggregation during destabilization and recovery are consistent with the notion that efficient prion fragmentation and segregation require a proper balance between Hsp104 and other (e.g., Hsp70-Ssa) chaperones. In contrast to heat shock, [PSI(+)] destabilization by osmotic stressors does not always depend on cell proliferation and/or protein synthesis, indicating that different stresses may impact the prion via different mechanisms. Our data demonstrate that heat stress causes asymmetric prion distribution in a cell division and confirm that the effects of Hsps on prions are physiologically relevant. Copyright © 2011 Elsevier Ltd. All rights reserved.

Genetic human prion disease modelled in PrP transgenic Drosophila.

Science.gov (United States)

Thackray, Alana M; Cardova, Alzbeta; Wolf, Hanna; Pradl, Lydia; Vorberg, Ina; Jackson, Walker S; Bujdoso, Raymond

2017-09-20

Inherited human prion diseases, such as fatal familial insomnia (FFI) and familial Creutzfeldt-Jakob disease (fCJD), are associated with autosomal dominant mutations in the human prion protein gene PRNP and accumulation of PrP Sc , an abnormal isomer of the normal host protein PrP C , in the brain of affected individuals. PrP Sc is the principal component of the transmissible neurotoxic prion agent. It is important to identify molecular pathways and cellular processes that regulate prion formation and prion-induced neurotoxicity. This will allow identification of possible therapeutic interventions for individuals with, or at risk from, genetic human prion disease. Increasingly, Drosophila has been used to model human neurodegenerative disease. An important unanswered question is whether genetic prion disease with concomitant spontaneous prion formation can be modelled in Drosophila We have used pUAST/PhiC31-mediated site-directed mutagenesis to generate Drosophila transgenic for murine or hamster PrP (prion protein) that carry single-codon mutations associated with genetic human prion disease. Mouse or hamster PrP harbouring an FFI (D178N) or fCJD (E200K) mutation showed mild Proteinase K resistance when expressed in Drosophila Adult Drosophila transgenic for FFI or fCJD variants of mouse or hamster PrP displayed a spontaneous decline in locomotor ability that increased in severity as the flies aged. Significantly, this mutant PrP-mediated neurotoxic fly phenotype was transferable to recipient Drosophila that expressed the wild-type form of the transgene. Collectively, our novel data are indicative of the spontaneous formation of a PrP-dependent neurotoxic phenotype in FFI- or CJD-PrP transgenic Drosophila and show that inherited human prion disease can be modelled in this invertebrate host. © 2017 The Author(s).

Rebels with a cause: molecular features and physiological consequences of yeast prions.

Science.gov (United States)

Garcia, David M; Jarosz, Daniel F

2014-02-01

Prions are proteins that convert between structurally and functionally distinct states, at least one of which is self-perpetuating. The prion fold templates the conversion of native protein, altering its structure and function, and thus serves as a protein-based element of inheritance. Molecular chaperones ensure that these prion aggregates are divided and faithfully passed from mother cells to their daughters. Prions were originally identified as the cause of several rare neurodegenerative diseases in mammals, but the last decade has brought great progress in understanding their broad importance in biology and evolution. Most prion proteins regulate information flow in signaling networks, or otherwise affect gene expression. Consequently, switching into and out of prion states creates diverse new traits – heritable changes based on protein structure rather than nucleic acid. Despite intense study of the molecular mechanisms of this paradigm-shifting, epigenetic mode of inheritance, many key questions remain. Recent studies in yeast that support the view that prions are common, often beneficial elements of inheritance that link environmental stress to the appearance of new traits.

De novo generation of infectious prions with bacterially expressed recombinant prion protein.

Science.gov (United States)

Zhang, Zhihong; Zhang, Yi; Wang, Fei; Wang, Xinhe; Xu, Yuanyuan; Yang, Huaiyi; Yu, Guohua; Yuan, Chonggang; Ma, Jiyan

2013-12-01

The prion hypothesis is strongly supported by the fact that prion infectivity and the pathogenic conformer of prion protein (PrP) are simultaneously propagated in vitro by the serial protein misfolding cyclic amplification (sPMCA). However, due to sPMCA's enormous amplification power, whether an infectious prion can be formed de novo with bacterially expressed recombinant PrP (rPrP) remains to be satisfactorily resolved. To address this question, we performed unseeded sPMCA with rPrP in a laboratory that has never been exposed to any native prions. Two types of proteinase K (PK)-resistant and self-perpetuating recombinant PrP conformers (rPrP-res) with PK-resistant cores of 17 or 14 kDa were generated. A bioassay revealed that rPrP-res(17kDa) was highly infectious, causing prion disease in wild-type mice with an average survival time of about 172 d. In contrast, rPrP-res(14kDa) completely failed to induce any disease. Our findings reveal that sPMCA is sufficient to initiate various self-perpetuating PK-resistant rPrP conformers, but not all of them possess in vivo infectivity. Moreover, generating an infectious prion in a prion-free environment establishes that an infectious prion can be formed de novo with bacterially expressed rPrP.

A systematic investigation of production of synthetic prions from recombinant prion protein.

Science.gov (United States)

Schmidt, Christian; Fizet, Jeremie; Properzi, Francesca; Batchelor, Mark; Sandberg, Malin K; Edgeworth, Julie A; Afran, Louise; Ho, Sammy; Badhan, Anjna; Klier, Steffi; Linehan, Jacqueline M; Brandner, Sebastian; Hosszu, Laszlo L P; Tattum, M Howard; Jat, Parmjit; Clarke, Anthony R; Klöhn, Peter C; Wadsworth, Jonathan D F; Jackson, Graham S; Collinge, John

2015-12-01

According to the protein-only hypothesis, infectious mammalian prions, which exist as distinct strains with discrete biological properties, consist of multichain assemblies of misfolded cellular prion protein (PrP). A critical test would be to produce prion strains synthetically from defined components. Crucially, high-titre 'synthetic' prions could then be used to determine the structural basis of infectivity and strain diversity at the atomic level. While there have been multiple reports of production of prions from bacterially expressed recombinant PrP using various methods, systematic production of high-titre material in a form suitable for structural analysis remains a key goal. Here, we report a novel high-throughput strategy for exploring a matrix of conditions, additives and potential cofactors that might generate high-titre prions from recombinant mouse PrP, with screening for infectivity using a sensitive automated cell-based bioassay. Overall, approximately 20,000 unique conditions were examined. While some resulted in apparently infected cell cultures, this was transient and not reproducible. We also adapted published methods that reported production of synthetic prions from recombinant hamster PrP, but again did not find evidence of significant infectious titre when using recombinant mouse PrP as substrate. Collectively, our findings are consistent with the formation of prion infectivity from recombinant mouse PrP being a rare stochastic event and we conclude that systematic generation of prions from recombinant PrP may only become possible once the detailed structure of authentic ex vivo prions is solved. © 2015 The Authors.

gene polymorphism and its serum lev

Indian Academy of Sciences (India)

Navya

Association of Interleukin-10 (-1082 A>G, -819 C >T and -592 C >A) gene polymorphism and its ... Th2 induced component of anti-β cell immunity is mediated principally by IL-10 (Lee et al. ..... promoter polymorphisms influence the clinical outcome of diffuse large B-cell lymphoma. ... Bone Marrow Transplant 36, 1089-1095.

PrionScan: an online database of predicted prion domains in complete proteomes.

Science.gov (United States)

Espinosa Angarica, Vladimir; Angulo, Alfonso; Giner, Arturo; Losilla, Guillermo; Ventura, Salvador; Sancho, Javier

2014-02-05

Prions are a particular type of amyloids related to a large variety of important processes in cells, but also responsible for serious diseases in mammals and humans. The number of experimentally characterized prions is still low and corresponds to a handful of examples in microorganisms and mammals. Prion aggregation is mediated by specific protein domains with a remarkable compositional bias towards glutamine/asparagine and against charged residues and prolines. These compositional features have been used to predict new prion proteins in the genomes of different organisms. Despite these efforts, there are only a few available data sources containing prion predictions at a genomic scale. Here we present PrionScan, a new database of predicted prion-like domains in complete proteomes. We have previously developed a predictive methodology to identify and score prionogenic stretches in protein sequences. In the present work, we exploit this approach to scan all the protein sequences in public databases and compile a repository containing relevant information of proteins bearing prion-like domains. The database is updated regularly alongside UniprotKB and in its present version contains approximately 28000 predictions in proteins from different functional categories in more than 3200 organisms from all the taxonomic subdivisions. PrionScan can be used in two different ways: database query and analysis of protein sequences submitted by the users. In the first mode, simple queries allow to retrieve a detailed description of the properties of a defined protein. Queries can also be combined to generate more complex and specific searching patterns. In the second mode, users can submit and analyze their own sequences. It is expected that this database would provide relevant insights on prion functions and regulation from a genome-wide perspective, allowing researches performing cross-species prion biology studies. Our database might also be useful for guiding experimentalists

Prion protein immunocytochemistry helps to establish the true incidence of prion diseases.

Science.gov (United States)

Lantos, P L; McGill, I S; Janota, I; Doey, L J; Collinge, J; Bruce, M T; Whatley, S A; Anderton, B H; Clinton, J; Roberts, G W

1992-11-23

Creutzfeldt-Jakob disease (CJD) and Gerstmann-Strüssler-Scheinker disease (GSSD) are transmissible spongiform encephalopathies or prion diseases affecting man. It has been reported that prion diseases may occur without the histological hallmarks of spongiform encephalopathies: vacuolation of the cerebral grey matter, neuronal loss and astrocytosis. These cases without characteristic neuropathology may go undiagnosed and consequently the true incidence of transmissible dementias is likely to have been under-estimated. Immunocytochemistry using antibodies to prion protein gives positive staining of these cases, albeit the pattern of immunostaining differs from that seen in typical forms. Accumulation of prion protein is a molecular hallmark of prion diseases, and thus a reproducible, speedy and cost-efficient immunocytochemical screening of unusual dementias may help to establish the true incidence of prion diseases.

Brain transcriptional stability upon prion protein-encoding gene invalidation in zygotic or adult mouse

Directory of Open Access Journals (Sweden)

Béringue Vincent

2010-07-01

Full Text Available Abstract Background The physiological function of the prion protein remains largely elusive while its key role in prion infection has been expansively documented. To potentially assess this conundrum, we performed a comparative transcriptomic analysis of the brain of wild-type mice with that of transgenic mice invalidated at this locus either at the zygotic or at the adult stages. Results Only subtle transcriptomic differences resulting from the Prnp knockout could be evidenced, beside Prnp itself, in the analyzed adult brains following microarray analysis of 24 109 mouse genes and QPCR assessment of some of the putatively marginally modulated loci. When performed at the adult stage, neuronal Prnp disruption appeared to sequentially induce a response to an oxidative stress and a remodeling of the nervous system. However, these events involved only a limited number of genes, expression levels of which were only slightly modified and not always confirmed by RT-qPCR. If not, the qPCR obtained data suggested even less pronounced differences. Conclusions These results suggest that the physiological function of PrP is redundant at the adult stage or important for only a small subset of the brain cell population under classical breeding conditions. Following its early reported embryonic developmental regulation, this lack of response could also imply that PrP has a more detrimental role during mouse embryogenesis and that potential transient compensatory mechanisms have to be searched for at the time this locus becomes transcriptionally activated.

Sheep scrapie susceptibility-linked polymorphisms do not modulate the initial binding of cellular to disease-associated prion protein prior to conversion

NARCIS (Netherlands)

Rigter, A.; Bossers, A.

2005-01-01

Conversion of the host-encoded protease-sensitive cellular prion protein (PrPC) into the scrapie-associated protease-resistant isoform (PrPSc) of prion protein (PrP) is the central event in transmissible spongiform encephalopathies or prion diseases. Differences in transmissibility and

Gene-gene interactions and gene polymorphisms of VEGFA and EG-VEGF gene systems in recurrent pregnancy loss.

Science.gov (United States)

Su, Mei-Tsz; Lin, Sheng-Hsiang; Chen, Yi-Chi; Kuo, Pao-Lin

2014-06-01

Both vascular endothelial growth factor A (VEGFA) and endocrine gland-derived vascular endothelial growth factor (EG-VEGF) systems play major roles in angiogenesis. A body of evidence suggests VEGFs regulate critical processes during pregnancy and have been associated with recurrent pregnancy loss (RPL). However, little information is available regarding the interaction of these two major major angiogenesis-related systems in early human pregnancy. This study was conducted to investigate the association of gene polymorphisms and gene-gene interaction among genes in VEGFA and EG-VEGF systems and idiopathic RPL. A total of 98 women with history of idiopathic RPL and 142 controls were included, and 5 functional SNPs selected from VEGFA, KDR, EG-VEGF (PROK1), PROKR1 and PROKR2 were genotyped. We used multifactor dimensionality reduction (MDR) analysis to choose a best model and evaluate gene-gene interactions. Ingenuity pathways analysis (IPA) was introduced to explore possible complex interactions. Two receptor gene polymorphisms [KDR (Q472H) and PROKR2 (V331M)] were significantly associated with idiopathic RPL (P<0.01). The MDR test revealed that the KDR (Q472H) polymorphism was the best loci to be associated with RPL (P=0.02). IPA revealed EG-VEGF and VEGFA systems shared several canonical signaling pathways that may contribute to gene-gene interactions, including the Akt, IL-8, EGFR, MAPK, SRC, VHL, HIF-1A and STAT3 signaling pathways. Two receptor gene polymorphisms [KDR (Q472H) and PROKR2 (V331M)] were significantly associated with idiopathic RPL. EG-VEGF and VEGFA systems shared several canonical signaling pathways that may contribute to gene-gene interactions, including the Akt, IL-8, EGFR, MAPK, SRC, VHL, HIF-1A and STAT3.

Porcine prion protein amyloid.

Science.gov (United States)

Hammarström, Per; Nyström, Sofie

2015-01-01

Mammalian prions are composed of misfolded aggregated prion protein (PrP) with amyloid-like features. Prions are zoonotic disease agents that infect a wide variety of mammalian species including humans. Mammals and by-products thereof which are frequently encountered in daily life are most important for human health. It is established that bovine prions (BSE) can infect humans while there is no such evidence for any other prion susceptible species in the human food chain (sheep, goat, elk, deer) and largely prion resistant species (pig) or susceptible and resistant pets (cat and dogs, respectively). PrPs from these species have been characterized using biochemistry, biophysics and neurobiology. Recently we studied PrPs from several mammals in vitro and found evidence for generic amyloidogenicity as well as cross-seeding fibril formation activity of all PrPs on the human PrP sequence regardless if the original species was resistant or susceptible to prion disease. Porcine PrP amyloidogenicity was among the studied. Experimentally inoculated pigs as well as transgenic mouse lines overexpressing porcine PrP have, in the past, been used to investigate the possibility of prion transmission in pigs. The pig is a species with extraordinarily wide use within human daily life with over a billion pigs harvested for human consumption each year. Here we discuss the possibility that the largely prion disease resistant pig can be a clinically silent carrier of replicating prions.

Sexual transmission of the [Het-s] prion leads to meiotic drive in Podospora anserina

NARCIS (Netherlands)

Dalstra, H.J.P.; Swart, K.; Debets, A.J.M.; Saupe, S.J.; Hoekstra, R.F.

2003-01-01

In the filamentous fungus Podospora anserina, two phenomena are associated with polymorphism at the het-s locus, vegetative incompatibility and ascospore abortion. Two het-s alleles occur naturally, het-s and het-S. The het-s encoded protein is a prion propagating as a self-perpetuating amyloid

Recombinant human prion protein inhibits prion propagation in vitro.

Science.gov (United States)

Yuan, Jue; Zhan, Yi-An; Abskharon, Romany; Xiao, Xiangzhu; Martinez, Manuel Camacho; Zhou, Xiaochen; Kneale, Geoff; Mikol, Jacqueline; Lehmann, Sylvain; Surewicz, Witold K; Castilla, Joaquín; Steyaert, Jan; Zhang, Shulin; Kong, Qingzhong; Petersen, Robert B; Wohlkonig, Alexandre; Zou, Wen-Quan

2013-10-09

Prion diseases are associated with the conformational conversion of the cellular prion protein (PrP(C)) into the pathological scrapie isoform (PrP(Sc)) in the brain. Both the in vivo and in vitro conversion of PrP(C) into PrP(Sc) is significantly inhibited by differences in amino acid sequence between the two molecules. Using protein misfolding cyclic amplification (PMCA), we now report that the recombinant full-length human PrP (rHuPrP23-231) (that is unglycosylated and lacks the glycophosphatidylinositol anchor) is a strong inhibitor of human prion propagation. Furthermore, rHuPrP23-231 also inhibits mouse prion propagation in a scrapie-infected mouse cell line. Notably, it binds to PrP(Sc), but not PrP(C), suggesting that the inhibitory effect of recombinant PrP results from blocking the interaction of brain PrP(C) with PrP(Sc). Our findings suggest a new avenue for treating prion diseases, in which a patient's own unglycosylated and anchorless PrP is used to inhibit PrP(Sc) propagation without inducing immune response side effects.

Incunabular Immunological Events in Prion Trafficking

Science.gov (United States)

Michel, Brady; Meyerett-Reid, Crystal; Johnson, Theodore; Ferguson, Adam; Wyckoff, Christy; Pulford, Bruce; Bender, Heather; Avery, Anne; Telling, Glenn; Dow, Steven; Zabel, Mark D.

2012-01-01

While prions probably interact with the innate immune system immediately following infection, little is known about this initial confrontation. Here we investigated incunabular events in lymphotropic and intranodal prion trafficking by following highly enriched, fluorescent prions from infection sites to draining lymph nodes. We detected biphasic lymphotropic transport of prions from the initial entry site upon peripheral prion inoculation. Prions arrived in draining lymph nodes cell autonomously within two hours of intraperitoneal administration. Monocytes and dendritic cells (DCs) required Complement for optimal prion delivery to lymph nodes hours later in a second wave of prion trafficking. B cells constituted the majority of prion-bearing cells in the mediastinal lymph node by six hours, indicating intranodal prion reception from resident DCs or subcapsulary sinus macrophages or directly from follicular conduits. These data reveal novel, cell autonomous prion lymphotropism, and a prominent role for B cells in intranodal prion movement. PMID:22679554

Prion Protein and Aging

Directory of Open Access Journals (Sweden)

Lisa eGasperini

2014-08-01

Full Text Available The cellular prion protein (PrPC has been widely investigated ever since its conformational isoform, the prion (or PrPSc, was identified as the etiological agent of prion disorders. The high homology shared by the PrPC-encoding gene among mammals, its high turnover rate and expression in every tissue strongly suggest that PrPC may possess key physiological functions. Therefore, defining PrPC roles, properties and fate in the physiology of mammalian cells would be fundamental to understand its pathological involvement in prion diseases. Since the incidence of these neurodegenerative disorders is enhanced in aging, understanding PrPC functions in this life phase may be of crucial importance. Indeed, a large body of evidence suggests that PrPC plays a neuroprotective and antioxidant role. Moreover, it has been suggested that PrPC is involved in Alzheimer disease, another neurodegenerative pathology that develops predominantly in the aging population. In prion diseases, PrPC function is likely lost upon protein aggregation occurring in the course of the disease. Additionally, the aging process may alter PrPC biochemical properties, thus influencing its propensity to convert into PrPSc. Both phenomena may contribute to the disease development and progression. In Alzheimer disease, PrPC has a controversial role because its presence seems to mediate β-amyloid toxicity, while its down-regulation correlates with neuronal death. The role of PrPC in aging has been investigated from different perspectives, often leading to contrasting results. The putative protein functions in aging have been studied in relation to memory, behavior and myelin maintenance. In aging mice, PrPC changes in subcellular localization and post-translational modifications have been explored in an attempt to relate them to different protein roles and propensity to convert into PrPSc. Here we provide an overview of the most relevant studies attempting to delineate PrPC functions and

The inhibition of prions through blocking prion conversion by permanently charged branched polyamines of low cytotoxicity.

Science.gov (United States)

Lim, Yong-beom; Mays, Charles E; Kim, Younghwan; Titlow, William B; Ryou, Chongsuk

2010-03-01

Branched polyamines are effective in inhibiting prions in a cationic surface charge density dependent manner. However, toxicity associated with branched polyamines, in general, often hampers the successful application of the compounds to treat prion diseases. Here, we report that constitutively maintained cationic properties in branched polyamines reduced the intrinsic toxicity of the compounds while retaining the anti-prion activities. In prion-infected neuroblastoma cells, quaternization of amines in polyethyleneimine (PEI) and polyamidoamine (PAMAM) dendrimers markedly increased the nontoxic concentration ranges of the compounds and still supported, albeit reduced, an appreciable level of anti-prion activity in clearing prions from the infected cells. Furthermore, quaternized PEI was able to degrade prions at acidic pH conditions and inhibit the in vitro prion propagation facilitated by conversion of the normal prion protein isoform to its misfolded counterpart, although such activities were decreased by quaternization. Quaternized PAMAM was least effective in degrading prions but efficiently inhibited prion conversion with the same efficacy as unmodified PAMAM. Our results suggest that quaternization represents an effective strategy for developing nontoxic branched polyamines with potent anti-prion activity. This study highlights the importance of polyamine structural control for developing polyamine-based anti-prion agents and understanding of an action mechanism of quaternized branched polyamines. Copyright (c) 2009 Elsevier Ltd. All rights reserved.

Serotonin transporter (SERT gene polymorphism in Parkinson’s disease

Directory of Open Access Journals (Sweden)

Mahmut Özkaya

2004-06-01

Full Text Available Background: Parkinson disease (PD is the second most common neurodegenerative disorder with a prevalence of about 2% in persons older than 65 years of age. Neurodegenerative process in PD is not restricted to the dopaminergic neurons of the substantia nigra but also affects serotoninergic neurons. It has been shown that PD brains with Lewy bodies in the substantia nigra also had Lewy bodies in the raphe nuclei. The re-uptake of 5HT released into the synaptic cleft is mediated by the 5HT transporter (SERT. The SERT gene has been mapped to the chromosome of 17q11.1-q12 and has two main polymorphisms: intron two VNTR polymorphism and promoter region 44 bp insertion/deletion polymorphism. Objective: In this study we investigated whether two polymorphic regions in the serotonin transporter gene are associated with PD. Material and Method: After obtaining informed consent, blood samples were collected from 76 patients and 54 healthy volunteers. Genomic DNA was extracted from peripheral leucocytes using standard methods. The SERT gene genotypes were determined using polymerase chain reaction (PCR method. Results: Based on the intron 2 VNTR polymorphism of SERT gene, the distribution of 12/12, 12/10 and 10/10 genotypes were found as, 56.6 %, 35.5 %, 7.9 % in patients whereas this genotype distribution in control group was 40.7 %, 46.3 % and 13 %, respectively. According to 5-HTTLPR polymorphism, the distribution of L/L, L/S and S/S genotypes were found as 27.6 % 51.3 % and 21.1 % in patients whereas this genotype distribution in control group was 33.4 %, 50.0 % and 16.6 %, respectively. Despite the fact that the genotype distribution of SERT gene polymorphism in patients and control group seemed to be different from each other, this difference was not found to be statistically significant. Conclusion: This finding suggests that polymorphisms within the SERT gene do not play a major role in PD susceptibility in the Turkish population.

Prion-Like Domains in Phagobiota

Directory of Open Access Journals (Sweden)

George Tetz

2017-11-01

Full Text Available Prions are molecules characterized by self-propagation, which can undergo a conformational switch leading to the creation of new prions. Prion proteins have originally been associated with the development of mammalian pathologies; however, recently they have been shown to contribute to the environmental adaptation in a variety of prokaryotic and eukaryotic organisms. Bacteriophages are widespread and represent the important regulators of microbiota homeostasis and have been shown to be diverse across various bacterial families. Here, we examined whether bacteriophages contain prion-like proteins and whether these prion-like protein domains are involved in the regulation of homeostasis. We used a computational algorithm, prion-like amino acid composition, to detect prion-like domains in 370,617 publicly available bacteriophage protein sequences, which resulted in the identification of 5040 putative prions. We analyzed a set of these prion-like proteins, and observed regularities in their distribution across different phage families, associated with their interactions with the bacterial host cells. We found that prion-like domains could be found across all phages of various groups of bacteria and archaea. The results obtained in this study indicate that bacteriophage prion-like proteins are predominantly involved in the interactions between bacteriophages and bacterial cell, such as those associated with the attachment and penetration of bacteriophage in the cell, and the release of the phage progeny. These data allow the identification of phage prion-like proteins as novel regulators of the interactions between bacteriophages and bacterial cells.

Association of -330 interleukin-2 gene polymorphism with oral cancer.

Science.gov (United States)

Singh, Prithvi Kumar; Kumar, Vijay; Ahmad, Mohammad Kaleem; Gupta, Rajni; Mahdi, Abbas Ali; Jain, Amita; Bogra, Jaishri; Chandra, Girish

2017-12-01

Cytokines play an important role in the development of cancer. Several single-nucleotide polymorphisms (SNPs) of cytokine genes have been reported to be associated with the development and severity of inflammatory diseases and cancer predisposition. This study was undertaken to evaluate a possible association of interleukin 2 (IL-2) (- 330A>C) gene polymorphisms with the susceptibility to oral cancer. The SNP in IL-2 (-330A>C) gene was genotyped in 300 oral cancer patients and in similar number of healthy volunteers by polymerase chain reaction (PCR)-restriction fragment length polymorphism and the association of the gene with the disease was evaluated. IL-2 (-330A>C) gene polymorphism was significantly associated with oral cancer whereas it was neither associated with clinicopathological status nor with cancer pain. The AC heterozygous genotype was significantly associated with oral cancer patients as compared to controls [odds ratio (OR): 3.0; confidence interval (CI): 2.14-4.20; Poral cancer (OR: 1.80; CI: 1.39-2.33; PC) gene polymorphism was also associated with oral cancer in tobacco smokers and chewers. Our results showed that oral cancer patients had significantly higher frequency of AA genotype but significantly lower frequency of AC genotype and C allele compared to controls. The IL-2 AC genotype and C allele of IL-2 (-330A>C) gene polymorphisms could be potential protective factors and might reduce the risk of oral cancer in Indian population.

Protecting effect of PrP codons M142 and K222 in goats orally challenged with bovine spongiform encephalopathy prions.

Science.gov (United States)

Fast, C; Goldmann, W; Berthon, P; Tauscher, K; Andréoletti, O; Lantier, I; Rossignol, C; Bossers, A; Jacobs, J G; Hunter, N; Groschup, M H; Lantier, F; Langeveld, J P M

2017-09-19

Breeding towards genetic resistance to prion disease is effective in eliminating scrapie. In sheep, classical forms of scrapie have been eradicated almost completely in several countries by breeding programs using a prion protein (PrP) gene (PRNP) amino acid polymorphism. For goats, field and experimental studies have provided evidence for several amino acid polymorphisms that are associated with resistance to scrapie, but only limited data are available concerning the susceptibility of caprine PRNP genotypes to BSE. In this study, goat kids representing five PRNP genotypes based on three polymorphisms (M142, Q211 and K222 and the wild type I142, R211 and Q222) were orally challenged with bovine or goat BSE. Wild type goats were killed with clinical signs between 24-28 months post inoculation (mpi) to both challenges, and goats with genotype R/Q211 succumbed between 29-36 mpi. I/M142 goats developed clinical signs at 44-45 mpi and M/M142 goats remained healthy until euthanasia at 48 mpi. None of the Q/K222 goats showed definite clinical signs. Taken together the highest attack ratios were seen in wild type and R/Q211 goats, and the lowest in I/M142, M/M142 and Q/K222. In all genotype groups, one or more goats remained healthy within the incubation period in both challenges and without detectable PrP deposition in the tissues. Our data show that both the K222 and M142 polymorphisms lengthen the incubation period significantly compared to wild type animals, but only K222 was associated with a significant increase in resistance to BSE infection after oral exposure to both BSE sources.

Increased infectivity of anchorless mouse scrapie prions in transgenic mice overexpressing human prion protein.

Science.gov (United States)

Race, Brent; Phillips, Katie; Meade-White, Kimberly; Striebel, James; Chesebro, Bruce

2015-06-01

Prion protein (PrP) is found in all mammals, mostly as a glycoprotein anchored to the plasma membrane by a C-terminal glycosylphosphatidylinositol (GPI) linkage. Following prion infection, host protease-sensitive prion protein (PrPsen or PrPC) is converted into an abnormal, disease-associated, protease-resistant form (PrPres). Biochemical characteristics, such as the PrP amino acid sequence, and posttranslational modifications, such as glycosylation and GPI anchoring, can affect the transmissibility of prions as well as the biochemical properties of the PrPres generated. Previous in vivo studies on the effects of GPI anchoring on prion infectivity have not examined cross-species transmission. In this study, we tested the effect of lack of GPI anchoring on a species barrier model using mice expressing human PrP. In this model, anchorless 22L prions derived from tg44 mice were more infectious than 22L prions derived from C57BL/10 mice when tested in tg66 transgenic mice, which expressed wild-type anchored human PrP at 8- to 16-fold above normal. Thus, the lack of the GPI anchor on the PrPres from tg44 mice appeared to reduce the effect of the mouse-human PrP species barrier. In contrast, neither source of prions induced disease in tgRM transgenic mice, which expressed human PrP at 2- to 4-fold above normal. Prion protein (PrP) is found in all mammals, usually attached to cells by an anchor molecule called GPI. Following prion infection, PrP is converted into a disease-associated form (PrPres). While most prion diseases are species specific, this finding is not consistent, and species barriers differ in strength. The amino acid sequence of PrP varies among species, and this variability affects prion species barriers. However, other PrP modifications, including glycosylation and GPI anchoring, may also influence cross-species infectivity. We studied the effect of PrP GPI anchoring using a mouse-to-human species barrier model. Experiments showed that prions produced by

STAT4 gene polymorphism in patients after renal allograft transplantation.

Science.gov (United States)

Dąbrowska-Żamojcin, Ewa; Dziedziejko, Violetta; Safranow, Krzysztof; Domański, Leszek; Słuczanowska-Głabowska, Sylwia; Pawlik, Andrzej

2016-01-01

STAT4 (signal transducer and activator of transcription 4) is involved in the regulation of innate and adaptive immune responses. Some studies have suggested that STAT4 may be involved in the immune response after graft transplantation. Several polymorphisms in the STAT4 gene have been identified. The most commonly studied polymorphism in the STAT4 gene is rs7574865. In our study, we examined whether this polymorphism is associated with the early and late functions of renal allografts. A total of 270 recipients of first renal transplants were included in the study. Single nucleotide polymorphisms (SNPs) within the STAT4 gene were genotyped using TaqMan genotyping assays. There were no statistically significant associations between the STAT4 gene rs7574865 polymorphism and delayed graft function, acute rejection, chronic allograft dysfunction, post-transplant diabetes mellitus, or creatinine serum concentrations after transplantation. Our results suggest a lack of association between the STAT4 rs7574865 SNP and kidney allograft function in the Polish population.

Advancing prion science: guidance for the National Prion Research Program

National Research Council Canada - National Science Library

Erdtmann, Rick; Sivitz, Laura

2004-01-01

...€™s National Prion Research Program (NPRP). Transmissible spongiform encephalopathies (TSEs), also called prion diseases, are invariably fatal neurodegenerative infectious diseases that include bovine spongiform encephalopathy...

A novel polymorphism of resistin gene and its association with meat ...

African Journals Online (AJOL)

Searching for candidate gene polymorphisms and their relationship with meat quality traits is an important issue for Bos taurus industry. In this study, we evaluated polymorphism of resistin (RETN) gene involved in energy metabolism. Using the polymerase chain reaction-single strand conformation polymorphism ...

Treatment with a non-toxic, self-replicating anti-prion delays or prevents prion disease in vivo.

Science.gov (United States)

Diaz-Espinoza, R; Morales, R; Concha-Marambio, L; Moreno-Gonzalez, I; Moda, F; Soto, C

2018-03-01

Transmissible spongiform encephalopathies (TSEs) are fatal neurological disorders caused by prions, which are composed of a misfolded protein (PrP Sc ) that self-propagates in the brain of infected individuals by converting the normal prion protein (PrP C ) into the pathological isoform. Here, we report a novel experimental strategy for preventing prion disease based on producing a self-replicating, but innocuous PrP Sc -like form, termed anti-prion, which can compete with the replication of pathogenic prions. Our results show that a prophylactic inoculation of prion-infected animals with an anti-prion delays the onset of the disease and in some animals completely prevents the development of clinical symptoms and brain damage. The data indicate that a single injection of the anti-prion eliminated ~99% of the infectivity associated to pathogenic prions. Furthermore, this treatment caused significant changes in the profile of regional PrP Sc deposition in the brains of animals that were treated, but still succumbed to the disease. Our findings provide new insights for a mechanistic understanding of prion replication and support the concept that prion replication can be separated from toxicity, providing a novel target for therapeutic intervention.

The Serotonin Transporter Gene Polymorphisms and Risk of Ischemic Stroke

DEFF Research Database (Denmark)

Mortensen, Janne Kærgård; Kraglund, Kristian Lundsgaard; Johnsen, Søren Paaske

2018-01-01

may influence platelet activity, as they result in different levels of transporters and thereby different levels of serotonin in platelets. SERT gene polymorphisms have thus been associated with the risk of myocardial infarction. A similar association may exist between SERT gene polymorphisms...... and stroke. However, to our knowledge, this potential association has not previously been studied. We therefore aimed to investigate the association between polymorphisms in the SERT gene and the risk of ischemic stroke/transitory ischemic attack (TIA). MATERIALS AND METHODS: We conducted a case...

Amyloid cores in prion domains: Key regulators for prion conformational conversion.

Science.gov (United States)

Fernández, María Rosario; Batlle, Cristina; Gil-García, Marcos; Ventura, Salvador

2017-01-02

Despite the significant efforts devoted to decipher the particular protein features that encode for a prion or prion-like behavior, they are still poorly understood. The well-characterized yeast prions constitute an ideal model system to address this question, because, in these proteins, the prion activity can be univocally assigned to a specific region of their sequence, known as the prion forming domain (PFD). These PFDs are intrinsically disordered, relatively long and, in many cases, of low complexity, being enriched in glutamine/asparagine residues. Computational analyses have identified a significant number of proteins having similar domains in the human proteome. The compositional bias of these regions plays an important role in the transition of the prions to the amyloid state. However, it is difficult to explain how composition alone can account for the formation of specific contacts that position correctly PFDs and provide the enthalpic force to compensate for the large entropic cost of immobilizing these domains in the initial assemblies. We have hypothesized that short, sequence-specific, amyloid cores embedded in PFDs can perform these functions and, accordingly, act as preferential nucleation centers in both spontaneous and seeded aggregation. We have shown that the implementation of this concept in a prediction algorithm allows to score the prion propensities of putative PFDs with high accuracy. Recently, we have provided experimental evidence for the existence of such amyloid cores in the PFDs of Sup35, Ure2, Swi1, and Mot3 yeast prions. The fibrils formed by these short stretches may recognize and promote the aggregation of the complete proteins inside cells, being thus a promising tool for targeted protein inactivation.

Association of transforming growth factor-ß3 gene polymorphism ...

African Journals Online (AJOL)

Genotyping for the TGF-β3 gene using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method and BslI restriction endonuclease showed a mutation in 294-bp fragment located on the fourth intron of chromosome 5. Polymorphism in TGF-β3 gene was significantly (P < 0.1) associated with ...

Creutzfeldt-Jakob Disease with a prion protein gene codon 180 mutation presenting asymmetric cortical high-intensity on magnetic resonance imaging.

Science.gov (United States)

Amano, Yuko; Kimura, Noriyuki; Hanaoka, Takuya; Aso, Yasuhiro; Hirano, Teruyuki; Murai, Hiroyuki; Satoh, Katsuya; Matsubara, Etsuro

2015-01-01

Here we report a genetically confirmed case of Creutzfeldt-Jakob disease with a prion protein gene codon 180 mutation presenting atypical magnetic resonance imaging findings. The present case exhibited an acute onset and lateralized neurologic signs, and progressive cognitive impairment. No myoclonus or periodic synchronous discharges on electroencephalography were observed. Diffusion-weighted images revealed areas of high signal intensity in the right frontal and temporal cortices at onset that extended to the whole cortex and basal ganglia of the right cerebral hemisphere at 3 months. Although the cerebrospinal fluid (CSF) was initially negative for neuron specific enolase, tau protein, 14-3-3 protein, and abnormal prion protein, the CSF was positive for these brain-derived proteins at 3 months after onset.

Atypical scrapie prions from sheep and lack of disease in transgenic mice overexpressing human prion protein.

Science.gov (United States)

Wadsworth, Jonathan D F; Joiner, Susan; Linehan, Jacqueline M; Balkema-Buschmann, Anne; Spiropoulos, John; Simmons, Marion M; Griffiths, Peter C; Groschup, Martin H; Hope, James; Brandner, Sebastian; Asante, Emmanuel A; Collinge, John

2013-11-01

Public and animal health controls to limit human exposure to animal prions are focused on bovine spongiform encephalopathy (BSE), but other prion strains in ruminants may also have zoonotic potential. One example is atypical/Nor98 scrapie, which evaded statutory diagnostic methods worldwide until the early 2000s. To investigate whether sheep infected with scrapie prions could be another source of infection, we inoculated transgenic mice that overexpressed human prion protein with brain tissue from sheep with natural field cases of classical and atypical scrapie, sheep with experimental BSE, and cattle with BSE. We found that these mice were susceptible to BSE prions, but disease did not develop after prolonged postinoculation periods when mice were inoculated with classical or atypical scrapie prions. These data are consistent with the conclusion that prion disease is less likely to develop in humans after exposure to naturally occurring prions of sheep than after exposure to epizootic BSE prions of ruminants.

Guinea Pig Prion Protein Supports Rapid Propagation of Bovine Spongiform Encephalopathy and Variant Creutzfeldt-Jakob Disease Prions.

Science.gov (United States)

Watts, Joel C; Giles, Kurt; Saltzberg, Daniel J; Dugger, Brittany N; Patel, Smita; Oehler, Abby; Bhardwaj, Sumita; Sali, Andrej; Prusiner, Stanley B

2016-11-01

The biochemical and neuropathological properties of bovine spongiform encephalopathy (BSE) and variant Creutzfeldt-Jakob disease (vCJD) prions are faithfully maintained upon transmission to guinea pigs. However, primary and secondary transmissions of BSE and vCJD in guinea pigs result in long incubation periods of ∼450 and ∼350 days, respectively. To determine if the incubation periods of BSE and vCJD prions could be shortened, we generated transgenic (Tg) mice expressing guinea pig prion protein (GPPrP). Inoculation of Tg(GPPrP) mice with BSE and vCJD prions resulted in mean incubation periods of 210 and 199 days, respectively, which shortened to 137 and 122 days upon serial transmission. In contrast, three different isolates of sporadic CJD prions failed to transmit disease to Tg(GPPrP) mice. Many of the strain-specified biochemical and neuropathological properties of BSE and vCJD prions, including the presence of type 2 protease-resistant PrP Sc , were preserved upon propagation in Tg(GPPrP) mice. Structural modeling revealed that two residues near the N-terminal region of α-helix 1 in GPPrP might mediate its susceptibility to BSE and vCJD prions. Our results demonstrate that expression of GPPrP in Tg mice supports the rapid propagation of BSE and vCJD prions and suggest that Tg(GPPrP) mice may serve as a useful paradigm for bioassaying these prion isolates. Variant Creutzfeldt-Jakob disease (vCJD) and bovine spongiform encephalopathy (BSE) prions are two of the prion strains most relevant to human health. However, propagating these strains in mice expressing human or bovine prion protein has been difficult because of prolonged incubation periods or inefficient transmission. Here, we show that transgenic mice expressing guinea pig prion protein are fully susceptible to vCJD and BSE prions but not to sporadic CJD prions. Our results suggest that the guinea pig prion protein is a better, more rapid substrate than either bovine or human prion protein for

Gene-gene, gene-environment, gene-nutrient interactions and single nucleotide polymorphisms of inflammatory cytokines.

Science.gov (United States)

Nadeem, Amina; Mumtaz, Sadaf; Naveed, Abdul Khaliq; Aslam, Muhammad; Siddiqui, Arif; Lodhi, Ghulam Mustafa; Ahmad, Tausif

2015-05-15

Inflammation plays a significant role in the etiology of type 2 diabetes mellitus (T2DM). The rise in the pro-inflammatory cytokines is the essential step in glucotoxicity and lipotoxicity induced mitochondrial injury, oxidative stress and beta cell apoptosis in T2DM. Among the recognized markers are interleukin (IL)-6, IL-1, IL-10, IL-18, tissue necrosis factor-alpha (TNF-α), C-reactive protein, resistin, adiponectin, tissue plasminogen activator, fibrinogen and heptoglobins. Diabetes mellitus has firm genetic and very strong environmental influence; exhibiting a polygenic mode of inheritance. Many single nucleotide polymorphisms (SNPs) in various genes including those of pro and anti-inflammatory cytokines have been reported as a risk for T2DM. Not all the SNPs have been confirmed by unifying results in different studies and wide variations have been reported in various ethnic groups. The inter-ethnic variations can be explained by the fact that gene expression may be regulated by gene-gene, gene-environment and gene-nutrient interactions. This review highlights the impact of these interactions on determining the role of single nucleotide polymorphism of IL-6, TNF-α, resistin and adiponectin in pathogenesis of T2DM.

Lichens: Unexpected anti-prion agents?

Science.gov (United States)

Rodriguez, Cynthia M.; Bennett, James P.; Johnson, Christopher J.

2012-01-01

The prion diseases sheep scrapie and cervid chronic wasting disease are transmitted, in part, via an environmental reservoir of infectivity; prions released from infected animals persist in the environment and can cause disease years later. Central to controlling disease transmission is the identification of methods capable of inactivating these agents on the landscape. We have found that certain lichens, common, ubiquitous, symbiotic organisms, possess a serine protease capable of degrading prion protein (PrP) from prion-infected animals. The protease functions against a range of prion strains from various hosts and reduces levels of abnormal PrP by at least two logs. We have now tested more than 20 lichen species from several geographical locations and from various taxa and found that approximately half of these species degrade PrP. Critical next steps include examining the effect of lichens on prion infectivity and cloning the protease responsible for PrP degradation. The impact of lichens on prions in the environment remains unknown. We speculate that lichens could have the potential to degrade prions when they are shed from infected animals onto lichens or into environments where lichens are abundant. In addition, lichens are frequently consumed by cervids and many other animals and the effect of dietary lichens on prion disease transmission should also be considered.

A closer look at prion strains

Science.gov (United States)

Solforosi, Laura; Milani, Michela; Mancini, Nicasio; Clementi, Massimo; Burioni, Roberto

2013-01-01

Prions are infectious proteins that are responsible for transmissible spongiform encephalopathies (TSEs) and consist primarily of scrapie prion protein (PrPSc), a pathogenic isoform of the host-encoded cellular prion protein (PrPC). The absence of nucleic acids as essential components of the infectious prions is the most striking feature associated to these diseases. Additionally, different prion strains have been isolated from animal diseases despite the lack of DNA or RNA molecules. Mounting evidence suggests that prion-strain-specific features segregate with different PrPSc conformational and aggregation states. Strains are of practical relevance in prion diseases as they can drastically differ in many aspects, such as incubation period, PrPSc biochemical profile (e.g., electrophoretic mobility and glycoform ratio) and distribution of brain lesions. Importantly, such different features are maintained after inoculation of a prion strain into genetically identical hosts and are relatively stable across serial passages. This review focuses on the characterization of prion strains and on the wide range of important implications that the study of prion strains involves. PMID:23357828

Medulla oblongata transcriptome changes during presymptomatic natural scrapie and their association with prion-related lesions.

Science.gov (United States)

Filali, Hicham; Martin-Burriel, Inmaculada; Harders, Frank; Varona, Luis; Serrano, Carmen; Acín, Cristina; Badiola, Juan J; Bossers, Alex; Bolea, Rosa

2012-08-16

The pathogenesis of natural scrapie and other prion diseases is still poorly understood. Determining the variations in the transcriptome in the early phases of the disease might clarify some of the molecular mechanisms of the prion-induced pathology and allow for the development of new biomarkers for diagnosis and therapy. This study is the first to focus on the identification of genes regulated during the preclinical phases of natural scrapie in the ovine medulla oblongata (MO) and the association of these genes with prion deposition, astrocytosis and spongiosis. A custom microarray platform revealed that 86 significant probes had expression changes greater than 2-fold. From these probes, we identified 32 genes with known function; the highest number of regulated genes was included in the phosphoprotein-encoding group. Genes encoding extracellular marker proteins and those involved in the immune response and apoptosis were also differentially expressed. In addition, we investigated the relationship between the gene expression profiles and the appearance of the main scrapie-associated brain lesions. Quantitative Real-time PCR was used to validate the expression of some of the regulated genes, thus showing the reliability of the microarray hybridization technology. Genes involved in protein and metal binding and oxidoreductase activity were associated with prion deposition. The expression of glial fibrillary acidic protein (GFAP) was associated with changes in the expression of genes encoding proteins with oxidoreductase and phosphatase activity, and the expression of spongiosis was related to genes encoding extracellular matrix components or transmembrane transporters. This is the first genome-wide expression study performed in naturally infected sheep with preclinical scrapie. As in previous studies, our findings confirm the close relationship between scrapie and other neurodegenerative diseases.

Polymorphism of the prolactin gene and its association with egg ...

African Journals Online (AJOL)

p2492989

In this study, polymorphism of the prolactin gene was screened in six Chinese native ... Prolactin (PRL) is a single-chain polypeptide hormone that belongs to the growth hormone gene ..... Enhance the efficiency of single-strand conformation polymorphism analysis by short polyacrylamide gel and modified silver staining.

Variably Protease-Sensitive Prionopathy: A New Sporadic Disease of the Prion Protein

Science.gov (United States)

Zou, Wen-Quan; Puoti, Gianfranco; Xiao, Xiangzhu; Yuan, Jue; Qing, Liuting; Cali, Ignazio; Shimoji, Miyuki; Langeveld, Jan P. M.; Castellani, Rudy; Notari, Silvio; Crain, Barbara; Schmidt, Robert E.; Geschwind, Michael; DeArmond, Stephen J.; Cairns, Nigel J.; Dickson, Dennis; Honig, Lawrence; Torres, Juan Maria; Mastrianni, James; Capellari, Sabina; Giaccone, Giorgio; Belay, Ermias D.; Schonberger, Lawrence B.; Cohen, Mark; Perry, George; Kong, Qingzhong; Parchi, Piero; Tagliavini, Fabrizio; Gambetti, Pierluigi

2011-01-01

Objective The objective of the study is to report 2 new genotypic forms of protease-sensitive prionopathy (PSPr), a novel prion disease described in 2008, in 11 subjects all homozygous for valine at codon 129 of the prion protein (PrP) gene (129VV). The 2 new PSPr forms affect individuals who are either homozygous for methionine (129MM) or heterozygous for methionine/valine (129MV). Methods Fifteen affected subjects with 129MM, 129MV, and 129VV underwent comparative evaluation at the National Prion Disease Pathology Surveillance Center for clinical, histopathologic, immunohistochemical, genotypical, and PrP characteristics. Results Disease duration (between 22 and 45 months) was significantly different in the 129VV and 129MV subjects. Most other phenotypic features along with the PrP electrophoretic profile were similar but distinguishable in the 3 129 genotypes. A major difference laid in the sensitivity to protease digestion of the disease-associated PrP, which was high in 129VV but much lower, or altogether lacking, in 129MV and 129MM. This difference prompted the substitution of the original designation with “variably protease-sensitive prionopathy” (VPSPr). None of the subjects had mutations in the PrP gene coding region. Interpretation Because all 3 129 genotypes are involved, and are associated with distinguishable phenotypes, VPSPr becomes the second sporadic prion protein disease with this feature after Creutzfeldt-Jakob disease, originally reported in 1920. However, the characteristics of the abnormal prion protein suggest that VPSPr is different from typical prion diseases, and perhaps more akin to subtypes of Gerstmann-Sträussler-Scheinker disease. PMID:20695009

Classical Bovine Spongiform Encephalopathy by Transmission of H-Type Prion in Homologous Prion Protein Context

Science.gov (United States)

Andréoletti, Olivier; Lacroux, Caroline; Prieto, Irene; Lorenzo, Patricia; Larska, Magdalena; Baron, Thierry; Espinosa, Juan-Carlos

2011-01-01

Bovine spongiform encephalopathy (BSE) and BSE-related disorders have been associated with a single major prion strain. Recently, 2 atypical, presumably sporadic forms of BSE have been associated with 2 distinct prion strains that are characterized mainly by distinct Western blot profiles of abnormal protease-resistant prion protein (PrPres), named high-type (BSE-H) and low-type (BSE-L), that also differed from classical BSE. We characterized 5 atypical BSE-H isolates by analyzing their molecular and neuropathologic properties during transmission in transgenic mice expressing homologous bovine prion protein. Unexpectedly, in several inoculated animals, strain features emerged that were highly similar to those of classical BSE agent. These findings demonstrate the capability of an atypical bovine prion to acquire classical BSE–like properties during propagation in a homologous bovine prion protein context and support the view that the epidemic BSE agent could have originated from such a cattle prion. PMID:21888788

Polymorphism at codon 36 of the p53 gene.

Science.gov (United States)

Felix, C A; Brown, D L; Mitsudomi, T; Ikagaki, N; Wong, A; Wasserman, R; Womer, R B; Biegel, J A

1994-01-01

A polymorphism at codon 36 in exon 4 of the p53 gene was identified by single strand conformation polymorphism (SSCP) analysis and direct sequencing of genomic DNA PCR products. The polymorphic allele, present in the heterozygous state in genomic DNAs of four of 100 individuals (4%), changes the codon 36 CCG to CCA, eliminates a FinI restriction site and creates a BccI site. Including this polymorphism there are four known polymorphisms in the p53 coding sequence.

Prions

Directory of Open Access Journals (Sweden)

W. Bodemer

2016-09-01

BSE is always unknown. Telemetry revealed a shift in sleep–wake cycles early on, long before behavioral changes or clinical symptoms appeared. Pathology confirmed non-neuronal tissue as hidden places where prions exist. The rhesus model also allowed first comparative studies of epigenetic modifications on RNA in peripheral blood and brain tissue collected from uninfected and prion-infected animals. To conclude, our studies clearly demonstrated that this model is valid since progression to disease is almost identical to human CJD.

The many shades of prion strain adaptation.

Science.gov (United States)

Baskakov, Ilia V

2014-01-01

In several recent studies transmissible prion disease was induced in animals by inoculation with recombinant prion protein amyloid fibrils produced in vitro. Serial transmission of amyloid fibrils gave rise to a new class of prion strains of synthetic origin. Gradual transformation of disease phenotypes and PrP(Sc) properties was observed during serial transmission of synthetic prions, a process that resembled the phenomenon of prion strain adaptation. The current article discusses the remarkable parallels between phenomena of prion strain adaptation that accompanies cross-species transmission and the evolution of synthetic prions occurring within the same host. Two alternative mechanisms underlying prion strain adaptation and synthetic strain evolution are discussed. The current article highlights the complexity of the prion transmission barrier and strain adaptation and proposes that the phenomenon of prion adaptation is more common than previously thought.

Effects of solution chemistry and aging time on prion protein adsorption and replication of soil-bound prions.

Directory of Open Access Journals (Sweden)

Samuel E Saunders

2011-04-01

Full Text Available Prion interactions with soil may play an important role in the transmission of chronic wasting disease (CWD and scrapie. Prions are known to bind to a wide range of soil surfaces, but the effects of adsorption solution chemistry and long-term soil binding on prion fate and transmission risk are unknown. We investigated HY TME prion protein (PrP(Sc adsorption to soil minerals in aqueous solutions of phosphate buffered saline (PBS, sodium chloride, calcium chloride, and deionized water using western blotting. The replication efficiency of bound prions following adsorption in these solutions was also evaluated by protein misfolding cyclic amplification (PMCA. Aging studies investigated PrP(Sc desorption and replication efficiency up to one year following adsorption in PBS or DI water. Results indicate that adsorption solution chemistry can affect subsequent prion replication or desorption ability, especially after incubation periods of 30 d or longer. Observed effects were minor over the short-term (7 d or less. Results of long-term aging experiments demonstrate that unbound prions or prions bound to a diverse range of soil surfaces can readily replicate after one year. Our results suggest that while prion-soil interactions can vary with solution chemistry, prions bound to soil could remain a risk for transmitting prion diseases after months in the environment.

STAT4 gene polymorphism in patients after renal allograft transplantation

OpenAIRE

D?browska-?amojcin, Ewa; Dziedziejko, Violetta; Safranow, Krzysztof; Doma?ski, Leszek; S?uczanowska-G?abowska, Sylwia; Pawlik, Andrzej

2016-01-01

Introduction STAT4 (signal transducer and activator of transcription 4) is involved in the regulation of innate and adaptive immune responses. Some studies have suggested that STAT4 may be involved in the immune response after graft transplantation. Several polymorphisms in the STAT4 gene have been identified. The most commonly studied polymorphism in the STAT4 gene is rs7574865. In our study, we examined whether this polymorphism is associated with the early and late functions of renal allog...

Depressive symptoms in schizophrenia and dopamine and serotonin gene polymorphisms.

Science.gov (United States)

Peitl, Vjekoslav; Štefanović, Mario; Karlović, Dalibor

2017-07-03

Although depressive symptoms seem to be frequent in schizophrenia they have received significantly less attention than other symptom domains. As impaired serotonergic and dopaminergic neurotransmission is implicated in the pathogenesis of depression and schizophrenia this study sought to investigate the putative association between several functional gene polymorphisms (SERT 5-HTTLPR, MAO-A VNTR, COMT Val158Met and DAT VNTR) and schizophrenia. Other objectives of this study were to closely examine schizophrenia symptom domains by performing factor analysis of the two most used instruments in this setting (Positive and negative syndrome scale - PANSS and Calgary depression rating scale - CDSS) and to examine the influence of investigated gene polymorphisms on the schizophrenia symptom domains, focusing on depressive scores. A total of 591 participants were included in the study (300 schizophrenic patients and 291 healthy volunteers). 192 (64%) of schizophrenic patients had significant depressive symptoms. Genotype distribution revealed no significant differences regarding all investigated polymorphisms except the separate gender analysis for MAO-A gene polymorphism which revealed significantly more allele 3 carriers in schizophrenic males. Factor analysis of the PANSS scale revealed the existence of five separate factors (symptom domains), while the CDSS scale revealed two distinct factors. Several investigated gene polymorphisms (mostly SERT and MAO-A, but also COMT) significantly influenced two factors from the PANSS (aggressive/impulsive and negative symptoms) and one from the CDSS scale (suicidality), respectively. Depressive symptoms in schizophrenic patients may be influenced by functional gene polymorphisms, especially those implicated in serotonergic neurotransmission. Copyright © 2017 Elsevier Inc. All rights reserved.

Prion disease resembling frontotemporal dementia and parkinsonism linked to chromosome 17

Directory of Open Access Journals (Sweden)

Nitrini Ricardo

2001-01-01

Full Text Available OBJECTIVE: To compare the clinical features of a familial prion disease with those of frontotemporal dementia and parkinsonism linked to chromosome 17 (FTDP-17. BACKGROUND: Prion diseases are not usually considered in the differential diagnosis of FTDP-17, since familial Creutzfeldt-Jakob disease (CJD, the most common inherited prion disease, often manifests as a rapidly progressive dementia. Conversely, FTDP-17 usually has an insidious onset in the fifth decade, with abnormal behavior and parkinsonian features. METHOD: We present the clinical features of 12 patients from a family with CJD associated with a point mutation at codon 183 of the prion protein gene. RESULTS: The mean age at onset was 44.0 ± 3.7; the duration of the symptoms until death ranged from two to nine years. Behavioral disturbances were the predominant presenting symptoms. Nine patients were first seen by psychiatrists. Eight patients manifested parkinsonian signs. CONCLUSION: These clinical features bear a considerable resemblance to those described in FTDP-17.

Association of ACE Gene I/D polymorphism with migraine in Kashmiri population.

Science.gov (United States)

Wani, Irfan Yousuf; Sheikh, Saleem; Shah, Zafar Amin; Pandith, Arshid A; Wani, Mushtaq; Asimi, Ravouf; Wani, Maqbool; Sheikh, Shahnawaz; Mehraj, Iqra

2016-01-01

Migraine is a complex, recurrent headache disorder that is one of the most common complaints in neurology practice. The role of various genes in its pathogenesis is being studied. We did this study to see whether an association exists between ACE gene I/D polymorphism and migraine in our region. The study included 100 patients diagnosed with migraine and 121 healthy controls. The study subject were age and gender matched. The analysis was based on Polymerase Chain Reaction (PCR) and included following steps: DNA extraction from blood, PCR and Restriction Fragment Length Polymorphism (RFLP). Out of 100 cases, 69 were females and 31 were males. Fifty-seven were having migraine without aura and 43 had migraine with aura. 45 of the cases had II polymorphism, 40 had ID polymorphism and 15 had DD polymorphism in ACE gene. We were not able to find a statistically significant association between ACE gene I/D polymorphism with migraine. The reason for difference in results between our study and other studies could be because of different ethnicity in study populations. So a continuous research is needed in this regard in order to find the genes and different polymorphism that increase the susceptibility of Kashmiri population to migraine.

Ultraviolet-ozone treatment reduces levels of disease-associated prion protein and prion infectivity

Science.gov (United States)

Johnson, C.J.; Gilbert, P.; McKenzie, D.; Pedersen, J.A.; Aiken, Judd M.

2009-01-01

Background. Transmissible spongiform encephalopathies (TSEs) are a group of fatal neurodegenerative diseases caused by novel infectious agents referred to as prions. Prions appear to be composed primarily, if not exclusively, of a misfolded isoform of the cellular prion protein. TSE infectivity is remarkably stable and can resist many aggressive decontamination procedures, increasing human, livestock and wildlife exposure to TSEs. Findings. We tested the hypothesis that UV-ozone treatment reduces levels of the pathogenic prion protein and inactivates the infectious agent. We found that UV-ozone treatment decreased the carbon and prion protein content in infected brain homogenate to levels undetectable by dry-ashing carbon analysis or immunoblotting, respectively. After 8 weeks of ashing, UV-ozone treatment reduced the infectious titer of treated material by a factor of at least 105. A small amount of infectivity, however, persisted despite UV-ozone treatment. When bound to either montmorillonite clay or quartz surfaces, PrPTSE was still susceptible to degradation by UV-ozone. Conclusion. Our findings strongly suggest that UV-ozone treatment can degrade pathogenic prion protein and inactivate prions, even when the agent is associated with surfaces. Using larger UV-ozone doses or combining UV-ozone treatment with other decontaminant methods may allow the sterilization of TSE-contaminated materials. ?? 2009 Aiken et al; licensee BioMed Central Ltd.

Generic amyloidogenicity of mammalian prion proteins from species susceptible and resistant to prions.

Science.gov (United States)

Nyström, Sofie; Hammarström, Per

2015-05-11

Prion diseases are lethal, infectious diseases associated with prion protein (PrP) misfolding. A large number of mammals are susceptible to both sporadic and acquired prion diseases. Although PrP is highly conserved and ubiquitously expressed in all mammals, not all species exhibit prion disease. By employing full length recombinant PrP from five known prion susceptible species (human, cattle, cat, mouse and hamster) and two species considered to be prion resistant (pig and dog) the amyloidogenicity of these PrPs has been delineated. All the mammalian PrPs, even from resistant species, were swiftly converted from the native state to amyloid-like structure when subjected to a native condition conversion assay. The PrPs displayed amyloidotypic tinctorial and ultrastructural hallmarks. Self-seeded conversion of the PrPs displayed significantly decreased lag phases demonstrating that nucleation dependent polymerization is a dominating mechanism in the fibrillation process. Fibrils from Aβ1-40, Aβ1-42, Lysozyme, Insulin and Transthyretin did not accelerate conversion of HuPrP whereas fibrils from HuPrP90-231 and HuPrP121-231 as well as full length PrPs of all PrPs efficiently seeded conversion showing specificity of the assay requiring the C-terminal PrP sequence. Our findings have implications for PrP misfolding and could have ramifications in the context of prion resistant species and silent carriers.

The Evaluation of IL6 and ESR1 Gene Polymorphisms in Primary Dysmenorrhea.

Science.gov (United States)

Ozsoy, Asker Zeki; Karakus, Nevin; Yigit, Serbulent; Cakmak, Bulent; Nacar, Mehmet Can; Yılmaz Dogru, Hatice

2016-01-01

Primary dysmenorrhea is the most common gynecological complaint with painful menstrual cramps in pelvis without any pathology. It affects about half of menstruating women, and it causes significant disruption in quality of life. We investigated the association between IL6 gene promoter and ESR1 gene XbaI and PvuII polymorphisms and primary dysmenorrhea. In this case-control study, 152 unrelated young women with primary dysmenorrhea and 150 unrelated healthy age-matched controls participated. Genomic DNA was isolated and IL6 and ESR1 gene polymorphisms were genotyped using PCR-based RFLP assay. The distribution of genotype and allele frequencies of IL6 gene promoter and ESR1 gene XbaI polymorphisms were not statistically different between patients and controls (p > 0.05). However, the genotype and allele frequencies of ESR1 gene PvuII polymorphism showed statistically significant differences between primary dysmenorrhea patients and controls (p = 0.009 and p = 0.021, respectively). Statistically significant associations were also observed between age and married status of primary dysmenorrhea patients and ESR1 gene PvuII polymorphism (p = 0.044 and p = 0.023, respectively). In combined genotype analyses, AG at ESR1 XbaI and TC at ESR1 PvuII loci encoded a p-value of 0.027. Thus, individuals who are heterozygote at both loci have a lower risk of developing primary dysmenorrhea. Our study suggests no strong association between IL6 gene promoter and ESR1 gene XbaI polymorphisms and primary dysmenorrhea in Turkish women. However, ESR1 gene PvuII polymorphism showed statistically significant differences between primary dysmenorrhea patients and controls. The potential association between ESR1 gene PvuII polymorphism and age and married status of dysmenorrhea patients deserves further consideration.

Glucocorticoid receptor gene polymorphism and juvenile idiopathic arthritis

Directory of Open Access Journals (Sweden)

Scheplyagina Larisa A

2011-01-01

Full Text Available Abstract Background The glucocorticoid receptor gene (NR3C1 has been suggested as a candidate gene affecting juvenile idiopathic arthritis (JIA course and prognosis. The purpose of this study is to investigate the glucocorticoid receptor gene BclI polymorphism (rs41423247 in JIA patients, the gene's role in susceptibility to juvenile idiopathic arthritis, and its associations with JIA activity, course and bone mineralization. Methods One hundred twenty-two Caucasian children with JIA and 143 healthy ethnically matched controls were studied. We checked markers of clinical and laboratory activity: morning stiffness, Ritchie Articular Index (RAI, swollen joint count (SJC, tender joint count (TJC, physician's visual analog scale (VAS, hemoglobin level (Hb, leukocyte count (L, platelet count (Pl, Westergren erythrocyte sedimentation rate (ESR, C-reactive protein (CRP, albumin, DAS and DAS28. Bone mineralization was measured by dual-energy X-ray absorptiometry (DXA of lumbar spine L1-L4. Assessments of bone metabolism included osteocalcin, C-terminal telopeptide (CTT, parathyroid hormone (PTH, total and ionized calcium, inorganic phosphate and total alkaline phosphatase (TAP. BclI polymorphism was genotyped by polymerase chain reaction restriction fragment length polymorphism. Results No association was observed between glucocorticoid receptor gene polymorphism and the presence or absence of JIA. In girls with JIA, the presence of the G allele was associated with an unfavorable arthritis course, a younger age of onset of arthritis (p = 0.0017, and higher inflammatory activity. The higher inflammatory activity was demonstrated by the following: increased time of morning stiffness (p = 0.02, VAS (p = 0.014, RAI (p = 0.048, DAS (p = 0.035, DAS28 (p = 0.05, Pl (p = 0.003, L (p = 0.046, CRP (p = 0.01. In addition, these patients had bone metabolism disturbances as follows: decreased BA (p = 0.0001, BMC (p = 0.00007, BMD (0.005 and Z score (p = 0.002; and

Prion replication without host adaptation during interspecies transmissions.

Science.gov (United States)

Bian, Jifeng; Khaychuk, Vadim; Angers, Rachel C; Fernández-Borges, Natalia; Vidal, Enric; Meyerett-Reid, Crystal; Kim, Sehun; Calvi, Carla L; Bartz, Jason C; Hoover, Edward A; Agrimi, Umberto; Richt, Jürgen A; Castilla, Joaquín; Telling, Glenn C

2017-01-31

Adaptation of prions to new species is thought to reflect the capacity of the host-encoded cellular form of the prion protein (PrP C ) to selectively propagate optimized prion conformations from larger ensembles generated in the species of origin. Here we describe an alternate replicative process, termed nonadaptive prion amplification (NAPA), in which dominant conformers bypass this requirement during particular interspecies transmissions. To model susceptibility of horses to prions, we produced transgenic (Tg) mice expressing cognate PrP C Although disease transmission to only a subset of infected TgEq indicated a significant barrier to EqPrP C conversion, the resulting horse prions unexpectedly failed to cause disease upon further passage to TgEq. TgD expressing deer PrP C was similarly refractory to deer prions from diseased TgD infected with mink prions. In both cases, the resulting prions transmitted to mice expressing PrP C from the species of prion origin, demonstrating that transmission barrier eradication of the originating prions was ephemeral and adaptation superficial in TgEq and TgD. Horse prions produced in vitro by protein misfolding cyclic amplification of mouse prions using horse PrP C also failed to infect TgEq but retained tropism for wild-type mice. Concordant patterns of neuropathology and prion deposition in susceptible mice infected with NAPA prions and the corresponding prion of origin confirmed preservation of strain properties. The comparable responses of both prion types to guanidine hydrochloride denaturation indicated this occurs because NAPA precludes selection of novel prion conformations. Our findings provide insights into mechanisms regulating interspecies prion transmission and a framework to reconcile puzzling epidemiological features of certain prion disorders.

DNA Characterization and Polymorphism of KISS1 Gene in Egyptian ...

African Journals Online (AJOL)

The objective of this study was the detection of the restriction fragment length polymorphism (RFLP) and single nucleotide polymorphisms (SNPs) of KISS1 gene in six major Egyptian small ruminant breeds. The primers used in this study flanked a 377 bp fragment from intron 1 of KISS1 gene in sheep and goat. These PCR ...

Inflammatory bowel disease: the role of inflammatory cytokine gene polymorphisms

Directory of Open Access Journals (Sweden)

Joanna Balding

2004-01-01

Full Text Available THE mechanisms responsible for development of inflammatory bowel disease (IBD have not been fully elucidated, although the main cause of disease pathology is attributed to up-regulated inflammatory processes. The aim of this study was to investigate frequencies of polymorphisms in genes encoding pro-inflammatory and anti-inflammatory markers in IBD patients and controls. We determined genotypes of patients with IBD (n=172 and healthy controls (n=389 for polymorphisms in genes encoding various cytokines (interleukin (IL-1β, IL-6, tumour necrosis factor (TNF, IL-10, IL-1 receptor antagonist. Association of these genotypes to disease incidence and pathophysiology was investigated. No strong association was found with occurrence of IBD. Variation was observed between the ulcerative colitis study group and the control population for the TNF-α-308 polymorphism (p=0.0135. There was also variation in the frequency of IL-6-174 and TNF-α-308 genotypes in the ulcerative colitis group compared with the Crohn's disease group (p=0.01. We concluded that polymorphisms in inflammatory genes are associated with variations in IBD phenotype and disease susceptibility. Whether the polymorphisms are directly involved in regulating cytokine production, and consequently pathophysiology of IBD, or serve merely as markers in linkage disequilibrium with susceptibility genes remains unclear.

High prevalence of a fungal prion

NARCIS (Netherlands)

Debets, A.J.M.; Dalstra, H.J.P.; Slakhorst, S.M.; Koopmanschap-Memelink, A.B.; Hoekstra, R.F.; Saupe, S.J.

2012-01-01

Prions are infectious proteins that cause fatal diseases in mammals. Prions have also been found in fungi, but studies on their role in nature are scarce. The proposed biological function of fungal prions is debated and varies from detrimental to benign or even beneficial. [Het-s] is a prion of the

Disrupting the cortical actin cytoskeleton points to two distinct mechanisms of yeast [PSI+] prion formation

Science.gov (United States)

Speldewinde, Shaun H.; Tuite, Mick F.

2017-01-01

Mammalian and fungal prions arise de novo; however, the mechanism is poorly understood in molecular terms. One strong possibility is that oxidative damage to the non-prion form of a protein may be an important trigger influencing the formation of its heritable prion conformation. We have examined the oxidative stress-induced formation of the yeast [PSI+] prion, which is the altered conformation of the Sup35 translation termination factor. We used tandem affinity purification (TAP) and mass spectrometry to identify the proteins which associate with Sup35 in a tsa1 tsa2 antioxidant mutant to address the mechanism by which Sup35 forms the [PSI+] prion during oxidative stress conditions. This analysis identified several components of the cortical actin cytoskeleton including the Abp1 actin nucleation promoting factor, and we show that deletion of the ABP1 gene abrogates oxidant-induced [PSI+] prion formation. The frequency of spontaneous [PSI+] prion formation can be increased by overexpression of Sup35 since the excess Sup35 increases the probability of forming prion seeds. In contrast to oxidant-induced [PSI+] prion formation, overexpression-induced [PSI+] prion formation was only modestly affected in an abp1 mutant. Furthermore, treating yeast cells with latrunculin A to disrupt the formation of actin cables and patches abrogated oxidant-induced, but not overexpression-induced [PSI+] prion formation, suggesting a mechanistic difference in prion formation. [PIN+], the prion form of Rnq1, localizes to the IPOD (insoluble protein deposit) and is thought to influence the aggregation of other proteins. We show Sup35 becomes oxidized and aggregates during oxidative stress conditions, but does not co-localize with Rnq1 in an abp1 mutant which may account for the reduced frequency of [PSI+] prion formation. PMID:28369054

EVALUATION OF CYTOKINE GENE POLYMORPHISM IN B CELL LYMPHOID MALIGNANCIES

Directory of Open Access Journals (Sweden)

E. L. Nazarova

2014-01-01

Full Text Available Previous studies with some solid tumors has shown that polymorphisms of certain cytokine genes may be used as predictors of clinical outcome in the patients. It seemed important to evaluate potential correlations between production of certain pro- and anti-inflammatory cytokines and co-receptor molecules, and promoter polymorphism of the cytokine genes involved into regulation of cell proliferation, differentiation, apoptosis, lipid metabolism and blood clotting in the patients with hematological malignancies. The article contains our results concerning associations between of IL-1β, -2, -4, -10, -17, TNFα, and allelic polymorphisms of their genes in 62 patients with B cell lymphoid malignancies in an ethnically homogenous group (self-identified as Russians. We have shown that the GА and AA genotypes of the G-308A polymorphism in TNFα gene are significantly associated with increased production of this cytokine, being more common in aggressive non-Hodgkin lymphomas, more rare in multiple myeloma and in indolent non-Hodgkin lymphomas.

Prion protein in milk.

Directory of Open Access Journals (Sweden)

Nicola Franscini

Full Text Available BACKGROUND: Prions are known to cause transmissible spongiform encephalopathies (TSE after accumulation in the central nervous system. There is increasing evidence that prions are also present in body fluids and that prion infection by blood transmission is possible. The low concentration of the proteinaceous agent in body fluids and its long incubation time complicate epidemiologic analysis and estimation of spreading and thus the risk of human infection. This situation is particularly unsatisfactory for food and pharmaceutical industries, given the lack of sensitive tools for monitoring the infectious agent. METHODOLOGY/PRINCIPAL FINDINGS: We have developed an adsorption matrix, Alicon PrioTrap, which binds with high affinity and specificity to prion proteins. Thus we were able to identify prion protein (PrP(C--the precursor of prions (PrP(Sc--in milk from humans, cows, sheep, and goats. The absolute amount of PrP(C differs between the species (from microg/l range in sheep to ng/l range in human milk. PrP(C is also found in homogenised and pasteurised off-the-shelf milk, and even ultrahigh temperature treatment only partially diminishes endogenous PrP(C concentration. CONCLUSIONS/SIGNIFICANCE: In view of a recent study showing evidence of prion replication occurring in the mammary gland of scrapie infected sheep suffering from mastitis, the appearance of PrP(C in milk implies the possibility that milk of TSE-infected animals serves as source for PrP(Sc.

Protease resistance of infectious prions is suppressed by removal of a single atom in the cellular prion protein.

Science.gov (United States)

Leske, Henning; Hornemann, Simone; Herrmann, Uli Simon; Zhu, Caihong; Dametto, Paolo; Li, Bei; Laferriere, Florent; Polymenidou, Magdalini; Pelczar, Pawel; Reimann, Regina Rose; Schwarz, Petra; Rushing, Elisabeth Jane; Wüthrich, Kurt; Aguzzi, Adriano

2017-01-01

Resistance to proteolytic digestion has long been considered a defining trait of prions in tissues of organisms suffering from transmissible spongiform encephalopathies. Detection of proteinase K-resistant prion protein (PrPSc) still represents the diagnostic gold standard for prion diseases in humans, sheep and cattle. However, it has become increasingly apparent that the accumulation of PrPSc does not always accompany prion infections: high titers of prion infectivity can be reached also in the absence of protease resistant PrPSc. Here, we describe a structural basis for the phenomenon of protease-sensitive prion infectivity. We studied the effect on proteinase K (PK) resistance of the amino acid substitution Y169F, which removes a single oxygen atom from the β2-α2 loop of the cellular prion protein (PrPC). When infected with RML or the 263K strain of prions, transgenic mice lacking wild-type (wt) PrPC but expressing MoPrP169F generated prion infectivity at levels comparable to wt mice. The newly generated MoPrP169F prions were biologically indistinguishable from those recovered from prion-infected wt mice, and elicited similar pathologies in vivo. Surprisingly, MoPrP169F prions showed greatly reduced PK resistance and density gradient analyses showed a significant reduction in high-density aggregates. Passage of MoPrP169F prions into mice expressing wt MoPrP led to full recovery of protease resistance, indicating that no strain shift had taken place. We conclude that a subtle structural variation in the β2-α2 loop of PrPC affects the sensitivity of PrPSc to protease but does not impact prion replication and infectivity. With these findings a specific structural feature of PrPC can be linked to a physicochemical property of the corresponding PrPSc.

An acoustic prion assay

Directory of Open Access Journals (Sweden)

Gordon Hayward

2016-12-01

Full Text Available An acoustic prion assay has been demonstrated for sheep brain samples. Only five false positives and no false negatives were observed in a test of 45 positive and 45 negative samples. The acoustic prion sensor was constructed using a thickness shear mode quartz resonator coated with a covalently bound recombinant prion protein. The characteristic indicator of a scrapie infected sheep brain sample was an observed shoulder in the frequency decrease in response to a sample.The response of the sensor aligns with a conformational shift in the surface protein and with the propagation mechanism of the disease. This alignment is evident in the response timing and shape, dependence on concentration, cross species behaviour and impact of blood plasma. This alignment is far from sufficient to prove the mechanism of the sensor but it does offer the possibility of a rapid and inexpensive additional tool to explore prion disease. Keywords: Prions, Thickness shear mode quartz sensor

Truncated forms of the prion protein PrP demonstrate the need for complexity in prion structure

Energy Technology Data Exchange (ETDEWEB)

Wan, William; Stöhr, Jan; Kendall, Amy; Stubbs, Gerald

2015-09-01

Self-propagation of aberrant protein folds is the defining characteristic of prions. Knowing the structural basis of self-propagation is essential to understanding prions and their related diseases. Prion rods are amyloid fibrils, but not all amyloids are prions. Prions have been remarkably intractable to structural studies, so many investigators have preferred to work with peptide fragments, particularly in the case of the mammalian prion protein PrP. We compared the structures of a number of fragments of PrP by X-ray fiber diffraction, and found that although all of the peptides adopted amyloid conformations, only the larger fragments adopted conformations that modeled the complexity of self-propagating prions, and even these fragments did not always adopt the PrP structure. It appears that the relatively complex structure of the prion form of PrP is not accessible to short model peptides, and that self-propagation may be tied to a level of structural complexity unobtainable in simple model systems. The larger fragments of PrP, however, are useful to illustrate the phenomenon of deformed templating (heterogeneous seeding), which has important biological consequences.

Prion pathogenesis and secondary lymphoid organs (SLO): tracking the SLO spread of prions to the brain.

Science.gov (United States)

Mabbott, Neil A

2012-01-01

Prion diseases are subacute neurodegenerative diseases that affect humans and a range of domestic and free-ranging animal species. These diseases are characterized by the accumulation of PrP (Sc), an abnormally folded isoform of the cellular prion protein (PrP (C)), in affected tissues. The pathology during prion disease appears to occur almost exclusively within the central nervous system. The extensive neurodegeneration which occurs ultimately leads to the death of the host. An intriguing feature of the prion diseases, when compared with other protein-misfolding diseases, is their transmissibility. Following peripheral exposure, some prion diseases accumulate to high levels within lymphoid tissues. The replication of prions within lymphoid tissue has been shown to be important for the efficient spread of disease to the brain. This article describes recent progress in our understanding of the cellular mechanisms that influence the propagation of prions from peripheral sites of exposure (such as the lumen of the intestine) to the brain. A thorough understanding of these events will lead to the identification of important targets for therapeutic intervention, or alternatively, reveal additional processes that influence disease susceptibility to peripherally-acquired prion diseases.

Truncated forms of the prion protein PrP demonstrate the need for complexity in prion structure.

Science.gov (United States)

Wan, William; Stöhr, Jan; Kendall, Amy; Stubbs, Gerald

2015-01-01

Self-propagation of aberrant protein folds is the defining characteristic of prions. Knowing the structural basis of self-propagation is essential to understanding prions and their related diseases. Prion rods are amyloid fibrils, but not all amyloids are prions. Prions have been remarkably intractable to structural studies, so many investigators have preferred to work with peptide fragments, particularly in the case of the mammalian prion protein PrP. We compared the structures of a number of fragments of PrP by X-ray fiber diffraction, and found that although all of the peptides adopted amyloid conformations, only the larger fragments adopted conformations that modeled the complexity of self-propagating prions, and even these fragments did not always adopt the PrP structure. It appears that the relatively complex structure of the prion form of PrP is not accessible to short model peptides, and that self-propagation may be tied to a level of structural complexity unobtainable in simple model systems. The larger fragments of PrP, however, are useful to illustrate the phenomenon of deformed templating (heterogeneous seeding), which has important biological consequences.

Canine candidate genes for dilated cardiomyopathy: annotation of and polymorphic markers for 14 genes.

Science.gov (United States)

Wiersma, Anje C; Leegwater, Peter Aj; van Oost, Bernard A; Ollier, William E; Dukes-McEwan, Joanna

2007-10-19

Dilated cardiomyopathy is a myocardial disease occurring in humans and domestic animals and is characterized by dilatation of the left ventricle, reduced systolic function and increased sphericity of the left ventricle. Dilated cardiomyopathy has been observed in several, mostly large and giant, dog breeds, such as the Dobermann and the Great Dane. A number of genes have been identified, which are associated with dilated cardiomyopathy in the human, mouse and hamster. These genes mainly encode structural proteins of the cardiac myocyte. We present the annotation of, and marker development for, 14 of these genes of the dog genome, i.e. alpha-cardiac actin, caveolin 1, cysteine-rich protein 3, desmin, lamin A/C, LIM-domain binding factor 3, myosin heavy polypeptide 7, phospholamban, sarcoglycan delta, titin cap, alpha-tropomyosin, troponin I, troponin T and vinculin. A total of 33 Single Nucleotide Polymorphisms were identified for these canine genes and 11 polymorphic microsatellite repeats were developed. The presented polymorphisms provide a tool to investigate the role of the corresponding genes in canine Dilated Cardiomyopathy by linkage analysis or association studies.

Controlling the prion propensity of glutamine/asparagine-rich proteins.

Science.gov (United States)

Paul, Kacy R; Ross, Eric D

2015-01-01

The yeast Saccharomyces cerevisiae can harbor a number of distinct prions. Most of the yeast prion proteins contain a glutamine/asparagine (Q/N) rich region that drives prion formation. Prion-like domains, defined as regions with high compositional similarity to yeast prion domains, are common in eukaryotic proteomes, and mutations in various human proteins containing prion-like domains have been linked to degenerative diseases, including amyotrophic lateral sclerosis. Here, we discuss a recent study in which we utilized two strategies to generate prion activity in non-prion Q/N-rich domains. First, we made targeted mutations in four non-prion Q/N-rich domains, replacing predicted prion-inhibiting amino acids with prion-promoting amino acids. All four mutants formed foci when expressed in yeast, and two acquired bona fide prion activity. Prion activity could be generated with as few as two mutations, suggesting that many non-prion Q/N-rich proteins may be just a small number of mutations from acquiring aggregation or prion activity. Second, we created tandem repeats of short prion-prone segments, and observed length-dependent prion activity. These studies demonstrate the considerable progress that has been made in understanding the sequence basis for aggregation of prion and prion-like domains, and suggest possible mechanisms by which new prion domains could evolve.

New polymorphisms of Xeroderma Pigmentosum DNA repair genes in myelodysplastic syndrome.

Science.gov (United States)

Santiago, Sabrina Pinheiro; Junior, Howard Lopes Ribeiro; de Sousa, Juliana Cordeiro; de Paula Borges, Daniela; de Oliveira, Roberta Taiane Germano; Farias, Izabelle Rocha; Costa, Marília Braga; Maia, Allan Rodrigo Soares; da Nóbrega Ito, Mayumi; Magalhães, Silvia Maria Meira; Pinheiro, Ronald Feitosa

2017-07-01

The association between Xeroderma Pigmentosum DNA repair genes (XPA rs1800975, XPC rs2228000, XPD rs1799793 and XPF rs1800067) polymorphisms and myelodysplastic syndrome (MDS) have not been reported. To assess the functional role between these polymorphisms and MDS, we evaluated 189 samples stratified in two groups: 95 bone marrow samples from MDS patients and 94 from healthy elderly volunteers used as controls. Genotypes for all polymorphisms were identified in DNA samples in an allelic discrimination experiment by real-time polymerase chain reaction (qPCR). We also studied the mRNA expression of XPA and XPC genes to evaluate if its polymorphisms were functional in 53 RNAm MDS patients by qPCR methodologies. To the rs2228000 polymorphism, the CT and TT polymorphic genotype were associated with increased odds ratio (OR) of more profound cytopenia (hemoglobin and neutrophils count). To the rs1799793 polymorphism, we found that the GG homozygous wild-type genotype was associated with a decreased chance of developing MDS. We observed low expression of XPA in younger patients, in hypoplastic MDS and patients with abnormal karyotype when presented AG or AA polymorphic genotypes. We also found that there was a statistically significant interaction between the presence of micromegakaryocyte on down regulation of XPC regarding the CT heterozygous genotype of the rs1800975 polymorphism. Our results suggest that new functional polymorphisms of Xeroderma Pigmentosum DNA repair genes in MDS are related to its pathogenesis and prognosis. Copyright © 2017 Elsevier Ltd. All rights reserved.

Cellular Aspects of Prion Replication In Vitro

Science.gov (United States)

Grassmann, Andrea; Wolf, Hanna; Hofmann, Julia; Graham, James; Vorberg, Ina

2013-01-01

Prion diseases or transmissible spongiform encephalopathies (TSEs) are fatal neurodegenerative disorders in mammals that are caused by unconventional agents predominantly composed of aggregated misfolded prion protein (PrP). Prions self-propagate by recruitment of host-encoded PrP into highly ordered β-sheet rich aggregates. Prion strains differ in their clinical, pathological and biochemical characteristics and are likely to be the consequence of distinct abnormal prion protein conformers that stably replicate their alternate states in the host cell. Understanding prion cell biology is fundamental for identifying potential drug targets for disease intervention. The development of permissive cell culture models has greatly enhanced our knowledge on entry, propagation and dissemination of TSE agents. However, despite extensive research, the precise mechanism of prion infection and potential strain effects remain enigmatic. This review summarizes our current knowledge of the cell biology and propagation of prions derived from cell culture experiments. We discuss recent findings on the trafficking of cellular and pathologic PrP, the potential sites of abnormal prion protein synthesis and potential co-factors involved in prion entry and propagation. PMID:23340381

Biosafety of Prions.

Science.gov (United States)

Bistaffa, Edoardo; Rossi, Martina; De Luca, Chiara M G; Moda, Fabio

2017-01-01

Prions are the infectious agents that cause devastating and untreatable disorders known as Transmissible Spongiform Encephalopathies (TSEs). The pathologic events and the infectious nature of these transmissible agents are not completely understood yet. Due to the difficulties in inactivating prions, working with them requires specific recommendations and precautions. Moreover, with the advent of innovative technologies, such as the Protein Misfolding Cyclic Amplification (PMCA) and the Real Time Quaking-Induced Conversion (RT-QuIC), prions could be amplified in vitro and the infectious features of the amplified products need to be carefully assessed. © 2017 Elsevier Inc. All rights reserved.

Polymorphisms at the Ligand Binding Site of the Vitamin D Receptor Gene and Osteomalacia

Science.gov (United States)

Ak, Duygu Gezen; Kahraman, Hakkí; Dursun, Erdinç; Duman, Belgin Süsleyici; Erensoy, Nevin; Alagöl, Faruk; Tanakol, Refik; Yılmazer, Selma

2005-01-01

Vitamin D receptor (VDR) gene polymorphisms have been suggested as possible determinants of bone mineral density (BMD) and calcium metabolism. In this study, our aim was to determine whether there is an association between VDR gene polymorphism and osteomalacia or not. We determined ApaI and TaqI polymorphisms in the vitamin D receptor gene in 24 patients with osteomalacia and 25 age-matched healthy controls. Serum calcium, phosphorus, ALP, PTH, 25OHD levels were also examined. We used PCR and RFLP methods to test for an association between osteomalacia and polymorphisms within, intron 8 and exon 9 of the VDR gene. When the control and patients were compared for their ApaI and TaqI genotypes there was no relationship between VDR gene allelic polymorphisms and osteomalacia. Whereas a nearly significant difference for A allele was found in the allellic distribution of the patients (p = 0.08). Also no association between biochemical data and VDR gene polymorphisms was observed. PMID:16403954

Polymorphisms at the Ligand Binding Site of the Vitamin D Receptor Gene and Osteomalacia

Directory of Open Access Journals (Sweden)

Duygu Gezen Ak

2005-01-01

Full Text Available Vitamin D receptor (VDR gene polymorphisms have been suggested as possible determinants of bone mineral density (BMD and calcium metabolism. In this study, our aim was to determine whether there is an association between VDR gene polymorphism and osteomalacia or not. We determined ApaI and TaqI polymorphisms in the vitamin D receptor gene in 24 patients with osteomalacia and 25 age-matched healthy controls. Serum calcium, phosphorus, ALP, PTH, 25OHD levels were also examined. We used PCR and RFLP methods to test for an association between osteomalacia and polymorphisms within, intron 8 and exon 9 of the VDR gene. When the control and patients were compared for their ApaI and TaqI genotypes there was no relationship between VDR gene allelic polymorphisms and osteomalacia. Whereas a nearly significant difference for A allele was found in the allellic distribution of the patients (p = 0.08. Also no association between biochemical data and VDR gene polymorphisms was observed.

Thermodynamic Stabilization of the Folded Domain of Prion Protein Inhibits Prion Infection in Vivo

Directory of Open Access Journals (Sweden)

Qingzhong Kong

2013-07-01

Full Text Available Prion diseases, or transmissible spongiform encephalopathies (TSEs, are associated with the conformational conversion of the cellular prion protein, PrPC, into a protease-resistant form, PrPSc. Here, we show that mutation-induced thermodynamic stabilization of the folded, α-helical domain of PrPC has a dramatic inhibitory effect on the conformational conversion of prion protein in vitro, as well as on the propagation of TSE disease in vivo. Transgenic mice expressing a human prion protein variant with increased thermodynamic stability were found to be much more resistant to infection with the TSE agent than those expressing wild-type human prion protein, in both the primary passage and three subsequent subpassages. These findings not only provide a line of evidence in support of the protein-only model of TSEs but also yield insight into the molecular nature of the PrPC→PrPSc conformational transition, and they suggest an approach to the treatment of prion diseases.

The effects of glutamine/asparagine content on aggregation and heterologous prion induction by yeast prion-like domains.

Science.gov (United States)

Shattuck, Jenifer E; Waechter, Aubrey C; Ross, Eric D

2017-07-04

Prion-like domains are low complexity, intrinsically disordered domains that compositionally resemble yeast prion domains. Many prion-like domains are involved in the formation of either functional or pathogenic protein aggregates. These aggregates range from highly dynamic liquid droplets to highly ordered detergent-insoluble amyloid-like aggregates. To better understand the amino acid sequence features that promote conversion to stable, detergent-insoluble aggregates, we used the prediction algorithm PAPA to identify predicted aggregation-prone prion-like domains with a range of compositions. While almost all of the predicted aggregation-prone domains formed foci when expressed in cells, the ability to form the detergent-insoluble aggregates was highly correlated with glutamine/asparagine (Q/N) content, suggesting that high Q/N content may specifically promote conversion to the amyloid state in vivo. We then used this data set to examine cross-seeding between prion-like proteins. The prion protein Sup35 requires the presence of a second prion, [PIN + ], to efficiently form prions, but this requirement can be circumvented by the expression of various Q/N-rich protein fragments. Interestingly, almost all of the Q/N-rich domains that formed SDS-insoluble aggregates were able to promote prion formation by Sup35, highlighting the highly promiscuous nature of these interactions.

Live-cell FRET imaging reveals clustering of the prion protein at the cell surface induced by infectious prions.

Science.gov (United States)

Tavares, Evandro; Macedo, Joana A; Paulo, Pedro M R; Tavares, Catarina; Lopes, Carlos; Melo, Eduardo P

2014-07-01

Prion diseases are associated to the conversion of the prion protein into a misfolded pathological isoform. The mechanism of propagation of protein misfolding by protein templating remains largely unknown. Neuroblastoma cells were transfected with constructs of the prion protein fused to both CFP-GPI-anchored and to YFP-GPI-anchored and directed to its cell membrane location. Live-cell FRET imaging between the prion protein fused to CFP or YFP was measured giving consistent values of 10±2%. This result was confirmed by fluorescence lifetime imaging microscopy and indicates intermolecular interactions between neighbor prion proteins. In particular, considering that a maximum FRET efficiency of 17±2% was determined from a positive control consisting of a fusion CFP-YFP-GPI-anchored. A stable cell clone expressing the two fusions containing the prion protein was also selected to minimize cell-to-cell variability. In both, stable and transiently transfected cells, the FRET efficiency consistently increased in the presence of infectious prions - from 4±1% to 7±1% in the stable clone and from 10±2% to 16±1% in transiently transfected cells. These results clearly reflect an increased clustering of the prion protein on the membrane in the presence of infectious prions, which was not observed in negative control using constructs without the prion protein and upon addition of non-infected brain. Our data corroborates the recent view that the primary site for prion conversion is the cell membrane. Since our fluorescent cell clone is not susceptible to propagate infectivity, we hypothesize that the initial event of prion infectivity might be the clustering of the GPI-anchored prion protein. Copyright © 2014 Elsevier B.V. All rights reserved.

Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

Directory of Open Access Journals (Sweden)

Pooja H. Gupta

2015-05-01

Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

Are Toll-like receptor gene polymorphisms associated with prostate cancer?

International Nuclear Information System (INIS)

Kutikhin, Anton G; Yuzhalin, Arseniy E

2012-01-01

The suggestion that there is a connection between chronic intraprostatic inflammation and prostate cancer was declared some years ago. As Toll-like receptors (TLRs) are the key players in the processes of chronic intraprostatic inflammation, there is a hypothesis that TLR gene polymorphisms may be associated with prostate cancer risk. Although a number of comprehensive studies have been conducted on large samples in various countries, reliable connections between these single nucleotide polymorphisms and prostate cancer risk, stage, grade, aggressiveness, ability to metastasize, and mortality have not been detected. Results have also varied slightly in different populations. The data obtained regarding the absence of connection between the polymorphisms of the genes encoding interleukin-1 receptor-associated kinases (IRAK1 and IRAK4) and prostate cancer risk might indicate a lack of association between inherited variation in the TLR signaling pathway and prostate cancer risk. It is possible to consider that polymorphisms of genes encoding TLRs and proteins of the TLR pathway also do not play a major role in the etiology and pathogenesis of prostate cancer. Feasibly, it would be better to focus research on associations between TLR single nucleotide polymorphisms and cancer risk in other infection-related cancer types

Cytokine gene polymorphisms and their association with cervical ...

African Journals Online (AJOL)

Materials and methods: The present study was undertaken to evaluate association of cytokine gene polymorphisms with cervical cancer in a north Indian population. Genotyping of single nucleotide polymorphisms (SNPs) viz. IL 6-597G/A (rs1800797), IL-1b-511C/T (rs16944) and TNF-a-308G/A (rs1800629) was carried out ...

The complexity and implications of yeast prion domains

Science.gov (United States)

2011-01-01

Prions are infectious proteins with altered conformations converted from otherwise normal host proteins. While there is only one known mammalian prion protein, PrP, a handful of prion proteins have been identified in the yeast Saccharomyces cerevisiae. Yeast prion proteins usually have a defined region called prion domain (PrD) essential for prion properties, which are typically rich in glutamine (Q) and asparagine (N). Despite sharing several common features, individual yeast PrDs are generally intricate and divergent in their compositional characteristics, which potentially implicates their prion phenotypes, such as prion-mediated transcriptional regulations. PMID:22156731

Prion diseases and adult neurogenesis: how do prions counteract the brain's endogenous repair machinery?

Science.gov (United States)

Relaño-Ginés, Aroa; Lehmann, Sylvain; Crozet, Carole

2014-01-01

Scientific advances in stem cell biology and adult neurogenesis have raised the hope that neurodegenerative disorders could benefit from stem cell-based therapy. Adult neurogenesis might be part of the physiological regenerative process, however it might become impaired by the disease's mechanism and therefore contribute to neurodegeneration. In prion disorders this endogenous repair system has rarely been studied. Whether adult neurogenesis plays a role or not in brain repair or in the propagation of prion pathology remains unclear. We have recently investigated the status of adult neural stem cells isolated from prion-infected mice. We were able to show that neural stem cells accumulate and replicate prions thus resulting in an alteration of their neuronal destiny. We also reproduced these results in adult neural stem cells, which were infected in vitro. The fact that endogenous adult neurogenesis could be altered by the accumulation of misfolded prion protein represents another great challenge. Inhibiting prion propagation in these cells would thus help the endogenous neurogenesis to compensate for the injured neuronal system. Moreover, understanding the endogenous modulation of the neurogenesis system would help develop effective neural stem cell-based therapies.

Spermidine cures yeast of prions

Directory of Open Access Journals (Sweden)

Shaun H. Speldewinde

2015-12-01

Full Text Available Prions are self-perpetuating amyloid protein aggregates which underlie various neurodegenerative diseases in mammals. The molecular basis underlying their conversion from a normally soluble protein into the prion form remains largely unknown. Studies aimed at uncovering these mechanism(s are therefore essential if we are to develop effective therapeutic strategies to counteract these disease-causing entities. Autophagy is a cellular degradation system which has predominantly been considered as a non-selective bulk degradation process which recycles macromolecules in response to starvation conditions. We now know that autophagy also serves as a protein quality control mechanism which selectively degrades protein aggregates and damaged organelles. These are commonly accumulated in various neurodegenerative disorders including prion diseases. In our recent study [Speldewinde et al. Mol. Biol. Cell. (2015] we used the well-established yeast [PSI+]/Sup35 and [PIN­+]/Rnq1 prion models to show that autophagy prevents sporadic prion formation. Importantly, we found that spermidine, a polyamine that has been used to increase autophagic flux, acts as a protective agent which prevents spontaneous prion formation.

Accelerating Yeast Prion Biology using Droplet Microfluidics

Science.gov (United States)

Ung, Lloyd; Rotem, Assaf; Jarosz, Daniel; Datta, Manoshi; Lindquist, Susan; Weitz, David

2012-02-01

Prions are infectious proteins in a misfolded form, that can induce normal proteins to take the misfolded state. Yeast prions are relevant, as a model of human prion diseases, and interesting from an evolutionary standpoint. Prions may also be a form of epigenetic inheritance, which allow yeast to adapt to stressful conditions at rates exceeding those of random mutations and propagate that adaptation to their offspring. Encapsulation of yeast in droplet microfluidic devices enables high-throughput measurements with single cell resolution, which would not be feasible using bulk methods. Millions of populations of yeast can be screened to obtain reliable measurements of prion induction and loss rates. The population dynamics of clonal yeast, when a fraction of the cells are prion expressing, can be elucidated. Furthermore, the mechanism by which certain strains of bacteria induce yeast to express prions in the wild can be deduced. Integrating the disparate fields of prion biology and droplet microfluidics reveals a more complete picture of how prions may be more than just diseases and play a functional role in yeast.

The celecoxib derivatives AR-12 and AR-14 induce autophagy and clear prion-infected cells from prions.

Science.gov (United States)

Abdulrahman, Basant A; Abdelaziz, Dalia; Thapa, Simrika; Lu, Li; Jain, Shubha; Gilch, Sabine; Proniuk, Stefan; Zukiwski, Alexander; Schatzl, Hermann M

2017-12-14

Prion diseases are fatal infectious neurodegenerative disorders that affect both humans and animals. The autocatalytic conversion of the cellular prion protein (PrP C ) into the pathologic isoform PrP Sc is a key feature in prion pathogenesis. AR-12 is an IND-approved derivative of celecoxib that demonstrated preclinical activity against several microbial diseases. Recently, AR-12 has been shown to facilitate clearance of misfolded proteins. The latter proposes AR-12 to be a potential therapeutic agent for neurodegenerative disorders. In this study, we investigated the role of AR-12 and its derivatives in controlling prion infection. We tested AR-12 in prion infected neuronal and non-neuronal cell lines. Immunoblotting and confocal microscopy results showed that AR-12 and its analogue AR-14 reduced PrP Sc levels after only 72 hours of treatment. Furthermore, infected cells were cured of PrP Sc after exposure of AR-12 or AR-14 for only two weeks. We partially attribute the influence of the AR compounds on prion propagation to autophagy stimulation, in line with our previous findings that drug-induced stimulation of autophagy has anti-prion effects in vitro and in vivo. Taken together, this study demonstrates that AR-12 and the AR-14 analogue are potential new therapeutic agents for prion diseases and possibly protein misfolding disorders involving prion-like mechanisms.

Functional diversification of hsp40: distinct j-protein functional requirements for two prions allow for chaperone-dependent prion selection.

Science.gov (United States)

Harris, Julia M; Nguyen, Phil P; Patel, Milan J; Sporn, Zachary A; Hines, Justin K

2014-07-01

Yeast prions are heritable amyloid aggregates of functional yeast proteins; their propagation to subsequent cell generations is dependent upon fragmentation of prion protein aggregates by molecular chaperone proteins. Mounting evidence indicates the J-protein Sis1 may act as an amyloid specificity factor, recognizing prion and other amyloid aggregates and enabling Ssa and Hsp104 to act in prion fragmentation. Chaperone interactions with prions, however, can be affected by variations in amyloid-core structure resulting in distinct prion variants or 'strains'. Our genetic analysis revealed that Sis1 domain requirements by distinct variants of [PSI+] are strongly dependent upon overall variant stability. Notably, multiple strong [PSI+] variants can be maintained by a minimal construct of Sis1 consisting of only the J-domain and glycine/phenylalanine-rich (G/F) region that was previously shown to be sufficient for cell viability and [RNQ+] prion propagation. In contrast, weak [PSI+] variants are lost under the same conditions but maintained by the expression of an Sis1 construct that lacks only the G/F region and cannot support [RNQ+] propagation, revealing mutually exclusive requirements for Sis1 function between these two prions. Prion loss is not due to [PSI+]-dependent toxicity or dependent upon a particular yeast genetic background. These observations necessitate that Sis1 must have at least two distinct functional roles that individual prions differentially require for propagation and which are localized to the glycine-rich domains of the Sis1. Based on these distinctions, Sis1 plasmid-shuffling in a [PSI+]/[RNQ+] strain permitted J-protein-dependent prion selection for either prion. We also found that, despite an initial report to the contrary, the human homolog of Sis1, Hdj1, is capable of [PSI+] prion propagation in place of Sis1. This conservation of function is also prion-variant dependent, indicating that only one of the two Sis1-prion functions may have

MTHFR Gene C677T Polymorphism in Autism Spectrum Disorders

Directory of Open Access Journals (Sweden)

Elif Funda Sener

2014-01-01

Full Text Available Aim. Autism is a subgroup of autism spectrum disorders, classified as a heterogeneous neurodevelopmental disorder and symptoms occur in the first three years of life. The etiology of autism is largely unknown, but it has been accepted that genetic and environmental factors may both be responsible for the disease. Recent studies have revealed that the genes involved in the folate/homocysteine pathway may be risk factors for autistic children. In particular, C677T polymorphism in the MTHFR gene as a possible risk factor for autism is still controversial. We aimed to investigate the possible effect of C677T polymorphism in a Turkish cohort. Methods. Autism patients were diagnosed by child psychiatrists according to DSM-IV and DSM-V criteria. A total of 98 children diagnosed as autistic and 70 age and sex-matched children who are nonautistic were tested for C677T polymorphism. This polymorphism was studied by using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP methods. Results. MTHFR 677T-allele frequency was found to be higher in autistic children compared with nonautistic children (29% versus 24%, but it was not found statistically significant. Conclusions. We conclude that other MTHFR polymorphisms such as A1298C or other folate/homocysteine pathway genes may be studied to show their possible role in autism.

Canine candidate genes for dilated cardiomyopathy: annotation of and polymorphic markers for 14 genes

Directory of Open Access Journals (Sweden)

van Oost Bernard A

2007-10-01

Full Text Available Abstract Background Dilated cardiomyopathy is a myocardial disease occurring in humans and domestic animals and is characterized by dilatation of the left ventricle, reduced systolic function and increased sphericity of the left ventricle. Dilated cardiomyopathy has been observed in several, mostly large and giant, dog breeds, such as the Dobermann and the Great Dane. A number of genes have been identified, which are associated with dilated cardiomyopathy in the human, mouse and hamster. These genes mainly encode structural proteins of the cardiac myocyte. Results We present the annotation of, and marker development for, 14 of these genes of the dog genome, i.e. α-cardiac actin, caveolin 1, cysteine-rich protein 3, desmin, lamin A/C, LIM-domain binding factor 3, myosin heavy polypeptide 7, phospholamban, sarcoglycan δ, titin cap, α-tropomyosin, troponin I, troponin T and vinculin. A total of 33 Single Nucleotide Polymorphisms were identified for these canine genes and 11 polymorphic microsatellite repeats were developed. Conclusion The presented polymorphisms provide a tool to investigate the role of the corresponding genes in canine Dilated Cardiomyopathy by linkage analysis or association studies.

Covalent surface modification of prions: a mass spectrometry-based means of detecting distinctive structural features of prion strains

Science.gov (United States)

Prions (PrPSc) are molecular pathogens that are able to convert the isosequential normal cellular prion protein (PrPC) into a prion. The only demonstrated differences between PrPC and PrPSc is conformational, they are isoforms. A given host can be infected by more than one kind or strain of prion. F...

Androgen Receptor Gene Polymorphism, Aggression, and Reproduction in Tanzanian Foragers and Pastoralists

Science.gov (United States)

Butovskaya, Marina L.; Lazebny, Oleg E.; Vasilyev, Vasiliy A.; Dronova, Daria A.; Karelin, Dmitri V.; Mabulla, Audax Z. P.; Shibalev, Dmitri V.; Shackelford, Todd K.; Fink, Bernhard; Ryskov, Alexey P.

2015-01-01

The androgen receptor (AR) gene polymorphism in humans is linked to aggression and may also be linked to reproduction. Here we report associations between AR gene polymorphism and aggression and reproduction in two small-scale societies in northern Tanzania (Africa)—the Hadza (monogamous foragers) and the Datoga (polygynous pastoralists). We secured self-reports of aggression and assessed genetic polymorphism of the number of CAG repeats for the AR gene for 210 Hadza men and 229 Datoga men (aged 17–70 years). We conducted structural equation modeling to identify links between AR gene polymorphism, aggression, and number of children born, and included age and ethnicity as covariates. Fewer AR CAG repeats predicted greater aggression, and Datoga men reported more aggression than did Hadza men. In addition, aggression mediated the identified negative relationship between CAG repeats and number of children born. PMID:26291982

Lesion of the Olfactory Epithelium Accelerates Prion Neuroinvasion and Disease Onset when Prion Replication Is Restricted to Neurons

Science.gov (United States)

Crowell, Jenna; Wiley, James A.; Bessen, Richard A.

2015-01-01

Natural prion diseases of ruminants are moderately contagious and while the gastrointestinal tract is the primary site of prion agent entry, other mucosae may be entry sites in a subset of infections. In the current study we examined prion neuroinvasion and disease induction following disruption of the olfactory epithelium in the nasal mucosa since this site contains environmentally exposed olfactory sensory neurons that project directly into the central nervous system. Here we provide evidence for accelerated prion neuroinvasion and clinical onset from the olfactory mucosa after disruption and regeneration of the olfactory epithelium and when prion replication is restricted to neurons. In transgenic mice with neuron restricted replication of prions, there was a reduction in survival when the olfactory epithelium was disrupted prior to intranasal inoculation and there was >25% decrease in the prion incubation period. In a second model, the neurotropic DY strain of transmissible mink encephalopathy was not pathogenic in hamsters by the nasal route, but 50% of animals exhibited brain infection and/or disease when the olfactory epithelium was disrupted prior to intranasal inoculation. A time course analysis of prion deposition in the brain following loss of the olfactory epithelium in models of neuron-restricted prion replication suggests that neuroinvasion from the olfactory mucosa is via the olfactory nerve or brain stem associated cranial nerves. We propose that induction of neurogenesis after damage to the olfactory epithelium can lead to prion infection of immature olfactory sensory neurons and accelerate prion spread to the brain. PMID:25822718

Lesion of the olfactory epithelium accelerates prion neuroinvasion and disease onset when prion replication is restricted to neurons.

Directory of Open Access Journals (Sweden)

Jenna Crowell

Full Text Available Natural prion diseases of ruminants are moderately contagious and while the gastrointestinal tract is the primary site of prion agent entry, other mucosae may be entry sites in a subset of infections. In the current study we examined prion neuroinvasion and disease induction following disruption of the olfactory epithelium in the nasal mucosa since this site contains environmentally exposed olfactory sensory neurons that project directly into the central nervous system. Here we provide evidence for accelerated prion neuroinvasion and clinical onset from the olfactory mucosa after disruption and regeneration of the olfactory epithelium and when prion replication is restricted to neurons. In transgenic mice with neuron restricted replication of prions, there was a reduction in survival when the olfactory epithelium was disrupted prior to intranasal inoculation and there was >25% decrease in the prion incubation period. In a second model, the neurotropic DY strain of transmissible mink encephalopathy was not pathogenic in hamsters by the nasal route, but 50% of animals exhibited brain infection and/or disease when the olfactory epithelium was disrupted prior to intranasal inoculation. A time course analysis of prion deposition in the brain following loss of the olfactory epithelium in models of neuron-restricted prion replication suggests that neuroinvasion from the olfactory mucosa is via the olfactory nerve or brain stem associated cranial nerves. We propose that induction of neurogenesis after damage to the olfactory epithelium can lead to prion infection of immature olfactory sensory neurons and accelerate prion spread to the brain.

Two methylenetetrahydrofolate reductase gene (MTHFR) polymorphisms, schizophrenia and bipolar disorder

DEFF Research Database (Denmark)

Jönsson, Erik G; Larsson, Kristina; Vares, Maria

2008-01-01

disorder. In a replication attempt the MTHFR C677T and A1298C SNPs were analyzed in three Scandinavian schizophrenia case-control samples. In addition, Norwegian patients with bipolar disorder were investigated. There were no statistically significant allele or genotype case-control differences....... The present Scandinavian results do not verify previous associations between the putative functional MTHFR gene polymorphisms and schizophrenia or bipolar disorder. However, when combined with previous studies in meta-analyses there is still evidence for association between the MTHFR C677T polymorphism......Recent meta-analyses of the methylenetetrahydrofolate reductase gene (MTHFR) have suggested association between two of its functional single gene polymorphisms (SNPs; C677T and A1298C) and schizophrenia. Studies have also suggested association between MTHFR C677T and A1298C variation and bipolar...

IDENTIFICATION OF GH|ALUI AND GHR|ALUI GENES POLYMORPHISMS IN INDONESIAN BUFFALO

Directory of Open Access Journals (Sweden)

E. Andreas

2014-10-01

Full Text Available Growth hormone (GH is an anabolic hormone which sintesized and secreted by somatrotop cell inpituitary anterior lobe. GH exert its effect on growth and metabolism by interacting with a specificreceptor on the surface of the target cells. Growth hormone receptor (GHR has been suggested ascandidate gene for traits related to meat production in Bovidae. The objectives of this study were toidentify polymorphism of GH and GHR genes in buffalo. The 452 DNA samples buffalo were collectedfrom five populations in Indonesia (Siborong-Borong-Medan (65, Lebak-Banten (29, Pandeglang-Banten (180, Semarang-Central Java, and Mataram-West Nusa Tenggara (103. A gene fragment of theGH|AluI gene at 432 bp located on exon 3 and GHR|AluI gene at 298 bp on exon 10 were successfullyamplified by using the techniques of a PCR (polymerase chain reaction and genotyped by PCR-RFLP(restriction fragment length polymorphism then -SSCP (single strand conformation polymorphism. Theresults showed no polymorphisms were detected in these genes. All buffaloes tested had LL genotype forlocus GH|AluI and AA genotype for locus GHR|AluI.

Association of genetic polymorphism in GH gene with milk ...

Indian Academy of Sciences (India)

Associations were analysed between polymorphisms of the growth hormone gene (GH-MspI) (localized in intron 3) and milk production traits of Beijing Holstein cows (a total of 543 cows). Polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP) method was used for identification of various ...

Role of Prion Replication in the Strain-dependent Brain Regional Distribution of Prions.

Science.gov (United States)

Hu, Ping Ping; Morales, Rodrigo; Duran-Aniotz, Claudia; Moreno-Gonzalez, Ines; Khan, Uffaf; Soto, Claudio

2016-06-10

One intriguing feature of prion diseases is their strain variation. Prion strains are differentiated by the clinical consequences they generate in the host, their biochemical properties, and their potential to infect other animal species. The selective targeting of these agents to specific brain structures have been extensively used to characterize prion strains. However, the molecular basis dictating strain-specific neurotropism are still elusive. In this study, isolated brain structures from animals infected with four hamster prion strains (HY, DY, 139H, and SSLOW) were analyzed for their content of protease-resistant PrP(Sc) Our data show that these strains have different profiles of PrP deposition along the brain. These patterns of accumulation, which were independent of regional PrP(C) production, were not reproduced by in vitro replication when different brain regions were used as substrate for the misfolding-amplification reaction. On the contrary, our results show that in vitro replication efficiency depended exclusively on the amount of PrP(C) present in each part of the brain. Our results suggest that the variable regional distribution of PrP(Sc) in distinct strains is not determined by differences on prion formation, but on other factors or cellular pathways. Our findings may contribute to understand the molecular mechanisms of prion pathogenesis and strain diversity. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Transmission Properties of Human PrP 102L Prions Challenge the Relevance of Mouse Models of GSS.

Science.gov (United States)

Asante, Emmanuel A; Grimshaw, Andrew; Smidak, Michelle; Jakubcova, Tatiana; Tomlinson, Andrew; Jeelani, Asif; Hamdan, Shyma; Powell, Caroline; Joiner, Susan; Linehan, Jacqueline M; Brandner, Sebastian; Wadsworth, Jonathan D F; Collinge, John

2015-07-01

Inherited prion disease (IPD) is caused by autosomal-dominant pathogenic mutations in the human prion protein (PrP) gene (PRNP). A proline to leucine substitution at PrP residue 102 (P102L) is classically associated with Gerstmann-Sträussler-Scheinker (GSS) disease but shows marked clinical and neuropathological variability within kindreds that may be caused by variable propagation of distinct prion strains generated from either PrP 102L or wild type PrP. To-date the transmission properties of prions propagated in P102L patients remain ill-defined. Multiple mouse models of GSS have focused on mutating the corresponding residue of murine PrP (P101L), however murine PrP 101L, a novel PrP primary structure, may not have the repertoire of pathogenic prion conformations necessary to accurately model the human disease. Here we describe the transmission properties of prions generated in human PrP 102L expressing transgenic mice that were generated after primary challenge with ex vivo human GSS P102L or classical CJD prions. We show that distinct strains of prions were generated in these mice dependent upon source of the inoculum (either GSS P102L or CJD brain) and have designated these GSS-102L and CJD-102L prions, respectively. GSS-102L prions have transmission properties distinct from all prion strains seen in sporadic and acquired human prion disease. Significantly, GSS-102L prions appear incapable of transmitting disease to conventional mice expressing wild type mouse PrP, which contrasts strikingly with the reported transmission properties of prions generated in GSS P102L-challenged mice expressing mouse PrP 101L. We conclude that future transgenic modeling of IPDs should focus exclusively on expression of mutant human PrP, as other approaches may generate novel experimental prion strains that are unrelated to human disease.

Spontaneous generation of rapidly transmissible prions in transgenic mice expressing wild-type bank vole prion protein.

Science.gov (United States)

Watts, Joel C; Giles, Kurt; Stöhr, Jan; Oehler, Abby; Bhardwaj, Sumita; Grillo, Sunny K; Patel, Smita; DeArmond, Stephen J; Prusiner, Stanley B

2012-02-28

Currently, there are no animal models of the most common human prion disorder, sporadic Creutzfeldt-Jakob disease (CJD), in which prions are formed spontaneously from wild-type (WT) prion protein (PrP). Interestingly, bank voles (BV) exhibit an unprecedented promiscuity for diverse prion isolates, arguing that bank vole PrP (BVPrP) may be inherently prone to adopting misfolded conformations. Therefore, we constructed transgenic (Tg) mice expressing WT BVPrP. Tg(BVPrP) mice developed spontaneous CNS dysfunction between 108 and 340 d of age and recapitulated the hallmarks of prion disease, including spongiform degeneration, pronounced astrogliosis, and deposition of alternatively folded PrP in the brain. Brain homogenates of ill Tg(BVPrP) mice transmitted disease to Tg(BVPrP) mice in ∼35 d, to Tg mice overexpressing mouse PrP in under 100 d, and to WT mice in ∼185 d. Our studies demonstrate experimentally that WT PrP can spontaneously form infectious prions in vivo. Thus, Tg(BVPrP) mice may be useful for studying the spontaneous formation of prions, and thus may provide insight into the etiology of sporadic CJD.

Follicular dendritic cell-specific prion protein (PrP expression alone is sufficient to sustain prion infection in the spleen.

Directory of Open Access Journals (Sweden)

Laura McCulloch

2011-12-01

Full Text Available Prion diseases are characterised by the accumulation of PrP(Sc, an abnormally folded isoform of the cellular prion protein (PrP(C, in affected tissues. Following peripheral exposure high levels of prion-specific PrP(Sc accumulate first upon follicular dendritic cells (FDC in lymphoid tissues before spreading to the CNS. Expression of PrP(C is mandatory for cells to sustain prion infection and FDC appear to express high levels. However, whether FDC actively replicate prions or simply acquire them from other infected cells is uncertain. In the attempts to-date to establish the role of FDC in prion pathogenesis it was not possible to dissociate the Prnp expression of FDC from that of the nervous system and all other non-haematopoietic lineages. This is important as FDC may simply acquire prions after synthesis by other infected cells. To establish the role of FDC in prion pathogenesis transgenic mice were created in which PrP(C expression was specifically "switched on" or "off" only on FDC. We show that PrP(C-expression only on FDC is sufficient to sustain prion replication in the spleen. Furthermore, prion replication is blocked in the spleen when PrP(C-expression is specifically ablated only on FDC. These data definitively demonstrate that FDC are the essential sites of prion replication in lymphoid tissues. The demonstration that Prnp-ablation only on FDC blocked splenic prion accumulation without apparent consequences for FDC status represents a novel opportunity to prevent neuroinvasion by modulation of PrP(C expression on FDC.

Direct Detection of Soil-Bound Prions

Science.gov (United States)

Genovesi, Sacha; Leita, Liviana; Sequi, Paolo; Andrighetto, Igino; Sorgato, M. Catia; Bertoli, Alessandro

2007-01-01

Scrapie and chronic wasting disease are contagious prion diseases affecting sheep and cervids, respectively. Studies have indicated that horizontal transmission is important in sustaining these epidemics, and that environmental contamination plays an important role in this. In the perspective of detecting prions in soil samples from the field by more direct methods than animal-based bioassays, we have developed a novel immuno-based approach that visualises in situ the major component (PrPSc) of prions sorbed onto agricultural soil particles. Importantly, the protocol needs no extraction of the protein from soil. Using a cell-based assay of infectivity, we also report that samples of agricultural soil, or quartz sand, acquire prion infectivity after exposure to whole brain homogenates from prion-infected mice. Our data provide further support to the notion that prion-exposed soils retain infectivity, as recently determined in Syrian hamsters intracerebrally or orally challanged with contaminated soils. The cell approach of the potential infectivity of contaminated soil is faster and cheaper than classical animal-based bioassays. Although it suffers from limitations, e.g. it can currently test only a few mouse prion strains, the cell model can nevertheless be applied in its present form to understand how soil composition influences infectivity, and to test prion-inactivating procedures. PMID:17957252

Direct detection of soil-bound prions.

Directory of Open Access Journals (Sweden)

Sacha Genovesi

Full Text Available Scrapie and chronic wasting disease are contagious prion diseases affecting sheep and cervids, respectively. Studies have indicated that horizontal transmission is important in sustaining these epidemics, and that environmental contamination plays an important role in this. In the perspective of detecting prions in soil samples from the field by more direct methods than animal-based bioassays, we have developed a novel immuno-based approach that visualises in situ the major component (PrP(Sc of prions sorbed onto agricultural soil particles. Importantly, the protocol needs no extraction of the protein from soil. Using a cell-based assay of infectivity, we also report that samples of agricultural soil, or quartz sand, acquire prion infectivity after exposure to whole brain homogenates from prion-infected mice. Our data provide further support to the notion that prion-exposed soils retain infectivity, as recently determined in Syrian hamsters intracerebrally or orally challenged with contaminated soils. The cell approach of the potential infectivity of contaminated soil is faster and cheaper than classical animal-based bioassays. Although it suffers from limitations, e.g. it can currently test only a few mouse prion strains, the cell model can nevertheless be applied in its present form to understand how soil composition influences infectivity, and to test prion-inactivating procedures.

Impact of estrogen receptor α gene and oxytocin receptor gene polymorphisms on female sexuality

Directory of Open Access Journals (Sweden)

Anastasia K Armeni

2017-02-01

Full Text Available Over the past decades, research attention has increasingly been paid to the neurobiological component of sexual behavior. The aim of the present study was to investigate the correlation of estrogen receptor α (ERA gene polymorphism (rs2234693-PvuII (T→C substitution and oxytocin receptor gene polymorphism (rs53576 (G→A substitution with sexuality parameters of young, healthy women. One hundred thirty-three Greek heterosexual women, students in higher education institutions, 20–25 years of age, sexually active, with normal menstrual cycles (28–35 days, were recruited in the study. Exclusion criteria were chronic and/or major psychiatric diseases, use of oral contraceptive pills (OCs, polycystic ovary syndrome (PCOS, thyroid diseases as well as drugs that are implicated in hypothalamus–pituitary–gonadal axis. T allele (wildtype of rs2234693 (PvuII polymorphism of ERA gene was correlated with increased levels of arousal and lubrication, whereas A allele (polymorphic of rs53576 (OXTR polymorphism was correlated with increased arousal levels. The simultaneous presence of both T allele of rs2234693 (PvuII and A allele of rs53576 (OXTR polymorphisms (T + A group was correlated with increased arousal, orgasm levels as well as female sexual function index full score. To our knowledge, this is the first study to investigate the interaction between ERA and OXTR with regard to sexual function in women. Female sexuality is a complex behavioral trait that encompasses both biological and psychological components. It seems that variability in female sexual response stems from genetic variability that characterizes endocrine, neurotransmitter and central nervous system influences.

Structural characterization of POM6 Fab and mouse prion protein complex identifies key regions for prions conformational conversion.

Science.gov (United States)

Baral, Pravas Kumar; Swayampakula, Mridula; Aguzzi, Adriano; James, Michael N G

2018-05-01

Conversion of the cellular prion protein PrP C into its pathogenic isoform PrP S c is the hallmark of prion diseases, fatal neurodegenerative diseases affecting many mammalian species including humans. Anti-prion monoclonal antibodies can arrest the progression of prion diseases by stabilizing the cellular form of the prion protein. Here, we present the crystal structure of the POM6 Fab fragment, in complex with the mouse prion protein (moPrP). The prion epitope of POM6 is in close proximity to the epitope recognized by the purportedly toxic antibody fragment, POM1 Fab also complexed with moPrP. The POM6 Fab recognizes a larger binding interface indicating a likely stronger binding compared to POM1. POM6 and POM1 exhibit distinct biological responses. Structural comparisons of the bound mouse prion proteins from the POM6 Fab:moPrP and POM1 Fab:moPrP complexes reveal several key regions of the prion protein that might be involved in initiating mis-folding events. The structural data of moPrP:POM6 Fab complex are available in the PDB under the accession number www.rcsb.org/pdb/search/structidSearch.do?structureId=6AQ7. © 2018 Federation of European Biochemical Societies.

Mammalian amyloidogenic proteins promote prion nucleation in yeast.

Science.gov (United States)

Chandramowlishwaran, Pavithra; Sun, Meng; Casey, Kristin L; Romanyuk, Andrey V; Grizel, Anastasiya V; Sopova, Julia V; Rubel, Aleksandr A; Nussbaum-Krammer, Carmen; Vorberg, Ina M; Chernoff, Yury O

2018-03-02

Fibrous cross-β aggregates (amyloids) and their transmissible forms (prions) cause diseases in mammals (including humans) and control heritable traits in yeast. Initial nucleation of a yeast prion by transiently overproduced prion-forming protein or its (typically, QN-rich) prion domain is efficient only in the presence of another aggregated (in most cases, QN-rich) protein. Here, we demonstrate that a fusion of the prion domain of yeast protein Sup35 to some non-QN-rich mammalian proteins, associated with amyloid diseases, promotes nucleation of Sup35 prions in the absence of pre-existing aggregates. In contrast, both a fusion of the Sup35 prion domain to a multimeric non-amyloidogenic protein and the expression of a mammalian amyloidogenic protein that is not fused to the Sup35 prion domain failed to promote prion nucleation, further indicating that physical linkage of a mammalian amyloidogenic protein to the prion domain of a yeast protein is required for the nucleation of a yeast prion. Biochemical and cytological approaches confirmed the nucleation of protein aggregates in the yeast cell. Sequence alterations antagonizing or enhancing amyloidogenicity of human amyloid-β (associated with Alzheimer's disease) and mouse prion protein (associated with prion diseases), respectively, antagonized or enhanced nucleation of a yeast prion by these proteins. The yeast-based prion nucleation assay, developed in our work, can be employed for mutational dissection of amyloidogenic proteins. We anticipate that it will aid in the identification of chemicals that influence initial amyloid nucleation and in searching for new amyloidogenic proteins in a variety of proteomes. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Genetic Polymorphisms in Cytokine Genes in Colombian Patients with Ocular Toxoplasmosis.

Science.gov (United States)

Naranjo-Galvis, C A; de-la-Torre, A; Mantilla-Muriel, L E; Beltrán-Angarita, L; Elcoroaristizabal-Martín, X; McLeod, R; Alliey-Rodriguez, N; Begeman, I J; López de Mesa, C; Gómez-Marín, J E; Sepúlveda-Arias, J C

2018-04-01

Toxoplasmosis is caused by infection with the protozoan parasite Toxoplasma gondii , which has the capacity to infect all warm-blooded animals worldwide. Toxoplasmosis is a major cause of visual defects in the Colombian population; however, the association between genetic polymorphisms in cytokine genes and susceptibility to ocular toxoplasmosis has not been studied in this population. This work evaluates the associations between polymorphisms in genes coding for the cytokines tumor necrosis factor alpha (TNF-α) (rs1799964, rs1800629, rs1799724, rs1800630, and rs361525), interleukin 1β (IL-1β) (rs16944, rs1143634, and rs1143627), IL-1α (rs1800587), gamma interferon (IFN-γ) (rs2430561), and IL-10 (rs1800896 and rs1800871) and the presence of ocular toxoplasmosis (OT) in a sample of a Colombian population (61 patients with OT and 116 healthy controls). Genotyping was performed with the "dideoxynucleotide (ddNTP) primer extension" technique. Functional-effect predictions of single nucleotide polymorphisms (SNPs) were done by using FuncPred. A polymorphism in the IL-10 gene promoter (-1082G/A) was significantly more prevalent in OT patients than in controls ( P = 1.93e-08; odds ratio [OR] = 5.27e+03; 95% confidence interval [CI] = 3.18 to 8.739; Bonferroni correction [BONF] = 3.48e-07). In contrast, haplotype "AG" of the IL-10 gene promoter polymorphisms (rs1800896 and rs1800871) was present at a lower frequency in OT patients ( P = 7e-04; OR = 0.10; 95% CI = 0.03 to 0.35). The +874A/T polymorphism of IFN-γ was associated with OT ( P = 3.37e-05; OR = 4.2; 95% CI = 2.478 to 7.12; BONF = 6.07e-04). Haplotype "GAG" of the IL-1β gene promoter polymorphisms (rs1143634, rs1143627, and rs16944) appeared to be significantly associated with OT ( P = 0.0494). The IL-10, IFN-γ, and IL-1β polymorphisms influence the development of OT in the Colombian population. Copyright © 2018 American Society for Microbiology.

Association between Single Nucleotide Polymorphisms in Vitamin D Receptor Gene Polymorphisms and Permanent Tooth Caries Susceptibility to Permanent Tooth Caries in Chinese Adolescent

Directory of Open Access Journals (Sweden)

Miao Yu

2017-01-01

Full Text Available Purpose. Dental caries is a multifactorial infectious disease. In this study, we investigated whether single nucleotide polymorphisms (SNPs in vitamin D receptor (VDR gene were associated with susceptibility to permanent tooth caries in Chinese adolescents. Method. A total of 200 dental caries patients and 200 healthy controls aged 12 years were genotyped for VDR gene polymorphisms using the PCR-restriction fragment length polymorphism (PCR-RFLP assay. All of them were examined for their oral and dental status with the WHO criteria, and clinical information such as the Decayed Missing Filled Teeth Index (DMFT was evaluated. Genomic DNA was extracted from the buccal epithelial cells. The four polymorphic SNPs (Bsm I, Taq I, Apa I, and Fok I in VDR were assessed for both genotypic and phenotypic susceptibilities. Results. Among the four examined VDR gene polymorphisms, the increased frequency of the CT and CC genotype of the Fok I VDR gene polymorphism was associated with dental caries in 12-year-old adolescent, compared with the controls (X2 = 17.813, p≤0.001. Moreover, Fok I polymorphic allele C frequency was significantly increased in the dental caries cases, compared to the controls (X2 = 14.144, p≤0.001, OR = 1.730, 95% CI = 1.299–2.303. However, the other three VDR gene polymorphisms (Bsm I, Taq I, and Apa I showed no statistically significant differences in the caries groups compared with the controls. Conclusion. VDR-Fok I gene polymorphisms may be associated with susceptibility to permanent tooth caries in Chinese adolescent.

Polymorphism of growth hormone gene and its association with ...

African Journals Online (AJOL)

sunny t

2016-04-06

Apr 6, 2016 ... recorded to be more frequent (83.3, 92.86 and 90%) than pattern II (16.7, 7.14 and 10%) in Barki,. Rahmani ... Key words: Sheep, wool, growth hormone (GH) gene, polymorphism, single strand conformation polymorphism. (SSCP). ... electrophoresis and chemical and ribonuclease cleavage,. SSCP has ...

Association of Gene Polymorphisms in Interleukin 6 in Infantile Bronchial Asthma.

Science.gov (United States)

Babusikova, Eva; Jurecekova, Jana; Jesenak, Milos; Evinova, Andrea

2017-07-01

The genetic background of bronchial asthma is complex, and it is likely that multiple genes contribute to its development both directly and through gene-gene interactions. Cytokines contribute to different aspects of asthma, as they determine the type, severity and outcomes of asthma pathogenesis. Allergic asthmatics undergoing an asthmatic attack exhibit significantly higher levels of pro-inflammatory cytokines, such as interleukins and chemokines. In recent years, cytokines and their receptors have been shown to be highly polymorphic, and this prompted us to investigate interleukin 6 promoter polymorphisms at position -174G/C (rs1800795) and at -572G/C (rs1800796) in relation to asthma in children. Interleukin 6 promoter polymorphisms were analyzed in bronchial asthma patients and healthy children using polymerase chain reaction-restriction fragment length polymorphism analysis. We observed a significant association between polymorphism at -174G/C and bronchial asthma (OR=3.4, 95% CI: 2.045-5.638, P<.001). Higher associations between polymorphism at IL-6 -174G/C and bronchial asthma were observed in atopic patients (OR=4.1, 95% CI: 2.308-7.280, P<8.10 -7 ). Interleukin 6 polymorphism is associated with bronchial asthma, particularly its atopic phenotype. Expression and secretion of interleukins in asthmatic patients may be affected by genetic polymorphisms, and could have a disease-modifying effect in the asthmatic airway and modify the therapeutic response. Copyright © 2016 SEPAR. Publicado por Elsevier España, S.L.U. All rights reserved.

Analysis of Vitamin D Receptor (VDR Gene Polymorphisms in Alopecia Areata

Directory of Open Access Journals (Sweden)

Omer Ates

2016-09-01

Full Text Available Aim: Alopecia areata (AA is a disease characterized with hair loss on the hair skin any region of the body. This disease affects approximately 1%u20132% of the general population. The etiopathogenesis of this disease is unclear but infections, genetic, psychological and autoimmune factors is known play to role. Vitamin D is thought to be a regulator of the immune system and the action of it is dependent on the vitamin D receptor (VDR. Given the autoimmune component shared by this autoimmune diseases. In this study investigated the role of VDR gene polymorphisms in the development of AA. Material and Method: The study group included 198 patients with AA and 167 control. Genomic DNA was extracted from blood samples using DNA isolation kit. The frequency of VDR gene polymorphisms genotypes and allelic variants were analyzed by using Polymerase Chain Reaction (PCR and Restriction Fragment Length Polymorphisms (RFLP method. Results: Statistical evaluation of data results showed a not significant association for genotypic frequency distribution between the VDR gene BsmI (rs1544410 and ApaI (rs7975232, TaqI (rs731236 polymorphisms and AA (p=0.8891, 0.7309, 0.6761, respectively. Discussion: Our study reflects that VDR gene polymorphisms could not play a role in determining genetic susceptibility to AA.

The evaluation of angiotensin-converting enzyme (ACE) gene I/D and IL-4 gene intron 3 VNTR polymorphisms in coronary artery disease.

Science.gov (United States)

Basol, Nursah; Celik, Atac; Karakus, Nevin; Ozturk, Sibel Demir; Ozsoy, Sibel Demir; Yigit, Serbulent

2014-01-01

Genetic polymorphism is a strong risk factor for coronary artery disease (CAD). In the present study, our aim was to evaluate angiotensin-converting enzyme (ACE) gene I/D polymorphism and interleukin-4 (IL-4) gene Intron 3 variable number of tandem repeat (VNTR) polymorphism in CAD. One hundred and twenty-four CAD patients and one hundred and twenty-three controls were enrolled. Genomic DNA was isolated and genotyped using polymerase chain reaction (PCR) analyses. The risk associated with inheriting the combined genotypes for the two polymorphisms were evaluated and it was found that the individuals who were P2P2-homozygous at IL-4 gene intron 3 VNTR and DD-homozygous at ACE gene I/D have a higher risk of developing CAD. Although, there is no correlation between IL4 VNTR polymorphism and ACE gene polymorphism and CAD, there is a strong association between CAD and co-existence of IL-4 VNTR and ACE gene polymorphisms in the Turkish population. Copyright © 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Association of TAP Gene Polymorphisms and Risk of Cervical Intraepithelial Neoplasia

Directory of Open Access Journals (Sweden)

Camilla Natter

2013-01-01

Full Text Available Background. Transporter associated with antigen processing (TAP is responsible for peptide loading onto class I major histocompatibility complex (MHC-I molecules. TAP seems to facilitate the detection of HPV by MHC-I molecules and contributes to successful eradication of HPV. TAP polymorphisms could have an important impact on the course of HPV infection. Objective. The aim of this study is to evaluate the association between five TAP gene polymorphisms and the risk of CIN. Methods. This case-control study investigated five common TAP polymorphisms in TAP1 (1341 and 2254 and TAP2 (1135, 1693, and 1993 in 616 women with CIN and 206 controls. Associations between gene polymorphisms and risk of CIN were analysed by univariate and multivariable models. The combined effect of the five TAP gene polymorphisms on the risk for CIN was investigated by haplotype analysis. Results. No significant difference in genotype distribution of the five TAP polymorphisms was observed in women with CIN and controls. Haplotype analysis revealed that women with haplotype mut-wt-wt-wt-wt (TAP polymorphisms t1135-t1341-t1693-t1993-t2254 had a significantly lower risk for CIN, compared to women with the haplotype wt-wt-wt-wt-wt (; OR 0.5 []. Conclusion. Identification of this haplotype combination could be used to identify women, less susceptible for development of CIN following HPV infection.

Soluble Aβ aggregates can inhibit prion propagation.

Science.gov (United States)

Sarell, Claire J; Quarterman, Emma; Yip, Daniel C-M; Terry, Cassandra; Nicoll, Andrew J; Wadsworth, Jonathan D F; Farrow, Mark A; Walsh, Dominic M; Collinge, John

2017-11-01

Mammalian prions cause lethal neurodegenerative diseases such as Creutzfeldt-Jakob disease (CJD) and consist of multi-chain assemblies of misfolded cellular prion protein (PrP C ). Ligands that bind to PrP C can inhibit prion propagation and neurotoxicity. Extensive prior work established that certain soluble assemblies of the Alzheimer's disease (AD)-associated amyloid β-protein (Aβ) can tightly bind to PrP C , and that this interaction may be relevant to their toxicity in AD. Here, we investigated whether such soluble Aβ assemblies might, conversely, have an inhibitory effect on prion propagation. Using cellular models of prion infection and propagation and distinct Aβ preparations, we found that the form of Aβ assemblies which most avidly bound to PrP in vitro also inhibited prion infection and propagation. By contrast, forms of Aβ which exhibit little or no binding to PrP were unable to attenuate prion propagation. These data suggest that soluble aggregates of Aβ can compete with prions for binding to PrP C and emphasize the bidirectional nature of the interplay between Aβ and PrP C in Alzheimer's and prion diseases. Such inhibitory effects of Aβ on prion propagation may contribute to the apparent fall-off in the incidence of sporadic CJD at advanced age where cerebral Aβ deposition is common. © 2017 The Authors.

Prions: the danger of biochemical weapons

Directory of Open Access Journals (Sweden)

Eric Almeida Xavier

2014-09-01

Full Text Available The knowledge of biotechnology increases the risk of using biochemical weapons for mass destruction. Prions are unprecedented infectious pathogens that cause a group of fatal neurodegenerative diseases by a novel mechanism. They are transmissible particles that are devoid of nucleic acid. Due to their singular characteristics, Prions emerge as potential danger since they can be used in the development of such weapons. Prions cause fatal infectious diseases, and to date there is no therapeutic or prophylactic approach against these diseases. Furthermore, Prions are resistant to food-preparation treatments such as high heat and can find their way from the digestive system into the nervous system; recombinant Prions are infectious either bound to soil particles or in aerosols. Therefore, lethal Prions can be developed by malicious researchers who could use it to attack political enemies since such weapons cause diseases that could be above suspicion.

Effects of a naturally occurring amino acid substitution in bovine PrP: a model for inherited prion disease in a natural host species

Science.gov (United States)

The most common hereditary prion disease is human Creutzfeldt-Jakob disease (CJD) associated with a mutation in the prion gene (PRNP) resulting in a glutamic acid to lysine substitution at position 200 (E200K) in the prion protein. Models of E200K CJD in transgenic mice have proven interesting but h...

Association of ghrelin receptor gene polymorphism with bulimia nervosa in a Japanese population.

Science.gov (United States)

Miyasaka, K; Hosoya, H; Sekime, A; Ohta, M; Amono, H; Matsushita, S; Suzuki, K; Higuchi, S; Funakoshi, A

2006-09-01

Eating disorders (EDs) have a highly heterogeneous etiology and multiple genetic factors might contribute to their pathogenesis. Ghrelin, a novel growth hormone-releasing peptide, enhances appetite and increases food intake, and human ghrelin plasma levels are inversely correlated with body mass index. In the present study, we examined the 171T/C polymorphism of the ghrelin receptor (growth hormone secretagogue receptor, GHSR) gene in patients diagnosed with EDs, because the subjects having ghrelin gene polymorphism (Leu72Met) was not detected in a Japanese population, previously. In addition, beta3 adrenergic receptor gene polymorphism (Try64Arg) and cholecystokinin (CCK)-A receptor (R) gene polymorphism (-81A/G, -128G/T), which are both associated with obesity, were investigated. The subjects consisted of 228 Japanese patients with EDs [96 anorexia nervosa (AN), 116 bulimia nervosa (BN) and 16 not otherwise specified (NOS)]. The age- and gender-matched control group consisted of 284 unrelated Japanese subjects. The frequency of the CC type of the GHSR gene was significantly higher in BN subjects than in control subjects (chi(2) = 4.47, p = 0.035, odds ratio = 2.05, Bonferroni correction: p = 0.070), while the frequency in AN subjects was not different from that in controls. The distribution of neither beta3 adrenergic receptor gene nor CCK-AR polymorphism differed between EDs and control subjects. Therefore, the CC type of GHSR gene polymorphism (171T/C) is a risk factor for BN, but not for AN.

Defining the conformational features of anchorless, poorly neuroinvasive prions.

Directory of Open Access Journals (Sweden)

Cyrus Bett

Full Text Available Infectious prions cause diverse clinical signs and form an extraordinary range of structures, from amorphous aggregates to fibrils. How the conformation of a prion dictates the disease phenotype remains unclear. Mice expressing GPI-anchorless or GPI-anchored prion protein exposed to the same infectious prion develop fibrillar or nonfibrillar aggregates, respectively, and show a striking divergence in the disease pathogenesis. To better understand how a prion's physical properties govern the pathogenesis, infectious anchorless prions were passaged in mice expressing anchorless prion protein and the resulting prions were biochemically characterized. Serial passage of anchorless prions led to a significant decrease in the incubation period to terminal disease and altered the biochemical properties, consistent with a transmission barrier effect. After an intraperitoneal exposure, anchorless prions were only weakly neuroinvasive, as prion plaques rarely occurred in the brain yet were abundant in extracerebral sites such as heart and adipose tissue. Anchorless prions consistently showed very high stability in chaotropes or when heated in SDS, and were highly resistant to enzyme digestion. Consistent with the results in mice, anchorless prions from a human patient were also highly stable in chaotropes. These findings reveal that anchorless prions consist of fibrillar and highly stable conformers. The additional finding from our group and others that both anchorless and anchored prion fibrils are poorly neuroinvasive strengthens the hypothesis that a fibrillar prion structure impedes efficient CNS invasion.

76 FR 71294 - Prions; Proposed Amendment To Clarify Product Performance Data for Products With Prion-Related...

Science.gov (United States)

2011-11-17

... (FIFRA), and to amend its regulations to expressly include prion within the regulatory definition of pest... observed by the user including, but not limited to, microorganisms infectious to man in any area of the... prion within the regulatory definition of pest. EPA currently considers a prion to be a pest under FIFRA...

Coexistence of protease sensitive and resistant prion protein in 129VV homozygous sporadic Creutzfeldt–Jakob disease: a case report

Directory of Open Access Journals (Sweden)

Rodríguez-Martínez Ana B

2012-10-01

Full Text Available Abstract Introduction The coexistence of different molecular types of classical protease-resistant prion protein in the same individual have been described, however, the simultaneous finding of these with the recently described protease-sensitive variant or variably protease-sensitive prionopathy has, to the best of our knowledge, not yet been reported. Case presentation A 74-year-old Caucasian woman showed a sporadic Creutzfeldt–Jakob disease clinical phenotype with reactive depression, followed by cognitive impairment, akinetic-rigid Parkinsonism with pseudobulbar syndrome and gait impairment with motor apraxia, visuospatial disorientation, and evident frontal dysfunction features such as grasping, palmomental reflex and brisk perioral reflexes. She died at age 77. Neuropathological findings showed: spongiform change in the patient’s cerebral cortex, striatum, thalamus and molecular layer of the cerebellum with proteinase K-sensitive synaptic-like, dot-like or target-like prion protein deposition in the cortex, thalamus and striatum; proteinase K-resistant prion protein in the same regions; and elongated plaque-like proteinase K-resistant prion protein in the molecular layer of the cerebellum. Molecular analysis of prion protein after proteinase K digestion revealed decreased signal intensity in immunoblot, a ladder-like protein pattern, and a 71% reduction of PrPSc signal relative to non-digested material. Her cerebellum showed a 2A prion protein type largely resistant to proteinase K. Genotype of polymorphism at codon 129 was valine homozygous. Conclusion Molecular typing of prion protein along with clinical and neuropathological data revealed, to the best of our knowledge, the first case of the coexistence of different protease-sensitive prion proteins in the same patient in a rare case that did not fulfill the current clinical diagnostic criteria for either probable or possible sporadic Creutzfeldt–Jakob disease. This highlights the

Interleukin-6 and tumor necrosis factor-alpha gene polymorphisms in chronic idiopathic urticaria.

Science.gov (United States)

Tavakol, M; Amirzargar, A A; Movahedi, M; Aryan, Z; Bidoki, A Z; Gharagozlou, M; Aghamohammadi, A; Nabavi, M; Ahmadvand, A; Behniafard, N; Heidari, K; Soltani, S; Rezaei, N

2014-01-01

This study was performed to evaluate association of gene polymorphisms among proinflammatory cytokines and susceptibility to chronic idiopathic urticaria (CIU). Ninety patients with prolonged urticaria more than 6 weeks were included as case group. Single nucleotide polymorphisms (SNPs) of IL-6 (G/C -174, G/A nt565) and TNF-α (G/A -308, G/A -238) were evaluated, using polymerase chain reaction (PCR); and the results were compared to the control group. G allele was significantly higher in the patients at locus of -238 of promoter of TNF-α gene (p<0.001). Frequency of following genotypes were significantly lower in patients with CIU, compared to controls: AG at -308 and GA at -238 of TNF-α gene (p<0.05 and p<0.001, respectively), CG at -174 and GG at +565 of IL-6 gene (p<0.05). Additionally, following genotypes were more common among patients with CIU: GG at -308 and -238 of TNF-α gene (p<0.05 and p<0.001, respectively), GG at -174 and GA at +565 of IL-6 gene (p<0.05). Pro-inflammatory cytokine gene polymorphisms can affect susceptibility to CIU. TNF-α promoter polymorphisms as well as IL-6 gene polymorphisms are associated with CIU. Copyright © 2013 SEICAP. Published by Elsevier Espana. All rights reserved.

Endothelial nitric oxide synthase gene Glu298Asp polymorphism ...

African Journals Online (AJOL)

Administrator

2011-09-12

Sep 12, 2011 ... Figure 1. The Glu298Asp polymorphism of eNOS gene was shown by .... mechanisms by which eNOS Asp298 polymorphism ... Asp298 is exposed to selective proteolytic cleavage in ... grounds, inclusion and exclusion criteria for PE women ... attention to meta analysis study, it is more probable that.

Glycoform-selective prion formation in sporadic and familial forms of prion disease

NARCIS (Netherlands)

Xiao, X.; Yuan, J.; Haïk, S.; Cali, I.; Zhan, Y.; Moudjou, M.; Li, B.; Laplanche, J.L.; Laude, H.; Langeveld, J.P.M.; Gambetti, P.

2013-01-01

The four glycoforms of the cellular prion protein (PrP(C)) variably glycosylated at the two N-linked glycosylation sites are converted into their pathological forms (PrP(Sc)) in most cases of sporadic prion diseases. However, a prominent molecular characteristic of PrP(Sc) in the recently identified

Efficient prion disease transmission through common environmental materials.

Science.gov (United States)

Pritzkow, Sandra; Morales, Rodrigo; Lyon, Adam; Concha-Marambio, Luis; Urayama, Akihiko; Soto, Claudio

2018-03-02

Prion diseases are a group of fatal neurodegenerative diseases associated with a protein-based infectious agent, termed prion. Compelling evidence suggests that natural transmission of prion diseases is mediated by environmental contamination with infectious prions. We hypothesized that several natural and man-made materials, commonly found in the environments of wild and captive animals, can bind prions and may act as vectors for disease transmission. To test our hypothesis, we exposed surfaces composed of various common environmental materials ( i.e. wood, rocks, plastic, glass, cement, stainless steel, aluminum, and brass) to hamster-adapted 263K scrapie prions and studied their attachment and retention of infectivity in vitro and in vivo Our results indicated that these surfaces, with the sole exception of brass, efficiently bind, retain, and release prions. Prion replication was studied in vitro using the protein misfolding cyclic amplification technology, and infectivity of surface-bound prions was analyzed by intracerebrally challenging hamsters with contaminated implants. Our results revealed that virtually all prion-contaminated materials transmitted the disease at high rates. To investigate a more natural form of exposure to environmental contamination, we simply housed animals with large contaminated spheres made of the different materials under study. Strikingly, most of the hamsters developed classical clinical signs of prion disease and typical disease-associated brain changes. Our findings suggest that prion contamination of surfaces commonly present in the environment can be a source of disease transmission, thus expanding our understanding of the mechanisms for prion spreading in nature. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

General and Specific Genetic Polymorphism of Cytokines-Related Gene in AITD

Directory of Open Access Journals (Sweden)

Chen Xiaoheng

2017-01-01

Full Text Available Autoimmune thyroid disease (AITD shows the highest incidence among organ-specific autoimmune diseases and is the most common thyroid disease in humans, including Graves’ disease (GD and Hashimoto’s thyroiditis (HT. The susceptibility to autoimmune diseases is affected by increased autoantibody levels, susceptibility gene polymorphisms, environmental factors, and psychological factors, but the pathogenesis remains unclear. Various cytokines and related genes encoding them play important roles in the development and progression of AITD. CD152, an expression product of the CTLA-4 gene, downregulates T cell activation. The A/A genotype polymorphism in the CT60 locus may reduce the production of thyroid autoantibodies. The C1858T polymorphism of the PTNP22 gene reduces the expression of its encoded LYP, which increases the risk of GD and HT. GD is an organ-specific autoimmune disease involving increased secretion of thyroid hormone, whereas HT may be associated with the destruction of thyroid gland tissue and hypothyroidism. These two diseases exhibit similar pathogenesis but opposite trends in the clinical manifestations. In this review, we focus on the structure and function of these cytokines and related genes in AITD, as well as the association of polymorphisms with susceptibility to GD and HT, and attempt to describe their differences in pathogenesis and clinical manifestations.

PTH Gene Polymorphism and Breast Cancer Risk in Kazakhstan

Directory of Open Access Journals (Sweden)

Nurgul Sikhayeva

2014-12-01

Full Text Available Introduction. Breast cancer is the most common type of cancer among women. In Kazakhstan, breast cancer holds first place among causes of women death caused by cancer in the 45-55 year age group . Many studies have shown that the risk of acquiring breast cancer may be related to the level of calcium in the blood serum. One of the important regulators of calcium metabolism in the body is the parathyroid hormone. Single nucleotide polymorphisms in the gene encoding the parathyroid hormone (PTH are associated with breast cancer development risk, and may modify the associative interaction between the levels of calcium intake and breast cancer. Experimental studies have shown that PTH gene has a carcinogenic effect. At least three studies showed a weak positive correlation between the risk of acquiring breast cancer and primary hyperparathyroidism, a state with high levels of PTH and often high levels of calcium. The aim of this investigation was to evaluate potential association between PTH gene polymorphism and breast cancer risk among Kazakhstani women.Methods. Female breast cancer patients (n = 429 and matched control women (n = 373 were recruited into a case – control study,. Genomic DNA was extracted from peripheral venous blood of study participants using Wizard® Genomic DNA Purification Kit (Promega, USA. Detection of PTH gene polymorphism (rs1459015 was done by means of the TaqMan® SNP Genotyping Assay of real-time PCR. Statistical analysis was conducted using SPSS 19.0.Results. PTH gene alleles were in Hardy–Weinberg equilibrium (p > 0.05. Distribution was 59% CC, 35% CT, 6% TT in the group with breast cancer and 50% CC, 43% CT, 6% TT in the control group. Total difference (between the group with breast cancer and the control group in allele frequencies for PTH polymorphism was not significant (p > 0.05. No association was found between rs1459015 TT and breast cancer risk (OR = 1.039; 95%, CI 0.740 - 1.297; p = 0.893.Conclusion. We

Malassezia Yeast and Cytokine Gene Polymorphism in Atopic Dermatitis.

Science.gov (United States)

Jain, Charu; Das, Shukla; Ramachandran, V G; Saha, Rumpa; Bhattacharya, S N; Dar, Sajad

2017-03-01

Atopic Dermatitis (AD) is a recurrent chronic condition associated with microorganism and their interaction with the susceptible host. Malassezia yeast is a known commensal which is thought to provoke the recurrent episodes of symptoms in atopic dermatitis patients. Malassezia immunomodulatory properties along with defective skin barrier in such host, results in disease manifestation. Here, we studied Single Nucleotide Polymorphism (SNP) in IL10 and IFN γ genes of the host and its relation with susceptibility to Malassezia infection. To isolate Malassezia yeast from AD patients and compare the genetic susceptibility of the host by correlating the cytokine gene polymorphism with the control subjects. Study was conducted from January 2012 to January 2013. It was a prospective observational study done in Department of Microbiology and Department of Dermatology and Venereology in University College of Medical Sciences and GTB Hospital, Delhi. Sample size comprised of 38 cases each of AD. Skin scrapings were used for fungal culture on Sabouraud Dextrose Agar (SDA) and Modified Dixon Agar (MDA) and isolated were identified as per conventional phenotypic methods. Genomic DNA was extracted from blood samples collected from all study subjects. Cytokine genotyping was carried out by Amplification Refractory Mutations System- Polymerase Chain Reaction (ARMS-PCR) with sequence specific primers. Three SNPs (IL10-1082A/G; IL10-819/592C/T; IFN-γ+874A/T) in two cytokine genes were assessed in all the patients and healthy controls. Chi-Square Test or Fisher's-Exact Test and Bonferroni's correction. In AD group, Malassezia yeasts were cultured in 24 out of 38 samples and thus the identification rate was 63.1 percent as compared to healthy group, 52.6 percent (20/38). Significant difference in allele, or genotype distribution were observed in IL10-819/592C/T and IFN-γ+874A/T gene polymorphism in AD group. Higher isolation rate in cases as compared to control group highlights the

Prions and neuro degenerative diseases | Nair | African Journal of ...

African Journals Online (AJOL)

Prion is a disease-causing agent that is neither bacterial nor fungal nor viral and contains no genetic material. A prion is a protein that occurs normally in a harmless form. By folding into an aberrant shape, the normal prion turns into a rogue agent. It then co-opts other normal prions to become rogue prions. Prions have ...

Grass Plants Bind, Retain, Uptake, and Transport Infectious Prions

Directory of Open Access Journals (Sweden)

Sandra Pritzkow

2015-05-01

Full Text Available Prions are the protein-based infectious agents responsible for prion diseases. Environmental prion contamination has been implicated in disease transmission. Here, we analyzed the binding and retention of infectious prion protein (PrPSc to plants. Small quantities of PrPSc contained in diluted brain homogenate or in excretory materials (urine and feces can bind to wheat grass roots and leaves. Wild-type hamsters were efficiently infected by ingestion of prion-contaminated plants. The prion-plant interaction occurs with prions from diverse origins, including chronic wasting disease. Furthermore, leaves contaminated by spraying with a prion-containing preparation retained PrPSc for several weeks in the living plant. Finally, plants can uptake prions from contaminated soil and transport them to aerial parts of the plant (stem and leaves. These findings demonstrate that plants can efficiently bind infectious prions and act as carriers of infectivity, suggesting a possible role of environmental prion contamination in the horizontal transmission of the disease.

Prion-based memory of heat stress in yeast.

Science.gov (United States)

Chernova, Tatiana A; Chernoff, Yury O; Wilkinson, Keith D

2017-05-04

Amyloids and amyloid-based prions are self-perpetuating protein aggregates which can spread by converting a normal protein of the same sequence into a prion form. They are associated with diseases in humans and mammals, and control heritable traits in yeast and other fungi. Some amyloids are implicated in biologically beneficial processes. As prion formation generates reproducible memory of a conformational change, prions can be considered as molecular memory devices.  We have demonstrated that in yeast, stress-inducible cytoskeleton-associated protein Lsb2 forms a metastable prion in response to high temperature. This prion promotes conversion of other proteins into prions and can persist in a fraction of cells for a significant number of cell generations after stress, thus maintaining the memory of stress in a population of surviving cells. Acquisition of an amino acid substitution required for Lsb2 to form a prion coincides with acquisition of increased thermotolerance in the evolution of Saccharomyces yeast. Thus the ability to form an Lsb2 prion in response to stress coincides with yeast adaptation to growth at higher temperatures. These findings intimately connect prion formation to the cellular response to environmental stresses.

Polymorphism in ABC transporter genes of Dirofilaria immitis

Directory of Open Access Journals (Sweden)

Thangadurai Mani

2017-08-01

Full Text Available Dirofilaria immitis, a filarial nematode, causes dirofilariasis in dogs, cats and occasionally in humans. Prevention of the disease has been mainly by monthly use of the macrocyclic lactone (ML endectocides during the mosquito transmission season. Recently, ML resistance has been confirmed in D. immitis and therefore, there is a need to find new classes of anthelmintics. One of the mechanisms associated with ML resistance in nematodes has been the possible role of ATP binding cassette (ABC transporters in reducing drug concentrations at receptor sites. ABC transporters, mainly from sub-families B, C and G, may contribute to multidrug resistance (MDR by active efflux of drugs out of the cell. Gene products of ABC transporters may thus serve as the targets for agents that may modulate susceptibility to drugs, by inhibiting drug transport. ABC transporters are believed to be involved in a variety of physiological functions critical to the parasite, such as sterol transport, and therefore may also serve as the target for drugs that can act as anthelmintics on their own. Knowledge of polymorphism in these ABC transporter genes in nematode parasites could provide useful information for the process of drug design. We have identified 15 ABC transporter genes from sub-families A, B, C and G, in D. immitis, by comparative genomic approaches and analyzed them for polymorphism. Whole genome sequencing data from four ML susceptible (SUS and four loss of efficacy (LOE pooled populations were used for single nucleotide polymorphism (SNP genotyping. Out of 231 SNPs identified in those 15 ABC transporter genes, 89 and 75 of them were specific to the SUS or LOE populations, respectively. A few of the SNPs identified may affect gene expression, protein function, substrate specificity or resistance development and may be useful for transporter inhibitor/anthelmintic drug design, or in order to anticipate resistance development. Keywords: Dirofilaria immitis

S. pombe placed on the prion map

Directory of Open Access Journals (Sweden)

Jacqueline Hayles

2017-02-01

Full Text Available Schizosaccharomyces pombe has been used extensively as a model organism, however it is only recently that the first prion in this organism, a copper transporter protein encoded by ctr4, has been conclusively demonstrated. Prions are found in a wide range of organisms and have been implicated in a number of human neurodegenerative diseases. Research into the biology of prions has been carried out mainly in the budding yeast Saccharomyces cerevisiae, however there are many questions still to be addressed. Now, with the identification of the Ctr4 prion in S. pombe, further work in the two yeasts and comparisons of prion biology in these organisms should lead to a greater understanding of prions and their role in disease.

Prions: Beyond a Single Protein

Science.gov (United States)

Das, Alvin S.

2016-01-01

SUMMARY Since the term protein was first coined in 1838 and protein was discovered to be the essential component of fibrin and albumin, all cellular proteins were presumed to play beneficial roles in plants and mammals. However, in 1967, Griffith proposed that proteins could be infectious pathogens and postulated their involvement in scrapie, a universally fatal transmissible spongiform encephalopathy in goats and sheep. Nevertheless, this novel hypothesis had not been evidenced until 1982, when Prusiner and coworkers purified infectious particles from scrapie-infected hamster brains and demonstrated that they consisted of a specific protein that he called a “prion.” Unprecedentedly, the infectious prion pathogen is actually derived from its endogenous cellular form in the central nervous system. Unlike other infectious agents, such as bacteria, viruses, and fungi, prions do not contain genetic materials such as DNA or RNA. The unique traits and genetic information of prions are believed to be encoded within the conformational structure and posttranslational modifications of the proteins. Remarkably, prion-like behavior has been recently observed in other cellular proteins—not only in pathogenic roles but also serving physiological functions. The significance of these fascinating developments in prion biology is far beyond the scope of a single cellular protein and its related disease. PMID:27226089

The role of genetics in chronic wasting disease of North American cervids

Science.gov (United States)

Robinson, Stacie J.; Samuel, Michael D.; O'Rourke, Katherine; Johnson, Chad J.

2012-01-01

Chronic wasting disease (CWD) is a major concern for the management of North American cervid populations. This fatal prion disease has led to declines in populations which have high CWD prevalence and areas with both high and low infection rates have experienced economic losses in wildlife recreation and fears of potential spill-over into livestock or humans. Research from human and veterinary medicine has established that the prion protein gene (Prnp) encodes the protein responsible for transmissible spongiform encephalopathies (TSEs). Polymorphisms in the Prnp gene can lead to different prion forms that moderate individual susceptibility to and progression of TSE infection. Prnp genes have been sequenced in a number of cervid species including those currently infected by CWD (elk, mule deer, white-tailed deer, moose) and those for which susceptibility is not yet determined (caribou, fallow deer, sika deer). Over thousands of sequences examined, the Prnp gene is remarkably conserved within the family Cervidae; only 16 amino acid polymorphisms have been reported within the 256 amino acid open reading frame in the third exon of the Prnp gene. Some of these polymorphisms have been associated with lower rates of CWD infection and slower progression of clinical CWD. Here we review the body of research on Prnp genetics of North American cervids. Specifically, we focus on known polymorphisms in the Prnp gene, observed genotypic differences in CWD infection rates and clinical progression, mechanisms for genetic TSE resistance related to both the cervid host and the prion agent and potential for natural selection for CWD-resistance. We also identify gaps in our knowledge that require future research.

Association of angiotensin receptor 2 gene polymorphisms with pregnancy induced hypertension risk.

Science.gov (United States)

Li, Chenyang; Peng, Weijun; Zhang, Heng; Yan, Weirong

2018-05-01

To investigate the association of polymorphisms and haplotypes of angiotensin receptor 2 (AT2R) gene with pregnancy induced hypertension (PIH) in Chinese Han women. A case-control study was designed with 446 cases (gestational hypertension, GH: 124; pre-eclampsia, PE + eclampsia, E: 322) and 650 controls. rs5193, rs1403543 and rs12710567 of AT2R gene were genotyped. A logistic regression approach was applied to estimate the relationship between the polymorphisms and haplotypes of AT2Rgene with PIH risk. No relationship between AT2R gene polymorphisms and PIH was detected. The haplotype analysis also showed a negative result. rs5193, rs1403543 and rs12710567 of AT2R gene might have no effect on PIH risk among Chinese Han women.

Angiotensinogen gene polymorphisms in IDDM patients with diabetic nephropathy

DEFF Research Database (Denmark)

Tarnow, L; Cambien, Francois; Rossing, P

1996-01-01

Genotypic abnormalities of the renin-ANG system have been suggested as a risk factor for the development of diabetic nephropathy. Cleavage of angiotensinogen is the rate-limiting step in the activation of the renin-ANG system. The TT genotype of a polymorphism encoding threonine instead of methio......Genotypic abnormalities of the renin-ANG system have been suggested as a risk factor for the development of diabetic nephropathy. Cleavage of angiotensinogen is the rate-limiting step in the activation of the renin-ANG system. The TT genotype of a polymorphism encoding threonine instead...... of methionine (M235T) has been associated not only with increased plasma angiotensinogen concentration but also with essential hypertension. In addition, a polymorphism in the angiotensinogen gene substituting methionine for threonine (T174M) has been associated with hypertension in nondiabetic populations. We...... studied the relationship between these polymorphisms in the angiotensinogen gene in IDDM patients with diabetic nephropathy (121 men, 74 women, age 40.9 +/- 10 years, diabetes duration 27 +/- 8 years). There was no difference in M235T genotype distribution between IDDM patients with diabetic nephropathy...

Genetic polymorphism in three glutathione s-transferase genes and breast cancer risk

Energy Technology Data Exchange (ETDEWEB)

Woldegiorgis, S.; Ahmed, R.C.; Zhen, Y.; Erdmann, C.A.; Russell, M.L.; Goth-Goldstein, R.

2002-04-01

The role of the glutathione S-transferase (GST) enzyme family is to detoxify environmental toxins and carcinogens and to protect organisms from their adverse effects, including cancer. The genes GSTM1, GSTP1, and GSTT1 code for three GSTs involved in the detoxification of carcinogens, such as polycyclic aromatic hydrocarbons (PAHs) and benzene. In humans, GSTM1 is deleted in about 50% of the population, GSTT1 is absent in about 20%, whereas the GSTP1 gene has a single base polymorphism resulting in an enzyme with reduced activity. Epidemiological studies indicate that GST polymorphisms increase the level of carcinogen-induced DNA damage and several studies have found a correlation of polymorphisms in one of the GST genes and an increased risk for certain cancers. We examined the role of polymorphisms in genes coding for these three GST enzymes in breast cancer. A breast tissue collection consisting of specimens of breast cancer patients and non-cancer controls was analyzed by polymerase chain reaction (PCR) for the presence or absence of the GSTM1 and GSTT1 genes and for GSTP1 single base polymorphism by PCR/RFLP. We found that GSTM1 and GSTT1 deletions occurred more frequently in cases than in controls, and GSTP1 polymorphism was more frequent in controls. The effective detoxifier (putative low-risk) genotype (defined as presence of both GSTM1 and GSTT1 genes and GSTP1 wild type) was less frequent in cases than controls (16% vs. 23%, respectively). The poor detoxifier (putative high-risk) genotype was more frequent in cases than controls. However, the sample size of this study was too small to provide conclusive results.

Prion pathogenesis and secondary lymphoid organs (SLO)

Science.gov (United States)

Mabbott, Neil A.

2012-01-01

Prion diseases are subacute neurodegenerative diseases that affect humans and a range of domestic and free-ranging animal species. These diseases are characterized by the accumulation of PrPSc, an abnormally folded isoform of the cellular prion protein (PrPC), in affected tissues. The pathology during prion disease appears to occur almost exclusively within the central nervous system. The extensive neurodegeneration which occurs ultimately leads to the death of the host. An intriguing feature of the prion diseases, when compared with other protein-misfolding diseases, is their transmissibility. Following peripheral exposure, some prion diseases accumulate to high levels within lymphoid tissues. The replication of prions within lymphoid tissue has been shown to be important for the efficient spread of disease to the brain. This article describes recent progress in our understanding of the cellular mechanisms that influence the propagation of prions from peripheral sites of exposure (such as the lumen of the intestine) to the brain. A thorough understanding of these events will lead to the identification of important targets for therapeutic intervention, or alternatively, reveal additional processes that influence disease susceptibility to peripherally-acquired prion diseases. PMID:22895090

Anti-prion activity of Brilliant Blue G.

Directory of Open Access Journals (Sweden)

Yoshifumi Iwamaru

Full Text Available BACKGROUND: Prion diseases are fatal neurodegenerative disorders with no effective therapy currently available. Accumulating evidence has implicated over-activation of P2X7 ionotropic purinergic receptor (P2X7R in the progression of neuronal loss in several neurodegenerative diseases. This has led to the speculation that simultaneous blockade of this receptor and prion replication can be an effective therapeutic strategy for prion diseases. We have focused on Brilliant Blue G (BBG, a well-known P2X7R antagonist, possessing a chemical structure expected to confer anti-prion activity and examined its inhibitory effect on the accumulation of pathogenic isoforms of prion protein (PrPres in a cellular and a mouse model of prion disease in order to determine its therapeutic potential. PRINCIPAL FINDINGS: BBG prevented PrPres accumulation in infected MG20 microglial and N2a neural cells at 50% inhibitory concentrations of 14.6 and 3.2 µM, respectively. Administration of BBG in vivo also reduced PrPres accumulation in the brains of mice with prion disease. However, it did not appear to alleviate the disease progression compared to the vehicle-treated controls, implying a complex role of P2X7R on the neuronal degeneration in prion diseases. SIGNIFICANCE: These results provide novel insights into the pathophysiology of prion diseases and have important implications for the treatment.

Single nucleotide polymorphism in transcriptional regulatory regions and expression of environmentally responsive genes

International Nuclear Information System (INIS)

Wang, Xuting; Tomso, Daniel J.; Liu Xuemei; Bell, Douglas A.

2005-01-01

Single nucleotide polymorphisms (SNPs) in the human genome are DNA sequence variations that can alter an individual's response to environmental exposure. SNPs in gene coding regions can lead to changes in the biological properties of the encoded protein. In contrast, SNPs in non-coding gene regulatory regions may affect gene expression levels in an allele-specific manner, and these functional polymorphisms represent an important but relatively unexplored class of genetic variation. The main challenge in analyzing these SNPs is a lack of robust computational and experimental methods. Here, we first outline mechanisms by which genetic variation can impact gene regulation, and review recent findings in this area; then, we describe a methodology for bioinformatic discovery and functional analysis of regulatory SNPs in cis-regulatory regions using the assembled human genome sequence and databases on sequence polymorphism and gene expression. Our method integrates SNP and gene databases and uses a set of computer programs that allow us to: (1) select SNPs, from among the >9 million human SNPs in the NCBI dbSNP database, that are similar to cis-regulatory element (RE) consensus sequences; (2) map the selected dbSNP entries to the human genome assembly in order to identify polymorphic REs near gene start sites; (3) prioritize the candidate polymorphic RE containing genes by searching the existing genotype and gene expression data sets. The applicability of this system has been demonstrated through studies on p53 responsive elements and is being extended to additional pathways and environmentally responsive genes

Grass plants bind, retain, uptake, and transport infectious prions.

Science.gov (United States)

Pritzkow, Sandra; Morales, Rodrigo; Moda, Fabio; Khan, Uffaf; Telling, Glenn C; Hoover, Edward; Soto, Claudio

2015-05-26

Prions are the protein-based infectious agents responsible for prion diseases. Environmental prion contamination has been implicated in disease transmission. Here, we analyzed the binding and retention of infectious prion protein (PrP(Sc)) to plants. Small quantities of PrP(Sc) contained in diluted brain homogenate or in excretory materials (urine and feces) can bind to wheat grass roots and leaves. Wild-type hamsters were efficiently infected by ingestion of prion-contaminated plants. The prion-plant interaction occurs with prions from diverse origins, including chronic wasting disease. Furthermore, leaves contaminated by spraying with a prion-containing preparation retained PrP(Sc) for several weeks in the living plant. Finally, plants can uptake prions from contaminated soil and transport them to aerial parts of the plant (stem and leaves). These findings demonstrate that plants can efficiently bind infectious prions and act as carriers of infectivity, suggesting a possible role of environmental prion contamination in the horizontal transmission of the disease. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Disease Transmission by Misfolded Prion-Protein Isoforms, Prion-Like Amyloids, Functional Amyloids and the Central Dogma.

Science.gov (United States)

Daus, Martin L

2016-01-04

In 1982, the term "prions" (proteinaceous infectious particles) was coined to specify a new principle of infection. A misfolded isoform of a cellular protein has been described as the causative agent of a fatal neurodegenerative disease. At the beginning of prion research scientists assumed that the infectious agent causing transmissible spongiform encephalopathy (TSE) was a virus, but some unconventional properties of these pathogens were difficult to bring in line with the prevailing viral model. The discovery that prions (obviously devoid of any coding nucleic acid) can store and transmit information similarly to DNA was initially even denoted as being "heretical" but is nowadays mainly accepted by the scientific community. This review describes, from a historical point of view, how the "protein-only hypothesis" expands the Central Dogma. Definition of both, the prion principle and the Central Dogma, have been essential steps to understand information storage and transfer within and among cells and organisms. Furthermore, the current understanding of the infectivity of prion-proteins after misfolding is summarized succinctly. Finally, prion-like amyloids and functional amyloids, as found in yeast and bacteria, will be discussed.

Association of −330 interleukin-2 gene polymorphism with oral cancer

Directory of Open Access Journals (Sweden)

Prithvi Kumar Singh

2017-01-01

>Results: IL-2 (−330A>C gene polymorphism was significantly associated with oral cancer whereas it was neither associated with clinicopathological status nor with cancer pain. The AC heterozygous genotype was significantly associated with oral cancer patients as compared to controls [odds ratio (OR: 3.0; confidence interval (CI: 2.14-4.20; PC gene polymorphism was also associated with oral cancer in tobacco smokers and chewers. >Interpretation & conclusions: Our results showed that oral cancer patients had significantly higher frequency of AA genotype but significantly lower frequency of AC genotype and C allele compared to controls. The IL-2 AC genotype and C allele of IL-2 (−330A>C gene polymorphisms could be potential protective factors and might reduce the risk of oral cancer in Indian population.

Polymorphisms in human DNA repair genes and head and neck ...

Indian Academy of Sciences (India)

Abstract. Genetic polymorphisms in some DNA repair proteins are associated with a number of malignant transformations like head and ... Such studies may benefit from analysis of multiple genes or polymorphisms and from the ... low survival and high morbidity when diagnosed in advanced ...... racial and/or ethnic cohort.

Prevalence of coagulase gene polymorphism in Staphylococcus aureus isolates causing bovine mastitis

DEFF Research Database (Denmark)

Aarestrup, Frank Møller; Dangler, C. A.; Sordillo, L. M.

1995-01-01

This study was conducted to investigate polymorphism of the coagulase gene of Staphylococcus aureus causing bovine mastitis. One hundred eighty-seven strains of S. aureus were isolated from bovine mastitic milk samples obtained from 187 different Danish dairy farms. The isolates were characterised......% of the isolates. The ease of analysing coagulase gene polymorphisms among a large number of strains, and the multiple distinct polymorphic patterns generated, supports the use of this technique in epidemiological investigations of bovine mastitis. The predominating variants may have predelection for causing...

Protease-resistant prions selectively decrease Shadoo protein.

Directory of Open Access Journals (Sweden)

Joel C Watts

2011-11-01

Full Text Available The central event in prion diseases is the conformational conversion of the cellular prion protein (PrP(C into PrP(Sc, a partially protease-resistant and infectious conformer. However, the mechanism by which PrP(Sc causes neuronal dysfunction remains poorly understood. Levels of Shadoo (Sho, a protein that resembles the flexibly disordered N-terminal domain of PrP(C, were found to be reduced in the brains of mice infected with the RML strain of prions [1], implying that Sho levels may reflect the presence of PrP(Sc in the brain. To test this hypothesis, we examined levels of Sho during prion infection using a variety of experimental systems. Sho protein levels were decreased in the brains of mice, hamsters, voles, and sheep infected with different natural and experimental prion strains. Furthermore, Sho levels were decreased in the brains of prion-infected, transgenic mice overexpressing Sho and in infected neuroblastoma cells. Time-course experiments revealed that Sho levels were inversely proportional to levels of protease-resistant PrP(Sc. Membrane anchoring and the N-terminal domain of PrP both influenced the inverse relationship between Sho and PrP(Sc. Although increased Sho levels had no discernible effect on prion replication in mice, we conclude that Sho is the first non-PrP marker specific for prion disease. Additional studies using this paradigm may provide insight into the cellular pathways and systems subverted by PrP(Sc during prion disease.

Increased expression of p62/SQSTM1 in prion diseases and its association with pathogenic prion protein.

Science.gov (United States)

Homma, Takujiro; Ishibashi, Daisuke; Nakagaki, Takehiro; Satoh, Katsuya; Sano, Kazunori; Atarashi, Ryuichiro; Nishida, Noriyuki

2014-03-28

Prion diseases are neurodegenerative disorders characterized by the aggregation of abnormally folded prion protein (PrP(Sc)). In this study, we focused on the mechanism of clearance of PrP(Sc), which remains unclear. p62 is a cytosolic protein known to mediate both the formation and degradation of aggregates of abnormal proteins. The levels of p62 protein increased in prion-infected brains and persistently infected cell cultures. Upon proteasome inhibition, p62 co-localized with PrP(Sc), forming a large aggregate in the perinuclear region, hereafter referred to as PrP(Sc)-aggresome. These aggregates were surrounded with autophagosome marker LC3 and lysosomes in prion-infected cells. Moreover, transient expression of the phosphomimic form of p62, which has enhanced ubiquitin-binding activity, reduced the amount of PrP(Sc) in prion-infected cells, indicating that the activation of p62 could accelerate the clearance of PrP(Sc). Our findings would thus suggest that p62 could be a target for the therapeutic control of prion diseases.

Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes.

Science.gov (United States)

van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O

1992-01-01

Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671

Classical Bovine Spongiform Encephalopathy by Transmission of H-Type Prion in Homologous Prion Protein Context

OpenAIRE

Torres, Juan-María; Andréoletti, Olivier; Lacroux, Caroline; Prieto, Irene; Lorenzo, Patricia; Larska, Magdalena; Baron, Thierry; Espinosa, Juan-Carlos

2011-01-01

Bovine spongiform encephalopathy (BSE) and BSErelated disorders have been associated with a single major prion strain. Recently, 2 atypical, presumably sporadic forms of BSE have been associated with 2 distinct prion strains that are characterized mainly by distinct Western blot profi les of abnormal protease-resistant prion protein (PrPres), named high-type (BSE-H) and low-type (BSE-L), that also differed from classical BSE. We characterized 5 atypical BSE-H isolates by analyzing their molec...

The NALP3 inflammasome is involved in neurotoxic prion peptide-induced microglial activation

Directory of Open Access Journals (Sweden)

Shi Fushan

2012-07-01

Full Text Available Abstract Background Prion diseases are neurodegenerative disorders characterized by the accumulation of an abnormal disease-associated prion protein, PrPSc. In prion-infected brains, activated microglia are often present in the vicinity of PrPSc aggregates, and microglial activation is thought to play a key role in the pathogenesis of prion diseases. Although interleukin (IL-1β release by prion-induced microglia has been widely reported, the mechanism by which primed microglia become activated and secrete IL-1β in prion diseases has not yet been elucidated. In this study, we investigated the role of the NACHT, LRR and PYD domains-containing protein (NALP3 inflammasome in IL-1β release from lipopolysaccharide (LPS-primed microglia after exposure to a synthetic neurotoxic prion fragment (PrP106-126. Methods The inflammasome components NALP3 and apoptosis-associated speck-like protein (ASC were knocked down by gene silencing. IL-1β production was assessed using ELISA. The mRNA expression of NALP3, ASC, and pro-inflammatory factors was measured by quantitative PCR. Western blot analysis was used to detect the protein level of NALP3, ASC, caspase-1 and nuclear factor-κB. Results We found that that PrP106-126-induced IL-1β release depends on NALP3 inflammasome activation, that inflammasome activation is required for the synthesis of pro-inflammatory and chemotactic factors by PrP106-126-activated microglia, that inhibition of NF-κB activation abrogated PrP106-126-induced NALP3 upregulation, and that potassium efflux and production of reactive oxygen species were implicated in PrP106-126-induced NALP3 inflammasome activation in microglia. Conclusions We conclude that the NALP3 inflammasome is involved in neurotoxic prion peptide-induced microglial activation. To our knowledge, this is the first time that strong evidence for the involvement of NALP3 inflammasome in prion-associated inflammation has been found.

Statistical Mechanics of Prion Diseases

International Nuclear Information System (INIS)

Slepoy, A.; Singh, R. R. P.; Pazmandi, F.; Kulkarni, R. V.; Cox, D. L.

2001-01-01

We present a two-dimensional, lattice based, protein-level statistical mechanical model for prion diseases (e.g., mad cow disease) with concomitant prion protein misfolding and aggregation. Our studies lead us to the hypothesis that the observed broad incubation time distribution in epidemiological data reflect fluctuation dominated growth seeded by a few nanometer scale aggregates, while much narrower incubation time distributions for innoculated lab animals arise from statistical self-averaging. We model ''species barriers'' to prion infection and assess a related treatment protocol

Transmissible Spongiform Encephalopathies (Prion Diseases)

Science.gov (United States)

... This research is aimed at determining how abnormal prion proteins lead to disease, at finding better tests ... This research is aimed at determining how abnormal prion proteins lead to disease, at finding better tests ...

RESEARCH AND DEVELOPMENT CONTROL METHOD PATHOGENIC PRION INFECTIONS SECONDARY RAW MEAT INDUSTRY

Directory of Open Access Journals (Sweden)

A. Y. Prosekov

2016-01-01

Full Text Available Highly sensitive and specific method for identification of pathogenic prion protein was developed. It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle. Aligning gene sequences of pathogenic and normal prion protein of sheep (Ovis aries revealed that the nucleotide sequences of PrPc and PrPsc are identical. Murine monoclonal antibody 15B3 was selected. Synthetic sequence of 194 bps was randomly produced (DNA-tail. The produced sequence and the database sequences have no homologues. Two primer of20 bps were selected for synthesized DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left and CAGTTTCGATCCTCCTCCAG (right primers the amplification should be performed as follows: pre-denaturation, 95 °C, 60 seconds, 1 cycle; denaturation, 95 °C, 30 seconds, 30 cycles; annealing, 56 °C, 60 seconds, 30 cycles; elongation, 72 °C, 30 seconds, 30 cycles, additional elongation, 1 cycle, 600 seconds. The optimum concentration of reaction mixture components for PCR was established. High specificity of the developed test system and oligonucleotide primers was confirmed by electrophoretic separation of ground beef samples containing  pathogenic prion protein, as well as by comparative analysis of the results of pathogenic prion protein determination. These results were obtained using PCR test system and TeSeE™ ELISA system.

Polymorphism of the ACE gene and the risk of obstructive sleep apnoea.

Science.gov (United States)

Chmielewska, Izabela; Mlak, Radosław; Krawczyk, Paweł; Czukiewska, Ewa; Milanowski, Janusz

2013-01-01

Obstructive sleep apnoea/hypopnea syndrome (OSA) is characterized by obstruction of the upper airway during sleep, resulting in repetitive breathing pauses accompanied by oxygen desaturation and arousal from sleep. Among the candidate genes affecting the risk of OSA, genes whose polymorphisms influence the development of diseases with similar pathogenesis such as OSA could be listed: APOE, genes for leptin and leptin receptor, TNFA1, ADRB2 and ACE (gene for angiotensin-converting enzyme). Until now there has been a confirmed relationship between ACE gene polymorphism and cardiovascular diseases, but its effect on the incidence of OSA is debatable. The aim of this study was to investigate the effect of ACE gene insertion/deletion (I/D) polymorphism on the risk of OSA. Fifty-five patients with confirmed diagnose of OSA and qualified to CPAP therapy entered the study. The control group included 50 subjects who did not complain of any sleep related symptoms. Diagnose of OSA was set on the basis of full overnight polysomnography together with Epworth Sleepiness Scale according to American Academy of Sleep Medicine guidelines. DNA was isolated from peripheral blood leukocytes with Qiagen DNA mini Kit. ACE gene polymorphism was determined in genomic DNA using allele specific polymerase chain reaction. Different sizes of PCR products were observed on agarose gel electrophoresis. There were non-significant differences in the frequency of ACE genotypes. However, allele D had significantly lower prevalence in the study group than in the control group. (χ(2) = 4.25 p = 0.04). Moreover, I allele carriers had a threefold greater risk of developing OSA (HR = 2.748, 95% CI = 1.029-7.340, p gene polymorphism might be useful to determine the risk of developing OSA in clinically predisposed patients.

Glutathione S-transferase gene polymorphisms in presbycusis.

Science.gov (United States)

Ateş, Nurcan Aras; Unal, Murat; Tamer, Lülüfer; Derici, Ebru; Karakaş, Sevim; Ercan, Bahadir; Pata, Yavuz Selim; Akbaş, Yücel; Vayisoğlu, Yusuf; Camdeviren, Handan

2005-05-01

Glutathione and glutathione-related antioxidant enzymes are involved in the metabolism and detoxification of cytotoxic and carcinogenic compounds as well as reactive oxygen species. Reactive oxygen species generation occurs in prolonged relative hypoperfusion conditions such as in aging. The etiology of presbycusis is much less certain; however, a complex genetic cause is most likely. The effect of aging shows a wide interindividual range; we aimed to investigate whether profiles of (glutathione S-transferase (GST) M1, T1 and P1 genotypes may be associated with the risk of age-related hearing loss. We examined 68 adults with presbycusis and 69 healthy controls. DNA was extracted from whole blood, and the GSTM1, GSTT1 and GSTP1 polymorphisms were determined using a real-time polymerase chain reaction and fluorescence resonance energy transfer with a Light-Cycler Instrument. Associations between specific genotypes and the development of presbycusis were examined by use of logistic regression analyses to calculate odds ratios and 95% confidence intervals. Gene polymorphisms at GSTM1, GSTT1, and GSTP1 in subjects with presbycusis were not significantly different than in the controls (p > 0.05). Also, the combinations of different GSTM1, GSTT1, and GSTP1 genotypes were not an increased risk of presbycusis (p > 0.05). We could not demonstrate any significant association between the GSTM1, GSTT1, and GSTP1 polymorphism and age-related hearing loss in this population. This may be because of our sample size, and further studies need to investigate the exact role of GST gene polymorphisms in the etiopathogenesis of the presbycusis.

Experimental Models of Inherited PrP Prion Diseases.

Science.gov (United States)

Watts, Joel C; Prusiner, Stanley B

2017-11-01

The inherited prion protein (PrP) prion disorders, which include familial Creutzfeldt-Jakob disease, Gerstmann-Sträussler-Scheinker disease, and fatal familial insomnia, constitute ∼10%-15% of all PrP prion disease cases in humans. Attempts to generate animal models of these disorders using transgenic mice expressing mutant PrP have produced variable results. Although many lines of mice develop spontaneous signs of neurological illness with accompanying prion disease-specific neuropathological changes, others do not. Furthermore, demonstrating the presence of protease-resistant PrP species and prion infectivity-two of the hallmarks of the PrP prion disorders-in the brains of spontaneously sick mice has proven particularly challenging. Here, we review the progress that has been made toward developing accurate mouse models of the inherited PrP prion disorders. Copyright © 2017 Cold Spring Harbor Laboratory Press; all rights reserved.

Gene Polymorphism and Left Ventricular Geometry and Function in Hypertensive Subjects

Directory of Open Access Journals (Sweden)

Rosario Scaglione

2010-01-01

Full Text Available The distribution of the T29C TGFβ1 gene polymorphism was analyzed in 198 hypertensives with left ventricular hypertrophy (LVH and in 235 hypertensives without LVH. Circulating TGFβ1 levels, procollagen type III levels, microalbuminuria, and left ventricular geometry and function were evaluated in all the hypertensives with LVH subgrouped according to T29C TGFβ1 gene polymorphism. Circulating TGFβ1 was evaluated by ELISA technique, procollagen type III by a specific radioimmunoassay, microalbuminuria by radioimmunoassay, and left ventricular geometry and function by echocardiography. All groups were comparable for gender, age, and sex. Regarding T29C TGFβ1 gene polymorphism, prevalence of TC or CC genotypes was significantly (P<.05 higher in hypertensives with LVH than hypertensives without LVH TC and CC LVH hypertensives were characterized by a higher prevalence of subjects with microalbuminuria (P<.05 TC and CC versus TT, by increased levels of TGFβ1, procollagen type III, urinary albumin excretion, LVM, LVM/h2.7, and lower values of left ventricular ejection fraction (P<.05 TC and CC versus TT. Our data suggest that T29C TGFβ1 gene polymorphism was associated with clinical characteristics adequate to recognize a subset of LVH hypertensives with a higher severity of hypertension.

The non-octarepeat copper binding site of the prion protein is a key regulator of prion conversion

Science.gov (United States)

Giachin, Gabriele; Mai, Phuong Thao; Tran, Thanh Hoa; Salzano, Giulia; Benetti, Federico; Migliorati, Valentina; Arcovito, Alessandro; Longa, Stefano Della; Mancini, Giordano; D'Angelo, Paola; Legname, Giuseppe

2015-10-01

The conversion of the prion protein (PrPC) into prions plays a key role in transmissible spongiform encephalopathies. Despite the importance for pathogenesis, the mechanism of prion formation has escaped detailed characterization due to the insoluble nature of prions. PrPC interacts with copper through octarepeat and non-octarepeat binding sites. Copper coordination to the non-octarepeat region has garnered interest due to the possibility that this interaction may impact prion conversion. We used X-ray absorption spectroscopy to study copper coordination at pH 5.5 and 7.0 in human PrPC constructs, either wild-type (WT) or carrying pathological mutations. We show that mutations and pH cause modifications of copper coordination in the non-octarepeat region. In the WT at pH 5.5, copper is anchored to His96 and His111, while at pH 7 it is coordinated by His111. Pathological point mutations alter the copper coordination at acidic conditions where the metal is anchored to His111. By using in vitro approaches, cell-based and computational techniques, we propose a model whereby PrPC coordinating copper with one His in the non-octarepeat region converts to prions at acidic condition. Thus, the non-octarepeat region may act as the long-sought-after prion switch, critical for disease onset and propagation.

Analysis of Human Bradykinin Receptor Gene and Endothelial Nitric Oxide Synthase Gene Polymorphisms in End-Stage Renal Disease Among Malaysians

Directory of Open Access Journals (Sweden)

R. Vasudevan

2014-06-01

Full Text Available The aim of this study was to determine the association of the c.894G>T; p.Glu298Asp polymorphism and the variable number tandem repeat (VNTR polymorphism of the endothelial nitric oxide synthase (eNOS gene and c.181C>T polymorphism of the bradykinin type 2 receptor gene (B2R in Malaysian end-stage renal disease (ESRD subjects.

Selective propagation of mouse-passaged scrapie prions with long incubation period from a mixed prion population using GT1-7 cells.

Directory of Open Access Journals (Sweden)

Kohtaro Miyazawa

Full Text Available In our previous study, we demonstrated the propagation of mouse-passaged scrapie isolates with long incubation periods (L-type derived from natural Japanese sheep scrapie cases in murine hypothalamic GT1-7 cells, along with disease-associated prion protein (PrPSc accumulation. We here analyzed the susceptibility of GT1-7 cells to scrapie prions by exposure to infected mouse brains at different passages, following interspecies transmission. Wild-type mice challenged with a natural sheep scrapie case (Kanagawa exhibited heterogeneity of transmitted scrapie prions in early passages, and this mixed population converged upon one with a short incubation period (S-type following subsequent passages. However, when GT1-7 cells were challenged with these heterologous samples, L-type prions became dominant. This study demonstrated that the susceptibility of GT1-7 cells to L-type prions was at least 105 times higher than that to S-type prions and that L-type prion-specific biological characteristics remained unchanged after serial passages in GT1-7 cells. This suggests that a GT1-7 cell culture model would be more useful for the economical and stable amplification of L-type prions at the laboratory level. Furthermore, this cell culture model might be used to selectively propagate L-type scrapie prions from a mixed prion population.

Significant association of interleukin-4 gene intron 3 VNTR polymorphism with susceptibility to knee osteoarthritis.

Science.gov (United States)

Yigit, Serbulent; Inanir, Ahmet; Tekcan, Akın; Tural, Ercan; Ozturk, Gokhan Tuna; Kismali, Gorkem; Karakus, Nevin

2014-03-01

Interleukin-4 (IL-4) is a strong chondroprotective cytokine and polymorphisms within this gene may be a risk factor for osteoarthritis (OA). We aimed to investigate genotype and allele frequencies of IL-4 gene intron 3 variable number of tandem repeats (VNTR) polymorphism in patients with knee OA in a Turkish population. The study included 202 patients with knee OA and 180 healthy controls. Genomic DNA was isolated and IL-4 gene 70 bp VNTR polymorphism determined by using polymerase chain reaction (PCR) with specific primers followed by restriction fragment length polymorphism (RFLP) analysis. Our result show that there was statistically significant difference between knee OA patients and control group with respect to IL-4 genotype distribution and allele frequencies (p=0.000, OR: 0.20, 95% CI: 0.10-0.41, OR: 0.22, 95% CI: 0.12-0.42, respectively). Our findings suggest that there is an association of IL-4 gene intron 3 VNTR polymorphism with susceptibility of a person for development of knee OA. As a result, IL-4 gene intron 3 VNTR polymorphism could be a genetic marker in OA in a Turkish study population. This is the first association study that evaluates the associations between IL-4 gene VNTR polymorphism and knee OA. Crown Copyright © 2013. Published by Elsevier B.V. All rights reserved.

Resistance of soil-bound prions to rumen digestion.

Directory of Open Access Journals (Sweden)

Samuel E Saunders

Full Text Available Before prion uptake and infection can occur in the lower gastrointestinal system, ingested prions are subjected to anaerobic digestion in the rumen of cervids and bovids. The susceptibility of soil-bound prions to rumen digestion has not been evaluated previously. In this study, prions from infectious brain homogenates as well as prions bound to a range of soils and soil minerals were subjected to in vitro rumen digestion, and changes in PrP levels were measured via western blot. Binding to clay appeared to protect noninfectious hamster PrP(c from complete digestion, while both unbound and soil-bound infectious PrP(Sc proved highly resistant to rumen digestion. In addition, no change in intracerebral incubation period was observed following active rumen digestion of unbound hamster HY TME prions and HY TME prions bound to a silty clay loam soil. These results demonstrate that both unbound and soil-bound prions readily survive rumen digestion without a reduction in infectivity, further supporting the potential for soil-mediated transmission of chronic wasting disease (CWD and scrapie in the environment.

Resistance of Soil-Bound Prions to Rumen Digestion

Science.gov (United States)

Saunders, Samuel E.; Bartelt-Hunt, Shannon L.; Bartz, Jason C.

2012-01-01

Before prion uptake and infection can occur in the lower gastrointestinal system, ingested prions are subjected to anaerobic digestion in the rumen of cervids and bovids. The susceptibility of soil-bound prions to rumen digestion has not been evaluated previously. In this study, prions from infectious brain homogenates as well as prions bound to a range of soils and soil minerals were subjected to in vitro rumen digestion, and changes in PrP levels were measured via western blot. Binding to clay appeared to protect noninfectious hamster PrPc from complete digestion, while both unbound and soil-bound infectious PrPSc proved highly resistant to rumen digestion. In addition, no change in intracerebral incubation period was observed following active rumen digestion of unbound hamster HY TME prions and HY TME prions bound to a silty clay loam soil. These results demonstrate that both unbound and soil-bound prions readily survive rumen digestion without a reduction in infectivity, further supporting the potential for soil-mediated transmission of chronic wasting disease (CWD) and scrapie in the environment. PMID:22937149

Polymorphism of glucagon-like peptide-1 receptor gene (rs1042044 ...

African Journals Online (AJOL)

patience

2015-02-16

Feb 16, 2015 ... turnover via GLP-1 receptors (GLP1Rs) in postmenopausal state. Furthermore, polymorphisms in. GLP1R gene were suggested to affect the function of GLP1Rs and be associated with many diseases. However, the relationships between GLP1R polymorphisms and osteoporosis susceptibility and bone.

CYTOKINE GENE POLYMORPHISMS AS PREDICTORS OF CHRONIC PAIN SYNDROME IN ONCOLOGY

Directory of Open Access Journals (Sweden)

O. P. Bobrova

2017-01-01

Full Text Available The literature review on the role of cytokine gene polymorphisms in the development of chronic pain in cancer patients was presented using MedLine, PubMed, NEB elibrary.ru, WileyOnlineLibrary, WebofScience, OxfordUniversityPress and SAGEPremier databases for years 1995 to 2016. The role of inter-individual differences based on cytokine gene polymorphisms and their receptors for personalized anesthetic and accompanying treatment in oncology was shown.

Tetranucleotide repeat polymorphism at the human prostatic acid phosphatase (ACPP) gene

Energy Technology Data Exchange (ETDEWEB)

Polymeropoulos, M H; Xiao, Hong; Rath, D S; Merril, C R [National Inst. of Mental Health Neuroscience Center, Washington, DC (United States)

1991-09-11

The polymorphic (AAAT){sub n} repeat begins at base pair 2342 of the human prostatic acid phosphatase gene on chromosome 3q21-qter. The polymorphism can be typed using the polymerase chain reaction (PCR) as described previously. The predicted length of the amplified sequence was 275 bp. Co-dominant segregation was observed in two informative families. The human prostatic acid phosphatase gene has been assigned to chromosome 3q21-qter.

Hepatitis B virus DNA polymerase gene polymorphism based ...

African Journals Online (AJOL)

Hepatitis B virus DNA polymerase gene polymorphism based prediction of genotypes in chronic HBV patients from Western India. Yashwant G. Chavan, Sharad R. Pawar, Minal Wani, Amol D. Raut, Rabindra N. Misra ...

Cytokine gene polymorphisms and their association with cervical ...

African Journals Online (AJOL)

Maneesh Kumar Gupta

2015-11-17

Nov 17, 2015 ... gene polymorphisms with cervical cancer in a north Indian population. Genotyping of ... diseases like coronary heart disease, breast cancer, cervical cancer etc ...... Environmental risk factors for prevention and molecular inter-.

Variation in the prion protein sequence in Dutch goat breeds

NARCIS (Netherlands)

Windig, J.J.; Hoving, R.A.H.; Priem, J.; Bossers, A.; Keulen, van L.J.M.; Langeveld, J.P.M.

2016-01-01

Scrapie is a neurodegenerative disease occurring in goats and sheep. Several haplotypes of the prion protein increase resistance to scrapie infection and may be used in selective breeding to help eradicate scrapie. In this study, frequencies of the allelic variants of the PrP gene are determined

Polymorphisms of genes involved in polycyclic aromatic hydrocarbons’ biotransformation and atherosclerosis

Science.gov (United States)

Marinković, Natalija; Pašalić, Daria; Potočki, Slavica

2013-01-01

Polycyclic aromatic hydrocarbons (PAHs) are among the most prevalent environmental pollutants and result from the incomplete combustion of hydrocarbons (coal and gasoline, fossil fuel combustion, byproducts of industrial processing, natural emission, cigarette smoking, etc.). The first phase of xenobiotic biotransformation in the PAH metabolism includes activities of cytochrome P450 from the CYP1 family and microsomal epoxide hydrolase. The products of this biotransformation are reactive oxygen species that are transformed in the second phase through the formation of conjugates with glutathione, glucuronate or sulphates. PAH exposure may lead to PAH-DNA adduct formation or induce an inflammatory atherosclerotic plaque phenotype. Several genetic polymorphisms of genes encoded for enzymes involved in PAH biotransformation have been proven to lead to the development of diseases. Enzyme CYP P450 1A1, which is encoded by the CYP1A1 gene, is vital in the monooxygenation of lipofilic substrates, while GSTM1 and GSTT1 are the most abundant isophorms that conjugate and neutralize oxygen products. Some single nucleotide polymorphisms of the CYP1A1 gene as well as the deletion polymorphisms of GSTT1 and GSTM1 may alter the final specific cellular inflammatory respond. Occupational exposure or conditions from the living environment can contribute to the production of PAH metabolites with adverse effects on human health. The aim of this study was to obtain data on biotransformation and atherosclerosis, as well as data on the gene polymorphisms involved in biotransformation, in order to better study gene expression and further elucidate the interaction between genes and the environment. PMID:24266295

Generating Bona Fide Mammalian Prions with Internal Deletions.

Science.gov (United States)

Munoz-Montesino, Carola; Sizun, Christina; Moudjou, Mohammed; Herzog, Laetitia; Reine, Fabienne; Chapuis, Jérôme; Ciric, Danica; Igel-Egalon, Angelique; Laude, Hubert; Béringue, Vincent; Rezaei, Human; Dron, Michel

2016-08-01

Mammalian prions are PrP proteins with altered structures causing transmissible fatal neurodegenerative diseases. They are self-perpetuating through formation of beta-sheet-rich assemblies that seed conformational change of cellular PrP. Pathological PrP usually forms an insoluble protease-resistant core exhibiting beta-sheet structures but no more alpha-helical content, loosing the three alpha-helices contained in the correctly folded PrP. The lack of a high-resolution prion structure makes it difficult to understand the dynamics of conversion and to identify elements of the protein involved in this process. To determine whether completeness of residues within the protease-resistant domain is required for prions, we performed serial deletions in the helix H2 C terminus of ovine PrP, since this region has previously shown some tolerance to sequence changes without preventing prion replication. Deletions of either four or five residues essentially preserved the overall PrP structure and mutant PrP expressed in RK13 cells were efficiently converted into bona fide prions upon challenge by three different prion strains. Remarkably, deletions in PrP facilitated the replication of two strains that otherwise do not replicate in this cellular context. Prions with internal deletion were self-propagating and de novo infectious for naive homologous and wild-type PrP-expressing cells. Moreover, they caused transmissible spongiform encephalopathies in mice, with similar biochemical signatures and neuropathologies other than the original strains. Prion convertibility and transfer of strain-specific information are thus preserved despite shortening of an alpha-helix in PrP and removal of residues within prions. These findings provide new insights into sequence/structure/infectivity relationship for prions. Prions are misfolded PrP proteins that convert the normal protein into a replicate of their own abnormal form. They are responsible for invariably fatal neurodegenerative

Biological and biochemical characterization of mice expressing prion protein devoid of the octapeptide repeat region after infection with prions.

Science.gov (United States)

Yamaguchi, Yoshitaka; Miyata, Hironori; Uchiyama, Keiji; Ootsuyama, Akira; Inubushi, Sachiko; Mori, Tsuyoshi; Muramatsu, Naomi; Katamine, Shigeru; Sakaguchi, Suehiro

2012-01-01

Accumulating lines of evidence indicate that the N-terminal domain of prion protein (PrP) is involved in prion susceptibility in mice. In this study, to investigate the role of the octapeptide repeat (OR) region alone in the N-terminal domain for the susceptibility and pathogenesis of prion disease, we intracerebrally inoculated RML scrapie prions into tg(PrPΔOR)/Prnp(0/0) mice, which express mouse PrP missing only the OR region on the PrP-null background. Incubation times of these mice were not extended. Protease-resistant PrPΔOR, or PrP(Sc)ΔOR, was easily detectable but lower in the brains of these mice, compared to that in control wild-type mice. Consistently, prion titers were slightly lower and astrogliosis was milder in their brains. However, in their spinal cords, PrP(Sc)ΔOR and prion titers were abundant and astrogliosis was as strong as in control wild-type mice. These results indicate that the role of the OR region in prion susceptibility and pathogenesis of the disease is limited. We also found that the PrP(Sc)ΔOR, including the pre-OR residues 23-50, was unusually protease-resistant, indicating that deletion of the OR region could cause structural changes to the pre-OR region upon prion infection, leading to formation of a protease-resistant structure for the pre-OR region.

Soil clay content underlies prion infection odds

Science.gov (United States)

David, Walter W.; Walsh, D.P.; Farnsworth, Matthew L.; Winkelman, D.L.; Miller, M.W.

2011-01-01

Environmental factors-especially soil properties-have been suggested as potentially important in the transmission of infectious prion diseases. Because binding to montmorillonite (an aluminosilicate clay mineral) or clay-enriched soils had been shown to enhance experimental prion transmissibility, we hypothesized that prion transmission among mule deer might also be enhanced in ranges with relatively high soil clay content. In this study, we report apparent influences of soil clay content on the odds of prion infection in free-ranging deer. Analysis of data from prion-infected deer herds in northern Colorado, USA, revealed that a 1% increase in the clay-sized particle content in soils within the approximate home range of an individual deer increased its odds of infection by up to 8.9%. Our findings suggest that soil clay content and related environmental properties deserve greater attention in assessing risks of prion disease outbreaks and prospects for their control in both natural and production settings. ?? 2011 Macmillan Publishers Limited. All rights reserved.

Endothelial nitric oxide synthase gene polymorphisms associated ...

African Journals Online (AJOL)

Endothelial nitric oxide synthase (NOS3) is involved in key steps of immune response. Genetic factors predispose individuals to periodontal disease. This study's aim was to explore the association between NOS3 gene polymorphisms and clinical parameters in patients with periodontal disease. Genomic DNA was obtained ...

[Prevalence of gene polymorphisms associated with immune-dependent diseases in the populations of North Eurasia].

Science.gov (United States)

Cherednichenko, A A; Trifonova, E A; Vagaitseva, K V; Bocharova, A V; Varzari, A M; Radzhabov, M O; Stepanov, V A

2015-01-01

The data on distribution of genetic diversity in gene polymorphisms associated with autoimmune and allergic diseases and with regulation of immunoglobulin E and cytokines levels in 26 populations of the Northern Eurasia is presented. Substantial correlation between the values of average expected heterozygosity by 44 gene polymorphisms with climatic and geographical factors has not been revealed. Clustering of population groups in correspondence with their geographic locations is observed. The degree of gene differentiation among populations and the selective neutrality of gene polymorphisms have been assessed. The results of our work evidence the substantial genetic diversity and differentiation of human populations by studied genes.

Accumulation and dissemination of prion protein in experimental sheep scrapie in the natural host

Directory of Open Access Journals (Sweden)

Warner Richard

2009-02-01

Full Text Available Abstract Background In order to study the sites of uptake and mechanisms of dissemination of scrapie prions in the natural host under controlled conditions, lambs aged 14 days and homozygous for the VRQ allele of the PrP gene were infected by the oral route. Infection occurred in all lambs with a remarkably short and highly consistent incubation period of approximately 6 months. Challenge of lambs at approximately eight months of age resulted in disease in all animals, but with more variable incubation periods averaging significantly longer than those challenged at 14 days. This model provides an excellent system in which to study the disease in the natural host by virtue of the relatively short incubation period and close resemblance to natural infection. Results Multiple sites of prion uptake were identified, of which the most important was the Peyer's patch of the distal ileum. Neuroinvasion was detected initially in the enteric nervous system prior to infection of the central nervous system. At end stage disease prion accumulation was widespread throughout the entire neuraxis, but vacuolar pathology was absent in most animals that developed disease at 6–7 months of age. Conclusion Initial spread of detectable PrP was consistent with drainage in afferent lymph to dependent lymph nodes. Subsequent accumulation of prions in lymphoid tissue not associated with the gut is consistent with haematogenous spread. In addition to macrophages and follicular dendritic cells, prion containing cells consistent with afferent lymph dendritic cells were identified and are suggested as a likely vehicle for carriage of prions from initial site of uptake to the lymphoreticular system, and as potential carriers of prion protein in blood. It is apparent that spongiform change, the characteristic lesion of scrapie and other prion diseases, is not responsible for the clinical signs in sheep, but may develop in an age dependent manner.

Tetra primer ARMS-PCR relates folate/homocysteine pathway genes and ACE gene polymorphism with coronary artery disease.

Science.gov (United States)

Masud, Rizwan; Qureshi, Irfan Zia

2011-09-01

Cardiovascular disorders and coronary artery disease (CAD) are significant contributors to morbidity and mortality in heart patients. As genes of the folate/homocysteine pathway have been linked with the vascular disease, we investigated association of these gene polymorphisms with CAD/myocardial infarction (MI) using the novel approach of tetraprimer ARMS-PCR. A total of 230 participants (129 MI cases, 101 normal subjects) were recruited. We genotyped rs1801133 and rs1801131 SNPs in 5'10' methylenetetrahydrofolate reductase (MTHFR), rs1805087 SNP in 5' methyltetrahydrofolate homocysteine methyltransferase (MTR), rs662 SNP in paroxanse1 (PON1), and rs5742905 polymorphism in cystathionine beta synthase (CBS). Angiotensin converting enzyme (ACE) insertion/deletion polymorphism was detected through conventional PCR. Covariates included blood pressure, fasting blood sugar, serum cholesterol, and creatinine concentrations. Our results showed allele frequencies at rs1801133, rs1801131, rs1805087 and the ACE insertion/deletion (I/D) polymorphism varied between cases and controls. Logistic regression, after adjusting for covariates, demonstrated significant associations of rs1801133 and rs1805087 with CAD in the additive, dominant, and genotype model. In contrast, ACE I/D polymorphism was significantly related with CAD where recessive model was applied. Gene-gene interaction against the disease status revealed two polymorphism groups: rs1801133, rs662, and rs1805087; and rs1801131, rs662, and ACE I/D. Only the latter interaction maintained significance after adjusted for covariates. Our study concludes that folate pathway variants exert contributory influence on susceptibility to CAD. We further suggest that tetraprimer ARMS-PCR successfully resolves the genotypes in selected samples and might prove to be a superior technique compared to the conventional approach.

MM2-thalamic Creutzfeldt-Jakob disease: neuropathological, biochemical and transmission studies identify a distinctive prion strain.

Science.gov (United States)

Moda, Fabio; Suardi, Silvia; Di Fede, Giuseppe; Indaco, Antonio; Limido, Lucia; Vimercati, Chiara; Ruggerone, Margherita; Campagnani, Ilaria; Langeveld, Jan; Terruzzi, Alessandro; Brambilla, Antonio; Zerbi, Pietro; Fociani, Paolo; Bishop, Matthew T; Will, Robert G; Manson, Jean C; Giaccone, Giorgio; Tagliavini, Fabrizio

2012-09-01

In Creutzfeldt-Jakob disease (CJD), molecular typing based on the size of the protease resistant core of the disease-associated prion protein (PrP(Sc) ) and the M/V polymorphism at codon 129 of the PRNP gene correlates with the clinico-pathologic subtypes. Approximately 95% of the sporadic 129MM CJD patients are characterized by cerebral deposition of type 1 PrP(Sc) and correspond to the classic clinical CJD phenotype. The rare 129MM CJD patients with type 2 PrP(Sc) are further subdivided in a cortical and a thalamic form also indicated as sporadic fatal insomnia. We observed two young patients with MM2-thalamic CJD. Main neuropathological features were diffuse, synaptic PrP immunoreactivity in the cerebral cortex and severe neuronal loss and gliosis in the thalamus and olivary nucleus. Western blot analysis showed the presence of type 2A PrP(Sc) . Challenge of transgenic mice expressing 129MM human PrP showed that MM2-thalamic sporadic CJD (sCJD) was able to transmit the disease, at variance with MM2-cortical sCJD. The affected mice showed deposition of type 2A PrP(Sc) , a scenario that is unprecedented in this mouse line. These data indicate that MM2-thalamic sCJD is caused by a prion strain distinct from the other sCJD subtypes including the MM2-cortical form. © 2012 The Authors; Brain Pathology © 2012 International Society of Neuropathology.

[Polymorphism of vitamin D receptor gene Fok I in Mongolian population of China].

Science.gov (United States)

Xing, Shao-ji; Zhou, Li-she; Xu, Xiu-ju

2006-04-01

To investigate the polymorphism distribution of vitamin D receptor (VDR) gene Fok I in Mongolian population of China. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method was used to analyze three genotypes FF, Ff and ff in the start codon of VDR gene (Fok I) in unrelated normal healthy Mongolian individuals of China. In the population, we obtained the allelic frequencies of 57% and 43% for (F) and (f) allele and the percentage of genotypes FF, Ff and ff to be 31%, 52%, and 17% respectively. The polymorphism frequency and distribution of this VDR gene Fok I in Mongolian population of China exhibit its own characteristics.

Aerosols transmit prions to immunocompetent and immunodeficient mice.

Directory of Open Access Journals (Sweden)

Johannes Haybaeck

Full Text Available Prions, the agents causing transmissible spongiform encephalopathies, colonize the brain of hosts after oral, parenteral, intralingual, or even transdermal uptake. However, prions are not generally considered to be airborne. Here we report that inbred and crossbred wild-type mice, as well as tga20 transgenic mice overexpressing PrP(C, efficiently develop scrapie upon exposure to aerosolized prions. NSE-PrP transgenic mice, which express PrP(C selectively in neurons, were also susceptible to airborne prions. Aerogenic infection occurred also in mice lacking B- and T-lymphocytes, NK-cells, follicular dendritic cells or complement components. Brains of diseased mice contained PrP(Sc and transmitted scrapie when inoculated into further mice. We conclude that aerogenic exposure to prions is very efficacious and can lead to direct invasion of neural pathways without an obligatory replicative phase in lymphoid organs. This previously unappreciated risk for airborne prion transmission may warrant re-thinking on prion biosafety guidelines in research and diagnostic laboratories.

Genetic Analysis of the Atrial Natriuretic Peptide Gene Polymorphisms among Essential Hypertensive Patients in Malaysia

Directory of Open Access Journals (Sweden)

Nooshin Ghodsian

2016-01-01

Full Text Available Background. Atrial natriuretic peptide (ANP considerably influences blood pressure regulation through water and sodium homoeostasis. Several of the studies have utilized anonymous genetic polymorphic markers and made inconsequent claims about the ANP relevant disorders. Thus, we screened Insertion/Deletion (ID and G191A polymorphisms of ANP to discover sequence variations with potential functional significance and to specify the linkage disequilibrium pattern between polymorphisms. The relationships of detected polymorphisms with EH with or without Type 2 Diabetes Mellitus (T2DM status were tested subsequently. Method. ANP gene polymorphisms (I/D and A191G were specified utilizing mutagenically separated Polymerase Chain Reaction (PCR in 320 subjects including 163 EH case subjects and 157 controls. Result. This case-control study discovered a significant association between I/D polymorphisms of ANP gene in EH patient without T2DM. However, the study determined no association between G191A polymorphisms of ANP in EH with or without T2DM. In addition, sociodemographic factors in the case and healthy subjects exhibited strong differences (P<0.05. Conclusion. As a risk factor, ANP gene polymorphisms may affect hypertension. Despite the small sample size in this study, it is the first research assessing the ANP gene polymorphisms in both EH and T2DM patients among Malaysian population.

Transgenic fatal familial insomnia mice indicate prion infectivity-independent mechanisms of pathogenesis and phenotypic expression of disease.

Directory of Open Access Journals (Sweden)

Ihssane Bouybayoune

2015-04-01

Full Text Available Fatal familial insomnia (FFI and a genetic form of Creutzfeldt-Jakob disease (CJD178 are clinically different prion disorders linked to the D178N prion protein (PrP mutation. The disease phenotype is determined by the 129 M/V polymorphism on the mutant allele, which is thought to influence D178N PrP misfolding, leading to the formation of distinctive prion strains with specific neurotoxic properties. However, the mechanism by which misfolded variants of mutant PrP cause different diseases is not known. We generated transgenic (Tg mice expressing the mouse PrP homolog of the FFI mutation. These mice synthesize a misfolded form of mutant PrP in their brains and develop a neurological illness with severe sleep disruption, highly reminiscent of FFI and different from that of analogously generated Tg(CJD mice modeling CJD178. No prion infectivity was detectable in Tg(FFI and Tg(CJD brains by bioassay or protein misfolding cyclic amplification, indicating that mutant PrP has disease-encoding properties that do not depend on its ability to propagate its misfolded conformation. Tg(FFI and Tg(CJD neurons have different patterns of intracellular PrP accumulation associated with distinct morphological abnormalities of the endoplasmic reticulum and Golgi, suggesting that mutation-specific alterations of secretory transport may contribute to the disease phenotype.

Association of Interleukin-10 gene promoter polymorphisms with obstructive sleep apnea.

Science.gov (United States)

Özdaş, Sibel; Özdaş, Talih; Acar, Mustafa; Erbek, Selim S; Köseoğlu, Sabri; Göktürk, Gökhan; Izbirak, Afife

2016-05-01

Interleukin-10 (IL) is an anti-inflammatory cytokine that regulates normal sleep patterns, and recent studies have reported that it is a potential useful biomarker to identify presence and severity of sleep apnea syndrome (OSAS). Promoter polymorphisms of IL-10 gene have been associated with altered expression levels, which contributes to OSAS. The aim of this study was to determine the prevalence of -1082 G/A, -819 C/T, and -592 C/A promoter polymorphisms of IL-10 gene in individuals with OSAS and controls. An open-label study was performed in the Otorhinolaryngology and Sleep Disorders Outpatient Clinics. One hundred four cases with OSAS were included as the study group, and 78 individuals without OSAS were included as the controls. DNAs were extracted from peripheral blood leukocytes, and the sites that encompassed those polymorphisms were identified by DNA sequencing analyses. Data were analyzed with SNPStats and multifactor dimensionality reduction (MDR) software. The prevalence of OSAS was higher in males in the study group when compared to controls (P = 0.0003). The IL-10-1082 G/A, -819 C/T, and -592 C/A SNPs, and their minor alleles were associated with a significantly increased risk for OSAS compared to the controls (P ˂ 0.05 for all). Furthermore, ATA haplotype frequency was significantly higher in the study group compared to the control group, but the GCC haplotype frequency was lower (P = 0.0001 and P = 0.0001). As indicated in MDR analysis, combinations of IL-10 gene were associated with OSAS in single-, double-, and triple-locus analyses. The prevalences of the IL-10 gene promoter polymorphisms were different in OSAS patients and the controls in Turkish population. IL-10 gene polymorphisms may lead to altered inflammatory cascade, which might contribute to OSAS. Further studies on larger cohorts are needed to validate our findings.

Emerging prion disease drives host selection in a wildlife population

Science.gov (United States)

Robinson, Stacie J.; Samuel, Michael D.; Johnson, Chad J.; Adams, Marie; McKenzie, Debbie I.

2012-01-01

Infectious diseases are increasingly recognized as an important force driving population dynamics, conservation biology, and natural selection in wildlife populations. Infectious agents have been implicated in the decline of small or endangered populations and may act to constrain population size, distribution, growth rates, or migration patterns. Further, diseases may provide selective pressures that shape the genetic diversity of populations or species. Thus, understanding disease dynamics and selective pressures from pathogens is crucial to understanding population processes, managing wildlife diseases, and conserving biological diversity. There is ample evidence that variation in the prion protein gene (PRNP) impacts host susceptibility to prion diseases. Still, little is known about how genetic differences might influence natural selection within wildlife populations. Here we link genetic variation with differential susceptibility of white-tailed deer to chronic wasting disease (CWD), with implications for fitness and disease-driven genetic selection. We developed a single nucleotide polymorphism (SNP) assay to efficiently genotype deer at the locus of interest (in the 96th codon of the PRNP gene). Then, using a Bayesian modeling approach, we found that the more susceptible genotype had over four times greater risk of CWD infection; and, once infected, deer with the resistant genotype survived 49% longer (8.25 more months). We used these epidemiological parameters in a multi-stage population matrix model to evaluate relative fitness based on genotype-specific population growth rates. The differences in disease infection and mortality rates allowed genetically resistant deer to achieve higher population growth and obtain a long-term fitness advantage, which translated into a selection coefficient of over 1% favoring the CWD-resistant genotype. This selective pressure suggests that the resistant allele could become dominant in the population within an

AT1 Receptor Gene Polymorphisms in relation to Postprandial Lipemia

Directory of Open Access Journals (Sweden)

B. Klop

2012-01-01

Full Text Available Background. Recent data suggest that the renin-angiotensin system may be involved in triglyceride (TG metabolism. We explored the effect of the common A1166C and C573T polymorphisms of the angiotensin II type 1 receptor (AT1R gene on postprandial lipemia. Methods. Eighty-two subjects measured daytime capillary TG, and postprandial lipemia was estimated as incremental area under the TG curve. The C573T and A1166C polymorphisms of the AT1R gene were determined. Results. Postprandial lipemia was significantly higher in homozygous carriers of the 1166-C allele (9.39±8.36 mM*h/L compared to homozygous carriers of the 1166-A allele (2.02±6.20 mM*h/L (P<0.05. Postprandial lipemia was similar for the different C573T polymorphisms. Conclusion. The 1166-C allele of the AT1R gene seems to be associated with increased postprandial lipemia. These data confirm the earlier described relationships between the renin-angiotensin axis and triglyceride metabolism.

Epigenetic dominance of prion conformers.

Directory of Open Access Journals (Sweden)

Eri Saijo

2013-10-01

Full Text Available Although they share certain biological properties with nucleic acid based infectious agents, prions, the causative agents of invariably fatal, transmissible neurodegenerative disorders such as bovine spongiform encephalopathy, sheep scrapie, and human Creutzfeldt Jakob disease, propagate by conformational templating of host encoded proteins. Once thought to be unique to these diseases, this mechanism is now recognized as a ubiquitous means of information transfer in biological systems, including other protein misfolding disorders such as those causing Alzheimer's and Parkinson's diseases. To address the poorly understood mechanism by which host prion protein (PrP primary structures interact with distinct prion conformations to influence pathogenesis, we produced transgenic (Tg mice expressing different sheep scrapie susceptibility alleles, varying only at a single amino acid at PrP residue 136. Tg mice expressing ovine PrP with alanine (A at (OvPrP-A136 infected with SSBP/1 scrapie prions propagated a relatively stable (S prion conformation, which accumulated as punctate aggregates in the brain, and produced prolonged incubation times. In contrast, Tg mice expressing OvPrP with valine (V at 136 (OvPrP-V136 infected with the same prions developed disease rapidly, and the converted prion was comprised of an unstable (U, diffusely distributed conformer. Infected Tg mice co-expressing both alleles manifested properties consistent with the U conformer, suggesting a dominant effect resulting from exclusive conversion of OvPrP-V136 but not OvPrP-A136. Surprisingly, however, studies with monoclonal antibody (mAb PRC5, which discriminates OvPrP-A136 from OvPrP-V136, revealed substantial conversion of OvPrP-A136. Moreover, the resulting OvPrP-A136 prion acquired the characteristics of the U conformer. These results, substantiated by in vitro analyses, indicated that co-expression of OvPrP-V136 altered the conversion potential of OvPrP-A136 from the S to

Personalized Medicine Digoxin Theraphy in Individuals with MDR Gene Polymorphism

Directory of Open Access Journals (Sweden)

Em Sutrisna

2015-06-01

Full Text Available Digoxin is one of digitalis drugs. Wider applicability to heart failure and arrhythmias (supraventricular requires fairly strict scrutiny because of its narrow therapeutic index. Digoxin is a substrate of P-glycoprotein (P-gp encoded by multi drugs resistance-1 (MDR1. MDR-1 gen located on chromosome 7q21.1. This gene contains 28 exons that encoded a protein of 1280 amino acids. This gene plays an important role in the absorption, distribution and elimination of many drugs. MDR1C3435T polymorphism occurs in exon 26. There are three types of MDR1C3435T gene namely MDR1C3435T CC, MDR1C3435T CT and MDR1C3435T TT. These polymorphisms will affect to the formation of P-gp and consequently to change the kinetic profile of digoxin. The change of kinetic profile causes changes in the digoxin blood levels. The method used in this review is data search based on pubmed, medline, and embase with keywords MDR and digoxin. There are several different studies of the influence of polymorphisms MDR1C3435T on blood digoxin levels. Increased levels of digoxin in the blood due to polymorphism of MDR1C3435T will be at risk of digitalis intoxication. Long-term digoxin treatment or large dose should consider the patient’s genetic profile. Distribution of polymorphism of MDR1C3435T in Javanese population is approximately TT (0,10, CT (0,52, and CC(0, 38.

Research on the relativity between gene polymorphism and children cardiac insufficiency.

Science.gov (United States)

He, X-H; Li, C-L; Ling, N; Wang, Q-W; Wang, Z-Z; An, X-J

2017-08-01

We analyzed the relationship between Mink-S27 gene polymorphism and children with cardiac insufficiency. From April 2013 to April 2015, we enrolled 73 cases of children with cardiac insufficiency for this study, and all 73 were placed in the observation group. 76 normal cases were selected for the control group. Restriction fragment length polymorphism (RFLP) was used to make polymorphism analysis of the Mink-S27. Our results showed no significant differences in Mink-S27 genotype and allele distribution in both observation and control groups (p>0.05). In lesion samples collected from children with cardiac insufficiency, we detected significant difference in AA, CC genotype frequency and allele frequency between the observation group and the control group (prelatively high. GNAS2 gene polymorphism was associated with the prevalence of cardiac insufficiency in children. And also the patients' condition was correlated to the frequency of different genotypes and alleles.

Polymorphism of calpastatin gene in Arabic sheep using PCR- RFLP

African Journals Online (AJOL)

Calpastatin has been known as candidate gene in muscle growth efficiency and meat quality. This gene has been located to chromosome 5 of sheep. In order to evaluate the calpastatin gene polymorphism, random blood sample were collected from 111 Arabic ram sheep from different regions. The DNA extraction was ...

Peroxiredoxin 6 promotes upregulation of the prion protein (PrP in neuronal cells of prion-infected mice

Directory of Open Access Journals (Sweden)

Wagner Wibke

2012-12-01

Full Text Available Abstract Background It has been widely established that the conversion of the cellular prion protein (PrPC into its abnormal isoform (PrPSc is responsible for the development of transmissible spongiform encephalopathies (TSEs. However, the knowledge of the detailed molecular mechanisms and direct functional consequences within the cell is rare. In this study, we aimed at the identification of deregulated proteins which might be involved in prion pathogenesis. Findings Apolipoprotein E and peroxiredoxin 6 (PRDX6 were identified as upregulated proteins in brains of scrapie-infected mice and cultured neuronal cell lines. Downregulation of PrP gene expression using specific siRNA did not result in a decrease of PRDX6 amounts. Interestingly, selective siRNA targeting PRDX6 or overexpression of PRDX6 controlled PrPC and PrPSc protein amounts in neuronal cells. Conclusions Besides its possible function as a novel marker protein in the diagnosis of TSEs, PDRX6 represents an attractive target molecule in putative pharmacological intervention strategies in the future.

Prions, From Structure to Epigenetics and Neuronal Functions

Science.gov (United States)

Lindquist, Susan

2012-02-01

Prions are a unique type of protein that can misfold and convert other proteins to the same shape. The well-characterized yeast prion [PSI+] is formed from an inactive amyloid fiber conformation of the translation-termination factor, Sup35. This altered conformation is passed from mother cells to daughters, acting as a template to perpetuate the prion state and providing a mechanism of protein-based inheritance. We employed a variety of methods to determine the structure of Sup35 amyloid fibrils. First, using fluorescent tags and cross-linking we identified specific segments of the protein monomer that form intermolecular contacts in a ``Head-to-Head,'' ``Tail-to-Tail'' fashion while a central region forms intramolecular contacts. Then, using peptide arrays we mapped the region responsible for the prion transmission barrier between two different yeast species. We have also used optical tweezers to reveal that the non-covalent intermolecular contacts between monomers are unusually strong, and maintain fibril integrity even under forces that partially unfold individual monomers and extend fibril length. Based on the handful of known yeast prion proteins we predicted sequences that could be responsible for prion-like amyloid folding. Our screen identified 19 new candidate prions, whose protein-folding properties and diverse cellular functions we have characterized using a combination of genetic and biochemical techniques. Prion-driven phenotypic diversity increases under stress, and can be amplified by the dynamic maturation of prion-initiating states. These qualities allow prions to act as ``bet-hedging'' devices that facilitate the adaptation of yeast to stressful environments, and might speed the evolution of new traits. Together with Kandel and Si, we have also found that a regulatory protein that plays an important role in synaptic plasticity behaves as a prion in yeast. Cytoplasmic polyAdenylation element binding protein, CPEB, maintains synapses by promoting

Correlation between endometriosis combined with infertility and STAT3 gene polymorphisms

Directory of Open Access Journals (Sweden)

Juan Hu

2016-05-01

Full Text Available Objective: To investigate the correlation between STAT3 gene polymorphisms and endometriosis complicated with infertility. Methods: A total of 35 patients with endometriosis complicated with infertility and 35 cases of healthy volunteer from October 2014 to October 2015 in our hospital were selected as research objects. STAT3 gene polymorphisms of all objects were detected by PCR-RFLP method. Results: Polymorphic sites of STAT3 gene rs2293152 were expressed as three genotypes, namely, CC, GC, and GG. There were 18 cases, 10 cases and 7 cases of type CC, GC and GG in the observation group, accounted for 51.43%, 28.57% and 20.00%, respectively. There were 29 cases, 3 cases and 3 cases of type CC, GC and GG in the control group, accounted for 82.86%, 8.57% and 8.57%. There was a statistically difference` between the two groups. The frequency of C and G allele in the observation group and the control group were 65.71%, 34.29% and 87.14%, 12.86%, respectively. There were statistically significant differences between two groups. In addition, compared with the CC genotype, genotype G might increase the risk of the disease. Conclusions: The susceptibility of endometriosis complicated with infertility may be associated with STAT3 gene polymorphism and women who carried the G allele may have an increased the risk of the disease.

Interleukin 17 receptor gene polymorphism in periimplantitis and chronic periodontitis.

Directory of Open Access Journals (Sweden)

Mahdi Kadkhodazadeh

2013-06-01

Full Text Available Gene polymorphism of cytokines influencing their function has been known as a contributing factor in the pathogenesis of inflammatory diseases of the tooth and implant supporting tissues. The aim of this study was to investigate the association of IL-17R gene polymorphism (rs879576 with chronic periodontitis and periimplantitis in an Iranian population. 73 patients with chronic periodontitis, 37 patients with periimplantitis and 83 periodontally healthy patients were enrolled in this study. 5cc blood was obtained from each subject's arm vein and transferred to tubes containing EDTA. Genomic DNA was extracted using Miller's Salting Out technique. The DNA was transferred into 96 division plates, transported to Kbioscience Institute in United Kingdom and analyzed using the Kbioscience Competitive Allele Specific PCR (KASP technique. Chi-square and Kruskal Wallis tests were used to analyze differences in the expression of genotypes and frequency of alleles in disease and control groups (P-Value less than 0.05 was considered statistically significant. There were no significant differences between periodontitis, periimplantitis with AA, GG, GA genotype of IL-17R gene (P=0.8239. Also comparison of frequency of alleles in SNP rs879576 of IL-17R gene between the chronic periodontitis group and periimplantitis group did not revealed statistically significant differences (P=0.8239. The enigma of IL-17 and its polymorphism-role in periodontitis and periimplantitis is yet to be investigated more carefully throughout further research but this article demonstrates that polymorphism of IL-17R plays no significant role in incidence of chronic periodontitis and Periimplantitis.

Interleukin 17 Receptor Gene Polymorphism in Periimplantitis and Chronic Periodontitis

Directory of Open Access Journals (Sweden)

Mahdi Kadkhodazadeh

2013-05-01

Full Text Available Gene polymorphism of cytokines influencing their function has been known as a contributing factor in the pathogenesis of inflammatory diseases of the tooth and implant supporting tissues. The aim of this study was to investigate the association of IL-17R gene polymorphism (rs879576 with chronic periodontitis and periimplantitis in an Iranian population. 73 patients with chronic periodontitis, 37 patients with periimplantitis and 83 periodontally healthy patients were enrolled in this study. 5cc blood was obtained from each subject’s arm vein and transferred to tubes containing EDTA. Genomic DNA was extracted using Miller's Salting Out technique. The DNA was transferred into 96 division plates, transported to Kbioscience Institute in United Kingdom and analyzed using the Kbioscience Competitive Allele Specific PCR (KASP technique. Chi-square and Kruskal Wallis tests were used to analyze differences in the expression of genotypes and frequency of alleles in disease and control groups (P-Value less than 0.05 was considered statistically significant. There were no significant differences between periodontitis, periimplantitis with AA, GG, GA genotype of IL-17R gene (P=0.8239. Also comparison of frequency of alleles in SNP rs879576 of IL-17R gene between the chronic periodontitis group and periimplantitis group did not revealed statistically significant differences (P=0.8239. The enigma of IL-17 and its polymorphism-role in periodontitis and periimplantitis is yet to be investigated more carefully throughout further research but this article demonstrates that polymorphism of IL-17R plays no significant role in incidence of chronic periodontitis and Periimplantitis.

Association between polymorphism at 3 ׳UTR of urokinase gene and risk of calcium

Directory of Open Access Journals (Sweden)

S. Morovvati

2016-06-01

Full Text Available Background: Kidney stone is a common multifactorial disease in Iran. Environmental and genetic factors including single nucleotide polymorphism (SNP affect the incidence of kidney stones. Objective: The aim of this study was to determine the association of +4065 T/C polymorphism at 3′untranslated region (3'UTR of urokinase gene and calcium kidney stones. Methods: This case-control study was conducted on 70 patients with history of calcium kidney stones as case group and 70 healthy subjects as control group in the Baqiyatallah hospital in 2013. The polymorphism was assessed using the Allele Specific PCR (AS-PCR method. Allele and genotype frequencies of the two groups were compared using 2x2 contingency tables. Hardy-Weinberg equilibrium was compared between the two groups using Chi-square test. Findings: Of 70 cases, 10 (15% were heterozygous and 24 (34% were homozygous for the polymorphism. Of 70 controls, 25 (35% were heterozygous for the polymorphism. The frequency of mutant T allele was 41% in the case group and 18% in the control group. The frequency of mutant C allele was 59% in the case group and 82% in the control group. The risk of calcium kidney stones in carriers of the mutant allele was 1.7 times higher than non-carriers (OR: 1.7. Conclusion: With regards to the results, it seems that there is a significant association between the polymorphism at 3 ׳UTR of urokinase gene and formation of calcium kidney stones. Urokinase gene polymorphism may be introduced as a candidate gene involved in calcium stone formation.

Intraperitoneal Infection of Wild-Type Mice with Synthetically Generated Mammalian Prion.

Directory of Open Access Journals (Sweden)

Xinhe Wang

2015-07-01

Full Text Available The prion hypothesis postulates that the infectious agent in transmissible spongiform encephalopathies (TSEs is an unorthodox protein conformation based agent. Recent successes in generating mammalian prions in vitro with bacterially expressed recombinant prion protein provide strong support for the hypothesis. However, whether the pathogenic properties of synthetically generated prion (rec-Prion recapitulate those of naturally occurring prions remains unresolved. Using end-point titration assay, we showed that the in vitro prepared rec-Prions have infectious titers of around 104 LD50/μg. In addition, intraperitoneal (i.p. inoculation of wild-type mice with rec-Prion caused prion disease with an average survival time of 210-220 days post inoculation. Detailed pathological analyses revealed that the nature of rec-Prion induced lesions, including spongiform change, disease specific prion protein accumulation (PrP-d and the PrP-d dissemination amongst lymphoid and peripheral nervous system tissues, the route and mechanisms of neuroinvasion were all typical of classical rodent prions. Our results revealed that, similar to naturally occurring prions, the rec-Prion has a titratable infectivity and is capable of causing prion disease via routes other than direct intra-cerebral challenge. More importantly, our results established that the rec-Prion caused disease is pathogenically and pathologically identical to naturally occurring contagious TSEs, supporting the concept that a conformationally altered protein agent is responsible for the infectivity in TSEs.

Prion Amplification and Hierarchical Bayesian Modeling Refine Detection of Prion Infection

Science.gov (United States)

Wyckoff, A. Christy; Galloway, Nathan; Meyerett-Reid, Crystal; Powers, Jenny; Spraker, Terry; Monello, Ryan J.; Pulford, Bruce; Wild, Margaret; Antolin, Michael; Vercauteren, Kurt; Zabel, Mark

2015-02-01

Prions are unique infectious agents that replicate without a genome and cause neurodegenerative diseases that include chronic wasting disease (CWD) of cervids. Immunohistochemistry (IHC) is currently considered the gold standard for diagnosis of a prion infection but may be insensitive to early or sub-clinical CWD that are important to understanding CWD transmission and ecology. We assessed the potential of serial protein misfolding cyclic amplification (sPMCA) to improve detection of CWD prior to the onset of clinical signs. We analyzed tissue samples from free-ranging Rocky Mountain elk (Cervus elaphus nelsoni) and used hierarchical Bayesian analysis to estimate the specificity and sensitivity of IHC and sPMCA conditional on simultaneously estimated disease states. Sensitivity estimates were higher for sPMCA (99.51%, credible interval (CI) 97.15-100%) than IHC of obex (brain stem, 76.56%, CI 57.00-91.46%) or retropharyngeal lymph node (90.06%, CI 74.13-98.70%) tissues, or both (98.99%, CI 90.01-100%). Our hierarchical Bayesian model predicts the prevalence of prion infection in this elk population to be 18.90% (CI 15.50-32.72%), compared to previous estimates of 12.90%. Our data reveal a previously unidentified sub-clinical prion-positive portion of the elk population that could represent silent carriers capable of significantly impacting CWD ecology.

Prion amplification and hierarchical Bayesian modeling refine detection of prion infection.

Science.gov (United States)

Wyckoff, A Christy; Galloway, Nathan; Meyerett-Reid, Crystal; Powers, Jenny; Spraker, Terry; Monello, Ryan J; Pulford, Bruce; Wild, Margaret; Antolin, Michael; VerCauteren, Kurt; Zabel, Mark

2015-02-10

Prions are unique infectious agents that replicate without a genome and cause neurodegenerative diseases that include chronic wasting disease (CWD) of cervids. Immunohistochemistry (IHC) is currently considered the gold standard for diagnosis of a prion infection but may be insensitive to early or sub-clinical CWD that are important to understanding CWD transmission and ecology. We assessed the potential of serial protein misfolding cyclic amplification (sPMCA) to improve detection of CWD prior to the onset of clinical signs. We analyzed tissue samples from free-ranging Rocky Mountain elk (Cervus elaphus nelsoni) and used hierarchical Bayesian analysis to estimate the specificity and sensitivity of IHC and sPMCA conditional on simultaneously estimated disease states. Sensitivity estimates were higher for sPMCA (99.51%, credible interval (CI) 97.15-100%) than IHC of obex (brain stem, 76.56%, CI 57.00-91.46%) or retropharyngeal lymph node (90.06%, CI 74.13-98.70%) tissues, or both (98.99%, CI 90.01-100%). Our hierarchical Bayesian model predicts the prevalence of prion infection in this elk population to be 18.90% (CI 15.50-32.72%), compared to previous estimates of 12.90%. Our data reveal a previously unidentified sub-clinical prion-positive portion of the elk population that could represent silent carriers capable of significantly impacting CWD ecology.

Experimental sheep BSE prions generate the vCJD phenotype when serially passaged in transgenic mice expressing human prion protein.

Science.gov (United States)

Joiner, Susan; Asante, Emmanuel A; Linehan, Jacqueline M; Brock, Lara; Brandner, Sebastian; Bellworthy, Susan J; Simmons, Marion M; Hope, James; Collinge, John; Wadsworth, Jonathan D F

2018-03-15

The epizootic prion disease of cattle, bovine spongiform encephalopathy (BSE), causes variant Creutzfeldt-Jakob disease (vCJD) in humans following dietary exposure. While it is assumed that all cases of vCJD attributed to a dietary aetiology are related to cattle BSE, sheep and goats are susceptible to experimental oral challenge with cattle BSE prions and farmed animals in the UK were undoubtedly exposed to BSE-contaminated meat and bone meal during the late 1980s and early 1990s. Although no natural field cases of sheep BSE have been identified, it cannot be excluded that some BSE-infected sheep might have entered the European human food chain. Evaluation of the zoonotic potential of sheep BSE prions has been addressed by examining the transmission properties of experimental brain isolates in transgenic mice that express human prion protein, however to-date there have been relatively few studies. Here we report that serial passage of experimental sheep BSE prions in transgenic mice expressing human prion protein with methionine at residue 129 produces the vCJD phenotype that mirrors that seen when the same mice are challenged with vCJD prions from patient brain. These findings are congruent with those reported previously by another laboratory, and thereby strongly reinforce the view that sheep BSE prions could have acted as a causal agent of vCJD within Europe. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

More than just trash bins? Potential roles for extracellular vesicles in the vertical and horizontal transmission of yeast prions.

Science.gov (United States)

Kabani, Mehdi; Melki, Ronald

2016-05-01

In the yeast Saccharomyces cerevisiae, an ensemble of structurally and functionally diverse cytoplasmic proteins has the ability to form self-perpetuating protein aggregates (e.g. prions) which are the vectors of heritable non-Mendelian phenotypic traits. Whether harboring these prions is deleterious-akin to mammalian degenerative disorders-or beneficial-as epigenetic modifiers of gene expression-for yeasts has been intensely debated and strong arguments were made in support of both views. We recently reported that the yeast prion protein Sup35p is exported via extracellular vesicles (EV), both in its soluble and aggregated infectious states. Herein, we discuss the possible implications of this observation and propose several hypotheses regarding the roles of EV in both vertical and horizontal propagation of 'good' and 'bad' yeast prions.

Gene Expression and Polymorphism of Myostatin Gene and its Association with Growth Traits in Chicken.

Science.gov (United States)

Dushyanth, K; Bhattacharya, T K; Shukla, R; Chatterjee, R N; Sitaramamma, T; Paswan, C; Guru Vishnu, P

2016-10-01

Myostatin is a member of TGF-β super family and is directly involved in regulation of body growth through limiting muscular growth. A study was carried out in three chicken lines to identify the polymorphism in the coding region of the myostatin gene through SSCP and DNA sequencing. A total of 12 haplotypes were observed in myostatin coding region of chicken. Significant associations between haplogroups with body weight at day 1, 14, 28, and 42 days, and carcass traits at 42 days were observed across the lines. It is concluded that the coding region of myostatin gene was polymorphic, with varied levels of expression among lines and had significant effects on growth traits. The expression of MSTN gene varied during embryonic and post hatch development stage.

Vitamin D Receptor Gene Polymorphisms Associated with Childhood Autism.

Science.gov (United States)

Cieślińska, Anna; Kostyra, Elżbieta; Chwała, Barbara; Moszyńska-Dumara, Małgorzata; Fiedorowicz, Ewa; Teodorowicz, Małgorzata; Savelkoul, Huub F J

2017-09-09

Autism spectrum disorder (ASD) is a group of heterogeneous, behaviorally defined disorders whereby currently no biological markers are common to all affected individuals. A deregulated immune response may be contributing to the etiology of ASD. The active metabolite of vitamin D₃ has an immunoregulatory role mediated by binding to the vitamin D receptor (VDR) in monocyte, macrophages, and lymphocytes. The effects of vitamin D and interaction with the VDR may be influenced by polymorphism in the VDR gene. Genetic association of four different VDR polymorphisms (Apa-I, Bsm-I, Taq-I, Fok-I) associated with susceptibility to the development of autism in children was investigated. We uniquely found an association between the presence of the T allele at position Taq-I and presence of the a allele at position Apa-I of the VDR gene with decreased ASD incidence. There was also an association between female gender and the presence of the T allele. We found no statistical significant correlation between VDR single nucleotide polymorphisms (SNPs) and vitamin D₃ concentration in serum of ASD children. Genetic polymorphism in two SNP in VDR may be correlated with development of ASD symptoms by influencing functionality of vitamin D₃ metabolism, while vitamin D₃ levels were not significantly different between ASD and non-ASD children.

Leptin gene polymorphism in Indian Sahiwal cattle by single strand ...

African Journals Online (AJOL)

These leptin gene variants can be sequenced and screened in the entire population to develop single nucleotide polymorphisms (SNPs) for association studies with different productive and reproductive performances and marker assisted selection. Keywords: Leptin gene, PCR-SSCP, genetic variability, dairy cattle

Association of inflammatory gene polymorphisms with ischemic stroke in a Chinese Han population

OpenAIRE

Zhao, Nan; Liu, Xin; Wang, Yongqin; Liu, Xiaoqiu; Li, Jiana; Yu, Litian; Ma, Liyuan; Wang, Shuyu; Zhang, Hongye; Liu, Lisheng; Zhao, Jingbo; Wang, Xingyu

2012-01-01

Abstract Background Inflammatory mechanisms are important in stroke risk, and genetic variations in components of the inflammatory response have been implicated as risk factors for stroke. We tested the inflammatory gene polymorphisms and their association with ischemic stroke in a Chinese Han population. Methods A total of 1,124 ischemic stroke cases and 1,163 controls were genotyped with inflammatory panel strips containing 51 selected inflammatory gene polymorphisms from 35 candidate genes...

No Association between Personality and Candidate Gene Polymorphisms in a Wild Bird Population.

Directory of Open Access Journals (Sweden)

Hannah A Edwards

Full Text Available Consistency of between-individual differences in behaviour or personality is a phenomenon in populations that can have ecological consequences and evolutionary potential. One way that behaviour can evolve is to have a genetic basis. Identifying the molecular genetic basis of personality could therefore provide insight into how and why such variation is maintained, particularly in natural populations. Previously identified candidate genes for personality in birds include the dopamine receptor D4 (DRD4, and serotonin transporter (SERT. Studies of wild bird populations have shown that exploratory and bold behaviours are associated with polymorphisms in both DRD4 and SERT. Here we tested for polymorphisms in DRD4 and SERT in the Seychelles warbler (Acrocephalus sechellensis population on Cousin Island, Seychelles, and then investigated correlations between personality and polymorphisms in these genes. We found no genetic variation in DRD4, but identified four polymorphisms in SERT that clustered into five haplotypes. There was no correlation between bold or exploratory behaviours and SERT polymorphisms/haplotypes. The null result was not due to lack of power, and indicates that there was no association between these behaviours and variation in the candidate genes tested in this population. These null findings provide important data to facilitate representative future meta-analyses on candidate personality genes.

Evaluation of ACE gene I/D polymorphism in Iranian elite athletes.

Science.gov (United States)

Shahmoradi, Somayeh; Ahmadalipour, Ali; Salehi, Mansoor

2014-01-01

Angiotensin converting enzyme (ACE) is an important gene, which is associated with the successful physical activity. The ACE gene has a major polymorphism (I/D) in intron 16 that determines its plasma and tissue levels. In this study, we aimed to determine whether there is an association between this polymorphism and sports performance in our studied population including elite athletes of different sports disciplines. We investigated allele frequency and genotype distribution of the ACE gene in 156 Iranian elite athletes compared to 163 healthy individuals. We also investigated this allele frequency between elite athletes in three functional groups of endurance, power, and mixed sports performances. DNA was extracted from peripheral blood, and polymerase chain reaction (PCR) method was performed on intron 16 of the ACE gene. The ACE genotype was determined for each subject. Statistical analysis was performed by SPSS 15, and results were analyzed by Chi-Square test. There was a significant difference in genotype distribution and allele frequency of the ACE gene in athletes and control group (P = 0.05, P = 0.03, respectively). There was also a significant difference in allele frequency of the ACE gene in 3 groups of athletes with different sports disciplines (P = 0.045). Proportion of the ACE gene D allele was greater in elite endurance athletes (37 high-distance cyclists) than two other groups. Findings of the present study demonstrated that there is an association between the ACE gene I/D polymorphism and sports performance in Iranian elite athletes.

Polymorphisms of Selected DNA Repair Genes and Lung Cancer in Chromium Exposure.

Science.gov (United States)

Halasova, E; Matakova, T; Skerenova, M; Krutakova, M; Slovakova, P; Dzian, A; Javorkova, S; Pec, M; Kypusova, K; Hamzik, J

2016-01-01

Chromium is a well-known mutagen and carcinogen involved in lung cancer development. DNA repair genes play an important role in the elimination of genetic changes caused by chromium exposure. In the present study, we investigated the polymorphisms of the following DNA repair genes: XRCC3, participating in the homologous recombination repair, and hMLH1 and hMSH2, functioning in the mismatch repair. We focused on the risk the polymorphisms present in the development of lung cancer regarding the exposure to chromium. We analyzed 106 individuals; 45 patients exposed to chromium with diagnosed lung cancer and 61 healthy controls. Genotypes were determined by a PCR-RFLP method. We unravelled a potential for increased risk of lung cancer development in the hMLH1 (rs1800734) AA genotype in the recessive model. In conclusion, gene polymorphisms in the DNA repair genes underscores the risk of lung cancer development in chromium exposed individuals.

Polymorphisms in miRNA genes and their involvement in autoimmune diseases susceptibility.

Science.gov (United States)

Latini, Andrea; Ciccacci, Cinzia; Novelli, Giuseppe; Borgiani, Paola

2017-08-01

MicroRNAs (miRNAs) are small non-coding RNA molecules that negatively regulate the expression of multiple protein-encoding genes at the post-transcriptional level. MicroRNAs are involved in different pathways, such as cellular proliferation and differentiation, signal transduction and inflammation, and play crucial roles in the development of several diseases, such as cancer, diabetes, and cardiovascular diseases. They have recently been recognized to play a role also in the pathogenesis of autoimmune diseases. Although the majority of studies are focused on miRNA expression profiles investigation, a growing number of studies have been investigating the role of polymorphisms in miRNA genes in the autoimmune diseases development. Indeed, polymorphisms affecting the miRNA genes can modify the set of targets they regulate or the maturation efficiency. This review is aimed to give an overview about the available studies that have investigated the association of miRNA gene polymorphisms with the susceptibility to various autoimmune diseases and to their clinical phenotypes.

Long-term memory consolidation: The role of RNA-binding proteins with prion-like domains.

Science.gov (United States)

Sudhakaran, Indulekha P; Ramaswami, Mani

2017-05-04

Long-term and short-term memories differ primarily in the duration of their retention. At a molecular level, long-term memory (LTM) is distinguished from short-term memory (STM) by its requirement for new gene expression. In addition to transcription (nuclear gene expression) the translation of stored mRNAs is necessary for LTM formation. The mechanisms and functions for temporal and spatial regulation of mRNAs required for LTM is a major contemporary problem, of interest from molecular, cell biological, neurobiological and clinical perspectives. This review discusses primary evidence in support for translational regulatory events involved in LTM and a model in which different phases of translation underlie distinct phases of consolidation of memories. However, it focuses largely on mechanisms of memory persistence and the role of prion-like domains in this defining aspect of long-term memory. We consider primary evidence for the concept that Cytoplasmic Polyadenylation Element Binding (CPEB) protein enables the persistence of formed memories by transforming in prion-like manner from a soluble monomeric state to a self-perpetuating and persistent polymeric translationally active state required for maintaining persistent synaptic plasticity. We further discuss prion-like domains prevalent on several other RNA-binding proteins involved in neuronal translational control underlying LTM. Growing evidence indicates that such RNA regulatory proteins are components of mRNP (RiboNucleoProtein) granules. In these proteins, prion-like domains, being intrinsically disordered, could mediate weak transient interactions that allow the assembly of RNP granules, a source of silenced mRNAs whose translation is necessary for LTM. We consider the structural bases for RNA granules formation as well as functions of disordered domains and discuss how these complicate the interpretation of existing experimental data relevant to general mechanisms by which prion-domain containing RBPs

Polymorphisms in inflammation pathway genes and endometrial cancer risk

Science.gov (United States)

Delahanty, Ryan J.; Xiang, Yong-Bing; Spurdle, Amanda; Beeghly-Fadiel, Alicia; Long, Jirong; Thompson, Deborah; Tomlinson, Ian; Yu, Herbert; Lambrechts, Diether; Dörk, Thilo; Goodman, Marc T.; Zheng, Ying; Salvesen, Helga B.; Bao, Ping-Ping; Amant, Frederic; Beckmann, Matthias W.; Coenegrachts, Lieve; Coosemans, An; Dubrowinskaja, Natalia; Dunning, Alison; Runnebaum, Ingo B.; Easton, Douglas; Ekici, Arif B.; Fasching, Peter A.; Halle, Mari K.; Hein, Alexander; Howarth, Kimberly; Gorman, Maggie; Kaydarova, Dylyara; Krakstad, Camilla; Lose, Felicity; Lu, Lingeng; Lurie, Galina; O’Mara, Tracy; Matsuno, Rayna K.; Pharoah, Paul; Risch, Harvey; Corssen, Madeleine; Trovik, Jone; Turmanov, Nurzhan; Wen, Wanqing; Lu, Wei; Cai, Qiuyin; Zheng, Wei; Shu, Xiao-Ou

2013-01-01

Background Experimental and epidemiological evidence have suggested that chronic inflammation may play a critical role in endometrial carcinogenesis. Methods To investigate this hypothesis, a two-stage study was carried out to evaluate single nucleotide polymorphisms (SNPs) in inflammatory pathway genes in association with endometrial cancer risk. In stage 1, 64 candidate pathway genes were identified and 4,542 directly genotyped or imputed SNPs were analyzed among 832 endometrial cancer cases and 2,049 controls, using data from the Shanghai Endometrial Cancer Genetics Study. Linkage disequilibrium of stage 1 SNPs significantly associated with endometrial cancer (PAsian- and European-ancestry samples. Conclusions These findings lend support to the hypothesis that genetic polymorphisms in genes involved in the inflammatory pathway may contribute to genetic susceptibility to endometrial cancer. Impact Statement This study adds to the growing evidence that inflammation plays an important role in endometrial carcinogenesis. PMID:23221126

Selfish prion of Rnq1 mutant in yeast.

Science.gov (United States)

Kurahashi, Hiroshi; Shibata, Shoichiro; Ishiwata, Masao; Nakamura, Yoshikazu

2009-05-01

[PIN(+)] is a prion form of Rnq1 in Saccharomyces cerevisiae and is necessary for the de novo induction of a second prion, [PSI(+)]. We previously isolated a truncated form of Rnq1, named Rnq1Delta100, as a [PSI(+)]-eliminating factor in S. cerevisiae. Rnq1Delta100 deletes the N-terminal non-prion domain of Rnq1, and eliminates [PSI(+)] in [PIN(+)] yeast. Here we found that [PIN(+)] is transmissible to Rnq1Delta100 in the absence of full-length Rnq1, forming a novel prion variant [RNQ1Delta100(+)]. [RNQ1Delta100(+)] has similar [PIN(+)] properties as it stimulates the de novo induction of [PSI(+)] and is eliminated by the null hsp104Delta mutation, but not by Hsp104 overproduction. In contrast, [RNQ1Delta100(+)] inherits the inhibitory activity and hampers the maintenance of [PSI(+)] though less efficiently than [PIN(+)] made of Rnq1-Rnq1Delta100 co-aggregates. Interestingly, [RNQ1Delta100(+)] prion was eliminated by de novo [PSI(+)] induction. Thus, the [RNQ1Delta100(+)] prion demonstrates selfish activity to eliminate a heterologous prion in S. cerevisiae, showing the first instance of a selfish prion variant in living organisms.

Physical, chemical and kinetic factors affecting prion infectivity.

Science.gov (United States)

Properzi, Francesca; Badhan, Anjna; Klier, Steffi; Schmidt, Christian; Klöhn, Peter C; Wadsworth, Jonathan D F; Clarke, Anthony R; Jackson, Graham S; Collinge, John

2016-05-03

The mouse-adapted scrapie prion strain RML is one of the most widely used in prion research. The introduction of a cell culture-based assay of RML prions, the scrapie cell assay (SCA) allows more rapid and precise prion titration. A semi-automated version of this assay (ASCA) was applied to explore a range of conditions that might influence the infectivity and properties of RML prions. These include resistance to freeze-thaw procedures; stability to endogenous proteases in brain homogenate despite prolonged exposure to varying temperatures; distribution of infective material between pellet and supernatant after centrifugation, the effect of reducing agents and the influence of detergent additives on the efficiency of infection. Apparent infectivity is increased significantly by interaction with cationic detergents. Importantly, we have also elucidated the relationship between the duration of exposure of cells to RML prions and the transmission of infection. We established that the infection process following contact of cells with RML prions is rapid and followed an exponential time course, implying a single rate-limiting process.

DNA Repair Gene Polymorphism and the Risk of Mitral Chordae Tendineae Rupture

Directory of Open Access Journals (Sweden)

Aysel Kalayci Yigin

2015-01-01

Full Text Available Polymorphisms in Lys939Gln XPC gene may diminish DNA repair capacity, eventually increasing the risk of carcinogenesis. The aim of the present study was to evaluate the significance of polymorphism Lys939Gln in XPC gene in patients with mitral chordae tendinea rupture (MCTR. Twenty-one patients with MCTR and thirty-seven age and sex matched controls were enrolled in the study. Genotyping of XPC gene Lys939Gln polymorphism was carried out using polymerase chain reaction- (PCR- restriction fragment length polymorphism (RFLP. The frequencies of the heterozygote genotype (Lys/Gln-AC and homozygote genotype (Gln/Gln-CC were significantly different in MCTR as compared to control group, respectively (52.4% versus 43.2%, p=0.049; 38.15% versus 16.2%, p=0.018. Homozygote variant (Gln/Gln genotype was significantly associated with increased risk of MCTR (OR = 2.059; 95% CI: 1.097–3.863; p=0.018. Heterozygote variant (Lys/Gln genotype was also highly significantly associated with increased risk of MCTR (OR = 1.489; 95% CI: 1.041–2.129; p=0.049. The variant allele C was found to be significantly associated with MCTR (OR = 1.481; 95% CI: 1.101–1.992; p=0.011. This study has demonstrated the association of XPC gene Lys939Gln polymorphism with MCTR, which is significantly associated with increased risk of MCTR.

A closer look at prion strains: characterization and important implications.

Science.gov (United States)

Solforosi, Laura; Milani, Michela; Mancini, Nicasio; Clementi, Massimo; Burioni, Roberto

2013-01-01

Prions are infectious proteins that are responsible for transmissible spongiform encephalopathies (TSEs) and consist primarily of scrapie prion protein (PrP (Sc) ), a pathogenic isoform of the host-encoded cellular prion protein (PrP (C) ). The absence of nucleic acids as essential components of the infectious prions is the most striking feature associated to these diseases. Additionally, different prion strains have been isolated from animal diseases despite the lack of DNA or RNA molecules. Mounting evidence suggests that prion-strain-specific features segregate with different PrP (Sc) conformational and aggregation states. Strains are of practical relevance in prion diseases as they can drastically differ in many aspects, such as incubation period, PrP (Sc) biochemical profile (e.g., electrophoretic mobility and glycoform ratio) and distribution of brain lesions. Importantly, such different features are maintained after inoculation of a prion strain into genetically identical hosts and are relatively stable across serial passages. This review focuses on the characterization of prion strains and on the wide range of important implications that the study of prion strains involves.

Translation of the prion protein mRNA is robust in astrocytes but does not amplify during reactive astrocytosis in the mouse brain.

Directory of Open Access Journals (Sweden)

Walker S Jackson

Full Text Available Prion diseases induce neurodegeneration in specific brain areas for undetermined reasons. A thorough understanding of the localization of the disease-causing molecule, the prion protein (PrP, could inform on this issue but previous studies have generated conflicting conclusions. One of the more intriguing disagreements is whether PrP is synthesized by astrocytes. We developed a knock-in reporter mouse line in which the coding sequence of the PrP expressing gene (Prnp, was replaced with that for green fluorescent protein (GFP. Native GFP fluorescence intensity varied between and within brain regions. GFP was present in astrocytes but did not increase during reactive gliosis induced by scrapie prion infection. Therefore, reactive gliosis associated with prion diseases does not cause an acceleration of local PrP production. In addition to aiding in Prnp gene activity studies, this reporter mouse line will likely prove useful for analysis of chimeric animals produced by stem cell and tissue transplantation experiments.

Angiotensinogen and ACE gene polymorphisms and risk of atrial fibrillation in the general population

DEFF Research Database (Denmark)

Ravn, Lasse Steen; Benn, Marianne; Nordestgaard, Børge

2008-01-01

Objectives The renin-angiotensin system may play a role in the pathogenesis of atrial fibrillation, and renin-angiotensin system blockers reduce the risk of atrial fibrillation. We hypothesized that polymorphisms in the angiotensinogen and angiotensin-converting enzyme (ACE) genes encoding proteins...... in this system predict risk of atrial fibrillation. Methods and results We genotyped 9235 individuals from the Danish general population, The Copenhagen City Heart Study, for the a-20c, g-6a, T174M, and M235T polymorphisms in the angiotensinogen gene and the insertion/deletion (I/D) polymorphism in the ACE gene...

Association of porcine UCP3 gene polymorphisms with fatness traits ...

African Journals Online (AJOL)

Administrator

2011-04-25

Apr 25, 2011 ... ... for fatness traits in pig. Polymorphism in UCP3 gene may change the function ... NM_214049) and human UCP3 gene DNA sequence (GenBank accession No. NC_000011). ..... Sleep, 29: 645-649. Zhao J, Li H, Kong X, ...

Disease Transmission by Misfolded Prion-Protein Isoforms, Prion-Like Amyloids, Functional Amyloids and the Central Dogma

Directory of Open Access Journals (Sweden)

Martin L. Daus

2016-01-01

Full Text Available In 1982, the term “prions” (proteinaceous infectious particles was coined to specify a new principle of infection. A misfolded isoform of a cellular protein has been described as the causative agent of a fatal neurodegenerative disease. At the beginning of prion research scientists assumed that the infectious agent causing transmissible spongiform encephalopathy (TSE was a virus, but some unconventional properties of these pathogens were difficult to bring in line with the prevailing viral model. The discovery that prions (obviously devoid of any coding nucleic acid can store and transmit information similarly to DNA was initially even denoted as being “heretical” but is nowadays mainly accepted by the scientific community. This review describes, from a historical point of view, how the “protein-only hypothesis” expands the Central Dogma. Definition of both, the prion principle and the Central Dogma, have been essential steps to understand information storage and transfer within and among cells and organisms. Furthermore, the current understanding of the infectivity of prion-proteins after misfolding is summarized succinctly. Finally, prion-like amyloids and functional amyloids, as found in yeast and bacteria, will be discussed.

Author Details

African Journals Online (AJOL)

Identification of a single nucleotide polymorphism of the pituitary-specific transcriptional factor 1 (Pit 1) gene and its association with body composition trait in Iranian commercial broiler line. Abstract PDF · Vol 10, No 70 (2011) - Articles Polymorphisms of the prion protein gene Arabi sheep breed in Iran Abstract PDF · Vol 10, ...

Prion protein-deficient mice exhibit decreased CD4 T and LTi cell numbers and impaired spleen structure.

Science.gov (United States)

Kim, Soochan; Han, Sinsuk; Lee, Ye Eun; Jung, Woong-Jae; Lee, Hyung Soo; Kim, Yong-Sun; Choi, Eun-Kyoung; Kim, Mi-Yeon

2016-01-01

The cellular prion protein is expressed in almost all tissues, including the central nervous system and lymphoid tissues. To investigate the effects of the prion protein in lymphoid cells and spleen structure formation, we used prion protein-deficient (Prnp(0/0)) Zürich I mice generated by inactivation of the Prnp gene. Prnp(0/0) mice had decreased lymphocytes, in particular, CD4 T cells and lymphoid tissue inducer (LTi) cells. Decreased CD4 T cells resulted from impaired expression of CCL19 and CCL21 in the spleen rather than altered chemokine receptor CCR7 expression. Importantly, some of the white pulp regions in spleens from Prnp(0/0) mice displayed impaired T zone structure as a result of decreased LTi cell numbers and altered expression of the lymphoid tissue-organizing genes lymphotoxin-α and CXCR5, although expression of the lymphatic marker podoplanin and CXCL13 by stromal cells was not affected. In addition, CD3(-)CD4(+)IL-7Rα(+) LTi cells were rarely detected in impaired white pulp in spleens of these mice. These data suggest that the prion protein is required to form the splenic white pulp structure and for development of normal levels of CD4 T and LTi cells. Copyright © 2015. Published by Elsevier GmbH.

ALK7 Gene Polymorphism is Associated with Metabolic Syndrome Risk and Cardiovascular Remodeling

Energy Technology Data Exchange (ETDEWEB)

Zhang, Wenchao; Wang, Hui; Zhang, Wei [Key Laboratory of Cardiovascular Remodeling and Function Research Chinese Ministry of Education and Chinese Ministry of Public Health, Qilu Hospital of Shandong University, Jinan (China); Lv, Ruijuan [Department of Emergency, Qilu Hospital of Shandong University, Jinan (China); Wang, Zhihao [Key Laboratory of Cardiovascular Remodeling and Function Research Chinese Ministry of Education and Chinese Ministry of Public Health, Qilu Hospital of Shandong University, Jinan (China); Department of Geriatrics, Qilu Hospital of Shandong University, Jinan (China); Shang, Yuanyuan; Zhang, Yun; Zhong, Ming [Key Laboratory of Cardiovascular Remodeling and Function Research Chinese Ministry of Education and Chinese Ministry of Public Health, Qilu Hospital of Shandong University, Jinan (China); Chen, Yuguo; Tang, Mengxiong, E-mail: tangmengxiongsdu8@163.com [Key Laboratory of Cardiovascular Remodeling and Function Research Chinese Ministry of Education and Chinese Ministry of Public Health, Qilu Hospital of Shandong University, Jinan (China); Department of Emergency, Qilu Hospital of Shandong University, Jinan (China)

2013-08-15

Activin receptor-like kinase 7 (ALK7) is a type I receptor for the TGF-β superfamily and has recently been demonstrated to play an important role in the maintenance of metabolic homeostasis. To investigate the association of the ALK7 gene polymorphism with metabolic syndrome (MetS) and cardiovascular remodeling in MetS patients. The single nucleotide polymorphism rs13010956 in the ALK7 gene was genotyped in 351 Chinese subjects undergoing carotid and cardiac ultrasonography. The associations of the ALK7 gene polymorphism with the MetS phenotype, MetS parameters, and cardiovascular ultrasonic features were analyzed. The rs13010956 polymorphism in the ALK7 gene was found to be significantly associated with the MetS phenotype in females (p < 0.05) and was also significantly associated with blood pressure in the total (p < 0.05) and female populations (p < 0.01). Further analysis revealed that rs13010956 was associated with mean intima-media thickness of the carotid arteries in females (p < 0.05). After control for body mass index, blood pressure, fasting blood glucose, and triglycerides, rs13010956 was also found to be significantly associated with left ventricular mass index in the total (p < 0.05) and female populations (p < 0.05). Our findings suggested that the ALK7 gene polymorphism rs13010956 was significantly associated with MetS risk in females and may be involved in cardiovascular remodeling in MetS patients.

ALK7 Gene Polymorphism is Associated with Metabolic Syndrome Risk and Cardiovascular Remodeling

International Nuclear Information System (INIS)

Zhang, Wenchao; Wang, Hui; Zhang, Wei; Lv, Ruijuan; Wang, Zhihao; Shang, Yuanyuan; Zhang, Yun; Zhong, Ming; Chen, Yuguo; Tang, Mengxiong

2013-01-01

Activin receptor-like kinase 7 (ALK7) is a type I receptor for the TGF-β superfamily and has recently been demonstrated to play an important role in the maintenance of metabolic homeostasis. To investigate the association of the ALK7 gene polymorphism with metabolic syndrome (MetS) and cardiovascular remodeling in MetS patients. The single nucleotide polymorphism rs13010956 in the ALK7 gene was genotyped in 351 Chinese subjects undergoing carotid and cardiac ultrasonography. The associations of the ALK7 gene polymorphism with the MetS phenotype, MetS parameters, and cardiovascular ultrasonic features were analyzed. The rs13010956 polymorphism in the ALK7 gene was found to be significantly associated with the MetS phenotype in females (p < 0.05) and was also significantly associated with blood pressure in the total (p < 0.05) and female populations (p < 0.01). Further analysis revealed that rs13010956 was associated with mean intima-media thickness of the carotid arteries in females (p < 0.05). After control for body mass index, blood pressure, fasting blood glucose, and triglycerides, rs13010956 was also found to be significantly associated with left ventricular mass index in the total (p < 0.05) and female populations (p < 0.05). Our findings suggested that the ALK7 gene polymorphism rs13010956 was significantly associated with MetS risk in females and may be involved in cardiovascular remodeling in MetS patients

[CCR5, CCR2, apoe, p53, ITGB3 and HFE gene polymorphism in Western Siberia long-livers].

Science.gov (United States)

Ivanoshchuk, D E; Mikhaĭlova, S V; Kulikov, I V; Maksimov, V N; Voevoda, M I; Romashchenko, A G

2012-01-01

In order to estimate the distribution of some polymorphisms for the CCR5, CCR2, apoE, p53, ITGB3, and HFE genes in Russian long-livers from Western Siberia, a sample of 271 individuals (range 90-105 years) was examined. It was demonstrated that carriage of the delta32 polymorphism for the CCR5 gene, V64/polymorphism for the CCR2 gene, e2/e3/e4 for the apoE gene, L33P for the ITGB3 gene, as well as H63D and S65C polymorphisms for the HFE gene does not influence on predisposition to the longevity; carriage of the 282 Y allele for the HFE gene negatively influences on the longevity; carriage of the heterozygous genotype for the R72P polymorphism for the p53 gene correlates with the longevity of elderly people.

Association of oxidative stress gene polymorphisms with presbycusis.

Science.gov (United States)

Manche, Santoshi Kumari; Jangala, Madhavi; Putta, Padmavathi; Koralla, Raja Meganadh; Akka, Jyothy

2016-11-30

Presbycusis is characterised by etiopathological changes in the cochlea of the inner ear due to genetic and environmental factors and has a serious impact on quality of life. The present study was aimed to evaluate the role of oxidant stress gene polymorphisms in the development of presbycusis. 220 subjects with confirmed presbycusis from ENT specialists of MAA ENT hospital, Hyderabad, India from 2012 to 2014 were considered for the study. 270 age and sex matched controls were included in the study. Analysis of gene polymorphisms of SNPs cytochrome P450 1A1 (CYP1A1) 3801 T>C, 2455 A>G and 2453 A>C; glutathione S transferase (GST) T1 and M1; N-acetyl transferase (NAT2) 282 C>T and 857 G>A; uncoupled proteins (UCP1) (-3826) A>G and (UCP2) (866)G>A was carried out. Variations in the allelic and genotypic frequencies obtained were computed and analysed using appropriate statistical methods. The results of the study indicated that CYP1A1 gene polymorphism at 2453 C>A (adjusted OR: 1.59, 95% CI: 1.01-2.87) and 2455 A>G (adjusted OR: 1.87, 95% CI: 1.07-3.37), double null genotype of GSTM1 and GSTT1 (adjusted OR: 8.88, 95% CI: 4.10-19.19), NAT2 gene at C282T (adjusted OR: 1.77, 95% CI: 1.02-3.11) and G590 A (adjusted OR: 1.83, 95% CI 1.20-3.63) and UCP2 (-866) G>A (adjusted OR: 12.39; 95% CI: 6.51-23.56) showed increased risk for presbycusis while CYP1A1 at 3801 T>C and UCP1 (-3286) A>G exhibited no association. The haplotype combinations of T-G-A of CYP1A1 at 3801, 2455 and 2453 positions as well as T-A of NAT2*6 at 282 and 590 positions were found to contribute significant risk for the onset of presbycusis. Gene polymorphisms of CYP1A1 (A2455G, C2453A), NAT2*6 (C282T, G590 A), GST T1/M1 (double null genotype) and UCP2 (G-866 A) were found to contribute significant risk to presbycusis. Copyright © 2016 Elsevier B.V. All rights reserved.

The relation of serotonin-related gene and COMT gene polymorphisms with criminal behavior in schizophrenic disorder.

Science.gov (United States)

Koh, Kyung Bong; Choi, Eun Hee; Lee, Young-joon; Han, Mooyoung; Choi, Sang-Sup; Kim, So Won; Lee, Min Goo

2012-02-01

It has been suggested that patients with schizophrenia might be involved in criminal behavior, such as homicidal and violent behavior. However, the relationship between criminal behavior and genes in patients with schizophrenia has not been clearly elucidated. The objective of this study was to examine the relation between criminal behavior and serotonin-related gene or catechol-O-methyltransferase (COMT) gene polymorphisms in patients with schizophrenia. Serotonin-related and COMT polymorphic markers were assessed by using single nucleotide polymorphism (SNP) genotyping. Ninety-nine crime-related inpatients with schizophrenia (57 homicidal and 42 nonhomicidal violent) and 133 healthy subjects were enrolled between October 2005 and May 2008. Diagnoses were made according to the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV) criteria. The genotype frequencies of tryptophan hydroxylase-1 (TPH1) A218C and COMT V158M were compared between groups. The TPH1 CC genotype had 2.7-fold higher odds of crime-related schizophrenia compared with A-carrier genotype after the analysis was controlled for sex and age (OR, 2.69; 95% CI, 1.22 - 5.91; P = .01). In addition, the TPH1 CC genotype had 3.4-fold higher odds of homicidal schizophrenia compared with A-carrier genotype after the analysis was controlled for sex and age (OR, 3.38; 95% CI, 1.40 - 8.18; P = .007). However, no significant differences were found in the frequencies of genotype of COMT polymorphism between criminal schizophrenics and healthy subjects, nor were any significant differences found between nonhomicidal schizophrenics and healthy subjects. These results indicate that the TPH1 CC recessive genotype is likely to be a genetic risk factor for criminal behavior, especially homicidal behavior in patients with schizophrenia. However, COMT gene polymorphisms were not associated with criminal behavior in schizophrenic patients. © Copyright 2012 Physicians Postgraduate Press, Inc.

dPORE-miRNA: Polymorphic regulation of microRNA genes

KAUST Repository

Schmeier, Sebastian; Schaefer, Ulf; MacPherson, Cameron R.; Bajic, Vladimir B.

2011-01-01

Background: MicroRNAs (miRNAs) are short non-coding RNA molecules that act as post-transcriptional regulators and affect the regulation of protein-coding genes. Mostly transcribed by PolII, miRNA genes are regulated at the transcriptional level similarly to protein-coding genes. In this study we focus on human miRNAs. These miRNAs are involved in a variety of pathways and can affect many diseases. Our interest is on possible deregulation of the transcription initiation of the miRNA encoding genes, which is facilitated by variations in the genomic sequence of transcriptional control regions (promoters). Methodology: Our aim is to provide an online resource to facilitate the investigation of the potential effects of single nucleotide polymorphisms (SNPs) on miRNA gene regulation. We analyzed SNPs overlapped with predicted transcription factor binding sites (TFBSs) in promoters of miRNA genes. We also accounted for the creation of novel TFBSs due to polymorphisms not present in the reference genome. The resulting changes in the original TFBSs and potential creation of new TFBSs were incorporated into the Dragon Database of Polymorphic Regulation of miRNA genes (dPORE-miRNA). Conclusions: The dPORE-miRNA database enables researchers to explore potential effects of SNPs on the regulation of miRNAs. dPORE-miRNA can be interrogated with regards to: a/miRNAs (their targets, or involvement in diseases, or biological pathways), b/SNPs, or c/transcription factors. dPORE-miRNA can be accessed at http://cbrc.kaust.edu.sa/dpore and http://apps.sanbi.ac.za/dpore/. Its use is free for academic and non-profit users. © 2011 Schmeier et al.

dPORE-miRNA: Polymorphic regulation of microRNA genes

KAUST Repository

Schmeier, Sebastian

2011-02-04

Background: MicroRNAs (miRNAs) are short non-coding RNA molecules that act as post-transcriptional regulators and affect the regulation of protein-coding genes. Mostly transcribed by PolII, miRNA genes are regulated at the transcriptional level similarly to protein-coding genes. In this study we focus on human miRNAs. These miRNAs are involved in a variety of pathways and can affect many diseases. Our interest is on possible deregulation of the transcription initiation of the miRNA encoding genes, which is facilitated by variations in the genomic sequence of transcriptional control regions (promoters). Methodology: Our aim is to provide an online resource to facilitate the investigation of the potential effects of single nucleotide polymorphisms (SNPs) on miRNA gene regulation. We analyzed SNPs overlapped with predicted transcription factor binding sites (TFBSs) in promoters of miRNA genes. We also accounted for the creation of novel TFBSs due to polymorphisms not present in the reference genome. The resulting changes in the original TFBSs and potential creation of new TFBSs were incorporated into the Dragon Database of Polymorphic Regulation of miRNA genes (dPORE-miRNA). Conclusions: The dPORE-miRNA database enables researchers to explore potential effects of SNPs on the regulation of miRNAs. dPORE-miRNA can be interrogated with regards to: a/miRNAs (their targets, or involvement in diseases, or biological pathways), b/SNPs, or c/transcription factors. dPORE-miRNA can be accessed at http://cbrc.kaust.edu.sa/dpore and http://apps.sanbi.ac.za/dpore/. Its use is free for academic and non-profit users. © 2011 Schmeier et al.

The human prion diseases. A review with special emphasis on new variant CJD and comments on surveillance.

LENUS (Irish Health Repository)

Keohane, C

2012-02-03

The transmissible spongiform encephalopathies or prion diseases represent a new group of diseases with unique clinical and neuropathological features, the transmission of which is both genetic and infectious. The responsible agent is unconventional and appears to be largely composed of a glycoprotein, the prion protein PrP. This is normally present on different cells. In prion diseases, it becomes converted to the pathogenic form PrPres which is resistant to proteinase and accumulates within the brain and this process is accompanied by the development of spongiform change, gliosis and neuronal loss. The human prion diseases include Kuru a progressive cerebellar degeneration with late dementia affecting Fore tribes in New-Guinea, now almost extinct, regarded as being related to cannibalism. Creutzfeldt-Jakob disease is the more frequent human prion disease. Its incidence is approximately one case per million per year. Four variants are now recognized: sporadic, familial, iatrogenic and the new variant. The latter represents a distinct clinico-pathological entity. It is now widely accepted that it is due to the same agent responsible for Bovine Spongiform Encephalopathy in cattle. Gerstmann-Straussler-Scheinker disease is a very rare inherited disorder due to a number of different mutations in the PRP gene, characterized by abundant deposits of plaque PrPres in the cerebral grey matter. Fatal familial insomnia is another inherited disorder due to a mutation at codon 178 of the PRP gene associated with methionine on codon 129 of the mutant allele. The main neuropathological change is neuronal loss in the thalamus with little or no spongiosis and usually no PrPres deposition. Following the emergence of new variant CJD in 1996, surveillance of all forms of prion diseases has been now been actively introduced in many European nations in order to determine the true incidence and geographic distribution of these rare disorders in humans.

Prion-like domains in RNA binding proteins are essential for building subnuclear paraspeckles

NARCIS (Netherlands)

Hennig, Sven; Kong, Geraldine; Mannen, Taro; Sadowska, Agata; Kobelke, Simon; Blythe, Amanda; Knott, Gavin J; Iyer, K Swaminathan; Ho, Diwei; Newcombe, Estella A; Hosoki, Kana; Goshima, Naoki; Kawaguchi, Tetsuya; Hatters, Danny; Trinkle-Mulcahy, Laura; Hirose, Tetsuro; Bond, Charles S; Fox, Archa H

2015-01-01

Prion-like domains (PLDs) are low complexity sequences found in RNA binding proteins associated with the neurodegenerative disorder amyotrophic lateral sclerosis. Recently, PLDs have been implicated in mediating gene regulation via liquid-phase transitions that drive ribonucleoprotein granule

Prion protein and scrapie susceptibility

NARCIS (Netherlands)

Smits, M.A.; Bossers, A.; Schreuder, B.E.C.

1997-01-01

This article presents briefly current views on the role of prion protein (PrP) in Transmissible Spongiform Encephalopathies or prion diseases and the effect of PrP polymoryhisms on the susceptibility to these diseases, with special emphasis on sheep scrapie. The PrP genotype of sheep apears to be a

Association of IL-6 and MMP-3 gene polymorphisms with ...

Indian Academy of Sciences (India)

comprehensively and systematically performed this meta-analysis to detect whether the two gene polymorphisms are corre- .... control studies; (ii) 'failure to provide the genes' distribution details ..... biological activity of corresponding proteins such as IL-6 .... pathic scoliosis is related to inadequate calcium intake and weight.

Growth Hormone Gene Polymorphism in Two Iranian Native Fowls (Short Communication

Directory of Open Access Journals (Sweden)

Jafari A

1999-11-01

Full Text Available Biochemical polymorphism study is a method of determination of genetic variation. This variability could be a basis for selection and subsequent genetic improvement in farm animals. The polymorphism in the intron 1 of chicken growth hormone (cGH gene was investigated in the Iranian native fowls by using polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP method. The genomic DNA was extracted from 217 samples (129 samples from the native fowls of Isfahan province and 88 samples from the native fowls of Mazandaran province by using modified salting out technique. The DNA fragment of the growth hormone gene with 776 bp was amplified by PCR using specific primers. Then the PCR products were digested with MspI restriction enzyme and analyzed on 2.5% agarose gel. The allelic frequency of intron 1 locus for A1, A2 and A3 alleles in  Isfahan native fowls were 0.60, 0.21 and 0.19 and those in Mazandaran native  fowls were 0.28, 0.05 and 0.67, respectively. The results of current study indicated that the intron 1 of cGH is polymorphic in Iranian native fowls and could be exploited as a candidate gene for marker-assisted selection for growth-related traits.

Reduced response of splenocytes after mitogen-stimulation in the prion protein (PrP) gene-deficient mouse: PrPLP/Doppel production and cerebral degeneration

International Nuclear Information System (INIS)

Kim, Chi-Kyeong; Hirose, Yuko; Sakudo, Akikazu; Takeyama, Natsumi; Kang, Chung-Boo; Taniuchi, Yojiro; Matsumoto, Yoshitsugu; Itohara, Shigeyoshi; Sakaguchi, Suehiro; Onodera, Takashi

2007-01-01

Splenocytes of wild-type (Prnp +/+ ) and prion protein gene-deficient (Prnp -/- ) mice were treated with various activation stimuli such as T cell mitogen concanavalin A (ConA), phorbol 12-myristate 13-acetate (PMA) + ionomycin (Io), or B cell mitogen lipopolysaccharide (LPS). Cellular prion protein (PrP C ) expression was enhanced following ConA stimulation, but not PMA + Io or LPS in Prnp +/+ splenocytes. Rikn Prnp -/- splenocytes elicited lower cell proliferations than Prnp +/+ or Zrch I Prnp -/- splenocytes after LPS stimulation and showed sporadic nerve cells in the cerebral cortex and deeper structure. Around the degenerated nerve cells, mild vacuolation in the neuropil was observed. This neural alteration correlated well to the suppressed response of B cells in the spleen. The finding that discrete lesions within the central nervous systems induced marked modulation of immune function probably indicates the existence of a delicately balanced neural-endocrine network by PrP C and PrPLP/Doppel

Associations between STAT Gene Polymorphisms and Psoriasis in Northeastern China.

Science.gov (United States)

Zhou, Jing; Li, Yuzhen; Sun, Donglin

2017-01-01

Psoriasis is an autoimmune disease with genetic and environmental factors. Based on the roles of STATs (signaling transducers and activators of transcription) in autoimmune diseases, it is assumed STAT gene polymorphisms are associated with psoriasis. To study the association between STAT gene polymorphisms and psoriasis in the northeastern Chinese population. Eight single-nucleotide polymorphisms were genotyped: rs2293152, rs3816769, rs4796793, and rs744166 in STAT3, rs7574865 and rs3024866 in STAT4, and rs324011 and rs3024974 in STAT6, using SNaPshot methods. The genotype, allele, and haplotype frequencies were compared between 400 psoriasis patients and 398 healthy individuals in northeastern China. rs744166GG in STAT3 and rs7574865TT in STAT4 had higher frequencies in the case than the control group, suggesting these 2 genotypes increase the susceptibility to psoriasis (p < 0.05). Three haplotypes (H3, H6, and H7) were found to be associated with psoriasis in the study (p < 0.05). These results indicate a role of STAT genes in the pathogenesis of psoriasis. © 2017 S. Karger AG, Basel.

Extensive shared polymorphism at non-MHC immune genes in recently diverged North American prairie grouse

Science.gov (United States)

Minias, Piotr; Bateson, Zachary W.; Whittingham, Linda A.; Johnson, Jeff A.; Oyler-McCance, Sara J.; Dunn, Peter O.

2018-01-01

Gene polymorphisms shared between recently diverged species are thought to be widespread and most commonly reflect introgression from hybridization or retention of ancestral polymorphism through incomplete lineage sorting. Shared genetic diversity resulting from incomplete lineage sorting is usually maintained for a relatively short period of time, but under strong balancing selection it may persist for millions of years beyond species divergence (balanced trans-species polymorphism), as in the case of the major histocompatibility complex (MHC) genes. However, balancing selection is much less likely to act on non-MHC immune genes. The aim of this study was to investigate the patterns of shared polymorphism and selection at non-MHC immune genes in five grouse species from Centrocercus and Tympanuchus genera. For this purpose, we genotyped five non-MHC immune genes that do not interact directly with pathogens, but are involved in signaling and regulate immune cell growth. In contrast to previous studies with MHC, we found no evidence for balancing selection or balanced trans-species polymorphism among the non-MHC immune genes. No haplotypes were shared between genera and in most cases more similar allelic variants sorted by genus. Between species within genera, however, we found extensive shared polymorphism, which was most likely attributable to introgression or incomplete lineage sorting following recent divergence and large ancestral effective population size (i.e., weak genetic drift). Our study suggests that North American prairie grouse may have attained relatively low degree of reciprocal monophyly at nuclear loci and reinforces the rarity of balancing selection in non-MHC immune genes.

A meta-analysis of adiponectin gene rs22411766 T>G polymorphism and ischemic stroke susceptibility

Directory of Open Access Journals (Sweden)

Xiuju Chen

2016-01-01

Full Text Available Several studies have investigated the correlation between adiponectin gene rs22411766 T>G polymorphism and ischemic stroke risk. However, the results were not conclusive with each other. Therefore, to overcome this obstacle, we performed this meta-analysis to further explicate the adiponectin gene rs22411766 T>G polymorphism and ischemic stroke susceptibility. Case-control or cohort studies focused on adiponectin gene rs22411766 T>G polymorphism and ischemic stroke risk were electronic searched in the databases of Medline, Pubmed, Cochrane library, Excerpta Medica database(EMBASE and China National Knowledge Infrastructure (CNKI. All the potentially relevant studies were included in this meta-analysis. The association between adiponectin gene rs22411766 T>G polymorphism and ischemic stroke was expressed by odds ratio with its confidence interval. Publication bias has been assessed by begg’s funnel plot. All the analyses have been performed by Revman 5.1 statistical software. Finally, a total of six studies with 1,345 cases and 1,421 controls were included in this meta-analysis. Our results demonstrated that there was a significant association between adiponectin gene rs22411766 T>G polymorphism and ischemic stroke risk (p<0.05. People with G single nucleotide of adiponectin gene have the increased risk of developing ischemic stroke compared to T single nucleotide.

Prions in Variably Protease-Sensitive Prionopathy: An Update

NARCIS (Netherlands)

Zou, W.Q.; Gambetti, P.; Xiao, X.; Yuan, J.; Langeveld, J.P.M.; Pirisinu, L.

2013-01-01

Human prion diseases, including sporadic, familial, and acquired forms such as Creutzfeldt-Jakob disease (CJD), are caused by prions in which an abnormal prion protein (PrPSc) derived from its normal cellular isoform (PrPC) is the only known component. The recently-identified variably

A meta-analysis of eNOS and ACE gene polymorphisms and risk of pre-eclampsia in women.

Science.gov (United States)

Shaik, A P; Sultana, A; Bammidi, V K; Sampathirao, K; Jamil, K

2011-10-01

A meta-analyses of endothelial nitric oxide synthase (eNOS) and angiotensin-converting enzyme (ACE) gene polymorphisms in pre-eclampsia was performed. We shortlisted 33 studies (17 for ACE; 16 for eNOS gene polymorphisms), of which 29 articles (16 for ACE and 15 for eNOS) were analysed. Overall, 1,620 cases with pre-eclampsia and 2,158 controls were analysed for intron 16 insertion-deletion polymorphism in ACE gene. A total of 1,610 subjects with pre-eclampsia and 2,875 controls were analysed for the Glu298Asp in eNOS gene. Overall, the random-effects odds ratio (OR) with Glu298Asp in eNOS gene was 0.958 (95% confidence intervals, CI 0.747-1.228, p > 0.05), and for the insertion-deletion/ACE polymorphism was 0.987 (95% CI 0.698-1.395, p > 0.05). Significant heterogeneity was observed in the studies that evaluated polymorphisms in ACE (Q value = 55.6; I(2) = 73; p value = 0.000); and eNOS (Q value = 37.2; I(2) = 62.4; p value = 0.001) polymorphisms. No significant risk of pre-eclampsia was observed in both eNOS and ACE genes with these polymorphisms.

Polymorphism investigation of calpastatin gene in Zel sheep ...

African Journals Online (AJOL)

hosein

2012-02-14

Feb 14, 2012 ... Meat tenderness is an important quality characteristic for which consumers are interested. ... Key words: Calpastatin gene, polymorphism, Zel sheep, meat and polymerase chain reaction- ..... correlations for bovine postrigor calpastatin activity, intramuscular fat ... expression of the mRNA in skeletal muscle.

Cytokine Gene Polymorphisms in Egyptian Cases with Brain Tumors

International Nuclear Information System (INIS)

Badr El-Din, N.K.; Abdel-Hady, E.K.; Salem, F.K.; Settin, A.; ALI, N.

2009-01-01

Background: Cytokines are proposed to play important roles in brain tumor biology as well as neuro degeneration or impaired neuronal function. Objectives: This work aimed to check the association of polymorphisms of cytokine genes in Egyptian cases with brain tumors. Methods: This work included 45 cases affected by brain tumors diagnosed as 24 benign and 21 malignant. Their median age was 45 years, and they were 20 males and 25 females. These cases were taken randomly from the Neurosurgery Department of Mansoura University Hospital, Egypt. Case genotypes were compared to 98 healthy unrelated controls from the same locality. DNA was amplified using PCR utilizing sequence specific primers (SSP) for detection of polymorphisms related to TNF-a-308 (G/A), IL-10-1082 (G/A), IL-6-174 (G/C) and IL-1Ra (VNTR) genes. Results: Cases affected with benign brain tumors showed a significant higher frequency of IL-10-1082 A/A [odds ratio (OR=8.0), p<0.001] and IL-6-174 C/C (OR=6.3, p=0.002) homozygous genotypes as compared to controls. Malignant cases, on the other hand, showed significantly higher frequency of IL-6-174 C/C (OR =4.8, p=0.002) homozygous genotype and TNF-a-308 A/A (OR=4.9, p<0.001) homozygous genotype when compared to controls. In the meantime, all cases showed no significant difference regarding the distribution of IL-1Ra VNTR genotype polymorphism compared to controls. Conclusions: Cytokine gene polymorphisms showed a pattern of association with brain tumors which may have potential impact on family counseling and disease management.

Animal models for testing anti-prion drugs.

Science.gov (United States)

Fernández-Borges, Natalia; Elezgarai, Saioa R; Eraña, Hasier; Castilla, Joaquín

2013-01-01

Prion diseases belong to a group of fatal infectious diseases with no effective therapies available. Throughout the last 35 years, less than 50 different drugs have been tested in different experimental animal models without hopeful results. An important limitation when searching for new drugs is the existence of appropriate models of the disease. The three different possible origins of prion diseases require the existence of different animal models for testing anti-prion compounds. Wild type, over-expressing transgenic mice and other more sophisticated animal models have been used to evaluate a diversity of compounds which some of them were previously tested in different in vitro experimental models. The complexity of prion diseases will require more pre-screening studies, reliable sporadic (or spontaneous) animal models and accurate chemical modifications of the selected compounds before having an effective therapy against human prion diseases. This review is intended to put on display the more relevant animal models that have been used in the search of new antiprion therapies and describe some possible procedures when handling chemical compounds presumed to have anti-prion activity prior to testing them in animal models.

Relationship between IL-10 gene -819C/T polymorphism and the ...

African Journals Online (AJOL)

Background: The -819C/T polymorphism in interleukin 10 (IL-10) gene has been reported to be associated with inflammatory bowel disease (IBD) ,but the previous results are conflicting. Materials and methods: The present study aimed at investigating the association between this polymorphism and risk of IBD using a ...

Matrix metalloproteinase gene polymorphisms in patients with coronary artery disease

Directory of Open Access Journals (Sweden)

Vanessa L.N. Dalepiane

2007-01-01

Full Text Available Matrix metalloproteinases (MMPs play an important role in the pathogenesis of atherosclerosis, the pathology underlying the majority of coronary artery disease (CAD. In this study we tested the hypothesis that polymorphic variation in the MMP genes influences the risk of developing atherosclerosis. We analyzed functional polymorphisms in the promoter of the MMP-1, MMP-3, MMP-9 and MMP-12 genes in 183 Brazilian Caucasian individuals submitted to coronary angiography, of which 67 (37% had normal coronary arteries (control group and 116 (63% had CAD (CAD patient group. The -1607 1G/2G MMP-1, -1171 5A/6A MMP-3, -1562 C/T MMP-9, -82 A/G MMP-12 polymorphisms were analyzed by PCR followed by restriction digestion. No significant differences were observed in allele frequencies between the CAD patients and controls. Haplotype analysis showed no differences between the CAD patients and controls. There was a significant difference in the severity of CAD, as assessed by the number of diseased vessels, in MMP-1 1G/1G homozygous individuals and in those homozygous for the 6A allele of the MMP-3 polymorphism. However, multivariate analysis showed that diabetes mellitus was the only variable independently associated with CAD severity. Our findings indicated that MMP polymorphisms have no significant impact on the risk and severity of CAD.

New insights into structural determinants of prion protein folding and stability.

Science.gov (United States)

Benetti, Federico; Legname, Giuseppe

2015-01-01

Prions are the etiological agent of fatal neurodegenerative diseases called prion diseases or transmissible spongiform encephalopathies. These maladies can be sporadic, genetic or infectious disorders. Prions are due to post-translational modifications of the cellular prion protein leading to the formation of a β-sheet enriched conformer with altered biochemical properties. The molecular events causing prion formation in sporadic prion diseases are still elusive. Recently, we published a research elucidating the contribution of major structural determinants and environmental factors in prion protein folding and stability. Our study highlighted the crucial role of octarepeats in stabilizing prion protein; the presence of a highly enthalpically stable intermediate state in prion-susceptible species; and the role of disulfide bridge in preserving native fold thus avoiding the misfolding to a β-sheet enriched isoform. Taking advantage from these findings, in this work we present new insights into structural determinants of prion protein folding and stability.

The (CTGn polymorphism in the NOTCH4 gene is not associated with schizophrenia in Japanese individuals

Directory of Open Access Journals (Sweden)

Okubo Takehito

2001-06-01

Full Text Available Abstract Background The human NOTCH4 gene is a candidate gene for schizophrenia due to its chromosomal location and neurobiological roles. In a British linkage study, NOTCH4 gene polymorphisms were highly associated with schizophrenia. In a Japanese case-control association study, however, these polymorphisms did not show significant associations with schizophrenia. We conducted a case-control study with Japanese subjects to explore an association between the triplet repeat polymorphism in the NOTCH4 gene and schizophrenia, including subtypes of schizophrenia, longitudinal disease course characteristics, and a positive family history for psychoses. Methods We examined the (CTGn repeat polymorphism in the NOTCH4 gene among 100 healthy Japanese individuals and 102 patients with schizophrenia (22 paranoid, 38 disorganized, 29 residual, 64 episodic, 31 continuous, 42 with prominent negative symptoms, and 46 with positive family histories using a polymerase chain reaction-based, single-strand conformational polymorphism analysis. Results Five different alleles consisting of 6, 9, 10, 11, and 13 repeats of CTG (Leu in patients with schizophrenia, and 4 alleles consisting of 6, 9, 10, and 11 repeats in controls were found. No significant differences in genotype or allele frequencies of repeat numbers were found between controls and patients. In addition, there were no associations between the polymorphism and schizophrenia subtypes, longitudinal disease course characteristics, or positive family history of the patients. Conclusions Our data suggest a lack of association between the NOTCH4 gene triplet repeat polymorphism and schizophrenia in Japanese individuals.

Polymorphisms within the FANCA gene associate with premature ovarian failure in Korean women.

Science.gov (United States)

Pyun, Jung-A; Kim, Sunshin; Cha, Dong Hyun; Kwack, KyuBum

2014-05-01

This study investigated whether polymorphisms within the Fanconi anemia complementation group A (FANCA) gene contribute to the increased risk of premature ovarian failure (POF) in Korean women. Ninety-eight women with POF and 218 controls participated in this study. Genomic DNA from peripheral blood was isolated, and GoldenGate genotyping assay was used to identify single nucleotide polymorphisms (SNPs) within the FANCA gene. Two significant SNPs (rs1006547 and rs2239359; P FANCA gene may increase the risk for POF in Korean women.

A Neuronal Culture System to Detect Prion Synaptotoxicity.

Directory of Open Access Journals (Sweden)

Cheng Fang

2016-05-01

Full Text Available Synaptic pathology is an early feature of prion as well as other neurodegenerative diseases. Although the self-templating process by which prions propagate is well established, the mechanisms by which prions cause synaptotoxicity are poorly understood, due largely to the absence of experimentally tractable cell culture models. Here, we report that exposure of cultured hippocampal neurons to PrPSc, the infectious isoform of the prion protein, results in rapid retraction of dendritic spines. This effect is entirely dependent on expression of the cellular prion protein, PrPC, by target neurons, and on the presence of a nine-amino acid, polybasic region at the N-terminus of the PrPC molecule. Both protease-resistant and protease-sensitive forms of PrPSc cause dendritic loss. This system provides new insights into the mechanisms responsible for prion neurotoxicity, and it provides a platform for characterizing different pathogenic forms of PrPSc and testing potential therapeutic agents.

Polymorphism in leptin receptor gene was associated with obesity in ...

African Journals Online (AJOL)

The mutation in leptin receptor (LEPR) gene causes splicing abnormality that resulted in truncated receptor, aberrant signal transduction, leptin resistance, and obesity. This study aims to determine the association of LEPR gene polymorphisms, rs1137100 and rs1137101, on phenotype and leptin level between obese and ...

Codon 201Gly Polymorphic Type of the DCC Gene is Related to Disseminated Neuroblastoma

Directory of Open Access Journals (Sweden)

Xiao-Tang Kong

2001-01-01

Full Text Available The deleted in colorectal carcinoma (DCC gene is a potential tumor- suppressor gene on chromosome 18821.3. The relatively high frequency of loss of heterozygosity (LOH and loss of expression of this gene in neuroblastoma, especially in the advanced stages, imply the possibility of involvement of the DCC gene in progression of neuroblastoma. However, only few typical mutations have been identified in this gene, indicating that other possible mechanisms for the inactivation of this gene may exist. A polymorphic change (Arg to Gly at DCC codon 201 is related to advanced colorectal carcinoma and increases in the tumors with absent DCC protein expression. In order to understand whether this change is associated with the development or progression of neuroblastoma, we investigated codon 201 polymorphism of the DCC gene in 102 primary neuroblastomas by polymerase chain reaction single-strand conformation polymorphism. We found no missense or nonsense mutations, but a polymorphic change from CGA (Arg to GGA (Gly at codon 201 resulting in three types of polymorphism: codon 201Gly type, codon 201Arg/Gly type, and codon 201Arg type. The codon 201Gly type occurred more frequently in disseminated (stages IV and IVs neuroblastomas (72% than in localized (stages I, II, and III tumors (48% (P=.035, and normal controls (38% (P=.024. In addition, the codon 201Gly type was significantly more common in tumors found clinically (65% than in those found by mass screening (35% (P=.002. The results suggested that the codon 201Gly type of the DCC gene might be associated with a higher risk of disseminating neuroblastoma.

Fungal prion HET-s as a model for structural complexity and self-propagation in prions.

Science.gov (United States)

Wan, William; Stubbs, Gerald

2014-04-08

The highly ordered and reproducible structure of the fungal prion HET-s makes it an excellent model system for studying the inherent properties of prions, self-propagating infectious proteins that have been implicated in a number of fatal diseases. In particular, the HET-s prion-forming domain readily folds into a relatively complex two-rung β-solenoid amyloid. The faithful self-propagation of this fold involves a diverse array of inter- and intramolecular structural features. These features include a long flexible loop connecting the two rungs, buried polar residues, salt bridges, and asparagine ladders. We have used site-directed mutagenesis and X-ray fiber diffraction to probe the relative importance of these features for the formation of β-solenoid structure, as well as the cumulative effects of multiple mutations. Using fibrillization kinetics and chemical stability assays, we have determined the biophysical effects of our mutations on the assembly and stability of the prion-forming domain. We have found that a diversity of structural features provides a level of redundancy that allows robust folding and stability even in the face of significant sequence alterations and suboptimal environmental conditions. Our findings provide fundamental insights into the structural interactions necessary for self-propagation. Propagation of prion structure seems to require an obligatory level of complexity that may not be reproducible in short peptide models.

Interleukin gene polymorphisms in Chinese Han population with breast cancer, a case-control study.

Science.gov (United States)

Zuo, Xiaoxiao; Li, Miao; Yang, Ya; Liang, Tiansong; Yang, Hongyao; Zhao, Xinhan; Yang, Daoke

2018-04-06

Cytokines are known as important regulators of the cancer involved in inflammatory and immunological responses. This fact and plethora of gene polymorphism data prompted us to investigate IL1 gene polymorphisms in breast cancer (BC) patients. Totally, 530 patients with BC and 628 healthy control women were studied. The genetic polymorphisms for IL1 were analyzed by Massarray Sequencing method. Three single nucleotide polymorphisms (SNPs) identified in IL1B, IL1R1 gene are thought to influence breast cancer risk. The results of the association between IL-1B, IL1R1 polymorphisms and breast cancer risk have significant. We found that the variant TT genotype of rs10490571 was associated with a significantly increased breast cancer risk (TT vs. CC: OR = 2.82, 95% CI = 1.12-7.08, P = 0.047 for the codominant model). For rs16944 (AG vs. GG: OR = 0.60, 95% CI = 0.41-0.90, P = 0.034 for the codominant model) and rs1143623 (CG vs. CC: OR = 0.65, 95% CI = 0.45-0.94, P = 0.023 for the codominant model) have significant associations were found in genetic models. In conclusion, the present analysis suggests a correlation of polymorphic markers within the IL-1 gene locus with the risk in developing breast cancer. Taken together with our finding that IL1B, IL1R1 gene three SNP are also associated with the risk for the disease, we suggest that inflammation via innate and adaptive immunity contributes to multifactorial hereditary predisposition to pathogenesis of the breast cancer.

Effects of bovine prolactin gene polymorphism within exon 4 on milk ...

African Journals Online (AJOL)

In this study, polymorphism of prolactin gene was analyzed as a candidate gene responsible for variation and genetic trends in milk yield and composition traits. Genomic DNAs were extracted from 268 semen samples belonged to Iranian Holstein bulls. Genotyping for the prolactin gene using PCRRFLP technique and RsaI ...

Disturbed vesicular trafficking of membrane proteins in prion disease.

Science.gov (United States)

Uchiyama, Keiji; Miyata, Hironori; Sakaguchi, Suehiro

2013-01-01

The pathogenic mechanism of prion diseases remains unknown. We recently reported that prion infection disturbs post-Golgi trafficking of certain types of membrane proteins to the cell surface, resulting in reduced surface expression of membrane proteins and abrogating the signal from the proteins. The surface expression of the membrane proteins was reduced in the brains of mice inoculated with prions, well before abnormal symptoms became evident. Prions or pathogenic prion proteins were mainly detected in endosomal compartments, being particularly abundant in recycling endosomes. Some newly synthesized membrane proteins are delivered to the surface from the Golgi apparatus through recycling endosomes, and some endocytosed membrane proteins are delivered back to the surface through recycling endosomes. These results suggest that prions might cause neuronal dysfunctions and cell loss by disturbing post-Golgi trafficking of membrane proteins via accumulation in recycling endosomes. Interestingly, it was recently shown that delivery of a calcium channel protein to the cell surface was impaired and its function was abrogated in a mouse model of hereditary prion disease. Taken together, these results suggest that impaired delivery of membrane proteins to the cell surface is a common pathogenic event in acquired and hereditary prion diseases.

Chronic wasting disease prion infection of differentiated neurospheres.

Science.gov (United States)

Iwamaru, Yoshifumi; Mathiason, Candace K; Telling, Glenn C; Hoover, Edward A

2017-07-04

A possible strategy to develop more diverse cell culture systems permissive to infection with naturally occurring prions is to exploit culture of neurospheres from transgenic mice expressing the normal prion protein (PrP) of the native host species. Accordingly, we developed differentiated neurosphere cultures from the cervid PrP-expressing mice to investigate whether this in vitro system would support replication of non-adapted cervid-origin chronic wasting disease (CWD) prions. Here we report the successful amplification of disease-associated PrP in differentiated neurosphere cultures within 3 weeks after exposure to CWD prions from both white-tailed deer or elk. This neurosphere culture system provides a new in vitro tool that can be used to assess non-adapted CWD prion propagation and transmission.

Prion search and cellular prion protein expression in stranded dolphins.

Science.gov (United States)

Di Guardo, G; Cocumelli, C; Meoli, R; Barbaro, K; Terracciano, G; Di Francesco, C E; Mazzariol, S; Eleni, C

2012-01-01

The recent description of a prion disease (PD) case in a free-ranging bottlenose dolphin (Tursiops truncatus) prompted us to carry out an extensive search for the disease-associated isoform (PrPSc) of the cellular prion protein (PrPC) in the brain and in a range of lymphoid tissues from 23 striped dolphins (Stenella coeruleoalba), 5 bottlenose dolphins and 2 Risso s dolphins (Grampus griseus) found stranded between 2007 and 2012 along the Italian coastline. Three striped dolphins and one bottlenose dolphin showed microscopic lesions of encephalitis, with no evidence of spongiform brain lesions being detected in any of the 30 free-ranging cetaceans investigated herein. Nevertheless, we could still observe a prominent PrPC immunoreactivity in the brain as well as in lymphoid tissues from these dolphins. Although immunohistochemical and Western blot investigations yielded negative results for PrPSc deposition in all tissues from the dolphins under study, the reported occurrence of a spontaneous PD case in a wild dolphin is an intriguing issue and a matter of concern for both prion biology and intra/inter-species transmissibility, as well as for cetacean conservation medicine.

Prion Replication Elicits Cytopathic Changes in Differentiated Neurosphere Cultures

Science.gov (United States)

Iwamaru, Yoshifumi; Takenouchi, Takato; Imamura, Morikazu; Shimizu, Yoshihisa; Miyazawa, Kohtaro; Mohri, Shirou; Yokoyama, Takashi

2013-01-01

The molecular mechanisms of prion-induced cytotoxicity remain largely obscure. Currently, only a few cell culture models have exhibited the cytopathic changes associated with prion infection. In this study, we introduced a cell culture model based on differentiated neurosphere cultures isolated from the brains of neonatal prion protein (PrP)-null mice and transgenic mice expressing murine PrP (dNP0 and dNP20 cultures). Upon exposure to mouse Chandler prions, dNP20 cultures supported the de novo formation of abnormal PrP and the resulting infectivity, as assessed by bioassays. Furthermore, this culture was susceptible to various prion strains, including mouse-adapted scrapie, bovine spongiform encephalopathy, and Gerstmann-Sträussler-Scheinker syndrome prions. Importantly, a subset of the cells in the infected culture that was mainly composed of astrocyte lineage cells consistently displayed late-occurring, progressive signs of cytotoxicity as evidenced by morphological alterations, decreased cell viability, and increased lactate dehydrogenase release. These signs of cytotoxicity were not observed in infected dNP0 cultures, suggesting the requirement of endogenous PrP expression for prion-induced cytotoxicity. Degenerated cells positive for glial fibrillary acidic protein accumulated abnormal PrP and exhibited features of apoptotic death as assessed by active caspase-3 and terminal deoxynucleotidyltransferase nick-end staining. Furthermore, caspase inhibition provided partial protection from prion-mediated cell death. These results suggest that differentiated neurosphere cultures can provide an in vitro bioassay for mouse prions and permit the study of the molecular basis for prion-induced cytotoxicity at the cellular level. PMID:23740992

Rapid antemortem detection of CWD prions in deer saliva.

Directory of Open Access Journals (Sweden)

Davin M Henderson

Full Text Available Chronic wasting disease (CWD is an efficiently transmitted prion disease of cervids, now identified in 22 United States, 2 Canadian provinces and Korea. One hallmark of CWD is the shedding of infectious prions in saliva, as demonstrated by bioassay in deer. It is also clear that the concentration of prions in saliva, blood, urine and feces is much lower than in the nervous system or lymphoid tissues. Rapid in vitro detection of CWD (and other prions in body fluids and excreta has been problematic due to the sensitivity limits of direct assays (western blotting, ELISA and the presence of inhibitors in these complex biological materials that hamper detection. Here we use real-time quaking induced conversion (RT-QuIC to demonstrate CWD prions in both diluted and prion-enriched saliva samples from asymptomatic and symptomatic white-tailed deer. CWD prions were detected in 14 of 24 (58.3% diluted saliva samples from CWD-exposed white-tailed deer, including 9 of 14 asymptomatic animals (64.2%. In addition, a phosphotungstic acid enrichment enhanced the RT-QuIC assay sensitivity, enabling detection in 19 of 24 (79.1% of the above saliva samples. Bioassay in Tg[CerPrP] mice confirmed the presence of infectious prions in 2 of 2 RT-QuIC-positive saliva samples so examined. The modified RT-QuIC analysis described represents a non-invasive, rapid ante-mortem detection of prions in complex biologic fluids, excreta, or environmental samples as well as a tool for exploring prion trafficking, peripheralization, and dissemination.

Genetic association between polymorphism of mdm2 gene and symptoms and pathological types of NSCLC

International Nuclear Information System (INIS)

Liu Xiaolan; Wang Weili; Zhang Xueying; Hao Ming; Liu Linlin; Wu Zhenfeng; Jiang Hongwei

2008-01-01

Objective: To investigate the genetic association between polymorphism of mdm2 gene and symptoms and pathological types of non-small cell lung cancer (NSCLC). Methods: Polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) was used to identify mdm2 genotypes. The Pearson Chi square test and Woolf statistic method were used to analyze the relative risk and 95% confidence interval (CI) in order to find the genetic association between polymorphism of mdm2 gene and symptoms and pathological types of NSCLC. Results: In the SNP rs1196337 (a G to A base change) AA genotype showed association with cough of NSCLC (P<0.05). Conclusion: The polymorphism of mdm2 gene may be associated with symptom as cough of NSCLC. (authors)

Influence of leukotriene gene polymorphisms on chronic rhinosinusitis

Directory of Open Access Journals (Sweden)

Duval Melanie

2008-03-01

Full Text Available Abstract Background Chronic rhinosinusitis (CRS is increasingly viewed as an inflammatory condition of the sinonasal mucosa interacting with bacteria and/or fungi. However, factors conferring susceptibility to disease remain unknown. Advances in genomics offer powerful tools to explore this disorder. The goal of this study was to evaluate the effect of single nucleotide polymorphisms (SNP on CRS in a panel of genes related to cysteinyl leukotriene metabolism. Methods Severe cases of CRS and postal code match controls were recruited prospectively. A total of 206 cases and 200 controls were available for the present study. Using a candidate gene approach, five genes related to cysteinyl leukotriene metabolism were assessed. For each gene, we selected the maximally informative set of common SNPs (tagSNPs using the European-derived (CEU HapMap dataset. These SNPs are in arachidonate 5-lipoxygenase (ALOX5, arachidonate 5-lipoxygenase-activating protein (ALOX5AP, leukotriene C4 synthase (LTC4S, cysteinyl leukotriene receptor 1 (CYSLTR1 and cysteinyl leukotriene receptor 2 (CYSLTR2 genes. Results A total of 59 SNPs were genotyped to capture the common genetic variations within these genes. Three SNPs located within the ALOX5, CYSLTR1 and ALOX5AP genes reached the nominal p-value threshold (p Conclusion While these initial results do not support that polymorphsims in genes assessed involved in the leukotriene pathways are contributing to the pathogenesis of CRS, this initial study was not powered to detect polymorphisms with relative risk of 2.0 or less, where we could expect many gene effects for complex diseases to occur. Thus, despite this lack of significant association noted in this study, we believe that validation with external populations and the use of better-powered studies in the future may allow more conclusive findings.

Multidrug resistance 1 gene polymorphisms may determine Crohn's disease behavior in patients from Rio de Janeiro

Directory of Open Access Journals (Sweden)

Ana Teresa P. Carvalho

2014-01-01

Full Text Available OBJECTIVES: Conflicting data from studies on the potential role of multidrug resistance 1 gene polymorphisms in inflammatory bowel disease may result from the analysis of genetically and geographically distinct populations. Here, we investigated whether multidrug resistance 1 gene polymorphisms are associated with inflammatory bowel diseases in patients from Rio de Janeiro. METHODS: We analyzed 123 Crohn's disease patients and 83 ulcerative colitis patients to determine the presence of the multidrug resistance 1 gene polymorphisms C1236T, G2677T and C3435T. In particular, the genotype frequencies of Crohn's disease and ulcerative colitis patients were analyzed. Genotype-phenotype associations with major clinical characteristics were established, and estimated risks were calculated for the mutations. RESULTS: No significant difference was observed in the genotype frequencies of the multidrug resistance 1 G2677T/A and C3435T polymorphisms between Crohn's disease and ulcerative colitis patients. In contrast, the C1236T polymorphism was significantly more common in Crohn's disease than in ulcerative colitis (p = 0.047. A significant association was also found between the multidrug resistance 1 C3435T polymorphism and the stricturing form of Crohn's disease (OR: 4.13; p = 0.009, whereas no association was found with penetrating behavior (OR: 0.33; p = 0.094. In Crohn's disease, a positive association was also found between the C3435T polymorphism and corticosteroid resistance/refractoriness (OR: 4.14; p = 0.010. However, no significant association was found between multidrug resistance 1 gene polymorphisms and UC subphenotypic categories. CONCLUSION: The multidrug resistance 1 gene polymorphism C3435T is associated with the stricturing phenotype and an inappropriate response to therapy in Crohn's disease. This association with Crohn's disease may support additional pathogenic roles for the multidrug resistance 1 gene in regulating gut

Genetic polymorphisms at the leptin receptor gene in three beef cattle breeds

Directory of Open Access Journals (Sweden)

Sabrina E.M. Almeida

2008-01-01

Full Text Available The genetic diversity of a single nucleotide polymorphism (SNP at the exon 20 (T945M of the leptin receptor gene (LEPR and of three short tandem repeats (STRs BM7225, BMS694, and BMS2145 linked to LEPR was investigated in three beef cattle herds (Brangus Ibagé, Charolais, and Aberdeen Angus. A cheap and effective new method to analyze the T945M polymorphism in cattle populations was developed and the possible role of these polymorphisms in reproduction and weight gain of postpartum cows was evaluated. High levels of genetic diversity were observed with the average heterozygosity of STRs ranging from 0.71 to 0.81. No significant association was detected between LEPR markers and reproductive parameters or daily weight gain. These negative results suggest that the LEPR gene polymorphisms, at least those herein described, do not influence postpartum cows production.

Ghrelin gene polymorphisms in rheumatoid arthritis.

Science.gov (United States)

Ozgen, Metin; Koca, Suleyman Serdar; Etem, Ebru Onalan; Yuce, Huseyin; Aydin, Suleyman; Isik, Ahmet

2011-07-01

Ghrelin, an endogenous orexigenic peptide, has anti-inflammatory effects, down-regulates pro-inflammatory cytokines, and its altered levels are reported in various inflammatory diseases. The human preproghrelin (ghrelin/obestatin) gene shows several single nucleotide polymorphisms (SNPs) including Arg51Gln, Leu72Met, Gln90Leu, and A-501C. The aim of this study was to investigate the frequency, and clinical significance, of these four SNPs in a small cohort of Turkish patients with rheumatoid arthritis (RA). The study included 103 patients with RA and 103 healthy controls. In the RA group, disease activity and disease-related damage were assessed using the Disease Activity Score-28 (DAS-28), and the modified Larsen scoring (MLS) methods. In all the participants, genomic DNA was isolated and genotyped by polymerase chain reaction and restriction fragment length polymorphism analysis. The frequencies of ghrelin gene SNPs were 82.5 and 79.6% in the RA and control groups, respectively, and there were no significant differences in terms of genotype distributions and allele frequencies for these four SNPs between the groups. However, the A-501C SNP was found to be associated with early disease onset, and Gln90Leu SNP with less frequent rheumatoid factor positivity, in the RA group. A-501C SNP is associated with earlier onset of RA suggesting that genetic variations in the ghrelin gene may have an impact on RA. Copyright © 2010 Société française de rhumatologie. Published by Elsevier SAS. All rights reserved.

Relationship of interleukin-1B gene promoter region polymorphism with Helicobacter pylori infection and gastritis.

Science.gov (United States)

Ramis, Ivy Bastos; Vianna, Júlia Silveira; Halicki, Priscila Cristina Bartolomeu; Lara, Caroline; Tadiotto, Thássia Fernanda; da Silva Maciel, João Batista; Gonçalves, Carla Vitola; von Groll, Andrea; Dellagostin, Odir Antônio; da Silva, Pedro Eduardo Almeida

2015-09-29

Helicobacter pylori infection is associated with gastritis, peptic ulcer disease and gastric carcinoma. The severity of damage is determined by the interplay between environmental/behavioral factors, bacterial pathogenicity genes and host genetic polymorphisms that can influence the secretion levels of inflammatory cytokines. Accordingly, this study aimed to identify polymorphisms in the IL-1B and IL-1RN genes and their associations with H. pylori infection, cagA gene of H. pylori, and gastroduodenal diseases. Gastric biopsy samples from 151 patients infected with H. pylori and 76 uninfected individuals were analyzed. H. pylori infection was diagnosed by histology and PCR. Polymorphisms at positions -511, -31 and +3954 of the IL-1B gene were detected by PCR-RFLP, and an analysis of the VNTR polymorphism of the IL-1RN gene was performed by PCR. It was observed that the presence of the T/T genotype at position -511 and the C/C genotype at position -31 were associated with H. pylori infection and with an increased risk of gastritis in H. pylori-positive patients. Additionally, strains from patients H. pylori-positive carrying the cagA gene was significantly related with the T/T genotype at position -511 of IL-1B.  No association of polymorphisms at position +3954 of IL-1B and in the IL-1RN with H. pylori infection and with risk of severe gastric diseases was found. We demonstrated that polymorphisms in the promoter region of the IL-1B gene (at positions -511 and -31) are associated with an enhanced risk of H. pylori infection as well as gastritis in H. pylori-positive patients.

Transgenic Fatal Familial Insomnia Mice Indicate Prion Infectivity-Independent Mechanisms of Pathogenesis and Phenotypic Expression of Disease

OpenAIRE

Bouybayoune, I.; Mantovani, S.; Del Gallo, F.; Bertani, I.; Restelli, E.; Comerio, L.; Tapella, L.; Baracchi, F.; Fernández-Borges, N.; Mangieri, M.; Bisighini, C.; Beznoussenko, G..V.; Paladini, A.; Balducci, C.; Micotti, E.

2015-01-01

Author Summary Genetic prion diseases are degenerative brain disorders caused by mutations in the gene encoding the prion protein (PrP). Different PrP mutations cause different diseases, including Creutzfeldt-Jakob disease (CJD) and fatal familial insomnia (FFI). The reason for this variability is not known, but assembly of the mutant PrPs into distinct aggregates that spread in the brain by promoting PrP aggregation may contribute to the disease phenotype. We previously generated transgenic ...

Association study of interferon gamma (IFN-γ) +874T/A gene polymorphism in patients with paranoid schizophrenia.

Science.gov (United States)

Paul-Samojedny, Monika; Owczarek, Aleksander; Suchanek, Renata; Kowalczyk, Malgorzata; Fila-Danilow, Anna; Borkowska, Paulina; Kucia, Krzysztof; Kowalski, Jan

2011-03-01

Schizophrenia is a multifactorial disease with changes affecting the immune system. Dysregulation of the cytokine network in schizophrenia has been well documented. Such changes may occur due to disturbances in cytokine levels that are linked to polymorphisms of cytokine genes. However, research in the role of cytokine gene polymorphisms in schizophrenia has been surprisingly scanty. The aim of this study was to identify, in a case control study, whether polymorphism of IFN-γ gene is a risk factor for the development of paranoid schizophrenia. To the best of our knowledge, this is the first study that examines the association between the IFN-γ gene polymorphism and psychopathological symptoms in patients with paranoid schizophrenia. Polymorphism of IFN-γ (+874T/A, rs 62559044) in schizophrenic patients (n=179), as well as healthy individuals (n=196), both Polish residents, was genotyped using AS-PCR method. Of note, when analyzing the results, we took into consideration the gender of studied individuals. Surprisingly, a single-nucleotide polymorphism in the first intron of the IFN-γ gene was found to be associated with paranoid schizophrenia in males, but not in females. The presence of allele A at position +874 in the IFN-γ gene correlates with 1.66-fold higher risk of paranoid schizophrenia development in males. Differences in the genotypes may have an important role in determining the level of I gene transcription. Because other polymorphisms have been demonstrated to influence IFN-γ transcription, further analysis is necessary to clarify the role of this gene in the pathogenesis of paranoid schizophrenia.

FEATURES OF THE CLINICAL SIGNIFICANCE OF POLYMORPHIC VARIANTS OF ENOS AND AGTR2 GENES IN PATIENTS WITH CAD

Directory of Open Access Journals (Sweden)

A. L. Khokhlov

2016-01-01

Full Text Available Coronary heart disease (CHD is a major cause of mortality. Morphological substrate of CHD in most cases is atherosclerosis, which is based on structural genes polymorphism eNOS and AGTR2. The aim of the study was to study the prevalence of eNOS and AGTR2 genes in patients with coronary artery disease and the association of these genes with coronary heart disease. The study involved 187 patients aged 36 to 86 years (62,2±11,2 with different forms of CHD: stable and unstable angina, myocardial infarction and 45 people without CHD. Determination of gene polymorphisms was performed by real-time PCR analyzer of nucleic acids IQ 5 Bio-Rad. Statistical analysis was performed using Statistica 10.0. The study revealed a significant difference between the incidence of homozygous AA allelic variant gene AGTR2 group of patients with myocardial infarction and the comparison group; polymorphic variant AA AGTR2 gene is associated with earlier onset of coronary artery disease; It found that carriers of the polymorphic variant gene GA AGTR2 beginning statistically CHD occurred significantly later than in carriers of alleles GG and AA; age CHD debut TT allele carriers of the eNOS gene is associated with an earlier onset of the disease and statistically significantly different from the age of first CHD in carriers of alleles of polymorphic variants of GG and GT; revealed a positive correlation between the polymorphic allele AGTR2 gene with the presence of arterial hypertension in patients with coronary artery disease; It determined that the T allele carriers of the polymorphic gene eNOS is associated more early onset of hypertension, found the association of the polymorphic allele gene AGTR2 the need to use higher doses of ACE inhibitor — perindopril.

Interleukin Gene Polymorphisms and Susceptibility to HIV Infection

Indian Academy of Sciences (India)

Chrysa

vaccines, and with almost 36.7 million HIV-infected individuals worldwide .... The allelic and genotypic distribution of the IL genes SNPs are presented in .... polymorphism using the genetic model-free bivariate approach produced, as in ... Through its immuno-inhibitory and anti-inflammatory activities and, in particular, by.

[Aldose reductase gene polymorphism and rate of appearance of retinopathy in non insulin dependent diabetics].

Science.gov (United States)

Olmos, P; Acosta, A M; Schiaffino, R; Díaz, R; Alvarado, D; O'Brien, A; Muñoz, X; Arriagada, P; Claro, J C; Vega, R; Vollrath, V; Velasco, S; Emmerich, M; Maiz, A

1999-04-01

Recent studies suggest that polymorphisms associated to the aldose reductase gene could be related to early retinopathy in noninsulin dependent diabetics (NIDDM). There is also new interest on the genetic modulation of coagulation factors in relation to this complication. To look for a possible relationship between the rate of appearance of retinopathy and the genotype of (AC)n polymorphic marker associated to aldose reductase gene. A random sample of 27 NIDDM, aged 68.1 +/- 10.6 years, with a mean diabetes duration of 20.7 +/- 4.8 years and a mean glycosilated hemoglobin of 10.6 +/- 1.6%, was studied. The genotype of the (AC)n, polymorphic marker associated to the 5' end of the aldose reductase (ALR2) gene was determined by 32P-PCR plus sequenciation. Mutations of the factor XIII-A gene were studied by single stranded conformational polymorphism, sequenciation and restriction fragment length polymorphism. Four patients lacked the (AC)24 and had a higher rate of appearance of retinopathy than patients with the (AC)24 allele (0.0167 and 0.0907 score points per year respectively, p = 0.047). Both groups had similar glycosilated hemoglobin (11.7 +/- 0.2 and 10.5 +/- 1.6% respectively). Factor XIII gene mutations were not related to the rate of appearance of retinopathy. Our data suggest that the absence of the (AC)24 allele of the (AC)n polymorphic marker associated to the 5' end of the aldose reductase gene, is associated to a five fold reduction of retinopathy appearance rate.

Metabolism and gene polymorphisms of the folate pathway in Brazilian women with history of recurrent abortion.

Science.gov (United States)

Boas, Wendell Vilas; Gonçalves, Rozana Oliveira; Costa, Olívia Lúcia Nunes; Goncalves, Marilda Souza

2015-02-01

To investigate the association between polymorphisms in genes that encode enzymes involved in folate- and vitamin B12-dependent homocysteine metabolism and recurrent spontaneous abortion (RSA). We investigated the C677T and A1298C polymorphisms of the methylenetetrahydrofalate reductase gene (MTHFR), the A2756G polymorphism of the methionine synthase gene (MS) and the 844ins68 insertion of the cystathionine beta synthetase gene (CBS). The PCR technique followed by RFLP was used to assess the polymorphisms; the serum levels of homocysteine, vitamin B12 and folate were investigated by chemiluminescence. The EPI Info Software version 6.04 was used for statistical analysis. Parametric variables were compared by Student's t-test and nonparametric variables by the Wilcoxon rank sum test. The frequencies of gene polymorphisms in 89 women with a history of idiopathic recurrent miscarriage and 150 controls were 19.1 and 19.6% for the C677T, insertion, 20.8 and 26% for the A1298C insertion, 14.2 and 21.9% for the A2756G insertion, and 16.4 and 18% for the 844ins68 insertion, respectively. There were no significant differences between case and control groups in any of the gene polymorphisms investigated. However, the frequency of the 844ins68 insertion in the CBS gene was higher among women with a history of loss during the third trimester of pregnancy (p=0.003). Serum homocysteine, vitamin B12 and folate levels id not differ between the polymorphisms studied in the case and control groups. However, linear regression analysis showed a dependence of serum folate levels on the maintenance of tHcy levels. The investigated gene polymorphisms and serum homocysteine, vitamin B12 and folate levels were not associated with idiopathic recurrent miscarriage in the present study. Further investigations are needed in order to confirm the role of the CBS 844ins68 insertion in recurrent miscarriage.

Mammalian prions: tolerance to sequence changes-how far?

Science.gov (United States)

Salamat, Muhammad Khalid; Munoz-Montesino, Carola; Moudjou, Mohammed; Rezaei, Human; Laude, Hubert; Béringue, Vincent; Dron, Michel

2013-01-01

Upon prion infection, abnormal prion protein (PrP (Sc) ) self-perpetuate by conformational conversion of α-helix-rich PrP (C) into β sheet enriched form, leading to formation and deposition of PrP (Sc) aggregates in affected brains. However the process remains poorly understood at the molecular level and the regions of PrP critical for conversion are still debated. Minimal amino acid substitutions can impair prion replication at many places in PrP. Conversely, we recently showed that bona fide prions could be generated after introduction of eight and up to 16 additional amino acids in the H2-H3 inter-helix loop of PrP. Prion replication also accommodated the insertions of an octapeptide at different places in the last turns of H2. This reverse genetic approach reveals an unexpected tolerance of prions to substantial sequence changes in the protease-resistant part which is associated with infectivity. It also demonstrates that conversion does not require the presence of a specific sequence in the middle of the H2-H3 area. We discuss the implications of our findings according to different structural models proposed for PrP (Sc) and questioned the postulated existence of an N- or C-terminal prion domain in the protease-resistant region.

Dissociation of recombinant prion autocatalysis from infectivity.

Science.gov (United States)

Noble, Geoffrey P; Supattapone, Surachai

2015-01-01

Within the mammalian prion field, the existence of recombinant prion protein (PrP) conformers with self-replicating (ie. autocatalytic) activity in vitro but little to no infectious activity in vivo challenges a key prediction of the protein-only hypothesis of prion replication--that autocatalytic PrP conformers should be infectious. To understand this dissociation of autocatalysis from infectivity, we recently performed a structural and functional comparison between a highly infectious and non-infectious pair of autocatalytic recombinant PrP conformers derived from the same initial prion strain. (1) We identified restricted, C-terminal structural differences between these 2 conformers and provided evidence that these relatively subtle differences prevent the non-infectious conformer from templating the conversion of native PrP(C) substrates containing a glycosylphosphatidylinositol (GPI) anchor. (1) In this article we discuss a model, consistent with these findings, in which recombinant PrP, lacking post-translational modifications and associated folding constraints, is capable of adopting a wide variety of autocatalytic conformations. Only a subset of these recombinant conformers can be adopted by post-translationally modified native PrP(C), and this subset represents the recombinant conformers with high specific infectivity. We examine this model's implications for the generation of highly infectious recombinant prions and the protein-only hypothesis of prion replication.

Human Retrotransposon Insertion Polymorphisms Are Associated with Health and Disease via Gene Regulatory Phenotypes

Directory of Open Access Journals (Sweden)

Lu Wang

2017-08-01

Full Text Available The human genome hosts several active families of transposable elements (TEs, including the Alu, LINE-1, and SVA retrotransposons that are mobilized via reverse transcription of RNA intermediates. We evaluated how insertion polymorphisms generated by human retrotransposon activity may be related to common health and disease phenotypes that have been previously interrogated through genome-wide association studies (GWAS. To address this question, we performed a genome-wide screen for retrotransposon polymorphism disease associations that are linked to TE induced gene regulatory changes. Our screen first identified polymorphic retrotransposon insertions found in linkage disequilibrium (LD with single nucleotide polymorphisms that were previously associated with common complex diseases by GWAS. We further narrowed this set of candidate disease associated retrotransposon polymorphisms by identifying insertions that are located within tissue-specific enhancer elements. We then performed expression quantitative trait loci analysis on the remaining set of candidates in order to identify polymorphic retrotransposon insertions that are associated with gene expression changes in B-cells of the human immune system. This progressive and stringent screen yielded a list of six retrotransposon insertions as the strongest candidates for TE polymorphisms that lead to disease via enhancer-mediated changes in gene regulation. For example, we found an SVA insertion within a cell-type specific enhancer located in the second intron of the B4GALT1 gene. B4GALT1 encodes a glycosyltransferase that functions in the glycosylation of the Immunoglobulin G (IgG antibody in such a way as to convert its activity from pro- to anti-inflammatory. The disruption of the B4GALT1 enhancer by the SVA insertion is associated with down-regulation of the gene in B-cells, which would serve to keep the IgG molecule in a pro-inflammatory state. Consistent with this idea, the B4GALT1 enhancer

[Association of IL-1β-511T gene rs16944 polymorphism with febrile seizures].

Science.gov (United States)

Ren, Xiao-Tun; Sun, Su-Zhen; Liu, Fang; Wang, Xiao-Ming

2014-02-01

Despite substantial research efforts worldwide, the role of inflammatory cytokine IL-1β in the onset of febrile seizures (FS) remains controversial. The aim of this study was to assess the relationship between rs16944 polymorphism of the IL-1β-511T gene and occurrence of simple FS in a sample of Han children in northern China. The IL-1β-511T gene rs16944 was genotyped by SNaPshot SNP technique in 141 FS children and 130 healthy control subjects. The genotypic and allelic frequencies in the two groups were comparatively analyzed. There were no significant differences in genotypic and allelic frequencies of rs16944 polymorphism of the IL-1β-511T gene between FS patients and control subjects (P>0.05).When the clinical data on A/A, A/G and G/G genotypes of the rs16944 polymorphism in FS patients, there was statistically significant difference in age of first onset (χ(2)=19.491, Prs16944 polymorphism of the IL-1β-511T gene and the incidence of FS in Han children in Northern China. However, the differences in genotypes of this polymorphism might be associated with pathogenesis and prognosis of simple FS in the population studied.

A brief history of prions

Science.gov (United States)

Zabel, Mark D.; Reid, Crystal

2015-01-01

Proteins were described as distinct biological molecules and their significance in cellular processes was recognized as early as the 18th century. At the same time, Spanish shepherds observed a disease that compelled their Merino sheep to pathologically scrape against fences, a defining clinical sign that led to the disease being named scrapie. In the late 19th century, Robert Koch published his postulates for defining causative agents of disease. In the early 20th century, pathologists Creutzfeldt and Jakob described a neurodegenerative disease that would later be included with scrapie into a group of diseases known as transmissible spongiform encephalopathies (TSEs). Later that century, mounting evidence compelled a handful of scientists to betray the prevailing biological dogma governing pathogen replication that Watson and Crick so convincingly explained by cracking the genetic code just two decades earlier. Because TSEs seemed to defy these new rules, J.S. Griffith theorized mechanisms by which a pathogenic protein could encipher its own replication blueprint without a genetic code. Stanley Prusiner called this proteinaceous infectious pathogen a prion. Here we offer a concise account of the discovery of prions, the causative agent of TSEs, in the wider context of protein biochemistry and infectious disease. We highlight the discovery of prions in yeast and discuss the implication of prions as epigenomic carriers of biological and pathological information. We also consider expanding the prion hypothesis to include other proteins whose alternate isoforms confer new biological or pathological properties. PMID:26449713

[Association of muscle segment homeobox gene 1 polymorphisms with nonsyndromic cleft lip with or without cleft palate].

Science.gov (United States)

Zhang, Li; Tang, Jun-Ling; Liang, Shang-Zheng

2008-06-01

Muscle segment homeobox gene (MSX)1 has been proposed as a gene in which mutations may contribute to nonsyndromic cleft lip with or without cleft palate (NSCL/P). To study MSX1 polymorphisms in NSCL/ P by means of polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP), and investigate the association of MSX1 exons 1 polymorphisms with NSCL/P. DNA were extracted from blood samples from NSCL/P and unrelated normal subjects. Genome DNA from peripheral leukocyte with these blood samples were extracted, which was used as template to amplify desired gene fragment of MSX1 exons 1 by means of polymerase chain reaction (PCR). The PCR products were examined by single-strand conformation polymorphism (SSCP). The MSX1 exons 1 polymorphisms were examined by sequencing if mutations were found. MSX1 genes of exon 1 mutation was not been found in the NSCL/P and unrelated normal subjects by SSCP. No correlation between MSX1 exon 1 and NSCL/P was found. MSX1 exon 1 may not be a key gene (susceptibility gene) in NSCL/P.

GGC and StuI polymorphism on the androgen receptor gene in endometrial cancer patients

International Nuclear Information System (INIS)

Sasaki, Masahiro; Karube, Akihiro; Karube, Yuko; Watari, Michiko; Sakuragi, Noriaki; Fujimoto, Seiichiro; Dahiya, Rajvir

2005-01-01

Androgens have an anti-proliferative effect on endometrial cells. Human androgen receptor (AR) gene contains two polymorphic short tandem repeats of GGC and CAG, and a single-nucleotide polymorphism on exon 1 that is recognized by the restriction enzyme, StuI. Prior studies have shown that the lengths of the CAG repeat are inversely and linearly related to AR activity and associated with endometrial cancer. However, little is known about the GGC repeat and the StuI polymorphism of the AR gene. Thus, we investigated whether these AR polymorphisms are risk factors for endometrial cancer. To test this hypothesis, the genetic distributions of these polymorphisms were investigated in blood samples from endometrial cancer patients and healthy controls. The allelic and genotyping profiles were analyzed by polymerase chain reaction (PCR), PCR-restriction fragment length polymorphism (PCR-RFLP), and direct DNA sequencing, and analyzed statistically. The GGC repeat was significantly longer in endometrial cancer patients as compared to normal healthy controls. In general, an increased risk of endometrial cancer was found with increasing GGC repeat. The relative risk for the 17 GGC repeat was greater than 4, as compared to controls. However, the StuI polymorphism was not significantly different between patients and controls. The findings suggest that increased numbers of GGC repeat on the AR gene may be a risk factor for endometrial cancer

Polymorphisms of the ABCB1 gene in the pakistani population

International Nuclear Information System (INIS)

Farhat, K.; Waheed, A.

2015-01-01

Objective: To investigate the frequency of the single nucleotide polymorphism C1236Tin exon 12 of the ABCB1 gene in Pakistani population and to compare it with published data on Asian and Caucasian populations. Study Design: Across-sectional observational study. Place and Duration of Study: Combined Military Hospital, Rawalpindi and Institute of Biomedical and Genetic Engineering (IBGE), Islamabad, from August 2012 to May 2013. Methodology: C1236T polymorphism was investigated in 426 Pakistani subjects. The frequency was compared with the published data on other Asian and Caucasian populations. Results: The frequencies of ABCB1 C1236T were 16.4% for CC, 44.1% for CT and 39.4% for TT. Pakistanis differed significantly from all the European populations compared in the distribution of the TT genotype of C1236TABCB1 (p < 0.05). The Pakistani population also differed significantly from some of the European populations in the distribution of CC and CT genotype (p < 0.05). Conclusion: There was significant difference in the genotype frequency of the ABCB1 gene compared to other populations. This study has provided a framework for future pharmacogenetic and pharmacokinetic studies on this polymorphic variant of ABCB1 gene in the Pakistani population. (author)

Secretin receptor involvement in prion-infected cells and animals.

Science.gov (United States)

Kimura, Tomohiro; Nishizawa, Keiko; Oguma, Ayumi; Nishimura, Yuki; Sakasegawa, Yuji; Teruya, Kenta; Nishijima, Ichiko; Doh-ura, Katsumi

2015-07-08

The cellular mechanisms behind prion biosynthesis and metabolism remain unclear. Here we show that secretin signaling via the secretin receptor regulates abnormal prion protein formation in prion-infected cells. Animal studies demonstrate that secretin receptor deficiency slightly, but significantly, prolongs incubation time in female but not male mice. This gender-specificity is consistent with our finding that prion-infected cells are derived from females. Therefore, our results provide initial insights into the reasons why age of disease onset in certain prion diseases is reported to occur slightly earlier in females than males. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Detection of prion infectivity in fat tissues of scrapie-infected mice.

Directory of Open Access Journals (Sweden)

Brent Race

2008-12-01

Full Text Available Distribution of prion infectivity in organs and tissues is important in understanding prion disease pathogenesis and designing strategies to prevent prion infection in animals and humans. Transmission of prion disease from cattle to humans resulted in banning human consumption of ruminant nervous system and certain other tissues. In the present study, we surveyed tissue distribution of prion infectivity in mice with prion disease. We show for the first time detection of infectivity in white and brown fat. Since high amounts of ruminant fat are consumed by humans and also incorporated into animal feed, fat-containing tissues may pose a previously unappreciated hazard for spread of prion infection.

Role of Endothelial Nitric Oxide Synthase Gene Polymorphisms ...

African Journals Online (AJOL)