Radiation Dose Effects into LCO in Technical Specification by Iodine in Hanul units 1,2
Energy Technology Data Exchange (ETDEWEB)
Lee, Hye Min; Lee, Seung Chan [KHNP Central Research Institute, Daejeon (Korea, Republic of)
2015-05-15
This study estimates the impact of the 1-th coolant system in NPP to the LCO (Limiting Condition of Operation) limits which is in the site boundary. Dose limit is merged into the effective dose from whole body and thyroid dose limits, that is possible to combine the two LCOs to a unified LCO. To estimate the limits, the radiation dose of one of the designed accidents should be chosen to check the radiation dose response. The selected accident is based on Seung Chan Lee's study at KHNP in 2011. Using the selected accident, Iodine dose effect is reviewed depending on the LCO limiting responsibility and the specific behavior. In order to evaluate the radiation dose effect in Technical Specification of Hanul 1,2, SGTR is selected for some sensitivity analysis. From the results, in Hanul site, the case of LOOP plus ADV plus GIS is the most severe case and the dose limit margin is about 110% in LCO.
33 CFR 80.1490 - Apra Harbor, U.S. Territory of Guam.
2010-07-01
... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Apra Harbor, U.S. Territory of Guam. 80.1490 Section 80.1490 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Pacific Islands § 80.1490 Apra Harbor, U...
The LCO Follow-up and Characterization Network and AgentNEO Citizen Science Project
Lister, Tim; Greenstreet, Sarah; Gomez, Edward; Christensen, Eric J.; Larson, Stephen M.
2017-10-01
The LCO NEO Follow-up Network is using the telescopes of the Las Cumbres Observatory (LCO) and a web-based target selection, scheduling and data reduction system to confirm NEO candidates and characterize radar-targeted known NEOs. Starting in July 2014, the LCO NEO Follow-up Network has observed over 4,500 targets and reported more than 25,000 astrometric and photometric measurements to the Minor Planet Center.The LCO NEO Follow-up Network's main aims are to perform confirming follow-up of the large number of NEO candidates and to perform characterization measurements of radar targets to obtain light curves and rotation rates. The NEO candidates come from the NEO surveys such as Catalina, PanSTARRS, ATLAS, NEOWISE and others. In particular, we are targeting objects in the Southern Hemisphere, where the LCO NEO Follow-up Network is the largest resource for NEO observations.The first phase of the LCO Network comprises nine 1-meter and seven 0.4-meter telescopes at site at McDonald Observatory (Texas), Cerro Tololo (Chile), SAAO (South Africa) and Siding Spring Observatory (Australia). The network has been fully operational since 2014 May, and observations are being executed remotely and robotically. Additional 0.4-meter telescopes will be deployed in 2017 and 2x1-meter telescopes for a site at Ali Observatory, Tibet are planned for 2018-2019.We have developed web-based software called NEOexchange which automatically downloads and aggregates NEO candidates from the Minor Planet Center's NEO Confirmation Page, the Arecibo and Goldstone radar target lists and the NASA lists. NEOexchange allows the planning and scheduling of observations on the LCO Telescope Network and the tracking of the resulting blocks and generated data. We have extended the NEOexchange software to include automated scheduling and moving object detection, with the results presented to the user via the website.We will present results from the LCO NEO Follow-up Network and from the development of the
Using pico-LCoS SLMs for high speed cell sorting
DEFF Research Database (Denmark)
Bañas, Andrew Rafael; Aabo, Thomas; Palima, Darwin
2012-01-01
We propose the use of consumer pico projectors as cost effective spatial light modulators in cell sorting applications. The matched filtering Generalized Phase Contrast (mGPC) beam shaping method is used to produce high intensity optical spots for trapping and catapulting cells. A pico projector......’s liquid crystal on silicon (LCoS) chip was used as a binary phase spatial light modulator (SLM) wherein correlation target patterns are addressed. Experiments using the binary LCoS phase SLM with a fabricated Pyrex matched filter demonstrate the generation of intense optical spots that can potentially...... be used for cell sorting. Numerical studies also show mGPC’s robustness to phase aberrations in the LCoS device, and its ability to outperform a top hat beam with the same power....
Generalized Phase Contrast with matched filtering using LCoS pico-projectors
Bañas, Andrew Rafael; Palima, Darwin; Glückstad, Jesper
2012-01-01
We report a beam shaping system for generating high intensity programmable opticalspots using mGPC: matched filtering combined with Generalized Phase Contrastapplying two consumer handheld pico-projectors. Such a system presents a low costalternative for optical trapping and manipulation, optical lattices and other beamshaping applications usually implemented with high-end spatial light modulators.Portable pico-projectors based on liquid crystal on silicon (LCoS) devices were usedas binary ph...
Night vision goggle stimulation using LCoS and DLP projection technology, which is better?
Ali, Masoud H.; Lyon, Paul; De Meerleer, Peter
2014-06-01
High fidelity night-vision training has become important for many of the simulation systems being procured today. The end-users of these simulation-training systems prefer using their actual night-vision goggle (NVG) headsets. This requires that the visual display system stimulate the NVGs in a realistic way. Historically NVG stimulation was done with cathode-ray tube (CRT) projectors. However, this technology became obsolete and in recent years training simulators do NVG stimulation with laser, LCoS and DLP projectors. The LCoS and DLP projection technologies have emerged as the preferred approach for the stimulation of NVGs. Both LCoS and DLP technologies have advantages and disadvantages for stimulating NVGs. LCoS projectors can have more than 5-10 times the contrast capability of DLP projectors. The larger the difference between the projected black level and the brightest object in a scene, the better the NVG stimulation effects can be. This is an advantage of LCoS technology, especially when the proper NVG wavelengths are used. Single-chip DLP projectors, even though they have much reduced contrast compared to LCoS projectors, can use LED illuminators in a sequential red-green-blue fashion to create a projected image. It is straightforward to add an extra infrared (NVG wavelength) LED into this sequential chain of LED illumination. The content of this NVG channel can be independent of the visible scene, which allows effects to be added that can compensate for the lack of contrast inherent in a DLP device. This paper will expand on the differences between LCoS and DLP projectors for stimulating NVGs and summarize the benefits of both in night-vision simulation training systems.
Wang, Mi; Martínez, Francisco J.; Márquez, Andrés.; Ye, Yabin; Zong, Liangjia; Pascual, Inmaculada; Beléndez, Augusto
2017-08-01
Liquid-crystal on Silicon (LCoS) microdisplays are one of the competing technologies to implement wavelength selective switches (WSS) for optical telecommunications. Last generation LCoS, with more than 4 megapixels, have decreased pixel size to values smaller than 4 microns, what increases interpixel cross-talk effects such as fringing-field. We proceed with an experimental evaluation of a 3.74 micron pixel size parallel-aligned LCoS (PA-LCoS) device. At 1550 nm, for the first time we use time-average Stokes polarimetry to measure the retardance and its flicker magnitude as a function of voltage. We also verify the effect of the antireflection coating when we try to characterize the PA-LCoS out of the designed interval for the AR coating. Some preliminary results for the performance for binary gratings are also given, where the decrease of modulation range with the increase in spatial frequency is shown, together with some residual polarization effects.
NCBI nr-aa BLAST: CBRC-CJAC-01-1490 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-CJAC-01-1490 ref|XP_513201.1| PREDICTED: cannabinoid receptor 2 (macrophage) i...soform 2 [Pan troglodytes] ref|XP_001166334.1| PREDICTED: cannabinoid receptor 2 (macrophage) isoform 1 [Pan troglodytes] XP_513201.1 0.0 94% ...
Initial report for magnetostratigraphy of IODP Site U1490
Kumagai, Y.; Hatfield, R. G.; Nakamura, N.; Yamazaki, T.
2017-12-01
We report preliminary paleomagnetic results from between 175-296 meters composite depth (Miocene in age) of IODP Site U1490 recovered during Expedition 363. Site U1490 is located at 05°48.95´N, 142°39.27´E (the northern edge of the Eauripik Rise in the equatorial Pacific) in 2341 m water depth. A primary objective of Expedition 363 was to reconstruct the regional climate variability within the Western Pacific Warm Pool (WPWP) in a broad spatial coverage and different temporal resolutions through the time interval from the middle Miocene to late Pleistocene. The recovered pelagic sediments contains calcareous and siliceous nannofossils with varying proportions of clay and ash. It is also characterized by current-controlled mud waves with gradually decreasing amplitude upsection (Rosenthal et al., 2017). Since deep water is enriched in dissolved oxygen due to downwelling in polar regions, the mud waves were probably formed in an oxic environment by bottom currents, hindering the dissolution of magnetic minerals in the sediments. Shipboard analysis revealed that magnetic minerals between 20-175 m composite depth at Site U1490 have been dissolved by diagenetic alteration and the paleomagnetic data is uninterpretable. But the upper 20 m and below 175 m have a stable magnetization that spans from present to early Pleistocene (0-1.9 Ma) and middle to late Miocene period ( 9-19 Ma), respectively. The latter is an exceptionally long-time range continuous core sample, so it provides us an opportunity to reveal long-range variations of paleomagnetic field. We will show stepwise alternate-field (AF) demagnetization of the natural remanent magnetization on U-channel samples from the composite stratigraphic section to establish magnetostratigraphy at this site.
Generalized Phase Contrast with matched filtering using LCoS pico-projectors
DEFF Research Database (Denmark)
Bañas, Andrew Rafael; Palima, Darwin; Glückstad, Jesper
2012-01-01
, optical lattices and other beam shaping applications usually implemented with high-end spatial light modulators. Portable pico-projectors based on liquid crystal on silicon (LCoS) devices were used as binary phase-only spatial light modulators by setting the appropriate polarization of the illumination...
Expectativas y aspiraciones laborales de jóvenes que cursan primer año de la escuela media
Batlle, Silvia; Vidondo, Marcela; Rodríguez, M. F.; Nuñez, María Clara; Dueñas, Mercedes
2009-01-01
En este trabajo se presentarán algunos resultados y conclusiones sobre las expectativas y aspiraciones laborales de jóvenes estudiantes de primer año, entendiendo que éstas son dimensiones claves en la construcción de proyectos laborales. Esta información nos permitirá conocer mejor los posicionamientos actuales de los jóvenes hacia el trabajo, y las representaciones que van conformando respecto a las posibilidades de inserción en el mercado laboral.
Biological applications of an LCoS-based programmable array microscope (PAM)
Hagen, Guy M.; Caarls, Wouter; Thomas, Martin; Hill, Andrew; Lidke, Keith A.; Rieger, Bernd; Fritsch, Cornelia; van Geest, Bert; Jovin, Thomas M.; Arndt-Jovin, Donna J.
2007-02-01
We report on a new generation, commercial prototype of a programmable array optical sectioning fluorescence microscope (PAM) for rapid, light efficient 3D imaging of living specimens. The stand-alone module, including light source(s) and detector(s), features an innovative optical design and a ferroelectric liquid-crystal-on-silicon (LCoS) spatial light modulator (SLM) instead of the DMD used in the original PAM design. The LCoS PAM (developed in collaboration with Cairn Research, Ltd.) can be attached to a port of a(ny) unmodified fluorescence microscope. The prototype system currently operated at the Max Planck Institute incorporates a 6-position high-intensity LED illuminator, modulated laser and lamp light sources, and an Andor iXon emCCD camera. The module is mounted on an Olympus IX71 inverted microscope with 60-150X objectives with a Prior Scientific x,y, and z high resolution scanning stages. Further enhancements recently include: (i) point- and line-wise spectral resolution and (ii) lifetime imaging (FLIM) in the frequency domain. Multiphoton operation and other nonlinear techniques should be feasible. The capabilities of the PAM are illustrated by several examples demonstrating single molecule as well as lifetime imaging in live cells, and the unique capability to perform photoconversion with arbitrary patterns and high spatial resolution. Using quantum dot coupled ligands we show real-time binding and subsequent trafficking of individual ligand-growth factor receptor complexes on and in live cells with a temporal resolution and sensitivity exceeding those of conventional CLSM systems. The combined use of a blue laser and parallel LED or visible laser sources permits photoactivation and rapid kinetic analysis of cellular processes probed by photoswitchable visible fluorescent proteins such as DRONPA.
Innovative Development of Kernel-Based Reduced-Order Models for Predicting LCO Onset, Phase I
National Aeronautics and Space Administration — Reducing uncertainty in the prediction of limit cycle oscillations (LCO) and other nonlinear aeroservoelastic phenomena is critical to flight safety. To do so...
Degano, Bruno; Soumagne, Thibaud; Delaye, Thomas; Berger, Patrick; Perez, Thierry; Guillien, Alicia; Pellegrin, Jean-Luc; Launay, David; Magy-Bertrand, Nadine; Agard, Christian; Tiev, Kiet Phong; Hua-Huy, Thông; Tardiff, Catherine; Diaz, Véronique; Chambellan, Arnaud; Dinh-Xuan, Anh Tuan
2017-10-01
Screening is important to determine whether patients with systemic sclerosis (SSc) have pulmonary hypertension because earlier pulmonary hypertension treatment can improve survival in these patients. Although decreased transfer factor of the lung for carbon monoxide ( T LCO ) is currently considered the best pulmonary function test for screening for pulmonary hypertension in SSc, small series have suggested that partitioning T LCO into membrane conductance (diffusing capacity) for carbon monoxide ( D MCO ) and alveolar capillary blood volume ( V C ) through combined measurement of T LCO and transfer factor of the lung for nitric oxide ( T LNO ) is more effective to identify pulmonary hypertension in SSc patients compared with T LCO alone. Here, the objective was to determine whether combined T LCO - T LNO partitioned with recently refined equations could more accurately detect pulmonary hypertension than T LCO alone in SSc.For that purpose, 572 unselected consecutive SSc patients were retrospectively recruited in seven French centres.Pulmonary hypertension was diagnosed with right heart catheterisation in 58 patients. T LCO , T LNO and V C were all lower in SSc patients with pulmonary hypertension than in SSc patients without pulmonary hypertension. The area under the receiver operating characteristic curve for the presence of pulmonary hypertension was equivalent for T LCO (0.82, 95% CI 0.79-0.85) and T LNO (0.80, 95% CI 0.76-0.83), but lower for V C (0.75, 95% CI 0.71-0.78) and D MCO (0.66, 95% CI 0.62-0.70).Compared with T LCO alone, combined T LCO - T LNO does not add capability to detect pulmonary hypertension in unselected SSc patients. Copyright ©ERS 2017.
NCBI nr-aa BLAST: CBRC-CJAC-01-1490 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-CJAC-01-1490 ref|NP_001832.1| cannabinoid receptor 2 (macrophage) [Homo sapien...s] sp|P34972|CNR2_HUMAN Cannabinoid receptor 2 (CB2) (CB-2) (CX5) emb|CAA52376.1| CB2 (peripheral) cannabino...id receptor [Homo sapiens] emb|CAD22548.1| peripheral cannabinoid receptor CB2 [Homo sapiens] emb|CAD22549.1| peripheral cann...abinoid receptor CB2 [Homo sapiens] gb|AAO92299.1| cannabinoid r...eceptor 2 [Homo sapiens] emb|CAI14799.1| cannabinoid receptor 2 (macrophage) [Homo sapiens] emb|CAJ42137.1| cann
King, Sharon V.; Doblas, Ana; Patwary, Nurmohammed; Saavedra, Genaro; Martínez-Corral, Manuel; Preza, Chrysanthe
2014-03-01
Wavefront coding techniques are currently used to engineer unique point spread functions (PSFs) that enhance existing microscope modalities or create new ones. Previous work in this field demonstrated that simulated intensity PSFs encoded with a generalized cubic phase mask (GCPM) are invariant to spherical aberration or misfocus; dependent on parameter selection. Additional work demonstrated that simulated PSFs encoded with a squared cubic phase mask (SQUBIC) produce a depth invariant focal spot for application in confocal scanning microscopy. Implementation of PSF engineering theory with a liquid crystal on silicon (LCoS) spatial light modulator (SLM) enables validation of WFC phase mask designs and parameters by manipulating optical wavefront properties with a programmable diffractive element. To validate and investigate parameters of the GCPM and SQUBIC WFC masks, we implemented PSF engineering in an upright microscope modified with a dual camera port and a LCoS SLM. We present measured WFC PSFs and compare them to simulated PSFs through analysis of their effect on the microscope imaging system properties. Experimentally acquired PSFs show the same intensity distribution as simulation for the GCPM phase mask, the SQUBIC-mask and the well-known and characterized cubic-phase mask (CPM), first applied to high NA microscopy by Arnison et al.10, for extending depth of field. These measurements provide experimental validation of new WFC masks and demonstrate the use of the LCoS SLM as a WFC design tool. Although efficiency improvements are needed, this application of LCoS technology renders the microscope capable of switching among multiple WFC modes.
Lyu, Bo-Han; Wang, Chen; Tsai, Chun-Wei
2017-08-01
Jasper Display Corp. (JDC) offer high reflectivity, high resolution Liquid Crystal on Silicon - Spatial Light Modulator (LCoS-SLM) which include an associated controller ASIC and LabVIEW based modulation software. Based on this LCoS-SLM, also called Education Kit (EDK), we provide a training platform which includes a series of optical theory and experiments to university students. This EDK not only provides a LabVIEW based operation software to produce Computer Generated Holograms (CGH) to generate some basic diffraction image or holographic image, but also provides simulation software to verity the experiment results simultaneously. However, we believe that a robust LCoSSLM, operation software, simulation software, training system, and training course can help students to study the fundamental optics, wave optics, and Fourier optics more easily. Based on these fundamental knowledges, they could develop their unique skills and create their new innovations on the optoelectronic application in the future.
Matched-filtering generalized phase contrast using LCoS pico-projectors for beam-forming
DEFF Research Database (Denmark)
Bañas, Andrew Rafael; Palima, Darwin; Glückstad, Jesper
2012-01-01
, optical lattices and other beam-shaping applications usually implemented with high-end spatial light modulators. Portable pico-projectors based on liquid crystal on silicon (LCoS) devices are used as binary phase-only spatial light modulators by carefully setting the appropriate polarization of the laser...
Reduced-Order Modeling for Flutter/LCO Using Recurrent Artificial Neural Network
Yao, Weigang; Liou, Meng-Sing
2012-01-01
The present study demonstrates the efficacy of a recurrent artificial neural network to provide a high fidelity time-dependent nonlinear reduced-order model (ROM) for flutter/limit-cycle oscillation (LCO) modeling. An artificial neural network is a relatively straightforward nonlinear method for modeling an input-output relationship from a set of known data, for which we use the radial basis function (RBF) with its parameters determined through a training process. The resulting RBF neural network, however, is only static and is not yet adequate for an application to problems of dynamic nature. The recurrent neural network method [1] is applied to construct a reduced order model resulting from a series of high-fidelity time-dependent data of aero-elastic simulations. Once the RBF neural network ROM is constructed properly, an accurate approximate solution can be obtained at a fraction of the cost of a full-order computation. The method derived during the study has been validated for predicting nonlinear aerodynamic forces in transonic flow and is capable of accurate flutter/LCO simulations. The obtained results indicate that the present recurrent RBF neural network is accurate and efficient for nonlinear aero-elastic system analysis
Martínez, Francisco J; Márquez, Andrés; Gallego, Sergi; Ortuño, Manuel; Francés, Jorge; Pascual, Inmaculada; Beléndez, Augusto
2015-02-20
Parallel-aligned (PA) liquid-crystal on silicon (LCoS) microdisplays are especially appealing in a wide range of spatial light modulation applications since they enable phase-only operation. Recently we proposed a novel polarimetric method, based on Stokes polarimetry, enabling the characterization of their linear retardance and the magnitude of their associated phase fluctuations or flicker, exhibited by many LCoS devices. In this work we apply the calibrated values obtained with this technique to show their capability to predict the performance of spatially varying phase multilevel elements displayed onto the PA-LCoS device. Specifically we address a series of multilevel phase blazed gratings. We analyze both their average diffraction efficiency ("static" analysis) and its associated time fluctuation ("dynamic" analysis). Two different electrical configuration files with different degrees of flicker are applied in order to evaluate the actual influence of flicker on the expected performance of the diffractive optical elements addressed. We obtain a good agreement between simulation and experiment, thus demonstrating the predictive capability of the calibration provided by the average Stokes polarimetric technique. Additionally, it is obtained that for electrical configurations with less than 30° amplitude for the flicker retardance, they may not influence the performance of the blazed gratings. In general, we demonstrate that the influence of flicker greatly diminishes when the number of quantization levels in the optical element increases.
International Nuclear Information System (INIS)
1976-04-01
A description is presented of the methodology presently in use by Combustion Engineering to calculate Limiting Safety System Setting (LSSS) for the Local Power Density and Thermal Margin Trip Systems and Limiting Conditions for Operation (LCO) to assure that the specified acceptable fuel design limits are not exceeded during the design basis anticipated operational occurrences. The C-E Nuclear Steam Supply Systems for which the report is applicable are those incorporating the analog reactor protection system and licensed under the requirements of 10CFR50, Appendix A. The design basis events to be accommodated by the subject LSSS and LCO are discussed, and the methods to assure the required protection system response and initial required margin are described. The calculational techniques used to represent the specified acceptable fuel design limits in terms of monitored reactor parameters are provided. Using the resultant limits as a base, the methodology to synthesize the subject LSSS and LCO in terms of the parameters processed by the protection and monitoring systems is described
UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes
Directory of Open Access Journals (Sweden)
Nomin Batnyam
2012-01-01
Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.
Eigenstates of complex linear combinations of J1, J2, J3 for any representation of SU(2)
International Nuclear Information System (INIS)
Bacry, H.; Technion-Israel Inst. of Tech., Haifa. Dept. of Physics)
1977-05-01
The states which minimalize the uncertainty relation ΔJ 1 ΔJ 2 >=1/2/ 3 >/ are eigenstates of complex linear combinations of J 1 and J 2 . This kind of states is shown to have a very simple geometrical interpretation in the constellation formalism. A detailed description is given in the present pap
Matched-filtering generalized phase contrast using LCoS pico-projectors for beam-forming
Bañas, Andrew Rafael; Palima, Darwin; Glückstad, Jesper
2012-01-01
We report on a new beam-forming system for generating high intensity programmable optical spikes using so-called matched-filtering Generalized Phase Contrast (mGPC) applying two consumer handheld pico-projectors. Such a system presents a low-cost alternative for optical trapping and manipulation, optical lattices and other beam-shaping applications usually implemented with high-end spatial light modulators. Portable pico-projectors based on liquid crystal on silicon (LCoS) devices are used as...
A Multi-Mode Video Driver for a High Resolution LCoS Display
Farrell, Ronan; Jacob, Mark; Maher, Roger
2000-01-01
This paper describes the design of a display driver for Liquid Crystal on Silicon (LCoS) microdisplays. These are high resolution reflective display devices which allow up to 1280x1024 pixels on an area of 3.75cm2, and are typically refreshed at 120Hz. The required driver consists of a digital section capable of taking the common display formats such as SVGA and new formats, SXGA, and processing these to a common 120HzRGB signal, requiring an output rate of 160 mega-pixels/second. This signal...
Directory of Open Access Journals (Sweden)
N. Ramos-Pedroza
2015-01-01
careful algebraic manipulation in the regulation error system development, along with innovative design of the sliding surface. A detailed model of the UAV LCO dynamics is utilized, and a rigorous analysis is provided to prove asymptotic regulation of the pitching and plunging displacements. Numerical simulation results are provided to demonstrate the performance of the control law.
Martínez Guardiola, Francisco Javier; Márquez Ruiz, Andrés; Gallego Rico, Sergi; Ortuño Sánchez, Manuel; Francés Monllor, Jorge; Beléndez Vázquez, Augusto; Pascual Villalobos, Inmaculada
2014-01-01
Parallel-aligned liquid crystal on silicon (PA-LCoS) displays have become the most attractive spatial light modulator device for a wide range of applications, due to their superior resolution and light efficiency, added to their phase-only capability. Recently we proposed a novel polarimetric method, based on Stokes polarimetry, enabling the characterization of their linear retardance and the magnitude of their associated phase fluctuations, if existent, as it happens in most of digital backp...
Bugge, Anna; Tarp, Jakob; Østergaard, Lars; Domazet, Sidsel Louise; Andersen, Lars Bo; Froberg, Karsten
2014-09-18
The aim of the study; LCoMotion - Learning, Cognition and Motion was to develop, document, and evaluate a multi-component physical activity (PA) intervention in public schools in Denmark. The primary outcome was cognitive function. Secondary outcomes were academic skills, body composition, aerobic fitness and PA. The primary aim of the present paper was to describe the rationale, design and methods of the LCoMotion study. LCoMotion was designed as a cluster-randomized controlled study. Fourteen schools from all five regions in Denmark participated. All students from 6th and 7th grades were invited to participate (n = 869) and consent was obtained for 87% (n = 759). Baseline measurements were obtained in November/December 2013 and follow-up measurements in May/June 2014. The intervention lasted five months and consisted of a "package" of three main components: PA during academic lessons, PA during recess and PA homework. Furthermore a cycling campaign was conducted during the intervention period. Intervention schools should endeavor to ensure that students were physically active for at least 60 min every school day. Cognitive function was measured by a modified Eriksen flanker task and academic skills by a custom made mathematics test. PA was objectively measured by accelerometers (ActiGraph, GT3X and GT3X+) and aerobic fitness assessed by an intermittent shuttle-run test (the Andersen intermittent running test). Furthermore, compliance with the intervention was assessed by short message service (SMS)-tracking and questionnaires were delivered to students, parents and teachers. LCoMotion has ability to provide new insights on the effectiveness of a multicomponent intervention on cognitive function and academic skills in 6th and 7th grade students. Clinicaltrials.gov: NCT02012881 (10/10/2013).
MethPrimer: designing primers for methylation PCRs.
Li, Long-Cheng; Dahiya, Rajvir
2002-11-01
DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.
MPprimer: a program for reliable multiplex PCR primer design
Directory of Open Access Journals (Sweden)
Wang Xiaolei
2010-03-01
Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.
J. de Morainville y el primer dibujo universal de la quina o cascarilla
Directory of Open Access Journals (Sweden)
2003-01-01
Full Text Available En 1736 la Mission Géodésique Française appartenant à lAcadémie des Sciences de Paris arriva à Quito son but était deffectuer des études et des mesures pour établir la forme de la planète. Ce groupe de chercheurs, dirigé par Louis Godin et Charle-Marie de La Condamine, comprenait J. de Moiranville qui, en 1738, accompagna La Condamine à Saraguro (dans le département de Loja, Équateur, pour laider dans ses travaux et recherches sur larbre de quina ou cascarilla, utilisé pour guérir la malaria. À cette occasion Moiranville réalisa le premier dessin de la cascarilla au niveau mondial. En 1736 arribó a la Presidencia de Quito la Misión Geodésica Francesa, enviada por la Academia de Ciencias de París, con la finalidad de efectuar estudios que permitieran definir la forma del globo terráqueo. Formando parte de la misión, que estuvo bajo el mando de Luis Godin y de Carlos María de La Condamine, se hallaba el ingeniero J. de Morainville quien, en 1738, acompañó a La Condamine hasta el sitio de Zaraguro, ubicado en la Provincia de Loja (Ecuador, con la finalidad de estudiar el árbol de quina o cascarilla, el mismo que se utilizaba para el tratamiento de la malaria. Con esta oportunidad Morainville efectuó el primer dibujo universal de la cascarilla. The French Geodesics Mission under Louis Godin and Charles-Marie de La Condamine command arrived to the Presidency of Quito in 1763. This mission was sent by the Sciences Academy of Paris to carry out studies aimed at defining accurately the Earths shape. One of the members of this Mission was the engineer J. de Morainville who went to the Zaraguro site (Loja Province, Ecuador in 1738 accompanied by La Condamine. The purpose of their trip was to study the quina or cascarilla, a tree which was used to treat malaria. In this occasion, Morainville made the first drawing of the cascarilla.
DEFF Research Database (Denmark)
Bugge, Anna; Tarp, Jakob; Ostergaard, Lars
2014-01-01
BACKGROUND: The aim of the study; LCoMotion - Learning, Cognition and Motion was to develop, document, and evaluate a multi-component physical activity (PA) intervention in public schools in Denmark. The primary outcome was cognitive function. Secondary outcomes were academic skills, body composi...
Anderson, James; Chen, Cheng; Bos, Philip J.
2005-04-01
Single or dual panel microdisplay systems are becoming more popular in the marketplace. Consequently, Liquid Crystal on Silicon (LCoS) microdisplays are constantly being pushed to achieve faster switching times as well as higher contrast, while becoming simpler and allowing simpler optics engine design. Currently, most products use a Twisted Nematic (TN) mode with a retardation film. The most promising solution in research now is the Vertically Aligned Nematic (VAN) mode, which does not require a retarder.
Development of a microsatellite primer set to investigate the genetic ...
Indian Academy of Sciences (India)
Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545-549. Table 1.
Primer3_masker: integrating masking of template sequence with primer design software.
Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido
2018-06-01
Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.
A primer of multivariate statistics
Harris, Richard J
2014-01-01
Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why
Primer sets for cloning the human repertoire of T cell Receptor Variable regions.
Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele
2008-08-29
Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.
MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling
Directory of Open Access Journals (Sweden)
Kitchen James L
2012-11-01
Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.
MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.
Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G
2012-11-05
Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.
Primer sets for cloning the human repertoire of T cell Receptor Variable regions
Directory of Open Access Journals (Sweden)
Santoro Claudio
2008-08-01
Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.
Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.
Yofe, Ido; Schuldiner, Maya
2014-02-01
The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.
Çokakoğlu, Serpil; Nalçacı, Ruhi; Üşümez, Serdar; Malkoç, Sıddık
2016-04-01
The purpose of this study was to investigate the demineralization around brackets and shear bond strength (SBS) of brackets bonded to Er:YAG laser-irradiated enamel at different power settings with various adhesive systems combinations. A total of 108 premolar teeth were used in this study. Teeth were assigned into three groups according to the etching procedure, then each group divided into three subgroups based on the application of different adhesive systems. There were a total of nine groups as follows. Group 1: Acid + Transbond XT Primer; group 2: Er:YAG (100 mJ, 10 Hz) etching + Transbond XT Primer; group 3: Er:YAG (200 mJ, 10 Hz) etching + Transbond XT Primer; group 4: Transbond Plus self-etching primer (SEP); group 5: Er:YAG (100 mJ, 10 Hz) etching + Transbond Plus SEP; group 6: Er:YAG (200 mJ, 10 Hz) etching + Transbond Plus SEP; group 7: Clearfil Protect Bond; group 8: Er:YAG (100 mJ, 10 Hz) etching + Clearfil Protect Bond; group 9: Er:YAG (200 mJ, 10 Hz) etching + Clearfil Protect Bond. Brackets were bonded with Transbond XT Adhesive Paste in all groups. Teeth to be evaluated for demineralization and SBS were exposed to pH and thermal cyclings, respectively. Then, demineralization samples were scanned with micro-CT to determine lesion depth values. For SBS test, a universal testing machine was used and adhesive remnant was index scored after debonding. Data were analyzed statistically. No significant differences were found among the lesion depth values of the various groups, except for G7 and G8, in which the lowest values were recorded. The lowest SBS values were in G7, whereas the highest were in G9. The differences between the other groups were not significant. Er:YAG laser did not have a positive effect on prevention of enamel demineralization. When two step self-etch adhesive is preferred for bonding brackets, laser etching at 1 W (100 mJ, 10 Hz) is suggested to improve SBS of brackets.
Probabilistic approaches to LCO's and surveillance requirements for standby safety systems
International Nuclear Information System (INIS)
Lofgren, E.V.; Varcolik, F.
1982-11-01
Results are presented for a comprehensive analysis of risk-based methods for establishing Limiting Conditions for Operation (LCO) and surveillance requirements for on-line test and repair of nuclear power plant safety system components. Limiting Conditions for Operation refers to the legal constraint on safety system component outage times that are imposed by the NRC as part of the reactor operating license. Generally, when a safety system component is removed for repair or test for a period of time there is a period of increased vulnerability concerning the probability that the affected safety system will be available to mitigate an accident. This period of increased vulnerability exists until the component is restored to service. The constraint on the duration of this period, the allowed outage time (AOT), is the aspect of LCOs that is of interest here. In particular, methods are reviewed and developed that relate measures of risk to the AOT. Only by explicitly relating risk to AOT can outage times be constrained by placing limits on risk. Methods developed for relating risk measures to outage times are presented. The review and analysis of risk related methods for establishing LCOs are described
Primer design for a prokaryotic differential display RT-PCR.
Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H
1997-05-01
We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.
Directory of Open Access Journals (Sweden)
Puntipar Sonthiphand
Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library
Polyacid macromolecule primers
Sugama, Toshifumi.
1989-12-26
Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.
PHUSER (Primer Help for USER): a novel tool for USER fusion primer design
DEFF Research Database (Denmark)
Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads
2011-01-01
containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...
VizPrimer: a web server for visualized PCR primer design based on known gene structure.
Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang
2011-12-15
The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.
Matched-filtering generalized phase contrast using LCoS pico-projectors for beam-forming.
Bañas, Andrew; Palima, Darwin; Glückstad, Jesper
2012-04-23
We report on a new beam-forming system for generating high intensity programmable optical spikes using so-called matched-filtering Generalized Phase Contrast (mGPC) applying two consumer handheld pico-projectors. Such a system presents a low-cost alternative for optical trapping and manipulation, optical lattices and other beam-shaping applications usually implemented with high-end spatial light modulators. Portable pico-projectors based on liquid crystal on silicon (LCoS) devices are used as binary phase-only spatial light modulators by carefully setting the appropriate polarization of the laser illumination. The devices are subsequently placed into the object and Fourier plane of a standard 4f-setup according to the mGPC spatial filtering configuration. Having a reconfigurable spatial phase filter, instead of a fixed and fabricated one, allows the beam shaper to adapt to different input phase patterns suited for different requirements. Despite imperfections in these consumer pico-projectors, the mGPC approach tolerates phase aberrations that would have otherwise been hard to overcome by standard phase projection. © 2012 Optical Society of America
Directory of Open Access Journals (Sweden)
Li Kelvin
2012-11-01
Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus
Valerio, D. A.; Kulhanek, D. K.; Rosenthal, Y.; Holbourn, A. E.
2017-12-01
International Ocean Discovery Program (IODP) Expedition 363 sought to determine the nature of and driving forces behind climate variability in the Western Pacific Warm Pool (WPWP) region throughout the Neogene on millennial, orbital, and geologic timescales. Our research focuses on the Miocene (19-9 Ma) sediment record from IODP Site U1490 to examine changes in carbonate production and burial in the WPWP as a record of variations in the regional/global carbon cycle. This interval is of particular interest because it spans the Middle Miocene Climatic Optimum, the Middle Miocene Climate Transition, and the late Miocene carbonate crash. Site U1490 is located on the northern edge of Eauripik Rise at 05°58.95'N, 142°39.27'E in the northern part of the WPWP. At 2341 m water depth, today the site is bathed in Upper Circumpolar Deepwater. Miocene sediment at Site U1490 primarily consists of clay-bearing to clay-rich foraminifer-rich nannofossil ooze, although biogenic silica (primarily radiolaria) is a significant component in the lowermost part of the record. The sedimentation rate in the early to middle Miocene was very low (calcium carbonate content of 87 wt% throughout the site, with the most significant variations in the lower to middle Miocene, where contents range from 20 to 85 wt%. We collected X-ray fluorescence (XRF) data at 1 cm resolution along the composite stratigraphic section over the 19-9 Ma interval to obtain a qualitative measure of the bulk chemistry of the sediment. We will use the weight percent calcium carbonate of discrete samples to calibrate the XRF data to generate a high-resolution carbonate record. We observe cyclical variations in the Ca/Ba, which may reflect variations in productivity and/or dissolution through this interval, although additional work is needed to fully interpret these data. Ultimately our research will allow for comparison between records obtained from these cores located in the western equatorial Pacific to those obtained
IJ-OpenCV: Combining ImageJ and OpenCV for processing images in biomedicine.
Domínguez, César; Heras, Jónathan; Pascual, Vico
2017-05-01
The effective processing of biomedical images usually requires the interoperability of diverse software tools that have different aims but are complementary. The goal of this work is to develop a bridge to connect two of those tools: ImageJ, a program for image analysis in life sciences, and OpenCV, a computer vision and machine learning library. Based on a thorough analysis of ImageJ and OpenCV, we detected the features of these systems that could be enhanced, and developed a library to combine both tools, taking advantage of the strengths of each system. The library was implemented on top of the SciJava converter framework. We also provide a methodology to use this library. We have developed the publicly available library IJ-OpenCV that can be employed to create applications combining features from both ImageJ and OpenCV. From the perspective of ImageJ developers, they can use IJ-OpenCV to easily create plugins that use any functionality provided by the OpenCV library and explore different alternatives. From the perspective of OpenCV developers, this library provides a link to the ImageJ graphical user interface and all its features to handle regions of interest. The IJ-OpenCV library bridges the gap between ImageJ and OpenCV, allowing the connection and the cooperation of these two systems. Copyright © 2017 Elsevier Ltd. All rights reserved.
Combining Fourier phase encoding and broadband inversion toward J-edited spectra
Lin, Yulan; Guan, Quanshuai; Su, Jianwei; Chen, Zhong
2018-06-01
Nuclear magnetic resonance (NMR) spectra are often utilized for gathering accurate information relevant to molecular structures and composition assignments. In this study, we develop a homonuclear encoding approach based on imparting a discrete phase modulation of the targeted cross peaks, and combine it with a pure shift experiments (PSYCHE) based J-modulated scheme, providing simple 2D J-edited spectra for accurate measurement of scalar coupling networks. Chemical shifts and J coupling constants of protons coupled to the specific protons are demonstrated along the F2 and F1 dimensions, respectively. Polychromatic pulses by Fourier phase encoding were performed to simultaneously detect several coupling networks. Proton-proton scalar couplings are chosen by a polychromatic pulse and a PSYCHE element. Axis peaks and unwanted couplings are complete eradicated by incorporating a selective COSY block as a preparation period. The theoretical principles and the signal processing procedure are laid out, and experimental observations are rationalized on the basis of theoretical analyses.
Low-copy nuclear primers and ycf1 primers in Cactaceae.
Franck, Alan R; Cochrane, Bruce J; Garey, James R
2012-10-01
To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.
Bond strength of compomers to dentin using acidic primers.
Tate, W H; You, C; Powers, J M
1999-10-01
To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.
Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.
2012-01-01
DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820
Computer-generated holographic near-eye display system based on LCoS phase only modulator
Sun, Peng; Chang, Shengqian; Zhang, Siman; Xie, Ting; Li, Huaye; Liu, Siqi; Wang, Chang; Tao, Xiao; Zheng, Zhenrong
2017-09-01
Augmented reality (AR) technology has been applied in various areas, such as large-scale manufacturing, national defense, healthcare, movie and mass media and so on. An important way to realize AR display is using computer-generated hologram (CGH), which is accompanied by low image quality and heavy computing defects. Meanwhile, the diffraction of Liquid Crystal on Silicon (LCoS) has a negative effect on image quality. In this paper, a modified algorithm based on traditional Gerchberg-Saxton (GS) algorithm was proposed to improve the image quality, and new method to establish experimental system was used to broaden field of view (FOV). In the experiment, undesired zero-order diffracted light was eliminated and high definition 2D image was acquired with FOV broadened to 36.1 degree. We have also done some pilot research in 3D reconstruction with tomography algorithm based on Fresnel diffraction. With the same experimental system, experimental results demonstrate the feasibility of 3D reconstruction. These modifications are effective and efficient, and may provide a better solution in AR realization.
GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.
Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart
2011-01-01
The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.
Diversity of internal structures in inhibited epoxy primers
Directory of Open Access Journals (Sweden)
Anthony E. Hughes
2015-10-01
Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.
Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou
2016-11-01
It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.
Energy Technology Data Exchange (ETDEWEB)
Barends, Thomas R. M., E-mail: thomas.barends@mpimf-heidelberg.mpg.de [MPI for Medical Research, Heidelberg (Germany); Brosi, Richard W. W. [Freie Universitat Berlin, Berlin (Germany); Steinmetz, Andrea; Scherer, Anna; Hartmann, Elisabeth; Eschenbach, Jessica; Lorenz, Thorsten [MPI for Medical Research, Heidelberg (Germany); Seidel, Ralf [MPI for Molecular Physiology, Dortmund (Germany); Shoeman, Robert L.; Zimmermann, Sabine [MPI for Medical Research, Heidelberg (Germany); Bittl, Robert [Freie Universitat Berlin, Berlin (Germany); Schlichting, Ilme; Reinstein, Jochen [MPI for Medical Research, Heidelberg (Germany)
2013-08-01
The crystal structure of the N-terminal part of T. thermophilus DnaJ unexpectedly showed an ordered GF domain and guided the design of a construct enabling the first structure determination of a complete DnaJ cochaperone molecule. By combining the crystal structures with spin-labelling EPR and cross-linking in solution, a dynamic view of this flexible molecule was developed. Hsp70 chaperones assist in a large variety of protein-folding processes in the cell. Crucial for these activities is the regulation of Hsp70 by Hsp40 cochaperones. DnaJ, the bacterial homologue of Hsp40, stimulates ATP hydrolysis by DnaK (Hsp70) and thus mediates capture of substrate protein, but is also known to possess chaperone activity of its own. The first structure of a complete functional dimeric DnaJ was determined and the mobility of its individual domains in solution was investigated. Crystal structures of the complete molecular cochaperone DnaJ from Thermus thermophilus comprising the J, GF and C-terminal domains and of the J and GF domains alone showed an ordered GF domain interacting with the J domain. Structure-based EPR spin-labelling studies as well as cross-linking results showed the existence of multiple states of DnaJ in solution with different arrangements of the various domains, which has implications for the function of DnaJ.
Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.
Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela
2014-08-01
Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.
CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.
Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei
2015-07-01
The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.
Bioinformatic tools for PCR Primer design
African Journals Online (AJOL)
ES
reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.
30 CFR 56.6304 - Primer protection.
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...
International Nuclear Information System (INIS)
Nishino, N.; Zang, L.; Takeuchi, M.; Mizuuchi, T.; Ohshima, S.; Kasajima, K.; Sha, M.; Mukai, K.; Lee, H.Y.; Nagasaki, K.; Okada, H.; Minami, T.; Kobayashi, S.; Yamamoto, S.; Konoshima, S.; Nakamura, Y.; Sano, F.
2013-01-01
The hybrid probe system (a combination of Langmuir probes and magnetic probes), fast camera and gas puffing system were installed at the same toroidal section to study edge plasma turbulence/fluctuation in Heliotron J, especially blob (intermittent filament). Fast camera views the location of the probe head, so that the probe system yields the time evolution of the turbulence/fluctuation while the camera images the spatial profile. Gas puff at the same toroidal section was used to control the plasma density and simultaneous gas puff imaging technique. Using this combined system the filamentary structure associated with magnetic fluctuation was found in Heliotron J at the first time. The other kind of fluctuation was also observed at another experiment. This combination measurement enables us to distinguish MHD activity and electro-static activity
KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz
International Nuclear Information System (INIS)
Bowman, Stephen M.
2008-01-01
The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of
U.S. EPA, Pesticide Product Label, HORNET, 12/05/1995
2011-04-21
... 0dr):!~~t \\)tlt~ (1) i)rtnt~u COt:-)' 01 your linc!J i_,[int-~l! l~':~t:l~.L:': !(fl'-,ct-:'rl'.j r-hi_~ Lco;/ nC~J·,l('; t-'rior t( ... (t'l(asir.I'. it i 0 r S II i i- J~! ent • ...
Numerical modelling of the V-J combinations of the T cell receptor TRA/TRD locus.
Directory of Open Access Journals (Sweden)
Florence Thuderoz
2010-02-01
Full Text Available T-Cell antigen Receptor (TR repertoire is generated through rearrangements of V and J genes encoding alpha and beta chains. The quantification and frequency for every V-J combination during ontogeny and development of the immune system remain to be precisely established. We have addressed this issue by building a model able to account for Valpha-Jalpha gene rearrangements during thymus development of mice. So we developed a numerical model on the whole TRA/TRD locus, based on experimental data, to estimate how Valpha and Jalpha genes become accessible to rearrangements. The progressive opening of the locus to V-J gene recombinations is modeled through windows of accessibility of different sizes and with different speeds of progression. Furthermore, the possibility of successive secondary V-J rearrangements was included in the modelling. The model points out some unbalanced V-J associations resulting from a preferential access to gene rearrangements and from a non-uniform partition of the accessibility of the J genes, depending on their location in the locus. The model shows that 3 to 4 successive rearrangements are sufficient to explain the use of all the V and J genes of the locus. Finally, the model provides information on both the kinetics of rearrangements and frequencies of each V-J associations. The model accounts for the essential features of the observed rearrangements on the TRA/TRD locus and may provide a reference for the repertoire of the V-J combinatorial diversity.
Numerical Modelling Of The V-J Combinations Of The T Cell Receptor TRA/TRD Locus
Dariz, Aurélie; Baum, Thierry Pascal; Hierle, Vivien; Demongeot, Jacques; Marche, Patrice Noël; Jouvin-Marche, Evelyne
2010-01-01
T-Cell antigen Receptor (TR) repertoire is generated through rearrangements of V and J genes encoding α and β chains. The quantification and frequency for every V-J combination during ontogeny and development of the immune system remain to be precisely established. We have addressed this issue by building a model able to account for Vα-Jα gene rearrangements during thymus development of mice. So we developed a numerical model on the whole TRA/TRD locus, based on experimental data, to estimate how Vα and Jα genes become accessible to rearrangements. The progressive opening of the locus to V-J gene recombinations is modeled through windows of accessibility of different sizes and with different speeds of progression. Furthermore, the possibility of successive secondary V-J rearrangements was included in the modelling. The model points out some unbalanced V-J associations resulting from a preferential access to gene rearrangements and from a non-uniform partition of the accessibility of the J genes, depending on their location in the locus. The model shows that 3 to 4 successive rearrangements are sufficient to explain the use of all the V and J genes of the locus. Finally, the model provides information on both the kinetics of rearrangements and frequencies of each V-J associations. The model accounts for the essential features of the observed rearrangements on the TRA/TRD locus and may provide a reference for the repertoire of the V-J combinatorial diversity. PMID:20174554
The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings
Energy Technology Data Exchange (ETDEWEB)
Lech, L.M. [DuPont, Parkersburg, WV (United States)
1999-11-01
Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.
Serber, Robert
2018-01-01
Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.
DEFF Research Database (Denmark)
Lund, Anders Henrik; Duch, M; Lovmand, J
1997-01-01
, but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....
Nanotechnology: A Policy Primer
2013-06-24
savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT
Takubo, Chikako; Yasuda, Genta; Murayama, Ryosuke; Ogura, Yukari; Tonegawa, Motoka; Kurokawa, Hiroyasu; Miyazaki, Masashi
2010-08-01
We used ultrasonic measurements to monitor the influence of power density and primer application on the polymerization reaction of dual-cured resin cements. The ultrasonic equipment comprised a pulser-receiver, transducers, and an oscilloscope. Resin cements were mixed and inserted into a transparent mould, and specimens were placed on the sample stage, onto which the primer, if used, was also applied. Power densities of 0 (no irradiation), 200, or 600 mW cm(-2) were used for curing. The transit time through the cement disk was divided by the specimen thickness to obtain the longitudinal sound velocity. When resin cements were light-irradiated, each curve displayed an initial plateau of approximately 1,500 m s(-1), which rapidly increased to a second plateau of 2,300-2,900 m s(-1). The rate of sound velocity increase was retarded when the cements were light-irradiated at lower power densities, and increased when the primer was applied. The polymerization behaviour of dual-cured resin cements was therefore shown to be affected by the power density of the curing unit and the application of self-etching primer. (c) 2010 The Authors. Journal compilation (c) 2010 Eur J Oral Sci.
Shinohara, Ayano; Taira, Yohsuke; Sakihara, Michino; Sawase, Takashi
2018-01-01
Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study.
International Nuclear Information System (INIS)
Flude, J.W.; Nicholas, J.R.
1991-04-01
This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs
Huang, Chien-Hsun; Chang, Mu-Tzu; Huang, Lina; Chu, Wen-Shen
2015-12-01
This study described the use of species-specific PCR in combination with SNaPshot mini-sequencing to achieve species identification and strain differentiation in Lactobacillus rhamnosus. To develop species-specific PCR and strain subtyping primers, the dnaJ gene was used as a target, and its corresponding sequences were analyzed both in Lb. rhamnosus and in a subset of its phylogenetically closest species. The results indicated that the species-specific primer pair was indeed specific for Lb. rhamnosus, and the mini-sequencing assay was able to unambiguously distinguish Lb. rhamnosus strains into different haplotypes. In conclusion, we have successfully developed a rapid, accurate and cost-effective assay for inter- and intraspecies discrimination of Lb. rhamnosus, which can be applied to achieve efficient quality control of probiotic products. Copyright © 2015 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Ni, Chun Chun
2009-11-16
Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.
Chapman, J.; Kulhanek, D. K.; Rosenthal, Y.; Holbourn, A. E.
2017-12-01
International Ocean Discovery Program (IODP) Expedition 363 sought to determine the nature of and driving forces behind climate variability in the Western Pacific Warm Pool (WPWP) region throughout the Neogene on millennial, orbital, and geologic timescales. Our research focuses on the Pliocene to recent (4-0 Ma) sediment record from IODP Site U1490 to examine changes in carbonate production and burial in the WPWP as a record of variations in the regional/global carbon cycle. This interval is of particular interest because it spans the Middle Pliocene Warm Period, the initiation of Northern Hemisphere Glaciation, and the Mid-Pleistocene Transition. Site U1490 is located on the northern edge of Eauripik Rise at 05°58.95'N, 142°39.27'E in the northern part of the WPWP. At 2341 m water depth, today the site is bathed in Upper Circumpolar Deepwater. Pliocene to recent sediment primarily consists of foraminifer-rich nannofossil ooze, with the sedimentation rate varying between 1.5 and 3 cm/kyr. Initial shipboard measurement of calcium carbonate content shows little variation at low resolution (1 sample every few meters), varying between 90 and 95 wt%. We collected X-ray fluorescence (XRF) data at 2 cm resolution along the composite stratigraphic section to obtain a qualitative measure of the bulk chemistry of the sediment. We will use the weight percent calcium carbonate of discrete samples to calibrate the XRF data to generate a high-resolution carbonate record. We observe cyclical variations in the Ca/Ba, which may reflect variations in productivity and/or dissolution through this interval, although additional work is needed to fully interpret these data. Ultimately our research will allow for comparison between records obtained from these cores located in the western equatorial Pacific to those obtained in the eastern and central Pacific, which will better elucidate the nature of the carbon system during the Plio-Pleistocene.
The compleat strategyst being a primer on the theory of games of strategy
Williams, J D
1986-01-01
When J. D. Williams wrote this entertaining, witty introduction for the nonscientist, Game Theory was still a somewhat mysterious subject familiar to very few scientists beyond those researchers, like himself, working for the military. Now, over thirty years after its original publication as a Rand Corporation research study, his light-hearted though thoroughly effective primer is the recognized classic introduction to an increasingly applicable discipline. Used by amateurs, professionals, and students throughout the world in the classroom, on the job, and for personal amusement, the book has
Martínez Guardiola, Francisco Javier; Márquez Ruiz, Andrés; Gallego Rico, Sergi; Ortuño Sánchez, Manuel; Francés Monllor, Jorge; Pascual Villalobos, Inmaculada; Beléndez Vázquez, Augusto
2015-01-01
Recientemente demostramos una técnica de caracterización, la polarimetría de Stokes promedio, que permite obtener tanto el retardo en función del voltaje como la amplitud del flicker que presentan muchas pantallas de cristal líquido sobre silicio de alineación paralela (PA-LCoS). En este trabajo mostramos que conociendo ambas magnitudes podemos simular y diseñar elementos ópticos de fase multinivel para ser enviados a la pantalla PALCoS, con una muy buena capacidad predictiva. Financiado p...
Leung, T. K. Daisy; Riechers, Dominik A.
2016-02-01
We report the detection of CO(J = 3 \\to 2) line emission in the strongly lensed submillimeter galaxy (SMG) SMM J0939+8315 at z = 2.221, using the Combined Array for Research in Millimeter-wave Astronomy. SMM J0939+8315 hosts a type-2 quasar, and is gravitationally lensed by the radio galaxy 3C220.3 and its companion galaxy at z = 0.685. The 104 GHz continuum emission underlying the CO line is detected toward 3C220.3 with an integrated flux density of Scont = 7.4 ± 1.4 mJy. Using the CO(J = 3 \\to 2) line intensity of ICO(3-2) = (12.6 ± 2.0) Jy km s-1, we derive a lensing- and excitation-corrected CO line luminosity of {L}{{CO(1-0)}}\\prime = (3.4 ± 0.7) × 1010 (10.1/μL) K km s-1 pc2 for the SMG, where μL is the lensing magnification factor inferred from our lens modeling. This translates to a molecular gas mass of Mgas = (2.7 ± 0.6) × 1010 (10.1/μL) M⊙. Fitting spectral energy distribution models to the (sub)-millimeter data of this SMG yields a dust temperature of T = 63.1{}-1.3+1.1 K, a dust mass of Mdust = (5.2 ± 2.1) × 108 (10.1/μL) M⊙, and a total infrared luminosity of LIR = (9.1 ± 1.2) ×1012 (10.1/μL) L⊙. We find that the properties of the interstellar medium of SMM J0939+8315 overlap with both SMGs and type-2 quasars. Hence, SMM J0939+8315 may be transitioning from a starbursting phase to an unobscured quasar phase as described by the “evolutionary link” model, according to which this system may represent an intermediate stage in the evolution of present-day galaxies at an earlier epoch.
High-speed measurement of firearm primer blast waves
Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy
2012-01-01
This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...
Hexavalent Chromium IV-Free Primer Development
Alldredge, Michael J.; Buck, Amy L.
2015-01-01
Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.
Directory of Open Access Journals (Sweden)
Christopher Ryan Penton
2013-09-01
Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.
Multiplexing Short Primers for Viral Family PCR
Energy Technology Data Exchange (ETDEWEB)
Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W
2008-06-26
We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.
International Nuclear Information System (INIS)
Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh
2013-01-01
To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)
KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input
International Nuclear Information System (INIS)
Busch, R.D.
2003-01-01
The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a
Primer on spontaneous heating and pyrophoricity
Energy Technology Data Exchange (ETDEWEB)
1994-12-01
This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.
30 CFR 57.6304 - Primer protection.
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...
Características de emprendimiento social de los jóvenes en estudios previos a los universitarios
Lopez de Toro, Cristobal
2014-01-01
El presente Trabajo de Fin de Máster pretende indagar en las características del emprendimiento social en jóvenes en estudios previso a los universitarios. Para ellos en primer lugar se plantea el marco teórico general, mediante la revisión de varios estudios que profundizan en el concepto de emprendimiento social. En un primer apartado analizamos la conceptualización del emprendimiento social. Para ello comenzamos revisando las características del emprendimiento, con independencia de su v...
Directory of Open Access Journals (Sweden)
Daniella Abello Luque
2016-01-01
Full Text Available Este estudio evaluó el perfil cognitivo y los niveles de desesperanza, depresión y riesgo suicida en un grupo de jóvenes vinculados al proceso de formación de una escuela militar colombiana. En total participaron 114 sujetos, militares regulares de primer año (MR-1A, que representan la totalidad de un contingente particular; todos ellos hombres, con edades entre los diecisiete y los veintidós años, provenientes de hogares ubicados en la región Caribe (41% y el centro del país (12%, sin ningún tipo de diagnóstico médico o mental relevante. Los resultados indican relaciones lineales y directamente promocionales entre todas las variables, con magnitudes significativas en lo referente a las relaciones depresión-desesperanza (rs= 0,295; ρ= 0,01 y depresión-riesgo suicida (rs= 0,478; ρ= 0,01, siendo esta ultima el reporte más elevado.
3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.
Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong
2008-09-01
We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.
Jing, Weifang; Zhou, Jinrun; Wang, Chunyang; Qiu, Jianhua; Guo, Huijun; Li, Hongmei
2018-04-26
This study focuses on preparing the secretory recombinant J subgroup of avian leukosis virus (ALV-J) gp85 protein using Pichia pastoris and evaluating its immunoprotection as vaccine antigen combining with CpG-ODN adjuvant. The secretory recombinant plasmid pPIC9-gp85 containing ALV-J gp85 gene was designed and was transfected into the genome of P. pastoris (GS115) cells. The recombinant plasmid was expressed under the induction of methanol. The expressed products in the medium of the cells were purified and identified with endoglycosidase digestion assay and western blot mediated with monoclonal antibody (MAb) JE9. The purified product combining with CpG-ODN adjuvant was inoculated intramuscularly into 7-day-old chickens and three booster inoculations were performed on 21 days post first inoculation (dpfi), 42, and 56 dpfi. The antibody responses and cellular immune responses were detected, and the protective effects were analyzed after challenge with ALV-J. The results showed that the secretory pPIC9-gp85 plasmid was successfully constructed and could be stably expressed in GS115 cells. The expressed products were N-acetylglucosylated and could specifically combine with MAb (JE9). The secreted gp85 protein combining with CpG-ODN adjuvant could induce higher antibody response and spleen lymphocyte proliferation response and IFN-γ-inducing response, and could protect all the inoculated chickens against the viremia and the immunosuppressive lesions caused by ALV-J challenge. The results of neutralizing test in vitro suggested that the antisera with some ALV-J antibody titers could neutralize ALV-J strain and inhibit the growth of virus in vitro. The result of IFA showed that IgG antibody in the antisera could specifically combine with ALV-J strain in cells. It can be concluded that the secretory recombinant gp85 protein, as a new acetylglucosylated gp85 protein, was successfully prepared and combining with CpG-ODN adjuvant could protect the inoculated chickens
Rust transformation/rust compatible primers
Emeric, Dario A.; Miller, Christopher E.
1993-01-01
Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.
An iterative method for selecting degenerate multiplex PCR primers.
Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong
2007-01-01
Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.
Directory of Open Access Journals (Sweden)
Dunn Sade N
2008-06-01
Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.
Directory of Open Access Journals (Sweden)
Christopher A Gulvik
Full Text Available Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies. Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI's BLAST (De-MetaST-BLAST, the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications.
Bioinformatic tools and guideline for PCR primer design | Abd ...
African Journals Online (AJOL)
Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...
International Nuclear Information System (INIS)
Piguet, F.; Carrasco, M.; Mourlevat, J.L.; Rio, G.; Verneret, C.
2006-01-01
In order to comply with the needs of Utilities for improvements in the economic competitiveness of nuclear energy, one of the solutions proposed is to reduce the cost of the fuel cycle. To this aim, increasing the lifetime of cycles by introducing so-called 'low leakage' fuel loading patterns to the reactor is a rather promising solution. However, these loading patterns lead to an increase in the core hotspot factors and therefore to a reduction in the operating margins with respect to the core operating limits also called 'Limiting Conditions of Operations (LCO)'. For many years FRAMATOME-ANP has developed and proposed solutions aiming at increasing and therefore restoring these margins, namely: the improvement in design methods based on three-dimensional modelling of the core, on kinetic representation of transients and on neutron-thermohydraulic coupling or the improvement in the fuel with the introduction of intermediate grids. A complementary approach is to improve the core instrumentation associated with the system for monitoring the core operating margins to the LCO thresholds. The core operating limits monitoring function calls on real-time knowledge of the current power distribution in the core. If we take the French 1300 MWe units as an example, this knowledge is based on the measurement of the mean axial power distribution made by six sections neutron detectors, located outside the pressure vessel and equipped with a fast neutron filtering device. The results of this measurement are combined with pre-tabulated radial hotspot factors (Fxy), in order to calculate the total hotspot factor (FQ) of the core, the minimum Departure from Nucleate Boiling Ratio (DNBR) and, consequently, the margins with respect to the core operating limits. The limitations of a measurement made outside the vessel, and those of the 1D/2D modelling adopted, mean that these margins calculations have a high potential for improving the level of their accuracy. This is the reason why
Discrete random signal processing and filtering primer with Matlab
Poularikas, Alexander D
2013-01-01
Engineers in all fields will appreciate a practical guide that combines several new effective MATLAB® problem-solving approaches and the very latest in discrete random signal processing and filtering.Numerous Useful Examples, Problems, and Solutions - An Extensive and Powerful ReviewWritten for practicing engineers seeking to strengthen their practical grasp of random signal processing, Discrete Random Signal Processing and Filtering Primer with MATLAB provides the opportunity to doubly enhance their skills. The author, a leading expert in the field of electrical and computer engineering, offe
Medium Caliber Lead-Free Electric Primer. Version 2
2012-09-01
2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in
International Nuclear Information System (INIS)
Adeniyi, Adebayo A.; Ajibade, Peter A.
2015-01-01
The qualitative and quantitative quality of DFT methods combined with different basis sets in computing the J-coupling of the types 1 J(C–F) and n J(F–F) are investigated for the fluorobenzene and fluoropyridine derivatives. Interestingly, all of the computational methods perfectly reproduced the experimental order for n J(F–F) but many failed to reproduce the experimental order for 1 J(C–F) coupling. The functional PBEPBE gives the best quantitative values that are closer to the experimental spin–spin coupling when combined with the basis sets aug-cc-pVDZ and DGDZVP but is also part of the methods that fail to perfectly reproduce the experimental order for the 1 J(C–F) coupling. The basis set DGDZVP combined with all the methods except with PBEPBE perfectly reproduces the 1 J(C–F) experimental order. All the methods reproduce either the positive or the negative sign of the experimental spin–spin coupling except for the basis set 6-31+G(d,p) which fails to reproduce the experimental positive value of 3 J(F–F) regardless of what type of DFT methods was used. The values of the FC term is far higher than all other Ramsey terms in the one bond 1 J(C–F) coupling but in the two, three and four bonds n J(F–F) the values of PSO and SD are higher. - Graphical abstract: DFT methods were used to compute the J-coupling of molecules benf, benf2, benf2c, benf2c2, pyrf, pyrfc and pyrfc2, and are presented. Right combination of DFT functional with basis set can reproduce high level EOM-CCSD and experimental J-coupling results. All the methods can reproduce the qualitative order of the experimental J-coupling but not all reproduce the quantitative. The best quantitative results were obtained from PBEPBE combined with the high basis set aug-cc-pVDZ Also, PBEPBE combines with lower basis set DGDZVP to give a highly similar value. - Highlights: • DFT methods were used to compute the J-coupling of the molecules. • Right combination of DFT functional with basis
Simple sequence repeat marker loci discovery using SSR primer.
Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David
2004-06-12
Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/
Value for money assessment for public-private partnerships : a primer.
2015-01-01
This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.
SUPERCONDUCTING COMBINED FUNCTION MAGNET SYSTEM FOR J-PARC NEUTRINO EXPERIMENT
International Nuclear Information System (INIS)
2004-01-01
The J-PARC Neutrino Experiment, the construction of which starts in JFY 2004, will use a superconducting magnet system for its primary proton beam line. The system, which bends the 50 GeV 0.75 MW proton beam by about 80 degrees, consists of 28 superconducting combined function magnets. The magnets utilize single layer left/right asymmetric coils that generate a dipole field of 2.6 T and a quadrupole field of 18.6 T/m with the operation current of about 7.35 kA. The system also contains a few conduction cooled superconducting corrector magnets that serve as vertical and horizontal steering magnets. All the magnets are designed to provide a physical beam aperture of 130 mm in order to achieve a large beam acceptance. Extensive care is also required to achieve safe operation with the high power proton beam. The paper summarizes the system design as well as some safety analysis results
Economics : pricing, demand, and economic efficiency : a primer.
2008-11-01
The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...
Antoniou, Grigoris; Harmelen, Frank van
2004-01-01
The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a
Energy Technology Data Exchange (ETDEWEB)
Dan Arthur; Bruce Langhus; Jon Seekins
2005-05-25
During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of
Quick spacecraft charging primer
International Nuclear Information System (INIS)
Larsen, Brian Arthur
2014-01-01
This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.
Climate Change, Health, and Communication: A Primer.
Chadwick, Amy E
2016-01-01
Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.
Marketing Information Products and Services : A Primer for ...
International Development Research Centre (IDRC) Digital Library (Canada)
Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...
Can previous acid etching increase the bond strength of a self-etching primer adhesive to enamel?
Directory of Open Access Journals (Sweden)
Ana Paula Morales Cobra Carvalho
2009-06-01
Full Text Available Because a greater research effort has been directed to analyzing the adhesive effectiveness of self etch primers to dentin, the aim of this study was to evaluate, by microtensile testing, the bond strength to enamel of a composite resin combined with a conventional adhesive system or with a self-etching primer adhesive, used according to its original prescription or used with previous acid etching. Thirty bovine teeth were divided into 3 groups with 10 teeth each (n= 10. In one of the groups, a self-etching primer (Clearfil SE Bond - Kuraray was applied in accordance with the manufacturer's instructions and, in the other, it was applied after previous acid etching. In the third group, a conventional adhesive system (Scotchbond Multipurpose Plus - 3M-ESPE was applied in accordance with the manufacturer's instructions. The results obtained by analysis of variance revealed significant differences between the adhesive systems (F = 22.31. The self-etching primer (Clearfil SE Bond presented lower enamel bond strength values than the conventional adhesive system (Scotchbond Multipurpose Plus (m = 39.70 ± 7.07 MPa both when used according to the original prescription (m = 27.81 ± 2.64 MPa and with previous acid etching (m = 25.08 ± 4.92 MPa.
An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET
Energy Technology Data Exchange (ETDEWEB)
Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)
2011-01-15
Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.
Microsatellite primers for fungus-growing ants
DEFF Research Database (Denmark)
Villesen, Palle; Gertsch, P J; Boomsma, JJ
2002-01-01
We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....
Microsatellite Primers for Fungus-Growing Ants
DEFF Research Database (Denmark)
Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)
2002-01-01
We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....
Mastan, Shaik G.
2011-05-10
Jatropha curcas L., a multipurpose shrub, has acquired significant economic importance for its seed oil which can be converted to biodiesel an emerging alternative to petro-diesel. In addition to the commercial value, it is also having medicinal and even high nutritional value to use as animal fodder which is limited due to the toxicity. Development of molecular marker will enable to differentiate non-toxic from toxic variety of J. curcas in a mixed population and also for quality control since the toxic components of J. curcas has deleterious effect on animals. In the present study, the efforts were made to generate the specific SCAR marker for toxic and/or non-toxic J. curcas from RAPD markers. Among the markers specific for toxic and non-toxic varieties, four were selected, purified, cloned, sequenced, and designed primers out of which one set of primers NT-JC/SCAR I/OPQ15-F and R could able to discriminate the non-toxic with toxic Jatropha by giving expected 430 bp size amplification in non-toxic variety. Furthermore, novel multiplex PCR was designed using the nrDNA ITS primers to overcome the false negatives. Present work also demonstrates utility of the conserved regions of nrDNA coding genes in ruling out the artifacts in PCR-like false negatives frequently occur in SCAR due to various reasons. The specific SCAR markers generated in the present investigation will help to distinguish non-toxic from toxic varieties of J. curcas or vice versa, and isolated marker along with designed multiplex protocol has applications in quality control for selective cultivation of non-toxic variety and will also assist in breeding and molecular mapping studies. © 2011 Springer Science+Business Media, LLC.
Low–intermediate–high confinement transition in HL-2A tokamak plasmas
International Nuclear Information System (INIS)
Cheng, J.; Dong, J.Q.; Yan, L.W.; Hong, W.Y.; Zhao, K.J.; Huang, Z.H.; Ji, X.Q.; Zhong, W.L.; Yu, D.L.; Nie, L.; Song, X.M.; Yang, Q.W.; Ding, X.T.; Duan, X.R.; Liu, Yong; Itoh, K.; Itoh, S.-I.; Zou, X.L.
2014-01-01
The dynamics of low–intermediate–high confinement transitions was studied using a four-step Langmuir probe in the HL-2A edge plasma. Two types (dubbed type-Y and type-J) of limit cycle oscillations (LCOs) with opposite temporal ordering between the radial electric field and turbulence were first observed. In type-Y, the turbulence grows first, followed by the localized electric field. In contrast, the electric field leads turbulence in type-J. In addition, the Reynolds stress gradient is found not enough to drive the LCO flow and the three-wave nonlinear coupling is weak there. The continuously increasing amplitude of magnetic fluctuations and the significant correlation between the magnetic fluctuation and the electron pressure gradient indicate an important role of diamagnetic drifts in the L–H transition. Mode numbers of magnetic fluctuations in the LCO frequency are identified to be m/n = 1/0. (paper)
Culturas juveniles y trabajo social con jóvenes
Directory of Open Access Journals (Sweden)
GLADYS CASTIBLANCO-LEMUS
2008-01-01
Full Text Available Este trabajo tiene como propósito señalar algunas implicaciones teóricas y practicas de la relación entre la categoría culturas juveniles, concretamente desde los resultados del proyecto de investigación: Identidades juveniles: Música y producción cultural. Etnografía de agrupaciones Rave y hip hop rap en Bogotá y un conjunto de premisas conceptuales del trabajo social con jóvenes. Para tal efecto se abordarán tres aspectos: en primer lugar, se presenta una síntesis del proyecto destacando los más importantes resultados; en segundo lugar se plantean los referentes conceptuales que permiten establecer la relación y finalmente se señalan algunas pistas para incorporar otros contenidos para la actuación profesional con jóvenes.
DEFF Research Database (Denmark)
Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P
2007-01-01
BACKGROUND: The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine...... primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution...
A physicists guide to The Los Alamos Primer
International Nuclear Information System (INIS)
Reed, B Cameron
2016-01-01
In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)
International Nuclear Information System (INIS)
Kumar, A.V.R.; Nigam, R.K.
1998-01-01
The phase analysis of the rusts generated beneath the primer containing micaceous iron oxide (MIO) and micaceous iron oxide in combination with red lead (RL), zinc phosphate (ZP), basic lead silicochromate (BLSC) and zinc chromate (ZC) has been carried out by Moessbauer spectroscopy at room temperature. The rust beneath the coating obtained after immersion of the painted panel for six months in 3% NaCl, consists mainly of non-stoichiometric magnetite together with small fractions of γ-, α-FeOOH except in the case of panel painted with RL containing MIO showed only a central doublet indicating the formation of γ-FeOOH and SPM α-FeOOH. Non-stoichiometry of magnetite as calculated from the ratio of B/A sites of the peaks of magnetite in the spectrum has been found depending on the nature of anticorrosive pigment present in the primer coating. The order of non-stoichiometry has been found to be in order of ZC > BLSC > ZP > MIO. (author)
Nanoscopic and Photonic Ultrastructural Characterization of Two Distinct Insulin Amyloid States
Directory of Open Access Journals (Sweden)
Mikael Lindgren
2012-02-01
Full Text Available Two different conformational isoforms or amyloid strains of insulin with different cytotoxic capacity have been described previously. Herein these filamentous and fibrillar amyloid states of insulin were investigated using biophysical and spectroscopic techniques in combination with luminescent conjugated oligothiophenes (LCO. This new class of fluorescent probes has a well defined molecular structure with a distinct number of thiophene units that can adopt different dihedral angles depending on its binding site to an amyloid structure. Based on data from surface charge, hydrophobicity, fluorescence spectroscopy and imaging, along with atomic force microscopy (AFM, we deduce the ultrastructure and fluorescent properties of LCO stained insulin fibrils and filaments. Combined total internal reflection fluorescence microscopy (TIRFM and AFM revealed rigid linear fibrous assemblies of fibrils whereas filaments showed a short curvilinear morphology which assemble into cloudy deposits. All studied LCOs bound to the filaments afforded more blue-shifted excitation and emission spectra in contrast to those corresponding to the fibril indicating a different LCO binding site, which was also supported by less efficient hydrophobic probe binding. Taken together, the multi-tool approach used here indicates the power of ultrastructure identification applying AFM together with LCO fluorescence interrogation, including TIRFM, to resolve structural differences between amyloid states.
Chinchilla-Brenes, Sonia; Sánchez-Oller, Sylvia
2001-01-01
Proyecto de Investigación El problema de la deserción estudiantil es un fenómeno mundial que involucra principalmente a alumnos de primer ingreso a los centros educativos y de manera particular a las instituciones de educación superior las cuales reportan índices de deserción de alrededor del 30% en el primer año. Ante esta situación se hace necesaria la atención de la población de primer ingreso con programas específicos que acompañen a los y las estudiantes en este proceso de ajuste al m...
RUCS: Rapid identification of PCR primers for unique core sequences
DEFF Research Database (Denmark)
Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik
2017-01-01
Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...
Do we need primer for orthodontic bonding? A randomized controlled trial.
Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R
2015-04-01
To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown
Directory of Open Access Journals (Sweden)
Roberts WE
2015-09-01
Full Text Available Wendy E Roberts,1 Lily I Jiang,2 James H Herndon Jr3 1Generational and Cosmetic Dermatology, Rancho Mirage, CA, 2Thomas J Stephens and Associates, Richardson, 3Dermatology Center of Dallas, Dallas, TX, USA Background: Photoaged skin results from various environmental factors, most importantly chronic sun exposure. Dyschromia and fine lines/wrinkles are common clinical manifestations of photodamaged skin. Purpose: This single-center clinical trial was conducted to assess the efficacy and tolerability of a new multifunctional facial primer (camouflage, broad-spectrum SPF 50, and a treatment for hyperpigmentation when used by females with mild-to-moderate facial hyperpigmentation and fine lines due to photoaging over a course of 12 weeks. Patients and methods: Subjects were provided test material (Even Up-Clinical Pigment Perfector and supporting products to use on their face and neck. Products were used according to specific application instructions. Clinical grading for efficacy and tolerability assessments were performed by an expert grader at baseline, baseline (post-application primer, week 4, week 8, week 12, and week 12 (post-application primer. Standardized digital photographs were taken, and self-assessment questionnaires were conducted. Results: Twenty-eight female subjects completed the 12-week trial. The facial primer improved scores for the appearance of hyperpigmentation and other photoaging parameters immediately after the first application. The treatment also showed a progressive improvement in the clinical assessment of hyperpigmentation and other photoaging parameters over the 12-week trial. These long-term benefits can be attributed to an improvement in the underlying skin condition. The facial primer was well tolerated. Subject questionnaires showed that the product was highly rated at all visits. Conclusion: The facial primer was shown to be effective and well tolerated for immediate and long-term improvement in the appearance
Primer on consumer marketing research : procedures, methods, and tools
1994-03-01
The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...
Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum
Directory of Open Access Journals (Sweden)
Ma Xiaoying
2017-02-01
Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.
Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.
Directory of Open Access Journals (Sweden)
Andrea Fuso
Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.
Criticality calculations with MCNP trademark: A primer
International Nuclear Information System (INIS)
Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.
1994-01-01
With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand
UniPrime2: a web service providing easier Universal Primer design.
Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C
2009-07-01
The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.
Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.
Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis
2018-03-01
Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.
Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok
2018-03-01
We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.
Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings
DEFF Research Database (Denmark)
Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere
2014-01-01
, either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...
A database of PCR primers for the chloroplast genomes of higher plants
Heinze, Berthold
2007-01-01
Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828
A database of PCR primers for the chloroplast genomes of higher plants
Directory of Open Access Journals (Sweden)
Heinze Berthold
2007-02-01
Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.
Precariedad laboral de jóvenes asalariados en la ciudad de Toluca, 2005-2010
Directory of Open Access Journals (Sweden)
Yuliana Gabriela Román-Sánchez
2015-01-01
Full Text Available El nuevo contexto laboral está caracterizado por la precarización de la mano de obra, problema que afecta sobre todo a los jóvenes. Bajo este preámbulo, el objetivo del artículo es analizar las condiciones laborales de la población asalariada en la ciudad de Toluca desde una perspectiva de género. De manera precisa, se pretende estimar diferentes niveles de la precariedad laboral según grandes grupos de edad, así como de hombres y mujeres entre los 14 y 29 años de edad. Esto se realizó a través de la estimación del Índice de Precariedad Laboral con datos de la Encuesta Nacional de Ocupación y Empleo (enoe del primer trimestre de 2005 y primer trimestre de 2010.
The ability of T2/B4 primers to detect Leishmania infantum among ...
African Journals Online (AJOL)
SERVER
2008-04-03
Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...
Universal primers that amplify RNA from all three flavivirus subgroups
Directory of Open Access Journals (Sweden)
Barnard Ross T
2008-01-01
Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.
Elkins, Kelly M.; Kadunc, Raelynn E.
2012-01-01
In this laboratory experiment, real-time polymerase chain reaction (real-time PCR) was conducted using published human TPOX single-locus DNA primers for validation and various student-designed short tandem repeat (STR) primers for Combined DNA Index System (CODIS) loci. SYBR Green was used to detect the amplification of the expected amplicons. The…
Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.
Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G
2013-09-01
New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.
An evaluation of corrosion protection by two epoxy primers on 2219-T87 and 7075-T73 aluminum
Mendrek, M. J.
1992-01-01
A comparison of the corrosion protection provided by two amine epoxy primers was made using salt fog, alternate immersion, and total immersion as exposure media. The study is the result of a request to use an unqualified low volatile organic carbon (VOC) primer (AKZO 463-6-78) in place of the current primer (AKZO 463-6-3) because environmental regulations have eliminated use of the current primer in many states. Primed, scribed samples of 2219-T87 and 7075-T73 aluminum were exposed to 5-percent NaCl salt fog and 3.5-percent NaCl alternate immersion for a period of 90 days. In addition, electrode samples immersed in 3.5-percent NaCl were tested using electrochemical impedance spectroscopy (EIS). The EG&G model 368 ac impedance measurement system was used to monitor changing properties of AKZO 463-6-78 and AKZO 463-6-3 primed 2219-T87 aluminum for a period of 30 days. The response of the corroding system of a frequency scan can be modeled in terms of an equivalent circuit consisting of resistors and capacitors in a specific arrangement. Each resistor/capacitor combination represents physical processes taking place within the electrolyte, at the electrolyte/primer surface, within the coating, and at the coating/substrate surface. Values for the resistors and capacitors are assigned following a nonlinear least squares fit of the data to the equivalent circuit. Changes in the values of equivalent circuit parameters during the 30-day exposure allow assessment of the time to and mechanism of coating breakdown.
Strain effect on the magnetic and transport properties of LaCoO3 thin films
Li, Y.; Peng, S. J.; Wang, D. J.; Wu, K. M.; Wang, S. H.
2018-05-01
LaCoO3 (LCO) has attracted much attention due to the unique magnetic transition and spin transition of Co3+ ions. Epitaxial LCO film exhibits an unexpected ferromagnetism, in contrast to the non-magnetism of bulk LCO. An in-depth study on the property of strained LCO film is of great importance. We have fabricated 30 nm LCO films on various substrates and studied the magnetic and transport properties of films in different strain states (compressed strain for LCO/LaAlO3, tensile strain for LCO/(LaAlO3)0.3(Sr2TaAlO6)0.35, SrTiO3). The in-plane tensiled LCO films exhibit ferromagnetic ground state at 5K and magnetic transition with TC around 85K, while compressed LCO/LaAlO3 film has a negligibly small moment signal. Our results reveal that in-plane tensile strain and tetragonal distortion are much more favorable for stabilizing the FM order in LCO films.
Directory of Open Access Journals (Sweden)
Ni Luh Putu Indi Dharmayanti
2016-07-01
Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.
Design of a Percussion and Electric Primer Gun Firing Power Supply
2014-07-01
solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply
Joining X-Ray to Lensing: An Accurate Combined Analysis of MACS J0416.1–2403
Energy Technology Data Exchange (ETDEWEB)
Bonamigo, M.; Grillo, C. [Dark Cosmology Centre, Niels Bohr Institute, University of Copenhagen, Juliane Maries Vej 30, DK-2100 Copenhagen (Denmark); Ettori, S. [INAF, Osservatorio Astronomico di Bologna, Via Piero Gobetti, 93/3, 40129 Bologna (Italy); Caminha, G. B.; Rosati, P. [Dipartimento di Fisica e Scienze della Terra, Università degli Studi di Ferrara, Via Saragat 1, I-44122 Ferrara (Italy); Mercurio, A. [INAF—Osservatorio Astronomico di Capodimonte, Via Moiariello 16, I-80131 Napoli (Italy); Annunziatella, M. [INAF—Osservatorio Astronomico di Trieste, Via G.B. Tiepolo, 11 I-34143 Trieste (Italy); Balestra, I. [University Observatory Munich, Scheinerstrasse 1, D-81679 Munich (Germany); Lombardi, M., E-mail: bonamigo@dark-cosmology.dk [Dipartimento di Fisica, Università degli Studi di Milano, via Celoria 16, I-20133 Milano (Italy)
2017-06-20
We present a novel approach for a combined analysis of X-ray and gravitational lensing data and apply this technique to the merging galaxy cluster MACS J0416.1–2403. The method exploits the information on the intracluster gas distribution that comes from a fit of the X-ray surface brightness and then includes the hot gas as a fixed mass component in the strong-lensing analysis. With our new technique, we can separate the collisional from the collision-less diffuse mass components, thus obtaining a more accurate reconstruction of the dark matter distribution in the core of a cluster. We introduce an analytical description of the X-ray emission coming from a set of dual pseudo-isothermal elliptical mass distributions, which can be directly used in most lensing softwares. By combining Chandra observations with Hubble Frontier Fields imaging and Multi Unit Spectroscopic Explorer spectroscopy in MACS J0416.1–2403, we measure a projected gas-to-total mass fraction of approximately 10% at 350 kpc from the cluster center. Compared to the results of a more traditional cluster mass model (diffuse halos plus member galaxies), we find a significant difference in the cumulative projected mass profile of the dark matter component and that the dark matter over total mass fraction is almost constant, out to more than 350 kpc. In the coming era of large surveys, these results show the need of multiprobe analyses for detailed dark matter studies in galaxy clusters.
Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R
2013-06-06
Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.
Neuberger, Ulf; Kickingereder, Philipp; Helluy, Xavier; Fischer, Manuel; Bendszus, Martin; Heiland, Sabine
2017-12-01
Non-invasive detection of 2-hydroxyglutarate (2HG) by magnetic resonance spectroscopy is attractive since it is related to tumor metabolism. Here, we compare the detection accuracy of 2HG in a controlled phantom setting via widely used localized spectroscopy sequences quantified by linear combination of metabolite signals vs. a more complex approach applying a J-difference editing technique at 9.4T. Different phantoms, comprised out of a concentration series of 2HG and overlapping brain metabolites, were measured with an optimized point-resolved-spectroscopy sequence (PRESS) and an in-house developed J-difference editing sequence. The acquired spectra were post-processed with LCModel and a simulated metabolite set (PRESS) or with a quantification formula for J-difference editing. Linear regression analysis demonstrated a high correlation of real 2HG values with those measured with the PRESS method (adjusted R-squared: 0.700, pJ-difference editing method (adjusted R-squared: 0.908, pJ-difference editing method however had a significantly higher explanatory value over the regression model with the PRESS method (pJ-difference editing 2HG was discernible down to 1mM, whereas with the PRESS method 2HG values were not discernable below 2mM and with higher systematic errors, particularly in phantoms with high concentrations of N-acetyl-asparate (NAA) and glutamate (Glu). In summary, quantification of 2HG with linear combination of metabolite signals shows high systematic errors particularly at low 2HG concentration and high concentration of confounding metabolites such as NAA and Glu. In contrast, J-difference editing offers a more accurate quantification even at low 2HG concentrations, which outweighs the downsides of longer measurement time and more complex postprocessing. Copyright © 2017. Published by Elsevier GmbH.
Energy Technology Data Exchange (ETDEWEB)
Neuberger, Ulf; Fischer, Manuel; Heiland, Sabine [Univ. of Heidelberg Medical Center, Heidelberg (Germany). Dept. of Neuroradiology; Univ. of Heidelberg Medical Center, Heidelberg (Germany). Div. of Experimental Radiology; Kickingereder, Philipp; Bendszus, Martin [Univ. of Heidelberg Medical Center, Heidelberg (Germany). Dept. of Neuroradiology; Helluy, Xavier [Bochum Univ. (Germany). Dept. of Biopsychology
2017-07-01
Non-invasive detection of 2-hydroxyglutarate (2HG) by magnetic resonance spectroscopy is attractive since it is related to tumor metabolism. Here, we compare the detection accuracy of 2HG in a controlled phantom setting via widely used localized spectroscopy sequences quantified by linear combination of metabolite signals vs. a more complex approach applying a J-difference editing technique at 9.4 T. Different phantoms, comprised out of a concentration series of 2HG and overlapping brain metabolites, were measured with an optimized point-resolved-spectroscopy sequence (PRESS) and an in-house developed J-difference editing sequence. The acquired spectra were post-processed with LCModel and a simulated metabolite set (PRESS) or with a quantification formula for J-difference editing. Linear regression analysis demonstrated a high correlation of real 2HG values with those measured with the PRESS method (adjusted R-squared: 0.700, p < 0.001) as well as with those measured with the J-difference editing method (adjusted R-squared: 0.908, p < 0.001). The regression model with the J-difference editing method however had a significantly higher explanatory value over the regression model with the PRESS method (p < 0.0001). Moreover, with J-difference editing 2HG was discernible down to 1 mM, whereas with the PRESS method 2HG values were not discernable below 2 mM and with higher systematic errors, particularly in phantoms with high concentrations of N-acetyl-asparate (NAA) and glutamate (Glu). In summary, quantification of 2HG with linear combination of metabolite signals shows high systematic errors particularly at low 2HG concentration and high concentration of confounding metabolites such as NAA and Glu. In contrast, J-difference editing offers a more accurate quantification even at low 2HG concentrations, which outweighs the downsides of longer measurement time and more complex postprocessing.
Comparison of shear bond strength of orthodontic brackets using various zirconia primers.
Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju
2015-07-01
The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.
Bioinformatic tools for PCR Primer design
African Journals Online (AJOL)
ES
Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.
Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples
Directory of Open Access Journals (Sweden)
Alexandre R. Zuntini
2013-08-01
Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.
Maldonado-Avila, Miguel; Garduno-Arteaga, Leopoldo; Jungfermann-Guzman, Rene; Manzanilla-Garcia, Hugo A; Rosas-Nava, Emmanuel; Procuna-Hernandez, Nestor; Vela-Mollinedo, Alejandro; Almazan-Trevino, Luis; Guzman-Esquivel, Jose
2016-01-01
Indwelling double J ureteral stents are used routinely in the resolution of ureteral obstruction caused by different etiologies. Evaluation of urinary symptoms related to double-J stent, indicate that these affect 73-90% of patients. We conducted a prospective, randomized study, to evaluate the efficacy of tamsulosin, oxybutinin and combination therapy in improving the urinary symptoms. Patients who underwent ureteral stent placement after ureterolithotripsy (total 51), were randomized into three groups: Group I: Tamsulosin 0.4 mg. Once per day(17 patients), Group II: Oxybutinin 5 mg. once per day (17 patients), Group III: Tamsulosin+ oxybutynin once per day (17 patients). All the groups received the drugs for three weeks and completed a Spanish validated Ureteral Stent Symptom Questionnaire (USSQ) at day 7 and 21. Repeated measures ANOVA showed mean urinary symptom index score was 22.3 vs. 15.5 in group three (ptamsulosin group, the mean sexual score was 0.5 vs 1.5 (p=0.03). Among additional problems the mean was 7.2 vs 6.2 (p=0.03). No significant difference was noted among pain and general health index. No side effects were reported. Combination therapy with tamsulosin and oxybutynin improved irritative symptoms and work performance as well as sexual matters. Combination therapy should be considered for patients who complained of stent related symptoms.
Real-time PCR (qPCR) primer design using free online software.
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.
Yetter, Carol J.
2009-01-01
This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…
DNA Extraction and Primer Selection
DEFF Research Database (Denmark)
Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads
Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...
International Nuclear Information System (INIS)
Moriyasu, K.
1981-01-01
A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)
Tools for Ultraspecific Probe/Primer Design
National Research Council Canada - National Science Library
Fofanov, Yurly
2006-01-01
.... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...
Preparation and Characterization of Acrylic Primer for Concrete Substrate Application
Directory of Open Access Journals (Sweden)
El-Sayed Negim
2016-01-01
Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.
Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael
2014-01-01
Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...
Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae
Directory of Open Access Journals (Sweden)
Francesco Dal Grande
2013-03-01
Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.
40 CFR 63.745 - Standards: Primer and topcoat application operations.
2010-07-01
... CATEGORIES (CONTINUED) National Emission Standards for Aerospace Manufacturing and Rework Facilities § 63.745.../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g... (4.5 lb/gal) of primer (less water and exempt solvents), as applied, for general aviation rework...
Cheng, Yu-Huei
2014-12-01
Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.
The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.
Zellweger, Polle T.; Mackinlay, Jock D.
A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…
Targeted reduction of highly abundant transcripts using pseudo-random primers.
Arnaud, Ophélie; Kato, Sachi; Poulain, Stéphane; Plessy, Charles
2016-04-01
Transcriptome studies based on quantitative sequencing can estimate levels of gene expression by measuring target RNA abundance in sequencing libraries. Sequencing costs are proportional to the total number of sequenced reads, and in order to cover rare RNAs, considerable quantities of abundant and identical reads are needed. This major limitation can be addressed by depleting a proportion of the most abundant sequences from the library. However, such depletion strategies involve either extra handling of the input RNA sample or use of a large number of reverse transcription primers, termed not-so-random (NSR) primers, which are costly to synthesize. Taking advantage of the high tolerance of reverse transcriptase to mis-prime, we found that it is possible to use as few as 40 pseudo-random (PS) reverse transcription primers to decrease the rate of undesirable abundant sequences within a library without affecting the overall transcriptome diversity. PS primers are simple to design and can be used to deplete several undesirable RNAs simultaneously, thus creating a flexible tool for enriching transcriptome libraries for rare transcript sequences.
Defense Primer: DOD Contractors
2017-02-10
functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel
Freshwater Wetlands: A Citizen's Primer.
Catskill Center for Conservation and Development, Inc., Hobart, NY.
The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…
Quantitative Microbial Risk Assessment Tutorial - Primer
This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...
A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics
DEFF Research Database (Denmark)
Busk, Peter Kamp
2014-01-01
of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...
F. J. Eller; Carol A. Clausen; Frederick Green; S.L. Taylor
2010-01-01
Eastern red cedar (Juniperus virginiana L.) is an abundant renewable resource and represents a vast potential source of valuable natural products that may serve as natural biocides. Both the wood and needles from J. virginiana were extracted using liquid carbon dioxide (L-CO2) as well as ethanol (EtOH) and the yields determined.Woodblocks were...
Sensory reception of the primer pheromone ethyl oleate
Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang
2012-05-01
Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.
The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers
Danford, M. D.; Mendrek, M. J.; Walsh, D. W.
1995-01-01
The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.
Nakamoto, Tatsushi; Anerella, Michael; Escallier, John; Fujii, T; Fukui, Yuji; Ganetis, George; Gupta, Ramesh C; Harrison, Michael; Hashiguchi, E; Higashi, Norio; Ichikawa, Atsuko; Iwamoto, Yosuke; Jain, Animesh K; Kanahara, T; Kimura, Nobuhiro; Kobayashi, Takashi; Makida, Yasuhiro; Muratore, Joseph F; Obana, Tetsuhiro; Ogitsu, T; Ohhata, Hirokatsu; Okamura, T; Orikasa, T; Parker, Brett; Sasaki, Ken Ichi; Takasaki, Minoru; Tanaka, Ken Ichi; Terashima, Akio; Tomaru, Takayuki; Wanderer, Peter; Yamamoto, Akira
2005-01-01
A second generation of long-baseline neutrino oscillation experiments has been proposed as one of the main projects at J-PARC jointly built by JAERI and KEK. Superconducting combined function magnets, SCFMs, will be utilized for the 50 GeV, 750 kW proton beam line for the neutrino experiment and an R&D program is in underway at KEK. The magnet is designed to provide a combined function of a dipole field of 2.6 T with a quadrupole field of 19 T/m in a coil aperture of 173.4 mm. A series of 28 magnets in the beam line will be operated DC in supercritical helium cooling below 5 K. A design feature of the SCFM is the left-right asymmetry of the coil cross section: current distributions for superimposed dipole- and quadrupole- fields are combined in a single layer coil. Another design feature is the adoption of glass-fiber reinforced phenolic plastic spacers to replace the conventional metallic collars. To evaluate this unique design, fabrication of full-scale prototype magnets is in progress at KEK and the fi...
PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.
Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong
2015-01-01
Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.
GST-PRIME: an algorithm for genome-wide primer design.
Leister, Dario; Varotto, Claudio
2007-01-01
The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.
Lichens-a new source or yet unknown host of herbaceous plant viruses?
Czech Academy of Sciences Publication Activity Database
Petrzik, Karel; Vondrák, Jan; Barták, M.; Peksa, O.; Kubešová, Olga
2014-01-01
Roč. 138, č. 3 (2014), s. 549-559 ISSN 0929-1873 R&D Projects: GA ČR GAP501/12/1747 Institutional support: RVO:60077344 ; RVO:67985939 Keywords : Rhabdovirus * Ilarvirus * Lichenized fungi * ApMV Subject RIV: EE - Microbiology, Virology; EF - Botanics (BU-J) Impact factor: 1.490, year: 2014
Energy Technology Data Exchange (ETDEWEB)
Ranade, Shirish A; Srivastava, Anuj P; Srivastava, Jyoti; Tuli, Rakesh [PMB Division, National Botanical Research Institute, Rana Pratap Marg, Lucknow 226 001, U.P. (India); Rana, Tikam S [Plant Biodiversity and Conservation Biology Division, National Botanical Research Institute, Rana Pratap Marg, Lucknow 226 001, U.P. (India)
2008-06-15
Jatropha curcas L. (physic nut) has drawn attention in recent years as a source of seed oil that can provide an economically viable substitute for diesel. Very little work on provenance trials and genetic resources of J. curcas L. has been reported so far. Though J. curcas grows widely in India and several collections of the plant are also maintained, pedigree and provenance records are not always available. This article reports our studies on the diversity amongst the accessions of J. curcas L., both amongst already held collections as well as from a few locations in the wild. Two single-primer amplification reaction (SPAR) methods were used for this purpose. The accessions from the North East were most distant from all other accessions in UPGMA analysis. The NBRI, Bhubaneshwar and Lalkuan accessions were more related to each other. The UPGMA tree clearly shows well-separated accession groups: NBRI, Bhubaneshwar, North East, Lalkuan and Outgroup. The study suggests that this relatively recently introduced plant species shows adequate genetic diversity in India and that the SPAR methods are useful for a rapid assessment of the same. The methods provide important tools for analyzing the diversity within the available collections to shortlist the parental lines for adaptability trials and further improvement of Jatropha plants. (author)
Rull, Anna; Martínez-Bujidos, Maria; Pérez-Cuellar, Montserrat; Pérez, Antonio; Ordóñez-Llanos, Jordi; Sánchez-Quesada, José Luis
2015-08-01
Clusterin/apolipoprotein J (apoJ) circulates in blood in part associated to lipoproteins or in unbound form. When bound to HDL, apoJ is antiatherogenic by inhibiting endothelial cell apoptosis; thus, any factor modifying apoJ association to HDL would decrease its antiatherogenic function. However, the exact distribution of apoJ in each lipoprotein fraction, or in lipoprotein-non bound form has not been specifically investigated either in normolipemia or in dyslipemia. Basic lipid profile and apoJ concentration were determined in sera from 70 subjects, including a wide range of cholesterol and triglyceride concentrations. Lipoproteins were isolated by ultracentrifugation and their lipid and apolipoprotein composition was assessed. In the overall population, serum apoJ positively associated with cholesterol, triglyceride and VLDL-C concentrations, and HDL-C and triglyceride were independent predictors of increased apoJ concentration. Approximately, 20.5% of circulating apoJ was associated with lipoproteins (18.5% HDL, 0.9% LDL and 1.1% VLDL) and 79.5% was not bound to lipoproteins. Serum apoJ concentration was higher in hypercholesterolemic (HC), hypertriglyceridemic (HTG) and combined hyperlipidemic (CHL) sera compared to normolipemic (NL) sera (HC, 98.15 ± 33.6 mg/L; HTG, 103.3 ± 36.8 mg/L; CHL, 131.7 ± 26.8 mg/L; NL, 66.7 ± 33.8 mg/L; P lipoproteins in the NL group whereas this proportion rounded 15% in hyperlipidemic subjects. Our findings indicate that hyperlipidemia increases the concentration of apoJ in serum but, in turn, the content of lipoprotein-associated apoJ decreases. The redistribution of apoJ in hyperlipidemia could compromise the antiatherogenic properties of HDL. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
DEFF Research Database (Denmark)
Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine
2015-01-01
) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...
Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.
Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe
2018-01-17
In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.
Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer
Directory of Open Access Journals (Sweden)
Helen Hencida Thangamony
2018-01-01
Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.
Ekstrom, Claus Thorn
2011-01-01
Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i
Directory of Open Access Journals (Sweden)
Miguel Maldonado-Avila
2016-06-01
Full Text Available ABSTRACT Introduction and objective Indwelling double J ureteral stents are used routinely in the resolution of ureteral obstruction caused by different etiologies. Evaluation of urinary symptoms related to double-J stent, indicate that these affect 73-90% of patients. We conducted a prospective, randomized study, to evaluate the efficacy of tamsulosin, oxybutinin and combination therapy in improving the urinary symptoms. Methods Patients who underwent ureteral stent placement after ureterolithotripsy (total 51, were randomized into three groups: Group I: Tamsulosin 0.4 mg. once per day(17 patients, Group II: Oxybutinin 5 mg. once per day (17 patients, Group III: Tamsulosin+ oxybutynin once per day (17 patients. All the groups received the drugs for three weeks and completed a Spanish validated Ureteral Stent Symptom Questionnaire (USSQ at day 7 and 21. Results Repeated measures ANOVA showed mean urinary symptom index score was 22.3 vs. 15.5 in group three (p<0.001 at day 7 and 21 respectively. The mean work performance index was 6.6 vs 8.1 (p=0.049 favoring tamsulosin group, the mean sexual score was 0.5 vs 1.5 (p=0.03. Among additional problems the mean was 7.2 vs 6.2 (p=0.03. No significant difference was noted among pain and general health index. No side effects were reported. Conclusions Combination therapy with tamsulosin and oxybutynin improved irritative symptoms and work performance as well as sexual matters. Combination therapy should be considered for patients who complained of stent related symptoms.
THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY
Directory of Open Access Journals (Sweden)
Prima Ditahardiyani
2008-01-01
Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.
Galkiewicz, Julia P; Kellogg, Christina A
2008-12-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.
Galkiewicz, Julia P.; Kellogg, Christina A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.
Molecular passportization of clones of karelian birch using PCRwith semi-specific primers
Directory of Open Access Journals (Sweden)
Tatyana V Matveeva
2008-09-01
Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.
Galkiewicz, Julia P.; Kellogg, Christina A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299
Specific primer design of mitochondrial 12S rRNA for species identification in raw meats
Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.
2018-01-01
Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.
El primer virreinato americano
Directory of Open Access Journals (Sweden)
Cassá, Roberto
2006-12-01
Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the
logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.
El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.
Sediment transport primer: estimating bed-material transport in gravel-bed rivers
Peter Wilcock; John Pitlick; Yantao Cui
2009-01-01
This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...
Caetano-Anollés, G; Gresshoff, P M
1996-06-01
DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.
Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae
Directory of Open Access Journals (Sweden)
Andrew L. Krohn
2013-07-01
Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.
In vivo effect of a self-etching primer on dentin.
Milia, E; Lallai, M R; García-Godoy, F
1999-08-01
To determine the ultrastructural aspects of the dentin collagen area in the cavity preparation floor produced in vivo after phosphoric acid acid-etching or after using Clearfil Liner Bond 2 self-etching primer (LB2 Primer). Twenty-four non-carious third molars scheduled for extraction from young adult patients (16-30 years old) were used. Conventional Class I cavities (+/- 2 mm deep) were prepared on the occlusal surfaces of all teeth using a cylindrical diamond bur on a high-speed handpiece with copious water spray. To avoid dehydration of the dentin, the smear layer-covered dentin was briefly air-dried for 2 seconds. Cavities were assigned at random to the following groups: Group A: Dentin etched for 15 seconds with 34% phosphoric acid, rinsed for 20 seconds and then briefly air-dried for 2 seconds with oil-free compressed air leaving the surfaces slightly moist. Group B: LB2 Primer was applied to the cavity surfaces for 30 seconds and then briefly air-dried to remove the solvent. Group C: The untreated dentin smear layer was used as a control. In all three groups, the cavities were filled incrementally with a resin-based composite (APX), light curing every increment for 40 seconds. After 30 minutes, the teeth were extracted atraumatically and the samples immediately prepared for evaluation with the transmission electron microscope. The use of a self-etching primer did not produce significant morphological changes in the moist dentin substrate. Adverse morphological conditions where observed when there was an excess water on the dentin surface. Phosphoric acid altered the collagen more severely than the self-etching primer.
Characteristics of the population employed in primer sector in Turkey
Directory of Open Access Journals (Sweden)
Bayar Rüya
2006-01-01
Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.
Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito
2012-01-01
Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625
Directory of Open Access Journals (Sweden)
Essam Shalaby
2013-01-01
Full Text Available Purpose. We evaluated the effectiveness and safety of tamsulosin, solifenacin, and combination of both in reducing double-J stent-related lower urinary symptoms. Materials and Methods. A total of 338 patients with double-J ureteral stenting were randomly divided, postoperatively, into 4 groups. In group I (, no treatment was given (control group, group II ( received tamsulosin 0.4 mg daily, group III ( received solifenacin 10 mg daily, and group IV ( received a combination of both medications. Before insertion and 2 weeks after, all patients completed the International Prostate Symptom Score (IPSS, quality of life component of the IPSS (IPSS/Qol, Overactive Bladder Questionnaire (OAB-q, and Visual Analogue Pain Scale (VAPS questionnaire. Results. The demographics and preoperative questionnaires scores of all groups were comparable. There were statistically significant differences in all scores in favour of groups II, III, and IV as compared to control group ( value < 0.005. Group IV showed statistically significant differences in total IPSS, QoL score, and OAB-q score as compared to groups II and III ( value < 0.001. Conclusions. Combined therapy of tamsulosin and solifenacin significantly alleviated lower urinary symptoms associated with double-J stents as compared to either medication alone.
Menopause 101: A Primer for the Perimenopausal
... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...
Directory of Open Access Journals (Sweden)
Martin Beránek
2012-01-01
Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.
Polak, Jan; Shimoda, Larissa A.; Drager, Luciano F.; Undem, Clark; McHugh, Holly; Polotsky, Vsevolod Y.; Punjabi, Naresh M.
2013-01-01
. Intermittent hypoxia impairs glucose homeostasis in C57BL6/J mice: partial improvement with cessation of the exposure. SLEEP 2013;36(10):1483-1490. PMID:24082307
Genus-Specific Primers for Study of Fusarium Communities in Field Samples
Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna
2015-01-01
Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387
Galkiewicz, J.P.; Kellogg, C.A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.
Joint cost of energy under an optimal economic policy of hybrid power systems subject to uncertainty
International Nuclear Information System (INIS)
Díaz, Guzmán; Planas, Estefanía; Andreu, Jon; Kortabarria, Iñigo
2015-01-01
Economical optimization of hybrid systems is usually performed by means of LCoE (levelized cost of energy) calculation. Previous works deal with the LCoE calculation of the whole hybrid system disregarding an important issue: the stochastic component of the system units must be jointly considered. This paper deals with this issue and proposes a new fast optimal policy that properly calculates the LCoE of a hybrid system and finds the lowest LCoE. This proposed policy also considers the implied competition among power sources when variability of gas and electricity prices are taken into account. Additionally, it presents a comparative between the LCoE of the hybrid system and its individual technologies of generation by means of a fast and robust algorithm based on vector logical computation. Numerical case analyses based on realistic data are presented that valuate the contribution of technologies in a hybrid power system to the joint LCoE. - Highlights: • We perform the LCoE calculation with the stochastic component jointly considered. • We propose a fast an optimal policy that minimizes the LCoE. • We compare the obtained LCoEs by means of a fast and robust algorithm. • We take into account the competition among gas prices and electricity prices
Cryer, CW
2014-01-01
Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula
Majid, Shahn
2002-05-01
Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.
Directory of Open Access Journals (Sweden)
Wang Xiaowei
2008-12-01
Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.
Digiaro, Michele; Elbeaino, Toufic; Martelli, Giovanni Paolo
2007-04-01
Based on the nucleotide sequence homology of RNA-1 and RNA-2 of nepoviruses isolated from grapevines, three sets of degenerate primers, one for each of the three subgroups of the genus (A, B and C), were designed and proved effective for RT-PCR detection of subgroups in infected grapevines and herbaceous hosts. Primers designed specifically for detecting subgroup A species amplified a fragment of 255 bp from samples infected by Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Tobacco ringspot virus (TRSV) and Grapevine deformation virus (GDefV), but not from samples infected by other nepovirus species. Similarly, primers for detection of subgroup B nepoviruses amplified a 390 bp product from samples infected by Grapevine chrome mosaic virus (GCMV), Tomato black ring virus (TBRV), Grapevine Anatolian ringspot virus (GARSV) and Artichoke Italian latent virus (AILV). The third set of primers amplified a 640 bp fragment, only from samples infected by subgroup C nepoviruses, i.e Tomato ringspot virus (ToRSV) Grapevine Bulgarian latent virus (GBLV), and Grapevine Tunisian ringspot virus (GTRSV). These primers were able to detect simultaneously all viral species belonging to the same subgroup and to discriminate species of different subgroups. Multiplex-PCR detection of subgroup A and B nepoviruses was obtained using a specific primer (sense for subgroup A and antisense for subgroup B) for each of the species of the same subgroup in combination with the degenerate subgroup-specific primers. In this way it was possible to detect four different viral species in single samples containing mixtures of viruses of the same subgroup. In particular, for viruses of subgroup A (TRSV, GFLV, ArMV and GDefV) amplicons of 190, 259, 301 and 371 bp were obtained, whereas amplicons of 190, 278, 425 and 485 bp, respectively, were obtained from samples infected with viruses of subgroup B (GCMV, AILV, GARSV and TBRV).
Identificación partidaria de los jóvenes mexicanos en el proceso electoral 2012
Aguilar López, Jesús
2015-01-01
Estudiar el comportamiento electoral de los ciudadanos permite entender la continuidad y el cambio en los procesos políticos. Por su peso en el padrón electoral y por las características de su participación electoral, los jóvenes mexicanos representan un objeto de estudio de primer orden para entender los procesos de cambio político en el país. Tomando como base los datos que ofrece la Encuesta Nacional sobre Cultura Política de los Jóvenes 2012, se analizan los diferentes componentes que inf...
Scrimer: designing primers from transcriptome data
Czech Academy of Sciences Publication Activity Database
Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.
2015-01-01
Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015
Prunier, Rachel; Latimer, Andrew
2010-01-01
Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.
Profitability primer: a guide to profitability analysis in the electric power industry
International Nuclear Information System (INIS)
Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.
1996-06-01
As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated
Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G
2017-02-01
To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.
Temas de Física para Ingeniería: Primer principio de la termodinámica
Beléndez Vázquez, Augusto
1992-01-01
Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.
A primer on motor vehicle air pollution.
1973-01-01
This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...
Primer on CDM programme of activities
Energy Technology Data Exchange (ETDEWEB)
Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)
2009-07-01
As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)
Forest Interpreter's Primer on Fire Management.
Zelker, Thomas M.
Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…
Designing for transportation management and operations : a primer.
2013-02-01
This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...
Evaluation of genetic diversity in open pollinated guava by iPBS primers
International Nuclear Information System (INIS)
Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.
2013-01-01
DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)
The UVM primer a step-by-step introduction to the universal verification methodology
Salemi, Ray
2013-01-01
The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.
A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets
Energy Technology Data Exchange (ETDEWEB)
Warwick, William M.
2002-06-03
This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.
Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.
Françoso, E; Arias, M C
2013-09-01
Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.
Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo
Castillo Canales, Braulio
2017-01-01
En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...
Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer
Energy Technology Data Exchange (ETDEWEB)
Lucas, D.S.
2004-10-03
This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.
Móvil remisión de V. cinta del primer móvil.
2011-01-01
[ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.
Kim, John E; Beckthold, Brenda; Chen, Zhaoxia; Mihowich, Jennifer; Malloch, Laurie; Gill, Michael John
2007-11-01
The presence of HIV-1 non-B subtypes is increasing worldwide. This poses challenges to commercial diagnostic and viral load (RNA) monitoring tests that are predominantly based on HIV-1 subtype B strains. Based on phylogenetic analysis of the gag, pol, and env gene regions, we describe the first HIV-1 H/J recombinant in Canada that presented divergent viral load values. DNA sequence analysis of the gag gene region further revealed that genetic diversity between this H/J recombinant and the primers and probes used in the bio-Merieux Nuclisens HIV-1 QT (Nuclisens) and Roche Amplicor Monitor HIV-1, v1.5 (Monitor) viral RNA assays can erroneously lead to undetectable viral load values. This observation appears to be more problematic in the Nuclisens assay. In light of increasing genetic diversity in HIV worldwide we recommend that DNA sequencing of HIV, especially in the gag gene region targeted by primers and probes used in molecular diagnostic and viral load tests, be incorporated into clinical monitoring practices.
Leopold, Luna Bergere; Langbein, Walter Basil
1960-01-01
When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to
Energy Technology Data Exchange (ETDEWEB)
Zhang, Xuan; Zhang, Xiaofeng; Yan, Yue; Zhong, Yanli; Li, Lei; Zhang, Guanli [Beijing Institute of Aeronautical Materials (BIAM), Haidian District, Beijing, 100095 (China)
2015-04-01
A silicone-based primer layer was developed to improve the adhesion and thermal stability of amorphous transparent indium zinc oxide (IZO) films on polycarbonate (PC). The IZO films deposited by direct current magnetron sputtering at room temperature on primer-treated and untreated PCs were evaluated ex situ in terms of surface morphology, adhesion, optical, and electrical properties during annealing at 120 C in air. Nano-scratch tests indicated the adhesion of IZO films on primer-treated substrates was superior to that on untreated PCs. This superior adhesion can be attributed to the strong Si-O-Si inorganic bonds abundant in the primer layer and better matches of the primer layer in the terms of thermal expansion to the IZO. Moreover, the electrical resistivity of IZO films prepared on primer-treated PCs remained stable during the annealing treatment, whereas those of IZO films on untreated PCs presented a continuously increasing trend, which was attributed to the decrease in carrier concentration that resulted from oxygen adsorption. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
Mahoney, Anne M; Stimpson, Claudia L; Scott, Karen L; Hampson, Neil B
2007-12-01
The diffusing capacity of the lungs for carbon monoxide (D(LCO)) is commonly measured during pulmonary function testing (PFT). Although adjustment of the measured D(LCO) for an elevated baseline carboxyhemoglobin level is recommended, carboxyhemoglobin is not routinely measured, which may reduce the accuracy of D(LCO) measurements. We sought to assess the utility of routine carboxyhemoglobin measurement and subsequent D(LCO) correction in patients referred for PFT. We retrospectively reviewed 100 consecutive PFT results, including D(LCO) assessment. We used a pulse CO-oximeter (recently approved by the Food and Drug Administration) to noninvasively measure baseline carboxyhemoglobin (S(pCO)). We used simple descriptive statistics to compare the S(pCO) values. In subjects with elevated S(pCO) (> 2%) we adjusted the percent-of-predicted D(LCO). Interpretation of D(LCO) was categorized according to the American Thoracic Society classification scheme for respiratory impairment. The self-reported smokers had higher average S(pCO) than did self-reported nonsmokers (1.6% vs 3.5%, p carboxyhemoglobin is easy to perform during PFT. When precise measurement of D(LCO) is important, noninvasive measurement of carboxyhemoglobin may be of value. If routine S(pCO) measurement is considered, the highest yield is among current smokers.
Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen
2015-09-01
Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.
Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants
Directory of Open Access Journals (Sweden)
Aleksić Jelena M.
2016-01-01
Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005
D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto
2018-02-01
Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.
Leonhardt, U.
2001-01-01
Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...
Sheu, Sen-Je; Hwang, Wen-zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang
2009-01-01
PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf). The specificity of these four primer sets were confirmed by PCR with 88 bacterial strains of Lactobacillus, Enterococcus, Bifidobacterium, and other bacterial species. Results indicated that these primer sets generated predicted PCR products of 397, 230, 202, and 161 bp for L. acidophilus, L. delbrueckii, L. casei group, and B. longum, respectively. Bacterial species other than the target organisms tested did not generate false-positive results. When these four primer sets were combined for the simultaneous detection of the lactic acid bacteria (LAB) in fermented milk products including yogurt, the LAB species listed on the labels of these products could be identified without the preenrichment step. The identification limit for each LAB strain with this multiplex PCR method was N X 10(3) CFU/ml in milk samples. The results of our multiplex PCR method were confirmed by PCR assay using primers based on the 16S rDNA or the 16S-23S intergenic spacer region and by biochemical tests using the API 50 CHL kit. When this multiplex PCR method was used with the determination of counts of total viable LAB and bifidobacteria, the quality of commercial fermented milk products could be assured.
Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers
DEFF Research Database (Denmark)
Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.
2011-01-01
BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...
The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy
Energy Technology Data Exchange (ETDEWEB)
Lu Xiangyu [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zuo Yu, E-mail: zuoy@mail.buct.edu.c [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zhao Xuhui; Tang Yuming; Feng Xingguo [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China)
2011-01-15
Research highlights: {yields} A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. {yields} The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. {yields} EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R{sub ct} at the magnesium particle/coating interface decreased and the double-layer capacitance Q{sub dl} increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH){sub 2} in the coating also provided some degree of barrier protection.
The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy
International Nuclear Information System (INIS)
Lu Xiangyu; Zuo Yu; Zhao Xuhui; Tang Yuming; Feng Xingguo
2011-01-01
Research highlights: → A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. → The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. → EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R ct at the magnesium particle/coating interface decreased and the double-layer capacitance Q dl increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH) 2 in the coating also provided some degree of barrier protection.
Liu, Xiaojing; Locasale, Jason W
2017-04-01
Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Jonathan M. LaMantia
2018-04-01
Full Text Available Interspecific hybridization has been attempted to combine the heat and drought of Poa arachnifera Torr. with the turf quality characteristics of several Poa species. Confirmation of an F1 hybrid through morphological analysis of vegetative and flowering characteristics is often time consuming and ambiguous. Ent-kaurene oxidase (KO has been sequenced in rice, barley, and wheat. In rice, each of the five copies of KO gene has unique lengths for the first intron. Conserved intron spanning primers (CISP can be used as a DNA marker to exploit variations of intron lengths that flank conserved gene sequences. In the present study, we developed CISP to sequence partial genomic fragments of the KO gene from seven Poa species. Through sequence analysis, species-specific primers were also developed to produce co-dominant markers that can be used to identify interspecific hybrids between Texas bluegrass and six other Poa species used in the present study.
Fernández Santoyo, María Karla; Soto Patiño, Juan Carlos
2017-01-01
La deserción de los alumnos en México es un fenómeno que se da en gran medida, y con un mayor nivel de abandono en el primer año de estudios en las Instituciones de Nivel Superior. Por tanto, es fundamental conocer los motivos que llevan a los jóvenes a no concluir una carrera universitaria, para encontrar las mejores estrategias para afrontar de la mejor manera este fenómeno. Bajo este contexto el siguiente trabajo tiene como objetivo analizar las tendencias de los motivos de deserción en lo...
Directory of Open Access Journals (Sweden)
David L Nordstrom
2012-06-01
Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.
Directory of Open Access Journals (Sweden)
Diana Sari
2015-05-01
Full Text Available AbstrakDismenore primer merupakan nyeri menstruasi yang dijumpai tanpa kelainan yang nyata pada alat-alat genital. Lebih dari 50% wanita mengalami dismenore primer dan 15% diantaranya mengalami nyeri yang hebat.Tujuan penelitian ini adalah untuk menentukan hubungan tingkat stres dengan derajat dismenore primer. Penelitian dilakukan pada mahasiswi pendidikan dokter Fakultas Kedokteran Universitas Andalas angkatan 2009 dan 2010. Desain penelitian ini menggunakan cross sectional study dengan jumlah subjek 165 orang. Pengumpulan data dari responden dilakukan dengan wawancara terpimpin (pengisian kuesioner. Analisa statistik yang digunakan adalah uji chi-square dan uji koefisien korelasi sederhana. Uji chi-square menunjukan ada hubungan yang bermakna antara stres dengan kejadian dismenore primer dan uji statistik koefisien korelasi sederhana menunjukkan ada hubungan yang bermakna dengan korelasi agak lemah antara tingkat stres dengan derajat dismenore primer.Kata kunci: stres, dismenore primer, mahasiswi fakultas kedokteran AbstractPrimary dysmenorrhoea is menstrual pain founded without real abnormalities in genital organs. More than 50% woman experiance it and 15% had severe pain. The objective of this study was to determine relationship between stress and primary dysmenorrhoea. Research was executed to education medical female students medical faculty of Andalas University class of 2009 and 2010. This research use cross sectional study design with 165 subjects. Data was collected by guided interview. Statistic analysis use chi-square test and simple correlation test. Chi-square test show there is significant relationship between stress and primary dysmenorrhoea and simple coefficient test show there is weak correlation between stress levels and degree of primary dysmenorrhoea.Keywords: stress, primary dysmenorrhoea, female student of medical faculty
Qualification and Flight Test of Non-Chrome Primers for C-130 Aircraft
2011-08-17
system Significant hexavalent chrome reduction in finish system Potential exposure level of spray applied chromated conversion coating not as...Lockheed Martin Aeronautics Company Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft Scott Jones Lockheed Martin...00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft 5a. CONTRACT NUMBER 5b. GRANT
Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E
2001-04-01
Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.
Energy Technology Data Exchange (ETDEWEB)
Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.
2013-06-28
Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource
International Nuclear Information System (INIS)
Jothikumar, N.; Hill, Vincent R.
2013-01-01
Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource
Single primer amplification reaction methods reveal exotic and ...
Indian Academy of Sciences (India)
Unknown
mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...
Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas
2016-01-01
Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic
Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders
Energy Technology Data Exchange (ETDEWEB)
Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.
2000-09-27
This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.
Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders
Energy Technology Data Exchange (ETDEWEB)
A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson
1998-12-10
This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.
Summary of the primer on tumor immunology and the biological therapy of cancer
Directory of Open Access Journals (Sweden)
Margolin Kim
2009-01-01
Full Text Available Abstract The International Society for Biological Therapy of Cancer (iSBTc is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this program includes investigators from academic, regulatory, and biopharmaceutical venues. The program goal is to enable the attendees to learn the current status and the most recent advances in biologic therapies, and to leverage this knowledge towards the improvement of cancer therapy. The 2008 immunologic primer course was held on October 30 at the 23rd Annual meeting of iSBTc in San Diego, CA. Nine internationally renowned investigators gave excellent presentations on different topics. The topics covered in this primer included: (1 cytokines in cancer immunology; (2 anti-angiogenic therapy; (3 end stage: immune killing of tumors; (4 blocking T cell checkpoints; (5 approach to identification and therapeutic exploitation of tumor antigens; (6 T regulatory cells; (7 adoptive T cell therapy; (8 immune monitoring of cancer immunotherapy; and (9 immune adjuvants. We summarized the topics in this primer for public education. The related topic slides and schedule can be accessed online http://www.isbtc.org/meetings/am08/primer08.
[Environmental effects of combined sewage detention tank in central Shanghai].
Cheng, Jiang; Lü, Yong-peng; Huang, Xiao-fang; Guo, Sheng
2009-08-15
Through measuring the processes of precipitation, discharge and pollutant concentration over 20 times from 2006 to 2008 in Chendulu combined sewerage system (CSS) along Suzhou Creek in central Shanghai, the environmental effects of Chendulu combined sewage detention tank (CSDT), the first running CSDT in China, were studied. The results show that CSDT could improve CSS discharge capacity effectively with promoted interception ratio from 3.87 to 6.90-9.92. The mean annual combined sewer overflow (CSO) reduction and reduction rate are 9.10 x 10(4) m3 and 9.00%, respectively, and those of sanitary waste discharged directly to Suzhou Creek in non-rain-weather are 8.37 x 10(4) m(3) and 100% , respectively. The mean annual pollutants decrease rate of COD, BOD5, SS, NH4+ -N and TP of CSO are 13.76%, 19.69%, 15.29%, 18.24% and 15.10%, respectively, and those CSO pollutants decrease 41.21 t, 12.37 t, 50.10 t, 2.12 t and 0.29 t annually, respectively. The CSDT also could decrease sanitary waste discharged to Suzhou Creek totally, and those decreased pollutants are 20.75 t, 4.87 t, 14.90 t, 4.49 t and 0.30 t annually, respectively. The analysis shows that the CSDT design standard, running models and rainfall characteristics are the important influencing factors to realize the environmental effects of CSDT.
Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools
Directory of Open Access Journals (Sweden)
Melissa Agsalda
2009-01-01
Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.
Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.
Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce
2009-01-01
Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.
Empoderamiento de las jóvenes mexicanas y prevención de la violencia en el noviazgo
Directory of Open Access Journals (Sweden)
Irene CASIQUE-RODRÍGUEZ
2014-01-01
Full Text Available A partir de datos de la Encuesta Nacional de la Dinámica de las Relaciones en los Hogares 2011, se indagan, en primer término, algunos indicadores de empoderamiento de las mujeres jóvenes mexicanas (autonomía e ideología de roles y se explora cómo varían éstos según algunas condiciones sociodemográficas de las jóvenes (grupos de edad, nivel de escolaridad, situación conyugal, maternidad y condición de actividad. En segundo término se analizan las asociaciones que se establecen entre dichos indicadores y el riesgo de sufrir violencia en el noviazgo. Los resultados sugieren que la autonomía de las jóvenes juega un papel muy importante como factor de protección frente al riesgo de violencia emocional y de violencia sexual, lo que confirma la relevancia de promover acciones y programas que contribuyan de manera decidida a incrementar entre las mujeres solteras esta dimensión de empoderamiento.
2011-10-27
....'' TSTF-510, Revision 2, is available in the Agencywide Documents Access and Management System (ADAMS... SG Tube Integrity specification (Limiting Condition for Operation (LCO) 3.4.17, LCO 3.4.20, and LCO 3... address implementation issues associated with the inspection periods, and address other administrative...
International Nuclear Information System (INIS)
Oldendorf, W.; Oldendorf, W. Jr.
1991-01-01
Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI
International Nuclear Information System (INIS)
Zhan Fangfang; Zhou Xiaoming; Xing Da
2013-01-01
Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental
A Primer on Basic Effect Size Concepts.
Elmore, Patricia B.; Rotou, Ourania
The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…
2011-06-20
... Selection.'' TSTF-510, Revision 2, is available in the Agencywide Documents Access and Management System... Tube Integrity specification (Limiting Condition for Operation (LCO) 3.4.17, LCO 3.4.20, and LCO 3.4.18... implementation issues associated with the inspection periods, and address other administrative changes and...
New taxa and combinations in neotropical Juncus (Juncaceae)
DEFF Research Database (Denmark)
Balslev, Henrik
1983-01-01
Juncus arequipensis andJ. breviculmis are described as new species, andJ. ramboi subsp.colombianus as a new subspecies.Juncus arcticus Willd. var.mexicanus (Willd.), var.montanus (Engelm.), and var.andicola (Hook.) are proposed as new combinations.......Juncus arequipensis andJ. breviculmis are described as new species, andJ. ramboi subsp.colombianus as a new subspecies.Juncus arcticus Willd. var.mexicanus (Willd.), var.montanus (Engelm.), and var.andicola (Hook.) are proposed as new combinations....
Flicker in a twisted nematic spatial light modulator
Calderón-Hermosillo, Yuliana; García-Márquez, Jorge; Espinosa-Luna, Rafael; Ochoa, Noé Alcalá; López, Víctor; Aguilar, Alberto; Noé-Arias, Enrique; Alayli, Yasser
2013-06-01
Liquid Crystal on Silicon (LCoS) Spatial Light Modulators (SLM) are widely used for their capability to control beams howbeit fluctuations in phase and amplitude. It is then necessary to understand the negative effects of these fluctuations, also known as flicker, and the means to mitigate them. The flicker is observed either as high frequency variations of polarization, attenuation or high phase fluctuations on the wave front modulated by the LCoS device. Here, we compare the flicker behavior in a twisted nematic (TN) LCoS-SLM for different polarization schemes and temperatures. The quantitative evaluation shows that flicker is effectively reduced only by chilling the LCoS panel to temperatures just below 0 °C but, the LCoS modulation capability is also affected.
The Universal Primer - An open source solution for archiving, organizing and streaming live lectures
DEFF Research Database (Denmark)
Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej
2011-01-01
. The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...
Beauchaine, Theodore P.
2009-01-01
Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222
Magnesium-Based Sacrificial Anode Cathodic Protection Coatings (Mg-Rich Primers for Aluminum Alloys
Directory of Open Access Journals (Sweden)
Michael D. Blanton
2012-09-01
Full Text Available Magnesium is electrochemically the most active metal employed in common structural alloys of iron and aluminum. Mg is widely used as a sacrificial anode to provide cathodic protection of underground and undersea metallic structures, ships, submarines, bridges, decks, aircraft and ground transportation systems. Following the same principle of utilizing Mg characteristics in engineering advantages in a decade-long successful R&D effort, Mg powder is now employed in organic coatings (termed as Mg-rich primers as a sacrificial anode pigment to protect aerospace grade aluminum alloys against corrosion. Mg-rich primers have performed very well on aluminum alloys when compared against the current chromate standard, but the carcinogenic chromate-based coatings/pretreatments are being widely used by the Department of Defense (DoD to protect its infrastructure and fleets against corrosion damage. Factors such as reactivity of Mg particles in the coating matrix during exposure to aggressive corrosion environments, interaction of atmospheric gases with Mg particles and the impact of Mg dissolution, increases in pH and hydrogen gas liberation at coating-metal interface, and primer adhesion need to be considered for further development of Mg-rich primer technology.
Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da
2016-07-15
Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.
Gamper, H.A.; Leuchtmann, A.
2007-01-01
Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking
jFuzz: A Concolic Whitebox Fuzzer for Java
Jayaraman, Karthick; Harvison, David; Ganesh, Vijay; Kiezun, Adam
2009-01-01
We present jFuzz, a automatic testing tool for Java programs. jFuzz is a concolic whitebox fuzzer, built on the NASA Java PathFinder, an explicit-state Java model checker, and a framework for developing reliability and analysis tools for Java. Starting from a seed input, jFuzz automatically and systematically generates inputs that exercise new program paths. jFuzz uses a combination of concrete and symbolic execution, and constraint solving. Time spent on solving constraints can be significant. We implemented several well-known optimizations and name-independent caching, which aggressively normalizes the constraints to reduce the number of calls to the constraint solver. We present preliminary results due to the optimizations, and demonstrate the effectiveness of jFuzz in creating good test inputs. The source code of jFuzz is available as part of the NASA Java PathFinder. jFuzz is intended to be a research testbed for investigating new testing and analysis techniques based on concrete and symbolic execution. The source code of jFuzz is available as part of the NASA Java PathFinder.
Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.
Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong
2014-08-01
The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.
Molecular Basis for DNA Double-Strand Break Annealing and Primer Extension by an NHEJ DNA Polymerase
Directory of Open Access Journals (Sweden)
Nigel C. Brissett
2013-11-01
Full Text Available Nonhomologous end-joining (NHEJ is one of the major DNA double-strand break (DSB repair pathways. The mechanisms by which breaks are competently brought together and extended during NHEJ is poorly understood. As polymerases extend DNA in a 5′-3′ direction by nucleotide addition to a primer, it is unclear how NHEJ polymerases fill in break termini containing 3′ overhangs that lack a primer strand. Here, we describe, at the molecular level, how prokaryotic NHEJ polymerases configure a primer-template substrate by annealing the 3′ overhanging strands from opposing breaks, forming a gapped intermediate that can be extended in trans. We identify structural elements that facilitate docking of the 3′ ends in the active sites of adjacent polymerases and reveal how the termini act as primers for extension of the annealed break, thus explaining how such DSBs are extended in trans. This study clarifies how polymerases couple break-synapsis to catalysis, providing a molecular mechanism to explain how primer extension is achieved on DNA breaks.
DEFF Research Database (Denmark)
Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus
2005-01-01
A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted....... A ribonuclease mix was developed to specifically cleave the chimeric primers, irrespective of the base of the ribonucleotide, whereas standard primers without a ribonucleotide were unaffected by the ribonuclease treatment. The SBE products were analyzed in linear mode using a matrix-assisted laser desorption...... containing 9 chimeric primers and 8 standard primers....
Tirelli, E; Witkin, J M
1994-10-01
Behavioral effects of dopaminergic stimulation were evaluated in C57BL/6J mice and compared to the effects occurring in DBA/2J mice, an inbred strain with reduced densities of striatal dopamine receptors. Effects of apomorphine (0.5-64 mg/kg) alone and in combination with cocaine (30 mg/kg) were assessed using a time-sampling technique that classified climbing and leaning in separate categories. Locomotion was also assessed in a separate experiment. Climbing occurred in DBA/2J mice only at doses of apomorphine that were 16 times higher than the smallest effective dose in C57BL/6J mice; nevertheless, relative to baseline values, effects were fairly comparable. By contrast, whereas DBA/2J mice showed dose-dependent leaning under apomorphine, C57BL/6J mice exhibited little leaning even at doses not producing climbing, and only after the highest apomorphine dose was leaning significantly increased. Apomorphine was equipotent in inducing gnawing across strains, although somewhat less efficacious in DBA/2J mice. When given alone, cocaine produced significant climbing, but not leaning or gnawing, in either strain. Whereas cocaine potentiated apomorphine-induced climbing and gnawing in both strains, apomorphine-induced leaning was not consistently changed by cocaine in either strain. These effects were not indirectly due to hyperkinesia, since neither apomorphine alone nor apomorphine and cocaine in combination was stimulant; apomorphine alone reduced locomotor activity and attenuated cocaine-induced hyperkinesia. The present data do not support a unitary, purely quantitative, account of insensitivity to dopaminergic stimulation based upon low densities of striatal dopamine receptors in DBA/2J mice. Rather, this constellation of results is suggestive of qualitative interstrain dissimilarities in dopaminergic responsiveness that could reflect organizational differences in receptor populations.
The astrobiology primer: an outline of general knowledge--version 1, 2006.
Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S
2006-10-01
The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Each section includes a brief overview of a topic and a short list of readable and important literature for those interested in deeper knowledge. Because of the great diversity of material, each section was written by a different author with a different expertise. Contributors, authors, and editors are listed at the beginning, along with a list of those chapters and sections for which they were responsible. We are deeply indebted to the NASA Astrobiology Institute (NAI), in particular to Estelle Dodson, David Morrison, Ed Goolish, Krisstina Wilmoth, and Rose Grymes for their continued enthusiasm and support. The Primer came about in large part because of NAI support for graduate student research, collaboration, and inclusion as well as direct funding. We have entitled the Primer version 1 in hope that it will be only the first in a series, whose future volumes will be produced every 3-5 years. This way we can insure that the Primer keeps up with the current state of research. We hope that it will be a great resource for anyone trying to stay abreast of an ever-changing field.
Stanojevic, Sanja; Graham, Brian L; Cooper, Brendan G; Thompson, Bruce R; Carter, Kim W; Francis, Richard W; Hall, Graham L
2017-09-01
There are numerous reference equations available for the single-breath transfer factor of the lung for carbon monoxide ( T LCO ); however, it is not always clear which reference set should be used in clinical practice. The aim of the study was to develop the Global Lung Function Initiative (GLI) all-age reference values for T LCO Data from 19 centres in 14 countries were collected to define T LCO reference values. Similar to the GLI spirometry project, reference values were derived using the LMS (lambda, mu, sigma) method and the GAMLSS (generalised additive models for location, scale and shape) programme in R.12 660 T LCO measurements from asymptomatic, lifetime nonsmokers were submitted; 85% of the submitted data were from Caucasians. All data were uncorrected for haemoglobin concentration. Following adjustments for elevation above sea level, gas concentration and assumptions used for calculating the anatomic dead space volume, there was a high degree of overlap between the datasets. Reference values for Caucasians aged 5-85 years were derived for T LCO , transfer coefficient of the lung for carbon monoxide and alveolar volume.This is the largest collection of normative T LCO data, and the first global reference values available for T LCO . Copyright ©ERS 2017.
Sarafianou, Aspasia; Seimenis, Ioannis; Papadopoulos, Triantafillos
2008-05-01
adhesive failures and significantly lower bond strength compared to group R. Groups MPII50, MPII250, and SRL50, SRL250 showed combination failures and no significant difference compared with group R. EDS revealed interfacial rather than adhesive failures. Airborne-particle abrasion with 50-microm Al2O3 particles may result in improved bond strength, independent of the primer used. The bond strength of Metal Primer II and SR Link specimens was comparable to that of specimens treated with Rocatec.
Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V
2015-12-01
The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.
Promotion primer. Foerderfibel
Energy Technology Data Exchange (ETDEWEB)
1981-01-01
This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.
Gold nanoparticle-assisted primer walking for closing the human chromosomal gap
DEFF Research Database (Denmark)
Li, H; Shi, B; Li, X
2013-01-01
The finished sequence of the human genome still contains 260 euchromatic gaps. All the PCR-based genome walking techniques used to close gaps have common limitations, such as low efficiency and low specificity. We herein describe a strategy to solve this problem by employing gold nanoparticles (Au......NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...
Wang, Yong
2009-10-09
Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.
Energy Technology Data Exchange (ETDEWEB)
Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)
2013-01-25
Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection
Effect of oligonucleotide primers in determining viral variability within hosts
Directory of Open Access Journals (Sweden)
Moya Andrés
2004-12-01
Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.
Effect of oligonucleotide primers in determining viral variability within hosts.
Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando
2004-12-09
Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.
A set of primers for analyzing chloroplast DNA diversity in Citrus and related genera.
Cheng, Yunjiang; de Vicente, M Carmen; Meng, Haijun; Guo, Wenwu; Tao, Nengguo; Deng, Xiuxin
2005-06-01
Chloroplast simple sequence repeat (cpSSR) markers in Citrus were developed and used to analyze chloroplast diversity of Citrus and closely related genera. Fourteen cpSSR primer pairs from the chloroplast genomes of tobacco (Nicotiana tabacum L.) and Arabidopsis were found useful for analyzing the Citrus chloroplast genome (cpDNA) and recoded with the prefix SPCC (SSR Primers for Citrus Chloroplast). Eleven of the 14 primer pairs revealed some degree of polymorphism among 34 genotypes of Citrus, Fortunella, Poncirus and some of their hybrids, with polymorphism information content (PIC) values ranging from 0.057 to 0.732, and 18 haplotypes were identified. The cpSSR data were analyzed with NTSYS-pc software, and the genetic relationships suggested by the unweighted pair group method based on arithmetic means (UPGMA) dendrogram were congruent with previous taxonomic investigations: the results showed that all samples fell into seven major clusters, i.e., Citrus medica L., Poncirus, Fortunella, C. ichangensis Blanco, C. reticulata Swingle, C. aurantifolia (Christm.) Swingle and C. grandis (L.) Osbeck. The results of previous studies combined with our cpSSR analyses revealed that: (1) Calamondin (C. madurensis Swingle) is the result of hybridization between kumquat (Fortunella) and mandarin (C. reticulata), where kumquat acted as the female parent; (2) Ichang papeda (C. ichangensis) has a unique taxonomic status; and (3) although Bendiguangju mandarin (C. reticulata) and Satsuma mandarin (C. reticulata) are similar in fruit shape and leaf morphology, they have different maternal parents. Bendiguangju mandarin has the same cytoplasm as sweet orange (C. sinensis), whereas Satsuma mandarin has the cytoplasm of C. reticulata. Seventeen PCR products from SPCC1 and 21 from SPCC11 were cloned and sequenced. The results revealed that mononucleotide repeats as well as insertions and deletions of small segments of DNA were associated with SPCC1 polymorphism, whereas polymorphism
Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup
This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.
Directory of Open Access Journals (Sweden)
Luk Ketut Budi Maitriani
2015-10-01
Full Text Available ABSTRAK : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb. ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is
FullSSR: Microsatellite Finder and Primer Designer
Directory of Open Access Journals (Sweden)
Sebastián Metz
2016-01-01
Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.
Verdugo, T.; Limousin, M.; Motta, V.; Mamon, G. A.; Foëx, G.; Gastaldello, F.; Jullo, E.; Biviano, A.; Rojas, K.; Muñoz, R. P.; Cabanac, R.; Magaña, J.; Fernández-Trincado, J. G.; Adame, L.; De Leo, M. A.
2016-10-01
Context. The mass distribution in galaxy clusters and groups is an important cosmological probe. It has become clear in recent years that mass profiles are best recovered when combining complementary probes of the gravitational potential. Strong lensing (SL) is very accurate in the inner regions, but other probes are required to constrain the mass distribution in the outer regions, such as weak lensing or studies of dynamics. Aims: We constrain the mass distribution of a cluster showing gravitational arcs by combining a strong lensing method with a dynamical method using the velocities of its 24 member galaxies. Methods: We present a new framework in which we simultaneously fit SL and dynamical data. The SL analysis is based on the LENSTOOL software and the dynamical analysis uses the MAMPOSSt code, which we integrated into LENSTOOL. After describing the implementation of this new tool, we applied it to the galaxy group SL2S J02140-0535 (zspec = 0.44), which we had previously studied. We used new VLT/FORS2 spectroscopy of multiple images and group members, as well as shallow X-ray data from XMM. Results: We confirm that the observed lensing features in SL2S J02140-0535 belong to different background sources. One of these sources is located at zspec = 1.017 ± 0.001, whereas the other source is located at zspec = 1.628 ± 0.001. With the analysis of our new and our previously reported spectroscopic data, we find 24 secure members for SL2S J02140-0535. Both data sets are well reproduced by a single NFW mass profile; the dark matter halo coincides with the peak of the light distribution, with scale radius, concentration, and mass equal to rs = 82+44-17 kpc, c200 = 10.0+1.7-2.5, and M200 = 1.0+0.5-0.2 × 1014 M⊙ respectively. These parameters are better constrained when we fit SL and dynamical information simultaneously. The mass contours of our best model agrees with the direction defined by the luminosity contours and the X-ray emission of SL2S J02140-0535. The
Directory of Open Access Journals (Sweden)
Cheng-Hong Yang
Full Text Available BACKGROUND: Complete mitochondrial (mt genome sequencing is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. For long template sequencing, i.e., like the entire mtDNA, it is essential to design primers for Polymerase Chain Reaction (PCR amplicons which are partly overlapping each other. The presented chromosome walking strategy provides the overlapping design to solve the problem for unreliable sequencing data at the 5' end and provides the effective sequencing. However, current algorithms and tools are mostly focused on the primer design for a local region in the genomic sequence. Accordingly, it is still challenging to provide the primer sets for the entire mtDNA. METHODOLOGY/PRINCIPAL FINDINGS: The purpose of this study is to develop an integrated primer design algorithm for entire mt genome in general, and for the common primer sets for closely-related species in particular. We introduce ClustalW to generate the multiple sequence alignment needed to find the conserved sequences in closely-related species. These conserved sequences are suitable for designing the common primers for the entire mtDNA. Using a heuristic algorithm particle swarm optimization (PSO, all the designed primers were computationally validated to fit the common primer design constraints, such as the melting temperature, primer length and GC content, PCR product length, secondary structure, specificity, and terminal limitation. The overlap requirement for PCR amplicons in the entire mtDNA is satisfied by defining the overlapping region with the sliding window technology. Finally, primer sets were designed within the overlapping region. The primer sets for the entire mtDNA sequences were successfully demonstrated in the example of two closely-related fish species. The pseudo code for the primer design algorithm is provided. CONCLUSIONS/SIGNIFICANCE: In conclusion, it can be said that our proposed sliding window-based PSO
Directory of Open Access Journals (Sweden)
Joseph-Alexander Verreet
2011-01-01
Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.
Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S
2015-06-01
Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.
Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR
Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan
2002-01-01
AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381
PIPEMicroDB: microsatellite database and primer generation tool for pigeonpea genome.
Sarika; Arora, Vasu; Iquebal, M A; Rai, Anil; Kumar, Dinesh
2013-01-01
Molecular markers play a significant role for crop improvement in desirable characteristics, such as high yield, resistance to disease and others that will benefit the crop in long term. Pigeonpea (Cajanus cajan L.) is the recently sequenced legume by global consortium led by ICRISAT (Hyderabad, India) and been analysed for gene prediction, synteny maps, markers, etc. We present PIgeonPEa Microsatellite DataBase (PIPEMicroDB) with an automated primer designing tool for pigeonpea genome, based on chromosome wise as well as location wise search of primers. Total of 123 387 Short Tandem Repeats (STRs) were extracted from pigeonpea genome, available in public domain using MIcroSAtellite tool (MISA). The database is an online relational database based on 'three-tier architecture' that catalogues information of microsatellites in MySQL and user-friendly interface is developed using PHP. Search for STRs may be customized by limiting their location on chromosome as well as number of markers in that range. This is a novel approach and is not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of selected markers with left and right flankings of size up to 500 bp. This will enable researchers to select markers of choice at desired interval over the chromosome. Furthermore, one can use individual STRs of a targeted region over chromosome to narrow down location of gene of interest or linked Quantitative Trait Loci (QTLs). Although it is an in silico approach, markers' search based on characteristics and location of STRs is expected to be beneficial for researchers. Database URL: http://cabindb.iasri.res.in/pigeonpea/
Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL
International Nuclear Information System (INIS)
Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.
2000-01-01
This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums
DEFF Research Database (Denmark)
Liu, Dong; Polinder, Henk; Abrahamsen, Asger Bech
2017-01-01
This paper aims at finding feasible electromagnetic designs of superconducting synchronous generators (SCSGs) for a 10-MW direct-drive wind turbine. Since a lower levelized cost of energy (LCoE) increases the feasibility of SCSGs in this application, 12 generator topologies are compared regarding...... their LCoE in a simplified form of levelized equipment cost of energy (LCoE$_{\\text{eq}}$). MgB$_2$ wires are employed in the field winding. Based on the current unit cost and critical current density capability of the MgB $_2$ wire at 20 K, the topologies with more iron have a much lower LCo...
Global Surveillance of Emerging Influenza Virus Genotypes by Mass Spectrometry
2007-05-30
Intercontinental circulation of human influenza A( H1N2 ) reassortant viruses during the 2001–2002 influenza season. J Infect Dis 186: 1490–1493. 6. Taubenberger...Global Surveillance of Emerging Influenza Virus Genotypes by Mass Spectrometry Rangarajan Sampath1*, Kevin L. Russell2, Christian Massire1, Mark W...Infections and Immunity, University of Texas Medical Branch, Galveston, Texas, United States of America Background. Effective influenza surveillance requires
Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko
2016-02-01
The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Aspelund, Audun; Gundersen, Truls
2009-01-01
A novel energy and cost effective transport chain for stranded natural gas utilized for power production with CO 2 capture and storage is developed. It includes an offshore section, a combined gas carrier and an integrated receiving terminal. In the offshore section, natural gas (NG) is liquefied to LNG by liquid carbon dioxide (LCO 2 ) and liquid inert nitrogen (LIN), which are used as cold carriers. In the onshore process, the cryogenic exergy in the LNG is utilized to cool and liquefy the cold carriers, LCO 2 and LIN. The transport pressures for LNG, LIN and LCO 2 will influence the thermodynamic efficiency as well as the ship utilization; hence sensitivity analyses are performed, showing that the ship utilization for the payload will vary between 58% and 80%, and the transport chain exergy efficiency between 48% and 52%. A thermodynamically optimized process requires 319 kWh/tonne LNG. The NG lost due to power generation needed to operate the LEC processes is roughly one third of the requirement in a conventional transport chain for stranded NG gas with CO 2 capture and sequestration (CCS)
Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.
Wu, Z; Nagano, I; Xu, D; Takahashi, Y
1997-03-01
Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.
Xiao, Jing; Zhao, Jin; Liu, Mengjun; Liu, Ping; Dai, Li; Zhao, Zhihui
2015-01-01
Chinese jujube (Ziziphus jujuba), an economically important species in the Rhamnaceae family, is a popular fruit tree in Asia. Here, we surveyed and characterized simple sequence repeats (SSRs) in the jujube genome. A total of 436,676 SSR loci were identified, with an average distance of 0.93 Kb between the loci. A large proportion of the SSRs included mononucleotide, dinucleotide and trinucleotide repeat motifs, which accounted for 64.87%, 24.40%, and 8.74% of all repeats, respectively. Among the mononucleotide repeats, A/T was the most common, whereas AT/TA was the most common dinucleotide repeat. A total of 30,565 primer pairs were successfully designed and screened using a series of criteria. Moreover, 725 of 1,000 randomly selected primer pairs were effective among 6 cultivars, and 511 of these primer pairs were polymorphic. Sequencing the amplicons of two SSRs across three jujube cultivars revealed variations in the repeats. The transferability of jujube SSR primers proved that 35/64 SSRs could be transferred across family boundary. Using jujube SSR primers, clustering analysis results from 15 species were highly consistent with the Angiosperm Phylogeny Group (APGIII) System. The genome-wide characterization of SSRs in Chinese jujube is very valuable for whole-genome characterization and marker-assisted selection in jujube breeding. In addition, the transferability of jujube SSR primers could provide a solid foundation for their further utilization. PMID:26000739
International Nuclear Information System (INIS)
Goldflam, R.; Kouri, D.J.
1976-01-01
New methods for predicting the full matrix of integral cross sections are developed by combining the surprisal analysis of Bernstein and Levine with the j/sub z/-conserving coupled states method (j/sub z/CCS) of McGuire, Kouri, and Pack and with the statistical j/sub z/ approximation (Sj/sub z/) of Kouri, Shimoni, and Heil. A variety of approaches is possible and only three are studied in the present work. These are (a) a surprisal fit of the j=0→j' column of the j/sub z/CCS cross section matrix (thereby requiring only a solution of the lambda=0 set of j/sub z/CCS equations), (b) a surprisal fit of the lambda-bar=0 Sj/sub z/ cross section matrix (again requiring solution of the lambda=0 set of j/sub z/CCS equations only), and (c) a surprisal fit of a lambda-bar not equal to 0 Sj/sub z/ submatrix (involving input cross sections for j,j'> or =lambda-bar transitions only). The last approach requires the solution of the lambda=lambda-bar set of j/sub z/CCS equations only, which requires less computation effort than the effective potential method. We explore three different choices for the prior and two-parameter (i.e., linear) and three-parameter (i.e., parabolic) fits as applied to Ar--N 2 collisions. The results are in general very encouraging and for one choice of prior give results which are within 20% of the exact j/sub z/CCS results
Directory of Open Access Journals (Sweden)
Jonas Binladen
2007-02-01
Full Text Available The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources.We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences. Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis.We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%. Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial
Signals and systems primer with Matlab
Poularikas, Alexander D
2006-01-01
Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,
indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.
Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J
2017-01-01
Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.
DEFF Research Database (Denmark)
Hansen, A C; Grunwald, T; Lund, Anders Henrik
2001-01-01
could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold...
Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA
Energy Technology Data Exchange (ETDEWEB)
Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J. (Pharmasset); (Emerald)
2012-08-01
The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.
Molecular characterization of Fagaceae species using inter-primer binding site (iPBS) markers.
Coutinho, João Paulo; Carvalho, Ana; Martín, Antonio; Lima-Brito, José
2018-04-01
Retrotransposons (RTNs) contribute for genome evolution, influencing its size and structure. We investigated the utility of the RTN-based markers inter-primer binding site (iPBS) for the molecular characterization of 25 Fagaceae species from genera Castanea, Fagus and Quercus. The assessment of genetic diversity, relationships and structure, as well as taxonomic classification of Fagaceae based on molecular data is important for definition of conservation, forestry management strategies and discrimination among natural hybrids and their parents since natural hybridization may increase with the climate changes. Here, iPBS primers designed by other authors were tested alone and combined. Some of them were discriminative, revealed polymorphism within and among taxa allowing the production of a total of 150 iPBS markers. In addition, several monomorphic iPBS markers were also amplified in each taxon. The UPGMA dendrogram based on the pooled iPBS data revealed 27% of genetic similarity among species. The individuals were clustered per genus and most of the oaks per infrageneric group corroborating the adopted taxonomy. Globally, the iPBS markers demonstrated suitability for DNA fingerprinting, determination of phylogenies and taxonomic discrimination in Fagaceae, and could constitute a useful and alternative tool for germplasm characterization, and for definition of conservation strategies and forestry management. Moreover, these markers would be useful for fingerprinting natural hybrids that share morphological similarities with their parents. Since iPBS markers could also enable insights about RTNs evolution, an eventual correlation among iPBS polymorphism, variability of RTN insertions and/or genome size in Fagaceae is discussed.
Glennon, Kelsey L; Cron, Glynis V
2016-05-01
Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species.
Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, A.D. van; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martín, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, Z.W. de; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, G.S. de; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, M. de; Robert, V.
2015-01-01
The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic
Violencia en el noviazgo en una muestra de jóvenes mexicanos
Directory of Open Access Journals (Sweden)
Fabiola Peña-Cárdenas
2013-06-01
Full Text Available El estudio de la violencia en las relaciones de noviazgo es importante por tres razones: en primer lugar, se ha encontrado que una agresión física previa al matrimonio supone una probabilidad del 51% de que esa agresión se repita a lo largo del primer año y medio de convivencia. En segundo lugar, el estudio de la violencia puede ayudar en la comprensión general del fenómeno de la violencia en las relaciones íntimas. Finalmente, el conocimiento de este fenómeno puede ayudar a planear y fomentar su prevención. El estudio de la violencia en las parejas se ha centrado históricamente en la mujer, sin embargo, investigaciones recientes apuntan a que, por lo menos, en las parejas de novios, la diferencia entre géneros se está disminuyendo o incluso invirtiendo. En el presente estudio se presentan los datos obtenidos de una encuesta aplicada a un total de 140 jóvenes de uno y otro sexo en Tamaulipas, México, sobre violencia en el noviazgo. Los resultados indicaron que el 45.5 y el 46.8% de hombres y mujeres, respectivamente, es decir, el 46.2% del grupo total sufre de violencia en alguna medida. Eso significa que en nuestro estudio no se encontraron diferencias significativas en cuanto al ejercicio de la violencia entre géneros.
Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W
1998-08-01
The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.
Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers
Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li
2017-01-01
Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424
Bergkemper, Fabian; Kublik, Susanne; Lang, Friederike; Krüger, Jaane; Vestergaard, Gisle; Schloter, Michael; Schulz, Stefanie
2016-06-01
Phosphorus (P) is of central importance for cellular life but likewise a limiting macronutrient in numerous environments. Certainly microorganisms have proven their ability to increase the phosphorus bioavailability by mineralization of organic-P and solubilization of inorganic-P. On the other hand they efficiently take up P and compete with other biota for phosphorus. However the actual microbial community that is associated to the turnover of this crucial macronutrient in different ecosystems remains largely anonymous especially taking effects of seasonality and spatial heterogeneity into account. In this study seven oligonucleotide primers are presented which target genes coding for microbial acid and alkaline phosphatases (phoN, phoD), phytases (appA), phosphonatases (phnX) as well as the quinoprotein glucose dehydrogenase (gcd) and different P transporters (pitA, pstS). Illumina amplicon sequencing of soil genomic DNA underlined the high rate of primer specificity towards the respective target gene which usually ranged between 98% and 100% (phoN: 87%). As expected the primers amplified genes from a broad diversity of distinct microorganisms. Using DNA from a beech dominated forest soil, the highest microbial diversity was detected for the alkaline phosphatase (phoD) gene which was amplified from 15 distinct phyla respectively 81 families. Noteworthy the primers also allowed amplification of phoD from 6 fungal orders. The genes coding for acid phosphatase (phoN) and the quinoprotein glucose dehydrogenase (gcd) were amplified from 20 respectively 17 different microbial orders. In comparison the phytase and phosphonatase (appA, phnX) primers covered 13 bacterial orders from 2 different phyla respectively. Although the amplified microbial diversity was apparently limited both primers reliably detected all orders that contributed to the P turnover in the investigated soil as revealed by a previous metagenomic approach. Genes that code for microbial P transporter
Zhang, Chao; Liu, Runqiang; He, Jun; Ma, Zhiqing; Zhang, Xing
2016-10-12
In order to develop novel botanical insecticides, the joint action of Ligusticum chuanxiong oil (LCO) and lemongrass oil (LO) against Aphis citricola van der Goot was determined systematically indoors and outdoors. The chemical profiles of LCO and LO as determined by gas chromatography-mass spectrometry (GC-MS) analysis revealed that the main compounds from LCO were ( Z )-ligustilide (44.58%) and senkyunolide A (26.92%), and that of LO were geranial (42.16%) and neral (32.58%), respectively. The mixture of LCO and LO showed significant synergy against A. citricola , with a common-toxicity coefficient (CTC) value of 221.46 at the optimal ratio of LCO to LO (4:1, w : w ). Based on the results of solvents and emulsifiers screening, L. chuanxiong oil·Lemongrass oil 20% emulsifiable concentrate (20% LCO·LO EC) was developed, and its stability was confirmed with tests of cold and thermal storage. Field trials indicated that the insecticidal activity of the diluted 20% LCO·LO EC (1000 fold dilution) was comparable to conventional pesticide (20% imidacloprid EC) on A. citricola seven days after application. Thus, the mixture of LCO and LO has the potential to be further developed as a botanical pesticide.
Stielow, J.B.; Lévesque, C.A.; Seifert, K.A.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.J.M.; Groenewald, M.; Chaduli, D.; Lomascolo, A.; Welti, S.; Lesage-Meessen, L.; Favel, A.; Al-Hatmi, A.M.S.; Damm, U.; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, van A.D.; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martin, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, de Z.W.; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, de G.S.; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, de M.; Robert, V.
2015-01-01
The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers
Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.
Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J
2015-07-28
Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.
The effect of various primers on shear bond strength of zirconia ceramic and resin composite.
Sanohkan, Sasiwimol; Kukiattrakoon, Boonlert; Larpboonphol, Narongrit; Sae-Yib, Taewalit; Jampa, Thibet; Manoppan, Satawat
2013-11-01
To determine the in vitro shear bond strengths (SBS) of zirconia ceramic to resin composite after various primer treatments. Forty zirconia ceramic (Zeno, Wieland Dental) specimens (10 mm in diameter and 2 mm thick) were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10). Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE), AP (Alloy Primer, Kuraray Medical), and MP (Monobond Plus, Ivoclar Vivadent AG). One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE) cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE) and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa) were analyzed with one-way analysis of variance (ANOVA) and the Tukey's Honestly Significant Difference (HSD) test (α = 0.05). Group AP yielded the highest mean and standard deviation (SD) value of SBS (16.8 ± 2.5 MPa) and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa). The SBS did not differ significantly among the groups (P = 0.079). Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.
Blood Donation and Transfusion: A Primer for Health Educators.
Felts, W. Michael; Glascoff, Mary A.
1991-01-01
Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)
Small Commercial Building Re-tuning: A Primer
Energy Technology Data Exchange (ETDEWEB)
Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas
2013-09-30
To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.
Directory of Open Access Journals (Sweden)
P. Jorquera-Aguayo
Full Text Available Introducción. En el marco de un nuevo modelo educativo formativo, la Universidad San Sebastián apunta al desarrollo de estrategias pedagógicas que sitúan al estudiante en el centro de las acciones. Es así como surge la necesidad de incrementar la motivación en los jóvenes que ingresan a la carrera de medicina, profesión desde siempre ligada a los valores sociales y el altruismo. Este trabajo explora la relevancia del contacto temprano con el paciente y el hospital como fuentes de motivación en primer año. Sujetos y métodos. Todos los estudiantes de primer año de medicina (n = 115 fueron invitados a visitar voluntariamente un hospital. Allí, los estudiantes recorrieron el establecimiento y sostuvieron una conversación libre con un paciente. Las opiniones se recogieron a través de un escrito libre. Resultados. Se inscribieron 95 estudiantes, de los cuales 68 concurrieron a la visita. Al consultar sobre la vivencia con el paciente, los estudiantes se refirieron positivamente a ésta. La ansiedad al inicio de la conversación fue uno de los aspectos más mencionados, al igual que la importancia de conocer el futuro lugar de trabajo. Conclusiones. La experiencia evidenció un alto interés en participar. Asimismo reveló elementos de la vida afectiva de los estudiantes, pilar fundamental de la educación médica. Finalmente, se aconseja la temprana relación con el paciente y con el hospital como agentes motivacionales en primer año. Se sugiere incorporar tareas y complementar la evaluación con herramientas que permitan obtener información objetiva sobre los aprendizajes adquiridos.
Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae
Directory of Open Access Journals (Sweden)
Warren B. Chatwin
2014-10-01
Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.
Directory of Open Access Journals (Sweden)
Peter Zarras
2014-09-01
Full Text Available In this study, an electroactive polymer (EAP, poly(2,5-bis(N-methyl-N- hexylaminophenylene vinylene (BAM-PPV, was tested as an alternative to current hexavalent chromium (Cr(VI-based Army wash primers. BAM-PPV was tested in both laboratory and field studies to determine its adhesive and corrosion-inhibiting properties when applied to steel and aluminum alloys. The Army Research Laboratory (ARL tests showed that BAM-PPV combined with an epoxy primer and the Army chemical agent-resistant coating (CARC topcoat met Army performance requirements for military coatings. After successful laboratory testing, the BAM-PPV was then field tested for one year at the Aberdeen Test Center (ATC. This field testing showed that BAM-PPV incorporated into the Army military coating survived with no delamination of the coating and only minor corrosion on the chip sites.
Preionization Techniques in a kJ-Scale Dense Plasma Focus
Povilus, Alexander; Shaw, Brian; Chapman, Steve; Podpaly, Yuri; Cooper, Christopher; Falabella, Steve; Prasad, Rahul; Schmidt, Andrea
2016-10-01
A dense plasma focus (DPF) is a type of z-pinch device that uses a high current, coaxial plasma gun with an implosion phase to generate dense plasmas. These devices can accelerate a beam of ions to MeV-scale energies through strong electric fields generated by instabilities during the implosion of the plasma sheath. The formation of these instabilities, however, relies strongly on the history of the plasma sheath in the device, including the evolution of the gas breakdown in the device. In an effort to reduce variability in the performance of the device, we attempt to control the initial gas breakdown in the device by seeding the system with free charges before the main power pulse arrives. We report on the effectiveness of two techniques developed for a kJ-scale DPF at LLNL, a miniature primer spark gap and pulsed, 255nm LED illumination. Prepared by LLNL under Contract DE-AC52-07NA27344.
Beneath sci-fi sound: primer, science fiction sound design, and American independent cinema
Johnston, Nessa
2012-01-01
Primer is a very low budget science-fiction film that deals with the subject of time travel; however, it looks and sounds quite distinctively different from other films associated with the genre. While Hollywood blockbuster sci-fi relies on “sound spectacle” as a key attraction, in contrast Primer sounds “lo-fi” and screen-centred, mixed to two channel stereo rather than the now industry-standard 5.1 surround sound. Although this is partly a consequence of the economics of its production, the...
Directory of Open Access Journals (Sweden)
Jing eSui
2013-05-01
Full Text Available Multimodal brain imaging data have shown increasing utility in answering both scientifically interesting and clinically relevant questions. Each brain imaging technique provides a different view of brain function or structure, while multimodal fusion capitalizes on the strength of each and may uncover hidden relationships that can merge findings from separate neuroimaging studies. However, most current approaches have focused on pair-wise fusion and there is still relatively little work on N-way data fusion and examination of the relationships among multiple data types. We recently developed an approach called mCCA+jICA" as a novel multi-way fusion method which is able to investigate the disease risk factors that are either shared or distinct across multiple modalities as well as the full correspondence across modalities. In this paper, we applied this model to combine resting state fMRI (amplitude of low-frequency fluctuation, ALFF, grey matter density (GM and DTI (fractional anisotropy, FA data, in order to elucidate the abnormalities underlying schizophrenia patients (SZs, n=35 relative to healthy controls (HCs, n=28. Both modality-common and modality-unique abnormal regions were identified in SZs, which were then used for successful classification for 7 modality-combinations, showing the potential for a broad applicability of the mCCA+jICA model and its results. In addition, a pair of GM-DTI components showed significant correlation with the positive symptom subscale of Positive and Negative Syndrome Scale (PANSS, suggesting that gray matter density changes in default model network along with white matter disruption in anterior thalamic radiation are associated with increased positive PANSS. Findings suggest the DTI anisotropy changes in frontal lobe may relate to the corresponding functional/structural changes in prefrontal cortex and superior temporal gyrus that are thought to play a role in the clinical expression of schizophrenia.
Primers As Socializing Agents in American and Finnish Schools.
Hyona, Jukka; And Others
1995-01-01
Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…
Identifying the Active Surfaces of Electrochemically Tuned LiCoO2 for Oxygen Evolution Reaction
International Nuclear Information System (INIS)
Lu, Zhiyi; Chen, Guangxu; Li, Yanbin; Wang, Haotian; Xie, Jin
2017-01-01
Identification of active sites for catalytic processes has both fundamental and technological implications for rational design of future catalysts. Herein, we study the active surfaces of layered lithium cobalt oxide (LCO) for the oxygen evolution reaction (OER) using the enhancement effect of electrochemical delithiation (De-LCO). Our theoretical results indicate that the most stable (0001) surface has a very large overpotential for OER independent of lithium content. In contrast, edge sites such as the nonpolar (1120) and polar (0112) surfaces are predicted to be highly active and dependent on (de)lithiation. The effect of lithium extraction from LCO on the surfaces and their OER activities can be understood by the increase of Co 4+ sites relative to Co 3+ and by the shift of active oxygen 2p states. Experimentally, it is demonstrated that LCO nanosheets, which dominantly expose the (0001) surface show negligible OER enhancement upon delithiation. However, a noticeable increase in OER activity (~0.1 V in overpotential shift at 10 mA cm –2 ) is observed for the LCO nanoparticles, where the basal plane is greatly diminished to expose the edge sites, consistent with the theoretical simulations. In addition, we find that the OER activity of De-LCO nanosheets can be improved if we adopt an acid etching method on LCO to create more active edge sites, which in turn provides a strong evidence for the theoretical indication.
Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer
Energy Technology Data Exchange (ETDEWEB)
D. S. Lucas
2004-10-01
A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.
Energy Technology Data Exchange (ETDEWEB)
Zhang, Zhi-Yu; Gao, Yu; Zhao, Yinghe [Purple Mountain Observatory/Key Lab for Radio Astronomy, 2 West Beijing Road, Nanjing 210008 (China); Henkel, Christian; Menten, Karl M.; Güsten, Rolf [Max-Planck-Institut für Radioastronomie, Auf dem Hügel 69, D-53121 Bonn (Germany); Wang, Junzhi, E-mail: zyzhang@pmo.ac.cn [Shanghai Astronomical Observatory, 80 Nandan Road, Shanghai 200030 (China)
2014-04-01
We report HCN J = 4 → 3, HCO{sup +} J = 4 → 3, and CS J = 7 → 6 observations in 20 nearby star-forming galaxies with the Atacama Pathfinder EXperiment 12 m telescope. Combined with four HCN, three HCO{sup +}, and four CS detections from the literature, we probe the empirical link between the luminosity of molecular gas (L{sub gas}{sup ′}) and that of infrared emission (L {sub IR}), up to the highest gas densities (∼10{sup 6} cm{sup –3}) that have been probed so far. For nearby galaxies with large radii, we measure the IR luminosity within the submillimeter beam size (14''-18'') to match the molecular emission. We find linear slopes for L{sub CS} {sub J=7--6}{sup ′}-L {sub IR} and L{sub HCN} {sub J=4--3}{sup ′}-L {sub IR}, and a slightly super-linear slope for L{sub HCO{sup +}} {sub J=4--3}{sup ′}-L {sub IR}. The correlation of L{sub CS} {sub J=7--6}{sup ′}-L {sub IR} even extends over eight orders of luminosity magnitude down to Galactic dense cores, with a fit of log(L {sub IR}) =1.00(± 0.01) ×log(L{sub CS} {sub J=7--6}{sup ′}) + 4.03(± 0.04). Such linear correlations appear to hold for all densities >10{sup 4} cm{sup –3}, and indicate that star formation rate is not related to the free-fall timescale for dense molecular gas.
RESNICK, R. M.; Cornelissen, M. T.; WRIGHT, D. K.; EICHINGER, G. H.; FOX, H. S.; ter Schegget, J.; MANOS, M. M.
1990-01-01
We developed a polymerase chain reaction DNA amplification system using two distinct consensus oligonucleotide primer sets for the improved detection and typing of a broad spectrum of human genital papillomavirus (HPV) sequences, including those of novel viruses. The system incorporates one primer
Directory of Open Access Journals (Sweden)
Anderson Pinheiro de Freitas
2004-06-01
Full Text Available To evaluate the effect of different surface treatments on shear bond strength between a metallic alloy (Co-Cr-Mo - Remanium CD and a resin cement (Rely X TM and to evaluate the mode of fracture after testing, forty couples of metallic-alloy disks were melted, regularized, polished, submitted to four thermal cycles (Vacuum, 960ºC, 8 minutes and randomly separated into four groups. Each group received a different type of treatment: Group PSP: Polished with sandpaper 600; Group PCP: Polished with sandpaper 600 and application of the metal primer Alloy Primer (Kuraray; Group JSP: Sandblasted with 100µm aluminum oxide; Group JCP: Sandblasted with 100mm aluminum oxide and treated with a metal Primer. The groups were cemented and stored in distilled water at 37ºC for 36 hours and submitted to the shear bond strength test. The mean and standard deviation (in Kgf/cm² obtained for each group was: PSP 4.0/0.4; PCP 88.9/33.6; JSP 163.2/27.6; JCP 144.5/54.0. After the statistical analysis the authors concluded that: the highest values were obtained for the sandblasted groups (JSP, JCP, regardless of the primer application; the Alloy Primer increased the retention between the Rely X cement and the polished surface of the Co-Cr-Mo alloy, yet its bond strength was not greater than that obtained with sandblasting; all specimens showed adhesive failures in the tested interface.Para avaliar o efeito de diferentes tratamentos superficiais sobre a resistência ao cisalhamento da união entre uma liga metálica (Co-Cr-Mo - Remanium CD e um cimento resinoso (Rely X TM e analisar o tipo de fratura durante a separação dos espécimes, quarenta pares de discos metálicos foram fundidos, regularizados e polidos, submetidos a quatro ciclos térmicos (vácuo, 960ºC, 8 minutos e divididos aleatoriamente em quatro grupos. Cada grupo recebeu um tipo de tratamento: Grupo PSP: Polimento com lixa d'água Nº 600; Grupo PCP: Polimento com lixa 600 e aplicação do
Hematopoiesis Primer Modeling Combined Injury
2012-05-01
does impair the oxygen- carrying capacity of the blood (Puchala et al. 1999), and transfusion requirements of both platelets and red cells at Chernobyl ...El-Sonbaty M.A., M.A. El-Otiefy. Haematological change in severely burned patients. Annals of Burns and Fire Disasters 1996; IX(4). Accessed on line...immune system in severely burned patients. Ann Burns Fire Disasters 2009 Sep; 22(3):121-130. Flohé S., S. Lendemans, C. Selbach, C. Waydhas, M. Ackermann
Primer: Fracture mechanics in the nuclear power industry
International Nuclear Information System (INIS)
Wessel, E.T.; Server, W.L.; Kennedy, E.L.
1990-01-01
This Primer is intended to familiarize utility engineers with the fracture mechanics technology and to provide the basis for a working knowledge of the subject. It is directed towards all the engineering disciplines that are involved either directly or indirectly with the structural reliability of electrical power generation equipment and systems. These engineering disciplines include such areas as: design and stress analysis, metallurgy and materials, nondestructive inspection and quality control, structural analysis and reliability engineering, chemical engineering and water chemistry control, and architectural engineering. This Primer does not provide a comprehensive, in-depth treatment of all the detailed aspects involved in fracture mechanics. It does, however, provide sufficient information and a common vocabulary that should enable engineers to: read and converse intelligently about the subject, understand and utilize ASME Codes and Regulatory Guides involving fracture mechanics, absorb technical information presented and discussed at various technical meetings, and begin to apply this technology towards actual engineering problems encountered in the course of their work. Example problems are provided to further enhance an understanding of fracture mechanics. Also, Appendix A describes fracture mechanics computer codes available through EPRI to analyze rotors, reactor pressure vessels and piping
Bacillus sp. JR3 esterase LipJ: A new mesophilic enzyme showing traces of a thermophilic past.
Directory of Open Access Journals (Sweden)
Judit Ribera
Full Text Available A search for extremophile enzymes from ancient volcanic soils in El Hierro Island (Canary Islands, Spain allowed isolation of a microbial sporulated strain collection from which several enzymatic activities were tested. Isolates were obtained after sample cultivation under several conditions of nutrient contents and temperature. Among the bacterial isolates, supernatants from the strain designated JR3 displayed high esterase activity at temperatures ranging from 30 to 100°C, suggesting the presence of at least a hyper-thermophilic extracellular lipase. Sequence alignment of known thermophilic lipases allowed design of degenerated consensus primers for amplification and cloning of the corresponding lipase, named LipJ. However, the cloned enzyme displayed maximum activity at 30°C and pH 7, showing a different profile from that observed in supernatants of the parental strain. Sequence analysis of the cloned protein showed a pentapeptide motif -GHSMG- distinct from that of thermophilic lipases, and much closer to that of esterases. Nevertheless, the 3D structural model of LipJ displayed the same folding as that of thermophilic lipases, suggesting a common evolutionary origin. A phylogenetic study confirmed this possibility, positioning LipJ as a new member of the thermophilic family of bacterial lipases I.5. However, LipJ clusters in a clade close but separated from that of Geobacillus sp. thermophilic lipases. Comprehensive analysis of the cloned enzyme suggests a common origin of LipJ and other bacterial thermophilic lipases, and highlights the most probable divergent evolutionary pathway followed by LipJ, which during the harsh past times would have probably been a thermophilic enzyme, having lost these properties when the environment changed to more benign conditions.
Bacillus sp. JR3 esterase LipJ: A new mesophilic enzyme showing traces of a thermophilic past.
Ribera, Judit; Estupiñán, Mónica; Fuentes, Alba; Fillat, Amanda; Martínez, Josefina; Diaz, Pilar
2017-01-01
A search for extremophile enzymes from ancient volcanic soils in El Hierro Island (Canary Islands, Spain) allowed isolation of a microbial sporulated strain collection from which several enzymatic activities were tested. Isolates were obtained after sample cultivation under several conditions of nutrient contents and temperature. Among the bacterial isolates, supernatants from the strain designated JR3 displayed high esterase activity at temperatures ranging from 30 to 100°C, suggesting the presence of at least a hyper-thermophilic extracellular lipase. Sequence alignment of known thermophilic lipases allowed design of degenerated consensus primers for amplification and cloning of the corresponding lipase, named LipJ. However, the cloned enzyme displayed maximum activity at 30°C and pH 7, showing a different profile from that observed in supernatants of the parental strain. Sequence analysis of the cloned protein showed a pentapeptide motif -GHSMG- distinct from that of thermophilic lipases, and much closer to that of esterases. Nevertheless, the 3D structural model of LipJ displayed the same folding as that of thermophilic lipases, suggesting a common evolutionary origin. A phylogenetic study confirmed this possibility, positioning LipJ as a new member of the thermophilic family of bacterial lipases I.5. However, LipJ clusters in a clade close but separated from that of Geobacillus sp. thermophilic lipases. Comprehensive analysis of the cloned enzyme suggests a common origin of LipJ and other bacterial thermophilic lipases, and highlights the most probable divergent evolutionary pathway followed by LipJ, which during the harsh past times would have probably been a thermophilic enzyme, having lost these properties when the environment changed to more benign conditions.
Directory of Open Access Journals (Sweden)
Cristiane Becher Rosa
2008-06-01
Full Text Available OBJETIVO: o objetivo deste trabalho foi avaliar a resistência ao cisalhamento da colagem ortodôntica de um adesivo hidrofílico (Transbond Moisture-Insensitive Primer, 3M Unitek, Monrovia, Califórnia, de um adesivo auto-condicionante (Transbond Self-Etching Primer, 3M Unitek, Monrovia, Califórnia, e sem uso de adesivo, em superfícies de esmalte secas ou contaminadas por saliva. METODOLOGIA: incisivos bovinos (60 foram divididos em 6 grupos: (1 controle sem contaminação salivar (sem adesivo, (2 controle com contaminação salivar (sem adesivo, (3 adesivo auto-condicionante sem contaminação salivar, (4 adesivo auto-condicionante com contaminação salivar antes do adesivo, (5 adesivo hidrofílico sem contaminação salivar e (6 adesivo hidrofílico com contaminação salivar antes do adesivo. Braquetes metálicos foram colados com compósito (Transbond XT, 3M Unitek, Monrovia, Califórnia. Após a colagem, os corpos-de prova foram armazenados a 37±1ºC em ambiente úmido até a realização do teste de cisalhamento. Diferença estatística foi determinada com valor de probabilidade de 0,05 ou menos (p AIM: The purpose of this study was to evaluate the shear bond strength of orthodontic bonding with the use of a hydrophilic primer (Transbond Moisture-Insensitive Primer, 3M Unitek, Monrovia, Calif., a self-etching primer (Transbond Plus Self-etching Primer, 3M Unitek, Monrovia, Calif. and without primer application, in dry and saliva contaminated enamel surfaces. METHODS: Bovine incisors (60 were divided into 6 groups: (1 uncontaminated control (no primer, (2 control with saliva contamination (no primer, (3 uncontaminated self-etching primer, (4 saliva contamination before self-etching primer, (5 uncontaminated hydrophilic primer and (6 saliva contamination before hydrophilic primer. Stainless steel brackets were bonded with composite resin (Transbond XT, 3M Unitek, Monrovia, Calif.. After bonding, all samples were stored at 37±1°C in a
Directory of Open Access Journals (Sweden)
Pérez-Rey David
2010-08-01
Full Text Available Abstract Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1 convert each document into a tree of paper sections, (2 detect the candidate sequences using a set of finite state machine-based recognizers, (3 refine problem sequences using a rule-based expert system, and (4 annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch.
Primer on molecular genetics. DOE Human Genome Program
Energy Technology Data Exchange (ETDEWEB)
1992-04-01
This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.
International Nuclear Information System (INIS)
Tomka, M.; Kirchhoff, T.; Stefurkova, V.; Zajac, V.; Kulcsar, L.
1998-01-01
Familial adenomatous polyposis (FAP) is usually associated with mutation in the adenomatous polyposis coli (APC) gene. To examine the occurrence of these mutations in the number of FAP suspected families from the whole Slovakia effectively, we have applied heteroduplex analysis (HDA) and protein truncation test (PTT) for the analyses of 2-5 base pair deletions and point mutations of the APC gene. In the analyzed exon 15 of the APC gene determined by the primers 15Efor-15Grev for HDA and 15ET7-15J3 for PTT more than 70% of mutations should be deletions [3, 12], which are detectable by HDA. In our collection of 5 FAP families mutations in the APC gene were found in families 10, 27 and 41 using HDA. By PTT test the formation of truncated APC protein in FAP families 2, 10, 16 and 27 were revealed. The necessity of combination of at least HDA and PTT techniques for exact detection of APC mutations in analyzed APC region is discussed. (authors)
Directory of Open Access Journals (Sweden)
Chao Zhang
2016-10-01
Full Text Available In order to develop novel botanical insecticides, the joint action of Ligusticum chuanxiong oil (LCO and lemongrass oil (LO against Aphis citricola van der Goot was determined systematically indoors and outdoors. The chemical profiles of LCO and LO as determined by gas chromatography–mass spectrometry (GC-MS analysis revealed that the main compounds from LCO were (Z-ligustilide (44.58% and senkyunolide A (26.92%, and that of LO were geranial (42.16% and neral (32.58%, respectively. The mixture of LCO and LO showed significant synergy against A. citricola, with a common-toxicity coefficient (CTC value of 221.46 at the optimal ratio of LCO to LO (4:1, w:w. Based on the results of solvents and emulsifiers screening, L. chuanxiong oil·Lemongrass oil 20% emulsifiable concentrate (20% LCO·LO EC was developed, and its stability was confirmed with tests of cold and thermal storage. Field trials indicated that the insecticidal activity of the diluted 20% LCO·LO EC (1000 fold dilution was comparable to conventional pesticide (20% imidacloprid EC on A. citricola seven days after application. Thus, the mixture of LCO and LO has the potential to be further developed as a botanical pesticide.
Adhesion of epoxy primer to hydrotalcite conversion coated AA2024
Leggat, Robert Benton, III
Hydrotalcite-based (HT) conversion coatings are being developed as an environmentally benign alternative to chromate conversion coatings (CCC). Accelerated exposure tests were conducted on epoxy primed, HT-modified AA2024 to gauge service performance. HT-based conversion coatings did not perform as well as the CCC when used with an epoxy primer. The current HT chemistries are optimized for stand-alone corrosion protection, however additional research into the primer/HT interactions is necessary before they can be implemented within a coating scheme. The relative contribution of mechanical and physico-chemical interactions in controlling adhesion has been investigated in this study. Practical adhesion tests were used to assess the dry and wet bond strength of epoxy primer on HT coatings using the pull-off tensile strength (POTS) as the figure of merit. The practical adhesion of HT coated samples generally fell between that observed for the CCC and bare AA2024. Laboratory testing was done to assess the physical and chemical properties of HT coatings. Contact angle measurements were performed using powders representative of different HT chemistries to evaluate the dispersive and acid-base character of the surface. The wet POTS correlated with the electrodynamic (dipole + dispersive) parameter of the surface tension. The HT surfaces were found to be predominantly basic. Given the basicity of epoxy, these results indicate that increasing the acidic character of HT coatings may increase the adhesion performance. This was supported by electrokinetic measurements in which the dry POTS was found to increase with decreasing conversion coating iso-electric point. The correlations with the dry and wet state adhesion are interpreted as indicating that dry state adhesion is optimized by minimizing unfavorable polar interactions between the basic epoxy and HT interfaces. Wet state adhesion, where polar interactions are disrupted, is dictated by non-polar bonding. FTIR
A Primer on Concepts and Applications of Proteomics in Neuroscience
DEFF Research Database (Denmark)
Hosp, Fabian; Mann, Matthias
2017-01-01
The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS...
The effects of pH on N-methacryloyl glycine primer on bond strength to acid-etched dentin.
Nishiyama, N; Suzuki, K; Asakura, T; Nakai, H; Yasuda, S; Nemoto, K
1996-07-01
To develop a more effective adhesive primer, it is imperative to understand the adhesion mechanisms of the resin to the demineralized dentin through a dentin primer. When the bonding agent was directly applied to the dentin etched by 40 wt % phosphoric acid without a primer pretreatment, the bond strength of the resin to the dentin was 5 MPa. Conversely, when the demineralized dentin was pretreated with the N-methacryloyl glycine (NM alpha A) primer solution with a pH value of 1.5, the bond strength increased considerably to 15 MPa. However, the bond strength dropped dramatically from 15 to 3 MPa when the sodium salt of NM alpha A was added, thereby increasing the pH value of the NM alpha A primer solution from 3.2 to 5.0. When the pH value was increased above 3.5 (pKa value), the number of ionized NM alpha A species increased in the solution. As a result, the bond strength of the resin fell to approximately 3 MPa. This result was obtained despite the 5-micron-thick hybrid layer that was created in the subsurface of the intertubular dentin. The number of unionized NM alpha A species increased by lowering the pH value below 3.5. As a result, the NM alpha A primer provided a higher bond strength of the resin to the demineralized dentin. In contrast, when 10 wt % citric acid containing 3 wt % ferric chloride was applied to the dentin, maximum bond strength was obtained when the pH value of the NM alpha A primer solution was 3.5. The pH dependency of the bond strength obtained following 10 wt % citric acid containing 3 wt % ferric chloride etching is different from the results obtained from 40 wt % phosphoric acid etching. This can be attributed to the difference in the characteristics of the demineralized collageous layer.
Transportation Management Area Planning Certification Review Primer: Revised January 18, 2018
2018-01-18
This primer outlines key concepts and expectations of a Transportation Management Area (TMA) Planning Certification Review. Reflecting on the collective experiences of past Certification Reviews, this includes references to relevant laws and regulati...
Note: Primer Amysat 001; Fragment size is 211bp
Indian Academy of Sciences (India)
Renuka
Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.
DEFF Research Database (Denmark)
Lassen, Kristin Marie; Kjær, Erik Dahl; Ouédraogo, Moussa
2014-01-01
Premise of the study: Microsatellite primers were developed for an indigenous fruit tree, Parkia biglobosa, as a tool to study reproductive biology and population structure. Here we use the primers to determine the number of fathers per pod. Methods and Results: Microsatellite loci were enriched...
Directory of Open Access Journals (Sweden)
S Hamid Raji
2011-01-01
Conclusion: The shear bond strength of clearfil protect bond and transbond plus self-etch primer was enough for bonding the orthodontic brackets. The mode of failure of bonded brackets with these two self-etch primers is safe for enamel.
Estrada, T.; Ascasíbar, E.; Blanco, E.; Cappa, A.; Castejón, F.; Hidalgo, C.; van Milligen, B. Ph.; Sánchez, E.
2015-06-01
The spatiotemporal evolution of the interaction between turbulence and flows has been studied close to the L-H transition threshold conditions in the edge of TJ-II plasmas. As in other devices the temporal dynamics of the interaction displays limit cycle oscillations (LCO) with a characteristic predator-prey relationship between flows and turbulence. At TJ-II, the turbulence-flow front is found to propagate radially outwards at the onset of the LCO and in some particular cases, after a short time interval without oscillations, a reversal in the front propagation velocity is observed. Associated to this velocity reversal, a change in the temporal ordering of the LCO is measured. However, the change in the temporal ordering is not related to an intrinsic change in the nature of the LCO. In all cases the turbulence increase leads the process and produces an increase in the E × B flow shear. Dedicated experiments have been carried out to investigate the physical mechanisms triggering the onset of the LCO. At TJ-II the LCO are preferentially observed close to the transition threshold conditions at specific magnetic configurations having a low order rational surface located at the inner side of the E × B flow shear location. The behaviour of different frequency modes has been analysed and interpreted in terms of a geodesic acoustic mode generated by the non-linear mode coupling of Alfvén eigenmodes that evolves towards a low frequency flow, plus a MHD mode linked to the low order rational surface, as precursors of the LCO.
Detection of gunshot primer residue on bone in an experimental setting-an unexpected finding.
Berryman, Hugh E; Kutyla, Alicja K; Russell Davis, J
2010-03-01
Pork ribs with intact muscle tissue were used in an experimental attempt to identify bullet wipe on bone at distances from 1 to 6 feet with 0.45 caliber, full metal jacket ammunition. This resulted in the unexpected finding of primer-derived gunshot residue (GSR) deep within the wound tract. Of significance is the fact that the GSR was deposited on the bone, under the periosteum, after the bullet passed through a Ziploc bag and c. 1 inch of muscle tissue. It is also important to note that the GSR persisted on the bone after the periosteum was forcibly removed. The presence of primer-derived GSR on bone provides the potential to differentiate gunshot trauma from blunt trauma when the bone presents an atypical gunshot wound. In this study, the presence of gunshot primer residue at a distance of 6 feet demonstrates the potential for establishing maximum gun-to-target distance for remote shootings.
An anti-steroidogenic inhibitory primer pheromone in male sea lamprey (Petromyzon marinus)
Chung-Davidson, Yu-Wen; Wang, Huiyong; Bryan, Mara B.; Wu, Hong; Johnson, Nicholas S.; Li, Weiming
2013-01-01
Reproductive functions can be modulated by both stimulatory and inhibitory primer pheromones released by conspecifics. Many stimulatory primer pheromones have been documented, but relatively few inhibitory primer pheromones have been reported in vertebrates. The sea lamprey male sex pheromone system presents an advantageous model to explore the stimulatory and inhibitory primer pheromone functions in vertebrates since several pheromone components have been identified. We hypothesized that a candidate sex pheromone component, 7α, 12α-dihydroxy-5α-cholan-3-one-24-oic acid (3 keto-allocholic acid or 3kACA), exerts priming effects through the hypothalamic-pituitary-gonadal (HPG) axis. To test this hypothesis, we measured the peptide concentrations and gene expressions of lamprey gonadotropin releasing hormones (lGnRH) and the HPG output in immature male sea lamprey exposed to waterborne 3kACA. Exposure to waterborne 3kACA altered neuronal activation markers such as jun and jun N-terminal kinase (JNK), and lGnRH mRNA levels in the brain. Waterborne 3kACA also increased lGnRH-III, but not lGnRH-I or -II, in the forebrain. In the plasma, 3kACA exposure decreased all three lGnRH peptide concentrations after 1 h exposure. After 2 h exposure, 3kACA increased lGnRHI and -III, but decreased lGnRH-II peptide concentrations in the plasma. Plasma lGnRH peptide concentrations showed differential phasic patterns. Group housing condition appeared to increase the averaged plasma lGnRH levels in male sea lamprey compared to isolated males. Interestingly, 15α-hydroxyprogesterone (15α-P) concentrations decreased after prolonged 3kACA exposure (at least 24 h). To our knowledge, this is the only known synthetic vertebrate pheromone component that inhibits steroidogenesis in males.
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2017-07-01
Full Text Available Porcine adulteration in meatball samples were analyzed using real-time polymerase chain reaction (RT-PCR, based on the ND5 primer obtained by previous study. This work consisted of three stages which were annealing temperature optimization, method validation, and application. DNA template was extracted using phenol-CIAA (chloroform-iso amyl alcohol method. The optimum annealing temperature for ND5 primers (forward primer 5'-CATTCGCCTCACTCACATTAACC-3' and reverse primer 5'-AAGAGAGAGTTCTACGGTCTGTAG-3' was 58.0 °C, obtained after testing annealing at 50.5 to 59.5 °C gradient temperature with 5 °C interval. Melting curve analysis was done at 65.0 to 95.0 °C, with increasing temperature for 0.5 °C per 2 sec. Method was validated for its specificity, precision and limit of detection. RT-PCR method with ND5 primers produced 227 bp DNA fragment with 78.50 °C Tm value. From eight commercial meatball samples, one was detected containing porcine. The methods showed high specificity and precision, with experimentally determined limits for porcine were no less than 1%.
Development of specific primers for genus Fusarium and F. solani ...
African Journals Online (AJOL)
Yomi
2012-01-05
Jan 5, 2012 ... reproductive parts of plants. They are ... plant species in most parts of the world. .... 20 µl 2.5X master mix (Eppendorf) and 1 µl of each forward and ... List of primers developed for rapid detection of Fusarium sp. and F. solani.
Camilo, Cesar M; Lima, Gustavo M A; Maluf, Fernando V; Guido, Rafael V C; Polikarpov, Igor
2016-01-01
Following burgeoning genomic and transcriptomic sequencing data, biochemical and molecular biology groups worldwide are implementing high-throughput cloning and mutagenesis facilities in order to obtain a large number of soluble proteins for structural and functional characterization. Since manual primer design can be a time-consuming and error-generating step, particularly when working with hundreds of targets, the automation of primer design process becomes highly desirable. HTP-OligoDesigner was created to provide the scientific community with a simple and intuitive online primer design tool for both laboratory-scale and high-throughput projects of sequence-independent gene cloning and site-directed mutagenesis and a Tm calculator for quick queries.
Glennon, Kelsey L.; Cron, Glynis V.
2016-01-01
Premise of the study: Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Methods and Results: Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. Conclusions: These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species. PMID:27213125
Directory of Open Access Journals (Sweden)
Marco Suárez
2006-05-01
Full Text Available Objetivo. Estudiar los factores ambientales y genéticos que influyen sobre la edad al primer parto dehembras romosinuano. Materiales y métodos. Fueron estudiados 932 datos de la edad al primer partode hembras de la raza Romosinuano, nacidas en el Centro de Investigación Turipaná de CORPOICA,Cereté, Colombia, en el período de 1980 a 2001. Para el estudio de los factores ambientales se utilizóel análisis de varianza mediante modelos lineales utilizando el procedimiento GLM de SAS (1995.Resultados. La edad al primer parto fue de 1162.3±4.2 días, con un coeficiente de variación del 11.19%.El análisis de varianza reveló que el año y mes de nacimiento fueron causas estadísticamente significativasde variación de la edad al primer parto. La heredabilidad, calculada por la correlación intraclase entremedias hermanas paternas fue de 0.16±0.08. Conclusión. El año y mes de nacimiento influyeron en laedad al primer parto de hembras romosinuano, pero la heredabilidad de la edad al primer parto y elsexo de la cría no se constituyen en características importantes a tener en cuenta.
Ares, Janus, Globalization: A Primer For The Military Leader in NATO
National Research Council Canada - National Science Library
Clemons, Dean
2002-01-01
...: international military and commercial investment; dual-use technologies; and export control. As a primer on these stakes for the rising military leader within the North Atlantic Treaty, the study elucidates the issue of cooperation vs...
International Nuclear Information System (INIS)
Nam, Hyun-Suk; Oh, Chang-Young; Kim, Yun-Jae; Jerng, Dong Wook; Ainsworth, Robert A.; Budden, Peter J.; Marie, Stéphane
2015-01-01
This paper compares elastic–plastic values of J calculated using the methods in the UK R6 and the French A16 fitness-for-service procedures with FE results for a vessel with a circumferential surface crack under axial tension and a radial thermal gradient. In the FE analyses, the relative magnitudes and loading sequence of mechanical and thermal loads are systematically varied, together with the material strain hardening exponent. Fully circumferential and semi-elliptical surface crack with two relative crack depths are considered. It is found that the R6 estimates are overall accurate but can be non-conservative at large L_r. The A16 estimates are more conservative than the R6 estimates at small L_r but are conservative even at large L_r. Possible sources of conservatism and non-conservatism in R6 and A16 are discussed. - Highlights: • Accuracy of existing J estimation methods for combined mechanical and thermal loading are compared with FE results. • The methods in the UK R6 and the French A16 procedures are considered. • The R6 estimates are overall accurate but can be non-conservative at large L_r. • The A16 estimates are more conservative than the R6 estimates at small L_r but are conservative even at large L_r. • Possible sources of conservatism and non-conservatism in R6 and A16 are discussed.
Bayesian models a statistical primer for ecologists
Hobbs, N Thompson
2015-01-01
Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili
Directory of Open Access Journals (Sweden)
Lenka Maršálková
2014-07-01
Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.
Primer for criticality calculations with DANTSYS
International Nuclear Information System (INIS)
Busch, R.D.
1996-01-01
With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses
A web-based adaptive tutor to teach PCR primer design
van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.
2012-01-01
When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used
A Web-based Adaptive Tutor to Teach PCR Primer Design
Seters, van J.R.; Wellink, J.; Tramper, J.; Goedhart, M.J.; Ossevoort, M.A.
2012-01-01
When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used
International Nuclear Information System (INIS)
Aigner, R.; Melzer, E.; Seissler, H.
1986-01-01
This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de
Bond strength of primer/cement systems to zirconia subjected to artificial aging.
Zhao, Li; Jian, Yu-Tao; Wang, Xiao-Dong; Zhao, Ke
2016-11-01
Creating reliable and durable adhesion to the nonactive zirconia surface is difficult and has limited zirconia use. The introduction of functional monomers such as 10-methacryloyloxydecyl dihydrogen phosphate (MDP) appears to have enhanced bond strength to zirconia. The purpose of this in vitro study was to evaluate the long-term bond strength of several MDP-containing primer/cement systems to zirconia. Zirconia blocks were divided into 6 groups (n=24) according to the 3 primers/cements to be bonded, as follows: Scotchbond Universal/RelyX Ultimate (SU/RU; consisting of MDP-containing primer/MDP-free cement); Clearfil ceramic primer/Panavia F (CCP/PAN; consisting ofMDP-containing/MDP-containing); and Z-Prime Plus/Duo-Link (ZP/DUO; consisting ofMDP-containing/MDP-free), which were compared with 3 nonprimed groups, RU, PAN, and DUO. After bonding, each group was further divided into 3 subgroups (n=8) according to the level of aging: 24-hour storage in water at 37°C (24H); 30-day storage at 37°C (30D); and 30-day storage at 37°C followed by 3000 thermal cycles (30D/TC). After aging, a shear bond strength test and failure mode analysis were performed. The data were analyzed using 2-way ANOVA (α=.05). After aging, nearly all primer/cement groups presented significantly higher bond strength than the related nonprimed groups for each level of aging (P<.05), except for CCP/PAN versus PAN with 24H (P=.741). SU/RU had the highest bond strength among the groups for all treatments (P<.05), except for CCP/PAN versus SU/RU with 30D/TC (P=.171). Among the nonprimed groups, only RU went through 30D/TC without premature debonding. With 24H and 30D, the failure modes in SU/RU and CCP/PAN were purely mixed, whereas those in the other groups were mainly adhesive, except for RU. The superiority of the initial bond strength in SU/RU may result from some functional components other than MDP. The presence of MDP in the cement did not appear to have a positive effect on long-term bond
Incorporating travel-time reliability into the congestion management process : a primer.
2015-02-01
This primer explains the value of incorporating travel-time reliability into the Congestion Management Process (CMP) : and identifies the most current tools available to assist with this effort. It draws from applied research and best practices : fro...
Bayesian models: A statistical primer for ecologists
Hobbs, N. Thompson; Hooten, Mevin B.
2015-01-01
Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models
Effects of cyclophosphamide and irradiation singly and in combination upon SaI growth in A/J mice
International Nuclear Information System (INIS)
Anderson, R.E.; Williams, W.L.; Tokuda, S.
1987-01-01
The effects of various doses of cyclophosphamide and low-dose (15 rads) radiation upon the size of tumors caused by 10(4) Sarcoma I (SaI) cells was determined. In intact A/Jax (A/J) recipients, the effect of the two agents singly and in combination was found to be dependent especially upon the dosage of cyclophosphamide and the time of its administration in relation to tumor inoculation. In cell transfer experiments to adult thymectomized, lethally irradiated, bone-marrow-restored (ATxXBM) mice, the effects of cyclophosphamide and irradiation appeared to be either overlapping (low dosages of cyclophosphamide) or additive (dosages of cyclophosphamide greater than or equal to 50 mg/kg), suggesting that the two agents exert their influence in dissimilar fashion, perhaps by injuring different cell types with the same basic function. The most pronounced conjoint effects are seen when low dosages of cyclophosphamide are given 3 days after the adoptive transfer of spleen cells from mice pretreated with low-dose irradiation. The implications of this observation with respect to immunotherapy are discussed
Sousa, Ana Beatriz Silva; de Mattos Pimenta Vidal, Cristina; Leme-Kraus, Ariene Arcas; de Carvalho Panzeri Pires-de-Souza, Fernanda; Bedran-Russo, Ana K.
2016-01-01
Objective To evaluate the effect of experimental primers (chlorhexidine, enriched mixture of proanthocyanidins and doxycycline) on the adhesive properties and gelatinolytic activity at dentin-resin interfaces of occlusal Class I restorations. Methods The inactivation of enzymes by the experimental primers was assessed by fluorescence assay and gelatin zymography. To assess the adhesive properties, occlusal Class I cavities were prepared in sound human molars, etched with phosphoric acid and restored with one of the primers and an etch-and-rinse adhesive system (Adper Single Bond Plus - 3M ESPE). After the restorative procedures, the specimens were divided into two subgroups (n = 6) consisting of storage in incubation buffer or axial cyclic loading at 50 N and 1,000,000 cycles. Then, the sectioned and sliced specimens were assigned to in situ zymography assay and microtensile bond strength (TBS) test. Results Fluorescence assay and gelatin zymography revealed that the experimental primers inactivated rMMPs. In situ zymography (2-way ANOVA, Tukey, p 0.05). Significance The use of experimental primers impaired the enzymatic activity at the dentin-adhesive interface after cyclic loading and the activity of rMMPs. Cyclic loading did not have a significant effect on the bond strength. PMID:27524231
Pitta, João; Branco, Teresa C; Portugal, Jaime
2018-05-01
Saliva contamination has been shown to decrease bonding to zirconia. Adopting a less contamination-sensitive cement system may be an alternative to decontamination. The purpose of this in vitro study was to assess the ability of different primer/cement systems to promote a durable bond to zirconia after saliva contamination. Zirconia blocks (Lava Plus) (N=320) were airborne-particle abraded (50 μm Al 2 O 3 ) and divided into 32 experimental groups (n=10) according to the variables in the study: saliva contamination; primer/cement system (Panavia SA [PSA]; RelyX Unicem 2 [RU2]; Bifix SE [BSE]; Panavia F2.0 [PF2]; Scotchbond Universal + RelyX Ultimate [SBU+RXU]; Futurabond M+ + Bifix QM [FBM+BQM]; All-Bond Universal + Duo-link [ABU+DL]; Z-Prime Plus + Duo-link [ZPP+DL]; and aging period (72 hours; 30 days with 10 000 thermocycles at 5°C to 55°C). After half of the blocks had been contaminated with fresh human saliva for 10 minutes, rinsed with water, and air-dried, each primer/cement was applied. Polymerized composite resin disks were then placed over the cement, and the resin cement was light-polymerized for 20 seconds each at 2 opposite margins. After the aging time, the specimens were tested in shear (1 mm/min). The failure mode was classified as adhesive, cohesive, or mixed. Statistical analysis of the shear bond strength (SBS) data was performed with ANOVA followed by Tukey honest significant difference post hoc tests. Chi-square tests were used to analyze the failure mode data (α=.05). The mean SBS ranged between 4.2 and 34.5 MPa. Shear bond strength was influenced (Pcontamination, aging time). SBU+RXU and FBM+BQM showed a higher mean SBS than those of the other experimental groups (Pcontamination (P>.05). Failure was predominantly classified as adhesive. In general, saliva contamination and aging decreased bonding efficacy. Two systems, combining an application of a universal adhesive and a resin cement (SBU+RXU and FBM+BQM) were not affected by
Efficient One-Step Fusion PCR Based on Dual-Asymmetric Primers and Two-Step Annealing
DEFF Research Database (Denmark)
Liu, Yilan; Chen, Jinjin; Thygesen, Anders
2018-01-01
Gene splicing by fusion PCR is a versatile and widely used methodology, especially in synthetic biology. We here describe a rapid method for splicing two fragments by one-round fusion PCR with a dual-asymmetric primers and two-step annealing (ODT) method. During the process, the asymmetric...... intermediate fragments were generated in the early stage. Thereafter, they were hybridized in the subsequent cycles to serve as template for the target full-length product. The process parameters such as primer ratio, elongation temperature and cycle numbers were optimized. In addition, the fusion products...
El primer encuentro del padre con el bebé prematuro en la Unidad de Cuidados Intensivos Neonatales
Directory of Open Access Journals (Sweden)
Fernanda Martins Castro
2015-06-01
Full Text Available Objetivo: Describir el primer encuentro del padre con el hijo en la Unidad de Cuidados Intensivos Neonatales (UCIN y analizar el significado de este momento en la perspectiva de los padres. Método: estudio cualitativo, con ocho padres de niños prematuros, a través de entrevistas semi-estructuradas. Los datos se analizaron a través del análisis temático. Resultados: Surgieron tres núcleos temáticos: "primer encuentro con hijo prematuro: sentimientos paternales y emociones", "construcción de la relación entre los profesionales y los padres de los recién nacidos a partir del primer encuentro" y reconocimiento de la paternidad en el contexto de la UCIN. Conclusión: El primer encuentro del padre con su hijo en la UCIN provoca sentimientos y sorpresa, dolor, incertidumbre, alegría y esperanza. El equipo de salud debe estar preparado para brindar apoyo emocional, información y establecer una comunicación efectiva desde la primera visita.
Teaching Thermal Hydraulics and Numerical Methods: An Introductory Control Volume Primer
International Nuclear Information System (INIS)
D. S. Lucas
2004-01-01
A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com
Comparison of Self-Etch Primers with Conventional Acid Etching System on Orthodontic Brackets
Zope, Amit; Zope-Khalekar, Yogita; Chitko, Shrikant S.; Kerudi, Veerendra V.; Patil, Harshal Ashok; Jaltare, Pratik; Dolas, Siddhesh G
2016-01-01
Introduction The self-etching primer system consists of etchant and primer dispersed in a single unit. The etching and priming are merged as a single step leading to fewer stages in bonding procedure and reduction in the number of steps that also reduces the chance of introduction of error, resulting in saving time for the clinician. It also results in smaller extent of enamel decalcification. Aim To compare the Shear Bond Strength (SBS) of orthodontic bracket bonded with Self-Etch Primers (SEP) and conventional acid etching system and to study the surface appearance of teeth after debonding; etching with conventional acid etch and self-etch priming, using stereomicroscope. Materials and Methods Five Groups (n=20) were created randomly from a total of 100 extracted premolars. In a control Group A, etching of enamel was done with 37% phosphoric acid and bonding of stainless steel brackets with Transbond XT (3M Unitek, Monrovia, California). Enamel conditioning in left over four Groups was done with self-etching primers and adhesives as follows: Group B-Transbond Plus (3M Unitek), Group C Xeno V+ (Dentsply), Group D-G-Bond (GC), Group E-One-Coat (Coltene). The Adhesive Remnant Index (ARI) score was also evaluated. Additionally, the surface roughness using profilometer were observed. Results Mean SBS of Group A was 18.26±7.5MPa, Group B was 10.93±4.02MPa, Group C was 6.88±2.91MPa while of Group D was 7.78±4.13MPa and Group E was 10.39±5.22MPa respectively. In conventional group ARI scores shows that over half of the adhesive was remaining on the surface of tooth (score 1 to 3). In self-etching primer groups ARI scores show that there was no or minor amount of adhesive remaining on the surface of tooth (score 4 and 5). SEP produces a lesser surface roughness on the enamel than conventional etching. However, statistical analysis shows significant correlation (pbracket bonding after enamel conditioning with any of the SEPs tested. The SEPs used in Groups C (Xeno V
Xu, Jing-Yuan; Zhu, Yan; Yi, Ze; Wu, Gang; Xie, Guo-Yong; Qin, Min-Jian
2018-01-01
"Wu zhu yu", which is obtained from the dried unripe fruits of Tetradium ruticarpum (A. Jussieu) T. G. Hartley, has been used as a traditional Chinese medicine for treatment of headaches, abdominal colic, and hypertension for thousands of years. The present study was designed to assess the molecular genetic diversity among 25 collected accessions of T. ruticarpum (Wu zhu yu in Chinese) from different areas of China, based on inter-primer binding site (iPBS) markers and inter-simple sequence repeat (ISSR) markers. Thirteen ISSR primers generated 151 amplification bands, of which 130 were polymorphic. Out of 165 bands that were amplified using 10 iPBS primers, 152 were polymorphic. The iPBS markers displayed a higher proportion of polymorphic loci (PPL = 92.5%) than the ISSR markers (PPL = 84.9%). The results showed that T. ruticarpum possessed high loci polymorphism and genetic differentiation occurred in this plant. The combined data of iPBS and ISSR markers scored on 25 accessions produced five clusters that approximately matched the geographic distribution of the species. The results indicated that both iPBS and ISSR markers were reliable and effective tools for analyzing the genetic diversity in T. ruticarpum. Copyright © 2018 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.
Ongkowidjaja, F.; Soegiharto, B. M.; Purbiati, M.
2017-08-01
The shear bond strength (SBS) can be increased by removing protein pellicles from the enamel surface by deproteinization using 5.25% sodium hypochlorite (NaOCl). The SBS of a self-etch primer is lower than that of a total etch primer; nonetheless, it prevents white spot lesions. This study aimed to assess the SBS of the Anyetch (AE) total etch primer and FL-Bond II Shofu (FL) self-etch primer after enamel deproteinization using 5.25% NaOCl. Forty eight human maxillary first premolars were extracted, cleaned, and divided into four groups. In group A, brackets were bonded to the enamel without deproteinization before etching (A1: 10 teeth using total etch primer (AE); A2: 10 teeth using self-etch primer (FL)). In group B, brackets were bonded to the enamel after deproteinization with 5.25% NaOCl before etching (B1: 10 teeth using total etch primer (AE); B2: 10 teeth using self-etch primer (FL)). Brackets were bonded using Transbond XT, stored in artificial saliva for 24 h at 37°C, mounted on acrylic cylinders, and debonded using a Shimadzu AG-5000 universal testing machine. There were no significant differences in SBS between the total etch (AE) groups (p > 0.05) and between the self-etch (FL) groups (p > 0.05). There were significant differences in SBS between groups A and B. The mean SBS for groups A1, A2, B1, and B2 was 12.91±3.99, 4.46±2.47, 13.06±3.66, and 3.62±2.36 MPa, respectively. Deproteinization using NaOCl did not affect the SBS of the total etch primer (AE) group; it reduced the SBS of the self-etch primer (FL) group, but not with a statistically significant difference.
A Primer on Observational Measurement.
Girard, Jeffrey M; Cohn, Jeffrey F
2016-08-01
Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.
Cook, Brian J; Pink, Maren; Pal, Kuntal; Caulton, Kenneth G
2018-05-21
The bis-pyrazolato pyridine complex LCo(PEt 3 ) 2 serves as a masked form of three-coordinate Co II and shows diverse reactivity in its reaction with several potential outer sphere oxidants and oxygen atom transfer reagents. N-Methylmorpholine N-oxide (NMO) oxidizes coordinated PEt 3 from LCo(PEt 3 ) 2 , but the final cobalt product is still divalent cobalt, in LCo(NMO) 2 . The thermodynamics of a variety of oxygen atom transfer reagents, including NMO, are calculated by density functional theory, to rank their oxidizing power. Oxidation of LCo(PEt 3 ) 2 with AgOTf in the presence of LiCl as a trapping nucleophile forms the unusual aggregate [LCo(PEt 3 ) 2 Cl(LiOTf) 2 ] 2 held together by Li + binding to very nucleophilic chloride on Co(III) and triflate binding to those Li + . In contrast, Cp 2 Fe + effects oxidation to trivalent cobalt, to form (HL)Co(PEt 3 ) 2 Cl + ; proton and the chloride originate from solvent in a rare example of CH 2 Cl 2 dehydrochlorination. An unexpected noncomplementary redox reaction is reported involving attack by 2e reductant PEt 3 nucleophile on carbon of the 1e oxidant radical Cp 2 Fe + , forming a P-C bond and H + ; this reaction competes in the reaction of LCo(PEt 3 ) 2 with Cp 2 Fe + .
Directory of Open Access Journals (Sweden)
Julio J. Masquijo
2014-10-01
Full Text Available Introducción: si bien el crecimiento prenatal y posnatal del pie ha sido documentado hace varios años, el crecimiento longitudinal del primer metatarsiano en particular no ha sido estudiado previamente. El objetivo del estudio es determinar el patrón de crecimiento longitudinal posnatal de este hueso y compararlo con el del pie y los huesos largos del miembro inferior. Materiales y Métodos: mediante una búsqueda informatizada, se identificaron pacientes <18 años de edad con radiografías informadas como “normal” por el radiólogo. Se analizó una muestra de 886 pacientes divididos en 18 grupos según la edad (0-11 meses, 1 año, 2 años, etc. y el sexo. El análisis de las imágenes se realizó con un software de imágenes Kodak Carestream PACS. Resultados: el largo promedio en el primer grupo fue de 19,91 mm (3,20; 15,22-25,62. El largo promedio en el último grupo fue de 66,13 mm (5,33; 52,50-77,18. La tasa de crecimiento anual fue de 2,71 mm. La edad promedio al momento del cierre de la fisis fue de 14.85 años (± 1.64 para los varones y 14.77 años (± 3.63 para las niñas. Conclusión: el crecimiento del primer metatarsiano acompaña el crecimiento longitudinal del pie, pero no el de los huesos largos del miembro inferior. Las curvas de crecimiento del primer metatarsiano descritas en este artículo pueden ser aplicadas en patologías que afectan el desarrollo del pie o que requieren cirugía de corrección sobre el primer metatarsiano, o se las puede emplear como estándar de referencia en futuros estudios.
Lopes, Denilce Meneses; de Oliveira Campos, Lúcio Antônio; Salomão, Tânia Maria Fernandes; Tavares, Mara Garcia
2010-04-01
Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.
Gonzalez-Martinez, Alejandro; Rodriguez-Sanchez, Alejandro; Rodelas, Belén; Abbas, Ben A; Martinez-Toledo, Maria Victoria; van Loosdrecht, Mark C M; Osorio, F; Gonzalez-Lopez, Jesus
2015-01-01
Identification of anaerobic ammonium oxidizing (anammox) bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing) of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON) and three full-scale bioreactors (anammox, CANON, and DEMON), was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature). The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C) and hence a range of annealing temperatures of 44-49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.
Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki
2011-03-01
The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Douglas de Almeida Pereira
2015-09-01
Full Text Available Primer pairs that access microsatellite loci, initially constructed through the genome of Passiflora edulis Sims flavicarpa and P. alata, were tested concerning their ability to access microsatellite loci in ‘somnus’ passion fruit tree (P. setacea individuals. Seven out of the thirty one primer pairs tested were able to access DNA polymorphism in the genome of this wild Passiflora species, by evaluating six natural populations, located in a transition area between the biomes Caatinga and Cerrado, in the state of Bahia, Brazil. The number of alleles/loci was small, oscillating from 1 to 4. The average heterozygosity observed per locus in all populations ranged from 0.13 to 0.40. There was transference of heterologous microsatellite primer pairs from the Passiflora genus to ‘somnus’ passion fruit tree, constituting a new set of primers that access random co-dominant locus in this species, useful for conservationist purposes and pre-improvement of ‘somnus’ passion fruit tree.
SVX Sequence Crate Custom J2/J3 Backplane
International Nuclear Information System (INIS)
Utes, M.
1997-01-01
The Custom J2/J3 Backplane is a full length (21 slot) user specified custom 3U backplane to be used in both the J2 and J3 positions. Slot spacing is identical to that used for VME (0.8-inch), and each backplane shall fit into a standard Eurocard VME style crate. The purpose of the Custom J2/J3 Backplane is to send and receive control and clock signals from the SVX chips via 3M pleated foil cables (Slots 2-21), and in slot 1, accept a cable connector and route its signal through to a signal distribution board.
Scorpion Hybrid Optical-based Inertial Tracker (HObIT) test results
Atac, Robert; Spink, Scott; Calloway, Tom; Foxlin, Eric
2014-06-01
High fidelity night-vision training has become important for many of the simulation systems being procured today. The end-users of these simulation-training systems prefer using their actual night-vision goggle (NVG) headsets. This requires that the visual display system stimulate the NVGs in a realistic way. Historically NVG stimulation was done with cathode-ray tube (CRT) projectors. However, this technology became obsolete and in recent years training simulators do NVG stimulation with laser, LCoS and DLP projectors. The LCoS and DLP projection technologies have emerged as the preferred approach for the stimulation of NVGs. Both LCoS and DLP technologies have advantages and disadvantages for stimulating NVGs. LCoS projectors can have more than 5-10 times the contrast capability of DLP projectors. The larger the difference between the projected black level and the brightest object in a scene, the better the NVG stimulation effects can be. This is an advantage of LCoS technology, especially when the proper NVG wavelengths are used. Single-chip DLP projectors, even though they have much reduced contrast compared to LCoS projectors, can use LED illuminators in a sequential red-green-blue fashion to create a projected image. It is straightforward to add an extra infrared (NVG wavelength) LED into this sequential chain of LED illumination. The content of this NVG channel can be independent of the visible scene, which allows effects to be added that can compensate for the lack of contrast inherent in a DLP device. This paper will expand on the differences between LCoS and DLP projectors for stimulating NVGs and summarize the benefits of both in night-vision simulation training systems.
Energy Technology Data Exchange (ETDEWEB)
Anashin, V.V. [Budker Institute of Nuclear Physics, 11, akademika Lavrentieva prospect, Novosibirsk, 630090 (Russian Federation); Aulchenko, V.M. [Budker Institute of Nuclear Physics, 11, akademika Lavrentieva prospect, Novosibirsk, 630090 (Russian Federation); Novosibirsk State University, 2, Pirogova street, Novosibirsk, 630090 (Russian Federation); Baldin, E.M., E-mail: E.M.Baldin@inp.nsk.s [Budker Institute of Nuclear Physics, 11, akademika Lavrentieva prospect, Novosibirsk, 630090 (Russian Federation); Novosibirsk State University, 2, Pirogova street, Novosibirsk, 630090 (Russian Federation); Barladyan, A.K.; Barnyakov, A.Yu.; Barnyakov, M.Yu. [Budker Institute of Nuclear Physics, 11, akademika Lavrentieva prospect, Novosibirsk, 630090 (Russian Federation); Baru, S.E. [Budker Institute of Nuclear Physics, 11, akademika Lavrentieva prospect, Novosibirsk, 630090 (Russian Federation); Novosibirsk State University, 2, Pirogova street, Novosibirsk, 630090 (Russian Federation); Bedny, I.V. [Budker Institute of Nuclear Physics, 11, akademika Lavrentieva prospect, Novosibirsk, 630090 (Russian Federation); Beloborodova, O.L. [Budker Institute of Nuclear Physics, 11, akademika Lavrentieva prospect, Novosibirsk, 630090 (Russian Federation); Novosibirsk State University, 2, Pirogova street, Novosibirsk, 630090 (Russian Federation); Blinov, A.E. [Budker Institute of Nuclear Physics, 11, akademika Lavrentieva prospect, Novosibirsk, 630090 (Russian Federation); Blinov, V.E. [Budker Institute of Nuclear Physics, 11, akademika Lavrentieva prospect, Novosibirsk, 630090 (Russian Federation); Novosibirsk State Technical University, 20, Karl Marx prospect, Novosibirsk, 630092 (Russian Federation); Bobrov, A.V.; Bobrovnikov, V.S. [Budker Institute of Nuclear Physics, 11, akademika Lavrentieva prospect, Novosibirsk, 630090 (Russian Federation)
2010-03-01
The products of the electron width of the J/psi meson and the branching fraction of its decays to the lepton pairs were measured using data from the KEDR experiment at the VEPP-4M electron-positron collider. The results are GAMMA{sub ee}xGAMMA{sub ee}/GAMMA=0.3323+-0.0064(stat.)+-0.0048(syst.) keV, GAMMA{sub ee}xGAMMA{sub m}u{sub m}u/GAMMA=0.3318+-0.0052(stat.)+-0.0063(syst.) keV. Their combinations GAMMA{sub ee}x(GAMMA{sub ee}+GAMMA{sub m}u{sub m}u)/GAMMA=0.6641+-0.0082(stat.)+-0.0100(syst.) keV, GAMMA{sub ee}/GAMMA{sub m}u{sub m}u=1.002+-0.021(stat.)+-0.013(syst.) can be used to improve the accuracy of the leptonic and full widths and test leptonic universality. Assuming emu universality and using the world average value of the lepton branching fraction, we also determine the leptonic GAMMA{sub ll}=5.59+-0.12 keV and total GAMMA=94.1+-2.7 keV widths of the J/psi meson.
International Nuclear Information System (INIS)
Kang, Kyung Min
2003-02-01
Limiting conditions for operations define the allowed outage times and the actions to be taken if the repair cannot be completed within the AOT. Typically the actions required are plant shutdown. In situations where the risk associated with the action, i.e., the risk of plant shutdown given a failure in the safety system, may be substantial, a strategy is needed to control the risk implications. In this study the strategy is evaluated quantitatively using a tool of system dynamics. The strategic actions associated with LCO needs to be assessed dynamically. System dynamics technique is easy enough to be applied for quantitative assessment of LCO, where the system dynamics is an important factor in evaluating operational modes of nuclear power plants. The review on the improvements of overly conservative technical specification has been performed in this study. The VENSIM tool has been applied to evaluate quantitatively the LCO of the auxiliary feed water systems in the Wol-Sung nuclear power plant. A value of core damage frequency in PSA is used as risk measure. The analysis of both full power operation and shutdown operation has been compared for the value of the CDF. This study shows a plot of LCO full power operating and shutdown risks in term of core damage probability for failure of AFWS (auxiliary feedwater system). Obtaining a lower risk level in a stable mode, compared to the LCO operation alternative, is the principal motivation of going to full power operational mode or shutdown operational mode. A time dependent framework developed in this study has been applied to assess the LCO of the example problem and it is shown that it is very flexible in that it can be applied to assess LCO quantitatively under any operational context of the technical specifications. This study contributes risk informed regulation to enhance and optimize the LCO of previous technical specifications for CANDU through developing framework in application proposed in this methodology
Observation of ψ(3686)→e^{+}e^{-}χ_{cJ} and χ_{cJ}→e^{+}e^{-}J/ψ.
Ablikim, M; Achasov, M N; Ai, X C; Albayrak, O; Albrecht, M; Ambrose, D J; Amoroso, A; An, F F; An, Q; Bai, J Z; Baldini Ferroli, R; Ban, Y; Bennett, D W; Bennett, J V; Bertani, M; Bettoni, D; Bian, J M; Bianchi, F; Boger, E; Boyko, I; Briere, R A; Cai, H; Cai, X; Cakir, O; Calcaterra, A; Cao, G F; Cetin, S A; Chang, J F; Chelkov, G; Chen, G; Chen, H S; Chen, H Y; Chen, J C; Chen, M L; Chen, S; Chen, S J; Chen, X; Chen, X R; Chen, Y B; Cheng, H P; Chu, X K; Cibinetto, G; Dai, H L; Dai, J P; Dbeyssi, A; Dedovich, D; Deng, Z Y; Denig, A; Denysenko, I; Destefanis, M; De Mori, F; Ding, Y; Dong, C; Dong, J; Dong, L Y; Dong, M Y; Dou, Z L; Du, S X; Duan, P F; Fan, J Z; Fang, J; Fang, S S; Fang, X; Fang, Y; Farinelli, R; Fava, L; Fedorov, O; Feldbauer, F; Felici, G; Feng, C Q; Fioravanti, E; Fritsch, M; Fu, C D; Gao, Q; Gao, X L; Gao, X Y; Gao, Y; Gao, Z; Garzia, I; Goetzen, K; Gong, L; Gong, W X; Gradl, W; Greco, M; Gu, M H; Gu, Y T; Guan, Y H; Guo, A Q; Guo, L B; Guo, R P; Guo, Y; Guo, Y P; Haddadi, Z; Hafner, A; Han, S; Hao, X Q; Harris, F A; He, K L; Held, T; Heng, Y K; Hou, Z L; Hu, C; Hu, H M; Hu, J F; Hu, T; Hu, Y; Huang, G S; Huang, J S; Huang, X T; Huang, X Z; Huang, Y; Huang, Z L; Hussain, T; Ji, Q; Ji, Q P; Ji, X B; Ji, X L; Jiang, L W; Jiang, X S; Jiang, X Y; Jiao, J B; Jiao, Z; Jin, D P; Jin, S; Johansson, T; Julin, A; Kalantar-Nayestanaki, N; Kang, X L; Kang, X S; Kavatsyuk, M; Ke, B C; Kiese, P; Kliemt, R; Kloss, B; Kolcu, O B; Kopf, B; Kornicer, M; Kupsc, A; Kühn, W; Lange, J S; Lara, M; Larin, P; Leng, C; Li, C; Li, Cheng; Li, D M; Li, F; Li, F Y; Li, G; Li, H B; Li, H J; Li, J C; Li, Jin; Li, K; Li, K; Li, Lei; Li, P R; Li, Q Y; Li, T; Li, W D; Li, W G; Li, X L; Li, X N; Li, X Q; Li, Y B; Li, Z B; Liang, H; Liang, Y F; Liang, Y T; Liao, G R; Lin, D X; Liu, B; Liu, B J; Liu, C X; Liu, D; Liu, F H; Liu, Fang; Liu, Feng; Liu, H B; Liu, H H; Liu, H H; Liu, H M; Liu, J; Liu, J B; Liu, J P; Liu, J Y; Liu, K; Liu, K Y; Liu, L D; Liu, P L; Liu, Q; Liu, S B; Liu, X; Liu, Y B; Liu, Z A; Liu, Zhiqing; Loehner, H; Lou, X C; Lu, H J; Lu, J G; Lu, Y; Lu, Y P; Luo, C L; Luo, M X; Luo, T; Luo, X L; Lyu, X R; Ma, F C; Ma, H L; Ma, L L; Ma, M M; Ma, Q M; Ma, T; Ma, X N; Ma, X Y; Ma, Y M; Maas, F E; Maggiora, M; Mao, Y J; Mao, Z P; Marcello, S; Messchendorp, J G; Min, J; Mitchell, R E; Mo, X H; Mo, Y J; Morales Morales, C; Muchnoi, N Yu; Muramatsu, H; Nefedov, Y; Nerling, F; Nikolaev, I B; Ning, Z; Nisar, S; Niu, S L; Niu, X Y; Olsen, S L; Ouyang, Q; Pacetti, S; Pan, Y; Patteri, P; Pelizaeus, M; Peng, H P; Peters, K; Pettersson, J; Ping, J L; Ping, R G; Poling, R; Prasad, V; Qi, H R; Qi, M; Qian, S; Qiao, C F; Qin, L Q; Qin, N; Qin, X S; Qin, Z H; Qiu, J F; Rashid, K H; Redmer, C F; Ripka, M; Rong, G; Rosner, Ch; Ruan, X D; Sarantsev, A; Savrié, M; Schoenning, K; Schumann, S; Shan, W; Shao, M; Shen, C P; Shen, P X; Shen, X Y; Sheng, H Y; Shi, M; Song, W M; Song, X Y; Sosio, S; Spataro, S; Sun, G X; Sun, J F; Sun, S S; Sun, X H; Sun, Y J; Sun, Y Z; Sun, Z J; Sun, Z T; Tang, C J; Tang, X; Tapan, I; Thorndike, E H; Tiemens, M; Ullrich, M; Uman, I; Varner, G S; Wang, B; Wang, B L; Wang, D; Wang, D Y; Wang, K; Wang, L L; Wang, L S; Wang, M; Wang, P; Wang, P L; Wang, S G; Wang, W; Wang, W P; Wang, X F; Wang, Y; Wang, Y D; Wang, Y F; Wang, Y Q; Wang, Z; Wang, Z G; Wang, Z H; Wang, Z Y; Wang, Z Y; Weber, T; Wei, D H; Wei, J B; Weidenkaff, P; Wen, S P; Wiedner, U; Wolke, M; Wu, L H; Wu, L J; Wu, Z; Xia, L; Xia, L G; Xia, Y; Xiao, D; Xiao, H; Xiao, Z J; Xie, Y G; Xiu, Q L; Xu, G F; Xu, J J; Xu, L; Xu, Q J; Xu, Q N; Xu, X P; Yan, L; Yan, W B; Yan, W C; Yan, Y H; Yang, H J; Yang, H X; Yang, L; Yang, Y X; Ye, M; Ye, M H; Yin, J H; Yu, B X; Yu, C X; Yu, J S; Yuan, C Z; Yuan, W L; Yuan, Y; Yuncu, A; Zafar, A A; Zallo, A; Zeng, Y; Zeng, Z; Zhang, B X; Zhang, B Y; Zhang, C; Zhang, C C; Zhang, D H; Zhang, H H; Zhang, H Y; Zhang, J; Zhang, J J; Zhang, J L; Zhang, J Q; Zhang, J W; Zhang, J Y; Zhang, J Z; Zhang, K; Zhang, L; Zhang, S Q; Zhang, X Y; Zhang, Y; Zhang, Y H; Zhang, Y N; Zhang, Y T; Zhang, Yu; Zhang, Z H; Zhang, Z P; Zhang, Z Y; Zhao, G; Zhao, J W; Zhao, J Y; Zhao, J Z; Zhao, Lei; Zhao, Ling; Zhao, M G; Zhao, Q; Zhao, Q W; Zhao, S J; Zhao, T C; Zhao, Y B; Zhao, Z G; Zhemchugov, A; Zheng, B; Zheng, J P; Zheng, W J; Zheng, Y H; Zhong, B; Zhou, L; Zhou, X; Zhou, X K; Zhou, X R; Zhou, X Y; Zhu, K; Zhu, K J; Zhu, S; Zhu, S H; Zhu, X L; Zhu, Y C; Zhu, Y S; Zhu, Z A; Zhuang, J; Zotti, L; Zou, B S; Zou, J H
2017-06-02
Using 4.479×10^{8} ψ(3686) events collected with the BESIII detector, we search for the decays ψ(3686)→e^{+}e^{-}χ_{cJ} and χ_{cJ}→e^{+}e^{-}J/ψ, where J=0, 1, 2. The decays ψ(3686)→e^{+}e^{-}χ_{cJ} and χ_{cJ}→e^{+}e^{-}J/ψ are observed for the first time. The measured branching fractions are B(ψ(3686)→e^{+}e^{-}χ_{cJ})=(11.7±2.5±1.0)×10^{-4}, (8.6±0.3±0.6)×10^{-4}, (6.9±0.5±0.6)×10^{-4} for J=0, 1, 2, and B(χ_{cJ}→e^{+}e^{-}J/ψ)=(1.51±0.30±0.13)×10^{-4}, (3.73±0.09±0.25)×10^{-3}, (2.48±0.08±0.16)×10^{-3} for J=0, 1, 2, respectively. The ratios of the branching fractions B(ψ(3686)→e^{+}e^{-}χ_{cJ})/B(ψ(3686)→γχ_{cJ}) and B(χ_{cJ}→e^{+}e^{-}J/ψ)/B(χ_{cJ}→γJ/ψ) are also reported. Also, the α values of helicity angular distributions of the e^{+}e^{-} pair are determined for ψ(3686)→e^{+}e^{-}χ_{c1,2} and χ_{c1,2}→e^{+}e^{-}J/ψ.
Exact computation of the 3-j and 6-j symbols
International Nuclear Information System (INIS)
Lai Shantao; Chiu Yingnan
1990-01-01
A simple FORTRAN program for the exaxt computation of 3-j and 6-j symbols has been written for the VAX with VMS version v5.1 in our university's computing center. It goes beyond and contains all of the 3-j and 6-j symbols evaluated in the book by M. Rotenberg, R. Bivins, N. Metropolis and J.K. Wooten Jr. The 3-j symbols up to (30/m 1 30/m 2 30/m 3 ) and 6-j symbols up to {20/20 20/20 20/20} can be computed exactly by this program. Approximate values for larger j's up to (200/m 1 200/m 2 200/m 3 ) and {200/200 200/200 200/220} can also be computed by this program. (orig.)
Nkouawa, Agathe; Sako, Yasuhito; Okamoto, Munehiro; Ito, Akira
2016-01-01
For differential detection of Taenia solium, Taenia saginata, and Taenia asiatica, loop-mediated isothermal amplification (LAMP) assay targeting the cytochrome c oxidase subunit 1 gene has been recently developed and shown to be sensitive, specific, and effective. However, to achieve differential identification, one specimen requires three reaction mixtures containing a primer set of each Taenia species separately, which is complex and time consuming and increases the risk of cross-contamination. In this study, we developed a simple differential identification of human Taenia species using multiplex LAMP (mLAMP) in combination with dot enzyme-linked immunosorbent assay (dot-ELISA). Forward inner primers of T. solium, T. saginata, and T. asiatica labeled with fluorescein isothiocyanate (FITC), digoxigenin (DIG), and tetramethylrhodamine (TAMRA), respectively, and biotin-labeled backward inner primers were used in mLAMP. The mLAMP assay succeeded in specific amplification of each respective target gene in a single tube. Furthermore, the mLAMP product from each species was easily distinguished by dot-ELISA with an antibody specific for FITC, DIG, or TAMRA. The mLAMP assay in combination with dot-ELISA will make identification of human Taenia species simpler, easier, and more practical. PMID:27044566
Directory of Open Access Journals (Sweden)
Denilce Meneses Lopes
2010-01-01
Full Text Available Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.
MCNPTM criticality primer and training experiences
International Nuclear Information System (INIS)
Briesmeister, J.; Forster, R.A.; Busch, R.
1995-01-01
With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP
Canadian municipal carbon trading primer
International Nuclear Information System (INIS)
Seskus, A.
2002-01-01
The trading of greenhouse gas (GHG) emissions is being suggested as an effective economic way to meet Canada's Kyoto target. Emissions trading is a market-based instrument that can help achieve environmental improvements while using the market to absorb the economical and effective measures to achieve emissions reductions. Placing a value on emissions means that in order to minimize costs, companies will be motivated to apply the lowest-cost emission reductions possible for regulatory approval. The two main types of emissions trading that exist in Canada are the trading of emissions that lead to the formation of smog or acid rain, and the trading of greenhouse gas emissions that lead to climate change. Since carbon dioxide is the most prevalent GHG, making up approximately 75 per cent of Canadian GHG emissions, the trading of units of GHGs is often referred to as carbon trading. The impact that emissions trading will have on municipal operations was the focus of this primer. The trading of GHG involves buying and selling of allowances of GHGs between contracting parties, usually between one party that is short of GHG credits and another that has excess credits. The 3 common approaches to emissions trading include allowance trading (cap and trade), credit trading (baseline and credit), and a hybrid system which combines both credit and allowance trading systems. The issues that impact municipalities include the debate regarding who owns the credits from landfills, particularly if power is generated using landfill gas and the power is sold as green power. Other viable questions were also addressed, including who can claim emission reduction credits if a city implements energy efficiency projects, or fuel substitution programs. Also, will municipalities be allowed to trade internationally, for example, with municipalities in the United States, and how should they spend their money earned from selling credits. This report also presents highlights from 3 emissions
Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J
2018-01-16
DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of
Controlling Air Pollution; A Primer on Stationary Source Control Techniques.
Corman, Rena
This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…
Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing
2018-05-12
Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.
Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis
Kartika Maharani; Andira Larasari; Tiara Aninditha; Yetty Ramli
2015-01-01
Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP) dan metastasis (TM) menyebabkan perbedaan gambaran klinis dan derajat gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek b...
A primer on the mortgage market and mortgage finance
Daniel J. McDonald; Daniel L. Thornton
2008-01-01
This article is a primer on mortgage finance. It discusses the basics of the mortgage market and mortgage finance. In so doing, it provides useful information that can aid individuals in making better mortgage finance decisions. The discussion and the tools are presented within the context of mortgage finance; however, these same principles and tools can be applied to a wide range of financial decisions.
Indian Academy of Sciences (India)
Resonance - Origins and Usage · J Chandrasekhar · More Details ... Molecule of the Month Maitotoxin - Holder of Two World Records · J Chandrasekhar ... Molecule of the Month Adamantane - A Plastic Piece of Diamond · J Chandrasekhar.
Lee, Ji-Yeon; Ahn, Jaechan; An, Sang In; Park, Jeong-Won
2018-02-01
The aim of this study is to compare the shear bond strengths of ceramic brackets bonded to zirconia surfaces using different zirconia primers and universal adhesive. Fifty zirconia blocks (15 × 15 × 10 mm, Zpex, Tosoh Corporation) were polished with 1,000 grit sand paper and air-abraded with 50 µm Al 2 O 3 for 10 seconds (40 psi). They were divided into 5 groups: control (CO), Metal/Zirconia primer (MZ, Ivoclar Vivadent), Z-PRIME Plus (ZP, Bisco), Zirconia Liner (ZL, Sun Medical), and Scotchbond Universal adhesive (SU, 3M ESPE). Transbond XT Primer (used for CO, MZ, ZP, and ZL) and Transbond XT Paste was used for bracket bonding (Gemini clear ceramic brackets, 3M Unitek). After 24 hours at 37°C storage, specimens underwent 2,000 thermocycles, and then, shear bond strengths were measured (1 mm/min). An adhesive remnant index (ARI) score was calculated. The data were analyzed using one-way analysis of variance and the Bonferroni test ( p = 0.05). Surface treatment with primers resulted in increased shear bond strength. The SU group showed the highest shear bond strength followed by the ZP, ZL, MZ, and CO groups, in that order. The median ARI scores were as follows: CO = 0, MZ = 0, ZP = 0, ZL = 0, and SU = 3 ( p < 0.05). Within this experiment, zirconia primer can increase the shear bond strength of bracket bonding. The highest shear bond strength is observed in SU group, even when no primer is used.
Photosymbiotic Giant Clams are Transformers of Solar Flux
2014-01-01
function to forward-scatter light reflected from high albedo sand or from the highly reflec- tive clam shell itself (M. Lim 2014, personal communication...grains: aggregates made of crystalline water ice . Icarus 215, 682–694. (doi:10.1016/j.icarus.2011.04.011) 17. Denton EJ, Land MF. 1971 Mechanism of...2005.50.5.1490) 29. McFarland WN, Munz FW. 1975 Part II: the photic environment of clear tropical seas during the day. Vis. Res. 15, 1063–1070. (doi
4pnp J=0e-2e autoionizing series of calcium: experimental and theoretical analysis
International Nuclear Information System (INIS)
Bolovinos, A.; Luc-Koenig, E.; Assimopoulos, S.; Lyras, A.; Karapanagioti, N.E.; Crete Univ., Iraklion; Charalambidis, D.; Crete Univ., Iraklion; Aymar, M.
1996-01-01
The even parity 4pnp J=0, 1, 2 doubly excited autoionizing states of neutral calcium in an atomic beam are investigated by a two-step isolated core excitation (ICE) method using two different combinations of polarization of the laser beams. The different excited energy levels are assigned to nine autoionizing Rydberg series 4p 1/2,3/2 np J=0, 1, 2 for 8≤n≤22. The theoretical interpretation is achieved by a combination of the eigenchannel R-matrix theory and the multichannel quantum defect (MQDT) method. Two, five and six closed interacting channels are introduced for the J=0, J=1 and J=2 series respectively. Theoretical energy level positions, autoionization widths and excitation profiles are compared with the experimental data, confirming the identification of the observed structures and providing evidence of extended mixing between the 4p 1/2 np and 4p 3/2 np series. (orig.). With 9 figs., 3 tabs
A primer on pseudorandom generators
Goldreich, Oded
2010-01-01
A fresh look at the question of randomness was taken in the theory of computing: A distribution is pseudorandom if it cannot be distinguished from the uniform distribution by any efficient procedure. This paradigm, originally associating efficient procedures with polynomial-time algorithms, has been applied with respect to a variety of natural classes of distinguishing procedures. The resulting theory of pseudorandomness is relevant to science at large and is closely related to central areas of computer science, such as algorithmic design, complexity theory, and cryptography. This primer surveys the theory of pseudorandomness, starting with the general paradigm, and discussing various incarnations while emphasizing the case of general-purpose pseudorandom generators (withstanding any polynomial-time distinguisher). Additional topics include the "derandomization" of arbitrary probabilistic polynomial-time algorithms, pseudorandom generators withstanding space-bounded distinguishers, and several natural notions...
Barenghi, Carlo
2016-01-01
The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .
Making the connection: advancing traffic incident management in transportation planning : a primer.
2013-07-01
"The intent of this primer is to inform and guide traffic incident management (TIM) professionals and transportation planners to initiate and develop collaborative relationships and advance TIM programs through the metropolitan planning process. The ...
Spiral correlations in frustrated one-dimensional spin-1/2 Heisenberg J1-J2-J3 ferromagnets
International Nuclear Information System (INIS)
Zinke, R; Richter, J; Drechsler, S-L
2010-01-01
We use the coupled cluster method for infinite chains complemented by exact diagonalization of finite periodic chains to discuss the influence of a third-neighbor exchange J 3 on the ground state of the spin- 1/2 Heisenberg chain with ferromagnetic nearest-neighbor interaction J 1 and frustrating antiferromagnetic next-nearest-neighbor interaction J 2 . A third-neighbor exchange J 3 might be relevant to describe the magnetic properties of the quasi-one-dimensional edge-shared cuprates, such as LiVCuO 4 or LiCu 2 O 2 . In particular, we calculate the critical point J 2 c as a function of J 3 , where the ferromagnetic ground state gives way for a ground state with incommensurate spiral correlations. For antiferromagnetic J 3 the ferro-spiral transition is always continuous and the critical values J 2 c of the classical and the quantum model coincide. On the other hand, for ferromagnetic J 3 ∼ 1 | the critical value J 2 c of the quantum model is smaller than that of the classical model. Moreover, the transition becomes discontinuous, i.e. the model exhibits a quantum tricritical point. We also calculate the height of the jump of the spiral pitch angle at the discontinuous ferro-spiral transition.
Sergeant, Martin J; Constantinidou, Chrystala; Cogan, Tristan; Penn, Charles W; Pallen, Mark J
2012-01-01
The analysis of 16S-rDNA sequences to assess the bacterial community composition of a sample is a widely used technique that has increased with the advent of high throughput sequencing. Although considerable effort has been devoted to identifying the most informative region of the 16S gene and the optimal informatics procedures to process the data, little attention has been paid to the PCR step, in particular annealing temperature and primer length. To address this, amplicons derived from 16S-rDNA were generated from chicken caecal content DNA using different annealing temperatures, primers and different DNA extraction procedures. The amplicons were pyrosequenced to determine the optimal protocols for capture of maximum bacterial diversity from a chicken caecal sample. Even at very low annealing temperatures there was little effect on the community structure, although the abundance of some OTUs such as Bifidobacterium increased. Using shorter primers did not reveal any novel OTUs but did change the community profile obtained. Mechanical disruption of the sample by bead beating had a significant effect on the results obtained, as did repeated freezing and thawing. In conclusion, existing primers and standard annealing temperatures captured as much diversity as lower annealing temperatures and shorter primers.
A Web-Based Adaptive Tutor to Teach PCR Primer Design
van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.
2012-01-01
When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…
Development of specific primers for the detection of HVA1 from ...
African Journals Online (AJOL)
aghomotsegin
2014-01-22
Jan 22, 2014 ... can potentially improve the stress tolerance in plants. (Bajaj et al. ... protein) from barley was engineered in rice (Chandra et al., 2004; Rohila et al., .... US), 400 nM forward and reverse primers, 100 ng of DNA template in 25 µl ...
De neurocirujano a primer ministro de Salud de la Argentina
Directory of Open Access Journals (Sweden)
Karina Inés Ramacciotti
2008-01-01
Full Text Available La trayectoria y los vínculos que entabló Ramón Carrillo con anterioridad a ejercer el cargo de primer secretario de Salud Pública en la Argentina (1946 no han sido objeto de estudio pormenorizado. Así pues en este artículo se analizarán en primer lugar, una serie de cartas de lectores publicadas en La Semana Médica en los primeros años de la década del '40 del siglo XX. Estas notas permiten comprender las disputas internas que se produjeron en la Facultad de Ciencias Médicas al producirse el concurso de Titular de Neurocirugía de la Universidad de Buenos Aires. En segundo lugar, se revisará cómo Carrillo pasa de ocupar este prestigioso cargo académico a convertirse en decano interi- no de la Facultad de Ciencias Médicas. Son las relaciones que anuda durante estos años las que lo posicionan en un escenario político privilegiado para alcanzar un relevante puesto en la administración pública.
A primer on physical-layer network coding
Liew, Soung Chang; Zhang, Shengli
2015-01-01
The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader
Directory of Open Access Journals (Sweden)
Alejandro Gonzalez-Martinez
2015-01-01
Full Text Available Identification of anaerobic ammonium oxidizing (anammox bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON and three full-scale bioreactors (anammox, CANON, and DEMON, was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature. The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C and hence a range of annealing temperatures of 44–49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.
Great Lakes rivermouths: a primer for managers
Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul
2013-01-01
Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described
Evolución del peso en pacientes durante el primer año del trasplante renal
Directory of Open Access Journals (Sweden)
Pilar López Garrigós
Full Text Available Durante el primer año de trasplante renal es frecuente una ganancia de peso, debido, entre otros a la dieta, sedentarismo, e inmunosupresores, pudiendo aumentar los factores de riesgo del síndrome metabólico. Objetivos: Conocer la evolución del peso de nuestros pacientes durante el primer año del trasplante, y analizar la influencia con las distintas variables asociadas al paciente, sexo, edad, IMC, tratamiento inmunosupresor entre otras. Determinar la asociación entre la ganancia de peso y la aparición de factores de riesgo, como hipertensión arterial, diabetes y dislipidemia. Material y Método: Estudio retrospectivo y analítico. Se estudiaron 100 pacientes con un año de evolución en el trasplante, del Hospital Virgen de la Salud de Toledo. Sé analizaron datos antropométricos, demográficos y clínicos. La ganancia de peso se distribuyo según a las variables del estudio. Resultados: La ganancia de peso al año del trasplante afecto a 93 pacientes, con una media de 7,21 kg ±5,87. El 44,1% aumento su peso por encima de la media, y el 23,7% gano > 10 kg. La prevalencia de sobrepeso y obesidad antes del trasplante fue 57% y 76% después del trasplante. Los hombres ganaron ligeramente más peso que las mujeres. Los más jóvenes < 49 años ganaron más peso, media 9,3 kg. Mayor incidencia de diabetes, hipertensión y dislipemias en los pacientes con sobrepeso y obesidad. Conclusiones: La mayoría de los pacientes aumentaron significativamente de peso al año del trasplante, asociándose con varios de los factores del síndrome metabólico. - Importante la educación, por parte de la enfermería, del paciente para fomentar hábitos de vida saludable.
Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev
2016-02-09
Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.
Early phenotypical diagnoses in Trembler-J mice model.
Rosso, Gonzalo; Cal, Karina; Canclini, Lucía; Damián, Juan Pablo; Ruiz, Paul; Rodríguez, Héctor; Sotelo, José Roberto; Vazquez, Cristina; Kun, Alejandra
2010-06-30
Pmp-22 mutant mice (Trembler-J: B6.D2-Pmp22/J), are used as a model to study Charcot-Marie-Tooth type 1A (CMT1A). The identification of individual genotypes is a routine in the management of the Tr(J) colony. The earliest phenotypic manifestation of the pmp-22 mutation is just about 20th postnatal days, when pups begin to tremble. In this study, a rapid and simple diagnostic method was developed by modifying the Tail Suspension Test (MTST) to determine the difference between the Tr(J) and the wild-type mice phenotype. The animal behavioral phenotypes generated during the test were consistent with the specific genotype of each animal. The MTST allowed us to infer the heterozygous genotype in early postnatal stages, at 11 days after birth. The motor impairment of Tr(J) mice was also analyzed by a Fixed Bar Test (FBT), which revealed the disease evolution according to age. The main advantages of MTST are its objectivity, simplicity, and from the viewpoint of animal welfare, it is a non-invasive technique that combined with his rapidity show its very well applicability for use from an early age in these mice. Copyright 2010 Elsevier B.V. All rights reserved.
Metal-Insulator Transition in Copper Oxides Induced by Apex Displacements
Directory of Open Access Journals (Sweden)
Swagata Acharya
2018-05-01
Full Text Available High temperature superconductivity has been found in many kinds of compounds built from planes of Cu and O, separated by spacer layers. Understanding why critical temperatures are so high has been the subject of numerous investigations and extensive controversy. To realize high temperature superconductivity, parent compounds are either hole doped, such as La_{2}CuO_{4} (LCO with Sr (LSCO, or electron doped, such as Nd_{2}CuO_{4} (NCO with Ce (NCCO. In the electron-doped cuprates, the antiferromagnetic phase is much more robust than the superconducting phase. However, it was recently found that the reduction of residual out-of-plane apical oxygen dramatically affects the phase diagram, driving those compounds to a superconducting phase. Here we use a recently developed first-principles method to explore how displacement of the apical oxygen (AO in LCO affects the optical gap, spin and charge susceptibilities, and superconducting order parameter. By combining quasiparticle self-consistent GW (QS GW and dynamical mean-field theory (DMFT, we show that LCO is a Mott insulator, but small displacements of the apical oxygen drive the compound to a metallic state through a localization-delocalization transition, with a concomitant maximum in d-wave order parameter at the transition. We address the question of whether NCO can be seen as the limit of LCO with large apical displacements, and we elucidate the deep physical reasons why the behavior of NCO is so different from the hole-doped materials. We shed new light on the recent correlation observed between T_{c} and the charge transfer gap, while also providing a guide towards the design of optimized high-T_{c} superconductors. Further, our results suggest that strong correlation, enough to induce a Mott gap, may not be a prerequisite for high-T_{c} superconductivity.
Sun, Yu; Riva, Riccardo; Ditmar, Pavel
2016-11-01
The focus of the study is optimizing the technique for estimating geocenter motion and variations in J2 by combining data from the Gravity Recovery and Climate Experiment (GRACE) satellite mission with output from an Ocean Bottom Pressure model and a Glacial Isostatic Adjustment (GIA) model. First, we conduct an end-to-end numerical simulation study. We generate input time-variable gravity field observations by perturbing a synthetic Earth model with realistically simulated errors. We show that it is important to avoid large errors at short wavelengths and signal leakage from land to ocean, as well as to account for self-attraction and loading effects. Second, the optimal implementation strategy is applied to real GRACE data. We show that the estimates of annual amplitude in geocenter motion are in line with estimates from other techniques, such as satellite laser ranging (SLR) and global GPS inversion. At the same time, annual amplitudes of C10 and C11 are increased by about 50% and 20%, respectively, compared to estimates based on Swenson et al. (2008). Estimates of J2 variations are by about 15% larger than SLR results in terms of annual amplitude. Linear trend estimates are dependent on the adopted GIA model but still comparable to some SLR results.
Zhang, Hongwei; Feng, Shaolong; Zhao, Yulong; Wang, Shuo; Lu, Xiaonan
2015-12-02
Yersinia enterocolitica (Y. enterocolitica) is frequently isolated from a wide variety of foods and can cause human yersiniosis. Biochemical and culture-based assays are common detection methods, but require a long incubation time and easily misidentify Y. enterocolitica as other non-pathogenic Yersinia species. Alternatively, cross-priming amplification (CPA) under isothermal conditions combined with immunoblotting analysis enables a more sensitive detection in a relatively short time period. A set of specific displacement primers, cross primers and testing primers was designed on the basis of six specific sequences in Y. enterocolitica 16S-23S rDNA internal transcribed spacer. Under isothermal condition, amplification and hybridization were conducted simultaneously at 63°C for 60 min. The specificity of CPA was tested for 96 different bacterial strains and 165 commercial milk powder samples. Two red lines were developed on BioHelix Express strip for all of the Y. enterocolitica strains, and one red line was shown for non-Y. enterocolitica strains. The limit of detection of CPA was 10(0)fg for genomic DNA (1000 times more sensitive than PCR assay), 10(1) CFU/ml for pure bacterial culture, and 10(0) CFU per 100 g milk powder with pre-enrichment at 37°C for 24 h. CPA combined with immunoblotting analysis can achieve highly specific and sensitive detection of Y. enterocolitica in milk powder in 90 min after pre-enrichment. Copyright © 2015 Elsevier B.V. All rights reserved.
Human immunodeficiency virus uses tRNA(Lys,3) as primer for reverse transcription in HeLa-CD4+ cells
Das, A. T.; Koken, S. E.; Essink, B. B.; van Wamel, J. L.; Berkhout, B.
1994-01-01
Significant amounts of different tRNA molecules are present in retroviral particles, but one specific tRNA species functions as primer in reverse transcription. It is generally believed that the HIV-1 virus uses the tRNA(Lys,3) molecule as primer. This is based on sequence complementarity between
Routes to effective evacuation planning primer series : evacuating populations with special needs.
2009-04-01
Evacuation operations are conducted under the authority of, and based on decisions by, local and state authorities. The purpose of this primer, Evacuating Populations with Special Needs, is to provide local and state emergency managers, government of...
Hume, Benjamin C.C.; Ziegler, Maren; Poulain, Julie; Pochon, Xavier; Romac, Sarah; Boissin, Emilie; de Vargas, Colomban; Planes, Serge; Wincker, Patrick; Voolstra, Christian R.
2018-01-01
The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.
Hume, Benjamin C.C.
2018-05-23
The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.
Rockne, Karl J; Strand, Stuart E
2003-09-01
Type II alpha proteobacteria methanotrophs are capable of a wide range of cometabolic transformations of chlorinated solvents and polycyclic aromatic hydrocarbons (PAHs), and this activity has been exploited in many terrestrial bioremediation systems. However, at present, all known obligately marine methanotrophic isolates are Type I gamma proteobacteria which do not have this activity to the extent of Type II methanotrophs. In previous work in our laboratory, determining the presence of Type II alpha proteobacteria methanotrophs in marine enrichment cultures that co-metabolized PAHs required a more sensitive assay. 16S rDNA PCR primers were designed based on oligonucleotide probes for serine pathway methanotrophs and serine pathway methylotrophs with an approximate amplification fragment size of 870 base pairs. Comparison of the primers using double primer BLAST searches in established nucleotide databases showed potential amplification with all Methylocystis and Methylosinus spp., as well as potential amplification with Methylocella palustrus. DNA from Methylosinus trichosporium OB3b, a Type II methanotroph, amplified with the primers with a fragment size of approximately 850 base pairs, whereas DNA extracted from Methylomonas methanica, a Type I methanotroph, did not. The primers were used to amplify DNA extracted from two marine methanotrophic enrichment cultures: a low nitrogen/low copper enrichment to select for Type II methanotrophs and a high nitrogen/high copper enrichment to select for Type I methanotrophs. Although DNA from both cultures amplified with the PCR primers, amplification was stronger in cultures that were specifically enriched for Type II methanotrophs, suggesting the presence of higher numbers of Type II methanotrophs. These results provide further evidence for the existence of Type II marine methanotrophs, suggesting the possibility of exploiting cometabolic activity in marine systems.
KULTUR PRIMER FIBROBLAS: PENELITIAN PENDAHULUAN
Directory of Open Access Journals (Sweden)
Yuli Kurniawati
2015-05-01
Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well
Primer Extension Mutagenesis Powered by Selective Rolling Circle Amplification
Huovinen, Tuomas; Brockmann, Eeva-Christine; Akter, Sultana; Perez-Gamarra, Susan; Ylä-Pelto, Jani; Liu, Yuan; Lamminmäki, Urpo
2012-01-01
Primer extension mutagenesis is a popular tool to create libraries for in vitro evolution experiments. Here we describe a further improvement of the method described by T.A. Kunkel using uracil-containing single-stranded DNA as the template for the primer extension by additional uracil-DNA glycosylase treatment and rolling circle amplification (RCA) steps. It is shown that removal of uracil bases from the template leads to selective amplification of the nascently synthesized circular DNA strand carrying the desired mutations by phi29 DNA polymerase. Selective RCA (sRCA) of the DNA heteroduplex formed in Kunkel's mutagenesis increases the mutagenesis efficiency from 50% close to 100% and the number of transformants 300-fold without notable diversity bias. We also observed that both the mutated and the wild-type DNA were present in at least one third of the cells transformed directly with Kunkel's heteroduplex. In contrast, the cells transformed with sRCA product contained only mutated DNA. In sRCA, the complex cell-based selection for the mutant strand is replaced with the more controllable enzyme-based selection and less DNA is needed for library creation. Construction of a gene library of ten billion members is demonstrated with the described method with 240 nanograms of DNA as starting material. PMID:22355397
Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory
Elkins, Kelly M.
2011-01-01
The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…
Chen, Qianqian; Chen, Xiaoxiang; Zhang, Sichao; Lan, Ke; Lu, Jian; Zhang, Chiyu
2015-01-01
The development of simple, accurate, rapid and cost-effective technologies for mutation detection is crucial to the early diagnosis and prevention of numerous genetic diseases, pharmacogenetics, and drug resistance. Proofreading PCR (PR-PCR) was developed for mutation detection in 1998 but is rarely applied due to its low efficiency in allele discrimination. Here we developed a modified PR-PCR method using a ddNTP-blocked primer and a mixture of DNA polymerases with and without the 3'-5' proofreading function. The ddNTP-blocked primer exhibited the best blocking efficiency to avoid nonspecific primer extension while the mixture of a tiny amount of high-fidelity DNA polymerase with a routine amount of Taq DNA polymerase provided the best discrimination and amplification effects. The modified PR-PCR method is quite capable of detecting various mutation types, including point mutations and insertions/deletions (indels), and allows discrimination amplification when the mismatch is located within the last eight nucleotides from the 3'-end of the ddNTP-blocked primer. The modified PR-PCR has a sensitivity of 1-5 × 102 copies and a selectivity of 5 × 10-5 mutant among 107 copies of wild-type DNA. It showed a 100% accuracy rate in the detection of P72R germ-line mutation in the TP53 gene among 60 clinical blood samples, and a high potential to detect rifampin-resistant mutations at low frequency in Mycobacterium tuberculosis using an adaptor and a fusion-blocked primer. These results suggest that the modified PR-PCR technique is effective in detection of various mutations or polymorphisms as a simple, sensitive and promising approach. PMID:25915410
Directory of Open Access Journals (Sweden)
Laura Navarro-Sampedro
2012-11-01
Full Text Available Twelve nuclear microsatellite primers (nSSR were developed for the endangered species Abies pinsapo Boiss. to enable the study of gene flow and genetic structure in the remaining distribution areas. Microsatellite primers were developed using next-generation sequencing (454 data from a single Abies pinsapo individual. Primers were applied to thirty individuals from the three extant localities. The number of alleles per locus ranged from one to four. Cross-amplification was tested for other Abies species from the Mediterranean Basin, and most of the loci showed higher polymorphisms in the Mediterranean species than in A. pinsapo. These microsatellite markers provide tools for conservation genetic studies in Abies pinsapo as well other Abies species from the Mediterranean Basin.
Bouma, Harmen W.; Goldengorin, Boris; Lagakos, S; Perlovsky, L; Jha, M; Covaci, B; Zaharim, A; Mastorakis, N
2009-01-01
In this paper a Boolean Linear Programming (BLP) model is presented for the single machine scheduling problem 1 vertical bar pmtn; p(j) = 2;r(j)vertical bar Sigma w(j)C(j). The problem is a special case of the open problem 1 vertical bar pmtn; p(j) = p; r(j)vertical bar Sigma wj(g)C(j). We show that
Directory of Open Access Journals (Sweden)
Zuiter Afnan
2012-08-01
Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.
Transient Heat Transfer Model for Car Body Primer Curing
D. Zabala; N. Sánchez; J. Pinto
2010-01-01
A transient heat transfer mathematical model for the prediction of temperature distribution in the car body during primer baking has been developed by considering the thermal radiation and convection in the furnace chamber and transient heat conduction governing equations in the car framework. The car cockpit is considered like a structure with six flat plates, four vertical plates representing the car doors and the rear and front panels. The other two flat plates are the...
Hu, Ai-Yuan; Wang, Huai-Yu
2017-09-05
The frustrated spin-1/2 J 1 -J 2 -J 3 antiferromagnet with exchange anisotropy on the two-dimensional square lattice is investigated. The exchange anisotropy is presented by η with 0 ≤ η J 1 , J 2 , J 3 and anisotropy on the possible phase transition of the Néel state and collinear state are studied comprehensively. Our results indicate that for J 3 > 0 there are upper limits [Formula: see text] and η c values. When 0 J 3 ≤ [Formula: see text] and 0 ≤ η ≤ η c , the Néel and collinear states have the same order-disorder transition point at J 2 = J 1 /2. Nevertheless, when the J 3 and η values beyond the upper limits, it is a paramagnetic phase at J 2 = J 1 /2. For J 3 J 2 = J 1 /2. Therefore, for J 2 = J 1 /2, under such parameters, a first-order phase transition between the two states for these two cases below the critical temperatures may occur. When J 2 ≠ J 1 /2, the Néel and collinear states may also exist, while they have different critical temperatures. When J 2 > J 1 /2, a first-order phase transition between the two states may also occur. However, for J 2 J 1 /2, the Néel state is always more stable than the collinear state.
Hemorragias obstétricas en el primer y segundo trimestre del embarazo
García Rodríguez, Blanca
2013-01-01
Se aborda el tema de las hemorragias obstétricas en el primer y segundo trimestre del embarazo. Diagnóstico precoz de las mismas, la identificación de factores de riesgo, las causas y el tratamiento terapéutico
Lyapunov-based control of limit cycle oscillations in uncertain aircraft systems
Bialy, Brendan
Store-induced limit cycle oscillations (LCO) affect several fighter aircraft and is expected to remain an issue for next generation fighters. LCO arises from the interaction of aerodynamic and structural forces, however the primary contributor to the phenomenon is still unclear. The practical concerns regarding this phenomenon include whether or not ordnance can be safely released and the ability of the aircrew to perform mission-related tasks while in an LCO condition. The focus of this dissertation is the development of control strategies to suppress LCO in aircraft systems. The first contribution of this work (Chapter 2) is the development of a controller consisting of a continuous Robust Integral of the Sign of the Error (RISE) feedback term with a neural network (NN) feedforward term to suppress LCO behavior in an uncertain airfoil system. The second contribution of this work (Chapter 3) is the extension of the development in Chapter 2 to include actuator saturation. Suppression of LCO behavior is achieved through the implementation of an auxiliary error system that features hyperbolic functions and a saturated RISE feedback control structure. Due to the lack of clarity regarding the driving mechanism behind LCO, common practice in literature and in Chapters 2 and 3 is to replicate the symptoms of LCO by including nonlinearities in the wing structure, typically a nonlinear torsional stiffness. To improve the accuracy of the system model a partial differential equation (PDE) model of a flexible wing is derived (see Appendix F) using Hamilton's principle. Chapters 4 and 5 are focused on developing boundary control strategies for regulating the bending and twisting deformations of the derived model. The contribution of Chapter 4 is the construction of a backstepping-based boundary control strategy for a linear PDE model of an aircraft wing. The backstepping-based strategy transforms the original system to a exponentially stable system. A Lyapunov-based stability
Abbink, Truus E. M.; Beerens, Nancy; Berkhout, Ben
2004-01-01
Human immunodeficiency virus type 1 uses the tRNA(3)(Lys) molecule as a selective primer for reverse transcription. This primer specificity is imposed by sequence complementarity between the tRNA primer and two motifs in the viral RNA genome: the primer-binding site (PBS) and the primer activation
A Man-Portable Vector Sensor for Identification of Unexploded Ordnance
2011-08-24
Hanover data of Section III-B2, and Dr. L. Pasion , J. Jacobson, and H. Ngo of Sky Research and Dr. L.-P. Song of the University of British Columbia for...of equivalent dipole polarizabilities in situ,” IEEE Trans. Geosci. Remote Sens., vol. 43, no. 7, pp. 1490–1498, Jul. 2005. [27] L. R. Pasion and D. W...P. Song, F. Shubitidze, L. R. Pasion , D. W. Oldenburg, and S. D. Billings, “Computing transient electromagnetic responses of a metallic object using
Nkouawa, Agathe; Sako, Yasuhito; Okamoto, Munehiro; Ito, Akira
2016-06-01
For differential detection of Taenia solium, Taenia saginata, and Taenia asiatica, loop-mediated isothermal amplification (LAMP) assay targeting the cytochrome c oxidase subunit 1 gene has been recently developed and shown to be sensitive, specific, and effective. However, to achieve differential identification, one specimen requires three reaction mixtures containing a primer set of each Taenia species separately, which is complex and time consuming and increases the risk of cross-contamination. In this study, we developed a simple differential identification of human Taenia species using multiplex LAMP (mLAMP) in combination with dot enzyme-linked immunosorbent assay (dot-ELISA). Forward inner primers of T. solium, T. saginata, and T. asiatica labeled with fluorescein isothiocyanate (FITC), digoxigenin (DIG), and tetramethylrhodamine (TAMRA), respectively, and biotin-labeled backward inner primers were used in mLAMP. The mLAMP assay succeeded in specific amplification of each respective target gene in a single tube. Furthermore, the mLAMP product from each species was easily distinguished by dot-ELISA with an antibody specific for FITC, DIG, or TAMRA. The mLAMP assay in combination with dot-ELISA will make identification of human Taenia species simpler, easier, and more practical. © The American Society of Tropical Medicine and Hygiene.
Directory of Open Access Journals (Sweden)
Firuzbakht MM
2011-04-01
Full Text Available "nBackground and Aims: The aim of this study was to evaluate the effect of application of two types of primers over bracket bases on the shear bond strength (SBS and mode of bond failure."nMaterials and Methods: In this study, 75 human premolar teeth were divided into three equal groups. In group 1 (control, after surface preparation of enamel by conventional method (acid etching+primer brackets were bonded with Transbond XT composite. In group 2 (TX, brackets were bonded to enamel same as the first group but Transbond XT primer were used on bracket bases before placement of composite. In group 3 (PL, Transbond plus primer was applied on bracket bases before placement of composite. After 24 h, the SBS test was performed by universal testing machine at crosshead speed of 0.5 mm/min. Then, adhesive remnant index (ARI scores and percentage of cohesive fracture were determined using stereomicroscopy. SBS data were analyzed by one-way ANOVA and Duncan tests. Kruskal-Wallis and Mann-Whitney tests were used to analyze ARI and cohesive fracture results."nResults: There was significant difference in SBS values among the groups (P<0.001. The highest SBS was shown in TX group and the lowest was seen in PL group. There was no significant difference between control and TX groups in ARI scores (P=0.199. No significant difference was found in cohesive fracture values between the groups (P=0.093. Both the control and TX groups showed significant difference in ARI scores and cohesive fracture compared with the PL group in all of the comparisons (P<0.001."nConclusion: Application of Transbond XT primer over bracket base affects the bond strength and failure mode. Transbond XT primer increased the bond strength but Transbond plus primer decreased it.
A finite element primer for beginners the basics
Zohdi, Tarek I
2014-01-01
The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th
Transport phenomena in Newtonian fluids a concise primer
Olsson, Per
2013-01-01
This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum. The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid. Also provided at
Cruchaga, Carlos; Anso, Elena; Font, María; Martino, Virginia S.; Rouzaut, Ana; Martinez-Irujo, Juan J.
2007-01-01
Inhibitors of the excision reaction catalysed by HIV-1 RT (reverse transcriptase) represent a promising approach in the fight against HIV, because these molecules would interfere with the main mechanism of resistance of this enzyme towards chain-terminating nucleotides. Only a limited number of compounds have been demonstrated to inhibit this reaction to date, including NNRTIs (non-nucleoside RT inhibitors) and certain pyrophosphate analogues. We have found previously that 2GP (2-O-galloylpunicalin), an antiviral compound extracted from the leaves of Terminalia triflora, was able to inhibit both the RT and the RNase H activities of HIV-1 RT without affecting cell proliferation or viability. In the present study, we show that 2GP also inhibited the ATP- and PPi-dependent phosphorolysis catalysed by wild-type and AZT (3′-azido-3′-deoxythymidine)-resistant enzymes at sub-micromolar concentrations. Kinetic and direct-binding analysis showed that 2GP was a non-competitive inhibitor against the nucleotide substrate, whereas it competed with the binding of RT to the template–primer (Kd=85 nM). As expected from its mechanism of action, 2GP was active against mutations conferring resistance to NNRTIs and AZT. The combination of AZT with 2GP was highly synergistic when tested in the presence of pyrophosphate, indicating that the inhibition of RT-catalysed phosphorolysis was responsible for the synergy found. Although other RT inhibitors that compete with the template–primer have been described, this is the first demonstration that these compounds can be used to block the excision of chain terminating nucleotides, providing a rationale for their combination with nucleoside analogues. PMID:17355225
Detection of Vibrio harveyi using hemolysin primer in tiger shrimp Penaeus monodon
Directory of Open Access Journals (Sweden)
Irma Suriyani
2015-05-01
Full Text Available ABSTRACT This study was aimed to analyze the sensitivity and ability of primer hemolysin in detecting pathogenetic Vibrio on tiger shrimp post-larvae (PL exposed under different exposure times in media inoculated with Vibrio harveyi. The PL of tiger shrimp were infected with 106 cfu/mL of V. harveyi by immersion method for three, six, 12, 24, 48 and 72 hours. The presence of hemolisin genes was detected by PCR techniques. The electrophoresis detected narrow hemolysin genes after PL were exposed for three and six hours. Clear visible bands of DNA Vibrio were observed for 12 hours of exposure. In contrast, no detected hemolysin gene of Vibrio was observed for PL exposed within 24, 48, and 72 hours. The rapid detection on Vibrio pathogenic for tiger shrimp PL should be conducted within three to 12 hours of exposure. No recommendation in utilizing this rapid detection for tiger shrimp PL exposed beyond 12 hours of V. harveyi. Keywords: specific primer, luminous Vibrio bacteria, pathogenic, PCR method, hemolysin gene ABSTRAK Penelitian ini bertujuan untuk mengetahui kemampuan atau sensitivitas primer hemolisin dalam mendeteksi Vibrio patogen dengan lama pemaparan berbeda. Penelitian ini dilakukan dengan menginfeksikan Vibrio harveyi pada benur udang dengan metode perendaman pada konsentrasi 106 cfu/mL. Pengambilan sampel dilakukan pada waktu tiga, enam, 12, 24, 48, dan 72 jam pascainfeksi. Keberadaan gen hemolisin pada bakteri V. harveyi dideteksi menggunakan teknik polymerase chain reaction (PCR. Hasil elektroforesis memperlihatkan bahwa pada pemaparan tiga dan enam jam keberadaan gen hemolisin dari bakteri Vibrio patogen yang diinfeksikan sudah dapat terdeteksi pada benur walaupun masih terlihat tipis. Pada pemaparan 12 jam terlihat sangat jelas pita-pita DNA dari bakteri patogen. Sedangkan pada pemaparan 24, 48, dan 72 jam sudah tidak terdeteksi lagi gen hemolisin dari bakteri Vibrio. Hal ini diduga disebabkan terjadinya penurunan populasi
International Nuclear Information System (INIS)
Tejera R, A.; Cortes P, A.; Becerril V, A.
1990-03-01
For the practical application of the method proposed by J. Bryant, the authors carried out a series of small corrections, related with the bottom, the dead time of the detectors and channels, with the resolution time of the coincidences, with the accidental coincidences, with the decay scheme and with the gamma efficiency of the beta detector beta and the beta efficiency beta of the gamma detector. The calculation of the correction formula is presented in the development of the present report, being presented 25 combinations of the probability of the first existent state at once of one disintegration and the second state at once of the following disintegration. (Author)
Directory of Open Access Journals (Sweden)
Julieta Longo
2015-12-01
Full Text Available En la última década numerosos cambios modificaron el mundo del trabajo, y transformaron tanto los indicadores principales de empleo como también las características de las organizaciones sindicales. El artículo reflexiona acerca de las ambivalencias del trabajo de jóvenes que hicieron sus primeras experiencias en el mercado laboral luego de la crisis del 2001 y que actualmente trabajan en una empresa multinacional de supermercados. A partir de una estrategia metodológica cualitativa, basada en la realización de entrevistas en profundidad, el artículo sugiere que algunas de las contradicciones del modelo de la post-convertibilidad se agudizan en estos espacios laborales, lo que torna ambivalente la relación de los jóvenes con el trabajo. Particularmente, si bien para ellos el trabajo en el supermercado constituyó su primer empleo estable, lo consideran al mismo tiempo un “trabajo temporal” o “de paso"
International Nuclear Information System (INIS)
Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.
2017-01-01
Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.
Directory of Open Access Journals (Sweden)
Esther Lantero
2017-07-01
Full Text Available Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L. trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control
Energy Technology Data Exchange (ETDEWEB)
Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.
2017-07-01
Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.
Meadows, Donella H
2008-01-01
In the years following her role as the lead author of the international bestseller, "Limits to Growth"-the first book to show the consequences of unchecked growth on a finite planet- Donella Meadows remained a pioneer of environmental and social analysis until her untimely death in 2001. Meadows' newly released manuscript, "Thinking in Systems", is a concise and crucial book offering insight for problem solving on scales ranging from the personal to the global. Edited by the Sustainability Institute's Diana Wright, this essential primer brings systems thinking out of the realm of computers and equations and into the tangible world, showing readers how to develop the systems-thinking skills that thought leaders across the globe consider critical for 21st-century life. Some of the biggest problems facing the world-war, hunger, poverty, and environmental degradation-are essentially system failures. They cannot be solved by fixing one piece in isolation from the others, because even seemingly minor details have e...
Peran Keluarga dalam Pengelolaan Kasus di Layanan Primer Melalui Five Family Oriented Questions
Directory of Open Access Journals (Sweden)
Retno Asti Werdhani
2017-04-01
Full Text Available Pengelolaan kasus di layanan primer dengan pendekatan kedokteran keluarga memperhatikan potensi keluarga sebagai sumber daya pendukung dan atau penghambat keberhasilan penatalaksanaan pasien. Penelitian ini bertujuan untuk melihat gambaran kasus di layanan primer dan persepsi keluarga mengenai pasien melalui five family oriented question (FFOQ. Pengambilan data dilakukan menggunakan kuesioner pada 162 pasien Puskesmas dan Klinik di DKI Jakarta pada tahun 2015–2016. Kuesioner terdiri atas karakteristik pasien dan 5 pertanyaan terbuka FFOQ. Analisis dilakukan secara kuantitatif dan kualitatif. Hasilnya menunjukkan sebagian besar kasus di layanan primer adalah penyakit non-infeksi (82,7% dengan proporsi usia terbanyak adalah >40 tahun (76,5%. Persepsi pasien dan keluarga tentang penyebab penyakit dan cara mengatasinya masih bervariasi. Orang tua, pasangan, dan anak merupakan anggota keluarga yang paling menguatirkan kondisi pasien. Sebanyak 71,6% responden merasa ada stresor dalam keluarganya. Sumber stresor bervariasi antara lain sosial ekonomi, keluarga, pekerjaan, dan diri sendiri. Dukungan kepada pasien berupa dukungan emosional dan finansial yang diberikan oleh anggota keluarga sesuai kemampuan masing-masing. Disimpulkan keluarga berperan sebagai faktor pendukung dan penghambat dalam pengelolaan kasus di layanan primer untuk menunjang pengelolaan lebih berorientasi kepada pasien dan keluarga. Kata Kunci: five family oriented question, keluarga, layanan primer Family Acts in Cases Management In Primary Care through The Five Family Oriented Question Abstract Family oriented in primary care sees family as supporting resources/inhibiting case management accomplishment. The aim of this study was describing cases in primary care and family perception of the patient through the five family oriented question (FFOQ. Interviews were conducted in 162 patients from public health centers and clinics in DKI Jakarta year 2015–2016. Data were
Directory of Open Access Journals (Sweden)
Shrinivas Ashtekar
2016-01-01
Full Text Available Objective: To compare and evaluate the shear bond strength (SBS of lingual brackets, manufactured by three different processes, that is, laser sintering, milling, and casting, bonded with two different adhesive primers. Materials and Methods: One hundred and twenty premolars were selected, and three types of lingual brackets were used, namely, STB (milling, 7th Generation (casting, and lingualmatrix (laser sintering. Forty brackets per system were used half of which were sandblasted while the other half were used as available. Further, these were subdivided and bonded with Transbond XT primer and adhesive and 3M ESPE Primer and Transbond XT adhesive. Customization of STB and 7th Generation was done by Torque Angulation Reference Guide, Lingualmatrix had bases customized by Computer-aided design/computer-aided manufacturing. SBS was tested with universal testing machine and evaluated for adhesive remnant index (ARI. Results: Statistical analysis showed that surface treatment, use of different primers, method of customization influenced the SBS, and ARI suggested that the fracture occurred between composite and bracket interface. Conclusion: Lingualmatrix bracket showed greater SBS as compared to STB and 7th Generation, sandblasting increased SBS. 3M ESPE primer group showed increased SBS as that bonded with Transbond XT primer. The fracture was between the composite bracket interface.
Zhang, Jing; Yan, Xi; Han, Furong; Zhang, Jine; Liu, Dan; Shen, Baogen; Sun, Jirong
2018-05-01
The interface engineering of the complex oxides with strongly coupled degrees of freedom opens a wide space for the exploration of novel effects. La0.67Sr0.33MnO3 is one of the most typical complex oxides used for atomic level material engineering. Herein we reported an in-plane reversal of the magnetic anisotropy in (110)-oriented LaCoO3/La0.67Sr0.33MnO3 (LCO/LSMO) bilayers grown on (110)-oriented LaAlO3 substrates. Fixing the LSMO layer thickness to 8 nm and varying the LCO layer from 0 to 8 nm, totally six bilayers were fabricated. Without the LCO layer, the LSMO film exhibits an easy axis along the [1-10] direction. However, when the thickness of the LCO layer exceeds 1 nm, a signature of spin-reorientation appears; the easy axis turns from the [1-10] to the [001] direction below 225 K. This tendency is continuously enhanced by increasing the LCO. We reveal that lattice strains are different along these two directions. The magnetic anisotropy is not only controlled by lattice strain but also by structural distortion at interface. This work shows the great potential of the interface engineering with differently structured oxides for the exploration of novel functional materials.
J. L.
2005-01-01
Raadio 2aasta menukamate lugude edetabelis sai esikoha ansambel Nexus looga "Hingetuna", järgnesid Toe Tag "Legendaarne" ja Inese "15 magamata ööd"; parim lääne lugu Rammsteini "Ameerika". Raadio Uno edetabelis esikohal Inese "15 magamata ööd", järgnesid Nexuse "Hingetuna" ja moldaavlaste "Dragostea Din Tei"
Towards a global antibiotic resistance surveillance system : a primer for a roadmap
Grundmann, Hajo
The need for global data about the scale of antibiotic resistance (ABR) in a geographical explicit and timely manner has been identified by many stakeholders, including the World Health Organization. This primer should help defining the objectives, scale, scope, and structure of possible future
Musiikkitapahtuman järjestäminen järjestäjän näkökulmasta
Koskelo, Jermo
2012-01-01
Tämä opinnäytetyö on puoliksi toiminnallinen tutkielma musiikkitapahtuman järjestämisestä ja se sisältää kaksi osiota. Ensimmäisessä osassa käsitellään musiikkitapahtuman järjestämistä yleisesti ja toinen osa antaa konkreettisen esimerkin jo järjestetystä musiikkitapahtumasta ja sen vaiheista. Tutkielman tarkoituksena on antaa perusteellinen käsitys musiikkitapahtuman järjestämisestä. Tapahtuman järjestämisen kannalta on erityisen tärkeää anoa kaikki tarvittavat luvat ennen kuin aloitetaan...
Primer Vector Optimization: Survey of Theory, new Analysis and Applications
Guzman
This paper presents a preliminary study in developing a set of optimization tools for orbit rendezvous, transfer and station keeping. This work is part of a large scale effort undergoing at NASA Goddard Space Flight Center and a.i. solutions, Inc. to build generic methods, which will enable missions with tight fuel budgets. Since no single optimization technique can solve efficiently all existing problems, a library of tools where the user could pick the method most suited for the particular mission is envisioned. The first trajectory optimization technique explored is Lawden's primer vector theory [Ref. 1]. Primer vector theory can be considered as a byproduct of applying Calculus of Variations (COV) techniques to the problem of minimizing the fuel usage of impulsive trajectories. For an n-impulse trajectory, it involves the solution of n-1 two-point boundary value problems. In this paper, we look at some of the different formulations of the primer vector (dependent on the frame employed and on the force model). Also, the applicability of primer vector theory is examined in effort to understand when and why the theory can fail. Specifically, since COV is based on "small variations", singularities in the linearized (variational) equations of motion along the arcs must be taken into account. These singularities are a recurring problem in analyzes that employ "small variations" [Refs. 2, 3]. For example, singularities in the (2-body problem) variational equations along elliptic arcs occur when [Ref. 4], 1) the difference between the initial and final times is a multiple of the reference orbit period, 2) the difference between the initial and final true anomalies are given by k, for k= 0, 1, 2, 3,..., note that this cover the 3) the time of flight is a minimum for the given difference in true anomaly. For the N-body problem, the situation is more complex and is still under investigation. Several examples, such as the initialization of an orbit (ascent trajectory) and
International Nuclear Information System (INIS)
Iverson, B.
1997-01-01
'Progress for the last twelve months has revolved around setting up an antibody engineering and surface display system for use with a metal-complex binding antibody. (1) The author has isolated genes for the V regions of the heavy and light chains for the Ru(bpy)3 specific monoclonal AC1106 (Shreder, K S., Hariman, A., and Iverson, B.L., J. Am. Chem. Soc. 1996, 118, 3192-3201). This antibody binds Ru(bpy), derivatives with better than nanomolar affinity, and will serve as the generic metal-complex binding pocket. Cloning antibody genes from hybridomas is complicated by the fact that primers must be found that amplify the particular heavy and light chain genes in the hybridoma of interest. Antibody gene amplification primers are generally designed to amplify antibody repertoires from lymphocyte mRNA isolated from animals. While cloning repertoires from animals is routinely successful due to the diverse population of target m RNA, hybridomas have a single target sequence. Therefore, multiple primers and conditions must be tried before the correct primer combination is identified.'
Triazole-linked DNA as a primer surrogate in the synthesis of first-strand cDNA.
Fujino, Tomoko; Yasumoto, Ken-ichi; Yamazaki, Naomi; Hasome, Ai; Sogawa, Kazuhiro; Isobe, Hiroyuki
2011-11-04
A phosphate-eliminated nonnatural oligonucleotide serves as a primer surrogate in reverse transcription reaction of mRNA. Despite of the nonnatural triazole linkages in the surrogate, the reverse transcriptase effectively elongated cDNA sequences on the 3'-downstream of the primer by transcription of the complementary sequence of mRNA. A structure-activity comparison with the reference natural oligonucleotides shows the superior priming activity of the surrogate containing triazole-linkages. The nonnatural linkages also protect the transcribed cDNA from digestion reactions with 5'-exonuclease and enable us to remove noise transcripts of unknown origins. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Kukielka, C.A.; Detamore, M.B.
1986-01-01
Pennsylvania Power and Light Company is installing a fifth diesel generator at its Susquehanna Steam Electric Station. This new diesel generator will serve as a ''swing'' diesel generator, i.e., perform the function of any of the existing diesel generators. The addition of this diesel generator avoids a dual unit shutdown should a diesel generator outage for maintenance or repair exceed the three day Technical Specification Limiting Condition for Operation (LCO). It is estimated that up to fifteen days per diesel generator will be required to complete the tie-in. In accordance with the existing three day LCO, a dual unit shutdown would then result. To preclude such a shutdown, a one time temporary extension to the three day LCO was requested of the Nuclear Regulatory Commission (NRC). This paper presents a probabilistic evaluation that was used to estimate the increased risk due to extending the LCO to a cumulative sixty days to allow the tie-in of the fifth diesel generator
Barada, K.; Rhodes, T. L.; Burrell, K. H.; Zeng, L.; Bardóczi, L.; Chen, Xi; Muscatello, C. M.; Peebles, W. A.
2018-03-01
A new, long-lived limit cycle oscillation (LCO) regime has been observed in the edge of near zero torque high performance DIII-D tokamak plasma discharges. These LCOs are localized and composed of density turbulence, gradient drives, and E ×B velocity shear damping (E and B are the local radial electric and total magnetic fields). Density turbulence sequentially acts as a predator (via turbulence transport) of profile gradients and a prey (via shear suppression) to the E ×B velocity shear. Reported here for the first time is a unique spatiotemporal variation of the local E ×B velocity, which is found to be essential for the existence of this system. The LCO system is quasistationary, existing from 3 to 12 plasma energy confinement times (˜30 - 900 LCO cycles) limited by hardware constraints. This plasma system appears to contribute strongly to the edge transport in these high performance and transient-free plasmas, as evident from oscillations in transport relevant edge parameters at LCO time scale.
A primer on polymer nomenclature: Structure-based, sourced-based and trade names
Polymer nomenclature is important because it is part of the language of polymer science and is needed for polymer identification, reference, and documentation. A primer on polymer nomenclature is provided herein for people new to the field or for instructional use. Both structure-based and source-...
Primer registro de Serratospiculum tendo (Nematoda: Diplotriaenidae para el Perú
Directory of Open Access Journals (Sweden)
Luis A. Gomez-Puerta
2014-05-01
Full Text Available Reportamos por primera vez la presencia del nematodo, Serratospiculum tendo Nitzsch, 1819, parasitando los sacos aéreos de un halcón peregrino (Falco peregrinus Tunstall, 1771. Seis nematodos (2 machos y 4 hembras fueron colectados e identificados como S. tendo. El hallazgo de este nematodo constituye el primer registro en el Perú.
PRIMER REGISTRO DEL FLEBOTOMÍNEO BRUMPTOMYIA PINTOI (DIPTERA: PSYCHODIDAE) EN COLOMBIA
BEJARANO EDUAR ELÍAS; DUQUE PATRICIA; VÉLEZ IVÁN DARÍO
2004-01-01
Durante un estudio entomológico de la leishmaniosis realizado en La Macarena,Departamento del Meta, Colombia, se colectó un espécimen macho de Brumptomyiapintoi, el cual constituye el primer registro de la especie para el país. Este flebotomíneofue capturado con un aspirador bucal mientras reposaba en el interior de una cuevade armadillo.
A new set of validated SSR primers for application in mulberry ...
Indian Academy of Sciences (India)
user
2018-01-11
Jan 11, 2018 ... We chose 37 genomic sequences that had high number of di, tri and tetra SSR motifs from ... primers failed to produce any amplification products and ... Sericulture is a cottage industry that employs 8.03 million people across ... The resolving power of the SSR markers ranged from 0.11 (MulSatG100717) to.
Wang, Chaojen; Lin, Yisheng; Lin, Yinghong; Chung, Wenhsin
2013-01-01
Previous investigations demonstrated that Fusarium oxysporum (Fo), which is not pathogenic to cucumbers, could serve as a biological control agent for managing Fusarium wilt of cucumber caused by Fo f. sp. cucumerinum (Foc) in Taiwan. However, thus far it has not been possible to separate the populations of pathogenic Fo from the nonpathogenic isolates that have biological control potential through their morphological characteristics. Although these two populations can be distinguished from one another using a bioassay, the work is laborious and time-consuming. In this study, a fragment of the intergenic spacer (IGS) region of ribosomal DNA from an Fo biological control agent, Fo366, was PCR-amplified with published general primers, FIGS11/FIGS12 and sequenced. A new primer, NPIGS-R, which was designed based on the IGS sequence, was paired with the FIGS11 primer. These primers were then evaluated for their specificity to amplify DNA from nonpathogenic Fo isolates that have biological control potential. The results showed that the modified primer pair, FIGS11/NPIGS-R, amplified a 500-bp DNA fragment from five of seven nonpathogenic Fo isolates. These five Fo isolates delayed symptom development of cucumber Fusarium wilt in greenhouse bioassay tests. Seventy-seven Fo isolates were obtained from the soil and plant tissues and then subjected to amplification using the modified primer pair; six samples showed positive amplification. These six isolates did not cause symptoms on cucumber seedlings when grown in peat moss infested with the isolates and delayed disease development when the same plants were subsequently inoculated with a virulent isolate of Foc. Therefore, the modified primer pair may prove useful for the identification of Fo isolates that are nonpathogenic to cucumber which can potentially act as biocontrol agents for Fusarium wilt of cucumber. PMID:23762289
Directory of Open Access Journals (Sweden)
Andrés Alvarado
Full Text Available Transmissible plasmids are responsible for the spread of genetic determinants, such as antibiotic resistance or virulence traits, causing a large ecological and epidemiological impact. Transmissible plasmids, either conjugative or mobilizable, have in common the presence of a relaxase gene. Relaxases were previously classified in six protein families according to their phylogeny. Degenerate primers hybridizing to coding sequences of conserved amino acid motifs were designed to amplify related relaxase genes from γ-Proteobacterial plasmids. Specificity and sensitivity of a selected set of 19 primer pairs were first tested using a collection of 33 reference relaxases, representing the diversity of γ-Proteobacterial plasmids. The validated set was then applied to the analysis of two plasmid collections obtained from clinical isolates. The relaxase screening method, which we call "Degenerate Primer MOB Typing" or DPMT, detected not only most known Inc/Rep groups, but also a plethora of plasmids not previously assigned to any Inc group or Rep-type.
Exclusive production of J/ψ mesons in the ZEUS detector
International Nuclear Information System (INIS)
Tandler, J.
2003-07-01
Exclusive J/ψ production has been studied using the ZEUS detector at HERA. Two ranges of the photon virtuality, Q 2 2 and 0.15 2 2 are examined. The latter is defined by requiring the scattered electron to be detected in the Beam Pipe Calorimeter under low angles. The J/ψ mesons have been identified via the decay J/ψ→e + e - . The cross sections are measured as a function of the photon-proton centre-of-mass energy, W. The data used were taken during the 1999 and 2000 running periods, which yielded an integrated luminosity of 68.7 pb -1 . The measured W dependences are in agreement with each other and the values obtained in high-Q 2 (2 2 2 ) measurements. This leads to the conclusion that J/ψ production is a hard process for all Q 2 values and can be described with models based on perturbative QCD. Electron-pion separation of the ZEUS Transition Radiation Detector is measured. A method to combine TRD information and dE/dx measurements from the central drift chamber is developed and applied to the Q 2 2 J/ψ sample. (orig.)
Supplementary data: Mapping of shoot fly tolerance loci in sorghum ...
Indian Academy of Sciences (India)
Supplementary data: Mapping of shoot fly tolerance loci in sorghum using SSR markers. D. B. Apotikar, D. Venkateswarlu, R. B. Ghorade, R. M. Wadaskar, J. V. Patil and P. L. Kulwal. J. Genet. 90, 59–66. Table 1. List of SSR primers for sorghum. Primer code. Forward and reverse. Annealing temperature (°C). Product.
Directory of Open Access Journals (Sweden)
Elif Çepni
2012-01-01
Full Text Available In this study, Pseudomonas syringe pathovars isolated from olive, tomato and bean were identified by species-specific PCR and their genetic diversity was assessed by repetitive extragenic palindromic (REP-PCR. Reverse universal primers for REP-PCR were designed by using the bases of A, T, G or C at the positions of 1, 4 and 11 to identify additional polymorphism in the banding patterns. Binding of the primers to different annealing sites in the genome revealed additional fingerprint patterns in eight isolates of P. savastanoi pv. savastanoi and two isolates of P. syringae pv. tomato. The use of four different bases in the primer sequences did not affect the PCR reproducibility and was very efficient in revealing intra-pathovar diversity, particularly in P. savastanoi pv. savastanoi. At the pathovar level, the primer BOX1AR yielded shared fragments, in addition to five bands that discriminated among the pathovars P. syringae pv. phaseolicola, P. savastanoi pv. savastanoi and P. syringae pv. tomato. REP-PCR with a modified primer containing C produced identical bands among the isolates in a pathovar but separated three pathovars more distinctly than four other primers. Although REP-and BOX-PCRs have been successfully used in the molecular identification of Pseudomonas isolates from Turkish flora, a PCR based on inter-enterobacterial repetitive intergenic concensus (ERIC sequences failed to produce clear banding patterns in this study.
J-Specific Dynamics in AN Optical Centrifuge Using Transient IR Spectroscopy
Murray, Matthew J.; Liu, Qingnan; Toro, Carlos; Mullin, Amy S.
2013-06-01
Quantum state-specific dynamics are reported for a number of CO_{2} rotational states in an optical centrifuge. The optical centrifuge results from combining oppositely-chirped ultrafast laser pulses and spinning CO_{2} molecules into extremely high rotational states with J≈220. Collisions of centrifuged molecules induce depletion of population from low-J states (J=0 and 36) and lead to appearance of population in high J states (J=36, 54 and 76). Transient Doppler-broadened line profiles for individual CO_{2} states reveal that the depletion populations have narrow velocity distributions with translational temperatures significantly colder than 300 K. Molecules that appear in the higher rotational states have broad velocity distributions, showing that both rotational and translational energy are imparted in collisions of the centrifuged molecules. These results show that substantial amounts of angular momentum persist after many collisions and that translational energy exchange continues for several thousand collisions.
The c-Met Inhibitor MSC2156119J Effectively Inhibits Tumor Growth in Liver Cancer Models
Energy Technology Data Exchange (ETDEWEB)
Bladt, Friedhelm, E-mail: Friedhelm.Bladt@merckgroup.com; Friese-Hamim, Manja; Ihling, Christian; Wilm, Claudia; Blaukat, Andree [EMD Serono, and Merck Serono Research and Development, Merck KGaA, Darmstadt 64293 (Germany)
2014-08-19
The mesenchymal-epithelial transition factor (c-Met) is a receptor tyrosine kinase with hepatocyte growth factor (HGF) as its only high-affinity ligand. Aberrant activation of c-Met is associated with many human malignancies, including hepatocellular carcinoma (HCC). We investigated the in vivo antitumor and antimetastatic efficacy of the c-Met inhibitor MSC2156119J (EMD 1214063) in patient-derived tumor explants. BALB/c nude mice were inoculated with MHCC97H cells or with tumor fragments of 10 patient-derived primary liver cancer explants selected according to c-Met/HGF expression levels. MSC2156119J (10, 30, and 100 mg/kg) and sorafenib (50 mg/kg) were administered orally as single-agent treatment or in combination, with vehicle as control. Tumor response, metastases formation, and alpha fetoprotein (AFP) levels were measured. MSC2156119J inhibited tumor growth and induced complete regression in mice bearing subcutaneous and orthotopic MHCC97H tumors. AFP levels were undetectable after 5 weeks of MSC2156119J treatment, and the number of metastatic lung foci was reduced. Primary liver explant models with strong c-Met/HGF activation showed increased responsiveness to MSC2156119J, with MSC2156119J showing similar or superior activity to sorafenib. Tumors characterized by low c-Met expression were less sensitive to MSC2156119J. MSC2156119J was better tolerated than sorafenib, and combination therapy did not improve efficacy. These findings indicate that selective c-Met/HGF inhibition with MSC2156119J is associated with marked regression of c-Met high-expressing tumors, supporting its clinical development as an antitumor treatment for HCC patients with active c-Met signaling.
Patil, Basanagouda S; Rao, Bk Raghavendra; Sharathchandra, Sm; Hegde, Reshma; Kumar, G Vinay
2013-09-01
The aim of the present study was to investigate the effectiveness of the one total-etch self-priming adhesive, one two-step self-etching primer adhesive, and one 'all-in-one' self-etching adhesive system on the adhesion of a resin composite to enamel. Thirty-six freshly extracted human mandibular molars were selected for this study. A fat area about 5 mm in diameter was created on the exposed mesial surface of enamel of each tooth by moist grinding with 320, 420 and 600 grit silicon carbide paper. Twelve teeth were randomly assigned into three groups. In group 1, Adper Easy One (3M ESPE), a one step self-etching primer adhesive was applied and light curing unit for 10 seconds. In group 2, Adper SE Plus, a two-step self-etching primer with bottle A containing the aqueous primer and bottle B containing the acidic adhesive was applied and light cured for 10 seconds. Group 3 (control)-etchant 37% phosphoric acid is applied to the surface for 15 seconds and rinsed with water and air dried and adhesive (single bond 2) is applied to the surface and tube is placed and light cured for 20 seconds. Composite material (Z350) was placed in the tube and light cured for 40 seconds in all the groups. Bond strength testing was done using universal testing machine at the enamel-composite interface. The debonded enamel surface was evaluated in stereomicroscope to assess the cohesive, adhesive or mixed fracture. Data was statistically analyzed by one way analysis of variance (ANOVA). Group 1 performed least among all groups with a mean score of 19.46 MPa. Group 2 had a mean score of 25.67 MPa. Group 3 had a mean score of 27.16 MPa. Under the conditions of this in vitro study, the bond strength values of the two-step self-etching primer systems tested were similar to the total-etch. And, one step self-etching primers have lower bond strength compared to the total-etch.
In Silico PCR Tools for a Fast Primer, Probe, and Advanced Searching.
Kalendar, Ruslan; Muterko, Alexandr; Shamekova, Malika; Zhambakin, Kabyl
2017-01-01
The polymerase chain reaction (PCR) is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. The principle of this technique has been further used and applied in plenty of other simple or complex nucleic acid amplification technologies (NAAT). In parallel to laboratory "wet bench" experiments for nucleic acid amplification technologies, in silico or virtual (bioinformatics) approaches have been developed, among which in silico PCR analysis. In silico NAAT analysis is a useful and efficient complementary method to ensure the specificity of primers or probes for an extensive range of PCR applications from homology gene discovery, molecular diagnosis, DNA fingerprinting, and repeat searching. Predicting sensitivity and specificity of primers and probes requires a search to determine whether they match a database with an optimal number of mismatches, similarity, and stability. In the development of in silico bioinformatics tools for nucleic acid amplification technologies, the prospects for the development of new NAAT or similar approaches should be taken into account, including forward-looking and comprehensive analysis that is not limited to only one PCR technique variant. The software FastPCR and the online Java web tool are integrated tools for in silico PCR of linear and circular DNA, multiple primer or probe searches in large or small databases and for advanced search. These tools are suitable for processing of batch files that are essential for automation when working with large amounts of data. The FastPCR software is available for download at http://primerdigital.com/fastpcr.html and the online Java version at http://primerdigital.com/tools/pcr.html .
Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R
2015-05-01
Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.
Energy Technology Data Exchange (ETDEWEB)
Aaij, R. [European Organization for Nuclear Research (CERN), Geneva (Switzerland); Adeva, B. [Universidad de Santiago de Compostela, Santiago de Compostela (Spain); Adinolfi, M. [H.H. Wills Physics Laboratory, University of Bristol, Bristol (United Kingdom); Ajaltouni, Z. [Clermont Université, Université Blaise Pascal, CNRS/IN2P3, LPC, Clermont-Ferrand (France); Collaboration: The LHCb collaboration; and others
2017-03-07
The ratio of branching fractions and the difference in CP asymmetries of the decays B{sup +}→J/ψπ{sup +} and B{sup +}→J/ψK{sup +} are measured using a data sample of pp collisions collected by the LHCb experiment, corresponding to an integrated luminosity of 3 fb{sup −1} at centre-of-mass energies of 7 and 8 TeV. The results are ((B(B{sup +}→J/ψπ{sup +}))/(B(B{sup +}→J/ψK{sup +})))=(3.83±0.03±0.03)×10{sup −2} , A{sup CP}(B{sup +}→J/ψπ{sup +})−A{sup CP}(B{sup +}→J/ψK{sup +})=(1.82±0.86±0.14)×10{sup −2}, where the first uncertainties are statistical and the second are systematic. Combining this result with a recent LHCb measurement of A{sup CP}(B{sup +}→J/ψK{sup +}) provides the most precise estimate to date of CP violation in the decay B{sup +}→J/ψπ{sup +}, A{sup CP}(B{sup +}→J/ψπ{sup +})=(1.91±0.89±0.16)×10{sup −2}.
Al-Harbi, Fahad A; Ayad, Neveen M; Khan, Zahid A; Mahrous, Amr A; Morgano, Steven M
2016-01-01
Durability of the bond between different core materials and zirconia retainers is an important predictor of the success of a dental prosthesis. Nevertheless, because of its polycrystalline structure, zirconia cannot be etched and bonded to a conventional resin cement. The purpose of this in vitro study was to compare the effects of 3 metal primer/resin cement systems on the shear bond strength (SBS) of 3 core materials bonded to yttria-stabilized tetragonal zirconia polycrystalline (Y-TZP) ceramic retainers. Zirconia ceramic (Cercon) disks (5×3 mm) were airborne-particle abraded, rinsed, and air-dried. Disk-shaped core specimens (7×7 mm) that were prepared of composite resin, Ni-Cr, and zirconia were bonded to the zirconia ceramic disks by using one of 3 metal primer/cement systems: (Z-Prime Plus/BisCem, Zirconia Primer/Multilink Automix, or Clearfil Ceramic Primer/Clearfil SA). SBS was tested in a universal testing machine. Stereomicroscopy was used to evaluate the failure mode of debonded specimens. Data were analyzed using 2-way ANOVA and post hoc analysis using the Scheffe procedure (α=.05). Clearfil SA/Clearfil Ceramic Primer system with an Ni-Cr core yielded the highest SBS value (19.03 MPa), whereas the lowest SBS value was obtained when Multilink Automix/Zirconia Primer system was used with the zirconia core group (4.09 MPa). Differences in mean SBS values among the cement/primer groups were statistically significant, except for Clearfil SA and BisCem with both composite resin and zirconia cores. Differences in mean SBS values among the core subgroups were not statistically significant, except for zirconia core with BisCem, Multilink, and Clearfil SA. The predominant failure mode was adhesive, except for Clearfil SA and BisCem luting agents with composite resin cores, which displayed cohesive failure, and Multilink Automix with a composite resin, core as well as Clearfil SA with Ni-Cr cores, where the debonded specimens of each group displayed a mixed
[Design of primers to DNA of lactic acid bacteria].
Lashchevskiĭ, V V; Kovalenko, N K
2003-01-01
Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.
Accelerating MATLAB with GPU computing a primer with examples
Suh, Jung W
2013-01-01
Beyond simulation and algorithm development, many developers increasingly use MATLAB even for product deployment in computationally heavy fields. This often demands that MATLAB codes run faster by leveraging the distributed parallelism of Graphics Processing Units (GPUs). While MATLAB successfully provides high-level functions as a simulation tool for rapid prototyping, the underlying details and knowledge needed for utilizing GPUs make MATLAB users hesitate to step into it. Accelerating MATLAB with GPUs offers a primer on bridging this gap. Starting with the basics, setting up MATLAB for
Sánchez Romero, Elisa Isabel
2017-01-01
La presente tesis doctoral evalúa la eficacia del programa para el desarrollo moral y el fomento de valores en jóvenes adultos con discapacidad intelectual a través de juegos predeportivos y dilemas morales (programa DEMVA). Situado en el contexto de la educación superior, concretamente en la Universidad Católica de Murcia (UCAM), el programa DEMVA se llevó a cabo en la asignatura “Valores, tiempo libre y deporte”, del primer curso del programa UCAMPACITAS dirigido a la inserción socio-labora...
Nano sized La2Co2O6 double perovskite synthesized by sol gel method
Solanki, Neha; Lodhi, Pavitra Devi; Choudhary, K. K.; Kaurav, Netram
2018-05-01
We report here the synthesis of double perovskite La2Co2O6 (LCO) compound by a sol gel route method. The double perovskite structure of LCO system was confirmed via X-ray diffraction (XRD) analysis. Further, the lattice parameter, unit cell volume and bond length were refined by means of rietveld analysis using the full proof software. Debye Scherer formula was used to determine the particle size. The compound crystallized in triclinic structure with space group P-1 in ambient condition. We also obtained Raman modes from XRD spectra of poly-crystalline LCO sample. These results were interpreted for the observation of phonon excitations in this compound.
Optimisation of the PCR-invA primers for the detection of Salmonella ...
African Journals Online (AJOL)
A polymerase chain reaction (PCR)-based method for the detection of Salmonella species in water samples was optimised and evaluated for speed, specificity and sensitivity. Optimisation of Mg2+ and primer concentrations and cycling parameters increased the sensitivity and limit of detection of PCR to 2.6 x 104 cfu/m.
Primer reporte del empleo de marcadores ISTR en Cactaceae (Pilosocereus sp
Directory of Open Access Journals (Sweden)
Grecia Montalvo Fernández
2010-07-01
obtained plants they will be planted under natural conditions, where they will face diverse environmental situations, it is convenient to carry out a study of genetic diversity. The objective of this work was to estimate the genetic variability using the technical Inverse Sequence Tagged Repeat (ISTR. In vitro germination of seeds of Pilosocereus sp and the genetic variability of the obtained seedlings was determined. With the molecular analysis a total of 97 bands were detected, of them 62.8% were polymorphic. The biggest percentage of polymorphism (85.7% was obtained with the primer combination F6/B6. With the primer combinations employed were detected from 4 to 6 different band patterns. The heterocigocity hoped was 0.39. Key words: Cactaceae; variability; extintion; polymorphism.
Theoretical interpretations of J/ψ suppression: a summary
International Nuclear Information System (INIS)
Kharzeev, D.
1998-01-01
The strong ''anomalous'' J/ψ suppression observed recently by the NA50 collaboration at CERN SPS has attracted considerable attention. Is it the first signature of a long-awaited quark-gluon plasma, or just a peculiar combination of ''conventional'' effects acting together to produce the puzzling pattern observed experimentally? This talk is an attempt to summarize the theoretical explanations proposed during the last two years. (orig.)
Directory of Open Access Journals (Sweden)
E. Mahmoudi
2007-08-01
Full Text Available Pectobacterium is one of the major destructive causal agent in most crop plants throughout the world. During a survey in spring of 2005 in the rangeland of Kermanshah and Isfahan, provinces of Iran, samples of bulbs and stems of crown imperial with brown spot and soft rot were collected. Eight strains of pectolytic Erwinia were isolated and purified from these samples. Phenotypic tests indicated that the strains were gram-negative, facultative anaerobic, rod shaped, motile with peritrichous flagella. They were oxidase negative, catalase positive and also able to macerate potato slices. Pathogenicity of all the strains were confirmed on corn, philodendron and crown imperial by inoculation of these crops with a bacterial suspension and reisolation of the strain from symptomatic tissues. A pair of specific PCR primers was used to detect these bacterial strains. The primer set (EXPCCF/EXPCCR amplified a single fragment of the expected size (0.55 kb from genomic DNA of all strains used in this study. In nested PCR, the primer set (INPCCR/INPCCF amplified the expected single fragment (0.4 kb from the PCR product of first PCR amplification. On the basis of the biochemical and phenotypic characteristics and PCR amplification by the specific PCR primers, these strains were identified as Pectobacterium carotovorum subsp. carotovorum. This is the first report of occurrence of crown imperial bacterial soft-rot in Iran.
Recognition of base J in duplex DNA by J-binding protein
Sabatini, Robert; Meeuwenoord, Nico; van Boom, Jacques H.; Borst, Piet
2002-01-01
beta-d-Glucosylhydroxymethyluracil, also called base J, is an unusual modified DNA base conserved among Kinetoplastida. Base J is found predominantly in repetitive DNA and correlates with epigenetic silencing of telomeric variant surface glycoprotein genes. We have previously found a J-binding
What Are the Odds of that? A Primer on Understanding Logistic Regression
Huang, Francis L.; Moon, Tonya R.
2013-01-01
The purpose of this Methodological Brief is to present a brief primer on logistic regression, a commonly used technique when modeling dichotomous outcomes. Using data from the National Education Longitudinal Study of 1988 (NELS:88), logistic regression techniques were used to investigate student-level variables in eighth grade (i.e., enrolled in a…
Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R.; Tucker, Kimberly Pause; Bonde, Robert K.; McGuire, Peter M.; Lanyon, Janet M.
2010-01-01
The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These crossspecies microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals.
Alejandro, QUIROGA FERNÁNDEZ DE SOTO
2009-01-01
RESUMEN: el artículo analiza las reformas llevadas a cabo por la Dictadura de Primo de Rivera en la enseñanza secundaria y superior, con el fin de inculcar una serie de principios nacionalistas españoles a los jóvenes. En un primer apartado se discute el concepto primorriverista de ciudadanía autoritaria con el que se intentó adoctrinar a la población. La segunda sección explora la reforma de la enseñanza secundaria, la implantación del polémico «texto único» y sus efectos políticos. La últim...
Tracking the elusive 5' exonuclease activity of Chlamydomonas reinhardtii RNase J.
Liponska, Anna; Jamalli, Ailar; Kuras, Richard; Suay, Loreto; Garbe, Enrico; Wollman, Francis-André; Laalami, Soumaya; Putzer, Harald
2018-04-01
Chlamydomonas RNase J is the first member of this enzyme family that has endo- but no intrinsic 5' exoribonucleolytic activity. This questions its proposed role in chloroplast mRNA maturation. RNA maturation and stability in the chloroplast are controlled by nuclear-encoded ribonucleases and RNA binding proteins. Notably, mRNA 5' end maturation is thought to be achieved by the combined action of a 5' exoribonuclease and specific pentatricopeptide repeat proteins (PPR) that block the progression of the nuclease. In Arabidopsis the 5' exo- and endoribonuclease RNase J has been implicated in this process. Here, we verified the chloroplast localization of the orthologous Chlamydomonas (Cr) RNase J and studied its activity, both in vitro and in vivo in a heterologous B. subtilis system. Our data show that Cr RNase J has endo- but no significant intrinsic 5' exonuclease activity that would be compatible with its proposed role in mRNA maturation. This is the first example of an RNase J ortholog that does not possess a 5' exonuclease activity. A yeast two-hybrid screen revealed a number of potential interaction partners but three of the most promising candidates tested, failed to induce the latent exonuclease activity of Cr RNase J. We still favor the hypothesis that Cr RNase J plays an important role in RNA metabolism, but our findings suggest that it rather acts as an endoribonuclease in the chloroplast.
Piñol, J; Mir, G; Gomez-Polo, P; Agustí, N
2015-07-01
The quantification of the biological diversity in environmental samples using high-throughput DNA sequencing is hindered by the PCR bias caused by variable primer-template mismatches of the individual species. In some dietary studies, there is the added problem that samples are enriched with predator DNA, so often a predator-specific blocking oligonucleotide is used to alleviate the problem. However, specific blocking oligonucleotides could coblock nontarget species to some degree. Here, we accurately estimate the extent of the PCR biases induced by universal and blocking primers on a mock community prepared with DNA of twelve species of terrestrial arthropods. We also compare universal and blocking primer biases with those induced by variable annealing temperature and number of PCR cycles. The results show that reads of all species were recovered after PCR enrichment at our control conditions (no blocking oligonucleotide, 45 °C annealing temperature and 40 cycles) and high-throughput sequencing. They also show that the four factors considered biased the final proportions of the species to some degree. Among these factors, the number of primer-template mismatches of each species had a disproportionate effect (up to five orders of magnitude) on the amplification efficiency. In particular, the number of primer-template mismatches explained most of the variation (~3/4) in the amplification efficiency of the species. The effect of blocking oligonucleotide concentration on nontarget species relative abundance was also significant, but less important (below one order of magnitude). Considering the results reported here, the quantitative potential of the technique is limited, and only qualitative results (the species list) are reliable, at least when targeting the barcoding COI region. © 2014 John Wiley & Sons Ltd.
In Vitro Evaluation of Shear Bond Strength of Self Etching Primers to Dentin
Directory of Open Access Journals (Sweden)
Reena Vora
2012-01-01
Full Text Available Objectives: To evaluate and compare the shear bond strength of four self etching primer adhesives to dentin. Materials & Methods: A total of 75 extracted human maxillary and mandibular molars were selected for the study. The teeth were divided into 5 groups of 15 teeth each, Group A- AdheSE (Ivoclar Vivadent, Group B-Adper prompt (3M ESPE, Group C- i bond (Heraeus-Kulzer, Group D-XenoIII (Dentsply, De Trey Group E-Single bond (3M ESPE was used and served as control. All the adhesives were applied according to the manufacturer′s instructions. Composite post was built on these bonded surfaces using Z-100 hybrid composite. The teeth were subjected to thermocycling for 500 cycles between 5°C to 55°C. The teeth were then mounted on universal testing machine and fractured under a shearing load, applied at a speed of 0.2mm/min. The readings were noted, tabulated and shear bond strength calculated in Mega Pascal (Mpa units. Results: There was significant difference in the mean shear bond strength of the four self etching primers, adhesives tested. Shear strength values were in the range of 16.57 to 21.73 Mpa. Xeno III gave the highest mean of shear bond strength whereas Adhe SE showed the lowest value of shear strength. Conclusion: Based on the results of the study, it can be concluded that contemporary self etching primer adhesives bond successfully to dentin. Moreover the bonding ability of Self Etching Systems seems to be comparable to the conventional Total Etch Systems.
In vitro V(D)J recombination: signal joint formation.
Cortes, P; Weis-Garcia, F; Misulovin, Z; Nussenzweig, A; Lai, J S; Li, G; Nussenzweig, M C; Baltimore, D
1996-11-26
The first step of V(D)J recombination, specific cleavage at the recombination signal sequence (RSS), can be carried out by the recombination activating proteins RAG1 and RAG2. In vivo, the cleaved coding and signal ends must be rejoined to generate functional antigen receptors and maintain chromosomal integrity. We have investigated signal joint formation using deletion and inversion substrates in a cell free system. RAG1 and RAG2 alone or in combination were unable to generate signal joints. However, RAG1 and RAG2 complemented with nuclear extracts were able to recombine an extrachromosomal substrate and form precise signal joints. The in vitro reaction resembled authentic V(D)J recombination in being Ku-antigen-dependent.
A taxonomic synopsis of Altingiaceae with nine new combinations
Directory of Open Access Journals (Sweden)
Stefanie Ickert-Bond
2013-12-01
Full Text Available A taxonomic synopsis of the Altingiaceae is presented, including the taxonomic enumeration and distribution of 15 recognized species based on studies of 1,500 specimens from 24 herbaria throughout the distributional range of the taxa. Previous phylogenetic analyses based on several molecular markers have shown that Altingia and Semiliquidambar are nested within Liquidambar. All Altingia and Semiliquidambar species are now formally transferred to Liquidambar, which has the nomenclatural priority. The following nine new combinations are herein made: Liquidambar cambodiana (Lecomte Ickert-Bond & J. Wen, L. caudata (H. T. Chang Ickert-Bond & J. Wen, L. chingii (Metcalf Ickert-Bond & J. Wen, L. gracilipes (Hemsl. Ickert-Bond & J. Wen, L. multinervis (Cheng Ickert-Bond & J. Wen, L. obovata (Merrill & Chun Ickert-Bond & J. Wen, L. poilanei (Tardieu Ickert-Bond & J. Wen, L. siamensis (Craib Ickert-Bond & J. Wen, and L. yunnanensis (Rehder & Wilson Ickert-Bond & J. Wen.
Identification of novel intronic BRCA1 variants of uncertain ...
Indian Academy of Sciences (India)
in a Thai hereditary breast cancer family. Adisorn Ratanaphan, Pornpen Panomwan, Bhutorn Canyuk and Tanaphon Maipang. J. Genet. 90, 327–331. Table 1. Oligodeoxyribonucleotide primers used for PCR amplification of BRCA1 exon–intron 7 boundary sequences. Primers. Nucleotide position. Primer sequence (5 –3 ).
Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders
Energy Technology Data Exchange (ETDEWEB)
Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.
2004-02-10
This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.
Atmel AVR Microcontroller Primer Programming and Interfacing, Second Edition
Barrett, Steven F
2012-01-01
This textbook provides practicing scientists and engineers a primer on the Atmel AVR microcontroller. In this second edition we highlight the popular ATmega164 microcontroller and other pin-for-pin controllers in the family with a complement of flash memory up to 128 kbytes. The second edition also adds a chapter on embedded system design fundamentals and provides extended examples on two different autonomous robots. Our approach is to provide the fundamental skills to quickly get up and operating with this internationally popular microcontroller. We cover the main subsystems aboard the ATmega
Crack assessment of pipe under combined thermal and mechanical load
International Nuclear Information System (INIS)
Song, Tae Kwang; Kim, Yun Jae
2009-01-01
In this paper, J-integral and transient C(t)-integral, which were key parameters in low temperature and high temperature fracture mechanics, under combined thermal and mechanical load were estimated via 3-dimensional finite element analyses. Various type of thermal and mechanical load, material hardening were considered to decrease conservatism in existing solutions. As a results, V-factor and redistribution time for combined thermal and mechanical load were proposed to calculate J-integral and C(t)-integral, respectively.
Directory of Open Access Journals (Sweden)
Eliane Teresinha Peres
2016-03-01
Full Text Available The main objective of this work was to present and analyze editorial aspects of the primer Caminho Suave, as well as the participation of the publishing house of the same name, in federal programs for school textbooks. The primer was published for the first time in 1948 and is edited until today, representing a landmark for Brazilian literacy, exerting influence over generations of teachers and students alike. Data analyzed were collected from official sources (Diário Oficial da União [Brazilian Official National Press] and Diário Oficial do Estado de São Paulo [São Paulo State Official Press], from periodical press (Veja Digital, Grupo Folha, and Hemeroteca Digital Brasileira [Brazilian Digital Periodical Press Collection], and from printings of the primer itself. In the research process, data indicated the primer Caminho Suave as one of the biggest editorial successes concerning books used to teach reading and writing inBrazil, as some studies in this field had already indicated.
Su, Lei; Zhang, Qianqian; Gong, Jun
2017-07-01
Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.
International Nuclear Information System (INIS)
Sasaki, Ken-ichi; Nakamoto, Tatsushi; Ajima, Yasuo; Okamura, Takahiro; Ogitsu, Toru; Kimura, Nobuhiro; Terashima, Akio; Tomaru, Takayuki; Higashi, Norio
2010-01-01
Superconducting combined-function magnets have been utilized for the 50-GeV, 750-kW proton beam line in the J-PARC neutrino experiment. The magnets are designed to provide a dipole field of 2.6 T combined with a quadrupole field of 19 T/m in a coil aperture of 173.4 mm at a nominal current of 7,345 A. Following the success of a prototype R and D project, a superconducting magnet system for the J-PARC neutrino beam line has been constructed since 2005. Using a new conceptual beam line with the superconducting combined-function magnets has demonstrated successful beam transport to the target neutrino production. (author)
Number of states with given spin J of n fermions in a j orbit
International Nuclear Information System (INIS)
Talmi, Igal
2005-01-01
A recursion formula for the number of states with a given value of total spin J of n identical fermions in a j orbit, N(J,j,n), is derived. That number is expressed in terms of the number of states with some values of J, of n,n-1, and n-2 fermions in a (j-1) orbit. This formula may be used in calculating N(J,j,n). In this paper the formula is used to prove some interesting results that were found empirically by Zhao and Arima