WorldWideScience

Sample records for primary erythroid progenitor

  1. Hydroxyurea inhibits parvovirus B19 replication in erythroid progenitor cells.

    Science.gov (United States)

    Bonvicini, Francesca; Bua, Gloria; Conti, Ilaria; Manaresi, Elisabetta; Gallinella, Giorgio

    2017-07-15

    Parvovirus B19 (B19V) infection is restricted to erythroid progenitor cells (EPCs) of the human bone marrow, leading to transient arrest of erythropoiesis and severe complications mainly in subjects with underlying hematological disorders or with immune system deficits. Currently, there are no specific antiviral drugs for B19V treatment, but identification of compounds inhibiting B19V replication can be pursued by a drug repositioning strategy. In this frame, the present study investigates the activity of hydroxyurea (HU), the only disease-modifying therapy approved for sickle cell disease (SCD), towards B19V replication in the two relevant cellular systems, the UT7/EpoS1 cell line and EPCs. Results demonstrate that HU inhibits B19V replication with EC 50 values of 96.2µM and 147.1µM in UT7/EpoS1 and EPCs, respectively, providing experimental evidence of the antiviral activity of HU towards B19V replication, and confirming the efficacy of a drug discovery process by drug repositioning strategy. The antiviral activity occurs in vitro at concentrations lower than those affecting cellular DNA replication and viability, and at levels measured in plasma samples of SCD patients undergoing HU therapy. HU might determine a dual beneficial effect on SCD patients, not only for the treatment of the disease but also towards a virus responsible for severe complications. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Therapeutic γ-globin inducers reduce transcriptional repression in hemoglobinopathy erythroid progenitors through distinct mechanisms

    Science.gov (United States)

    Dai, Yan; Sangerman, Jose; Hong, Yuan Luo; Fuchareon, Suthat; Chui, David H.K.; Faller, Douglas V.; Perrine, Susan P.

    2015-01-01

    Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726

  3. Establishment of immortalized human erythroid progenitor cell lines able to produce enucleated red blood cells.

    Directory of Open Access Journals (Sweden)

    Ryo Kurita

    Full Text Available Transfusion of red blood cells (RBCs is a standard and indispensable therapy in current clinical practice. In vitro production of RBCs offers a potential means to overcome a shortage of transfusable RBCs in some clinical situations and also to provide a source of cells free from possible infection or contamination by microorganisms. Thus, in vitro production of RBCs may become a standard procedure in the future. We previously reported the successful establishment of immortalized mouse erythroid progenitor cell lines that were able to produce mature RBCs very efficiently. Here, we have developed a reliable protocol for establishing immortalized human erythroid progenitor cell lines that are able to produce enucleated RBCs. These immortalized cell lines produce functional hemoglobin and express erythroid-specific markers, and these markers are upregulated following induction of differentiation in vitro. Most importantly, these immortalized cell lines all produce enucleated RBCs after induction of differentiation in vitro, although the efficiency of producing enucleated RBCs remains to be improved further. To the best of our knowledge, this is the first demonstration of the feasibility of using immortalized human erythroid progenitor cell lines as an ex vivo source for production of enucleated RBCs.

  4. Reduction of erythroid progenitors in protein-energy malnutrition.

    Science.gov (United States)

    Borelli, Primavera; Blatt, Solange; Pereira, Juliana; de Maurino, Beatriz Beutler; Tsujita, Maristela; de Souza, Ana Cristina; Xavier, José Guilherme; Fock, Ricardo Ambrósio

    2007-02-01

    Protein-energy malnutrition is a syndrome in which anaemia together with multivitamin and mineral deficiency may be present. The pathophysiological mechanisms involved have not, however, yet been completely elucidated. The aim of the present study was to evaluate the pathophysiological processes that occur in this anaemia in animals that were submitted to protein-energy malnutrition, in particular with respect to Fe concentration and the proliferative activity of haemopoietic cells. For this, histological, histochemical, cell culture and immunophenotyping techniques were used. Two-month-old male Swiss mice were submitted to protein-energy malnutrition with a low-protein diet (20 g/kg) compared with control diet (400 g/kg). When the experimental group had attained a 20 % loss of their original body weight, the animals from both groups received, intravenously, 20 IU erythropoietin every other day for 14 d. Malnourished animals showed a decrease in red blood cells, Hb concentration and reticulocytopenia, as well as severe bone marrow and splenic atrophy. The results for serum Fe, total Fe-binding capacity, transferrin and erythropoietin in malnourished animals were no different from those of the control animals. Fe reserves in the spleen, liver and bone marrow were found to be greater in the malnourished animals. The mixed colony-forming unit assays revealed a smaller production of granulocyte-macrophage colony-forming units, erythroid burst-forming units, erythroid colony-forming units and CD45, CD117, CD119 and CD71 expression in the bone marrow and spleen cells of malnourished animals. These findings suggest that, in this protein-energy malnutrition model, anaemia is not caused by Fe deficiency or erythropoietin deficiency, but is a result of ineffective erythropoiesis.

  5. PI3 kinase is important for Ras, MEK and Erk activation of Epo-stimulated human erythroid progenitors

    Directory of Open Access Journals (Sweden)

    Schmidt Enrico K

    2004-05-01

    Full Text Available Abstract Background Erythropoietin is a multifunctional cytokine which regulates the number of erythrocytes circulating in mammalian blood. This is crucial in order to maintain an appropriate oxygen supply throughout the body. Stimulation of primary human erythroid progenitors (PEPs with erythropoietin (Epo leads to the activation of the mitogenic kinases (MEKs and Erks. How this is accomplished mechanistically remained unclear. Results Biochemical studies with human cord blood-derived PEPs now show that Ras and the class Ib enzyme of the phosphatidylinositol-3 kinase (PI3K family, PI3K gamma, are activated in response to minimal Epo concentrations. Surprisingly, three structurally different PI3K inhibitors block Ras, MEK and Erk activation in PEPs by Epo. Furthermore, Erk activation in PEPs is insensitive to the inhibition of Raf kinases but suppressed upon PKC inhibition. In contrast, Erk activation induced by stem cell factor, which activates c-Kit in the same cells, is sensitive to Raf inhibition and insensitive to PI3K and PKC inhibitors. Conclusions These unexpected findings contrast with previous results in human primary cells using Epo at supraphysiological concentrations and open new doors to eventually understanding how low Epo concentrations mediate the moderate proliferation of erythroid progenitors under homeostatic blood oxygen levels. They indicate that the basal activation of MEKs and Erks in PEPs by minimal concentrations of Epo does not occur through the classical cascade Shc/Grb2/Sos/Ras/Raf/MEK/Erk. Instead, MEKs and Erks are signal mediators of PI3K, probably the recently described PI3K gamma, through a Raf-independent signaling pathway which requires PKC activity. It is likely that higher concentrations of Epo that are induced by hypoxia, for example, following blood loss, lead to additional mitogenic signals which greatly accelerate erythroid progenitor proliferation.

  6. THE EFFECTS OF IL-1 AND IL-4 ON THE EPO-INDEPENDENT ERYTHROID PROGENITOR IN POLYCYTHEMIA-VERA

    NARCIS (Netherlands)

    DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E

    1994-01-01

    Human recombinant interleukin-1 (IL-1) was studied for its effects on the erythroid progenitors from normal subjects and from patients with polycythaemia vera (PV). No supportive effect of IL-1 was noticed on the normal, erythropoietin (Epo) dependent, erythroid burst-forming unit (BFU-E) using

  7. No changes in heme synthesis in human Friedreich´s ataxia erythroid progenitor cells.

    Science.gov (United States)

    Steinkellner, Hannes; Singh, Himanshu Narayan; Muckenthaler, Martina U; Goldenberg, Hans; Moganty, Rajeswari R; Scheiber-Mojdehkar, Barbara; Sturm, Brigitte

    2017-07-20

    Friedreich's ataxia (FRDA) is a neurodegenerative disease caused by reduced expression of the protein frataxin. Frataxin is thought to play a role in iron-sulfur cluster biogenesis and heme synthesis. In this study, we used erythroid progenitor stem cells obtained from FRDA patients and healthy donors to investigate the putative role, if any, of frataxin deficiency in heme synthesis. We used electrochemiluminescence and qRT-PCR for frataxin protein and mRNA quantification. We used atomic absorption spectrophotometry for iron levels and a photometric assay for hemoglobin levels. Protoporphyrin IX and Ferrochelatase were analyzed using auto-fluorescence. An "IronChip" microarray analysis followed by a protein-protein interaction analysis was performed. FRDA patient cells showed no significant changes in iron levels, hemoglobin synthesis, protoporphyrin IX levels, and ferrochelatase activity. Microarray analysis presented 11 genes that were significantly changed in all patients compared to controls. The genes are especially involved in oxidative stress, iron homeostasis and angiogenesis. The mystery about the involvement of frataxin on iron metabolism raises the question why frataxin deficiency in primary FRDA cells did not lead to changes in biochemical parameters of heme synthesis. It seems that alternative pathways can circumvent the impact of frataxin deficiency on heme synthesis. We show for the first time in primary FRDA patient cells that reduced frataxin levels are still sufficient for heme synthesis and possibly other mechanisms can overcome reduced frataxin levels in this process. Our data strongly support the fact that so far no anemia in FRDA patients was reported. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. The glucocorticoid receptor cooperates with the erythropoietin receptor and c-Kit to enhance and sustain proliferation of erythroid progenitors in vitro

    NARCIS (Netherlands)

    von Lindern, M.; Zauner, W.; Mellitzer, G.; Steinlein, P.; Fritsch, G.; Huber, K.; Löwenberg, B.; Beug, H.

    1999-01-01

    Although erythropoietin (Epo) is essential for the production of mature red blood cells, the cooperation with other factors is required for a proper balance between progenitor proliferation and differentiation. In avian erythroid progenitors, steroid hormones cooperate with tyrosine kinase receptors

  9. Parvovirus B19 integration into human CD36+ erythroid progenitor cells.

    Science.gov (United States)

    Janovitz, Tyler; Wong, Susan; Young, Neal S; Oliveira, Thiago; Falck-Pedersen, Erik

    2017-11-01

    The pathogenic autonomous human parvovirus B19 (B19V) productively infects erythroid progenitor cells (EPCs). Functional similarities between B19V nonstructural protein (NS1), a DNA binding endonuclease, and the Rep proteins of Adeno-Associated Virus (AAV) led us to hypothesize that NS1 may facilitate targeted nicking of the human genome and B19 vDNA integration. We adapted an integration capture sequencing protocol (IC-Seq) to screen B19V infected human CD36+ EPCs for viral integrants, and discovered 40,000 unique B19V integration events distributed throughout the human genome. Computational analysis of integration patterns revealed strong correlations with gene intronic regions, H3K9me3 sites, and the identification of 41 base pair consensus sequence with an octanucleotide core motif. The octanucleotide core has homology to a single region of B19V, adjacent to the P6 promoter TATA box. We present the first direct evidence that B19V infection of erythroid progenitor cells disrupts the human genome and facilitates viral DNA integration. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Enhanced inhibition of parvovirus B19 replication by cidofovir in extendedly exposed erythroid progenitor cells.

    Science.gov (United States)

    Bonvicini, Francesca; Bua, Gloria; Manaresi, Elisabetta; Gallinella, Giorgio

    2016-07-15

    Human parvovirus B19 (B19V) commonly induces self-limiting infections but can also cause severe clinical manifestations in patients with underlying haematological disorders or with immune system deficits. Currently, therapeutic options for B19V entirely rely on symptomatic and supportive treatments since a specific antiviral therapy is not yet available. Recently a first step in the research for active compounds inhibiting B19V replication has allowed identifying the acyclic nucleoside phosphonate cidofovir (CDV). Herein, the effect of CDV against B19V replication was characterized in human erythroid progenitor cells (EPCs) cultured and infected following different experimental approaches to replicate in vitro the infection of an expanding erythroid cell population in the bone marrow. B19V replication was selectively inhibited both in infected EPCs extendedly exposed to CDV 500μM (viral inhibition 82%) and in serially infected EPCs cultures with passage of the virus progeny, constantly under drug exposure (viral inhibition 99%). In addition, a potent inhibitory effect against B19V (viral inhibition 92%) was assessed in a short-term infection of EPCs treated with CDV 500μM 1day before viral infection. In the evaluated experimental conditions, the enhanced effect of CDV against B19V might be ascribed both to the increased intracellular drug concentration achieved by extended exposure, and to a progressive reduction in efficiency of the replicative process within treated EPCs population. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Leukemic transformation of normal murine erythroid progenitors: v- and c-ErbB act through signaling pathways activated by the EpoR and c-Kit in stress erythropoiesis

    NARCIS (Netherlands)

    von Lindern, M.; Deiner, E. M.; Dolznig, H.; Parren-van Amelsvoort, M.; Hayman, M. J.; Mullner, E. W.; Beug, H.

    2001-01-01

    Primary erythroid progenitors can be expanded by the synergistic action of erythropoietin (Epo), stem cell factor (SCF) and glucocorticoids. While Epo is required for erythropoiesis in general, glucocorticoids and SCF mainly contribute to stress erythropoiesis in hypoxic mice. This ability of normal

  12. Phosphorylated STAT5 directly facilitates parvovirus B19 DNA replication in human erythroid progenitors through interaction with the MCM complex.

    Science.gov (United States)

    Ganaie, Safder S; Zou, Wei; Xu, Peng; Deng, Xuefeng; Kleiboeker, Steve; Qiu, Jianming

    2017-05-01

    Productive infection of human parvovirus B19 (B19V) exhibits high tropism for burst forming unit erythroid (BFU-E) and colony forming unit erythroid (CFU-E) progenitor cells in human bone marrow and fetal liver. This exclusive restriction of the virus replication to human erythroid progenitor cells is partly due to the intracellular factors that are essential for viral DNA replication, including erythropoietin signaling. Efficient B19V replication also requires hypoxic conditions, which upregulate the signal transducer and activator of transcription 5 (STAT5) pathway, and phosphorylated STAT5 is essential for virus replication. In this study, our results revealed direct involvement of STAT5 in B19V DNA replication. Consensus STAT5-binding elements were identified adjacent to the NS1-binding element within the minimal origins of viral DNA replication in the B19V genome. Phosphorylated STAT5 specifically interacted with viral DNA replication origins both in vivo and in vitro, and was actively recruited within the viral DNA replication centers. Notably, STAT5 interacted with minichromosome maintenance (MCM) complex, suggesting that STAT5 directly facilitates viral DNA replication by recruiting the helicase complex of the cellular DNA replication machinery to viral DNA replication centers. The FDA-approved drug pimozide dephosphorylates STAT5, and it inhibited B19V replication in ex vivo expanded human erythroid progenitors. Our results demonstrated that pimozide could be a promising antiviral drug for treatment of B19V-related diseases.

  13. Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells.

    Directory of Open Access Journals (Sweden)

    Gloria Bua

    Full Text Available The pathogenic Parvovirus B19 (B19V is characterized by a strict adaptation to erythroid progenitor cells (EPCs, a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi and lower levels at day 18 (+1.5 Log from 2 to 48 hpi. B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18. Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6-15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage.

  14. Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells

    Science.gov (United States)

    Bua, Gloria; Manaresi, Elisabetta; Bonvicini, Francesca; Gallinella, Giorgio

    2016-01-01

    The pathogenic Parvovirus B19 (B19V) is characterized by a strict adaptation to erythroid progenitor cells (EPCs), a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi) and lower levels at day 18 (+1.5 Log from 2 to 48 hpi). B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18). Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6–15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage. PMID:26845771

  15. Sustained enhancement of OCTN1 transporter expression in association with hydroxyurea induced gamma-globin expression in erythroid progenitors

    OpenAIRE

    Walker, Aisha L.; Ofori-Acquah, Solomon

    2016-01-01

    The clinical benefits of hydroxyurea treatment in patients with sickle cell disease (SCD) are due largely to increased gamma-globin expression. However, mechanisms that control gamma-globin expression by hydroxyurea in erythroid progenitors are incompletely understood. Here, we investigated the role of two hydroxyurea transporters, urea transporter B (UTB) and organic cation/carnitine transporter 1 (OCTN1), in this process. Endogenous expression of both transporters peaked towards the end of ...

  16. CTCF and CohesinSA-1 Mark Active Promoters and Boundaries of Repressive Chromatin Domains in Primary Human Erythroid Cells.

    Directory of Open Access Journals (Sweden)

    Laurie A Steiner

    Full Text Available CTCF and cohesinSA-1 are regulatory proteins involved in a number of critical cellular processes including transcription, maintenance of chromatin domain architecture, and insulator function. To assess changes in the CTCF and cohesinSA-1 interactomes during erythropoiesis, chromatin immunoprecipitation coupled with high throughput sequencing and mRNA transcriptome analyses via RNA-seq were performed in primary human hematopoietic stem and progenitor cells (HSPC and primary human erythroid cells from single donors.Sites of CTCF and cohesinSA-1 co-occupancy were enriched in gene promoters in HSPC and erythroid cells compared to single CTCF or cohesin sites. Cell type-specific CTCF sites in erythroid cells were linked to highly expressed genes, with the opposite pattern observed in HSPCs. Chromatin domains were identified by ChIP-seq with antibodies against trimethylated lysine 27 histone H3, a modification associated with repressive chromatin. Repressive chromatin domains increased in both number and size during hematopoiesis, with many more repressive domains in erythroid cells than HSPCs. CTCF and cohesinSA-1 marked the boundaries of these repressive chromatin domains in a cell-type specific manner.These genome wide data, changes in sites of protein occupancy, chromatin architecture, and related gene expression, support the hypothesis that CTCF and cohesinSA-1 have multiple roles in the regulation of gene expression during erythropoiesis including transcriptional regulation at gene promoters and maintenance of chromatin architecture. These data from primary human erythroid cells provide a resource for studies of normal and perturbed erythropoiesis.

  17. A hanging drop culture method to study terminal erythroid differentiation.

    Science.gov (United States)

    Gutiérrez, Laura; Lindeboom, Fokke; Ferreira, Rita; Drissen, Roy; Grosveld, Frank; Whyatt, David; Philipsen, Sjaak

    2005-10-01

    To design a culture method allowing the quantitative and qualitative analysis of terminal erythroid differentiation. Primary erythroid progenitors derived either from mouse tissues or from human umbilical cord blood were differentiated using hanging drop cultures and compared to methylcellulose cultures. Cultured cells were analyzed by FACS to assess differentiation. We describe a practical culture method by adapting the previously described hanging drop culture system to conditions allowing terminal differentiation of primary erythroid progenitors. Using minimal volumes of media and small numbers of cells, we obtained quantitative terminal erythroid differentiation within two days of culture in the case of murine cells and 4 days in the case of human cells. The established methods for ex vivo culture of primary erythroid progenitors, such as methylcellulose-based burst-forming unit-erythroid (BFU-E) and colony-forming unit-erythroid (CFU-E) assays, allow the detection of committed erythroid progenitors but are of limited value to study terminal erythroid differentiation. We show that the application of hanging drop cultures is a practical alternative that, in combination with clonogenic assays, enables a comprehensive assessment of the behavior of primary erythroid cells ex vivo in the context of genetic and drug-induced perturbations.

  18. The negative impact of Wnt signaling on megakaryocyte and primitive erythroid progenitors derived from human embryonic stem cells

    Directory of Open Access Journals (Sweden)

    Prasuna Paluru

    2014-03-01

    Full Text Available The Wnt gene family consists of structurally related genes encoding secreted signaling molecules that have been implicated in many developmental processes, including regulation of cell fate and patterning during embryogenesis. Previously, we found that Wnt signaling is required for primitive or yolk sac-derived-erythropoiesis using the murine embryonic stem cell (ESC system. Here, we examine the effect of Wnt signaling on the formation of early hematopoietic progenitors derived from human ESCs. The first hematopoietic progenitor cells in the human ESC system express the pan-hematopoietic marker CD41 and the erythrocyte marker, glycophorin A or CD235. We have developed a novel serum-free, feeder-free, adherent differentiation system that can efficiently generate large numbers of CD41 + CD235+ cells. We demonstrate that this cell population contains progenitors not just for primitive erythroid and megakaryocyte cells but for the myeloid lineage as well and term this population the primitive common myeloid progenitor (CMP. Treatment of mesoderm-specified cells with Wnt3a led to a loss of hematopoietic colony-forming ability while the inhibition of canonical Wnt signaling with DKK1 led to an increase in the number of primitive CMPs. Canonical Wnt signaling also inhibits the expansion and/or survival of primitive erythrocytes and megakaryocytes, but not myeloid cells, derived from this progenitor population. These findings are in contrast to the role of Wnt signaling during mouse ESC differentiation and demonstrate the importance of the human ESC system in studying species-specific differences in development.

  19. Identification of a human erythroid progenitor cell population which expresses the CD34 antigen and binds the plant lectin Ulex europaeus I.

    Science.gov (United States)

    Unverzagt, K L; Martinson, J; Lee, W; Stiff, P J; Williams, S; Bender, J G

    1996-01-01

    Two and three color flow cytometry of normal human bone marrow was used to identify CD34+ progenitor cells and examine their binding to the plant lectin Ulex europaeus I (Ulex). In normal bone marrow, 48.48 +/- 17.4% of the CD34+ cells bind to Ulex. Two color flow cytometry was used to sort CD34 + cells, and subsets of CD34+ cells, CD34+ Ulex+ and CD34+ Ulex-. These populations were sorted into colony assays to assess myeloid (CFU-GM) and erythroid (BFU-E) progenitors. The CD34+ Ulex+ subset was 84 +/- 14% BFU-E colonies (mean +/- S.D.) and had the highest cloning efficiency of 28 +/- 13%. Three color analysis of CD34+ Ulex+ cells showed staining with other erythroid (CD71, GlyA) antibodies and lack of stain. ing with myeloid (CD13, CD45RA) antibodies. These studies confirmed the erythroid characteristics of this subpopulation.

  20. Tyrosine kinase receptor RON functions downstream of the erythropoietin receptor to induce expansion of erythroid progenitors

    NARCIS (Netherlands)

    van den Akker, Emile; van Dijk, Thamar; Parren-van Amelsvoort, Martine; Grossmann, Katja S.; Schaeper, Ute; Toney-Earley, Kenya; Waltz, Susan E.; Löwenberg, Bob; von Lindern, Marieke

    2004-01-01

    Erythropoietin (EPO) is required for cell survival during differentiation and for progenitor expansion during stress erythropoiesis. Although signaling pathways may couple directly to docking sites on the EPO receptor (EpoR), additional docking molecules expand the signaling platform of the

  1. Extended flow cytometry characterization of normal bone marrow progenitor cells by simultaneous detection of aldehyde dehydrogenase and early hematopoietic antigens: implication for erythroid differentiation studies

    Directory of Open Access Journals (Sweden)

    Pascariello Caterina

    2008-05-01

    Full Text Available Abstract Background Aldehyde dehydrogenase (ALDH is a cytosolic enzyme highly expressed in hematopoietic precursors from cord blood and granulocyte-colony stimulating factor mobilized peripheral blood, as well as in bone marrow from patients with acute myeloblastic leukemia. As regards human normal bone marrow, detailed characterization of ALDH+ cells has been addressed by one single study (Gentry et al, 2007. The goal of our work was to provide new information about the dissection of normal bone marrow progenitor cells based upon the simultaneous detection by flow cytometry of ALDH and early hematopoietic antigens, with particular attention to the expression of ALDH on erythroid precursors. To this aim, we used three kinds of approach: i multidimensional analytical flow cytometry, detecting ALDH and early hematopoietic antigens in normal bone marrow; ii fluorescence activated cell sorting of distinct subpopulations of progenitor cells, followed by in vitro induction of erythroid differentiation; iii detection of ALDH+ cellular subsets in bone marrow from pure red cell aplasia patients. Results In normal bone marrow, we identified three populations of cells, namely ALDH+CD34+, ALDH-CD34+ and ALDH+CD34- (median percentages were 0.52, 0.53 and 0.57, respectively. As compared to ALDH-CD34+ cells, ALDH+CD34+ cells expressed the phenotypic profile of primitive hematopoietic progenitor cells, with brighter expression of CD117 and CD133, accompanied by lower display of CD38 and CD45RA. Of interest, ALDH+CD34- population disclosed a straightforward erythroid commitment, on the basis of three orders of evidences. First of all, ALDH+CD34- cells showed a CD71bright, CD105+, CD45- phenotype. Secondly, induction of differentiation experiments evidenced a clear-cut expression of glycophorin A (CD235a. Finally, ALDH+CD34- precursors were not detectable in patients with pure red cell aplasia (PRCA. Conclusion Our study, comparing surface antigen expression of

  2. Antisense myb inhibition of purified erythroid progenitors in development and differentiation is linked to cycling activity and expression of DNA polymerase alpha

    International Nuclear Information System (INIS)

    Valtieri, M.; Venturelli, D.; Care, A.; Fossati, C.; Pelosi, E.; Labbaye, C.; Mattia, G.; Gewirtz, A.M.; Calabretta, B.; Peschle, C.

    1991-01-01

    These studies aimed to determine the expression and functional role of c-myb in erythroid progenitors with different cycling activities. In the first series of experiments the erythroid burst-forming unit (BFU-E) and colony-forming unit (CFU-E) populations from adult peripheral blood (PB), bone marrow (BM), and embryonic-fetal liver (FL) were treated with either c-myb antisense oligomers or 3H-thymidine (3H-TdR). A direct correlation was always observed between the inhibitory effect of anti-myb oligomers and the level of cycling activity. Thus, the inhibitory effect of antisense c-myb on the number of BFU-E colonies was 28.3% +/- 15.8% in PB, 53.4% +/- 9.3% in BM, and 68.2% +/- 24.5% in FL. Both adult and embryonic CFU-E were markedly inhibited. Using purified PB progenitors, we observed a similar pattern, although with slightly lower inhibitory effects. In the 3H-TdR suicide assay the killing index of BFU-E was 8.9% +/- 4.2% in PB, 29.4% +/- 6.5% in BM, and 40.1% +/- 9.6% in FL. The values for adult and embryonic CFU-E were 55.7% +/- 7.9% and 60.98% +/- 6.6%, respectively. We then investigated the kinetics of c-myb mRNA level during the erythroid differentiation of purified adult PB and FL BFU-E, as evaluated in liquid-phase culture by reverse transcription-polymerase chain reaction. Adult erythroid precursors showed a gradual increase of c-myb mRNA from day 4 through day 8 of culture and a sharp decrease at later times, whereas the expression of c-myb mRNA and protein in differentiation embryonic precursors peaked 2 days earlier. In both cases, c-myb mRNA level peaked at the CFU-E stage of differentiation. Finally, highly purified adult PB BFU-E were stimulated into cycling by a 3-day treatment with interleukin-3 in liquid phase: both the sensitivity to c-myb antisense oligomers and the 3H-TdR suicide index showed a gradual, strictly parallel increase

  3. A novel way to induce erythroid progenitor self renewal: cooperation of c-Kit with the erythropoietin receptor

    NARCIS (Netherlands)

    Wessely, O.; Bauer, A.; Quang, C. T.; Deiner, E. M.; von Lindern, M.; Mellitzer, G.; Steinlein, P.; Ghysdael, J.; Beug, H.

    1999-01-01

    Red blood cells are of vital importance for oxygen transport in vertebrates. Thus, their formation during development and homeostasis requires tight control of both progenitor proliferation and terminal red cell differentiation. Self renewal (i.e. long-term proliferation without differentiation) of

  4. Eto2/MTG16 and MTGR1 are heteromeric corepressors of the TAL1/SCL transcription factor in murine erythroid progenitors

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Ying; Xu, Zhixiong; Xie, Jingping [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Ham, Amy-Joan L. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Koury, Mark J. [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States); Hiebert, Scott W. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Brandt, Stephen J., E-mail: stephen.brandt@vanderbilt.edu [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cell and Developmental Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States)

    2009-12-11

    The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.

  5. Eto2/MTG16 and MTGR1 are heteromeric corepressors of the TAL1/SCL transcription factor in murine erythroid progenitors

    International Nuclear Information System (INIS)

    Cai, Ying; Xu, Zhixiong; Xie, Jingping; Ham, Amy-Joan L.; Koury, Mark J.; Hiebert, Scott W.; Brandt, Stephen J.

    2009-01-01

    The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.

  6. Identification of Cell Type-Specific Differences in Erythropoietin Receptor Signaling in Primary Erythroid and Lung Cancer Cells.

    Directory of Open Access Journals (Sweden)

    Ruth Merkle

    2016-08-01

    Full Text Available Lung cancer, with its most prevalent form non-small-cell lung carcinoma (NSCLC, is one of the leading causes of cancer-related deaths worldwide, and is commonly treated with chemotherapeutic drugs such as cisplatin. Lung cancer patients frequently suffer from chemotherapy-induced anemia, which can be treated with erythropoietin (EPO. However, studies have indicated that EPO not only promotes erythropoiesis in hematopoietic cells, but may also enhance survival of NSCLC cells. Here, we verified that the NSCLC cell line H838 expresses functional erythropoietin receptors (EPOR and that treatment with EPO reduces cisplatin-induced apoptosis. To pinpoint differences in EPO-induced survival signaling in erythroid progenitor cells (CFU-E, colony forming unit-erythroid and H838 cells, we combined mathematical modeling with a method for feature selection, the L1 regularization. Utilizing an example model and simulated data, we demonstrated that this approach enables the accurate identification and quantification of cell type-specific parameters. We applied our strategy to quantitative time-resolved data of EPO-induced JAK/STAT signaling generated by quantitative immunoblotting, mass spectrometry and quantitative real-time PCR (qRT-PCR in CFU-E and H838 cells as well as H838 cells overexpressing human EPOR (H838-HA-hEPOR. The established parsimonious mathematical model was able to simultaneously describe the data sets of CFU-E, H838 and H838-HA-hEPOR cells. Seven cell type-specific parameters were identified that included for example parameters for nuclear translocation of STAT5 and target gene induction. Cell type-specific differences in target gene induction were experimentally validated by qRT-PCR experiments. The systematic identification of pathway differences and sensitivities of EPOR signaling in CFU-E and H838 cells revealed potential targets for intervention to selectively inhibit EPO-induced signaling in the tumor cells but leave the responses in

  7. Human primary erythroid cells as a more sensitive alternative in vitro hematological model for nanotoxicity studies: Toxicological effects of silver nanoparticles.

    Science.gov (United States)

    Rujanapun, Narawadee; Aueviriyavit, Sasitorn; Boonrungsiman, Suwimon; Rosena, Apiwan; Phummiratch, Duangkamol; Riolueang, Suchada; Chalaow, Nipon; Viprakasit, Vip; Maniratanachote, Rawiwan

    2015-12-01

    Although immortalized cells established from cancerous cells have been widely used for studies in nanotoxicology studies, the reliability of the results derived from immortalized cells has been questioned because of their different characteristics from normal cells. In the present study, human primary erythroid cells in liquid culture were used as an in vitro hematological cell model for investigation of the nanotoxicity of silver nanoparticles (AgNPs) and comparing the results to the immortalized hematological cell lines HL60 and K562. The AgNPs caused significant cytotoxic effects in the primary erythroid cells, as shown by the decreased cell viability and induction of intracellular ROS generation and apoptosis, whereas they showed much lower cytotoxic and apoptotic effects in HL60 and K562 cells and did not induced ROS generation in these cell lines. Scanning electron microcopy revealed an interaction of AgNPs to the cell membrane in both primary erythroid and immortalized cells. In addition, AgNPs induced hemolysis in the primary erythroid cells in a dose-dependent manner, and transmission electron microcopy analysis revealed that AgNPs damaged the erythroid cell membrane. Taken together, these results suggest that human primary erythroid cells in liquid culture are a more sensitive alternative in vitro hematological model for nanotoxicology studies. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Kinetics of granulocytic and erythroid progenitor cells are affected differently by short-term, low-level benzene exposure

    Energy Technology Data Exchange (ETDEWEB)

    Dempster, A.M.; Snyder, C.A. (New York Univ. Medical Center, NY (United States). Inst. of Environmental Medicine)

    1991-09-01

    Mice were exposed to either air or 10 ppm benzene for 6 h/d X 5 d. Immediately after the last exposure, mice were injected, i.v., with either saline or hydroxyurea (HU). The dose of HU was sufficient to kill hematopoietic cells in or near S-phase of the cell cycle and sufficient to synchronize the surviving populations of hematopoietic cells. Three days after benzene exposure, CFU-E numbers had declined to 50% of control values while CFU-GM numbers were equal to control values at this time. The benzene exposures were sufficient to double the percentage of CFU-E in S-phase but produced no such increase among CFU-Gm. During 3 days of recovery from benzene exposure and HU treatment, the CFU-E population expanded 30-fold while the CFU-GM population expanded less than 3-fold. Following benzene exposure and HU treatment, both progenitor cells produced elevated numbers of their respective progeny. When CFU-E from benzene-exposed mice were cultured with varying concentrations of erythropoietin (EPO), the response at maximal EPO concentration was 66% of the response by control CFU-E. This strongly suggests that the CFU-E populations from benzene-exposed mice had been depleted of cells in or near S-phase. The results indicate that CFU-GM respond to low-level benzene exposure by increasing their rate of differentiation but not their rate of proliferation, while CFU-E respond by increasing both their rates of differentiation and proliferation. We speculate that it is the increase in CFU-E proliferation that renders these cells more susceptible to benzene than their granulocytic counterparts, especially those CFU-E at or near the S-phase of the cell cycle. (orig.).

  9. Activated Fps/Fes tyrosine kinase regulates erythroid differentiation and survival.

    Science.gov (United States)

    Sangrar, Waheed; Gao, Yan; Bates, Barbara; Zirngibl, Ralph; Greer, Peter A

    2004-10-01

    A substantial body of evidence implicates the cytoplasmic protein tyrosine kinase Fps/Fes in regulation of myeloid differentiation and survival. In this study we wished to determine if Fps/Fes also plays a role in the regulation of erythropoiesis. Mice tissue-specifically expressing a "gain-of-function" mutant fps/fes transgene (fps(MF)) encoding an activated variant of Fps/Fes (MFps), were used to explore the in vivo biological role of Fps/Fes. Erythropoiesis in these mice was assessed by hematological analysis, lineage marker analysis, bone-marrow colony assays, and biochemical approaches. fps(MF) mice displayed reductions in peripheral red cell counts. However, there was an accumulation of immature erythroid precursors, which displayed increased survival. Fps/Fes and the related Fer kinase were both detected in early erythroid progenitors/blasts and in mature red cells. Fps/Fes was also activated in response to erythropoietin (EPO) and stem cell factor (SCF), two critical factors in erythroid development. In addition, increased Stat5A/B activation and reduced Erk1/2 phosphorylation was observed in fps(MF) primary erythroid cells in response to EPO or SCF, respectively. These data support a role for Fps/Fes in regulating the survival and differentiation of erythroid cells through modulation of Stat5A/B and Erk kinase pathways induced by EPO and SCF. The increased numbers and survival of erythroid progenitors from fps(MF) mice, and their differential responsiveness to SCF and EPO, implicates Fps/Fes in the commitment of multilineage progenitors to the erythroid lineage. The anemic phenotype in fps(MF) mice suggests that downregulation of Fps/Fes activity might be required for terminal erythroid differentiation.

  10. Synergistic Effect of Sodium Butyrate and Thalidomide in the Induction of Fetal Hemoglobin Expression in Erythroid Progenitors Derived from Cord Blood CD133 + Cells

    Directory of Open Access Journals (Sweden)

    Ali Dehghanifard

    2012-07-01

    Full Text Available Background: The use of drugs with the ability to induce production of fetal hemoglobin as a novel therapeutic approach in treating β-Hemoglobinopathies is considered. γ-globin gene expression inducer drugs including sodium butyrate and thalidomide can reduce additional α-globin chains accumulation in erythroid precursors. Materials and Methods: In this experimental study, MACS kit was used to isolate CD133+ cells of umbilical cord blood. Further, the effect of two drugs of thalidomide and sodium butyrate were separately and combined studied on the induction of quantitative expression of β-globin and γ-globin genes in erythroid precursor cells derived from CD133+ stem cells in-vitro. For this purpose, the technique SYBR green Real-time PCR was used.Results: Flow cytometry results showed that approximately 95% of purified cells were CD133+. Real-time PCR results also showed the increased levels of γ-globin mRNA in the cell groups treated with thalidomide, sodium butyrate and combination of drugs as 2.6 and 1.2 and 3.5 times respectively, and for β-globin gene, it is respectively 1.4 and 1.3 and 1.6 times compared with the control group (p<0.05.Conclusion: The study results showed that the mentioned drug combination can act as a pharmaceutical composition affecting the induction of fetal hemoglobin expression in erythroid precursor cells derived from CD133 + cells.

  11. Natural killer cells recognize friend retrovirus-infected erythroid progenitor cells through NKG2D-RAE-1 interactions In Vivo.

    Science.gov (United States)

    Ogawa, Tatsuya; Tsuji-Kawahara, Sachiyo; Yuasa, Takae; Kinoshita, Saori; Chikaishi, Tomomi; Takamura, Shiki; Matsumura, Haruo; Seya, Tsukasa; Saga, Toshihiko; Miyazawa, Masaaki

    2011-06-01

    Natural killer (NK) cells function as early effector cells in the innate immune defense against viral infections and also participate in the regulation of normal and malignant hematopoiesis. NK cell activities have been associated with early clearance of viremia in experimental simian immunodeficiency virus and clinical human immunodeficiency virus type 1 (HIV-1) infections. We have previously shown that NK cells function as major cytotoxic effector cells in vaccine-induced immune protection against Friend virus (FV)-induced leukemia, and NK cell depletion totally abrogates the above protective immunity. However, how NK cells recognize retrovirus-infected cells remains largely unclear. The present study demonstrates a correlation between the expression of the products of retinoic acid early transcript-1 (RAE-1) genes in target cells and their susceptibility to killing by NK cells isolated from FV-infected animals. This killing was abrogated by antibodies blocking the NKG2D receptor in vitro. Further, the expression of RAE-1 proteins on erythroblast surfaces increased early after FV inoculation, and administration of an RAE-1-blocking antibody resulted in increased spleen infectious centers and exaggerated pathology, indicating that FV-infected erythroid cells are recognized by NK cells mainly through the NKG2D-RAE-1 interactions in vivo. Enhanced retroviral replication due to host gene-targeting resulted in markedly increased RAE-1 expression in the absence of massive erythroid cell proliferation, indicating a direct role of retroviral replication in RAE-1 upregulation.

  12. DJ-1 Modulates Nuclear Erythroid 2-Related Factor-2-Mediated Protection in Human Primary Alveolar Type II Cells in Smokers.

    Science.gov (United States)

    Bahmed, Karim; Messier, Elise M; Zhou, Wenbo; Tuder, Rubin M; Freed, Curt R; Chu, Hong Wei; Kelsen, Steven G; Bowler, Russell P; Mason, Robert J; Kosmider, Beata

    2016-09-01

    Cigarette smoke (CS) is a main source of oxidative stress and a key risk factor for emphysema, which consists of alveolar wall destruction. Alveolar type (AT) II cells are in the gas exchange regions of the lung. We isolated primary ATII cells from deidentified organ donors whose lungs were not suitable for transplantation. We analyzed the cell injury obtained from nonsmokers, moderate smokers, and heavy smokers. DJ-1 protects cells from oxidative stress and induces nuclear erythroid 2-related factor-2 (Nrf2) expression, which activates the antioxidant defense system. In ATII cells isolated from moderate smokers, we found DJ-1 expression by RT-PCR, and Nrf2 and heme oxygenase (HO)-1 translocation by Western blotting and immunocytofluorescence. In ATII cells isolated from heavy smokers, we detected Nrf2 and HO-1 cytoplasmic localization. Moreover, we found high oxidative stress, as detected by 4-hydroxynonenal (4-HNE) (immunoblotting), inflammation by IL-8 and IL-6 levels by ELISA, and apoptosis by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay in ATII cells obtained from heavy smokers. Furthermore, we detected early DJ-1 and late Nrf2 expression after ATII cell treatment with CS extract. We also overexpressed DJ-1 by adenovirus construct and found that this restored Nrf2 and HO-1 expression and induced nuclear translocation in heavy smokers. Moreover, DJ-1 overexpression also decreased ATII cell apoptosis caused by CS extract in vitro. Our results indicate that DJ-1 activates the Nrf2-mediated antioxidant defense system. Furthermore, DJ-1 overexpression can restore the impaired Nrf2 pathway, leading to ATII cell protection in heavy smokers. This suggests a potential therapeutic strategy for targeting DJ-1 in CS-related lung diseases.

  13. Recombinant human parvovirus B19 vectors: erythroid cell-specific delivery and expression of transduced genes.

    Science.gov (United States)

    Ponnazhagan, S; Weigel, K A; Raikwar, S P; Mukherjee, P; Yoder, M C; Srivastava, A

    1998-06-01

    A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562-566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111-1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited and

  14. Recombinant Human Parvovirus B19 Vectors: Erythroid Cell-Specific Delivery and Expression of Transduced Genes

    Science.gov (United States)

    Ponnazhagan, Selvarangan; Weigel, Kirsten A.; Raikwar, Sudhanshu P.; Mukherjee, Pinku; Yoder, Mervin C.; Srivastava, Arun

    1998-01-01

    A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562–566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111–1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited

  15. An imbalance in progenitor cell populations reflects tumour progression in breast cancer primary culture models

    LENUS (Irish Health Repository)

    Donatello, Simona

    2011-04-26

    Abstract Background Many factors influence breast cancer progression, including the ability of progenitor cells to sustain or increase net tumour cell numbers. Our aim was to define whether alterations in putative progenitor populations could predict clinicopathological factors of prognostic importance for cancer progression. Methods Primary cultures were established from human breast tumour and adjacent non-tumour tissue. Putative progenitor cell populations were isolated based on co-expression or concomitant absence of the epithelial and myoepithelial markers EPCAM and CALLA respectively. Results Significant reductions in cellular senescence were observed in tumour versus non-tumour cultures, accompanied by a stepwise increase in proliferation:senescence ratios. A novel correlation between tumour aggressiveness and an imbalance of putative progenitor subpopulations was also observed. Specifically, an increased double-negative (DN) to double-positive (DP) ratio distinguished aggressive tumours of high grade, estrogen receptor-negativity or HER2-positivity. The DN:DP ratio was also higher in malignant MDA-MB-231 cells relative to non-tumourogenic MCF-10A cells. Ultrastructural analysis of the DN subpopulation in an invasive tumour culture revealed enrichment in lipofuscin bodies, markers of ageing or senescent cells. Conclusions Our results suggest that an imbalance in tumour progenitor subpopulations imbalances the functional relationship between proliferation and senescence, creating a microenvironment favouring tumour progression.

  16. Erythroid Kruppel-like factor (EKLF) is recruited to the γ-globin gene promoter as a co-activator and is required for γ-globin gene induction by short-chain fatty acid derivatives

    Science.gov (United States)

    Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.

    2011-01-01

    Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418

  17. Dedifferentiation of Human Primary Thyrocytes into Multilineage Progenitor Cells without Gene Introduction

    Science.gov (United States)

    Saenko, Vladimir; Suzuki, Masatoshi; Matsuse, Michiko; Ohtsuru, Akira; Kumagai, Atsushi; Uga, Tatsuya; Yano, Hiroshi; Nagayama, Yuji; Yamashita, Shunichi

    2011-01-01

    While identification and isolation of adult stem cells have potentially important implications, recent reports regarding dedifferentiation/reprogramming from differentiated cells have provided another clue to gain insight into source of tissue stem/progenitor cells. In this study, we developed a novel culture system to obtain dedifferentiated progenitor cells from normal human thyroid tissues. After enzymatic digestion, primary thyrocytes, expressing thyroglobulin, vimentin and cytokeratin-18, were cultured in a serum-free medium called SAGM. Although the vast majority of cells died, a small proportion (∼0.5%) survived and proliferated. During initial cell expansion, thyroglobulin/cytokeratin-18 expression was gradually declined in the proliferating cells. Moreover, sorted cells expressing thyroid peroxidase gave rise to proliferating clones in SAGM. These data suggest that those cells are derived from thyroid follicular cells or at least thyroid-committed cells. The SAGM-grown cells did not express any thyroid-specific genes. However, after four-week incubation with FBS and TSH, cytokeratin-18, thyroglobulin, TSH receptor, PAX8 and TTF1 expressions re-emerged. Moreover, surprisingly, the cells were capable of differentiating into neuronal or adipogenic lineage depending on differentiating conditions. In summary, we have developed a novel system to generate multilineage progenitor cells from normal human thyroid tissues. This seems to be achieved by dedifferentiation of thyroid follicular cells. The presently described culture system may be useful for regenerative medicine, but the primary importance will be as a tool to elucidate the mechanisms of thyroid diseases. PMID:21556376

  18. DJ-1 Modulates Nuclear Erythroid 2–Related Factor-2–Mediated Protection in Human Primary Alveolar Type II Cells in Smokers

    Science.gov (United States)

    Bahmed, Karim; Messier, Elise M.; Zhou, Wenbo; Tuder, Rubin M.; Freed, Curt R.; Chu, Hong Wei; Kelsen, Steven G.; Bowler, Russell P.; Mason, Robert J.

    2016-01-01

    Cigarette smoke (CS) is a main source of oxidative stress and a key risk factor for emphysema, which consists of alveolar wall destruction. Alveolar type (AT) II cells are in the gas exchange regions of the lung. We isolated primary ATII cells from deidentified organ donors whose lungs were not suitable for transplantation. We analyzed the cell injury obtained from nonsmokers, moderate smokers, and heavy smokers. DJ-1 protects cells from oxidative stress and induces nuclear erythroid 2–related factor-2 (Nrf2) expression, which activates the antioxidant defense system. In ATII cells isolated from moderate smokers, we found DJ-1 expression by RT-PCR, and Nrf2 and heme oxygenase (HO)-1 translocation by Western blotting and immunocytofluorescence. In ATII cells isolated from heavy smokers, we detected Nrf2 and HO-1 cytoplasmic localization. Moreover, we found high oxidative stress, as detected by 4-hydroxynonenal (4-HNE) (immunoblotting), inflammation by IL-8 and IL-6 levels by ELISA, and apoptosis by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay in ATII cells obtained from heavy smokers. Furthermore, we detected early DJ-1 and late Nrf2 expression after ATII cell treatment with CS extract. We also overexpressed DJ-1 by adenovirus construct and found that this restored Nrf2 and HO-1 expression and induced nuclear translocation in heavy smokers. Moreover, DJ-1 overexpression also decreased ATII cell apoptosis caused by CS extract in vitro. Our results indicate that DJ-1 activates the Nrf2-mediated antioxidant defense system. Furthermore, DJ-1 overexpression can restore the impaired Nrf2 pathway, leading to ATII cell protection in heavy smokers. This suggests a potential therapeutic strategy for targeting DJ-1 in CS-related lung diseases. PMID:27093578

  19. Hydroxymethylation at Gene Regulatory Regions Directs Stem/Early Progenitor Cell Commitment during Erythropoiesis

    Directory of Open Access Journals (Sweden)

    Jozef Madzo

    2014-01-01

    Full Text Available Hematopoietic stem cell differentiation involves the silencing of self-renewal genes and induction of a specific transcriptional program. Identification of multiple covalent cytosine modifications raises the question of how these derivatized bases influence stem cell commitment. Using a replicative primary human hematopoietic stem/progenitor cell differentiation system, we demonstrate dynamic changes of 5-hydroxymethylcytosine (5-hmC during stem cell commitment and differentiation to the erythroid lineage. Genomic loci that maintain or gain 5-hmC density throughout erythroid differentiation contain binding sites for erythroid transcription factors and several factors not previously recognized as erythroid-specific factors. The functional importance of 5-hmC was demonstrated by impaired erythroid differentiation, with augmentation of myeloid potential, and disrupted 5-hmC patterning in leukemia patient-derived CD34+ stem/early progenitor cells with TET methylcytosine dioxygenase 2 (TET2 mutations. Thus, chemical conjugation and affinity purification of 5-hmC-enriched sequences followed by sequencing serve as resources for deciphering functional implications for gene expression during stem cell commitment and differentiation along a particular lineage.

  20. Primary Culture of Choroid Plexuses from Neonate Rats Containing Progenitor Cells Capable of Differentiation

    Directory of Open Access Journals (Sweden)

    Sheng-Li Huang

    2013-12-01

    Full Text Available Background: The choroid plexuses, which could secrete a number of neurotrophins, have recently been used in transplantation in central nervous system diseases. Aims: To study the mechanism of nerve regeneration in the central nervous system by grafting choroid plexus tissues. Study Design: Animal experimentation. Methods: The choroid plexuses from the lateral ventricles of neonatal rats were cultured in adherent culture, and immunocytochemical methods were used to analyse the progenitor cells on days 2, 6, and 10 after seeding. Results: Expression of both nestin and glial fibrillary acidic protein was observed in small cell aggregates on day 2 in primary culture. Most of the nestin-positive cells on day 6 were immunoreactive to glial fibrillary acidic protein antibody. No cells expressing nestin or glial fibrillary acidic protein were seen on day 10. Conclusion: These experimental results indicate that the choroid plexus contains a specific cell population – progenitor cells. Under in vitro experimental conditions, the progenitor cells differentiated into choroid plexus epithelial cells but did not form neurons or astrocytes.

  1. Protein kinase Cɛ inhibition restores megakaryocytic differentiation of hematopoietic progenitors from primary myelofibrosis patients.

    Science.gov (United States)

    Masselli, E; Carubbi, C; Gobbi, G; Mirandola, P; Galli, D; Martini, S; Bonomini, S; Crugnola, M; Craviotto, L; Aversa, F; Vitale, M

    2015-11-01

    Among the three classic Philadelphia chromosome-negative myeloproliferative neoplasms, primary myelofibrosis (PMF) is the most severe in terms of disease biology, survival and quality of life. Abnormalities in the process of differentiation of PMF megakaryocytes (MKs) are a hallmark of the disease. Nevertheless, the molecular events that lead to aberrant megakaryocytopoiesis have yet to be clarified. Protein kinase Cɛ (PKCɛ) is a novel serine/threonine kinase that is overexpressed in a variety of cancers, promoting aggressive phenotype, invasiveness and drug resistance. Our previous findings on the role of PKCɛ in normal (erythroid and megakaryocytic commitment) and malignant (acute myeloid leukemia) hematopoiesis prompted us to investigate whether it could be involved in the pathogenesis of PMF MK-impaired differentiation. We demonstrate that PMF megakaryocytic cultures express higher levels of PKCɛ than healthy donors, which correlate with higher disease burden but not with JAK2V617F mutation. Inhibition of PKCɛ function (by a negative regulator of PKCɛ translocation) or translation (by target small hairpin RNA) leads to reduction in PMF cell growth, restoration of PMF MK differentiation and inhibition of PKCɛ-related anti-apoptotic signaling (Bcl-xL). Our data suggest that targeting PKCɛ directly affects the PMF neoplastic clone and represent a proof-of-concept for PKCɛ inhibition as a novel therapeutic strategy in PMF.

  2. A common signaling pathway is activated in erythroid cells expressing high levels of fetal hemoglobin: a potential role for cAMP-elevating agents in β-globin disorders

    Directory of Open Access Journals (Sweden)

    Ikuta T

    2013-12-01

    Full Text Available Tohru Ikuta,1 Yuichi Kuroyanagi,1 Nadine Odo,1 Siyang Liu21Department of Anesthesiology and Perioperative Medicine, 2Department of Physiology, Medical College of Georgia, Georgia Regents University, Augusta, GA, USABackground: Although erythroid cells prepared from fetal liver, cord blood, or blood from β-thalassemia patients are known to express fetal hemoglobin at high levels, the underlying mechanisms remain elusive. We previously showed that cyclic nucleotides such as cAMP and cGMP induce fetal hemoglobin expression in primary erythroid cells. Here we report that cAMP signaling contributes to high-level fetal hemoglobin expression in erythroid cells prepared from cord blood and β-thalassemia.Methods: The status of the cAMP signaling pathway was investigated using primary erythroid cells prepared from cord blood and the mononuclear cells of patients with β-thalassemia; erythroid cells from adult bone marrow mononuclear cells served as the control.Results: We found that intracellular cAMP levels were higher in erythroid cells from cord blood and β-thalassemia than from adult bone marrow. Protein kinase A activity levels and cAMP-response element binding protein phosphorylation were higher in erythroid cells from cord blood or β-thalassemia than in adult bone marrow progenitors. Mitogen-activated protein kinase pathways, which play a role in fetal hemoglobin expression, were not consistently activated in cord blood or β-thalassemia erythroid cells. When cAMP signaling was activated in adult erythroid cells, fetal hemoglobin was induced at high levels and associated with reduced expression of BCL11A, a silencer of the β-globin gene.Conclusion: These results suggest that activated cAMP signaling may be a common mechanism among erythroid cells with high fetal hemoglobin levels, in part because of downregulation of BCL11A. Activation of the cAMP signaling pathway with cAMP-elevating agents may prove to be an important signaling mechanism to

  3. Hemozoin (malarial pigment directly promotes apoptosis of erythroid precursors.

    Directory of Open Access Journals (Sweden)

    Abigail A Lamikanra

    2009-12-01

    Full Text Available Severe malarial anemia is the most common syndrome of severe malaria in endemic areas. The pathophysiology of chronic malaria is characterised by a striking degree of abnormal development of erythroid precursors (dyserythropoiesis and an inadequate erythropoietic response in spite of elevated levels of erythropoietin. The cause of dyserythropoiesis is unclear although it has been suggested that bone-marrow macrophages release cytokines, chemokines or lipo-peroxides after exposure to hemozoin, a crystalloid form of undigested heme moieties from malarial infected erythrocytes, and so inhibit erythropoiesis. However, we have previously shown that hemozoin may directly inhibit erythroid development in vitro and the levels of hemozoin in plasma from patients with malarial anemia and hemozoin within the bone marrow was associated with reduced reticulocyte response. We hypothesized that macrophages may reduce, not enhance, the inhibitory effect of hemozoin on erythropoiesis. In an in vitro model of erythropoiesis, we now show that inhibition of erythroid cell development by hemozoin isolated from P. falciparum is characterised by delayed expression of the erythroid markers and increased apoptosis of progenitor cells. Crucially, macrophages appear to protect erythroid cells from hemozoin, consistent with a direct contribution of hemozoin to the depression of reticulocyte output from the bone marrow in children with malarial anemia. Moreover, hemozoin isolated from P. falciparum in vitro inhibits erythroid development independently of inflammatory mediators by inducing apoptotic pathways that not only involve activation of caspase 8 and cleavage of caspase 3 but also loss of mitochondrial potential. Taken together these data are consistent with a direct effect of hemozoin in inducing apoptosis in developing erythroid cells in malarial anemia. Accumulation of hemozoin in the bone marrow could therefore result in inadequate reticulocytosis in children that

  4. An imbalance in progenitor cell populations reflects tumour progression in breast cancer primary culture models.

    LENUS (Irish Health Repository)

    Donatello, Simona

    2011-01-01

    Many factors influence breast cancer progression, including the ability of progenitor cells to sustain or increase net tumour cell numbers. Our aim was to define whether alterations in putative progenitor populations could predict clinicopathological factors of prognostic importance for cancer progression.

  5. Studies of globin gene expression in differentiating erythroid cells

    International Nuclear Information System (INIS)

    Sullivan, T.D.

    1985-01-01

    The author has addressed questions concerning globin gene expression and the loss of protein synthesis in the terminal stages of erythroid development. (1) The hypothesis that the rate of cell division affects the relative synthesis of γ and β globin in erythroid cells was investigated. The effect of hydroxyurea, aminopterin, or low culture temperature on the in vitro growth of erythroid progenitor cells and on the relative synthesis of γ and β globin was measured. No consistent change in γ globin synthesis was detected. (2) The hypothesis that the ratio of γ and β globin synthesis decreases during erythroid maturation because of differential mRNA stability was investigated. The half-lives of γ and β globin mRNAs and γ and β globin protein synthesis were measured in cultured reticulocytes. γ and β globin mRNAs were assayed by solution hybridization and by in vitro translation. Globin synthesis was determined by 3 H-leucine incorporation into the γ and β globin chains. γ and β globin mRNAs decay with similar half-lives in cultured reticulocytes. Therefore, the change in the ratio of γ and β globin synthesis during erythroid maturation cannot be explained by differences in mRNA stability and is likely to result from asynchronous transcription of the genes. These data suggest that protein synthesis in maturing reticulocytes is not limited by the quantity of mRNA but by the availability of translation factors. (3) The hypothesis was tested that the initiation factor GEF becomes limiting for protein synthesis during reticulocyte maturation

  6. Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis

    KAUST Repository

    Barbarani, Gloria; Ronchi, Antonella; Ruoppolo, Margherita; Santorelli, Lucia; Steinfelder, Robert; Elangovan, Sudharshan; Fugazza, Cristina; Caterino, Marianna

    2017-01-01

    are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark

  7. Drug discovery for Diamond-Blackfan anemia using reprogrammed hematopoietic progenitors

    Science.gov (United States)

    Doulatov, Sergei; Vo, Linda T.; Macari, Elizabeth R.; Wahlster, Lara; Kinney, Melissa A.; Taylor, Alison M.; Barragan, Jessica; Gupta, Manav; McGrath, Katherine; Lee, Hsiang-Ying; Humphries, Jessica M.; DeVine, Alex; Narla, Anupama; Alter, Blanche P.; Beggs, Alan H.; Agarwal, Suneet; Ebert, Benjamin L.; Gazda, Hanna T.; Lodish, Harvey F.; Sieff, Colin A.; Schlaeger, Thorsten M.; Zon, Leonard I.; Daley, George Q.

    2017-01-01

    Diamond-Blackfan anemia (DBA) is a congenital disorder characterized by the failure of erythroid progenitor differentiation, severely curtailing red blood cell production. Because many DBA patients fail to respond to corticosteroid therapy, there is considerable need for therapeutics for this disorder. Identifying therapeutics for DBA requires circumventing the paucity of primary patient blood stem and progenitor cells. To this end, we adopted a reprogramming strategy to generate expandable hematopoietic progenitor cells from induced pluripotent stem cells (iPSCs) from DBA patients. Reprogrammed DBA progenitors recapitulate defects in erythroid differentiation, which were rescued by gene complementation. Unbiased chemical screens identified SMER28, a small-molecule inducer of autophagy, which enhanced erythropoiesis in a range of in vitro and in vivo models of DBA. SMER28 acted through autophagy factor ATG5 to stimulate erythropoiesis and up-regulate expression of globin genes. These findings present an unbiased drug screen for hematological disease using iPSCs and identify autophagy as a therapeutic pathway in DBA. PMID:28179501

  8. Lenalidomide induces lipid raft assembly to enhance erythropoietin receptor signaling in myelodysplastic syndrome progenitors.

    Science.gov (United States)

    McGraw, Kathy L; Basiorka, Ashley A; Johnson, Joseph O; Clark, Justine; Caceres, Gisela; Padron, Eric; Heaton, Ruth; Ozawa, Yukiyasu; Wei, Sheng; Sokol, Lubomir; List, Alan F

    2014-01-01

    Anemia remains the principal management challenge for patients with lower risk Myelodysplastic Syndromes (MDS). Despite appropriate cytokine production and cellular receptor display, erythropoietin receptor (EpoR) signaling is impaired. We reported that EpoR signaling is dependent upon receptor localization within lipid raft microdomains, and that disruption of raft integrity abolishes signaling capacity. Here, we show that MDS erythroid progenitors display markedly diminished raft assembly and smaller raft aggregates compared to normal controls (p = 0.005, raft number; p = 0.023, raft size). Because lenalidomide triggers raft coalescence in T-lymphocytes promoting immune synapse formation, we assessed effects of lenalidomide on raft assembly in MDS erythroid precursors and UT7 cells. Lenalidomide treatment rapidly induced lipid raft formation accompanied by EpoR recruitment into raft fractions together with STAT5, JAK2, and Lyn kinase. The JAK2 phosphatase, CD45, a key negative regulator of EpoR signaling, was displaced from raft fractions. Lenalidomide treatment prior to Epo stimulation enhanced both JAK2 and STAT5 phosphorylation in UT7 and primary MDS erythroid progenitors, accompanied by increased STAT5 DNA binding in UT7 cells, and increased erythroid colony forming capacity in both UT7 and primary cells. Raft induction was associated with F-actin polymerization, which was blocked by Rho kinase inhibition. These data indicate that deficient raft integrity impairs EpoR signaling, and provides a novel strategy to enhance EpoR signal fidelity in non-del(5q) MDS.

  9. Serum-free Erythroid Differentiation for Efficient Genetic Modification and High-Level Adult Hemoglobin Production.

    Science.gov (United States)

    Uchida, Naoya; Demirci, Selami; Haro-Mora, Juan J; Fujita, Atsushi; Raines, Lydia N; Hsieh, Matthew M; Tisdale, John F

    2018-06-15

    In vitro erythroid differentiation from primary human cells is valuable to develop genetic strategies for hemoglobin disorders. However, current erythroid differentiation methods are encumbered by modest transduction rates and high baseline fetal hemoglobin production. In this study, we sought to improve both genetic modification and hemoglobin production among human erythroid cells in vitro . To model therapeutic strategies, we transduced human CD34 + cells and peripheral blood mononuclear cells (PBMCs) with lentiviral vectors and compared erythropoietin-based erythroid differentiation using fetal-bovine-serum-containing media and serum-free media. We observed more efficient transduction (85%-93%) in serum-free media than serum-containing media (20%-69%), whereas the addition of knockout serum replacement (KSR) was required for serum-free media to promote efficient erythroid differentiation (96%). High-level adult hemoglobin production detectable by electrophoresis was achieved using serum-free media similar to serum-containing media. Importantly, low fetal hemoglobin production was observed in the optimized serum-free media. Using KSR-containing, serum-free erythroid differentiation media, therapeutic adult hemoglobin production was detected at protein levels with β-globin lentiviral transduction in both CD34 + cells and PBMCs from sickle cell disease subjects. Our in vitro erythroid differentiation system provides a practical evaluation platform for adult hemoglobin production among human erythroid cells following genetic manipulation.

  10. Selective toxicity of dihydroartemisinin on human CD34+ erythroid cell differentiation

    International Nuclear Information System (INIS)

    Finaurini, Sara; Ronzoni, Luisa; Colancecco, Alessandra; Cattaneo, Alessandra; Cappellini, Maria Domenica; Ward, Stephen A.; Taramelli, Donatella

    2010-01-01

    Artemisinins are safely used in the combination therapy for uncomplicated malaria, but their employment during pregnancy is still controversial. In fact, animal studies reported that the active metabolite, dihydroartemisinin (DHA), causes embryonic erythrocytes depletion, when the treatment is performed during a critical period of time. The present study investigates the effect of DHA on human developmental erythropoiesis in order to characterize the target erythroid stage and to predict the window of susceptibility in human pregnancy. As a model for human developmental erythropoiesis, peripheral blood purified, CD34+ cells were committed towards erythrocytes and DHA (0.5 or 2 μM) was added to different erythroid stages during 14 days culture. Erythroid differentiation was investigated by cytofluorimetric analysis of Glycophorin A expression, by morphological analysis and erythroid globin gene expression analysis with real-time PCR. It was found that the effect of DHA was dependent on the maturation stage of erythroid cells. In fact when DHA was added to the pro- and basophilic erythroblasts caused a significant dose-dependent inhibition of cell proliferation and a significant delay of erythroid differentiation, as measured by morphological analysis, expression of Glycophorin A by immunofluorescence and of erythroid globin genes by real-time PCR. In contrast, the inhibition of stem cells and of early progenitors was transient and masked by the subsequent exponential cell growth. No effect was observed on mature erythroid stages. This is the first demonstration that DHA affects human erythropoiesis in vitro, in a dose- and time-dependent manner; the target population seems to be the pro-erythroblast and basophilic erythroblast stage, suggesting that DHA toxicity is limited to primitive human erythropoiesis. These findings outline the relevance of DHA dosage and timing to prevent embryotoxicity and support current WHO recommendations of avoiding malaria treatment

  11. Andrographolide stimulates p38 mitogen-activated protein kinase-nuclear factor erythroid-2-related factor 2-heme oxygenase 1 signaling in primary cerebral endothelial cells for definite protection against ischemic stroke in rats.

    Science.gov (United States)

    Yen, Ting-Lin; Chen, Ray-Jade; Jayakumar, Thanasekaran; Lu, Wan-Jung; Hsieh, Cheng-Ying; Hsu, Ming-Jen; Yang, Chih-Hao; Chang, Chao-Chien; Lin, Yen-Kuang; Lin, Kuan-Hung; Sheu, Joen-Rong

    2016-04-01

    Stroke pathogenesis involves complex oxidative stress-related pathways. The nuclear factor erythroid-2-related factor 2 (Nrf2) and heme oxygenase 1 (HO-1) pathways have been considered molecular targets in pharmacologic intervention for ischemic diseases. Andrographolide, a labdane diterpene, has received increasing attention in recent years because of its various pharmacologic activities. We determined that andrographolide modulates the mitogen-activated protein kinase (MAPK)-Nrf2-HO-1 signaling cascade in primary cerebral endothelial cells (CECs) to provide positive protection against middle cerebral artery occlusion (MCAO)-induced ischemic stroke in rats. In the present study, andrographolide (10 μM) increased HO-1 protein and messenger RNA expressions, Nrf2 phosphorylation, and nuclear translocation in CECs, and these activities were disrupted by a p38 MAPK inhibitor, SB203580, but not by the extracellular signal-regulated kinase inhibitor PD98059 or c-Jun amino-terminal kinase inhibitor SP600125. Similar results were observed in confocal microscopy analysis. Moreover, andrographolide-induced Nrf2 and HO-1 protein expressions were significantly inhibited by Nrf2 small interfering RNA. Moreover, HO-1 knockdown attenuated the protective effect of andrographolide against oxygen-glucose deprivation-induced CEC death. Andrographolide (0.1 mg/kg) significantly suppressed free radical formation, blood-brain barrier disruption, and brain infarction in MCAO-insulted rats, and these effects were reversed by the HO-1 inhibitor zinc protoporphyrin IX. The mechanism is attributable to HO-1 activation, as directly evidenced by andrographolide-induced pronounced HO-1 expression in brain tissues, which was highly localized in the cerebral capillary. In conclusion, andrographolide increased Nrf2-HO-1 expression through p38 MAPK regulation, confirming that it provides protection against MCAO-induced brain injury. These findings provide strong evidence that andrographolide could

  12. Two different in vitro growth patterns for erythroid precursors in 18 patients with pure erythrocytosis

    International Nuclear Information System (INIS)

    Clement, S.; Eberlin, A.; Najean, Y.; Chedeville, A.

    1982-01-01

    Growth patterns of marrow and blood erythroid progenitors were studied in 18 cases of pure erythrocytosis using different doses of erythropoietin. 8 cases demonstrated ''spontaneous'' growth of CFU-E and blood BFU-E as observed in myeloproliferative disorders, but without an excess of circulating CFU-GM. 3 of these patients also had other symptoms of a pan-myelopathy. All these cases showed good sensitivity to 32 P myelo-suppression. 10 cases demonstrated growth patterns of erythroid progenitors similar to those observed in normal subjects, except for an excess of blood BFU-E, which suggests an abnormality of homeostatic regulation. In 5 of these cases, myelo-suppression was not effective. It is suggested that a stem cell study could differentiate patients with pure erythrocytosis due to ''autonomous'' abnormal stem cell growth from cases due to abnormal regulation factors, and that such a discrimination might be usefull for the choice of theraphy. (authors)

  13. Monomethylfumarate induces γ-globin expression and fetal hemoglobin production in cultured human retinal pigment epithelial (RPE) and erythroid cells, and in intact retina.

    Science.gov (United States)

    Promsote, Wanwisa; Makala, Levi; Li, Biaoru; Smith, Sylvia B; Singh, Nagendra; Ganapathy, Vadivel; Pace, Betty S; Martin, Pamela M

    2014-05-13

    Sickle retinopathy (SR) is a major cause of vision loss in sickle cell disease (SCD). There are no strategies to prevent SR and treatments are extremely limited. The present study evaluated (1) the retinal pigment epithelial (RPE) cell as a hemoglobin producer and novel cellular target for fetal hemoglobin (HbF) induction, and (2) monomethylfumarate (MMF) as an HbF-inducing therapy and abrogator of oxidative stress and inflammation in SCD retina. Human globin gene expression was evaluated by RT-quantitative (q)PCR in the human RPE cell line ARPE-19 and in primary RPE cells isolated from Townes humanized SCD mice. γ-Globin promoter activity was monitored in KU812 stable dual luciferase reporter expressing cells treated with 0 to 1000 μM dimethylfumarate, MMF, or hydroxyurea (HU; positive control) by dual luciferase assay. Reverse transcriptase-qPCR, fluorescence-activated cell sorting (FACS), immunofluorescence, and Western blot techniques were used to evaluate γ-globin expression and HbF production in primary human erythroid progenitors, ARPE-19, and normal hemoglobin producing (HbAA) and homozygous β(s) mutation (HbSS) RPE that were treated similarly, and in MMF-injected (1000 μM) HbAA and HbSS retinas. Dihydroethidium labeling and nuclear factor (erythroid-derived 2)-like 2 (Nrf2), IL-1β, and VEGF expression were also analyzed. Retinal pigment epithelial cells express globin genes and synthesize adult and fetal hemoglobin MMF stimulated γ-globin expression and HbF production in cultured RPE and erythroid cells, and in HbSS mouse retina where it also reduced oxidative stress and inflammation. The production of hemoglobin by RPE suggests the potential involvement of this cell type in the etiology of SR. Monomethylfumarate influences multiple parameters consistent with improved retinal health in SCD and may therefore be of therapeutic potential in SR treatment. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.

  14. Gamma-interferon alters globin gene expression in neonatal and adult erythroid cells

    International Nuclear Information System (INIS)

    Miller, B.A.; Perrine, S.P.; Antognetti, G.; Perlmutter, D.H.; Emerson, S.G.; Sieff, C.; Faller, D.V.

    1987-01-01

    The effect of gamma-interferon on fetal hemoglobin synthesis by purified cord blood, fetal liver, and adult bone marrow erythroid progenitors was studied with a radioligand assay to measure hemoglobin production by BFU-E-derived erythroblasts. Coculture with recombinant gamma-interferon resulted in a significant and dose-dependent decrease in fetal hemoglobin production by neonatal and adult, but not fetal, BFU-E-derived erythroblasts. Accumulation of fetal hemoglobin by cord blood BFU-E-derived erythroblasts decreased up to 38.1% of control cultures (erythropoietin only). Synthesis of both G gamma/A gamma globin was decreased, since the G gamma/A gamma ratio was unchanged. Picograms fetal hemoglobin per cell was decreased by gamma-interferon addition, but picograms total hemoglobin was unchanged, demonstrating that a reciprocal increase in beta-globin production occurred in cultures treated with gamma-interferon. No toxic effect of gamma-interferon on colony growth was noted. The addition of gamma-interferon to cultures resulted in a decrease in the percentage of HbF produced by adult BFU-E-derived cells to 45.6% of control. Fetal hemoglobin production by cord blood, fetal liver, and adult bone marrow erythroid progenitors, was not significantly affected by the addition of recombinant GM-CSF, recombinant interleukin 1 (IL-1), recombinant IL-2, or recombinant alpha-interferon. Although fetal progenitor cells appear unable to alter their fetal hemoglobin program in response to any of the growth factors added here, the interaction of neonatal and adult erythroid progenitors with gamma-interferon results in an altered expression of globin genes

  15. Carbon monoxide induced erythroid differentiation of K562 cells mimics the central macrophage milieu in erythroblastic islands.

    Directory of Open Access Journals (Sweden)

    Shlomi Toobiak

    Full Text Available Growing evidence supports the role of erythroblastic islands (EI as microenvironmental niches within bone marrow (BM, where cell-cell attachments are suggested as crucial for erythroid maturation. The inducible form of the enzyme heme oxygenase, HO-1, which conducts heme degradation, is absent in erythroblasts where hemoglobin (Hb is synthesized. Yet, the central macrophage, which retains high HO-1 activity, might be suitable to take over degradation of extra, harmful, Hb heme. Of these enzymatic products, only the hydrophobic gas molecule--CO can transfer from the macrophage to surrounding erythroblasts directly via their tightly attached membranes in the terminal differentiation stage.Based on the above, the study hypothesized CO to have a role in erythroid maturation. Thus, the effect of CO gas as a potential erythroid differentiation inducer on the common model for erythroid progenitors, K562 cells, was explored. Cells were kept under oxygen lacking environment to mimic BM conditions. Nitrogen anaerobic atmosphere (N₂A served as control for CO atmosphere (COA. Under both atmospheres cells proliferation ceased: in N₂A due to cell death, while in COA as a result of erythroid differentiation. Maturation was evaluated by increased glycophorin A expression and Hb concentration. Addition of 1%CO only to N₂A, was adequate for maintaining cell viability. Yet, the average Hb concentration was low as compared to COA. This was validated to be the outcome of diversified maturation stages of the progenitor's population.In fact, the above scenario mimics the in vivo EI conditions, where at any given moment only a minute portion of the progenitors proceeds into terminal differentiation. Hence, this model might provide a basis for further molecular investigations of the EI structure/function relationship.

  16. Molecular pathways of early CD105-positive erythroid cells as compared with CD34-positive common precursor cells by flow cytometric cell-sorting and gene expression profiling

    International Nuclear Information System (INIS)

    Machherndl-Spandl, S; Suessner, S; Danzer, M; Proell, J; Gabriel, C; Lauf, J; Sylie, R; Klein, H-U; Béné, M C; Weltermann, A; Bettelheim, P

    2013-01-01

    Special attention has recently been drawn to the molecular network of different genes that are responsible for the development of erythroid cells. The aim of the present study was to establish in detail the immunophenotype of early erythroid cells and to compare the gene expression profile of freshly isolated early erythroid precursors with that of the CD34-positive (CD34 + ) compartment. Multiparameter flow cytometric analyses of human bone marrow mononuclear cell fractions (n=20) defined three distinct early erythroid stages. The gene expression profile of sorted early erythroid cells was analyzed by Affymetrix array technology. For 4524 genes, a differential regulation was found in CD105-positive erythroid cells as compared with the CD34 + progenitor compartment (2362 upregulated genes). A highly significant difference was observed in the expression level of genes involved in transcription, heme synthesis, iron and mitochondrial metabolism and transforming growth factor-β signaling. A comparison with recently published data showed over 1000 genes that as yet have not been reported to be upregulated in the early erythroid lineage. The gene expression level within distinct pathways could be illustrated directly by applying the Ingenuity software program. The results of gene expression analyses can be seen at the Gene Expression Omnibus repository

  17. Erythroid differentiation of human induced pluripotent stem cells is independent of donor cell type of origin.

    Science.gov (United States)

    Dorn, Isabel; Klich, Katharina; Arauzo-Bravo, Marcos J; Radstaak, Martina; Santourlidis, Simeon; Ghanjati, Foued; Radke, Teja F; Psathaki, Olympia E; Hargus, Gunnar; Kramer, Jan; Einhaus, Martin; Kim, Jeong Beom; Kögler, Gesine; Wernet, Peter; Schöler, Hans R; Schlenke, Peter; Zaehres, Holm

    2015-01-01

    Epigenetic memory in induced pluripotent stem cells, which is related to the somatic cell type of origin of the stem cells, might lead to variations in the differentiation capacities of the pluripotent stem cells. In this context, induced pluripotent stem cells from human CD34(+) hematopoietic stem cells might be more suitable for hematopoietic differentiation than the commonly used fibroblast-derived induced pluripotent stem cells. To investigate the influence of an epigenetic memory on the ex vivo expansion of induced pluripotent stem cells into erythroid cells, we compared induced pluripotent stem cells from human neural stem cells and human cord blood-derived CD34(+) hematopoietic stem cells and evaluated their potential for differentiation into hematopoietic progenitor and mature red blood cells. Although genome-wide DNA methylation profiling at all promoter regions demonstrates that the epigenetic memory of induced pluripotent stem cells is influenced by the somatic cell type of origin of the stem cells, we found a similar hematopoietic induction potential and erythroid differentiation pattern of induced pluripotent stem cells of different somatic cell origin. All human induced pluripotent stem cell lines showed terminal maturation into normoblasts and enucleated reticulocytes, producing predominantly fetal hemoglobin. Differences were only observed in the growth rate of erythroid cells, which was slightly higher in the induced pluripotent stem cells derived from CD34(+) hematopoietic stem cells. More detailed methylation analysis of the hematopoietic and erythroid promoters identified similar CpG methylation levels in the induced pluripotent stem cell lines derived from CD34(+) cells and those derived from neural stem cells, which confirms their comparable erythroid differentiation potential. Copyright© Ferrata Storti Foundation.

  18. Hypoxia-inducible factor 1-mediated human GATA1 induction promotes erythroid differentiation under hypoxic conditions.

    Science.gov (United States)

    Zhang, Feng-Lin; Shen, Guo-Min; Liu, Xiao-Ling; Wang, Fang; Zhao, Ying-Ze; Zhang, Jun-Wu

    2012-08-01

    Hypoxia-inducible factor promotes erythropoiesis through coordinated cell type-specific hypoxia responses. GATA1 is essential to normal erythropoiesis and plays a crucial role in erythroid differentiation. In this study, we show that hypoxia-induced GATA1 expression is mediated by HIF1 in erythroid cells. Under hypoxic conditions, significantly increased GATA1 mRNA and protein levels were detected in K562 cells and erythroid induction cultures of CD34(+) haematopoietic stem/progenitor cells. Enforced HIF1α expression increased GATA1 expression, while HIF1α knockdown by RNA interference decreased GATA1 expression. In silico analysis revealed one potential hypoxia response element (HRE). The results from reporter gene and mutation analysis suggested that this element is necessary for hypoxic response. Chromatin immunoprecipitation (ChIP)-PCR showed that the putative HRE was recognized and bound by HIF1 in vivo. These results demonstrate that the up-regulation of GATA1 during hypoxia is directly mediated by HIF1.The mRNA expression of some erythroid differentiation markers was increased under hypoxic conditions, but decreased with RNA interference of HIF1α or GATA1. Flow cytometry analysis also indicated that hypoxia, desferrioxamine or CoCl(2) induced expression of erythroid surface markers CD71 and CD235a, while expression repression of HIF1α or GATA1 by RNA interference led to a decreased expression of CD235a. These results suggested that HIF1-mediated GATA1 up-regulation promotes erythropoiesis in order to satisfy the needs of an organism under hypoxic conditions. © 2011 The Authors Journal of Cellular and Molecular Medicine © 2011 Foundation for Cellular and Molecular Medicine/Blackwell Publishing Ltd.

  19. Myelo-erythroid commitment after burn injury is under β-adrenergic control via MafB regulation.

    Science.gov (United States)

    Hasan, Shirin; Johnson, Nicholas B; Mosier, Michael J; Shankar, Ravi; Conrad, Peggie; Szilagyi, Andrea; Gamelli, Richard L; Muthumalaiappan, Kuzhali

    2017-03-01

    Severely injured burn patients receive multiple blood transfusions for anemia of critical illness despite the adverse consequences. One limiting factor to consider alternate treatment strategies is the lack of a reliable test platform to study molecular mechanisms of impaired erythropoiesis. This study illustrates how conditions resulting in a high catecholamine microenvironment such as burns can instigate myelo-erythroid reprioritization influenced by β-adrenergic stimulation leading to anemia. In a mouse model of scald burn injury, we observed, along with a threefold increase in bone marrow LSK cells (lin neg Sca1 + cKit + ), that the myeloid shift is accompanied with a significant reduction in megakaryocyte erythrocyte progenitors (MEPs). β-Blocker administration (propranolol) for 6 days after burn, not only reduced the number of LSKs and MafB + cells in multipotent progenitors, but also influenced myelo-erythroid bifurcation by increasing the MEPs and reducing the granulocyte monocyte progenitors in the bone marrow of burn mice. Furthermore, similar results were observed in burn patients' peripheral blood mononuclear cell-derived ex vivo culture system, demonstrating that commitment stage of erythropoiesis is impaired in burn patients and intervention with propranolol (nonselective β1,2-adrenergic blocker) increases MEPs. Also, MafB + cells that were significantly increased following standard burn care could be mitigated when propranolol was administered to burn patients, establishing the mechanistic regulation of erythroid commitment by myeloid regulatory transcription factor MafB. Overall, results demonstrate that β-adrenergic blockers following burn injury can redirect the hematopoietic commitment toward erythroid lineage by lowering MafB expression in multipotent progenitors and be of potential therapeutic value to increase erythropoietin responsiveness in burn patients. Copyright © 2017 the American Physiological Society.

  20. Enhanced expression of Stim, Orai, and TRPC transcripts and proteins in endothelial progenitor cells isolated from patients with primary myelofibrosis.

    Directory of Open Access Journals (Sweden)

    Silvia Dragoni

    Full Text Available BACKGROUND: An increase in the frequency of circulating endothelial colony forming cells (ECFCs, the only subset of endothelial progenitor cells (EPCs truly belonging to the endothelial phenotype, occurs in patients affected by primary myelofibrosis (PMF. Herein, they might contribute to the enhanced neovascularisation of fibrotic bone marrow and spleen. Store-operated Ca2+ entry (SOCE activated by the depletion of the inositol-1,4,5-trisphosphate (InsP3-sensitive Ca2+ store drives proliferation in ECFCs isolated from both healthy donors (N-ECFCs and subjects suffering from renal cellular carcinoma (RCC-ECFCs. SOCE is up-regulated in RCC-ECFCs due to the over-expression of its underlying molecular components, namely Stim1, Orai1, and TRPC1. METHODOLOGY/PRINCIPAL FINDINGS: We utilized Ca2+ imaging, real-time polymerase chain reaction, western blot analysis and functional assays to evaluate molecular structure and the functional role of SOCE in ECFCs derived from PMF patients (PMF-ECFCs. SOCE, induced by either pharmacological (i.e. cyclopiazonic acid or CPA or physiological (i.e. ATP stimulation, was significantly higher in PMF-ECFCs. ATP-induced SOCE was inhibited upon blockade of the phospholipase C/InsP3 signalling pathway with U73111 and 2-APB. The higher amplitude of SOCE was associated to the over-expression of the transcripts encoding for Stim2, Orai2-3, and TRPC1. Conversely, immunoblotting revealed that Stim2 levels remained constant as compared to N-ECFCs, while Stim1, Orai1, Orai3, TRPC1 and TRPC4 proteins were over-expressed in PMF-ECFCs. ATP-induced SOCE was inhibited by BTP-2 and low micromolar La3+ and Gd3+, while CPA-elicited SOCE was insensitive to Gd3+. Finally, BTP-2 and La3+ weakly blocked PMF-ECFC proliferation, while Gd3+ was ineffective. CONCLUSIONS: Two distinct signalling pathways mediate SOCE in PMF-ECFCs; one is activated by passive store depletion and is Gd3+-resistant, while the other one is regulated by the InsP3

  1. Zinc finger protein 521 antagonizes early B-cell factor 1 and modulates the B-lymphoid differentiation of primary hematopoietic progenitors.

    Science.gov (United States)

    Mega, Tiziana; Lupia, Michela; Amodio, Nicola; Horton, Sarah J; Mesuraca, Maria; Pelaggi, Daniela; Agosti, Valter; Grieco, Michele; Chiarella, Emanuela; Spina, Raffaella; Moore, Malcolm A S; Schuringa, Jan Jacob; Bond, Heather M; Morrone, Giovanni

    2011-07-01

    Zinc finger protein 521 (EHZF/ZNF521) is a multi-functional transcription co-factor containing 30 zinc fingers and an amino-terminal motif that binds to the nucleosome remodelling and histone deacetylase (NuRD) complex. ZNF521 is believed to be a relevant player in the regulation of the homeostasis of the hematopoietic stem/progenitor cell compartment, however the underlying molecular mechanisms are still largely unknown. Here, we show that this protein plays an important role in the control of B-cell development by inhibiting the activity of early B-cell factor-1 (EBF1), a master factor in B-lineage specification. In particular, our data demonstrate that: (1) ZNF521 binds to EBF1 via its carboxyl-terminal portion and this interaction is required for EBF1 inhibition; (2) NuRD complex recruitment by ZNF521 is not essential for the inhibition of transactivation of EBF1-dependent promoters; (3) ZNF521 represses EBF1 target genes in a human B-lymphoid molecular context; and (4) RNAi-mediated silencing of ZNF521/Zfp521 in primary human and murine hematopoietic progenitors strongly enhances the generation of B-lymphocytes in vitro. Taken together, our data indicate that ZNF521 can antagonize B-cell development and lend support to the notion that it may contribute to conserve the multipotency of primitive lympho-myeloid progenitors by preventing or delaying their EBF1-driven commitment toward the B-cell lineage.

  2. Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis

    KAUST Repository

    Barbarani, Gloria

    2017-10-20

    The Sox6 transcription factor is crucial for terminal maturation of definitive red blood cells. Sox6-null mouse fetuses present misshapen and nucleated erythrocytes, due to impaired actin assembly and cytoskeleton stability. These defects are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark of erythroid maturation. To obtain an overview on processes downstream to Sox6 expression, we performed a differential proteomic analysis on human erythroid K562 cells overexpressing Sox6. Sox6-overexpression induces dysregulation of 64 proteins, involved in cytoskeleton remodeling and in protein synthesis, folding and trafficking, key processes for erythroid maturation. Moreover, 43 out of 64 genes encoding for differentially expressed proteins contain within their proximal regulatory regions sites that are bound by SOX6 according to ENCODE ChIP-seq datasets and are possible direct SOX6 targets. SAR1B, one of the most induced proteins upon Sox6 overexpression, shares a conserved regulatory module, composed by a double SOX6 binding site and a GATA1 consensus, with the adjacent SEC24 A gene. Since both genes encode for COPII components, this element could concur to the coordinated expression of these proteins during erythropoiesis.

  3. Nuclear Factor Erythroid 2 Regulates Human HSC Self-Renewal and T Cell Differentiation by Preventing NOTCH1 Activation.

    Science.gov (United States)

    Di Tullio, Alessandro; Passaro, Diana; Rouault-Pierre, Kevin; Purewal, Sukhveer; Bonnet, Dominique

    2017-07-11

    Nuclear factor erythroid-derived 2 (NF-E2) has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs) not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG) mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated) and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  4. Nuclear Factor Erythroid 2 Regulates Human HSC Self-Renewal and T Cell Differentiation by Preventing NOTCH1 Activation

    Directory of Open Access Journals (Sweden)

    Alessandro Di Tullio

    2017-07-01

    Full Text Available Nuclear factor erythroid-derived 2 (NF-E2 has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation.

  5. In vitro studies on the radiosensitivity of multipotent hemopoietic progenitors in canine bone marrow

    International Nuclear Information System (INIS)

    Kreja, L.; Weinsheimer, W.; Nothdurft, W.

    1991-01-01

    The in vitro radiation response to 280-kV x-rays (does rate 72 cGy/min) of multipotent hemopoietic progenitor cells, mixed colony-forming units (CFU-mix), from canine bone marrow was assayed and compared to the radiation response characteristics of early erythroid progenitors, erythroid burst-forming units (BFU-E). To improve the colony-forming efficiency, the effect of various bone marrow cell separation techniques on colony formation of both progenitors was examined. The separation of bone marrow aspirates by discontinuous buoyant gradient centrifugation using the lymphocyte separation medium Lymphoprep with a density of 1.070 g/ml allowed the establishment of reproducible survival curves. The survival curves for both progenitors were strictly exponential, and CFU-mix were found to be more radiosensitive (D0 = 12 ± 2 cGy) than BFU-E (D0 = 16 ± 2 cGy)

  6. MLL-ENL cooperates with SCF to transform primary avian multipotent cells.

    Science.gov (United States)

    Schulte, Cathleen E; von Lindern, Marieke; Steinlein, Peter; Beug, Hartmut; Wiedemann, Leanne M

    2002-08-15

    The MLL gene is targeted by chromosomal translocations, which give rise to heterologous MLL fusion proteins and are associated with distinct types of acute lymphoid and myeloid leukaemia. To determine how MLL fusion proteins alter the proliferation and/or differentiation of primary haematopoietic progenitors, we introduced the MLL-AF9 and MLL-ENL fusion proteins into primary chicken bone marrow cells. Both fusion proteins caused the sustained outgrowth of immature haematopoietic cells, which was strictly dependent on stem cell factor (SCF). The renewing cells have a long in vitro lifespan exceeding the Hayflick limit of avian cells. Analysis of clonal cultures identified the renewing cells as immature, multipotent progenitors, expressing erythroid, myeloid, lymphoid and stem cell surface markers. Employing a two-step commitment/differentiation protocol involving the controlled withdrawal of SCF, the MLL-ENL-transformed progenitors could be induced to terminal erythroid or myeloid differentiation. Finally, in cooperation with the weakly leukaemogenic receptor tyrosine kinase v-Sea, the MLL-ENL fusion protein gave rise to multilineage leukaemia in chicks, suggesting that other activated, receptor tyrosine kinases can substitute for ligand-activated c-Kit in vivo.

  7. Progenitor Epithelium

    Science.gov (United States)

    Marty-Santos, Leilani

    2015-01-01

    Insulin-producing β cells within the vertebrate fetal pancreas acquire their fate in a step-wise manner. Whereas the intrinsic factors dictating the transcriptional or epigenetic status of pancreatic lineages have been intensely examined, less is known about cell–cell interactions that might constitute a niche for the developing β cell lineage. It is becoming increasingly clear that understanding and recapitulating these steps may instruct in vitro differentiation of embryonic stem cells and/or therapeutic regeneration. Indeed, directed differentiation techniques have improved since transitioning from 2D to 3D cultures, suggesting that the 3D microenvironment in which β cells are born is critical. However, to date, it remains unknown whether the changing architecture of the pancreatic epithelium impacts the fate of cells therein. An emerging challenge in the field is to elucidate how progenitors are allocated during key events, such as the stratification and subsequent resolution of the pre-pancreatic epithelium, as well as the formation of lumens and branches. Here, we assess the progenitor epithelium and examine how it might influence the emergence of pancreatic multipotent progenitors (MPCs), which give rise to β cells and other pancreatic lineages. PMID:26216134

  8. Defining an EPOR- regulated transcriptome for primary progenitors, including Tnfr-sf13c as a novel mediator of EPO- dependent erythroblast formation.

    Directory of Open Access Journals (Sweden)

    Seema Singh

    Full Text Available Certain concepts concerning EPO/EPOR action modes have been challenged by in vivo studies: Bcl-x levels are elevated in maturing erythroblasts, but not in their progenitors; truncated EPOR alleles that lack a major p85/PI3K recruitment site nonetheless promote polycythemia; and Erk1 disruption unexpectedly bolsters erythropoiesis. To discover novel EPO/EPOR action routes, global transcriptome analyses presently are applied to interrogate EPO/EPOR effects on primary bone marrow-derived CFUe-like progenitors. Overall, 160 EPO/EPOR target transcripts were significantly modulated 2-to 21.8-fold. A unique set of EPO-regulated survival factors included Lyl1, Gas5, Pim3, Pim1, Bim, Trib3 and Serpina 3g. EPO/EPOR-modulated cell cycle mediators included Cdc25a, Btg3, Cyclin-d2, p27-kip1, Cyclin-g2 and CyclinB1-IP-1. EPO regulation of signal transduction factors was also interestingly complex. For example, not only Socs3 plus Socs2 but also Spred2, Spred1 and Eaf1 were EPO-induced as negative-feedback components. Socs2, plus five additional targets, further proved to comprise new EPOR/Jak2/Stat5 response genes (which are important for erythropoiesis during anemia. Among receptors, an atypical TNF-receptor Tnfr-sf13c was up-modulated >5-fold by EPO. Functionally, Tnfr-sf13c ligation proved to both promote proerythroblast survival, and substantially enhance erythroblast formation. The EPOR therefore engages a sophisticated set of transcriptome response circuits, with Tnfr-sf13c deployed as one novel positive regulator of proerythroblast formation.

  9. Hemopoietic regeneration in murine spleen following transfusion of normal and irradiated marrow: different response of granulocyte/macrophage and erythroid precursors

    International Nuclear Information System (INIS)

    Wangenheim, K.-H. von; Peterson, H.-P.; Huebner, G.E.; Feinendegen, L.E.

    1987-01-01

    To investigate cell proliferation in regenerating spleen, bone marrow of normal and gamma-irradiated donor mice (3 weeks after 5 Gy) was transfused into lethally irradiated recipients. In the donors and in the recipient spleens numbers of CFU-S and progenitor cells were determined. In the irradiated donors the progenitors were at control level after 3 weeks of recovery although CFU-S were still at 50% of control. Recipients of the irradiated marrow received therefore an increased proportion of progenitors. CFU-C appeared to be self-renewing and/or increased in number due to enhanced CFU-S differentiation, but not the erythroid progenitors. CFU-S self-renewal was reduced after 5 Gy. The data suggest that cell differentiation and maturation proceed during early splenic regeneration. The quantity of CFU-C does not necessarily mirror the situation in the stem cell compartment. (author)

  10. Characterization of human erythroid burst-promoting activity derived from bone marrow conditioned media

    International Nuclear Information System (INIS)

    Porter, P.N.; Ogawa, M.

    1982-01-01

    Bone marrow conditioned media (BMCM) increases burst number and the incorporation of 59 Fe into heme by bursts when peripheral blood or bone marrow cells are cultured at limiting serum concentrations. Burst-promoting activity (BPA) has now been purified approximately 300-fold from this source by ion-exchange chromatography on DEAE-Sephadex and absorption chromatography on hydroxyapatite agarose gel. Marrow BPA increased burst number and hemoglobin (Hb) synthesis in a dose-dependent manner. A larger increase in Hb synthesis than in burst number was consistently observed, which was probably a consequence of the increase in the number of cells per burst that occurs in the presence of BPA. The role of BPA in culture could be distinguished from erythropoietin (Ep), since no bursts grew in the absence of Ep, whether or not BPA was present, and since it had no effect on the growth of erythroid colonies scored at day 5 of culture. Our purified fraction did not support the growth of CFU-C in culture. Activity was stable at temperatures of 70 degrees C or lower for 10 min; exposure to 80 degrees C resulted in approximately 50% loss of activity. BPA was completely inactivated by treatment at 100 degrees C for 10 min. Thus, human bone marrow cells produce a heat-sensitive factor that specifically promotes the growth of early erythroid progenitors in culture

  11. Nuclear RNA sequencing of the mouse erythroid cell transcriptome.

    Directory of Open Access Journals (Sweden)

    Jennifer A Mitchell

    Full Text Available In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.

  12. Regulated proliferation of primitive hematopoietic progenitor cells in long-term human marrow cultures

    International Nuclear Information System (INIS)

    Cashman, J.; Eaves, A.C.; Eaves, C.J.

    1985-01-01

    We have examined the cycling status of various classes of erythroid and granulopoietic progenitor populations maintained for many weeks in standard normal long-term human marrow cultures. These were initiated with a single inoculum of marrow aspirate and were routinely fed by weekly removal of half of the nonadherent cells and replacement of half of the growth medium. Progenitors of large erythroid colonies (more than eight erythroblast clusters) present in the nonadherent fraction and progenitors of small granulocyte/macrophage colonies (fewer than 500 cells) present in both the nonadherent and adherent fractions were found to be actively cycling at all times examined (28% to 63% kill following a 20-minute exposure to 20 microCi/mL of high specific activity 3 H-thymidine). In contrast, progenitors of large granulocyte/macrophage colonies (more than 500 cells) and progenitors of large erythroid colonies (more than eight erythroblast clusters), present in the adherent layer, consistently alternated between a quiescent state at the time of each weekly medium change and a proliferating state two to three days later (0% to 13% kill and 21% to 49% kill, respectively). Additional experiments revealed that the activation of primitive progenitors in the adherent layer was not dependent on the addition of fresh glutamine or hydrocortisone, nor on the physical manipulations involved in changing the growth medium. These studies provide the first direct evidence that normal long-term human marrow cultures support the continued turnover of a variety of early hematopoietic progenitor cell types. Further, they indicate that the proliferative activity of the most primitive of these progenitors is regulated by stage-specific cell-cell interactions that are subject to manipulation

  13. Leukocyte-associated immunoglobulin-like receptor-1 is expressed on human megakaryocytes and negatively regulates the maturation of primary megakaryocytic progenitors and cell line

    International Nuclear Information System (INIS)

    Xue, Jiangnan; Zhang, Xiaoshu; Zhao, Haiya; Fu, Qiang; Cao, Yanning; Wang, Yuesi; Feng, Xiaoying; Fu, Aili

    2011-01-01

    Research highlights: → LAIR-1 is expressed on human megakaryocytes from an early stage. → Up-regulation of LAIR-1 negatively regulates megakaryocytic differentiation of cell line. → LAIR-1 negatively regulates the differentiation of primary megakaryocytic progenitors. -- Abstract: Leukocyte-associated immunoglobulin-like receptor-1 (LAIR-1) is an inhibitory collagen receptor which belongs to the immunoglobulin (Ig) superfamily. Although the inhibitory function of LAIR-1 has been extensively described in multiple leukocytes, its role in megakaryocyte (MK) has not been explored so far. Here, we show that LAIR-1 is expressed on human bone marrow CD34 + CD41a + and CD41a + CD42b + cells. LAIR-1 is also detectable in a fraction of human cord blood CD34 + cell-derived MK that has morphological characteristics of immature MK. In megakaryoblastic cell line Dami, the membrane protein expression of LAIR-1 is up-regulated significantly when cells are treated with phorbol ester phorbol 12-myristate 13-acetate (PMA). Furthermore, cross-linking of LAIR-1 in Dami cells with its natural ligand or anti-LAIR-1 antibody leads to the inhibition of cell proliferation and PMA-promoted differentiation when examined by the MK lineage-specific markers (CD41a and CD42b) and polyploidization. In addition, we also observed that cross-linking of LAIR-1 results in decreased MK generation from primary human CD34 + cells cultured in a cytokines cocktail that contains TPO. These results suggest that LAIR-1 is a likely candidate for an early marker of MK differentiation, and provide initial evidence indicating that LAIR-1 serves as a negative regulator of megakaryocytopoiesis.

  14. Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

    Science.gov (United States)

    Jaako, P; Debnath, S; Olsson, K; Zhang, Y; Flygare, J; Lindström, M S; Bryder, D; Karlsson, S

    2015-11-01

    Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of mouse double minute 2 (Mdm2), the main negative regulator of p53, by the 5S ribonucleoprotein particle (RNP). Meanwhile, it is not clear whether this mechanism solely mediates the p53-dependent component found in DBA. To approach this question, we crossed our mouse model for RPS19-deficient DBA with Mdm2(C305F) knock-in mice that have a disrupted 5S RNP-Mdm2 interaction. Upon induction of the Rps19 deficiency, Mdm2(C305F) reversed the p53 response and improved expansion of hematopoietic progenitors in vitro, and ameliorated the anemia in vivo. Unexpectedly, disruption of the 5S RNP-Mdm2 interaction also led to selective defect in erythropoiesis. Our findings highlight the sensitivity of erythroid progenitor cells to aberrations in p53 homeostasis mediated by the 5S RNP-Mdm2 interaction. Finally, we provide evidence indicating that physiological activation of the 5S RNP-Mdm2-p53 pathway may contribute to functional decline of the hematopoietic system in a cell-autonomous manner over time.

  15. The role of tumor suppressor p15Ink4b in the regulation of hematopoietic progenitor cell fate

    International Nuclear Information System (INIS)

    Humeniuk, R; Rosu-Myles, M; Fares, J; Koller, R; Bies, J; Wolff, L

    2013-01-01

    Epigenetic silencing of the tumor suppressor gene p15Ink4b (CDKN2B) is a frequent event in blood disorders like acute myeloid leukemia and myelodysplastic syndromes. The molecular function of p15Ink4b in hematopoietic differentiation still remains to be elucidated. Our previous study demonstrated that loss of p15Ink4b in mice results in skewing of the differentiation pattern of the common myeloid progenitor towards the myeloid lineage. Here, we investigated a function of p15Ink4b tumor suppressor gene in driving erythroid lineage commitment in hematopoietic progenitors. It was found that p15Ink4b is expressed more highly in committed megakaryocyte–erythroid progenitors than granulocyte–macrophage progenitors. More importantly, mice lacking p15Ink4b have lower numbers of primitive red cell progenitors and a severely impaired response to 5-fluorouracil- and phenylhydrazine-induced hematopoietic stress. Introduction of p15Ink4b into multipotential progenitors produced changes at the molecular level, including activation of mitogen-activated protein kinase/extracellular signal-regulated kinase (MEK/ERK) signaling, increase GATA-1, erythropoietin receptor (EpoR) and decrease Pu1, GATA-2 expression. These changes rendered cells more permissive to erythroid commitment and less permissive to myeloid commitment, as demonstrated by an increase in early burst-forming unit-erythroid formation with concomitant decrease in myeloid colonies. Our results indicate that p15Ink4b functions in hematopoiesis, by maintaining proper lineage commitment of progenitors and assisting in rapid red blood cells replenishment following stress

  16. Enhancement of erythroid colony growth in culture by hemin

    International Nuclear Information System (INIS)

    Porter, P.N.; Meints, R.H.; Mesner, K.

    1979-01-01

    Hemin was found to enhance the growth of murine erythroid colonies in culture. In the presence of 100 mU/ml erythropoietin (EPO), the addition of hemin (0.05-0.2 mM) resulted in the growth of twice as many colonies as were obtained with EPO alone. Hemin also significantly increased erythroid colony formation in culture in the absence of added EPO. Hemoblobin synthesis as measured by the incorporation of 59 Fe into cyclohexanone extractable heme was augmented in culture by hemin. Neither Δ-aminolevulinic acid, a hemin precursor, nor FeCl 3 increased colony number. (author)

  17. TMEM14C is required for erythroid mitochondrial heme metabolism.

    Science.gov (United States)

    Yien, Yvette Y; Robledo, Raymond F; Schultz, Iman J; Takahashi-Makise, Naoko; Gwynn, Babette; Bauer, Daniel E; Dass, Abhishek; Yi, Gloria; Li, Liangtao; Hildick-Smith, Gordon J; Cooney, Jeffrey D; Pierce, Eric L; Mohler, Kyla; Dailey, Tamara A; Miyata, Non; Kingsley, Paul D; Garone, Caterina; Hattangadi, Shilpa M; Huang, Hui; Chen, Wen; Keenan, Ellen M; Shah, Dhvanit I; Schlaeger, Thorsten M; DiMauro, Salvatore; Orkin, Stuart H; Cantor, Alan B; Palis, James; Koehler, Carla M; Lodish, Harvey F; Kaplan, Jerry; Ward, Diane M; Dailey, Harry A; Phillips, John D; Peters, Luanne L; Paw, Barry H

    2014-10-01

    The transport and intracellular trafficking of heme biosynthesis intermediates are crucial for hemoglobin production, which is a critical process in developing red cells. Here, we profiled gene expression in terminally differentiating murine fetal liver-derived erythroid cells to identify regulators of heme metabolism. We determined that TMEM14C, an inner mitochondrial membrane protein that is enriched in vertebrate hematopoietic tissues, is essential for erythropoiesis and heme synthesis in vivo and in cultured erythroid cells. In mice, TMEM14C deficiency resulted in porphyrin accumulation in the fetal liver, erythroid maturation arrest, and embryonic lethality due to profound anemia. Protoporphyrin IX synthesis in TMEM14C-deficient erythroid cells was blocked, leading to an accumulation of porphyrin precursors. The heme synthesis defect in TMEM14C-deficient cells was ameliorated with a protoporphyrin IX analog, indicating that TMEM14C primarily functions in the terminal steps of the heme synthesis pathway. Together, our data demonstrate that TMEM14C facilitates the import of protoporphyrinogen IX into the mitochondrial matrix for heme synthesis and subsequent hemoglobin production. Furthermore, the identification of TMEM14C as a protoporphyrinogen IX importer provides a genetic tool for further exploring erythropoiesis and congenital anemias.

  18. Delayed Mesoderm and Erythroid Differentiation of Murine Embryonic Stem Cells in the Absence of the Transcriptional Regulator FUBP1

    Directory of Open Access Journals (Sweden)

    Josephine Wesely

    2017-01-01

    Full Text Available The transcriptional regulator far upstream binding protein 1 (FUBP1 is essential for fetal and adult hematopoietic stem cell (HSC self-renewal, and the constitutive absence of FUBP1 activity during early development leads to embryonic lethality in homozygous mutant mice. To investigate the role of FUBP1 in murine embryonic stem cells (ESCs and in particular during differentiation into hematopoietic lineages, we generated Fubp1 knockout (KO ESC clones using CRISPR/Cas9 technology. Although FUBP1 is expressed in undifferentiated ESCs and during spontaneous differentiation following aggregation into embryoid bodies (EBs, absence of FUBP1 did not affect ESC maintenance. Interestingly, we observed a delayed differentiation of FUBP1-deficient ESCs into the mesoderm germ layer, as indicated by impaired expression of several mesoderm markers including Brachyury at an early time point of ESC differentiation upon aggregation to EBs. Coculture experiments with OP9 cells in the presence of erythropoietin revealed a diminished differentiation capacity of Fubp1 KO ESCs into the erythroid lineage. Our data showed that FUBP1 is important for the onset of mesoderm differentiation and maturation of hematopoietic progenitor cells into the erythroid lineage, a finding that is supported by the phenotype of FUBP1-deficient mice.

  19. The first trimester human placenta is a site for terminal maturation of primitive erythroid cells.

    Science.gov (United States)

    Van Handel, Ben; Prashad, Sacha L; Hassanzadeh-Kiabi, Nargess; Huang, Andy; Magnusson, Mattias; Atanassova, Boriana; Chen, Angela; Hamalainen, Eija I; Mikkola, Hanna K A

    2010-10-28

    Embryonic hematopoiesis starts via the generation of primitive red blood cells (RBCs) that satisfy the embryo's immediate oxygen needs. Although primitive RBCs were thought to retain their nuclei, recent studies have shown that primitive RBCs in mice enucleate in the fetal liver. It has been unknown whether human primitive RBCs enucleate, and what hematopoietic site might support this process. Our data indicate that the terminal maturation and enucleation of human primitive RBCs occurs in first trimester placental villi. Extravascular ζ-globin(+) primitive erythroid cells were found in placental villi between 5-7 weeks of development, at which time the frequency of enucleated RBCs was higher in the villous stroma than in circulation. RBC enucleation was further evidenced by the presence of primitive reticulocytes and pyrenocytes (ejected RBC nuclei) in the placenta. Extravascular RBCs were found to associate with placental macrophages, which contained ingested nuclei. Clonogenic macrophage progenitors of fetal origin were present in the chorionic plate of the placenta before the onset of fetoplacental circulation, after which macrophages had migrated to the villi. These findings indicate that placental macrophages may assist the enucleation process of primitive RBCs in placental villi, implying an unexpectedly broad role for the placenta in embryonic hematopoiesis.

  20. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    Energy Technology Data Exchange (ETDEWEB)

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn

    2012-11-15

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  1. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    International Nuclear Information System (INIS)

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun

    2012-01-01

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  2. Erythroid differentiation of fetal, newborn and adult haemopoietic stem cells

    International Nuclear Information System (INIS)

    Rencricca, N.J.; Howard, D.; Kubanek, B.; Stohlman, F.; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)

    1976-01-01

    Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron ( 59 Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments. (author)

  3. Erythroid differentiation of fetal, newborn, and adult haemopoietic stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Rencricca, N J; Howard, D; Kubanek, B; Stohlman, F [Boston Univ., Mass. (USA). School of Medicine; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)

    1976-01-01

    Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron (/sup 59/Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments.

  4. Genetic manipulation of RPS5 gene expression modulates the initiation of commitment of MEL cells to erythroid maturation: Implications in understanding ribosomopathies.

    Science.gov (United States)

    Vizirianakis, Ioannis S; Papachristou, Eleni T; Andreadis, Panagiotis; Zopounidou, Elena; Matragkou, Christina N; Tsiftsoglou, Asterios S

    2015-07-01

    Impairment of ribosome biogenesis contributes to the molecular pathophysiology of ribosomopathies by deregulating cell-lineage specific proliferation, differentiation and apoptosis decisions of haematopoietic progenitor cells. Here, using pro-erythroblast-like murine erythroleukemia (MEL) cells, a model system of erythroid maturation, we aimed to investigate whether genetic manipulation of RPS5 expression affects the capacity of cells to grow and differentiate in culture. Parental MEL cells stably transfected with full length RPS5 cDNA in sense (MEL-C14 culture) or antisense (MEL-antisenseRPS5 culture) orientation, as well as MEL cells transiently transfected with siRNAs specific for RPS5 gene silencing (MEL-RPS5siRNA culture) were assessed for their ability to fully execute their erythroid maturation program in culture. The data obtained thus far indicate that: a) MEL-antisenseRPS5 exhibit a pronounced delay in the initiation of differentiation, as well as an impairment of commitment, since the continuous presence of the inducer in culture is required for the cells to fully execute their erythroid maturation program. b) RNAi-mediating silencing of RPS5 gene expression resulted in the inability of MEL cells to differentiate; however, when these cells were allowed to recapitulate normal RPS5 gene expression levels they regained their differentiation capacity by accumulating high proportion of erythroid mature cells. c) Interestingly the latter, is accompanied by morphological changes of cells and an impairment of their proliferation and apoptosis potential. Such data for the first time correlate the RPS5 gene expression levels with the differentiation capacity of MEL cells in vitro, a fact that might also have implications in understanding ribosomopathies.

  5. Variation in primary and culture-expanded cells derived from connective tissue progenitors in human bone marrow space, bone trabecular surface and adipose tissue.

    Science.gov (United States)

    Qadan, Maha A; Piuzzi, Nicolas S; Boehm, Cynthia; Bova, Wesley; Moos, Malcolm; Midura, Ronald J; Hascall, Vincent C; Malcuit, Christopher; Muschler, George F

    2018-03-01

    Connective tissue progenitors (CTPs) embody the heterogeneous stem and progenitor cell populations present in native tissue. CTPs are essential to the formation and remodeling of connective tissue and represent key targets for tissue-engineering and cell-based therapies. To better understand and characterize CTPs, we aimed to compare the (i) concentration and prevalence, (ii) early in vitro biological behavior and (iii) expression of surface-markers and transcription factors among cells derived from marrow space (MS), trabecular surface (TS), and adipose tissues (AT). Cancellous-bone and subcutaneous-adipose tissues were collected from 8 patients. Cells were isolated and cultured. Colony formation was assayed using Colonyze software based on ASTM standards. Cell concentration ([Cell]), CTP concentration ([CTP]) and CTP prevalence (P CTP ) were determined. Attributes of culture-expanded cells were compared based on (i) effective proliferation rate and (ii) expression of surface-markers CD73, CD90, CD105, SSEA-4, SSEA-3, SSEA-1/CD15, Cripto-1, E-Cadherin/CD324, Ep-CAM/CD326, CD146, hyaluronan and transcription factors Oct3/4, Sox-2 and Nanog using flow cytometry. Mean [Cell], [CTP] and P CTP were significantly different between MS and TS samples (P = 0.03, P = 0.008 and P= 0.0003), respectively. AT-derived cells generated the highest mean total cell yield at day 6 of culture-4-fold greater than TS and more than 40-fold greater than MS per million cells plated. TS colonies grew with higher mean density than MS colonies (290 ± 11 versus 150 ± 11 cell per mm 2 ; P = 0.0002). Expression of classical-mesenchymal stromal cell (MSC) markers was consistently recorded (>95%) from all tissue sources, whereas all the other markers were highly variable. The prevalence and biological potential of CTPs are different between patients and tissue sources and lack variation in classical MSC markers. Other markers are more likely to discriminate differences

  6. Advances in understanding the pathogenesis of primary familial and congenital polycythemia

    Science.gov (United States)

    Huang, Lily Jun-shen; Shen, Yu-Min; Bulut, Gamze B.

    2010-01-01

    Summary Primary familial and congenital polycythemia (PFCP) is an autosomal-dominant proliferative disorder characterized by erythrocytosis and hypersensitivity of erythroid progenitors to erythropoietin (Epo). Several lines of evidence suggest a causal role of truncated erythropoietin receptor (EpoR) in this disease. In this review, we discuss PFCP in the context of erythrocytosis and EpoR signaling. We focus on recent studies describing mechanisms underlying Epo-dependent EpoR down-regulation. One mechanism depends on internalization mediated through the p85 regulatory subunit of the Phosphoinositide 3-Kinase, and the other utilizes ubiquitin-based proteasomal degradation. Truncated PFCP EpoRs are not properly down-regulated upon stimulation, underscoring the importance of these mechanisms in the pathogenesis of PFCP. PMID:20096014

  7. Cytokinetics and Regulation of Progenitor Cells

    Energy Technology Data Exchange (ETDEWEB)

    Lajtha, L. G. [Paterson Laboratories, Christie Hospital and Holt Radium Institute, Manchester (United Kingdom)

    1967-07-15

    Full text: In spite of great differences in the life-span of fully differentiated haemic cells, the cellular kinetics of their production appears to be similar. Recent evidence indicates a common ultimate stem cell for most of the cells in the peripheral blood. The various pathways of differentiation, however, result in transient dividing and differentiating cell populations which differ from each other not only in their specific biochemical processes but also in the manner of control and kinetic pattern of their proliferation. The population best understood is the erythroid progenitor series of cells, primarily because it has the greatest number of experimentally measurable parameters at the present. This will be discussed in detail and comparisons will be made with the myeloid and lymphoid progenitor populations. The fine structure of the bone-marrow stem cell population will be examined in particular, with regard to the suitability or otherwise of the current stem cell models to explain the kinetic pattern of all the peripheral blood elements after perturbations of their steady-state values. Four different assay methods of bone-marrow stem cells have been examined with regard to the kinetic pattern following perturbation of the steady-state system, e.g. by irradiation. Basically, the stem cell assays fall into two categories: those depending on grafting haemopoietic cells into suitably treated recipients, and those in which recovery of the population is allowed in the animal in which the perturbation was produced, without handling the cells. Evidence is accumulating which indicates that in the grafting techniques, a selective loss of stem cells may occur, . especially stem cells in cell cycle, hence in early stages of recovery of the population unduly low numerical values might be noted. In view of this observation, the concept of the colony-forming cell may have to be revised and instead the colony-forming property of the stem cell introduced. (author)

  8. Cytokinetics and Regulation of Progenitor Cells

    International Nuclear Information System (INIS)

    Lajtha, L.G.

    1967-01-01

    Full text: In spite of great differences in the life-span of fully differentiated haemic cells, the cellular kinetics of their production appears to be similar. Recent evidence indicates a common ultimate stem cell for most of the cells in the peripheral blood. The various pathways of differentiation, however, result in transient dividing and differentiating cell populations which differ from each other not only in their specific biochemical processes but also in the manner of control and kinetic pattern of their proliferation. The population best understood is the erythroid progenitor series of cells, primarily because it has the greatest number of experimentally measurable parameters at the present. This will be discussed in detail and comparisons will be made with the myeloid and lymphoid progenitor populations. The fine structure of the bone-marrow stem cell population will be examined in particular, with regard to the suitability or otherwise of the current stem cell models to explain the kinetic pattern of all the peripheral blood elements after perturbations of their steady-state values. Four different assay methods of bone-marrow stem cells have been examined with regard to the kinetic pattern following perturbation of the steady-state system, e.g. by irradiation. Basically, the stem cell assays fall into two categories: those depending on grafting haemopoietic cells into suitably treated recipients, and those in which recovery of the population is allowed in the animal in which the perturbation was produced, without handling the cells. Evidence is accumulating which indicates that in the grafting techniques, a selective loss of stem cells may occur, . especially stem cells in cell cycle, hence in early stages of recovery of the population unduly low numerical values might be noted. In view of this observation, the concept of the colony-forming cell may have to be revised and instead the colony-forming property of the stem cell introduced. (author)

  9. Bmi-1 Regulates Extensive Erythroid Self-Renewal

    Directory of Open Access Journals (Sweden)

    Ah Ram Kim

    2015-06-01

    Full Text Available Red blood cells (RBCs, responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression data sets from self-renewing and differentiating erythroblasts were analyzed and revealed the differential expression of Bmi-1. Bmi-1 overexpression conferred extensive self-renewal capacity upon adult bone-marrow-derived self-renewing erythroblasts, which normally have limited proliferative potential. Importantly, Bmi-1 transduction did not interfere with the ability of extensively self-renewing erythroblasts (ESREs to terminally mature either in vitro or in vivo. Bmi-1-induced ESREs can serve to generate in vitro models of erythroid-intrinsic disorders and ultimately may serve as a source of cultured RBCs for transfusion therapy.

  10. Novel pathways to erythropoiesis induced by dimerization of intracellular C-Mpl in human hematopoietic progenitors.

    Science.gov (United States)

    Parekh, Chintan; Sahaghian, Arineh; Kim, William; Scholes, Jessica; Ge, Shundi; Zhu, Yuhua; Asgharzadeh, Shahab; Hollis, Roger; Kohn, Donald; Ji, Lingyun; Malvar, Jemily; Wang, Xiaoyan; Crooks, Gay

    2012-04-01

    The cytokine thrombopoietin (Tpo) plays a critical role in hematopoiesis by binding to the extracellular domain and inducing homodimerization of the intracellular signaling domain of its receptor, c-Mpl. Mpl homodimerization can also be accomplished by binding of a synthetic ligand to a constitutively expressed fusion protein F36VMpl consisting of a ligand binding domain (F36V) and the intracellular signaling domain of Mpl. Unexpectedly, in contrast to Tpo stimulation, robust erythropoiesis is induced after dimerization of F36VMpl in human CD34+ progenitor cells. The goal of this study was to define the hematopoietic progenitor stages at which dimerization of intracellular Mpl induces erythropoiesis and the downstream molecular events that mediate this unanticipated effect. Dimerization (in the absence of erythropoietin and other cytokines) in human common myeloid progenitors and megakaryocytic erythroid progenitors caused a significant increase in CD34+ cells (p Mpl in human myeloerythroid progenitors induces progenitor expansion and erythropoiesis through molecular mechanisms that are not shared by Tpo stimulation of endogenous Mpl. Copyright © 2012 AlphaMed Press.

  11. Expression of assayable residual stem cell damage in erythroid differentiation

    International Nuclear Information System (INIS)

    Huebner, G.E.; Miller, M.E.; Cronkite, E.P.

    1985-01-01

    In rodents, residual damage is inducible in hematopoietic stem cells by exposure to ionizing radiation or alkylating agents. This damage can b e assayed in mice by transferring bone marrow into lethally irradiated syngeneic recipients and subsequently measuring the incremental increase of-( 125 I)iodo-2'-deoxyuridine incorporation in spleens. In this study, bone marrow from mice treated 3 weeks previously with Methylnitrosourea (50 mg/kg) or 450 rad was injected into recipients in order to determine possible residual effects of treatment of erythroid cell differentiation following stem cell seeding. Such effects were detected by a reduced amount of 59 Fe incorporation into spleens, thus indicatin g transfer of residual stem cell damage to differentiating cells. (orig.)

  12. Induction of multipotential hematopoietic progenitors from human pluripotent stem cells via re-specification of lineage-restricted precursors

    Science.gov (United States)

    Doulatov, Sergei; Vo, Linda T.; Chou, Stephanie S.; Kim, Peter G.; Arora, Natasha; Li, Hu; Hadland, Brandon K.; Bernstein, Irwin D.; Collins, James J.; Zon, Leonard I.; Daley, George Q.

    2013-01-01

    Summary Human pluripotent stem cells (hPSCs) represent a promising source of patient-specific cells for disease modeling, drug screens, and cellular therapies. However, the inability to derive engraftable human hematopoietic stem and progenitor (HSPCs) has limited their characterization to in vitro assays. We report a strategy to re-specify lineage-restricted CD34+CD45+ myeloid precursors derived from hPSCs into multilineage progenitors that can be expanded in vitro and engraft in vivo. HOXA9, ERG, and RORA conferred self-renewal and multilineage potential in vitro and maintained primitive CD34+CD38− cells. Screening cells via transplantation revealed that two additional factors, SOX4 and MYB, were required for engraftment. Progenitors specified with all five factors gave rise to reproducible short-term engraftment with myeloid and erythroid lineages. Erythroid precursors underwent hemoglobin switching in vivo, silencing embryonic and activating adult globin expression. Our combinatorial screening approach establishes a strategy for obtaining transcription factor-mediated engraftment of blood progenitors from human pluripotent cells. PMID:24094326

  13. Erythroblastic Sarcoma Presenting as Bilateral Ovarian Masses in an Infant with Pure Erythroid Leukemia

    Science.gov (United States)

    Wang, Huan-You; Huang, Lily Jun-shen; Garcia, Rolando; Li, Shiyong; Galliani, Carlos A.

    2010-01-01

    Pure erythroid leukemia is a rare subtype of acute erythroid leukemia that is characterized by a predominant erythroid population, and erythroblastic sarcoma has not yet been described in the English literature. Here we report a first case of erythroblastic sarcoma which presented as bilateral ovarian masses in a three and half month old baby girl with pure erythroid leukemia. Bone marrow aspirate and biopsy showed the marrow was completely replaced by large-sized blasts consistent with erythroblasts. Immunophenotypically, both the tumor cells from the ovarian mass and bone marrow blasts were positive for CD117, glycophorin A, and hemoglobin A, demonstrating erythroid differentiation. Reverse transcriptase polymerase chain reaction showed the tumor cells from ovarian mass expressed hemoglobin F and α1 spectrin, confirming their erythroid lineage. Conventional karyotype of the bone marrow aspirates revealed del(6) (q23q25) and trisomy 7 in all 21 cells examined. Fluorescence in situ hybridization of the ovarian mass demonstrated loss of C-MYB at 6q23 locus in 41% of the cells, and deletion of chromosome 7 and 7q in 37% and 66% of cells, respectively. Taken together, we showed, for the first time, that pure erythroid leukemia presented as a myeloid sarcoma in the form of ovarian masses. PMID:21237494

  14. Hemolytic disease of the fetus and newborn due to anti-Ge3: combined antibody-dependent hemolysis and erythroid precursor cell growth inhibition.

    Science.gov (United States)

    Blackall, Douglas P; Pesek, Gina D; Montgomery, Matthew M; Oza, Krishna K; Arndt, Patricia A; Garratty, George; Shahcheraghi, Ali; Denomme, Gregory A

    2008-10-01

    The Gerbich (Ge) antigens are a collection of high-incidence antigens carried on the red blood cell membrane glycoproteins, glycophorins C and D. Antibodies against these antigens are uncommon, and there have been only rare case reports of hemolytic disease of the fetus and newborn due to anti-Ge. In this case report, we present a neonate with severe anemia and hyperbilirubinemia due to anti-Ge3. Routine and special laboratory studies undertaken in this case suggested two mechanisms for the patient's hemolysis and persistent anemia. Antibody-dependent hemolysis was associated with early-onset hyperbilirubinemia, anemia, and a mild reticulocytosis, and inhibition of erythroid progenitor cell growth was associated with late anemia and normal bilirubin and reticulocyte values. Though rare, anti-Ge3 can be a dangerous antibody in pregnancy. Affected neonates may require intensive initial therapy and close follow-up for at least several weeks after delivery.

  15. Progenitors of white dwarfs

    International Nuclear Information System (INIS)

    Drilling, J.S.; Schoenberner, D.

    1985-01-01

    Direct observational evidence is presented which indicates that the immediate progenitors of white dwarfs are the central stars of planetary nebulae (approximately 70%), other post-AGB objects (approximately 30%), and post-HB objects not massive enough to climb the AGB (approximately 0.3%). The combined birth rate for these objects is in satisfactory agreement with the death rate of main-sequence stars and the birth rate of white dwarfs

  16. [Update on the biology of heme synthesis in erythroid cells].

    Science.gov (United States)

    Fujiwara, Tohru; Harigae, Hideo

    2015-02-01

    Heme is a prosthetic group of hemoproteins playing important roles in oxygen transport, detoxification, circadian rhythm, microRNA processing, regulation of transcription, and translation. The majority of heme (-85%) is synthesized in red blood cells mainly for hemoglobin production, whereas hepatocytes account for most of the rest, functioning primarily in the synthesis of cytochrome P450 enzymes and mitochondrial respiratory enzymes. Thus, failure of heme biosynthesis causes severe inherited or acquired disorders in humans, including porphyria and sideroblastic anemia. The heme biosynthetic pathway is composed of eight enzymes that work in either mitochondria or the cytoplasm, which have been extensively researched and frequently reviewed. On the other hand, the mechanisms governing transport and intracellular trafficking of heme intermediates, as well as their potential links to human diseases, are poorly understood. Herein, we focus on recent understanding of the heme biosynthetic pathway and on human disorders due to defective heme synthesis in erythroid cells, such as X-linked sideroblastic anemia and erythropoietic protoporphyria.

  17. Prospective identification of erythroid elements in cultured peripheral blood.

    Science.gov (United States)

    Miller, J L; Njoroge, J M; Gubin, A N; Rodgers, G P

    1999-04-01

    We have developed a prospective approach to identify the generation of erythroid cells derived from cultured peripheral blood mononuclear cells (PBMC) by monitoring the expression of the cell surface protein CD48. Unpurified populations of PBMC obtained from the buffy coats of normal volunteers were grown in suspension culture in the absence or presence of erythropoietin. A profile of surface CD48 expression permitted a flow cytometric identification of erythropoietin responsive populations at various stages of their maturation. In the absence of erythropoietin (EPO) supplemented media, the CD48- cells represented <5% of the total population of PBMC remaining in culture. In cultures supplemented with 1 U/mL EPO, the mean percentage of CD48- cells increased to 34.7 + 14.9% (p < 0.01) after 14 days in culture. Coordinated CD34 and CD71 (transferrin receptor) expression, morphology, gamma-globin transcription, and colony formation in methylcellulose were observed during the 14-day culture period. Flow cytometric monitoring of bulk cultured PBMC provides a simple and reliable means for the prospective or real-time study of human erythropoiesis.

  18. Meloxicam elevates serum concentration of Erythropoietin and numbers of bone marrow erythroid progenitor cells in sublethally gamma-irradiated mice

    Czech Academy of Sciences Publication Activity Database

    Hofer, Michal; Pospíšil, Milan; Vacek, Antonín; Znojil, V.; Holá, Jiřina; Štreitová, Denisa

    2009-01-01

    Roč. 78, č. 1 (2009), s. 19-22 ISSN 0001-7213 R&D Projects: GA ČR(CZ) GA305/08/0158; GA AV ČR(CZ) 1QS500040507 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : cyclooxygenase-2 inhibition * erythropoiesis * radiation-induced myelosuppression Subject RIV: BO - Biophysics Impact factor: 0.403, year: 2009

  19. Integrative analysis of copy number and gene expression data suggests novel pathogenetic mechanisms in primary myelofibrosis.

    Science.gov (United States)

    Salati, Simona; Zini, Roberta; Nuzzo, Simona; Guglielmelli, Paola; Pennucci, Valentina; Prudente, Zelia; Ruberti, Samantha; Rontauroli, Sebastiano; Norfo, Ruggiero; Bianchi, Elisa; Bogani, Costanza; Rotunno, Giada; Fanelli, Tiziana; Mannarelli, Carmela; Rosti, Vittorio; Salmoiraghi, Silvia; Pietra, Daniela; Ferrari, Sergio; Barosi, Giovanni; Rambaldi, Alessandro; Cazzola, Mario; Bicciato, Silvio; Tagliafico, Enrico; Vannucchi, Alessandro M; Manfredini, Rossella

    2016-04-01

    Primary myelofibrosis (PMF) is a Myeloproliferative Neoplasm (MPN) characterized by megakaryocyte hyperplasia, progressive bone marrow fibrosis, extramedullary hematopoiesis and transformation to Acute Myeloid Leukemia (AML). A number of phenotypic driver (JAK2, CALR, MPL) and additional subclonal mutations have been described in PMF, pointing to a complex genomic landscape. To discover novel genomic lesions that can contribute to disease phenotype and/or development, gene expression and copy number signals were integrated and several genomic abnormalities leading to a concordant alteration in gene expression levels were identified. In particular, copy number gain in the polyamine oxidase (PAOX) gene locus was accompanied by a coordinated transcriptional up-regulation in PMF patients. PAOX inhibition resulted in rapid cell death of PMF progenitor cells, while sparing normal cells, suggesting that PAOX inhibition could represent a therapeutic strategy to selectively target PMF cells without affecting normal hematopoietic cells' survival. Moreover, copy number loss in the chromatin modifier HMGXB4 gene correlates with a concomitant transcriptional down-regulation in PMF patients. Interestingly, silencing of HMGXB4 induces megakaryocyte differentiation, while inhibiting erythroid development, in human hematopoietic stem/progenitor cells. These results highlight a previously un-reported, yet potentially interesting role of HMGXB4 in the hematopoietic system and suggest that genomic and transcriptional imbalances of HMGXB4 could contribute to the aberrant expansion of the megakaryocytic lineage that characterizes PMF patients. © 2015 UICC.

  20. Masses of supernova progenitors

    International Nuclear Information System (INIS)

    Tinsley, B.M.

    1977-01-01

    The possible nature and masses of supernovae progenitors, and the bearing of empirical results on some unsolved theoretical problems concerning the origin of supernovae, are discussed. The author concentrates on two main questions: what is the lower mass limit for stars to die explosively and what stars initiate type I supernovae. The evidence considered includes local supernova rates, empirical estimates of msub(w) (the upper mass limit for death as a white dwarf), the distributions of supernovae among stellar populations in galaxies and the colors of supernova producing galaxies. (B.D.)

  1. Acute erythroid neoplastic proliferations. A biological study based on 62 patients.

    Science.gov (United States)

    Domingo-Claros, Alicia; Larriba, Itziar; Rozman, Maruja; Irriguible, Dolors; Vallespí, Teresa; Aventin, Anna; Ayats, Ramon; Millá, Fuensanta; Solé, Francesc; Florensa, Lourdes; Gallart, Miquel; Tuset, Esperanza; Lopez, Carmen; Woessner, Soledad

    2002-02-01

    The terms acute erythroleukemia and AML-M6 are defined in the FAB classification as proliferations of dysplastic erythroid elements mixed with blasts of myeloid origin, but pure erythroid leukemias are not included. The recent WHO classification has a category of acute myeloid leukemia not otherwise categorized, which includes acute erythroid leukemia (M6) of two subtypes: M6a-erythroleukemia (erythroid/myeloid) and M6b-pure erythroid leukemia. The aims of this co-operative study were to discover the incidences of these different subtypes, and pay special attention to the morphology of these entities. We reviewed a series of 62 patients with erythroid neoplastic proliferations. Previous medical history, age, sex, peripheral blood and bone marrow cell counts, cytochemical stains, immunophenotype, and cytogenetics were evaluated at presentation. We analyzed the incidence of erythrocyte, leukocyte and platelet abnormalities in the peripheral blood. In bone marrow we analyzed dysplastic features of erythroblasts, granulocytic elements and the megakaryocytic lineage. Fifty-three patients met the criteria of M6a subtype of the WHO classification, and 2 were classified as having pure erythremia (M6b); 7 cases could not be classified according to the WHO criteria. Fifty-five patients presented with de novo acute leukemia, and seven patients had secondary acute leukemia. The most frequent dysplastic features in blood smears were: schistocytes, tear-drop and pincered cells in erythrocytes; hypogranulation and hyposegmentation in leukocytes; gigantism and hypogranulation in platelets. In bone marrow, megaloblastic changes, multinuclearity, karyorrhexis and basophilic stippling in erythroblasts; hypogranulation and gigantism in granulocytic series, and micromegakaryocytes and unconnected nuclei in megakarocytes were the most dysplastic features. A positive PAS reaction and increase of bone marrow iron with ring sideroblasts were common features. Trilineage dysplasia was

  2. Human Cord Blood and Bone Marrow CD34+ Cells Generate Macrophages That Support Erythroid Islands.

    Directory of Open Access Journals (Sweden)

    Eyayu Belay

    Full Text Available Recently, we developed a small molecule responsive hyperactive Mpl-based Cell Growth Switch (CGS that drives erythropoiesis associated with macrophages in the absence of exogenous cytokines. Here, we compare the physical, cellular and molecular interaction between the macrophages and erythroid cells in CGS expanded CD34+ cells harvested from cord blood, marrow or G-CSF-mobilized peripheral blood. Results indicated that macrophage based erythroid islands could be generated from cord blood and marrow CD34+ cells but not from G-CSF-mobilized CD34+ cells. Additional studies suggest that the deficiency resides with the G-CSF-mobilized CD34+ derived monocytes. Gene expression and proteomics studies of the in vitro generated erythroid islands detected the expression of erythroblast macrophage protein (EMP, intercellular adhesion molecule 4 (ICAM-4, CD163 and DNASE2. 78% of the erythroblasts in contact with macrophages reached the pre reticulocyte orthochromatic stage of differentiation within 14 days of culture. The addition of conditioned medium from cultures of CD146+ marrow fibroblasts resulted in a 700-fold increase in total cell number and a 90-fold increase in erythroid cell number. This novel CD34+ cell derived erythroid island may serve as a platform to explore the molecular basis of red cell maturation and production under normal, stress and pathological conditions.

  3. Dynamics of GATA1 binding and expression response in a GATA1-induced erythroid differentiation system

    Directory of Open Access Journals (Sweden)

    Deepti Jain

    2015-06-01

    Full Text Available During the maturation phase of mammalian erythroid differentiation, highly proliferative cells committed to the erythroid lineage undergo dramatic changes in morphology and function to produce circulating, enucleated erythrocytes. These changes are caused by equally dramatic alterations in gene expression, which in turn are driven by changes in the abundance and binding patterns of transcription factors such as GATA1. We have studied the dynamics of GATA1 binding by ChIP-seq and the global expression responses by RNA-seq in a GATA1-dependent mouse cell line model for erythroid maturation, in both cases examining seven progressive stages during differentiation. Analyses of these data should provide insights both into mechanisms of regulation (early versus late targets and the consequences in cell physiology (e.g., distinctive categories of genes regulated at progressive stages of differentiation. The data are deposited in the Gene Expression Omnibus, series GSE36029, GSE40522, GSE49847, and GSE51338.

  4. A Rare Case of Pure Erythroid Sarcoma in a Pediatric Patient: Case Report and Literature Review

    Directory of Open Access Journals (Sweden)

    Pablo Manresa

    2017-12-01

    Full Text Available We describe an exceptional case of erythroid sarcoma in a pediatric patient as a growing orbital mass with no evidence of morphologic bone marrow involvement, who was finally diagnosed of pure erythroid sarcoma based on histopathology and flow cytometry criteria. We discuss the contribution of standardized eight-color flow cytometry as a rapid and reliable diagnostic method. The use of normal bone marrow databases allowed us to identify small aberrant populations in bone marrow and later confirm the diagnosis in the neoplastic tissue.

  5. Fusion of ZMYND8 and RELA genes in acute erythroid leukemia

    DEFF Research Database (Denmark)

    Panagopoulos, Ioannis; Micci, Francesca; Thorsen, Jim

    2013-01-01

    Acute erythroid leukemia was diagnosed in a 4-month-old boy. Cytogenetic analysis of bone marrow (BM) cells showed a t(11;20)(p11;q11) translocation. RNA extracted from the BM was sequenced and analyzed for fusion transcripts using the software FusionMap. A ZMYND8-RELA fusion was ranked first. RT...

  6. Probing Conformational Stability and Dynamics of Erythroid and Nonerythroid Spectrin: Effects of Urea and Guanidine Hydrochloride

    Science.gov (United States)

    Patra, Malay; Mukhopadhyay, Chaitali; Chakrabarti, Abhijit

    2015-01-01

    We have studied the conformational stability of the two homologous membrane skeletal proteins, the erythroid and non-erythroid spectrins, in their dimeric and tetrameric forms respectively during unfolding in the presence of urea and guanidine hydrochloride (GuHCl). Fluorescence and circular dichroism (CD) spectroscopy have been used to study the changes of intrinsic tryptophan fluorescence, anisotropy, far UV-CD and extrinsic fluorescence of bound 1-anilinonapthalene-8-sulfonic acid (ANS). Chemical unfolding of both proteins were reversible and could be described as a two state transition. The folded erythroid spectrin and non-erythroid spectrin were directly converted to unfolded monomer without formation of any intermediate. Fluorescence quenching, anisotropy, ANS binding and dynamic light scattering data suggest that in presence of low concentrations of the denaturants (up-to 1M) hydrogen bonding network and van der Waals interaction play a role inducing changes in quaternary as well as tertiary structures without complete dissociation of the subunits. This is the first report of two large worm like, multi-domain proteins obeying twofold rule which is commonly found in small globular proteins. The free energy of stabilization (ΔGu H 2 0) for the dimeric spectrin has been 20 kcal/mol lesser than the tetrameric from. PMID:25617632

  7. Dimethyl sulfoxide-inducible cytoplasmic factor involved in erythroid differentiation in mouse erythroleukemia (Friend) cells

    International Nuclear Information System (INIS)

    Watanabe, T.; Oishi, M.

    1987-01-01

    A previous report described an intracellular factor (differentiation-inducing factor I, or DIF-I) that seem to play a role in erythroid differentiation in mouse erythroleukemia (MEL) cells. The authors have detected another erythroid-inducing factor in cell-free extracts from dimethyl sulfoxide- or hexamethylenebis(acetamide)-treated MEL cells, which acts synergistically with DIF-I. The partially purified factor (termed DIF-II) triggered erythroid differentiation when introduced into undifferentiated MEL cells that had been potentiated by the induction of DIF-I. The activity in the extracts appeared in an inducible manner after addition of dimethyl sulfoxide or hexamethylenebis(acetamide), reached a maximum at 6 hr, and then rapidly decreased. The induction was inhibited by phorbol 12-myristate 13-acetate and also by cycloheximide. No induction was observed in a mutant MEL cell line defective in erythroid differentiation. These characteristics are consistent with the supposition that DIF-II is one of the putative dimethyl sulfoxide-inducible factors detected in previously reported cell-fusion and cytoplast-fusion experiments. The role of DIF-II in MEL-cell differentiation and in vitro differentiation in general is discussed

  8. PCBP1 and NCOA4 regulate erythroid iron storage and heme biosynthesis.

    Science.gov (United States)

    Ryu, Moon-Suhn; Zhang, Deliang; Protchenko, Olga; Shakoury-Elizeh, Minoo; Philpott, Caroline C

    2017-05-01

    Developing erythrocytes take up exceptionally large amounts of iron, which must be transferred to mitochondria for incorporation into heme. This massive iron flux must be precisely controlled to permit the coordinated synthesis of heme and hemoglobin while avoiding the toxic effects of chemically reactive iron. In cultured animal cells, iron chaperones poly rC-binding protein 1 (PCBP1) and PCBP2 deliver iron to ferritin, the sole cytosolic iron storage protein, and nuclear receptor coactivator 4 (NCOA4) mediates the autophagic turnover of ferritin. The roles of PCBP, ferritin, and NCOA4 in erythroid development remain unclear. Here, we show that PCBP1, NCOA4, and ferritin are critical for murine red cell development. Using a cultured cell model of erythroid differentiation, depletion of PCBP1 or NCOA4 impaired iron trafficking through ferritin, which resulted in reduced heme synthesis, reduced hemoglobin formation, and perturbation of erythroid regulatory systems. Mice lacking Pcbp1 exhibited microcytic anemia and activation of compensatory erythropoiesis via the regulators erythropoietin and erythroferrone. Ex vivo differentiation of erythroid precursors from Pcbp1-deficient mice confirmed defects in ferritin iron flux and heme synthesis. These studies demonstrate the importance of ferritin for the vectorial transfer of imported iron to mitochondria in developing red cells and of PCBP1 and NCOA4 in mediating iron flux through ferritin.

  9. Mesenchymal progenitor cells for the osteogenic lineage.

    Science.gov (United States)

    Ono, Noriaki; Kronenberg, Henry M

    2015-09-01

    Mesenchymal progenitors of the osteogenic lineage provide the flexibility for bone to grow, maintain its function and homeostasis. Traditionally, colony-forming-unit fibroblasts (CFU-Fs) have been regarded as surrogates for mesenchymal progenitors; however, this definition cannot address the function of these progenitors in their native setting. Transgenic murine models including lineage-tracing technologies based on the cre-lox system have proven to be useful in delineating mesenchymal progenitors in their native environment. Although heterogeneity of cell populations of interest marked by a promoter-based approach complicates overall interpretation, an emerging complexity of mesenchymal progenitors has been revealed. Current literatures suggest two distinct types of bone progenitor cells; growth-associated mesenchymal progenitors contribute to explosive growth of bone in early life, whereas bone marrow mesenchymal progenitors contribute to the much slower remodeling process and response to injury that occurs mainly in adulthood. More detailed relationships of these progenitors need to be studied through further experimentation.

  10. Comparative Analysis of the Hematopoietic Progenitor Cells from Placenta, Cord Blood, and Fetal Liver, Based on Their Immunophenotype

    Directory of Open Access Journals (Sweden)

    Maria D. Kuchma

    2015-01-01

    Full Text Available We have investigated the characteristics of human hematopoietic progenitor cells (HPCs with the CD34+CD45lowSSClow phenotype from full-term placental tissue (FTPT as compared to cord blood (CB and fetal liver (FL cells. We demonstrated the presence of cell subpopulations at various stages of the differentiation with such immunophenotypes as CD34+/lowCD45low/-, CD34++CD45low/-, CD34+++CD45low/-, CD34+/lowCD45hi, and CD34++CD45hi in both first trimester placental tissue (FiTPT and FTPT which implies their higher phenotypic heterogeneity compared to CB. HPCs of the FTPT origin expressed the CD90 antigen at a higher level compared to its expression by the CB HPCs and the CD133 antigen expression being at the same level in both cases. The HPCs compartment of FTPT versus CB contained higher number of myeloid and erythroid committed cells but lower number of myeloid and lymphoid ones compared to FL HPCs. HPCs of the FTPT and CB origin possess similar potentials for the multilineage differentiation in vitro and similar ratios of myeloid and erythroid progenitors among the committed cells. This observation suggests that the active hematopoiesis occurs in the FTPT. We obtained viable HPCs from cryopreserved placental tissue fragments allowing us to develop procedures for banking and testing of placenta-derived HPCs for clinical use.

  11. Production of erythrocytes from directly isolated or Delta1 Notch ligand expanded CD34+ hematopoietic progenitor cells: process characterization, monitoring and implications for manufacture.

    Science.gov (United States)

    Glen, Katie E; Workman, Victoria L; Ahmed, Forhad; Ratcliffe, Elizabeth; Stacey, Adrian J; Thomas, Robert J

    2013-09-01

    Economic ex vivo manufacture of erythrocytes at 10(12) cell doses requires an efficiently controlled bio-process capable of extensive proliferation and high terminal density. High-resolution characterization of the process would identify production strategies for increased efficiency, monitoring and control. CD34(+) cord blood cells or equivalent cells that had been pre-expanded for 7 days with Delta1 Notch ligand were placed in erythroid expansion and differentiation conditions in a micro-scale ambr suspension bioreactor. Multiple culture parameters were varied, and phenotype markers and metabolites measured to identify conserved trends and robust monitoring markers. The cells exhibited a bi-modal erythroid differentiation pattern with an erythroid marker peak after 2 weeks and 3 weeks of culture; differentiation was comparatively weighted toward the second peak in Delta1 pre-expanded cells. Both differentiation events were strengthened by omission of stem cell factor and dexamethasone. The cumulative cell proliferation and death, or directly measured CD45 expression, enabled monitoring of proliferative rate of the cells. The metabolic activities of the cultures (glucose, glutamine and ammonia consumption or production) were highly variable but exhibited systematic change synchronized with the change in differentiation state. Erythroid differentiation chronology is partly determined by the heterogeneous CD34(+) progenitor compartment with implications for input control; Delta1 ligand-mediated progenitor culture can alter differentiation profile with control benefits for engineering production strategy. Differentiation correlated changes in cytokine response, markers and metabolic state will enable scientifically designed monitoring and timing of manufacturing process steps. Copyright © 2013 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

  12. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells

    International Nuclear Information System (INIS)

    Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun

    2013-01-01

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation

  13. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells

    Energy Technology Data Exchange (ETDEWEB)

    Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn

    2013-12-15

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation.

  14. The influence of gender- and age-related differences in the radiosensitivity of hematopoietic progenitor cells detected in steady-state human peripheral blood

    International Nuclear Information System (INIS)

    Kato, Kengo; Kashiwakura, Ikuo; Kuwabara, Mikinori

    2011-01-01

    To investigate the importance of gender and aging on the individual radiosensitivity of lineage-committed myeloid hematopoietic stem/progenitor cells (HSPCs) detected in mononuclear cells (MNCs) of steady-state human peripheral blood (PB), the clonogenic survival of HPCs, including colony-forming unit-granulocyte macrophage; burst-forming unit-erythroid; colony-forming unit-granulocyte-erythroid-macrophage-megakaryocyte cells derived from MNCs exposed to 0.5 Gy and 2 Gy X-irradiation were estimated. MNCs were prepared from the buffy-coats of 59 healthy individual blood donors. The results showed that large individual differences exist in the number of HSPCs, as well as in the surviving fraction of cells. Furthermore, the number of progenitor cells strongly correlated with their surviving fraction, suggesting that the radiosensitivity of hematopoietic progenitor cells decreases with the number of cells in the 10 5 cells population. A statistically significant negative correlation was observed between the surviving fraction observed at a dose of 0.5 Gy and the age of an individual, however, none of these correlations were observed after 2 Gy irradiation. No statistically significant difference was observed in individual radiosensitivity between males and females at either radiation dose. The present results indicated a correlation between the individual responsiveness of HSPCs to ionizing irradiation, especially to low dose irradiation, and aging. (author)

  15. Definitive hematopoietic stem/progenitor cells manifest distinct differentiation output in the zebrafish VDA and PBI.

    Science.gov (United States)

    Jin, Hao; Sood, Raman; Xu, Jin; Zhen, Fenghua; English, Milton A; Liu, P Paul; Wen, Zilong

    2009-02-01

    One unique feature of vertebrate definitive hematopoiesis is the ontogenic switching of hematopoietic stem cells from one anatomical compartment or niche to another. In mice, hematopoietic stem cells are believed to originate in the aorta-gonad-mesonephros (AGM), subsequently migrate to the fetal liver (FL) and finally colonize the bone marrow (BM). Yet, the differentiation potential of hematopoietic stem cells within early niches such as the AGM and FL remains incompletely defined. Here, we present in vivo analysis to delineate the differentiation potential of definitive hematopoietic stem/progenitor cells (HSPCs) in the zebrafish AGM and FL analogies, namely the ventral wall of dorsal aorta (VDA) and the posterior blood island (PBI), respectively. Cell fate mapping and analysis of zebrafish runx1(w84x) and vlad tepes (vlt(m651)) mutants revealed that HSPCs in the PBI gave rise to both erythroid and myeloid lineages. However, we surprisingly found that HSPCs in the VDA were not quiescent but were uniquely adapted to generate myeloid but not erythroid lineage cells. We further showed that such distinct differentiation output of HSPCs was, at least in part, ascribed to the different micro-environments present in these two niches. Our results highlight the importance of niche in shaping the differentiation output of developing HSPCs.

  16. Individual differences in the radiosensitivity of hematopoietic progenitor cells detected in steady-state human peripheral blood

    International Nuclear Information System (INIS)

    Oriya, Asami; Takahashi, Kenji; Kashiwakura, Ikuo; Inanami, Osamu; Kuwabara, Mikinori; Miura, Toshiaki; Abe, Yoshinao

    2008-01-01

    The aim of this study is to evaluate the individual differences in radiosensitivity of lineage-committed myeloid hematopoietic progenitors, colony-forming cells (CFC), detected in steady-state human peripheral blood (PB). Mononuclear cells were prepared from the buffy-coat of 30 individuals PB, and were assayed for CFC by semi-solid culture supplemented with cytokines. X irradiation was performed in the range of 0.5-4 Gy at a dose rate of about 80 cGy/min. The mean number of hematopoietic progenitor cells is 5866±3408 in 1 ml of buffy-coat, suggesting that the erythroid progenitor cells are the major population. The total CFC radiosensitivity parameter D 0 and n value are 1.18±0.24 and 1.89±0.98, respectively. Using a linear regression analysis, a statistically significant correlation is observed between the D 0 value and the surviving fraction at 4 Gy (r=0.611 p 0 parameter and the level of antioxidants, plasma uric acid, plasma bilirubin, and intracellular glutathione. The present study demonstrates that there are large individual differences in the radiosensitivity of hematopoietic progenitor cells as detected in steady-state human PB. These differences demonstrate almost no correlation with plasma or intracellular antioxidants. The prediction of individual differences in radiosensitivity of CFC can only be measured by 4 Gy irradiation. (author)

  17. Binary progenitors of supernovae

    Science.gov (United States)

    Trimble, V.

    1984-12-01

    Among the massive stars that are expected to produce Type II, hydrogen-rich supernovae, the presence of a close companion can increase the main sequence mass needed to yield a collapsing core. In addition, due to mass transfer from the primary to the secondary, the companion enhances the stripping of the stellar hydrogen envelope produced by single star winds and thereby makes it harder for the star to give rise to a typical SN II light curve. Among the less massive stars that may be the basis for Type I, hydrogen-free supernovae, a close companion could be an innocent bystander to carbon detonation/deflagration in the primary. It may alternatively be a vital participant which transfers material to a white dwarf primary and drives it to explosive conditions.

  18. Erythroid precursors from patients with low-risk myelodysplasia demonstrate ultrastructural features of enhanced autophagy of mitochondria

    NARCIS (Netherlands)

    Houwerzijl, E. J.; Pol, H-W D.; Blom, N. R.; van der Want, J. J. L.; de Wolf, J. Thm; Vellenga, E.

    Recent studies in erythroid cells have shown that autophagy is an important process for the physiological clearance of mitochondria during terminal differentiation. However, autophagy also plays an important role in removing damaged and dysfunctional mitochondria. Defective mitochondria and impaired

  19. Dexamethasone targeted directly to macrophages induces macrophage niches that promote erythroid expansion

    DEFF Research Database (Denmark)

    Falchi, Mario; Varricchio, Lilian; Martelli, Fabrizio

    2015-01-01

    Cultures of human CD34(pos) cells stimulated with erythroid growth factors plus dexamethasone, a model for stress erythropoiesis, generate numerous erythroid cells plus a few macrophages (approx. 3%; 3:1 positive and negative for CD169). Interactions occurring between erythroblasts and macrophages...... in these cultures and the biological effects associated with these interactions were documented by live phase-contrast videomicroscopy. Macrophages expressed high motility interacting with hundreds/thousands of erythroblasts per hour. CD169(pos) macrophages established multiple rapid 'loose' interactions...... with proerythroblasts leading to formation of transient erythroblastic island-like structures. By contrast, CD169(neg) macrophages established 'tight' interactions with mature erythroblasts and phagocytosed these cells. 'Loose' interactions of CD169(pos) macrophages were associated with proerythroblast cytokinesis (the...

  20. Non-erythroid alpha spectrin prevents telomere dysfunction after DNA interstrand cross-link damage

    OpenAIRE

    Zhang, Pan; Herbig, Utz; Coffman, Frederick; Lambert, Muriel W.

    2013-01-01

    Telomere integrity is critical for telomere function and genomic stability. We previously demonstrated that non-erythroid ?-spectrin (?IISp) is present in mammalian cell nuclei where it is important in repair of DNA interstrand cross-links (ICLs) and chromosome stability. We now demonstrate that ?IISp is also important for telomere maintenance after ICL damage. It localizes to telomeres in S phase after ICL damage where it has enhanced association with TRF1 and TRF2 and is required for recrui...

  1. Erythroid differentiation and commitment in rat erythroleukemia cells with hypertonic culture conditions.

    OpenAIRE

    Yamaguchi, Y; Kluge, N; Ostertag, W; Furusawa, M

    1981-01-01

    Cell cultures of 7,12-dimethylbenz[a]anthracene-induced rat erythroleukemia can be stimulated to synthesize hemoglobin when cultured in hypertonic media. During hypertonic treatment the intracellular osmotic conditions immediately readjust to those of the extracellular medium. None of the Friend virus-induced mouse erythroleukemia cell lines was inducible for differentiation with the same hypertonic culture conditions used for rat cells. Earliest commitment to erythroid terminal differentiati...

  2. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells.

    Science.gov (United States)

    Suriguga; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun

    2013-12-15

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. © 2013.

  3. Effects of extracellular matrix proteins on the growth of haematopoietic progenitor cells

    International Nuclear Information System (INIS)

    Celebi, Betuel; Pineault, Nicolas; Mantovani, Diego

    2011-01-01

    Umbilical cord blood (UCB) transplantation and haematological recovery are currently limited by the amount of haematopoietic progenitor cells (HPCs) present in each unit. HPCs and haematopoietic stem cells (HSCs) normally interact with cells and extracellular matrix (ECM) proteins present within the endosteal and vascular niches. Hence, we investigated whether coating of culture surfaces with ECM proteins normally present in the marrow microenvironment could benefit the ex vivo expansion of HPCs. Towards this, collagen types I and IV (COL I and IV), laminin (LN) and fibronectin (FN) were tested individually or as component of two ECM-mix complexes. Individually, ECM proteins had both common and unique properties on the growth and differentiation of UCB CD34+ cells; some ECM proteins favoured the differentiation of some lineages over that of others (e.g. FN for erythroids), some the expansion of HPCs (e.g. LN and megakaryocyte (MK) progenitor) while others had less effects. Next, two ECM-mix complexes were tested; the first one contained all four ECM proteins (4ECMp), while the second 'basement membrane-like structure' was without COL I (3ECMp). Removal of COL I led to strong reductions in cell growth and HPCs expansion. Interestingly, the 4ECMp-mix complex reproducibly increased CD34+ (1.3-fold) and CD41+ (1.2-fold) cell expansions at day 6 (P < 0.05) versus control, and induced greater myeloid progenitor expansion (P < 0.05) than 3ECMp. In conclusion, these results suggest that optimization of BM ECM protein complexes could provide a better environment for the ex vivo expansion of haematopoietic progenitors than individual ECM protein.

  4. Effects of extracellular matrix proteins on the growth of haematopoietic progenitor cells

    Energy Technology Data Exchange (ETDEWEB)

    Celebi, Betuel; Pineault, Nicolas [Hema-Quebec, Research and Development Department, Quebec City, G1V 5C3, PQ (Canada); Mantovani, Diego, E-mail: nicolas.pineault@hema-quebec.qc.ca [Laboratory for Biomaterials and Bioengineering, Department of Materials Engineering and University Hospital Research Center, Laval University, Quebec City, G1V 0A6, PQ (Canada)

    2011-10-15

    Umbilical cord blood (UCB) transplantation and haematological recovery are currently limited by the amount of haematopoietic progenitor cells (HPCs) present in each unit. HPCs and haematopoietic stem cells (HSCs) normally interact with cells and extracellular matrix (ECM) proteins present within the endosteal and vascular niches. Hence, we investigated whether coating of culture surfaces with ECM proteins normally present in the marrow microenvironment could benefit the ex vivo expansion of HPCs. Towards this, collagen types I and IV (COL I and IV), laminin (LN) and fibronectin (FN) were tested individually or as component of two ECM-mix complexes. Individually, ECM proteins had both common and unique properties on the growth and differentiation of UCB CD34+ cells; some ECM proteins favoured the differentiation of some lineages over that of others (e.g. FN for erythroids), some the expansion of HPCs (e.g. LN and megakaryocyte (MK) progenitor) while others had less effects. Next, two ECM-mix complexes were tested; the first one contained all four ECM proteins (4ECMp), while the second 'basement membrane-like structure' was without COL I (3ECMp). Removal of COL I led to strong reductions in cell growth and HPCs expansion. Interestingly, the 4ECMp-mix complex reproducibly increased CD34+ (1.3-fold) and CD41+ (1.2-fold) cell expansions at day 6 (P < 0.05) versus control, and induced greater myeloid progenitor expansion (P < 0.05) than 3ECMp. In conclusion, these results suggest that optimization of BM ECM protein complexes could provide a better environment for the ex vivo expansion of haematopoietic progenitors than individual ECM protein.

  5. Polyherbal EMSA ERITIN Promotes Erythroid Lineages and Lymphocyte Migration in Irradiated Mice

    Directory of Open Access Journals (Sweden)

    Ibrahim Mansur

    2016-01-01

    Full Text Available Radiotherapy is commonly used to kill malignant cells, but it can significantly deplete hematopoietic and splenic erythroblasts. Radioprotective agents are therefore very important in clinical radiotherapy. We examined the effect of poly-herbal EMSA ERITIN on immunological responses when administered to sublethally irradiated mice with the aim of highlighting promotes erythroid lineages and lymphocytes migration in irradiated mice with the parameter are TER119+CD123+in bone marrow and SDF-1 in bone marrow and spleen organ. Normal BALB/c mice were sublethally irradiated with 600 rad. EMSA ERITIN was administered orally at different doses:(1.04, 3.125 and 9.375 mg/g body weight for 15 days. On day 16 erythroid lineages (TER-119+CD123+ were observed in bone marrow and lymphocytes migration by the production of SDF-1 in spleen and bone marrow. Lymphocytes migration was indicated by the production of SDF-1 in spleen and bone marrow using flow cytometry analysis. EMSA ERITIN increased the generation of erythroid lineage cells marked by TER119+CD123+ and promoted lymphocyte migration by increasing SDF-1 production in bone marrow and spleen. EMSA ERITIN appears to be a powerful medicinal herb with potential as a food supplement to normalize homeostasis and erythropoiesis after radiation.

  6. In vitro studies of the sensitivity of canine bone-marrow erythroid burst-forming units (BFU-E) and fibroblast colony-forming units (CFU-F) to X-irradiation

    International Nuclear Information System (INIS)

    Kreja, Ludwika; Baltschukat, Klaus; Nothdurft, Wilhelm

    1989-01-01

    The radiosensitivity of the early erythroid progenitor cells (BFU-E) and the progenitor cells of the stroma (CFU-F) in canine bone marrow was studied under steady-state conditions by in vitro irradiation with 280 kV X-rays. The dose-effect relationship for colony formation was determined for BFU-E obtained from the iliac crest marrow, and for CFU-F in bone marrow collected from the iliac crest and the humerus of adult beagles. The BFU-E were adequately stimulated with serum from lethally irradiated dogs to obtain a source of BPA (burst-promoting activity). The BFU-E proved to be extremely radiosensitive, (the survival curve was exponential (D o 15.3 ± 1.8 cGY)). Buffy-coat leukocytes separated from bone marrow leukocytes obtained by aspiration were an optimum source of CFU-F. A curve was fitted to data obtained for CFU-F obtained from iliac crest or humerus, resulting in D o = 241 ± 38 cGY and an extrapolation number n = 1.38 ± 0.62 or D o = 261 ± 40 cGY and n = 1.04 ± 0.42, respectively. (author)

  7. The poster as modernist progenitor

    Directory of Open Access Journals (Sweden)

    Katherine Hauser

    2015-12-01

    Full Text Available Ruth E. Iskin’s The Poster: Art, Advertising. Design, and Collecting, 1860s-1900s positions the late-nineteenth-century advertising poster as the progenitor of valued modernist practices typically attached solely to photography and film. Modernist biases separating high art from mass culture account for scholars ignoring posters, however the poster ushered in an innovative reductive graphic style as well as pioneered the notion of multiple originals.

  8. PROGENITORS OF RECOMBINING SUPERNOVA REMNANTS

    Energy Technology Data Exchange (ETDEWEB)

    Moriya, Takashi J., E-mail: takashi.moriya@ipmu.jp [Kavli Institute for the Physics and Mathematics of the Universe, Todai Institutes for Advanced Study, University of Tokyo, Kashiwanoha 5-1-5, Kashiwa, Chiba 277-8583 (Japan)

    2012-05-01

    Usual supernova remnants have either ionizing plasma or plasma in collisional ionization equilibrium, i.e., the ionization temperature is lower than or equal to the electron temperature. However, the existence of recombining supernova remnants, i.e., supernova remnants with ionization temperature higher than the electron temperature, has been recently confirmed. One suggested way to have recombining plasma in a supernova remnant is to have a dense circumstellar medium at the time of the supernova explosion. If the circumstellar medium is dense enough, collisional ionization equilibrium can be established in the early stage of the evolution of the supernova remnant and subsequent adiabatic cooling, which occurs after the shock wave gets out of the dense circumstellar medium, makes the electron temperature lower than the ionization temperature. We study the circumstellar medium around several supernova progenitors and show which supernova progenitors can have a circumstellar medium dense enough to establish collisional ionization equilibrium soon after the explosion. We find that the circumstellar medium around red supergiants (especially massive ones) and the circumstellar medium dense enough to make Type IIn supernovae can establish collisional ionization equilibrium soon after the explosion and can evolve to become recombining supernova remnants. Wolf-Rayet stars and white dwarfs have the possibility to be recombining supernova remnants but the fraction is expected to be very small. As the occurrence rate of the explosions of red supergiants is much higher than that of Type IIn supernovae, the major progenitors of recombining supernova remnants are likely to be red supergiants.

  9. Identification of Different Classes of Luminal Progenitor Cells within Prostate Tumors

    Directory of Open Access Journals (Sweden)

    Supreet Agarwal

    2015-12-01

    Full Text Available Primary prostate cancer almost always has a luminal phenotype. However, little is known about the stem/progenitor properties of transformed cells within tumors. Using the aggressive Pten/Tp53-null mouse model of prostate cancer, we show that two classes of luminal progenitors exist within a tumor. Not only did tumors contain previously described multipotent progenitors, but also a major population of committed luminal progenitors. Luminal cells, sorted directly from tumors or grown as organoids, initiated tumors of adenocarcinoma or multilineage histological phenotypes, which is consistent with luminal and multipotent differentiation potentials, respectively. Moreover, using organoids we show that the ability of luminal-committed progenitors to self-renew is a tumor-specific property, absent in benign luminal cells. Finally, a significant fraction of luminal progenitors survived in vivo castration. In all, these data reveal two luminal tumor populations with different stem/progenitor cell capacities, providing insight into prostate cancer cells that initiate tumors and can influence treatment response.

  10. Amplification of neural stem cell proliferation by intermediate progenitor cells in Drosophila brain development

    Directory of Open Access Journals (Sweden)

    Bello Bruno C

    2008-02-01

    Full Text Available Abstract Background In the mammalian brain, neural stem cells divide asymmetrically and often amplify the number of progeny they generate via symmetrically dividing intermediate progenitors. Here we investigate whether specific neural stem cell-like neuroblasts in the brain of Drosophila might also amplify neuronal proliferation by generating symmetrically dividing intermediate progenitors. Results Cell lineage-tracing and genetic marker analysis show that remarkably large neuroblast lineages exist in the dorsomedial larval brain of Drosophila. These lineages are generated by brain neuroblasts that divide asymmetrically to self renew but, unlike other brain neuroblasts, do not segregate the differentiating cell fate determinant Prospero to their smaller daughter cells. These daughter cells continue to express neuroblast-specific molecular markers and divide repeatedly to produce neural progeny, demonstrating that they are proliferating intermediate progenitors. The proliferative divisions of these intermediate progenitors have novel cellular and molecular features; they are morphologically symmetrical, but molecularly asymmetrical in that key differentiating cell fate determinants are segregated into only one of the two daughter cells. Conclusion Our findings provide cellular and molecular evidence for a new mode of neurogenesis in the larval brain of Drosophila that involves the amplification of neuroblast proliferation through intermediate progenitors. This type of neurogenesis bears remarkable similarities to neurogenesis in the mammalian brain, where neural stem cells as primary progenitors amplify the number of progeny they generate through generation of secondary progenitors. This suggests that key aspects of neural stem cell biology might be conserved in brain development of insects and mammals.

  11. Radiosensitivity of human haematopoietic stem/progenitor cells

    International Nuclear Information System (INIS)

    Kato, Kengo; Kashiwakura, Ikuo; Omori, Atsuko

    2013-01-01

    The haematopoietic system is regenerative tissue with a high proliferative potential; therefore, haematopoietic stem cells (HSCs) are sensitive to extracellular oxidative stress caused by radiation and chemotherapeutic agents. An understanding of this issue can help predict haematopoietic recovery from radiation exposure as well as the extent of radiation damage to the haematopoietic system. In the present study, the radiosensitivity of human lineage-committed myeloid haematopoietic stem/progenitor cells (HSPCs), including colony-forming unit–granulocyte macrophage, burst-forming unit–erythroid and colony-forming unit–granulocyte–erythroid–macrophage–megakaryocyte cells, which are contained in adult individual peripheral blood (PB) and fetus/neonate placental/umbilical cord blood (CB), were studied. The PB of 59 healthy individual blood donors and the CB of 42 neonates were investigated in the present study. HSPCs prepared from PB and CB were exposed to 0.5 or 2 Gy x-irradiation. The results showed that large individual differences exist in the surviving fraction of cells. In the case of adult PB, a statistically significant negative correlation was observed between the surviving fraction observed at a dose of 0.5 Gy and the age of the blood donors; however, none of these correlations were observed after 2 Gy x-irradiation. In addition, seasonal and gender variation were observed in the surviving fraction of CB HSPCs. The present results suggest that there are large individual differences in the surviving fraction of HSPCs contained in both adult PB and fetus/neonate CB. In addition, some factors, including the gender, age and season of birth, affect the radiosensitivity of HSPCs, especially with a relatively low-dose exposure. (paper)

  12. Induction of erythroid differentiation in human erythroleukemia cells by depletion of malic enzyme 2.

    Directory of Open Access Journals (Sweden)

    Jian-Guo Ren

    2010-09-01

    Full Text Available Malic enzyme 2 (ME2 is a mitochondrial enzyme that catalyzes the conversion of malate to pyruvate and CO2 and uses NAD as a cofactor. Higher expression of this enzyme correlates with the degree of cell de-differentiation. We found that ME2 is expressed in K562 erythroleukemia cells, in which a number of agents have been found to induce differentiation either along the erythroid or the myeloid lineage. We found that knockdown of ME2 led to diminished proliferation of tumor cells and increased apoptosis in vitro. These findings were accompanied by differentiation of K562 cells along the erythroid lineage, as confirmed by staining for glycophorin A and hemoglobin production. ME2 knockdown also totally abolished growth of K562 cells in nude mice. Increased ROS levels, likely reflecting increased mitochondrial production, and a decreased NADPH/NADP+ ratio were noted but use of a free radical scavenger to decrease inhibition of ROS levels did not reverse the differentiation or apoptotic phenotype, suggesting that ROS production is not causally involved in the resultant phenotype. As might be expected, depletion of ME2 induced an increase in the NAD+/NADH ratio and ATP levels fell significantly. Inhibition of the malate-aspartate shuttle was insufficient to induce K562 differentiation. We also examined several intracellular signaling pathways and expression of transcription factors and intermediate filament proteins whose expression is known to be modulated during erythroid differentiation in K562 cells. We found that silencing of ME2 leads to phospho-ERK1/2 inhibition, phospho-AKT activation, increased GATA-1 expression and diminished vimentin expression. Metabolomic analysis, conducted to gain insight into intermediary metabolic pathways that ME2 knockdown might affect, showed that ME2 depletion resulted in high orotate levels, suggesting potential impairment of pyrimidine metabolism. Collectively our data point to ME2 as a potentially novel

  13. Generation of erythroid cells from polyploid giant cancer cells: re-thinking about tumor blood supply.

    Science.gov (United States)

    Yang, Zhigang; Yao, Hong; Fei, Fei; Li, Yuwei; Qu, Jie; Li, Chunyuan; Zhang, Shiwu

    2018-04-01

    During development and tumor progression, cells need a sufficient blood supply to maintain development and rapid growth. It is reported that there are three patterns of blood supply for tumor growth: endothelium-dependent vessels, mosaic vessels, and vasculogenic mimicry (VM). VM was first reported in highly aggressive uveal melanomas, with tumor cells mimicking the presence and function of endothelial cells forming the walls of VM vessels. The walls of mosaic vessels are randomly lined with both endothelial cells and tumor cells. We previously proposed a three-stage process, beginning with VM, progressing to mosaic vessels, and eventually leading to endothelium-dependent vessels. However, many phenomena unique to VM channel formation remain to be elucidated, such as the origin of erythrocytes before VM vessels connect with endothelium-dependent vessels. In adults, erythroid cells are generally believed to be generated from hematopoietic stem cells in the bone marrow. In contrast, embryonic tissue obtains oxygen through formation of blood islands, which are largely composed of embryonic hemoglobin with a higher affinity with oxygen, in the absence of mature erythrocytes. Recent data from our laboratory suggest that embryonic blood-forming mechanisms also exist in cancer tissue, particularly when these tissues are under environmental stress such as hypoxia. We review the evidence from induced pluripotent stem cells in vitro and in vivo to support this previously underappreciated cell functionality in normal and cancer cells, including the ability to generate erythroid cells. We will also summarize the current understanding of tumor angiogenesis, VM, and our recent work on polyploid giant cancer cells, with emphasis on their ability to generate erythroid cells and their association with tumor growth under hypoxia. An alternative embryonic pathway to obtain oxygen in cancer cells exists, particularly when they are under hypoxic conditions.

  14. H4 histamine receptors mediate cell cycle arrest in growth factor-induced murine and human hematopoietic progenitor cells.

    Directory of Open Access Journals (Sweden)

    Anne-France Petit-Bertron

    Full Text Available The most recently characterized H4 histamine receptor (H4R is expressed preferentially in the bone marrow, raising the question of its role during hematopoiesis. Here we show that both murine and human progenitor cell populations express this receptor subtype on transcriptional and protein levels and respond to its agonists by reduced growth factor-induced cell cycle progression that leads to decreased myeloid, erythroid and lymphoid colony formation. H4R activation prevents the induction of cell cycle genes through a cAMP/PKA-dependent pathway that is not associated with apoptosis. It is mediated specifically through H4R signaling since gene silencing or treatment with selective antagonists restores normal cell cycle progression. The arrest of growth factor-induced G1/S transition protects murine and human progenitor cells from the toxicity of the cell cycle-dependent anticancer drug Ara-C in vitro and reduces aplasia in a murine model of chemotherapy. This first evidence for functional H4R expression in hematopoietic progenitors opens new therapeutic perspectives for alleviating hematotoxic side effects of antineoplastic drugs.

  15. Iron overload promotes erythroid apoptosis through regulating HIF-1a/ROS signaling pathway in patients with myelodysplastic syndrome.

    Science.gov (United States)

    Zheng, Qing-Qing; Zhao, You-Shan; Guo, Juan; Zhao, Si-da; Song, Lu-Xi; Fei, Cheng-Ming; Zhang, Zheng; Li, Xiao; Chang, Chun-Kang

    2017-07-01

    Erythroid apoptosis increases significantly in myelodysplastic syndrome (MDS) patients with iron overload, but the underlying mechanism is not fully clear. In this study, we aim to explore the effect of HIF-1a/ROS on erythroid apoptosis in MDS patients with iron overload. We found that iron overload injured cellular functions through up-regulating ROS levels in MDS/AML cells, including inhibited cell viability, increased cell apoptosis and blocked cell cycle at G0/G1 phase. Interestingly, overexpression of hypoxia inducible factor-1a (HIF-1a), which was under-expressed in iron overload models, reduced ROS levels and attenuated cell damage caused by iron overload in MDS/AML cells. And gene knockdown of HIF-1a got the similar results as iron overload in MDS/AML cells. Furthermore, iron overload caused high erythroid apoptosis was closely related with ROS in MDS patients. Importantly, the HIF-1a protein levels of erythrocytes elevated obviously after incubation with desferrioxamine (DFO) from MDS patients with iron overload, accompanied by ROS levels inhibited and erythroid apoptosis reduced. Taken together, our findings determine that the HIF-1a/ROS signaling pathway plays a key role in promoting erythroid apoptosis in MDS patients with iron overload. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Proteomic analysis of erythroid differentiation induced by hexamethylene bisacetamide in murine erythroleukemia cells

    Czech Academy of Sciences Publication Activity Database

    Petrák, J.; Myslivcová, D.; Man, Petr; Čmejlová, J.; Čmejla, R.; Vyoral, D.

    2007-01-01

    Roč. 35, - (2007), s. 193-202 ISSN 0301-472X R&D Projects: GA MŠk LC545 Grant - others:CZ(CZ) 023736; GA ČR(CZ) GA303/04/0003; GA MŠk(CZ) LC06044 Institutional research plan: CEZ:AV0Z50200510 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : murine erythroleukemia cells * erythroid differentiation * hexamethylene bisacetamide Subject RIV: EE - Microbiology, Virology Impact factor: 3.147, year: 2007

  17. PRV-1, erythroid colonies and platelet Mpl are unrelated to thrombosis in essential thrombocythaemia

    DEFF Research Database (Denmark)

    Vannucchi, Alessandro M; Pancrazzi, Alessandro; Antonioli, Elisabetta

    2004-01-01

    markers of ET, namely PRV-1 overexpression, endogenous erythroid colony (EEC) formation, and reduced platelet Mpl content. Fifty-three (60%) of 88 subjects studied had monoclonal myelopoiesis and presented a 32% incidence of major thrombosis compared with 6% of polyclonal subjects (P = 0.......009). The frequency of abnormalities of PRV-1, EEC, or Mpl was similar in monoclonal and polyclonal subjects (respectively, 28%, 48%, 75%, and 37%, 27%, 63%), and none of them correlated with thrombosis. We conclude that the exploited epigenetic markers constitute independent phenotypic variations...

  18. Establishment and characterization of a unique 1 microm diameter liver-derived progenitor cell line.

    Science.gov (United States)

    Aravalli, Rajagopal N; Behnan Sahin, M; Cressman, Erik N K; Steer, Clifford J

    2010-01-01

    Liver-derived progenitor cells (LDPCs) are recently identified novel stem/progenitor cells from healthy, unmanipulated adult rat livers. They are distinct from other known liver stem/progenitor cells such as the oval cells. In this study, we have generated a LDPC cell line RA1 by overexpressing the simian virus 40 (SV40) large T antigen (TAg) in primary LDPCs. This cell line was propagated continuously for 55 passages in culture, after which it became senescent. Interestingly, following transformation with SV40 TAg, LDPCs decreased in size significantly and the propagating cells measured 1 microm in diameter. RA1 cells proliferated in vitro with a doubling time of 5-7 days, and expressed cell surface markers of LDPCs. In this report, we describe the characterization of this novel progenitor cell line that might serve as a valuable model to study liver cell functions and stem cell origin of liver cancers. Copyright 2009 Elsevier Inc. All rights reserved.

  19. Epigenetic Reprogramming of Muscle Progenitors: Inspiration for Clinical Therapies

    Directory of Open Access Journals (Sweden)

    Silvia Consalvi

    2016-01-01

    Full Text Available In the context of regenerative medicine, based on the potential of stem cells to restore diseased tissues, epigenetics is becoming a pivotal area of interest. Therapeutic interventions that promote tissue and organ regeneration have as primary objective the selective control of gene expression in adult stem cells. This requires a deep understanding of the epigenetic mechanisms controlling transcriptional programs in tissue progenitors. This review attempts to elucidate the principle epigenetic regulations responsible of stem cells differentiation. In particular we focus on the current understanding of the epigenetic networks that regulate differentiation of muscle progenitors by the concerted action of chromatin-modifying enzymes and noncoding RNAs. The novel exciting role of exosome-bound microRNA in mediating epigenetic information transfer is also discussed. Finally we show an overview of the epigenetic strategies and therapies that aim to potentiate muscle regeneration and counteract the progression of Duchenne Muscular Dystrophy (DMD.

  20. Glial progenitor cell-based treatment of the childhood leukodystrophies

    DEFF Research Database (Denmark)

    Osório, M. Joana; Goldman, Steven A.

    2016-01-01

    stem cell-derived human neural or glial progenitor cells may comprise a promising strategy for both structural remyelination and metabolic rescue. A broad variety of pediatric white matter disorders, including the primary hypomyelinating disorders, the lysosomal storage disorders, and the broader group...... genetic editing of pluripotent stem cells. Yet these challenges notwithstanding, the promise of glial progenitor cell-based treatment of the childhood myelin disorders offers hope to the many victims of this otherwise largely untreatable class of disease....... and astrocytes are the major affected cell populations, and are either structurally impaired or metabolically compromised through cell-intrinsic pathology, or are the victims of mis-accumulated toxic byproducts of metabolic derangement. In either case, glial cell replacement using implanted tissue or pluripotent...

  1. Massive splenomegaly in acute erythroid leukaemia (FAB Class-M6): an unusual presentation.

    Science.gov (United States)

    Sherazi, Syed Furqan Haider; Butt, Zeeshan

    2012-09-01

    AML-M6 has a peak incidence in the seventh decade with slight male preponderance, and can also present at a younger age. The usual features are anaemia, thrombocytopenia, malaise, fatigue, easy bruising, epistaxis and petechiae. Splenomegaly may occur in 20-40 % of the cases but massive splenomegaly is rare presentation and have been only reported once in humans and once in animals. A 22 year Asian female, presented with fatigue, pallor, mild jaundice, exertional dyspnoea, epigastric pain, tender right hypochondrium and massive splenomegaly. Investigations revealed anaemia and thrombocytopenia, tear drop cells, basophilic stippling, piokilocytosis and anisochromia; increased uric acid and LDH. Abdominal ultrasound showed enlarged liver (22cm) and spleen (20cm). Bone marrow aspiration revealed 51% erythroid and 24% non-erythroid precursors, depressed leukopoeisis and megakarypoeisis. Erythroblasts were PAS and CD71 positive and also reacted to Antihaemoglobin-Antibody. This report highlights characteristic features and diagnostic criteria of erythroleukaemia, differential diagnosis of massive splenomegaly and their rare association.

  2. Erythroid cells in vitro: from developmental biology to blood transfusion products.

    Science.gov (United States)

    Migliaccio, Anna Rita; Whitsett, Carolyn; Migliaccio, Giovanni

    2009-07-01

    Red blood cells (RBCs) transfusion plays a critical role in numerous therapies. Disruption of blood collection by political unrest, natural disasters and emerging infections and implementation of restrictions on the use of erythropoiesis-stimulating agents in cancer may impact blood availability in the near future. These considerations highlight the importance of developing alternative blood products. Knowledge about the processes that control RBC production has been applied to the establishment of culture conditions allowing ex-vivo generation of RBCs in numbers close to those (2.5 x 10 cells/ml) present in a transfusion, from cord blood, donated blood units or embryonic stem cells. In addition, experimental studies demonstrate that such cells protect mice from lethal bleeding. Therefore, erythroid cells generated ex vivo may be suitable for transfusion provided they can be produced safely in adequate numbers. However, much remains to be done to translate a theoretical production of approximately 2.5 x 10 RBCs in the laboratory into a 'clinical grade production process'. This review summarizes the state-of-the-art in establishing ex-vivo culture conditions for erythroid cells and discusses the most compelling issues to be addressed to translate this progress into a clinical grade transfusion product.

  3. RECOMBINANT HUMAN MAST-CELL GROWTH-FACTOR SUPPORTS ERYTHROID COLONY FORMATION IN POLYCYTHEMIA-VERA IN THE PRESENCE AND ABSENCE OF ERYTHROPOIETIN AND SERUM

    NARCIS (Netherlands)

    MULLER, EW; DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E

    The effect of mast cell growth factor (MGF) was studied on erythropoietin (Epo)-dependent and Epo-independent (''spontaneous'') erythroid colony formation in patients with polycythemia vera (PV). MGF stimulated both Epo-dependent and Epo-independent erythroid colony formation from PV peripheral

  4. Progenitor's Signatures in Type Ia Supernova Remnants

    NARCIS (Netherlands)

    Chiotellis, A.; Kosenko, D.; Schure, K.M.; Vink, J.

    2013-01-01

    The remnants of Type Ia supernovae (SNe Ia) can provide important clues about their progenitor histories. We discuss two well-observed supernova remnants (SNRs) that are believed to have resulted from SNe Ia, and use various tools to shed light on the possible progenitor histories. We find that

  5. Pulpal progenitors and dentin repair.

    Science.gov (United States)

    Harichane, Y; Hirata, A; Dimitrova-Nakov, S; Granja, I; Goldberg, A; Kellermann, O; Poliard, A

    2011-07-01

    Mesenchymal stem cells are present in the dental pulp. They have been shown to contribute to dentin-like tissue formation in vitro and to participate in bone repair after a mandibular lesion. However, their capacity to contribute efficiently to reparative dentin formation after pulp lesion has never been explored. After pulp exposure, we have identified proliferative cells within 3 zones. In the crown, zone I is near the cavity, and zone II corresponds to the isthmus between the mesial and central pulp. In the root, zone III, near the apex, at a distance from the inflammatory site, contains mitotic stromal cells which may represent a source of progenitor cells. Stem-cell-based strategies are promising treatments for tissue injury in dentistry. Our experiments focused on (1) location of stem cells induced to leave their quiescent state early after pulp injury and (2) implantation of pulp progenitors, a substitute for classic endodontic treatments, paving the way for pulp stem-cell-based therapies.

  6. Transplanting oligodendrocyte progenitors into the adult CNS

    International Nuclear Information System (INIS)

    Franklin, R.J.M.; Blakemore, W.F.; Cambridge Univ.

    1997-01-01

    This review covers a number of aspects of the behaviour of oligodendrocyte progenitors following transplantation into the adult CNS. First, an account is given of the ability of transplanted oligodendrocyte progenitors, grown in tissue culture in the presence of PDGF and bFGF, to extensively remyelinate focal areas of persistent demyelination. Secondly, we describe how transplanted clonal cell lines of oligodendrocyte progenitors will differentiate in to astrocytes as will oligodendrocytes following transplantation into pathological environments in which both oligodendrocytes and astrocytes are absent, thereby manifesting the bipotentially demonstrable in vitro but not during development. Finally, a series of studies examining the migratory behaviour of transplanted oligodendrocyte progenitors (modelled using the oligodendrocyte progenitor cell line CG4) are described. (author)

  7. APC sets the Wnt tone necessary for cerebral cortical progenitor development.

    Science.gov (United States)

    Nakagawa, Naoki; Li, Jingjun; Yabuno-Nakagawa, Keiko; Eom, Tae-Yeon; Cowles, Martis; Mapp, Tavien; Taylor, Robin; Anton, E S

    2017-08-15

    Adenomatous polyposis coli (APC) regulates the activity of β-catenin, an integral component of Wnt signaling. However, the selective role of the APC-β-catenin pathway in cerebral cortical development is unknown. Here we genetically dissected the relative contributions of APC-regulated β-catenin signaling in cortical progenitor development, a necessary early step in cerebral cortical formation. Radial progenitor-specific inactivation of the APC-β-catenin pathway indicates that the maintenance of appropriate β-catenin-mediated Wnt tone is necessary for the orderly differentiation of cortical progenitors and the resultant formation of the cerebral cortex. APC deletion deregulates β-catenin, leads to high Wnt tone, and disrupts Notch1 signaling and primary cilium maintenance necessary for radial progenitor functions. β-Catenin deregulation directly disrupts cilium maintenance and signaling via Tulp3, essential for intraflagellar transport of ciliary signaling receptors. Surprisingly, deletion of β-catenin or inhibition of β-catenin activity in APC-null progenitors rescues the APC-null phenotype. These results reveal that APC-regulated β-catenin activity in cortical progenitors sets the appropriate Wnt tone necessary for normal cerebral cortical development. © 2017 Nakagawa et al.; Published by Cold Spring Harbor Laboratory Press.

  8. Human mammary progenitor cell fate decisions are products of interactions with combinatorial microenvironments

    Energy Technology Data Exchange (ETDEWEB)

    LaBarge, Mark A; Nelson, Celeste M; Villadsen, Rene; Fridriksdottir, Agla; Ruth, Jason R; Stampfer, Martha R; Petersen, Ole W; Bissell, Mina J

    2008-09-19

    In adult tissues, multi-potent progenitor cells are some of the most primitive members of the developmental hierarchies that maintain homeostasis. That progenitors and their more mature progeny share identical genomes, suggests that fate decisions are directed by interactions with extrinsic soluble factors, ECM, and other cells, as well as physical properties of the ECM. To understand regulation of fate decisions, therefore, would require a means of understanding carefully choreographed combinatorial interactions. Here we used microenvironment protein microarrays to functionally identify combinations of cell-extrinsic mammary gland proteins and ECM molecules that imposed specific cell fates on bipotent human mammary progenitor cells. Micropatterned cell culture surfaces were fabricated to distinguish between the instructive effects of cell-cell versus cell-ECM interactions, as well as constellations of signaling molecules; and these were used in conjunction with physiologically relevant 3 dimensional human breast cultures. Both immortalized and primary human breast progenitors were analyzed. We report on the functional ability of those proteins of the mammary gland that maintain quiescence, maintain the progenitor state, and guide progenitor differentiation towards myoepithelial and luminal lineages.

  9. Leukemic blast cell colony formation in semisolid culture with erythropoietin: a case report of acute poorly differentiated erythroid leukemia.

    Science.gov (United States)

    Tomonaga, M; Jinnai, I; Tagawa, M; Amenomori, T; Nishino, K; Yao, E; Nonaka, H; Kuriyama, K; Yoshida, Y; Matsuo, T

    1987-02-01

    The bone marrow of a patient with acute undifferentiated leukemia developed unique colonies after a 14-day culture in erythropoietin (EPO)-containing methylcellulose. The colonies consisted of 20 to 200 nonhemoglobinized large blast cells. Cytogenetic analysis of single colonies revealed hypotetraploid karyotypes with several marker chromosomes that were identical to those found in directly sampled bone marrow. The concurrently formed erythroid bursts showed only normal karyotypes. No leukemic colony formation was observed in other culture systems with either colony-stimulating activity (CSA) or phytohemagglutinin-stimulated leukocyte-conditioned medium (PHA-LCM). The leukemic colonies exhibited a complete EPO-dose dependency similar to that of the patient's normal BFU-E. Although cytochemical and immunologic marker studies of the bone marrow cells failed to clarify the cell lineage of the leukemic cells with extraordinarily large cell size, ultrastructural study revealed erythroid differentiation such as siderosome formation in the cytoplasm and ferritin particles in the rhophecytosis invaginations. These findings indicate that the patient had poorly differentiated erythroid leukemia and that some of the clonogenic cells might respond to EPO in vitro. Corresponding to this biological feature, the leukemic cells were markedly decreased in number in response to repeated RBC transfusions, and partial remission was obtained. These observations suggest that erythroid leukemia distinct from erythroleukemia (M6) with a myeloblastic component, can develop as a minor entity of human acute leukemia.

  10. Differentiation stage-specific regulation of primitive human hematopoietic progenitor cycling by exogenous and endogenous inhibitors in an in vivo model.

    Science.gov (United States)

    Cashman, J D; Clark-Lewis, I; Eaves, A C; Eaves, C J

    1999-12-01

    Nonobese diabetic/severe combined immunodeficient (NOD/SCID) mice transplanted with human cord blood or adult marrow cells and injected 6 weeks posttransplant with 2 daily doses of transforming growth factor-beta(1) (TGF-beta(1)), monocyte chemoattractant protein-1 (MCP-1), or a nonaggregating form of macrophage inflammatory protein-1alpha (MIP-1alpha) showed unique patterns of inhibition of human progenitor proliferation 1 day later. TGF-beta(1) was active on long-term culture initiating cells (LTC-IC) and on primitive erythroid and granulopoietic colony-forming cells (HPP-CFC), but had no effect on mature CFC. MCP-1 inhibited the cycling of both types of HPP-CFC but not LTC-IC. MIP-1alpha did not inhibit either LTC-IC or granulopoietic HPP-CFC but was active on erythroid HPP-CFC and mature granulopoietic CFC. All of these responses were independent of the source of human cells transplanted. LTC-IC of either human cord blood or adult marrow origin continue to proliferate in NOD/SCID mice for many weeks, although the turnover of all types of human CFC in mice transplanted with adult human marrow (but not cord blood) is downregulated after 6 weeks. Interestingly, administration of either MIP-1beta, an antagonist of both MIP-1alpha and MCP-1 or MCP-1(9-76), an antagonist of MCP-1 (and MCP-2 and MCP-3), into mice in which human marrow-derived CFC had become quiescent, caused the rapid reactivation of these progenitors in vivo. These results provide the first definition of stage-specific inhibitors of human hematopoietic progenitor cell cycling in vivo. In addition they show that endogenous chemokines can contribute to late graft failure, which can be reversed by the administration of specific antagonists.

  11. Erythroid Differentiation Regulator 1 as a Novel Biomarker for Hair Loss Disorders.

    Science.gov (United States)

    Woo, Yu Ri; Hwang, Sewon; Jeong, Seo Won; Cho, Dae Ho; Park, Hyun Jeong

    2017-02-03

    Erythroid differentiation regulator 1 (Erdr1) is known to be involved in the inflammatory process via regulating the immune system in many cutaneous disorders, such as psoriasis and rosacea. However, the role of Erdr1 in various hair loss disorders remains unclear. The aim of this study was to investigate the putative role of Erdr1 in alopecias. Skin samples from 21 patients with hair loss disorders and five control subjects were retrieved, in order to assess their expression levels of Erdr1. Results revealed that expression of Erdr1 was significantly downregulated in the epidermis and hair follicles of patients with hair loss disorders, when compared to that in the control group. In particular, the expression of Erdr1 was significantly decreased in patients with alopecia areata. We propose that Erdr1 downregulation might be involved in the pathogenesis of hair loss, and could be considered as a novel biomarker for hair loss disorders.

  12. Comparison of different methods for erythroid differentiation in the K562 cell line.

    Science.gov (United States)

    Shariati, Laleh; Modaress, Mehran; Khanahmad, Hossein; Hejazi, Zahra; Tabatabaiefar, Mohammad Amin; Salehi, Mansoor; Modarressi, Mohammad Hossein

    2016-08-01

    To compare methods for erythroid differentiation of K562 cells that will be promising in the treatment of beta-thalassemia by inducing γ-globin synthesis. Cells were treated separately with: RPMI 1640 medium without glutamine, RPMI 1640 medium without glutamine supplemented with 1 mM sodium butyrate, RPMI 1640 medium supplemented with 1 mM sodium butyrate, 25 µg cisplatin/ml, 0.1 µg cytosine arabinoside/ml. The highest differentiation (84 %) with minimum toxicity was obtained with cisplatin at 15 µg /ml. Real-time RT-PCR showed that expression of the γ-globin gene was significantly higher in the cells differentiated with cisplatin compared to undifferentiated cells (P < 0.001). Cisplatin is useful in the experimental therapy of ß-globin gene defects and can be considered for examining the basic mechanism of γ-reactivation.

  13. The effect of ceruloplasmin on erythroid precursor cells in the marrow of irradiated mice

    International Nuclear Information System (INIS)

    Suda, Toshio; Miura, Yasusada; Ozawa, Keiya; Yamada, Masaaki.

    1981-01-01

    The effect of ceruloplasmine on erythroid colony forming unit (CFU-e) of irradiated mice was investigated. Whole body #betta# ray irradiation of 100rad decreased the number of CFU-e from 154 to 40 per 4 * 10 4 myeloid nucleated cells. When human #betta#-globulin of 1 mg/kg or ceruloplasmin of 1 mg/kg was administrated immediately after irradiation, the number of CFU-e increased to that of more than normal and normal value in 2 days, respectively. In the case where ceruloplasmin was begun to administrated 7 days before irradiation, though the CFU-e number decreased from 144 to 44, the number increased to 317 after 2 days, and gradually decreased to the normal value by 16 days after irradiation. (Nakanishi, T)

  14. Erythroid cell mitochondria receive endosomal iron by a "kiss-and-run" mechanism.

    Science.gov (United States)

    Hamdi, Amel; Roshan, Tariq M; Kahawita, Tanya M; Mason, Anne B; Sheftel, Alex D; Ponka, Prem

    2016-12-01

    In erythroid cells, more than 90% of transferrin-derived iron enters mitochondria where ferrochelatase inserts Fe 2+ into protoporphyrin IX. However, the path of iron from endosomes to mitochondrial ferrochelatase remains elusive. The prevailing opinion is that, after its export from endosomes, the redox-active metal spreads into the cytosol and mysteriously finds its way into mitochondria through passive diffusion. In contrast, this study supports the hypothesis that the highly efficient transport of iron toward ferrochelatase in erythroid cells requires a direct interaction between transferrin-endosomes and mitochondria (the "kiss-and-run" hypothesis). Using a novel method (flow sub-cytometry), we analyze lysates of reticulocytes after labeling these organelles with different fluorophores. We have identified a double-labeled population definitively representing endosomes interacting with mitochondria, as demonstrated by confocal microscopy. Moreover, we conclude that this endosome-mitochondrion association is reversible, since a "chase" with unlabeled holotransferrin causes a time-dependent decrease in the size of the double-labeled population. Importantly, the dissociation of endosomes from mitochondria does not occur in the absence of holotransferrin. Additionally, mutated recombinant holotransferrin, that cannot release iron, significantly decreases the uptake of 59 Fe by reticulocytes and diminishes 59 Fe incorporation into heme. This suggests that endosomes, which are unable to provide iron to mitochondria, cause a "traffic jam" leading to decreased endocytosis of holotransferrin. Altogether, our results suggest that a molecular mechanism exists to coordinate the iron status of endosomal transferrin with its trafficking. Besides its contribution to the field of iron metabolism, this study provides evidence for a new intracellular trafficking pathway of organelles. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Let-7 microRNAs are developmentally regulated in circulating human erythroid cells

    Directory of Open Access Journals (Sweden)

    Reed Christopher

    2009-11-01

    Full Text Available Abstract Background MicroRNAs are ~22nt-long small non-coding RNAs that negatively regulate protein expression through mRNA degradation or translational repression in eukaryotic cells. Based upon their importance in regulating development and terminal differentiation in model systems, erythrocyte microRNA profiles were examined at birth and in adults to determine if changes in their abundance coincide with the developmental phenomenon of hemoglobin switching. Methods Expression profiling of microRNA was performed using total RNA from four adult peripheral blood samples compared to four cord blood samples after depletion of plasma, platelets, and nucleated cells. Labeled RNAs were hybridized to custom spotted arrays containing 474 human microRNA species (miRBase release 9.1. Total RNA from Epstein-Barr virus (EBV-transformed lymphoblastoid cell lines provided a hybridization reference for all samples to generate microRNA abundance profile for each sample. Results Among 206 detected miRNAs, 79% of the microRNAs were present at equivalent levels in both cord and adult cells. By comparison, 37 microRNAs were up-regulated and 4 microRNAs were down-regulated in adult erythroid cells (fold change > 2; p let-7 miRNA family consistently demonstrated increased abundance in the adult samples by array-based analyses that were confirmed by quantitative PCR (4.5 to 18.4 fold increases in 6 of 8 let-7 miRNA. Profiling studies of messenger RNA (mRNA in these cells additionally demonstrated down-regulation of ten let-7 target genes in the adult cells. Conclusion These data suggest that a consistent pattern of up-regulation among let-7 miRNA in circulating erythroid cells occurs in association with hemoglobin switching during the fetal-to-adult developmental transition in humans.

  16. Dihydroartemisinin inhibits the human erythroid cell differentiation by altering the cell cycle

    International Nuclear Information System (INIS)

    Finaurini, Sara; Basilico, Nicoletta; Corbett, Yolanda; D’Alessandro, Sarah; Parapini, Silvia; Olliaro, Piero; Haynes, Richard K.; Taramelli, Donatella

    2012-01-01

    Artemisinin derivatives such as dihydroartemisinin (DHA) induce significant depletion of early embryonic erythroblasts in animal models. We have reported previously that DHA specifically targets pro-erythroblasts and basophilic erythroblasts, when human CD34+ stem cells are differentiated toward the erythroid lineage, indicating that a window of susceptibility to artemisinins may exist also in human developmental erythropoiesis during pregnancy. To better investigate the toxicity of artemisinin derivatives, the structure–activity relationship was evaluated against the K562 leukaemia cell line, used as a model for differentiating early human erythroblasts. All artemisinins derivatives, except deoxyartemisinin, inhibited both spontaneous and induced erythroid differentiation, confirming that the peroxide bridge is responsible for the erythro-toxicity. On the contrary, cell growth was markedly reduced by DHA, artemisone and artesunate but not by artemisinin, 10-deoxoartemisinin or deoxy-artemisinin. The substituent at position C-10 is responsible only for the anti-proliferative effect, since 10-deoxoartemisinin did not reduce cell growth but arrested the differentiation of K562 cells. In particular, the results showed that DHA resulted the most potent and rapidly acting compound of the drug family, causing (i) the decreased expression of GpA surface receptors and the down regulation the γ-globin gene; (ii) the alteration of S phase of cell cycle and (iii) the induction of programmed cell death of early erythroblasts in a dose dependent manner within 24 h. In conclusion, these findings confirm that the active metabolite DHA is responsible for the erythro-toxicity of most of artemisinins used in therapy. Thus, as long as no further clinical data are available, current WHO recommendations of avoiding malaria treatment with artemisinins during the first trimester of pregnancy remain valid.

  17. Hydroxyurea responsiveness in β-thalassemic patients is determined by the stress response adaptation of erythroid progenitors and their differentiation propensity

    NARCIS (Netherlands)

    F. Pourfarzad, F. (Farzin); M.M. von Lindern (Marieke); A. Azarkeivan (Azita); J. Hou (Jun); S.K. Kia; F. Esteghamat (Fatemehsadat); W.F.J. van IJcken (Wilfred); J.N.J. Philipsen (Sjaak); H. Najmabadi (Hossein); F.G. Grosveld (Frank)

    2013-01-01

    textabstractβ-thalassemia is caused by mutations in the β-globin locus resulting in loss of, or reduced, hemoglobin A (adult hemoglobin, HbA, α2β2) production. Hydroxyurea treatment increases fetal γ-globin (fetal hemoglobin, HbF, α2γ2) expression in postnatal life substituting for the missing adult

  18. Hydroxyurea responsiveness in β-thalassemic patients is determined by the stress response adaptation of erythroid progenitors and their differentiation propensity

    NARCIS (Netherlands)

    Pourfarzad, Farzin; von Lindern, Marieke; Azarkeivan, Azita; Hou, Jun; Kia, Sima Kheradmand; Esteghamat, Fatemehsadat; van Ijcken, Wilfred; Philipsen, Sjaak; Najmabadi, Hossein; Grosveld, Frank

    2013-01-01

    β-thalassemia is caused by mutations in the β-globin locus resulting in loss of, or reduced, hemoglobin A (adult hemoglobin, HbA, α2β2) production. Hydroxyurea treatment increases fetal γ-globin (fetal hemoglobin, HbF, α2γ2) expression in postnatal life substituting for the missing adult β-globin

  19. Progenitor cells in pulmonary vascular remodeling

    Science.gov (United States)

    Yeager, Michael E.; Frid, Maria G.; Stenmark, Kurt R.

    2011-01-01

    Pulmonary hypertension is characterized by cellular and structural changes in the walls of pulmonary arteries. Intimal thickening and fibrosis, medial hypertrophy and fibroproliferative changes in the adventitia are commonly observed, as is the extension of smooth muscle into the previously non-muscularized vessels. A majority of these changes are associated with the enhanced presence of α-SM-actin+ cells and inflammatory cells. Atypical abundances of functionally distinct endothelial cells, particularly in the intima (plexiform lesions), and also in the perivascular regions, are also described. At present, neither the origin(s) of these cells nor the molecular mechanisms responsible for their accumulation, in any of the three compartments of the vessel wall, have been fully elucidated. The possibility that they arise from either resident vascular progenitors or bone marrow–derived progenitor cells is now well established. Resident vascular progenitor cells have been demonstrated to exist within the vessel wall, and in response to certain stimuli, to expand and express myofibroblastic, endothelial or even hematopoietic markers. Bone marrow–derived or circulating progenitor cells have also been shown to be recruited to sites of vascular injury and to assume both endothelial and SM-like phenotypes. Here, we review the data supporting the contributory role of vascular progenitors (including endothelial progenitor cells, smooth muscle progenitor cells, pericytes, and fibrocytes) in vascular remodeling. A more complete understanding of the processes by which progenitor cells modulate pulmonary vascular remodeling will undoubtedly herald a renaissance of therapies extending beyond the control of vascular tonicity and reduction of pulmonary artery pressure. PMID:22034593

  20. MiR-27a Promotes Hemin-Induced Erythroid Differentiation of K562 Cells by Targeting CDC25B

    Directory of Open Access Journals (Sweden)

    Dongsheng Wang

    2018-03-01

    Full Text Available Background/Aims: MicroRNAs (miRNAs play a crucial role in erythropoiesis. MiR-23a∼27a∼24-2 clusters have been proven to take part in erythropoiesis via some proteins. CDC25B (cell division control Cdc2 phosphostase B is also the target of mir-27a; whether it regulates erythropoiesis and its mechanism are unknown. Methods: To evaluate the potential role of miR-27a during erythroid differentiation, we performed miR-27a gain- and loss-of-function experiments on hemin-induced K562 cells. We detected miR-27a expression after hemin stimulation at different time points. At the same time, the γ-globin gene also was measured via real-time PCR. According to the results of the chips, we screened the target protein of miR-27a through a dual-luciferase reporter assay and identified it via Western blot analyses. To evaluate the function of CDC25B, benzidine staining and flow cytometry were employed to detect the cell differentiation and cell cycle. Results: We found that miR-27a promotes hemin-induced erythroid differentiation of human K562 cells by targeting cell division cycle 25 B (CDC25B. Overexpression of miR-27a promotes the differentiation of hemin-induced K562 cells, as demonstrated by γ-globin overexpression. The inhibition of miR-27a expression suppresses erythroid differentiation, thus leading to a reduction in the γ-globin gene. CDC25B was identified as a new target of miR-27a during erythroid differentiation. Overexpression of miR-27a led to decreased CDC25B expression after hemin treatment, and CDC25B was up-regulated when miR-27a expression was inhibited. Moreover, the inhibition of CDC25B affected erythroid differentiation, as assessed by γ-globin expression. Conclusion: This study is the first report of the interaction between miR-27a and CDC25B, and it improves the understanding of miRNA functions during erythroid differentiation.

  1. Lhx2 expression promotes self-renewal of a distinct multipotential hematopoietic progenitor cell in embryonic stem cell-derived embryoid bodies.

    Directory of Open Access Journals (Sweden)

    Lina Dahl

    Full Text Available The molecular mechanisms regulating the expansion of the hematopoietic system including hematopoietic stem cells (HSCs in the fetal liver during embryonic development are largely unknown. The LIM-homeobox gene Lhx2 is a candidate regulator of fetal hematopoiesis since it is expressed in the fetal liver and Lhx2(-/- mice die in utero due to severe anemia. Moreover, expression of Lhx2 in embryonic stem (ES cell-derived embryoid bodies (EBs can lead to the generation of HSC-like cell lines. To further define the role of this transcription factor in hematopoietic regulation, we generated ES cell lines that enabled tet-inducible expression of Lhx2. Using this approach we observed that Lhx2 expression synergises with specific signalling pathways, resulting in increased frequency of colony forming cells in developing EB cells. The increase in growth factor-responsive progenitor cells directly correlates to the efficiency in generating HSC-like cell lines, suggesting that Lhx2 expression induce self-renewal of a distinct multipotential hematopoietic progenitor cell in EBs. Signalling via the c-kit tyrosine kinase receptor and the gp130 signal transducer by IL-6 is necessary and sufficient for the Lhx2 induced self-renewal. While inducing self-renewal of multipotential progenitor cells, expression of Lhx2 inhibited proliferation of primitive erythroid precursor cells and interfered with early ES cell commitment, indicating striking lineage specificity of this effect.

  2. Erythrocyte enrichment in hematopoietic progenitor cell cultures based on magnetic susceptibility of the hemoglobin.

    Directory of Open Access Journals (Sweden)

    Xiaoxia Jin

    Full Text Available Using novel media formulations, it has been demonstrated that human placenta and umbilical cord blood-derived CD34+ cells can be expanded and differentiated into erythroid cells with high efficiency. However, obtaining mature and functional erythrocytes from the immature cell cultures with high purity and in an efficient manner remains a significant challenge. A distinguishing feature of a reticulocyte and maturing erythrocyte is the increasing concentration of hemoglobin and decreasing cell volume that results in increased cell magnetophoretic mobility (MM when exposed to high magnetic fields and gradients, under anoxic conditions. Taking advantage of these initial observations, we studied a noninvasive (label-free magnetic separation and analysis process to enrich and identify cultured functional erythrocytes. In addition to the magnetic cell separation and cell motion analysis in the magnetic field, the cell cultures were characterized for cell sedimentation rate, cell volume distributions using differential interference microscopy, immunophenotyping (glycophorin A, hemoglobin concentration and shear-induced deformability (elongation index, EI, by ektacytometry to test for mature erythrocyte attributes. A commercial, packed column high-gradient magnetic separator (HGMS was used for magnetic separation. The magnetically enriched fraction comprised 80% of the maturing cells (predominantly reticulocytes that showed near 70% overlap of EI with the reference cord blood-derived RBC and over 50% overlap with the adult donor RBCs. The results demonstrate feasibility of label-free magnetic enrichment of erythrocyte fraction of CD34+ progenitor-derived cultures based on the presence of paramagnetic hemoglobin in the maturing erythrocytes.

  3. Biosynthesis of heme in immature erythroid cells. The regulatory step for heme formation in the human erythron

    International Nuclear Information System (INIS)

    Gardner, L.C.; Cox, T.M.

    1988-01-01

    Heme formation in reticulocytes from rabbits and rodents is subject to end product negative feedback regulation: intracellular free heme has been shown to control acquisition of transferrin iron for heme synthesis. To identify the site of control of heme biosynthesis in the human erythron, immature erythroid cells were obtained from peripheral blood and aspirated bone marrow. After incubation with human 59Fe transferrin, 2-[14C]glycine, or 4-[14C]delta-aminolevulinate, isotopic incorporation into extracted heme was determined. Addition of cycloheximide to increase endogenous free heme, reduced incorporation of labeled glycine and iron but not delta-aminolevulinate into cell heme. Incorporation of glycine and iron was also sensitive to inhibition by exogenous hematin (Ki, 30 and 45 microM, respectively) i.e. at concentrations in the range which affect cell-free protein synthesis in reticulocyte lysates. Hematin treatment rapidly diminished incorporation of intracellular 59Fe into heme by human erythroid cells but assimilation of 4-[14C]delta-aminolevulinate into heme was insensitive to inhibition by hematin (Ki greater than 100 microM). In human reticulocytes (unlike those from rabbits), addition of ferric salicylaldehyde isonicotinoylhydrazone, to increase the pre-heme iron pool independently of the transferrin cycle, failed to promote heme synthesis or modify feedback inhibition induced by hematin. In human erythroid cells (but not rabbit reticulocytes) pre-incubation with unlabeled delta-aminolevulinate or protoporphyrin IX greatly stimulated utilization of cell 59Fe for heme synthesis and also attenuated end product inhibition. In human erythroid cells heme biosynthesis is thus primarily regulated by feedback inhibition at one or more steps which lead to delta-aminolevulinate formation

  4. Disturbances in the positioning, proliferation, and apoptosis of neural progenitors contribute to subcortical band heterotopia formation

    Science.gov (United States)

    Fitzgerald, MP; Covio, M; Lee, KS

    2011-01-01

    Cortical malformations are commonly associated with intractable epilepsy and other developmental disorders. Our studies utilize the tish rat, a spontaneously occurring genetic model of subcortical band heterotopia (SBH) associated with epilepsy, to evaluate the developmental events underlying SBH formation in the neocortex. Our results demonstrate that Pax6+ and Tbr2+ progenitors are mislocalized in tish+/− and tish−/− neocortex throughout neurogenesis. In addition, mislocalized tish−/− progenitors possess a longer cell cycle than wildtype or normally-positioned tish−/− progenitors, owing to a lengthened G2+M+G1 time. This mislocalization is not associated with adherens junction breakdown or loss of radial glial polarity in the ventricular zone, as assessed by immunohistochemistry against phalloidin (to identify F-actin), aPKC-λ, and Par3. However, vimentin immunohistochemistry indicates that the radial glial scaffold is disrupted in the region of the tish−/− heterotopia. Moreover, lineage tracing experiments using in utero electroporation in tish−/− neocortex demonstrate that mislocalized progenitors do not retain contact with the ventricular surface and that ventricular/subventricular zone progenitors produce neurons that migrate into both the heterotopia and cortical plate. Taken together, these findings define a series of developmental errors contributing to SBH formation that differs fundamentally from a primary error in neuronal migration. PMID:21145942

  5. Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

    OpenAIRE

    Jaako, Pekka; Debnath, Shubhranshu; Olsson, Karin; Zhang, Y; Flygare, Johan; Lindström, M S; Bryder, David; Karlsson, Stefan

    2015-01-01

    Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of Mdm2, the main negative regulator of p53, by the 5S ribonucleoprot...

  6. Establishment and characterization of a unique 1 μm diameter liver-derived progenitor cell line

    International Nuclear Information System (INIS)

    Aravalli, Rajagopal N.; Behnan Sahin, M.; Cressman, Erik N.K.; Steer, Clifford J.

    2010-01-01

    Liver-derived progenitor cells (LDPCs) are recently identified novel stem/progenitor cells from healthy, unmanipulated adult rat livers. They are distinct from other known liver stem/progenitor cells such as the oval cells. In this study, we have generated a LDPC cell line RA1 by overexpressing the simian virus 40 (SV40) large T antigen (TAg) in primary LDPCs. This cell line was propagated continuously for 55 passages in culture, after which it became senescent. Interestingly, following transformation with SV40 TAg, LDPCs decreased in size significantly and the propagating cells measured 1 μm in diameter. RA1 cells proliferated in vitro with a doubling time of 5-7 days, and expressed cell surface markers of LDPCs. In this report, we describe the characterization of this novel progenitor cell line that might serve as a valuable model to study liver cell functions and stem cell origin of liver cancers.

  7. Establishment and characterization of a unique 1 {mu}m diameter liver-derived progenitor cell line

    Energy Technology Data Exchange (ETDEWEB)

    Aravalli, Rajagopal N., E-mail: arava001@umn.edu [Department of Radiology, University of Minnesota Medical School, Minneapolis, MN 55455 (United States); Behnan Sahin, M. [Department of Medicine, University of Minnesota Medical School, Minneapolis, MN 55455 (United States); Cressman, Erik N.K. [Department of Radiology, University of Minnesota Medical School, Minneapolis, MN 55455 (United States); Steer, Clifford J., E-mail: steer001@umn.edu [Department of Medicine, University of Minnesota Medical School, Minneapolis, MN 55455 (United States); Department of Genetics, Cell Biology, and Development, University of Minnesota Medical School, Minneapolis, MN 55455 (United States)

    2010-01-01

    Liver-derived progenitor cells (LDPCs) are recently identified novel stem/progenitor cells from healthy, unmanipulated adult rat livers. They are distinct from other known liver stem/progenitor cells such as the oval cells. In this study, we have generated a LDPC cell line RA1 by overexpressing the simian virus 40 (SV40) large T antigen (TAg) in primary LDPCs. This cell line was propagated continuously for 55 passages in culture, after which it became senescent. Interestingly, following transformation with SV40 TAg, LDPCs decreased in size significantly and the propagating cells measured 1 {mu}m in diameter. RA1 cells proliferated in vitro with a doubling time of 5-7 days, and expressed cell surface markers of LDPCs. In this report, we describe the characterization of this novel progenitor cell line that might serve as a valuable model to study liver cell functions and stem cell origin of liver cancers.

  8. FHL2 interacts with CALM and is highly expressed in acute erythroid leukemia

    International Nuclear Information System (INIS)

    Pašaliç, Z; Greif, P A; Jurinoviç, V; Mulaw, M; Kakadia, P M; Tizazu, B; Fröhlich-Archangelo, L; Krause, A; Bohlander, S K

    2011-01-01

    The t(10;11)(p13;q14) translocation results in the fusion of the CALM (clathrin assembly lymphoid myeloid leukemia protein) and AF10 genes. This translocation is observed in acute myeloblastic leukemia (AML M6), acute lymphoblastic leukemia (ALL) and malignant lymphoma. Using a yeast two-hybrid screen, the four and a half LIM domain protein 2 (FHL2) was identified as a CALM interacting protein. Recently, high expression of FHL2 in breast, gastric, colon, lung as well as in prostate cancer was shown to be associated with an adverse prognosis. The interaction between CALM and FHL2 was confirmed by glutathione S-transferase-pulldown assay and co-immunoprecipitation experiments. The FHL2 interaction domain of CALM was mapped to amino acids 294–335 of CALM. The transcriptional activation capacity of FHL2 was reduced by CALM, but not by CALM/AF10, which suggests that regulation of FHL2 by CALM might be disturbed in CALM/AF10-positive leukemia. Extremely high expression of FHL2 was seen in acute erythroid leukemia (AML M6). FHL2 was also highly expressed in chronic myeloid leukemia and in AML with complex aberrant karyotype. These results suggest that FHL2 may play an important role in leukemogenesis, especially in the case of AML M6

  9. Effect of interleukin-9 on clonogenic maturation and cell-cycle status of fetal and adult hematopoietic progenitors

    Energy Technology Data Exchange (ETDEWEB)

    Holbrook, S.T.; Ohls, R.K.; Schibler, K.R.; Yang, Y.C.; Christensen, R.D. (Univ. of Utah School of Medicine, Salt Lake City (USA))

    1991-05-15

    We assessed the effect of interleukin-9 (IL-9) on clonogenic maturation and cell-cycle status of hematopoietic progenitors of fetal (umbilical cord blood) and adult (bone marrow) origin. As a single agent IL-9 supported, in a concentration-dependent fashion, maturation of burst-forming units-erythroid (BFU-E) of adult and fetal origin. However, only 1/3 the number of adult BFU-E colonies developed, as did in response to granulocyte-macrophage colony-stimulating factor (GM-CSF), and only 1/6 the number developed as did in response to IL-3. In contrast, the effect of IL-9 on fetal BFU-E colonies was equal to that of GM-CSF and IL-3. Synergistic effects of IL-9 with low concentrations (0.1 ng/mL) of GM-CSF and IL-3 were seen on adult BFU-E colony formation, but no effect was apparent at higher concentrations (1.0 ng/mL). In contrast, using fetal cells, synergistic effects of IL-9 with low and high concentrations of GM-CSF and IL-3 were apparent. Addition of IL-9 to plates containing fetal cells plus GM-CSF and IL-3 not only resulted in more BFU-E colonies, but also in more multicentered (greater than or equal to 10 individual centers) colonies, and more cells per colony. IL-9 had a wider spectrum of action on progenitors of fetal origin than on progenitors of adult origin, supporting the generation of fetal multipotent colony-forming unit (CFU)-Mix and CFU-GM colonies. Incubation with IL-9 did not accelerate cycling of adult or fetal BFU-E, CFU-Mix, or CFU-GM to the extent observed after incubation with IL-6.

  10. Effect of interleukin-9 on clonogenic maturation and cell-cycle status of fetal and adult hematopoietic progenitors

    International Nuclear Information System (INIS)

    Holbrook, S.T.; Ohls, R.K.; Schibler, K.R.; Yang, Y.C.; Christensen, R.D.

    1991-01-01

    We assessed the effect of interleukin-9 (IL-9) on clonogenic maturation and cell-cycle status of hematopoietic progenitors of fetal (umbilical cord blood) and adult (bone marrow) origin. As a single agent IL-9 supported, in a concentration-dependent fashion, maturation of burst-forming units-erythroid (BFU-E) of adult and fetal origin. However, only 1/3 the number of adult BFU-E colonies developed, as did in response to granulocyte-macrophage colony-stimulating factor (GM-CSF), and only 1/6 the number developed as did in response to IL-3. In contrast, the effect of IL-9 on fetal BFU-E colonies was equal to that of GM-CSF and IL-3. Synergistic effects of IL-9 with low concentrations (0.1 ng/mL) of GM-CSF and IL-3 were seen on adult BFU-E colony formation, but no effect was apparent at higher concentrations (1.0 ng/mL). In contrast, using fetal cells, synergistic effects of IL-9 with low and high concentrations of GM-CSF and IL-3 were apparent. Addition of IL-9 to plates containing fetal cells plus GM-CSF and IL-3 not only resulted in more BFU-E colonies, but also in more multicentered (greater than or equal to 10 individual centers) colonies, and more cells per colony. IL-9 had a wider spectrum of action on progenitors of fetal origin than on progenitors of adult origin, supporting the generation of fetal multipotent colony-forming unit (CFU)-Mix and CFU-GM colonies. Incubation with IL-9 did not accelerate cycling of adult or fetal BFU-E, CFU-Mix, or CFU-GM to the extent observed after incubation with IL-6

  11. Heterogeneity of limbal basal epithelial progenitor cells.

    Science.gov (United States)

    Hayashida, Yasutaka; Li, Wei; Chen, Ying-Ting; He, Hua; Chen, Szu-yu; Kheirkah, Ahmad; Zhu, Ying-Tien; Matsumoto, Yukihiro; Tseng, Scheffer C G

    2010-11-01

    Although corneal epithelial stem cells (SCs) are located at the limbus between the cornea and the conjunctiva, not all limbal basal epithelial cells are SCs. Using 2 dispase digestions to remove different amounts of limbal basal epithelial cells for cross-sections, flat mounts, and cytospin preparations, double immunostaining to pancytokeratins (PCK) and vimentin (Vim) identified 3 p63+ epithelial progenitors such as PCK-/Vim+, PCK/Vim, and PCK-/Vim+ and 1 p63+ mesenchymal cell, PCK-/Vim+. PCK-/Vim- progenitors had the smallest cell size were 10-20 times more enriched on collagen I-coated dishes in the 5-minute rapid adherent fraction that contained the highest percentage of p63+ cells but the lowest percentage of cytokeratin12+ cells, and gave rise to high Ki67 labeling and vivid clonal growth. In contrast, PCK+/Vim+ and PCK+/Vim- progenitors were found more in the slow-adherent fraction and yielded poor clonal growth. PCK/Vim progenitors and clusters of PCK-/Vim+ mesenchymal cells, which were neither melanocytes nor Langerhans cells, were located in the limbal basal region. Therefore, differential expression of PCK and Vim helps identify small PCK-/Vim- cells as the most likely candidate for SCs among a hierarchy of heterogeneous limbal basal progenitors, and their close association with PCK-/Vim+ presumed "niche" cells.

  12. Involvement of placental/umbilical cord blood acid-base status and gas values on the radiosensitivity of human fetal/neonatal hematopoietic stem/progenitor cells

    International Nuclear Information System (INIS)

    Yamaguchi, Masaru; Ebina, Satoko; Kashiwakura, Ikuo

    2013-01-01

    Arterial cord blood (CB) acid-base status and gas values, such as pH, PCO 2 , PO 2 , HCO 3 - and base excess, provide useful information on the fetal and neonatal condition. However, it remains unknown whether these values affect the radiosensitivity of fetal/neonatal hematopoiesis. The present study evaluated the relationship between arterial CB acid-base status, gas values, and the radiosensitivity of CB hematopoietic stem/progenitor cells (HSPCs). A total of 25 CB units were collected. The arterial CB acid-base status and gas values were measured within 30 min of delivery. The CD34 + HSPCs obtained from CB were exposed to 2 Gy X-irradiation, and then assayed for colony-forming unit-granulocyte-macrophage, burst-forming unit-erythroid (BFU-E), and colony-forming unit-granulocyte erythroid, macrophage and megakaryocyte cells. Acid-base status and gas values for PCO 2 and HCO 3 - showed a statistically significant negative correlation with the surviving fraction of BFU-E. In addition, a significant positive correlation was observed between gestational age and PCO 2 . Moreover, the surviving fraction of BFU-E showed a significant negative correlation with gestational age. Thus, HSPCs obtained from CB with high PCO 2 /HCO 3 - levels were sensitive to X-irradiation, which suggests that the status of arterial PCO 2 /HCO 3 - influences the radiosensitivity of fetal/neonatal hematopoiesis, especially erythropoiesis. (author)

  13. Haemopoietic progenitor cells in human peripheral blood

    International Nuclear Information System (INIS)

    Zwaan, F.E.

    1980-01-01

    The purpose of the investigation reported is to purify haemopoietic progenitor cells from human peripheral blood using density gradient centrifugation in order to isolate a progenitor cell fraction without immunocompetent cells. The purification technique of peripheral blood flow colony forming unit culture (CFU-c) by means of density gradient centrifugation and a combined depletion of various rosettes is described. The results of several 'in vitro' characteristics of purified CFU-c suspensions and of the plasma clot diffusion chamber culture technique are presented. Irradiation studies revealed that for both human bone marrow and peripheral blood the CFU-c were less radioresistant than clusters. Elimination of monocytes (and granulocytes) from the test suspensions induced an alteration in radiosensitivity pararmeters. The results obtained with the different techniques are described by analysing peripheral progenitor cell activity in myeloproliferative disorders. (Auth.)

  14. Analysis of gene expression in small numbers of purified hemopoietic progenitor cells by RT-PCR.

    Science.gov (United States)

    Ziegler, B L; Lamping, C P; Thoma, S J; Fliedner, T M

    1995-05-01

    Primitive hemopoietic stem cells represent the most probable targets for genetic alterations due to exposure to ionizing irradiation or chemical carcinogens. We have applied a two-step protocol for the purification of CD34+HLA-DR-/low hemopoietic progenitor cells from cord blood (CB). CD34+ cells were isolated by monoclonal antibody (mAb) against CD34 (My10) and immunomagnetic beads. Beads were cleaved off the CD34+ cells by enzymatic treatment with chymopapain. Due to chymopapain-resistance of epitopes recognized by the used mAbs purity control of CD34+ cells and separation into CD34+HLA-DR-/low and CD34+HLA-DR+ subsets could be performed by using flow cytometry. Two miniaturized procedures were applied to isolate poly(A)+ mRNA for the reverse transcription polymerase chain reaction (RT-PCR) from small numbers of CD34+HLA-DR-/low cells. In five experiments, the mean purity of immunomagnetically isolated CD34+ cells was 93.8% +/- 3.9. Flow cytometry sorting of CD34+ cells resulted in pure CD34+HLA-DR-/low populations (purity > 98.8%; range 98.8% to 99.9%; viability > 96%) with an average yield of 2600 +/- 800 cells/5 x 10(7) low density CB cells. By RT-PCR using both poly(A)+ mRNA isolation procedures, sequences corresponding to CD34 and beta 2-microglobulin were amplified from as few as 20 cells. Furthermore, a sequence-independent RT-PCR (SIP-RT-PCR) was applied to amplify the cDNA derived from five erythroblasts isolated from a burst-forming unit-erythroid (BFU-E). Upon hybridization, full-length c-fos message was detected in the SIP-RT-PCR amplified material. Our data demonstrate that gene expression can be detected at the transcriptional level in small numbers of hemopoietic progenitor cells. In addition, the SIP-RT-PCR may allow the amplification of unique mRNA species when subtractive hybridization procedures are performed. The presented data should be useful to analyze gene expression in rare subsets of radiation-exposed immature hemopoietic stem/progenitor

  15. X Inactivation and Progenitor Cancer Cells

    Directory of Open Access Journals (Sweden)

    Ruben Agrelo

    2011-04-01

    Full Text Available In mammals, silencing of one of the two X chromosomes is necessary to achieve dosage compensation. The 17 kb non-coding RNA called Xist triggers X inactivation. Gene silencing by Xist can only be achieved in certain contexts such as in cells of the early embryo and in certain hematopoietic progenitors where silencing factors are present. Moreover, these epigenetic contexts are maintained in cancer progenitors in which SATB1 has been identified as a factor related to Xist-mediated chromosome silencing.

  16. Antioxidant mechanism of black garlic extract involving nuclear factor erythroid 2-like factor 2 pathway.

    Science.gov (United States)

    Ha, Ae Wha; Kim, Woo Kyoung

    2017-06-01

    Although studies have revealed that black garlic is a potent antioxidant, its antioxidant mechanism remains unclear. The objective of this study was to determine black garlic's antioxidant activities and possible antioxidant mechanisms related to nuclear factor erythroid 2-like factor 2 (Nrf2)-Keap1 complex. After four weeks of feeding rats with a normal fat diet (NF), a high-fat diet (HF), a high-fat diet with 0.5% black garlic extract (HF+BGE 0.5), a high-fat diet with 1.0% black garlic extract (HF+BGE 1.0), or a high-fat diet with 1.5% black garlic extract (HF+BGE 1.5), plasma concentrations of glucose, insulin,homeostatic model assessment of insulin resistance (HOMA-IR) were determined. As oxidative stress indices, plasma concentrations of thiobarbituric acid reactive substances (TBARS) and 8-isoprostaglandin F2α (8-iso-PGF) were determined. To measure antioxidant capacities, plasma total antioxidant capacity (TAC) and activities of antioxidant enzymes in plasma and liver were determined. The mRNA expression levels of antioxidant related proteins such as Nrf2, NAD(P)H: quinone-oxidoreductase-1 (NQO1), heme oxygenase-1 (HO-1), glutathione reductase (GR), and glutathione S-transferase alpha 2 (GSTA2) were examined. Plasma glucose level, plasma insulin level, and HOMA-IR in black garlic supplemented groups were significantly ( P concentration and TAC in the HF+BGE 1.5 group were significantly decreased compared to those of the HF group. The activities of catalase and glutathione peroxidase were significantly ( P antioxidant systems in rats fed with black garlic extract were related to mRNA expression levels of Nrf2 related genes.

  17. Haematopoietic stem and progenitor cells from human pluripotent stem cells

    Science.gov (United States)

    Sugimura, Ryohichi; Jha, Deepak Kumar; Han, Areum; Soria-Valles, Clara; da Rocha, Edroaldo Lummertz; Lu, Yi-Fen; Goettel, Jeremy A.; Serrao, Erik; Rowe, R. Grant; Malleshaiah, Mohan; Wong, Irene; Sousa, Patricia; Zhu, Ted N.; Ditadi, Andrea; Keller, Gordon; Engelman, Alan N.; Snapper, Scott B.; Doulatov, Sergei; Daley, George Q.

    2018-01-01

    A variety of tissue lineages can be differentiated from pluripotent stem cells by mimicking embryonic development through stepwise exposure to morphogens, or by conversion of one differentiated cell type into another by enforced expression of master transcription factors. Here, to yield functional human haematopoietic stem cells, we perform morphogen-directed differentiation of human pluripotent stem cells into haemogenic endothelium followed by screening of 26 candidate haematopoietic stem-cell-specifying transcription factors for their capacity to promote multi-lineage haematopoietic engraftment in mouse hosts. We recover seven transcription factors (ERG, HOXA5, HOXA9, HOXA10, LCOR, RUNX1 and SPI1) that are sufficient to convert haemogenic endothelium into haematopoietic stem and progenitor cells that engraft myeloid, B and T cells in primary and secondary mouse recipients. Our combined approach of morphogen-driven differentiation and transcription-factor-mediated cell fate conversion produces haematopoietic stem and progenitor cells from pluripotent stem cells and holds promise for modelling haematopoietic disease in humanized mice and for therapeutic strategies in genetic blood disorders. PMID:28514439

  18. Cataclysmic Variables as Supernova Ia Progenitors

    Directory of Open Access Journals (Sweden)

    Stella Kafka

    2012-06-01

    Full Text Available Although the identification of the progenitors of type Ia supernovae (SNeIa remains controversial, it is generally accepted that they originate from binary star systems in which at least one component is a carbon-oxygen white dwarf (WD; those systems are grouped under the wide umbrella of cataclysmic variables. Current theories for SNeIa progenitors hold that, either via Roche lobe overflow of the companion or via a wind, the WD accumulates hydrogen or helium rich material which is then burned to C and O onto the WD’s surface. However, the specifics of this scenario are far from being understood or defined, allowing for a wealth of theories fighting for attention and a dearth of observations to support them. I discuss the latest attempts to identify and study those controversial SNeIa progenitors. I also introduce the most promising progenitor in hand and I present observational diagnostics that can reveal more members of the category.

  19. Cardiac Progenitor Cell Extraction from Human Auricles

    KAUST Repository

    Di Nardo, Paolo; Pagliari, Francesca

    2017-01-01

    by precursor cells mostly embedded into the heart apex and in the atria. We have shown that an elective region of progenitor cell embedding is represented by the auricles, non-contractile atria appendages that can be easily sampled without harming the patient

  20. SUPERNOVA REMNANT PROGENITOR MASSES IN M31

    Energy Technology Data Exchange (ETDEWEB)

    Jennings, Zachary G.; Williams, Benjamin F.; Dalcanton, Julianne J.; Gilbert, Karoline M.; Fouesneau, Morgan; Weisz, Daniel R. [Department of Astronomy, University of Washington Seattle, Box 351580, WA 98195 (United States); Murphy, Jeremiah W. [Department of Astrophysical Sciences, Princeton University, Princeton, NJ 08544 (United States); Dolphin, Andrew E., E-mail: zachjenn@uw.edu, E-mail: adolphin@raytheon.com [Raytheon, 1151 East Hermans Road, Tucson, AZ 85706 (United States)

    2012-12-10

    Using Hubble Space Telescope photometry, we age-date 59 supernova remnants (SNRs) in the spiral galaxy M31 and use these ages to estimate zero-age main-sequence masses (M{sub ZAMS}) for their progenitors. To accomplish this, we create color-magnitude diagrams (CMDs) and employ CMD fitting to measure the recent star formation history of the regions surrounding cataloged SNR sites. We identify any young coeval population that likely produced the progenitor star, then assign an age and uncertainty to that population. Application of stellar evolution models allows us to infer the M{sub ZAMS} from this age. Because our technique is not contingent on identification or precise location of the progenitor star, it can be applied to the location of any known SNRs. We identify significant young star formation around 53 of the 59 SNRs and assign progenitor masses to these, representing a factor of {approx}2 increase over currently measured progenitor masses. We consider the remaining six SNRs as either probable Type Ia candidates or the result of core-collapse progenitors that have escaped their birth sites. In general, the distribution of recovered progenitor masses is bottom-heavy, showing a paucity of the most massive stars. If we assume a single power-law distribution, dN/dM{proportional_to}M{sup {alpha}}, then we find a distribution that is steeper than a Salpeter initial mass function (IMF) ({alpha} = -2.35). In particular, we find values of {alpha} outside the range -2.7 {>=} {alpha} {>=} -4.4 to be inconsistent with our measured distribution at 95% confidence. If instead we assume a distribution that follows a Salpeter IMF up to some maximum mass, then we find that values of M{sub Max} > 26 are inconsistent with the measured distribution at 95% confidence. In either scenario, the data suggest that some fraction of massive stars may not explode. The result is preliminary and requires more SNRs and further analysis. In addition, we use our distribution to estimate a

  1. Characterization of Hemagglutinin Negative Botulinum Progenitor Toxins

    Directory of Open Access Journals (Sweden)

    Suzanne R. Kalb

    2017-06-01

    Full Text Available Botulism is a disease involving intoxication with botulinum neurotoxins (BoNTs, toxic proteins produced by Clostridium botulinum and other clostridia. The 150 kDa neurotoxin is produced in conjunction with other proteins to form the botulinum progenitor toxin complex (PTC, alternating in size from 300 kDa to 500 kDa. These progenitor complexes can be classified into hemagglutinin positive or hemagglutinin negative, depending on the ability of some of the neurotoxin-associated proteins (NAPs to cause hemagglutination. The hemagglutinin positive progenitor toxin complex consists of BoNT, nontoxic non-hemagglutinin (NTNH, and three hemagglutinin proteins; HA-70, HA-33, and HA-17. Hemagglutinin negative progenitor toxin complexes contain BoNT and NTNH as the minimally functional PTC (M-PTC, but not the three hemagglutinin proteins. Interestingly, the genome of hemagglutinin negative progenitor toxin complexes comprises open reading frames (orfs which encode for three proteins, but the existence of these proteins has not yet been extensively demonstrated. In this work, we demonstrate that these three proteins exist and form part of the PTC for hemagglutinin negative complexes. Several hemagglutinin negative strains producing BoNT/A, /E, and /F were found to contain the three open reading frame proteins. Additionally, several BoNT/A-containing bivalent strains were examined, and NAPs from both genes, including the open reading frame proteins, were associated with BoNT/A. The open reading frame encoded proteins are more easily removed from the botulinum complex than the hemagglutinin proteins, but are present in several BoNT/A and /F toxin preparations. These are not easily removed from the BoNT/E complex, however, and are present even in commercially-available purified BoNT/E complex.

  2. Origin of hemopoietic stromal progenitor cells in chimeras

    International Nuclear Information System (INIS)

    Chertkov, J.L.; Drize, N.J.; Gurevitch, O.A.; Samoylova, R.S.

    1985-01-01

    Intravenously injected bone marrow cells do not participate in the regeneration of hemopoietic stromal progenitors in irradiated mice, nor in the curetted parts of the recipient's marrow. The hemopoietic stromal progenitors in allogeneic chimeras are of recipient origin. The adherent cell layer (ACL) of long-term cultures of allogeneic chimera bone marrow contains only recipient hemopoietic stromal progenitors. However, in ectopic hemopoietic foci produced by marrow implantation under the renal capsule and repopulated by the recipient hemopoietic cells after irradiation and reconstitution by syngeneic hemopoietic cells, the stromal progenitors were of implant donor origin, as were stromal progenitors of the ACL in long-term cultures of hemopoietic cells from ectopic foci. Our results confirm that the stromal and hemopoietic progenitors differ in origin and that hemopoietic stromal progenitors are not transplantable by the intravenous route in mice

  3. FGF8 activates proliferation and migration in mouse post-natal oligodendrocyte progenitor cells.

    Directory of Open Access Journals (Sweden)

    Pablo Cruz-Martinez

    Full Text Available Fibroblast growth factor 8 (FGF8 is a key molecular signal that is necessary for early embryonic development of the central nervous system, quickly disappearing past this point. It is known to be one of the primary morphogenetic signals required for cell fate and survival processes in structures such as the cerebellum, telencephalic and isthmic organizers, while its absence causes severe abnormalities in the nervous system and the embryo usually dies in early stages of development. In this work, we have observed a new possible therapeutic role for this factor in demyelinating disorders, such as leukodystrophy or multiple sclerosis. In vitro, oligodendrocyte progenitor cells were cultured with differentiating medium and in the presence of FGF8. Differentiation and proliferation studies were performed by immunocytochemistry and PCR. Also, migration studies were performed in matrigel cultures, where oligodendrocyte progenitor cells were placed at a certain distance of a FGF8-soaked heparin bead. The results showed that both migration and proliferation was induced by FGF8. Furthermore, a similar effect was observed in an in vivo demyelinating mouse model, where oligodendrocyte progenitor cells were observed migrating towards the FGF8-soaked heparin beads where they were grafted. In conclusion, the results shown here demonstrate that FGF8 is a novel factor to induce oligodendrocyte progenitor cell activation, migration and proliferation in vitro, which can be extrapolated in vivo in demyelinated animal models.

  4. Role of the mitochondrial amino acid pool in the differential sensitivity of erythroid and myeloid cells to chloramphenicol

    International Nuclear Information System (INIS)

    Abou-Khalil, S.; Abou-Khalil, W.H.; Whitney, P.L.; Yunis, A.A.

    1986-01-01

    Previous studies in the authors laboratory have suggested that mitochondrial amino acid (AA) pool is involved in the differential sensitivity of erythroid and myeloid cells to chloramphenicol (CAP). The present study examines the role of AA pool by analysis of its composition and testing the effects of its major components. The endogenous AA composition of isolated mitochondria protein was determined using a JEOL 5AH AA analyzer. L-( 14 C) leucine incorporation into mitochondrial protein was used to measure the rate of protein synthesis. Analysis of the endogenous pool in erythroleukemia (EM) and chloroleukemia (CM) mitochrondria showed similar total amount of AAs. However, some AAs were present in significantly higher or lower quantity within EM and CM (i.e. EM had about 2-fold higher glycine content). When compensating for each low AA addition of that particular acid to the reaction medium, only glycine and serine had significant effect. Thus, the addition of increasing concentrations of glycine or serine enhanced the sensitivity to CAP from 14% to 49-51% in CM but not in EM. Other AAs gave little or no effect. Since glycine is one of the first reactants in heme biosynthesis within mitochondria and is interconvertible with serine, it would appear that erythroid cells sensitivity to CAP is determined by the mitochondrial glycine-serine pool and may be somehow related of the pathway to heme biosynthesis in these cells

  5. THE AGES OF TYPE Ia SUPERNOVA PROGENITORS

    International Nuclear Information System (INIS)

    Brandt, Timothy D.; Aubourg, Eric; Strauss, Michael A.; Tojeiro, Rita; Heavens, Alan; Jimenez, Raul

    2010-01-01

    Using light curves and host galaxy spectra of 101 Type Ia supernovae (SNe Ia) with redshift z ∼ 2.4 Gyr. We find that each channel contributes roughly half of the Type Ia rate in our reference sample. We also construct the average spectra of high-stretch and low-stretch SN Ia host galaxies, and find that the difference of these spectra looks like a main-sequence B star with nebular emission lines indicative of star formation. This supports our finding that there are two populations of SNe Ia, and indicates that the progenitors of high-stretch supernovae are at the least associated with very recent star formation in the last few tens of Myr. Our results provide valuable constraints for models of Type Ia progenitors and may help improve the calibration of SNe Ia as standard candles.

  6. Interneuron progenitor transplantation to treat CNS dysfunction

    Directory of Open Access Journals (Sweden)

    Muhammad O Chohan

    2016-08-01

    Full Text Available Due to the inadequacy of endogenous repair mechanisms diseases of the nervous system remain a major challenge to scientists and clinicians. Stem cell based therapy is an exciting and viable strategy that has been shown to ameliorate or even reverse symptoms of CNS dysfunction in preclinical animal models. Of particular importance has been the use of GABAergic interneuron progenitors as a therapeutic strategy. Born in the neurogenic niches of the ventral telencephalon, interneuron progenitors retain their unique capacity to disperse, integrate and induce plasticity in adult host circuitries following transplantation. Here we discuss the potential of interneuron based transplantation strategies as it relates to CNS disease therapeutics. We also discuss mechanisms underlying their therapeutic efficacy and some of the challenges that face the field.

  7. Neural Progenitors Adopt Specific Identities by Directly Repressing All Alternative Progenitor Transcriptional Programs.

    Science.gov (United States)

    Kutejova, Eva; Sasai, Noriaki; Shah, Ankita; Gouti, Mina; Briscoe, James

    2016-03-21

    In the vertebrate neural tube, a morphogen-induced transcriptional network produces multiple molecularly distinct progenitor domains, each generating different neuronal subtypes. Using an in vitro differentiation system, we defined gene expression signatures of distinct progenitor populations and identified direct gene-regulatory inputs corresponding to locations of specific transcription factor binding. Combined with targeted perturbations of the network, this revealed a mechanism in which a progenitor identity is installed by active repression of the entire transcriptional programs of other neural progenitor fates. In the ventral neural tube, sonic hedgehog (Shh) signaling, together with broadly expressed transcriptional activators, concurrently activates the gene expression programs of several domains. The specific outcome is selected by repressive input provided by Shh-induced transcription factors that act as the key nodes in the network, enabling progenitors to adopt a single definitive identity from several initially permitted options. Together, the data suggest design principles relevant to many developing tissues. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  8. Observational Investigations of the Progenitors of Supernovae

    Science.gov (United States)

    Lyman, J. D.

    2014-03-01

    Supernovae (SNe) are the spectacular deaths of stars and have shaped the universe we see today. Their far-reaching influence affects the chemical and dynamical evolution of galaxies, star formation, neutron star and black hole formation, and they are largely responsible for most of the heavy elements that make up the universe, including around 90 per cent of the reader. They also provide laboratories of nuclear and particle physics far beyond what we can construct on Earth and act as probes of extreme density and energy. This thesis presents new research into understanding the nature of the progenitor systems of various types of SNe, as well as presenting results that will allow their study to be more productive in the future, through use of automated pipelines and methods to increase the science value of discovered SNe. An environmental study of two peculiar types of transients ('Calcium-rich' and '2002cx-like'), which may not be true SNe, reveals extremely different ages of the exploding systems that will constrain the current theoretical effort into discovering the progenitor systems. The GRB-SN 120422A/2012bz is investigated and found to be an extremely luminous and energetic SN, even amongst the infamously bright GRB-SNe. A method is presented that allows an accurate reconstruction of the bolometric light curve of a core-collapse SN, which relies on only two optical filter observations - this will hugely reduce the observational cost of constructing bolometric light curves, a tool of great importance when hoping to constrain the nature of a SN explosion and hence its progenitor. Finally, this method is utilised to construct the largest bolometric CCSN bolometric light curve sample to date, and these are analytically modelled to reveal population statistics of the explosions, thus informing on the nature of the progenitors.

  9. EVOLUTION OF PROGENITORS FOR ELECTRON CAPTURE SUPERNOVAE

    International Nuclear Information System (INIS)

    Takahashi, Koh; Umeda, Hideyuki; Yoshida, Takashi

    2013-01-01

    We provide progenitor models for electron capture supernovae (ECSNe) with detailed evolutionary calculation. We include minor electron capture nuclei using a large nuclear reaction network with updated reaction rates. For electron capture, the Coulomb correction of rates is treated and the contribution from neutron-rich isotopes is taken into account in each nuclear statistical equilibrium (NSE) composition. We calculate the evolution of the most massive super asymptotic giant branch stars and show that these stars undergo off-center carbon burning and form ONe cores at the center. These cores become heavier up to the critical mass of 1.367 M ☉ and keep contracting even after the initiation of O+Ne deflagration. Inclusion of minor electron capture nuclei causes convective URCA cooling during the contraction phase, but the effect on the progenitor evolution is small. On the other hand, electron capture by neutron-rich isotopes in the NSE region has a more significant effect. We discuss the uniqueness of the critical core mass for ECSNe and the effect of wind mass loss on the plausibility of our models for ECSN progenitors.

  10. Normal Hematopoietic Progenitor Subsets Have Distinct Reactive Oxygen Species, BCL2 and Cell-Cycle Profiles That Are Decoupled from Maturation in Acute Myeloid Leukemia.

    Directory of Open Access Journals (Sweden)

    Naeem Khan

    Full Text Available In acute myeloid leukemia (AML quiescence and low oxidative state, linked to BCL2 mitochondrial regulation, endow leukemic stem cells (LSC with treatment-resistance. LSC in CD34+ and more mature CD34- AML have heterogeneous immunophenotypes overlapping with normal stem/progenitor cells (SPC but may be differentiated by functional markers. We therefore investigated the oxidative/reactive oxygen species (ROS profile, its relationship with cell-cycle/BCL2 for normal SPC, and whether altered in AML and myelodysplasia (MDS. In control BM (n = 24, ROS levels were highest in granulocyte-macrophage progenitors (GMP and CD34- myeloid precursors but megakaryocyte-erythroid progenitors had equivalent levels to CD34+CD38low immature-SPC although they were ki67high. BCL2 upregulation was specific to GMPs. This profile was also observed for CD34+SPC in MDS-without-excess-blasts (MDS-noEB, n = 12. Erythroid CD34- precursors were, however, abnormally ROS-high in MDS-noEB, potentially linking oxidative stress to cell loss. In pre-treatment AML (n = 93 and MDS-with-excess-blasts (MDS-RAEB (n = 14, immunophenotypic mature-SPC had similar ROS levels to co-existing immature-SPC. However ROS levels varied between AMLs; Flt3ITD+/NPM1wild-type CD34+SPC had higher ROS than NPM1mutated CD34+ or CD34- SPC. An aberrant ki67lowBCL2high immunophenotype was observed in CD34+AML (most prominent in Flt3ITD AMLs but also in CD34- AMLs and MDS-RAEB, suggesting a shared redox/pro-survival adaptation. Some patients had BCL2 overexpression in CD34+ ROS-high as well as ROS-low fractions which may be indicative of poor early response to standard chemotherapy. Thus normal SPC subsets have distinct ROS, cell-cycle, BCL2 profiles that in AML /MDS-RAEB are decoupled from maturation. The combined profile of these functional properties in AML subpopulations may be relevant to differential treatment resistance.

  11. Progenitor cells of erythroblasts: an in vitro investigation of erythropoietin-responsive cells of guinea pig bone marrow

    International Nuclear Information System (INIS)

    Rosse, C.; Beaufait, D.W.

    1978-01-01

    The experiments were designed to therst whether erythroblast progenitor cell function could be demonstrated in a morphological cell type designated as transitional cells. Two cell fractions were obtained from the bone marrow of normal and polycythemic guinea pigs. One fraction (F1) was enriched in transitional cells and contained few other cell types which could be considered as candidates for erythropoietin responsive cells (ERC). The other fraction (F2) contained undifferentiated blast cells as well as transitional cells. The effect of human urinary erythropoiesis stimulating factors (ESF) on heme synthesis was compared in these two fractions by measuring 59 Fe incorporation into heme. ESF was more effective in stimulating heme synthesis in guinea pig bone marrow cells than homologous sera obtained from anemic or hypoxic animals. The majority of ERC sedimented in F2, but the stimulation index was comparable in the two fractions. It was confirmed by radioautography that the ESF response in F1 was due to the generation of proerythroblasts and basophilic erythroblasts that incorporated 55 Fe. The generation of these cells in F1 was dependent on the addition of ESF to the cultures, whereas 55 Fe-labeled erythroblasts were recovered from cultures of F2 not supplemented with ESF. ESF induced a proportion of transitional cells to incorporate 55 Fe in both F1 and F2. Transitional cells were the only cell type in which heme synthesis was dependent on ESF. Radioautography with 55 Fe identified a proportion of these cells as ERC in both F1 and F2 fractions of bone marrow obtained from normal and polycythemic guinea pigs. The present studies show that some transitional cells function as progenitors of erythroblasts because they respond to ESF by initiation of heme synthesis and by transformation into the earliest recognizable erythroid cells

  12. A single-cell resolution map of mouse hematopoietic stem and progenitor cell differentiation.

    Science.gov (United States)

    Nestorowa, Sonia; Hamey, Fiona K; Pijuan Sala, Blanca; Diamanti, Evangelia; Shepherd, Mairi; Laurenti, Elisa; Wilson, Nicola K; Kent, David G; Göttgens, Berthold

    2016-08-25

    Maintenance of the blood system requires balanced cell fate decisions by hematopoietic stem and progenitor cells (HSPCs). Because cell fate choices are executed at the individual cell level, new single-cell profiling technologies offer exciting possibilities for mapping the dynamic molecular changes underlying HSPC differentiation. Here, we have used single-cell RNA sequencing to profile more than 1600 single HSPCs, and deep sequencing has enabled detection of an average of 6558 protein-coding genes per cell. Index sorting, in combination with broad sorting gates, allowed us to retrospectively assign cells to 12 commonly sorted HSPC phenotypes while also capturing intermediate cells typically excluded by conventional gating. We further show that independently generated single-cell data sets can be projected onto the single-cell resolution expression map to directly compare data from multiple groups and to build and refine new hypotheses. Reconstruction of differentiation trajectories reveals dynamic expression changes associated with early lymphoid, erythroid, and granulocyte-macrophage differentiation. The latter two trajectories were characterized by common upregulation of cell cycle and oxidative phosphorylation transcriptional programs. By using external spike-in controls, we estimate absolute messenger RNA (mRNA) levels per cell, showing for the first time that despite a general reduction in total mRNA, a subset of genes shows higher expression levels in immature stem cells consistent with active maintenance of the stem-cell state. Finally, we report the development of an intuitive Web interface as a new community resource to permit visualization of gene expression in HSPCs at single-cell resolution for any gene of choice. © 2016 by The American Society of Hematology.

  13. ON THE PROGENITOR SYSTEM OF THE TYPE Iax SUPERNOVA 2014dt IN M61

    Energy Technology Data Exchange (ETDEWEB)

    Foley, Ryan J. [Astronomy Department, University of Illinois at Urbana-Champaign, 1002 West Green Street, Urbana, IL 61801 (United States); Van Dyk, Schuyler D. [IPAC/Caltech, Mail Code 100-22, Pasadena, CA 91125 (United States); Jha, Saurabh W. [Department of Physics and Astronomy, Rutgers, The State University of New Jersey, 136 Frelinghuysen Road, Piscataway, NJ 08854 (United States); Clubb, Kelsey I.; Filippenko, Alexei V.; Mauerhan, Jon C. [Department of Astronomy, University of California, Berkeley, CA 94720-3411 (United States); Miller, Adam A. [Jet Propulsion Laboratory, California Institute of Technology, 4800 Oak Grove Drive, MS 169-506, Pasadena, CA 91109 (United States); Smith, Nathan [Steward Observatory, University of Arizona, Tucson, AZ 85721 (United States)

    2015-01-10

    We present pre-explosion and post-explosion Hubble Space Telescope images of the Type Iax supernova (SN Iax) 2014dt in M61. After astrometrically aligning these images, we do not detect any stellar sources at the position of the SN in the pre-explosion images to relatively deep limits (3σ limits of M {sub F438W} > –5.0 mag and M {sub F814W} > –5.9 mag). These limits are similar to the luminosity of SN 2012Z's progenitor system (M {sub F435W} = –5.43 ± 0.15 and M {sub F814W} = –5.24 ± 0.16 mag), the only probable detected progenitor system in pre-explosion images of a SN Iax, and indeed, of any white-dwarf supernova. SN 2014dt is consistent with having a C/O white-dwarf primary/helium-star companion progenitor system, as was suggested for SN 2012Z, although perhaps with a slightly smaller or hotter donor. The data are also consistent with SN 2014dt having a low-mass red giant or main-sequence star companion. The data rule out main-sequence stars with M {sub init} ≳ 16 M {sub ☉} and most evolved stars with M {sub init} ≳ 8 M {sub ☉} as being the progenitor of SN 2014dt. Hot Wolf-Rayet stars are also allowed, but the lack of nearby bright sources makes this scenario unlikely. Because of its proximity (D = 12 Mpc), SN 2014dt is ideal for long-term monitoring, where images in ∼2 yr may detect the companion star or the luminous bound remnant of the progenitor white dwarf.

  14. Endothelial Cells Promote Expansion of Long-Term Engrafting Marrow Hematopoietic Stem and Progenitor Cells in Primates.

    Science.gov (United States)

    Gori, Jennifer L; Butler, Jason M; Kunar, Balvir; Poulos, Michael G; Ginsberg, Michael; Nolan, Daniel J; Norgaard, Zachary K; Adair, Jennifer E; Rafii, Shahin; Kiem, Hans-Peter

    2017-03-01

    Successful expansion of bone marrow (BM) hematopoietic stem and progenitor cells (HSPCs) would benefit many HSPC transplantation and gene therapy/editing applications. However, current expansion technologies have been limited by a loss of multipotency and self-renewal properties ex vivo. We hypothesized that an ex vivo vascular niche would provide prohematopoietic signals to expand HSPCs while maintaining multipotency and self-renewal. To test this hypothesis, BM autologous CD34 + cells were expanded in endothelial cell (EC) coculture and transplanted in nonhuman primates. CD34 + C38 - HSPCs cocultured with ECs expanded up to 17-fold, with a significant increase in hematopoietic colony-forming activity compared with cells cultured with cytokines alone (colony-forming unit-granulocyte-erythroid-macrophage-monocyte; p < .005). BM CD34 + cells that were transduced with green fluorescent protein lentivirus vector and expanded on ECs engrafted long term with multilineage polyclonal reconstitution. Gene marking was observed in granulocytes, lymphocytes, platelets, and erythrocytes. Whole transcriptome analysis indicated that EC coculture altered the expression profile of 75 genes in the BM CD34 + cells without impeding the long-term engraftment potential. These findings show that an ex vivo vascular niche is an effective platform for expansion of adult BM HSPCs. Stem Cells Translational Medicine 2017;6:864-876. © 2016 The Authors Stem Cells Translational Medicine published by Wiley Periodicals, Inc. on behalf of AlphaMed Press.

  15. Generation of a High Number of Healthy Erythroid Cells from Gene-Edited Pyruvate Kinase Deficiency Patient-Specific Induced Pluripotent Stem Cells

    Directory of Open Access Journals (Sweden)

    Zita Garate

    2015-12-01

    Full Text Available Pyruvate kinase deficiency (PKD is a rare erythroid metabolic disease caused by mutations in the PKLR gene. Erythrocytes from PKD patients show an energetic imbalance causing chronic non-spherocytic hemolytic anemia, as pyruvate kinase defects impair ATP production in erythrocytes. We generated PKD induced pluripotent stem cells (PKDiPSCs from peripheral blood mononuclear cells (PB-MNCs of PKD patients by non-integrative Sendai viral vectors. PKDiPSCs were gene edited to integrate a partial codon-optimized R-type pyruvate kinase cDNA in the second intron of the PKLR gene by TALEN-mediated homologous recombination (HR. Notably, we found allele specificity of HR led by the presence of a single-nucleotide polymorphism. High numbers of erythroid cells derived from gene-edited PKDiPSCs showed correction of the energetic imbalance, providing an approach to correct metabolic erythroid diseases and demonstrating the practicality of this approach to generate the large cell numbers required for comprehensive biochemical and metabolic erythroid analyses.

  16. Generation and Characterization of Erythroid Cells from Human Embryonic Stem Cells and Induced Pluripotent Stem Cells: An Overview

    Directory of Open Access Journals (Sweden)

    Kai-Hsin Chang

    2011-01-01

    Full Text Available Because of the imbalance in the supply and demand of red blood cells (RBCs, especially for alloimmunized patients or patients with rare blood phenotypes, extensive research has been done to generate therapeutic quantities of mature RBCs from hematopoietic stem cells of various sources, such as bone marrow, peripheral blood, and cord blood. Since human embryonic stem cells (hESCs and induced pluripotent stem cells (iPSCs can be maintained indefinitely in vitro, they represent potentially inexhaustible sources of donor-free RBCs. In contrast to other ex vivo stem-cell-derived cellular therapeutics, tumorigenesis is not a concern, as RBCs can be irradiated without marked adverse effects on in vivo function. Here, we provide a comprehensive review of the recent publications relevant to the generation and characterization of hESC- and iPSC-derived erythroid cells and discuss challenges to be met before the eventual realization of clinical usage of these cells.

  17. Generation of megakaryocytic progenitors from human embryonic stem cells in a feeder- and serum-free medium.

    Directory of Open Access Journals (Sweden)

    Marjorie Pick

    Full Text Available BACKGROUND: The production of human platelets from embryonic stem cells in a defined culture system is a prerequisite for the generation of platelets for therapeutic use. As an important step towards this goal, we report the differentiation of human embryonic stem cells (hESCs towards the megakaryocyte (Mk lineage using a 'spin embryoid body' method in serum-free differentiation medium. METHODOLOGY AND PRINCIPAL FINDINGS: Immunophenotypic analyses of differentiating hESC identified a subpopulation of cells expressing high levels of CD41a that expressed other markers associated with the Mk lineage, including CD110, CD42b and CD61. Differentiated cells were sorted on the basis of their expression of CD41a, CD34 and CD45 and assessed for Mk colony formation, expression of myeloid and Mk genes and ability to endoreplicate DNA. In a collagen-based colony assay, the CD41a⁺ cells sorted from these differentiation cultures produced 100-800 Mk progenitors at day 13 and 25-160 Mk progenitors at day 20 of differentiation per 100,000 cells assayed. Differentiated Mk cells produced platelet-like particles which expressed CD42b and were activated by ADP, similar to platelets generated from precursors in cord blood. These studies were complemented by real time PCR analyses showing that subsets of cells enriched for CD41a⁺ Mk precursors expressed high levels of Mk associated genes such as PF4 and MPL. Conversely, high levels of myeloid and erythroid related transcripts, such as GATA1, TAL1/SCL and PU.1, were detected in sorted fractions containing CD34⁺ and CD45⁺ cells. CONCLUSIONS: We describe a serum- and feeder-free culture system that enabled the generation of Mk progenitors from human embryonic stem cells. These cells formed colonies that included differentiated Mks that fragmented to form platelet-like particles. This protocol represents an important step towards the generation of human platelets for therapeutic use.

  18. Retinal progenitor cell xenografts to the pig retina

    DEFF Research Database (Denmark)

    Warfvinge, Karin; Kiilgaard, Jens Folke; Lavik, Erin B

    2005-01-01

    To investigate the survival, integration, and differentiation of mouse retinal progenitor cells after transplantation to the subretinal space of adult pigs.......To investigate the survival, integration, and differentiation of mouse retinal progenitor cells after transplantation to the subretinal space of adult pigs....

  19. Selective uptake of boronophenylalanine by glioma stem/progenitor cells

    International Nuclear Information System (INIS)

    Sun, Ting; Zhou, Youxin; Xie, Xueshun; Chen, Guilin; Li, Bin; Wei, Yongxin; Chen, Jinming; Huang, Qiang; Du, Ziwei

    2012-01-01

    The success of boron neutron capture therapy (BNCT) depends on the amount of boron in cells and the tumor/blood and tumor/(normal tissue) boron concentration ratios. For the first time, measurements of boron uptake in both stem/progenitor and differentiated glioma cells were performed along with measurements of boron biodistribution in suitable animal models. In glioma stem/progenitor cells, the selective accumulation of boronophenylalanine (BPA) was lower, and retention of boron after BPA removal was longer than in differentiated glioma cells in vitro. However, boron biodistribution was not statistically significantly different in mice with xenografts. - Highlights: ► Uptake of BPA was analyzed in stem/progenitor and differentiated glioma cells. ► Selective accumulation of BPA was lower in glioma stem/progenitor cells. ► Retention of boron after BPA removal was longer in glioma stem/progenitor cells. ► Boron biodistribution was not statistically different in mice with xenografts.

  20. Impairment of circulating endothelial progenitors in Down syndrome

    Directory of Open Access Journals (Sweden)

    Costa Valerio

    2010-09-01

    Full Text Available Abstract Background Pathological angiogenesis represents a critical issue in the progression of many diseases. Down syndrome is postulated to be a systemic anti-angiogenesis disease model, possibly due to increased expression of anti-angiogenic regulators on chromosome 21. The aim of our study was to elucidate some features of circulating endothelial progenitor cells in the context of this syndrome. Methods Circulating endothelial progenitors of Down syndrome affected individuals were isolated, in vitro cultured and analyzed by confocal and transmission electron microscopy. ELISA was performed to measure SDF-1α plasma levels in Down syndrome and euploid individuals. Moreover, qRT-PCR was used to quantify expression levels of CXCL12 gene and of its receptor in progenitor cells. The functional impairment of Down progenitors was evaluated through their susceptibility to hydroperoxide-induced oxidative stress with BODIPY assay and the major vulnerability to the infection with human pathogens. The differential expression of crucial genes in Down progenitor cells was evaluated by microarray analysis. Results We detected a marked decrease of progenitors' number in young Down individuals compared to euploid, cell size increase and some major detrimental morphological changes. Moreover, Down syndrome patients also exhibited decreased SDF-1α plasma levels and their progenitors had a reduced expression of SDF-1α encoding gene and of its membrane receptor. We further demonstrated that their progenitor cells are more susceptible to hydroperoxide-induced oxidative stress and infection with Bartonella henselae. Further, we observed that most of the differentially expressed genes belong to angiogenesis, immune response and inflammation pathways, and that infected progenitors with trisomy 21 have a more pronounced perturbation of immune response genes than infected euploid cells. Conclusions Our data provide evidences for a reduced number and altered

  1. Tapak liman (Elephantopus scaber L) extract-induced CD4+ and CD8+ differentiation from hematopoietic stem cells and progenitor cell proliferation in mice (Mus musculus L)

    Science.gov (United States)

    Djati, Muhammad Sasmito; Habibu, Hindun; Jatiatmaja, Nabilah A.; Rifa'i, Muhaimin

    2017-11-01

    Tapak Liman (Elephantopus scaber L) is a traditional medicinal plant containing several active compounds that potentially affecting hematopoietic stem cells, such as epifrieelinol, lupeol, stigmasterol, triacontane-1-ol, dotriacontane-1-ol, lupeol acetate, deoxyelephan-topin, isodeoxyelephantopin, polyphenol luteolin-7, as well as various flavonoids and glucosides. The aim of this study was to elucidate the effect of leaf extract of Tapak Liman on hematopoietic stem cells in mice BALB/c, by observation of the relative number of cells expressing CD4/CD8, CD4/CD62L, and TER119/B220 in the spleen, and TER119/B220, TER119/VLA-4 and TER119/CD34 in bone marrow, after being administered leaf extract for 2 weeks. This experiment used 12 female mice, which were divided into three treatment groups, P1= 0.5 g.g bw-1.day-1, P2= 1.0 g.g bw-1.day-1 and P3=2.0 g.g bw-1.day-1 Tapak Liman leaf extract as well as a control. The relative numbers of cells expressing surface molecules were analyzed by flowcytometry and quantitative data were tested using one-way ANOVA. The results showed that the leaf extract of Tapak Liman has no significant effect on erythrocyte proliferation; on the other hand, it had a significant effect on both proliferation and differentiation of B lymphocytes (B220+) in bone marrow (p=0.044) and increased the expression of CD4+, CD8+ molecule in B cells (p=0.026) and erythroid cells in spleen and bone marrow, based on the estimation of cells that expressed TER119+VLA-4+, identified as important in the development pathway of erythrocytes. An increased cell percentage of TER11+VLA-4+ occurred for treatment P2, 12% higher than the control. The increased expression of TER119+VLA-4+ was assumed to be due to the iron content in Tapak Liman, which functioned to stimulate the progenitor hematopoietic cells to proliferate and differentiate into a precursor of erythroid cells (TER119+VLA-4+). There was an increasing number of cells expressing the surface molecules TER119

  2. Isoform-specific potentiation of stem and progenitor cell engraftment by AML1/RUNX1.

    Directory of Open Access Journals (Sweden)

    Shinobu Tsuzuki

    2007-05-01

    Full Text Available AML1/RUNX1 is the most frequently mutated gene in leukaemia and is central to the normal biology of hematopoietic stem and progenitor cells. However, the role of different AML1 isoforms within these primitive compartments is unclear. Here we investigate whether altering relative expression of AML1 isoforms impacts the balance between cell self-renewal and differentiation in vitro and in vivo.The human AML1a isoform encodes a truncated molecule with DNA-binding but no transactivation capacity. We used a retrovirus-based approach to transduce AML1a into primitive haematopoietic cells isolated from the mouse. We observed that enforced AML1a expression increased the competitive engraftment potential of murine long-term reconstituting stem cells with the proportion of AML1a-expressing cells increasing over time in both primary and secondary recipients. Furthermore, AML1a expression dramatically increased primitive and committed progenitor activity in engrafted animals as assessed by long-term culture, cobblestone formation, and colony assays. In contrast, expression of the full-length isoform AML1b abrogated engraftment potential. In vitro, AML1b promoted differentiation while AML1a promoted proliferation of progenitors capable of short-term lymphomyeloid engraftment. Consistent with these findings, the relative abundance of AML1a was highest in the primitive stem/progenitor compartment of human cord blood, and forced expression of AML1a in these cells enhanced maintenance of primitive potential both in vitro and in vivo.These data demonstrate that the "a" isoform of AML1 has the capacity to potentiate stem and progenitor cell engraftment, both of which are required for successful clinical transplantation. This activity is consistent with its expression pattern in both normal and leukaemic cells. Manipulating the balance of AML1 isoform expression may offer novel therapeutic strategies, exploitable in the contexts of leukaemia and also in cord blood

  3. Identification of human embryonic progenitor cell targeting peptides using phage display.

    Directory of Open Access Journals (Sweden)

    Paola A Bignone

    Full Text Available Human pluripotent stem (hPS cells are capable of differentiation into derivatives of all three primary embryonic germ layers and can self-renew indefinitely. They therefore offer a potentially scalable source of replacement cells to treat a variety of degenerative diseases. The ability to reprogram adult cells to induced pluripotent stem (iPS cells has now enabled the possibility of patient-specific hPS cells as a source of cells for disease modeling, drug discovery, and potentially, cell replacement therapies. While reprogramming technology has dramatically increased the availability of normal and diseased hPS cell lines for basic research, a major bottleneck is the critical unmet need for more efficient methods of deriving well-defined cell populations from hPS cells. Phage display is a powerful method for selecting affinity ligands that could be used for identifying and potentially purifying a variety of cell types derived from hPS cells. However, identification of specific progenitor cell-binding peptides using phage display may be hindered by the large cellular heterogeneity present in differentiating hPS cell populations. We therefore tested the hypothesis that peptides selected for their ability to bind a clonal cell line derived from hPS cells would bind early progenitor cell types emerging from differentiating hPS cells. The human embryonic stem (hES cell-derived embryonic progenitor cell line, W10, was used and cell-targeting peptides were identified. Competition studies demonstrated specificity of peptide binding to the target cell surface. Efficient peptide targeted cell labeling was accomplished using multivalent peptide-quantum dot complexes as detected by fluorescence microscopy and flow cytometry. The cell-binding peptides were selective for differentiated hPS cells, had little or no binding on pluripotent cells, but preferential binding to certain embryonic progenitor cell lines and early endodermal hPS cell derivatives. Taken

  4. PET imaging of adoptive progenitor cell therapies

    International Nuclear Information System (INIS)

    Gelovani, Juri G.

    2008-01-01

    The overall objective of this application is to develop novel technologies for non-invasive imaging of adoptive stem cell-based therapies with positron emission tomography (PET) that would be applicable to human patients. To achieve this objective, stem cells will be genetically labeled with a PET-reporter gene and repetitively imaged to assess their distribution, migration, differentiation, and persistence using a radiolabeled reporter probe. This new imaging technology will be tested in adoptive progenitor cell-based therapy models in animals, including: delivery pro-apoptotic genes to tumors, and T-cell reconstitution for immunostimulatory therapy during allogeneic bone marrow progenitor cell transplantation. Technical and Scientific Merits. Non-invasive whole body imaging would significantly aid in the development and clinical implementation of various adoptive progenitor cell-based therapies by providing the means for non-invasive monitoring of the fate of injected progenitor cells over a long period of observation. The proposed imaging approaches could help to address several questions related to stem cell migration and homing, their long-term viability, and their subsequent differentiation. The ability to image these processes non-invasively in 3D and repetitively over a long period of time is very important and will help the development and clinical application of various strategies to control and direct stem cell migration and differentiation. Approach to accomplish the work. Stem cells will be genetically with a reporter gene which will allow for repetitive non-invasive 'tracking' of the migration and localization of genetically labeled stem cells and their progeny. This is a radically new approach that is being developed for future human applications and should allow for a long term (many years) repetitive imaging of the fate of tissues that develop from the transplanted stem cells. Why the approach is appropriate. The novel approach to stem cell imaging

  5. Cardiac Progenitor Cell Extraction from Human Auricles

    KAUST Repository

    Di Nardo, Paolo

    2017-02-22

    For many years, myocardial tissue has been considered terminally differentiated and, thus, incapable of regenerating. Recent studies have shown, instead, that cardiomyocytes, at least in part, are slowly substituted by new cells originating by precursor cells mostly embedded into the heart apex and in the atria. We have shown that an elective region of progenitor cell embedding is represented by the auricles, non-contractile atria appendages that can be easily sampled without harming the patient. The protocol here reported describes how from auricles a population of multipotent, cardiogenic cells can be isolated, cultured, and differentiated. Further studies are needed to fully exploit this cell population, but, sampling auricles, it could be possible to treat cardiac patients using their own cells circumventing rejection or organ shortage limitations.

  6. PET imaging of adoptive progenitor cell therapies.

    Energy Technology Data Exchange (ETDEWEB)

    Gelovani, Juri G.

    2008-05-13

    Objectives. The overall objective of this application is to develop novel technologies for non-invasive imaging of adoptive stem cell-based therapies with positron emission tomography (PET) that would be applicable to human patients. To achieve this objective, stem cells will be genetically labeled with a PET-reporter gene and repetitively imaged to assess their distribution, migration, differentiation, and persistence using a radiolabeled reporter probe. This new imaging technology will be tested in adoptive progenitor cell-based therapy models in animals, including: delivery pro-apoptotic genes to tumors, and T-cell reconstitution for immunostimulatory therapy during allogeneic bone marrow progenitor cell transplantation. Technical and Scientific Merits. Non-invasive whole body imaging would significantly aid in the development and clinical implementation of various adoptive progenitor cell-based therapies by providing the means for non-invasive monitoring of the fate of injected progenitor cells over a long period of observation. The proposed imaging approaches could help to address several questions related to stem cell migration and homing, their long-term viability, and their subsequent differentiation. The ability to image these processes non-invasively in 3D and repetitively over a long period of time is very important and will help the development and clinical application of various strategies to control and direct stem cell migration and differentiation. Approach to accomplish the work. Stem cells will be genetically with a reporter gene which will allow for repetitive non-invasive “tracking” of the migration and localization of genetically labeled stem cells and their progeny. This is a radically new approach that is being developed for future human applications and should allow for a long term (many years) repetitive imaging of the fate of tissues that develop from the transplanted stem cells. Why the approach is appropriate. The novel approach to

  7. Amniotic fluid promotes the appearance of neural retinal progenitors and neurons in human RPE cell cultures.

    Science.gov (United States)

    Davari, Maliheh; Soheili, Zahra-Soheila; Ahmadieh, Hamid; Sanie-Jahromi, Fateme; Ghaderi, Shima; Kanavi, Mozhgan Rezaei; Samiei, Shahram; Akrami, Hassan; Haghighi, Massoud; Javidi-Azad, Fahimeh

    2013-01-01

    Retinal pigment epithelial (RPE) cells are capable of differentiating into retinal neurons when induced by the appropriate growth factors. Amniotic fluid contains a variety of growth factors that are crucial for the development of a fetus. In this study, the effects of human amniotic fluid (HAF) on primary RPE cell cultures were evaluated. RPE cells were isolated from the globes of postnatal human cadavers. The isolated cells were plated and grown in DMEM/F12 with 10% fetal bovine serum. To confirm the RPE identity of the cultured cells, they were immunocytochemically examined for the presence of the RPE cell-specific marker RPE65. RPE cultures obtained from passages 2-7 were treated with HAF and examined morphologically for 1 month. To determine whether retinal neurons or progenitors developed in the treated cultures, specific markers for bipolar (protein kinase C isomer α, PKCα), amacrine (cellular retinoic acid-binding protein I, CRABPI), and neural progenitor (NESTIN) cells were sought, and the amount of mRNA was quantified using real-time PCR. Treating RPE cells with HAF led to a significant decrease in the number of RPE65-positive cells, while PKCα- and CRABPI-positive cells were detected in the cultures. Compared with the fetal bovine serum-treated cultures, the levels of mRNAs quantitatively increased by 2-, 20- and 22-fold for NESTIN, PKCα, and CRABPI, respectively. The RPE cultures treated with HAF established spheres containing both pigmented and nonpigmented cells, which expressed neural progenitor markers such as NESTIN. This study showed that HAF can induce RPE cells to transdifferentiate into retinal neurons and progenitor cells, and that it provides a potential source for cell-based therapies to treat retinal diseases.

  8. Circulating CD34+ progenitor cells and risk of mortality in a population with coronary artery disease.

    Science.gov (United States)

    Patel, Riyaz S; Li, Qunna; Ghasemzadeh, Nima; Eapen, Danny J; Moss, Lauren D; Janjua, A Umair; Manocha, Pankaj; Kassem, Hatem Al; Veledar, Emir; Samady, Habib; Taylor, W Robert; Zafari, A Maziar; Sperling, Laurence; Vaccarino, Viola; Waller, Edmund K; Quyyumi, Arshed A

    2015-01-16

    Low circulating progenitor cell numbers and activity may reflect impaired intrinsic regenerative/reparative potential, but it remains uncertain whether this translates into a worse prognosis. To investigate whether low numbers of progenitor cells associate with a greater risk of mortality in a population at high cardiovascular risk. Patients undergoing coronary angiography were recruited into 2 cohorts (1, n=502 and 2, n=403) over separate time periods. Progenitor cells were enumerated by flow cytometry as CD45(med+) blood mononuclear cells expressing CD34, with additional quantification of subsets coexpressing CD133, vascular endothelial growth factor receptor 2, and chemokine (C-X-C motif) receptor 4. Coefficient of variation for CD34 cells was 2.9% and 4.8%, 21.6% and 6.5% for the respective subsets. Each cohort was followed for a mean of 2.7 and 1.2 years, respectively, for the primary end point of all-cause death. There was an inverse association between CD34(+) and CD34(+)/CD133(+) cell counts and risk of death in cohort 1 (β=-0.92, P=0.043 and β=-1.64, P=0.019, respectively) that was confirmed in cohort 2 (β=-1.25, P=0.020 and β=-1.81, P=0.015, respectively). Covariate-adjusted hazard ratios in the pooled cohort (n=905) were 3.54 (1.67-7.50) and 2.46 (1.18-5.13), respectively. CD34(+)/CD133(+) cell counts improved risk prediction metrics beyond standard risk factors. Reduced circulating progenitor cell counts, identified primarily as CD34(+) mononuclear cells or its subset expressing CD133, are associated with risk of death in individuals with coronary artery disease, suggesting that impaired endogenous regenerative capacity is associated with increased mortality. These findings have implications for biological understanding, risk prediction, and cell selection for cell-based therapies. © 2014 American Heart Association, Inc.

  9. Impaired endothelial progenitor cell mobilization and dysfunctional bone marrow stroma in diabetes mellitus.

    Science.gov (United States)

    Westerweel, Peter E; Teraa, Martin; Rafii, Shahin; Jaspers, Janneke E; White, Ian A; Hooper, Andrea T; Doevendans, Pieter A; Verhaar, Marianne C

    2013-01-01

    Circulating Endothelial Progenitor Cell (EPC) levels are reduced in diabetes mellitus. This may be a consequence of impaired mobilization of EPC from the bone marrow. We hypothesized that under diabetic conditions, mobilization of EPC from the bone marrow to the circulation is impaired -at least partly- due to dysfunction of the bone marrow stromal compartment. Diabetes was induced in mice by streptozotocin injection. Circulating Sca-1(+)Flk-1(+) EPC were characterized and quantified by flow cytometry at baseline and after mobilization with G-CSF/SCF injections. In vivo hemangiogenic recovery was tested by 5-FU challenge. Interaction within the bone marrow environment between CD34(+) hematopoietic progenitor cells (HPC) and supporting stroma was assessed by co-cultures. To study progenitor cell-endothelial cell interaction under normoglycemic and hyperglycemic conditions, a co-culture model using E4Orf1-transfected human endothelial cells was employed. In diabetic mice, bone marrow EPC levels were unaffected. However, circulating EPC levels in blood were lower at baseline and mobilization was attenuated. Diabetic mice failed to recover and repopulate from 5-FU injection. In vitro, primary cultured bone marrow stroma from diabetic mice was impaired in its capacity to support human CFU-forming HPC. Finally, hyperglycemia hampered the HPC supportive function of endothelial cells in vitro. EPC mobilization is impaired under experimental diabetic conditions and our data suggest that diabetes induces alterations in the progenitor cell supportive capacity of the bone marrow stroma, which could be partially responsible for the attenuated EPC mobilization and reduced EPC levels observed in diabetic patients.

  10. Impaired endothelial progenitor cell mobilization and dysfunctional bone marrow stroma in diabetes mellitus.

    Directory of Open Access Journals (Sweden)

    Peter E Westerweel

    Full Text Available Circulating Endothelial Progenitor Cell (EPC levels are reduced in diabetes mellitus. This may be a consequence of impaired mobilization of EPC from the bone marrow. We hypothesized that under diabetic conditions, mobilization of EPC from the bone marrow to the circulation is impaired -at least partly- due to dysfunction of the bone marrow stromal compartment.Diabetes was induced in mice by streptozotocin injection. Circulating Sca-1(+Flk-1(+ EPC were characterized and quantified by flow cytometry at baseline and after mobilization with G-CSF/SCF injections. In vivo hemangiogenic recovery was tested by 5-FU challenge. Interaction within the bone marrow environment between CD34(+ hematopoietic progenitor cells (HPC and supporting stroma was assessed by co-cultures. To study progenitor cell-endothelial cell interaction under normoglycemic and hyperglycemic conditions, a co-culture model using E4Orf1-transfected human endothelial cells was employed.In diabetic mice, bone marrow EPC levels were unaffected. However, circulating EPC levels in blood were lower at baseline and mobilization was attenuated. Diabetic mice failed to recover and repopulate from 5-FU injection. In vitro, primary cultured bone marrow stroma from diabetic mice was impaired in its capacity to support human CFU-forming HPC. Finally, hyperglycemia hampered the HPC supportive function of endothelial cells in vitro.EPC mobilization is impaired under experimental diabetic conditions and our data suggest that diabetes induces alterations in the progenitor cell supportive capacity of the bone marrow stroma, which could be partially responsible for the attenuated EPC mobilization and reduced EPC levels observed in diabetic patients.

  11. A COMPREHENSIVE PROGENITOR MODEL FOR SNe Ia

    International Nuclear Information System (INIS)

    Meng, X.; Yang, W.

    2010-01-01

    Although the nature of the progenitor of Type Ia supernovae (SNe Ia) is still unclear, the single-degenerate (SD) channel for the progenitor is currently accepted, in which a carbon-oxygen white dwarf (CO WD) accretes hydrogen-rich material from its companion, increases its mass to the Chandrasekhar mass limit, and then explodes as an SN Ia. The companion may be a main sequence or a slightly evolved star (WD + MS), or a red giant star (WD + RG). Incorporating the effect of mass stripping and accretion-disk instability on the evolution of the WD binary, we carried out binary stellar evolution calculations for more than 1600 close WD binaries. As a result, the initial parameter spaces for SNe Ia are presented in an orbital period-secondary mass (log P i , M i 2 ) plane. We confirmed that in a WD + MS system, the initial companion leading to SNe Ia may have mass from 1 M sun to 5 M sun . The initial WD mass for SNe Ia from WD + MS channel is as low as 0.565 M sun , while the lowest WD mass from the WD + RG channel is 1.0 M sun . Adopting the above results, we studied the birth rate of SNe Ia via a binary population synthesis approach. We found that the Galactic SNe Ia birth rate from SD model is (2.55-2.9) x 10 -3 yr -1 (including WD + He star channel), which is slightly smaller than that from observation. If a single starburst is assumed, the distribution of the delay time of SNe Ia from the SD model may be a weak bimodality, where WD + He channel contributes to SNe Ia with delay time shorter than 10 8 yr and WD + RG channel to those with age longer than 6 Gyr.

  12. THE PROGENITOR OF THE TYPE IIb SN 2008ax REVISITED

    Energy Technology Data Exchange (ETDEWEB)

    Folatelli, Gastón; Bersten, Melina C.; Benvenuto, Omar G. [Instituto de Astrofísica de La Plata (Argentina); Kuncarayakti, Hanindyo [Millennium Institute of Astrophysics (MAS), Casilla 36-D, Santiago (Chile); Maeda, Keiichi; Nomoto, Ken’ichi, E-mail: gaston@fcaglp.unlp.edu.ar [Kavli Institute for the Physics and Mathematics of the Universe (WPI), The University of Tokyo, Kashiwa, Chiba 277-8583 (Japan)

    2015-10-01

    Hubble Space Telescope observations of the site of the supernova (SN) SN 2008ax obtained in 2011 and 2013 reveal that the possible progenitor object detected in pre-explosion images was in fact multiple. Four point sources are resolved in the new, higher-resolution images. We identify one of the sources with the fading SN. The other three objects are consistent with single supergiant stars. We conclude that their light contaminated the previously identified progenitor candidate. After subtraction of these stars, the progenitor appears to be significantly fainter and bluer than previously measured. Post-explosion photometry at the SN location indicates that the progenitor object has disappeared. If single, the progenitor is compatible with a supergiant star of B to mid-A spectral type, while a Wolf–Rayet (W-R) star would be too luminous in the ultraviolet to account for the observations. Moreover, our hydrodynamical modeling shows that the pre-explosion mass was 4–5 M{sub ⊙} and the radius was 30–50 R{sub ⊙}, which is incompatible with a W-R progenitor. We present a possible interacting binary progenitor computed with our evolutionary models that reproduces all the observational evidence. A companion star as luminous as an O9–B0 main-sequence star may have remained after the explosion.

  13. Ionizing radiation induces apoptosis in hematopoietic stem and progenitor cells

    International Nuclear Information System (INIS)

    Meng, A.; Zhou, D.; Geiger, H.; Zant, G.V.

    2003-01-01

    The aims of this study was to determine if ionizing radiation (IR) induces apoptosis in hematopoietic stem (HSC) and progenitor cells. Lin-cells were isolated from mouse bone marrow (BM) and pretreated with vehicle or 100 μM z-VAD 1 h prior to exposure to 4 Gy IR. The apoptotic and/or necrotic responses of these cells to IR were analyzed by measuring the annexin V and/or 7-AAD staining in HSC and progenitor populations using flow cytometry, and hematopoietic function of these cells was determined by CAFC assay. Exposure of Lin-cells to IR selectively decreased the numbers of HSC and progenitors in association with an increase in apoptosis in a time-dependent manner. Pretreatment of Lin- cells with z-VAD significantly inhibited IR-induced apoptosis and the decrease in the numbers of HSC and progenitors. However, IR alone or in combination with z-VAD did not lead to a significant increase in necrotic cell death in either HSC or progenitors. In addition, pretreatment of BM cells with z-VAD significantly attenuated IR-induced reduction in the frequencies of day-7, -28 and -35 CAFC. Exposure of HSC and progenitors to IR induces apoptosis. The induction of HSC and progenitor apoptosis contributes to IR-induced suppression of their hematopoietic function

  14. THE PROGENITOR OF THE TYPE IIb SN 2008ax REVISITED

    International Nuclear Information System (INIS)

    Folatelli, Gastón; Bersten, Melina C.; Benvenuto, Omar G.; Kuncarayakti, Hanindyo; Maeda, Keiichi; Nomoto, Ken’ichi

    2015-01-01

    Hubble Space Telescope observations of the site of the supernova (SN) SN 2008ax obtained in 2011 and 2013 reveal that the possible progenitor object detected in pre-explosion images was in fact multiple. Four point sources are resolved in the new, higher-resolution images. We identify one of the sources with the fading SN. The other three objects are consistent with single supergiant stars. We conclude that their light contaminated the previously identified progenitor candidate. After subtraction of these stars, the progenitor appears to be significantly fainter and bluer than previously measured. Post-explosion photometry at the SN location indicates that the progenitor object has disappeared. If single, the progenitor is compatible with a supergiant star of B to mid-A spectral type, while a Wolf–Rayet (W-R) star would be too luminous in the ultraviolet to account for the observations. Moreover, our hydrodynamical modeling shows that the pre-explosion mass was 4–5 M ⊙ and the radius was 30–50 R ⊙ , which is incompatible with a W-R progenitor. We present a possible interacting binary progenitor computed with our evolutionary models that reproduces all the observational evidence. A companion star as luminous as an O9–B0 main-sequence star may have remained after the explosion

  15. Bone marrow endothelial progenitors in atherosclerotic plaque resolution

    Science.gov (United States)

    Yao, Longbiao; Heuser-Baker, Janet; Herlea-Pana, Oana; Barlic-Dicen, Jana

    2013-01-01

    Atherosclerosis is a major cause of morbidity and mortality in the United States. Persistently elevated circulating low-density lipoprotein, or hypercholesterolemia, and deposition of low-density lipoprotein in the vascular wall are the main inducers of atherosclerosis, which manifests itself as arterial lesions or plaques. Some plaques become thrombosis-prone and rupture, causing acute myocardial infarction or stroke. Lowering plasma cholesterol through the use of statins is the primary intervention against atherosclerosis. Treatment with statins slows progression of atherosclerosis but can only support limited plaque regression. Partially regressed plaques continue to pose a serious threat due to their remaining potential to rupture. Thus, new interventions inducing complete reversal of atherosclerosis are being sought. Implementation of new therapies will require clear understanding of the mechanisms driving plaque resolution. In this Commentary, we highlight the role of bone marrow endothelial progenitors in atherosclerotic plaque regression and discuss how regenerative cell-based interventions could be used in combination with plasma lipid-lowering to induce plaque reversal in order to prevent and/or reduce adverse cardiovascular events. PMID:23538778

  16. Quercetin inhibits adipogenesis of muscle progenitor cells in vitro

    Directory of Open Access Journals (Sweden)

    Tomoko Funakoshi

    2018-03-01

    Full Text Available Muscle satellite cells are committed myogenic progenitors capable of contributing to myogenesis to maintain adult muscle mass and function. Several experiments have demonstrated that muscle satellite cells can differentiate into adipocytes in vitro, supporting the mesenchymal differentiation potential of these cells. Moreover, muscle satellite cells may be a source of ectopic muscle adipocytes, explaining the lipid accumulation often observed in aged skeletal muscle (sarcopenia and in muscles of patients` with diabetes. Quercetin, a polyphenol, is one of the most abundant flavonoids distributed in edible plants, such as onions and apples, and possesses antioxidant, anticancer, and anti-inflammatory properties. In this study, we examined whether quercetin inhibited the adipogenesis of muscle satellite cells in vitro with primary cells from rat limbs by culture in the presence of quercetin under adipogenic conditions. Morphological observations, Oil Red-O staining results, triglyceride content analysis, and quantitative reverse transcription polymerase chain reaction revealed that quercetin was capable of inhibiting the adipogenic induction of muscle satellite cells into adipocytes in a dose-dependent manner by suppressing the transcript levels of adipogenic markers, such as peroxisome proliferator-activated receptor-γ and fatty acid binding protein 4. Our results suggested that quercetin inhibited the adipogenesis of muscle satellite cells in vitro by suppressing the transcription of adipogenic markers. Keywords: Quercetin, Muscle satellite cell, Differentiation, Intramuscular lipid

  17. Infusion of megakaryocytic progenitor products generated from cord blood hematopoietic stem/progenitor cells: results of the phase 1 study.

    Directory of Open Access Journals (Sweden)

    Jiafei Xi

    Full Text Available BACKGROUND: Currently, a constant shortage in the supply of platelets has become an important medical and society challenge, especially in developing country, and the in vitro production of megakaryocytic progenitor cells (MPs from cord blood could represent an effective platelet substitute. In the present study, our objective was to determine the safety and feasibility of ex vivo generated MPs in patients. METHODS AND FINDINGS: MPs were produced and characterized from cord blood mononuclear cells under a serum free medium with cytokines. We investigated the feasibility of expansion and infusion of cord blood-derived MPs in 24 patients with advanced hematological malignancies. The primary end point was the safety and tolerability of the infusion of cord blood-derived MPs. No adverse effects were observed in patients who received ex vivo-generated cells at concentrations of up to a median value of 5.45 × 10(6cells/kg of body weight. With one year follow-up, acute and chronic GVHD had not been observed among patients who received MPs infusion, even without ABO blood group and HLA typing matching. CONCLUSIONS: These initial results in patients are very encouraging. They suggest that infusion of cord blood-derived MPs appears safe and feasible for treatment of thrombocytopenia.

  18. Possible interaction between B1 retrotransposon-containing sequences and β(major) globin gene transcriptional activation during MEL cell erythroid differentiation.

    Science.gov (United States)

    Vizirianakis, Ioannis S; Tezias, Sotirios S; Amanatiadou, Elsa P; Tsiftsoglou, Asterios S

    2012-01-01

    Repetitive sequences consist of >50% of mammalian genomic DNAs and among these SINEs (short interspersed nuclear elements), e.g. B1 elements, account for 8% of the mouse genome. In an effort to delineate the molecular mechanism(s) involved in the blockade of the in vitro differentiation program of MEL (murine erythroleukaemia) cells by treatment with methylation inhibitors, we detected a DNA region of 559 bp in chromosome 7 located downstream of the 3'-end of the β(major) globin gene (designated B1-559) with unique characteristics. We have fully characterized this B1-559 region that includes a B1 element, several repeats of ATG initiation codons and consensus DNA-binding sites for erythroid-specific transcription factors NF-E2 (nuclear factor-erythroid-derived 2), GATA-1 and EKLF (erythroid Krüppel-like factor). Fragments derived from B1-559 incubated with nuclear extracts form protein complexes in both undifferentiated and differentiated MEL cells. Transient reporter-gene experiments in MEL and human erythroleukaemia K-562 cells with recombinant constructs containing B1-559 fragments linked to HS-2 (hypersensitive site-2) sequences of human β-globin gene LCR (locus control region) indicated potential cooperation upon erythropoiesis and globin gene expression. The possible interaction between the B1-559 region and β(major) globin gene transcriptional activation upon execution of erythroid MEL cell differentiation programme is discussed. © The Author(s) Journal compilation © 2012 Portland Press Limited

  19. The effects of erythropoietin signaling on telomerase regulation in non-erythroid malignant and non-malignant cells

    International Nuclear Information System (INIS)

    Uziel, Orit; Kanfer, Gil; Beery, Einat; Yelin, Dana; Shepshelovich, Daniel; Bakhanashvili, Mary; Nordenberg, Jardena; Lahav, Meir

    2014-01-01

    Highlights: • We assumed that some of erythropoietin adverse effects may be mediated by telomerase activity. • EPO administration increased telomerase activity, cells proliferation and migration. • The inhibition of telomerase modestly repressed the proliferative effect of erythropoietin. • Telomere shortening caused by long term inhibition of the enzyme totally abolished that effect. • This effect was mediated via the Lyn–AKT axis and not by the canonical JAK2–STAT pathway. - Abstract: Treatment with erythropoietin (EPO) in several cancers is associated with decreased survival due to cancer progression. Due to the major importance of telomerase in cancer biology we hypothesized that some of these effects may be mediated through EPO effect on telomerase. For this aim we explored the possible effects of EPO on telomerase regulation, cell migration and chemosensitivity in non-erythroid malignant and non-malignant cells. Cell proliferation, telomerase activity (TA) and cell migration increased in response to EPO. EPO had no effect on cancer cells sensitivity to cisplatinum and on the cell cycle status. The inhibition of telomerase modestly repressed the proliferative effect of EPO. Telomere shortening caused by long term inhibition of the enzyme abolished the effect of EPO, suggesting that EPO effects on cancer cells are related to telomere dynamics. TA was correlated with the levels of Epo-R. The increase in TA was mediated post-translationally through the Lyn-Src and not the canonical JAK2 pathway

  20. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

    International Nuclear Information System (INIS)

    Kim, Jiyoung; Cha, Young-Nam; Surh, Young-Joon

    2010-01-01

    Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

  1. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jiyoung [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cha, Young-Nam [Inha University College of Medicine, Incheon 382-751 (Korea, Republic of); Surh, Young-Joon, E-mail: surh@plaza.snu.ac.kr [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Department of Molecular Medicine and Biopharmaceutical Sciences, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cancer Research Institute, Seoul National University, Seoul 110-799 (Korea, Republic of)

    2010-08-07

    Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

  2. Role of Nuclear Factor (Erythroid-Derived 2-Like 2 Signaling for Effects of Fumaric Acid Esters on Dendritic Cells

    Directory of Open Access Journals (Sweden)

    Anna Hammer

    2017-12-01

    Full Text Available To date, the intracellular signaling pathways involved in dendritic cell (DC function are poorly understood. The antioxidative transcription factor nuclear factor (erythroid-derived 2-like 2 (Nrf2 has been shown to affect maturation, function, and subsequent DC-mediated T cell responses of murine and human DCs. In experimental autoimmune encephalomyelitis (EAE, as prototype animal model for a T helper cell-mediated autoimmune disease, antigen presentation, cytokine production, and costimulation by DCs play a major role. We explore the role of Nrf2 in DC function, and DC-mediated T cell responses during T cell-mediated autoimmunity of the central nervous system using genetic ablation and pharmacological activation in mice and men to corroborate our data in a translational setting. In murine and human DCs, monomethyl fumarate induced Nrf2 signaling inhibits DC maturation and DC-mediated T cell proliferation by reducing inflammatory cytokine production and expression of costimulatory molecules. In contrast, Nrf2-deficient DCs generate more activated T helper cells (Th1/Th17 but fewer regulatory T cells and foster T cell proliferation. Transfer of DCs with Nrf2 activation during active EAE reduces disease severity and T cell infiltration. Our data demonstrate that Nrf2 signaling modulates autoimmunity in murine and human systems via inhibiting DC maturation and function thus shedding further light on the mechanism of action of antioxidative stress pathways in antigen-presenting cells.

  3. Nuclear factor erythroid 2-related factor-2 activity controls 4-hydroxynonenal metabolism and activity in prostate cancer cells.

    Science.gov (United States)

    Pettazzoni, Piergiorgio; Ciamporcero, Eric; Medana, Claudio; Pizzimenti, Stefania; Dal Bello, Federica; Minero, Valerio Giacomo; Toaldo, Cristina; Minelli, Rosalba; Uchida, Koji; Dianzani, Mario Umberto; Pili, Roberto; Barrera, Giuseppina

    2011-10-15

    4-Hydroxynonenal (HNE) is an end product of lipoperoxidation with antiproliferative and proapoptotic properties in various tumors. Here we report a greater sensitivity to HNE in PC3 and LNCaP cells compared to DU145 cells. In contrast to PC3 and LNCaP cells, HNE-treated DU145 cells showed a smaller reduction in growth and did not undergo apoptosis. In DU145 cells, HNE did not induce ROS production and DNA damage and generated a lower amount of HNE-protein adducts. DU145 cells had a greater GSH and GST A4 content and GSH/GST-mediated HNE detoxification. Nuclear factor erythroid 2-related factor-2 (Nrf2) is a regulator of the antioxidant response. Nrf2 protein content and nuclear accumulation were higher in DU145 cells compared to PC3 and LNCaP cells, whereas the expression of KEAP1, the main negative regulator of Nrf2 activity, was lower. Inhibition of Nrf2 expression with specific siRNA resulted in a reduction in GST A4 expression and GS-HNE formation, indicating that Nrf2 controls HNE metabolism. In addition, Nrf2 knockdown sensitized DU145 cells to HNE-mediated antiproliferative and proapoptotic activity. In conclusion, we demonstrated that increased Nrf2 activity resulted in a reduction in HNE sensitivity in prostate cancer cells, suggesting a potential mechanism of resistance to pro-oxidant therapy. Copyright © 2011 Elsevier Inc. All rights reserved.

  4. The effects of erythropoietin signaling on telomerase regulation in non-erythroid malignant and non-malignant cells

    Energy Technology Data Exchange (ETDEWEB)

    Uziel, Orit, E-mail: Oritu@clalit.org.il [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Kanfer, Gil [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Dep. of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Beery, Einat [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Yelin, Dana; Shepshelovich, Daniel [Medicine A, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Bakhanashvili, Mary [Unit of Infectious Diseases, Sheba Medical Center, Tel-Hashomer (Israel); Nordenberg, Jardena [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Dep. of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Endocrinology Laboratory, Beilinson Medical Center, Petah-Tikva (Israel); Lahav, Meir [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Medicine A, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel)

    2014-07-18

    Highlights: • We assumed that some of erythropoietin adverse effects may be mediated by telomerase activity. • EPO administration increased telomerase activity, cells proliferation and migration. • The inhibition of telomerase modestly repressed the proliferative effect of erythropoietin. • Telomere shortening caused by long term inhibition of the enzyme totally abolished that effect. • This effect was mediated via the Lyn–AKT axis and not by the canonical JAK2–STAT pathway. - Abstract: Treatment with erythropoietin (EPO) in several cancers is associated with decreased survival due to cancer progression. Due to the major importance of telomerase in cancer biology we hypothesized that some of these effects may be mediated through EPO effect on telomerase. For this aim we explored the possible effects of EPO on telomerase regulation, cell migration and chemosensitivity in non-erythroid malignant and non-malignant cells. Cell proliferation, telomerase activity (TA) and cell migration increased in response to EPO. EPO had no effect on cancer cells sensitivity to cisplatinum and on the cell cycle status. The inhibition of telomerase modestly repressed the proliferative effect of EPO. Telomere shortening caused by long term inhibition of the enzyme abolished the effect of EPO, suggesting that EPO effects on cancer cells are related to telomere dynamics. TA was correlated with the levels of Epo-R. The increase in TA was mediated post-translationally through the Lyn-Src and not the canonical JAK2 pathway.

  5. Correction of glucocerebrosidase deficiency after retroviral-mediated gene transfer into hematopoietic progenitor cells from patients with Gaucher disease

    International Nuclear Information System (INIS)

    Fink, J.K.; Correll, P.H.; Perry, L.K.; Brady, R.O.; Karlsson, S.

    1990-01-01

    Retroviral gene transfer has been used successfully to correct the glucocerebrosidase (GCase) deficiency in primary hematopoietic cells from patients with Gaucher disease. For this model of somatic gene therapy, the authors developed a high-titer, amphotropic retroviral vector designated NTG in which the human GCase gene was driven by the mutant polyoma virus enhancer/herpesvirus thymidine kinase gene (tk) promoter (Py + /Htk). NTG normalized GCase activity in transduced Gaucher fibroblasts and efficiently infected human monocytic and erythroleukemic cell lines. RNA blot-hybridization (Northern blot) analysis of these hemaptopoietic cell lines showed unexpectedly high-level expression from the Moloney murine leukemia virus long terminal repeat (Mo-MLV LTR) and levels of Py + /Htk enhancer/promoter-initiated human GCase RNA that approximated endogenous GCase RNA levels. Furthermore, NTG efficiently infected human hematopoietic progenitor cells. Detection of the provirus in approximately one-third of NTG-infected progenitor colonies that had not been selected in G418-containing medium indicates that relative resistance to G418 underestimated the actual gene transfer efficiency. Northern blot analysis of NTG-infected, progenitor-derived cells showed expression from both the Mo-MLV LTR and the Py + /Htk enhancer/promoter. NTG-transduced hematopoietic progenitor cells from patients with Gaucher disease generated progeny in which GCase activity has been normalized

  6. Correction of glucocerebrosidase deficiency after retroviral-mediated gene transfer into hematopoietic progenitor cells from patients with Gaucher disease

    Energy Technology Data Exchange (ETDEWEB)

    Fink, J.K.; Correll, P.H.; Perry, L.K.; Brady, R.O.; Karlsson, S. (National Institutes of Health, Bethesda, MD (USA))

    1990-03-01

    Retroviral gene transfer has been used successfully to correct the glucocerebrosidase (GCase) deficiency in primary hematopoietic cells from patients with Gaucher disease. For this model of somatic gene therapy, the authors developed a high-titer, amphotropic retroviral vector designated NTG in which the human GCase gene was driven by the mutant polyoma virus enhancer/herpesvirus thymidine kinase gene (tk) promoter (Py{sup +}/Htk). NTG normalized GCase activity in transduced Gaucher fibroblasts and efficiently infected human monocytic and erythroleukemic cell lines. RNA blot-hybridization (Northern blot) analysis of these hemaptopoietic cell lines showed unexpectedly high-level expression from the Moloney murine leukemia virus long terminal repeat (Mo-MLV LTR) and levels of Py{sup +}/Htk enhancer/promoter-initiated human GCase RNA that approximated endogenous GCase RNA levels. Furthermore, NTG efficiently infected human hematopoietic progenitor cells. Detection of the provirus in approximately one-third of NTG-infected progenitor colonies that had not been selected in G418-containing medium indicates that relative resistance to G418 underestimated the actual gene transfer efficiency. Northern blot analysis of NTG-infected, progenitor-derived cells showed expression from both the Mo-MLV LTR and the Py{sup +}/Htk enhancer/promoter. NTG-transduced hematopoietic progenitor cells from patients with Gaucher disease generated progeny in which GCase activity has been normalized.

  7. Adventitial SCA-1+ Progenitor Cell Gene Sequencing Reveals the Mechanisms of Cell Migration in Response to Hyperlipidemia

    Directory of Open Access Journals (Sweden)

    Ioannis Kokkinopoulos

    2017-08-01

    Full Text Available Adventitial progenitor cells, including SCA-1+ and mesenchymal stem cells, are believed to be important in vascular remodeling. It has been shown that SCA-1+ progenitor cells are involved in neointimal hyperplasia of vein grafts, but little is known concerning their involvement in hyperlipidemia-induced atherosclerosis. We employed single-cell sequencing technology on primary adventitial mouse SCA-1+ cells from wild-type and atherosclerotic-prone (ApoE-deficient mice and found that a group of genes controlling cell migration and matrix protein degradation was highly altered. Adventitial progenitors from ApoE-deficient mice displayed an augmented migratory potential both in vitro and in vivo. This increased migratory ability was mimicked by lipid loading to SCA-1+ cells. Furthermore, we show that lipid loading increased miRNA-29b expression and induced sirtuin-1 and matrix metalloproteinase-9 levels to promote cell migration. These results provide direct evidence that blood cholesterol levels influence vascular progenitor cell function, which could be a potential target cell for treatment of vascular disease.

  8. Luminal progenitors restrict their lineage potential during mammary gland development.

    Science.gov (United States)

    Rodilla, Veronica; Dasti, Alessandro; Huyghe, Mathilde; Lafkas, Daniel; Laurent, Cécile; Reyal, Fabien; Fre, Silvia

    2015-02-01

    The hierarchical relationships between stem cells and progenitors that guide mammary gland morphogenesis are still poorly defined. While multipotent basal stem cells have been found within the myoepithelial compartment, the in vivo lineage potential of luminal progenitors is unclear. Here we used the expression of the Notch1 receptor, previously implicated in mammary gland development and tumorigenesis, to elucidate the hierarchical organization of mammary stem/progenitor cells by lineage tracing. We found that Notch1 expression identifies multipotent stem cells in the embryonic mammary bud, which progressively restrict their lineage potential during mammary ductal morphogenesis to exclusively generate an ERαneg luminal lineage postnatally. Importantly, our results show that Notch1-labelled cells represent the alveolar progenitors that expand during pregnancy and survive multiple successive involutions. This study reveals that postnatal luminal epithelial cells derive from distinct self-sustained lineages that may represent the cells of origin of different breast cancer subtypes.

  9. Reporter-Based Isolation of Developmental Myogenic Progenitors

    Directory of Open Access Journals (Sweden)

    Eyemen Kheir

    2018-04-01

    Full Text Available The formation and activity of mammalian tissues entail finely regulated processes, involving the concerted organization and interaction of multiple cell types. In recent years the prospective isolation of distinct progenitor and stem cell populations has become a powerful tool in the hands of developmental biologists and has rendered the investigation of their intrinsic properties possible. In this protocol, we describe how to purify progenitors with different lineage history and degree of differentiation from embryonic and fetal skeletal muscle by fluorescence-activated cell sorting (FACS. The approach takes advantage of a panel of murine strains expressing fluorescent reporter genes specifically in the myogenic progenitors. We provide a detailed description of the dissection procedures and of the enzymatic dissociation required to maximize the yield of mononucleated cells for subsequent FACS-based purification. The procedure takes ~6–7 h to complete and allows for the isolation and the subsequent molecular and phenotypic characterization of developmental myogenic progenitors.

  10. Endothelial progenitor cells in chronic obstructive pulmonary disease and emphysema

    Science.gov (United States)

    Tracy, Russell P.; Parikh, Megha A.; Hoffman, Eric A.; Shimbo, Daichi; Austin, John H. M.; Smith, Benjamin M.; Hueper, Katja; Vogel-Claussen, Jens; Lima, Joao; Gomes, Antoinette; Watson, Karol; Kawut, Steven; Barr, R. Graham

    2017-01-01

    Endothelial injury is implicated in the pathogenesis of COPD and emphysema; however the role of endothelial progenitor cells (EPCs), a marker of endothelial cell repair, and circulating endothelial cells (CECs), a marker of endothelial cell injury, in COPD and its subphenotypes is unresolved. We hypothesized that endothelial progenitor cell populations would be decreased in COPD and emphysema and that circulating endothelial cells would be increased. Associations with other subphenotypes were examined. The Multi-Ethnic Study of Atherosclerosis COPD Study recruited smokers with COPD and controls age 50–79 years without clinical cardiovascular disease. Endothelial progenitor cell populations (CD34+KDR+ and CD34+KDR+CD133+ cells) and circulating endothelial cells (CD45dimCD31+CD146+CD133-) were measured by flow cytometry. COPD was defined by standard spirometric criteria. Emphysema was assessed qualitatively and quantitatively on CT. Full pulmonary function testing and expiratory CTs were measured in a subset. Among 257 participants, both endothelial progenitor cell populations, and particularly CD34+KDR+ endothelial progenitor cells, were reduced in COPD. The CD34+KDR+CD133+ endothelial progenitor cells were associated inversely with emphysema extent. Both endothelial progenitor cell populations were associated inversely with extent of panlobular emphysema and positively with diffusing capacity. Circulating endothelial cells were not significantly altered in COPD but were inversely associated with pulmonary microvascular blood flow on MRI. There was no consistent association of endothelial progenitor cells or circulating endothelial cells with measures of gas trapping. These data provide evidence that endothelial repair is impaired in COPD and suggest that this pathological process is specific to emphysema. PMID:28291826

  11. Invited review: mesenchymal progenitor cells in intramuscular connective tissue development.

    Science.gov (United States)

    Miao, Z G; Zhang, L P; Fu, X; Yang, Q Y; Zhu, M J; Dodson, M V; Du, M

    2016-01-01

    The abundance and cross-linking of intramuscular connective tissue contributes to the background toughness of meat, and is thus undesirable. Connective tissue is mainly synthesized by intramuscular fibroblasts. Myocytes, adipocytes and fibroblasts are derived from a common pool of progenitor cells during the early embryonic development. It appears that multipotent mesenchymal stem cells first diverge into either myogenic or non-myogenic lineages; non-myogenic mesenchymal progenitors then develop into the stromal-vascular fraction of skeletal muscle wherein adipocytes, fibroblasts and derived mesenchymal progenitors reside. Because non-myogenic mesenchymal progenitors mainly undergo adipogenic or fibrogenic differentiation during muscle development, strengthening progenitor proliferation enhances the potential for both intramuscular adipogenesis and fibrogenesis, leading to the elevation of both marbling and connective tissue content in the resulting meat product. Furthermore, given the bipotent developmental potential of progenitor cells, enhancing their conversion to adipogenesis reduces fibrogenesis, which likely results in the overall improvement of marbling (more intramuscular adipocytes) and tenderness (less connective tissue) of meat. Fibrogenesis is mainly regulated by the transforming growth factor (TGF) β signaling pathway and its regulatory cascade. In addition, extracellular matrix, a part of the intramuscular connective tissue, provides a niche environment for regulating myogenic differentiation of satellite cells and muscle growth. Despite rapid progress, many questions remain in the role of extracellular matrix on muscle development, and factors determining the early differentiation of myogenic, adipogenic and fibrogenic cells, which warrant further studies.

  12. Biology and flow cytometry of proangiogenic hematopoietic progenitors cells.

    Science.gov (United States)

    Rose, Jonathan A; Erzurum, Serpil; Asosingh, Kewal

    2015-01-01

    During development, hematopoiesis and neovascularization are closely linked to each other via a common bipotent stem cell called the hemangioblast that gives rise to both hematopoietic cells and endothelial cells. In postnatal life, this functional connection between the vasculature and hematopoiesis is maintained by a subset of hematopoietic progenitor cells endowed with the capacity to differentiate into potent proangiogenic cells. These proangiogenic hematopoietic progenitors comprise a specific subset of bone marrow (BM)-derived cells that homes to sites of neovascularization and possess potent paracrine angiogenic activity. There is emerging evidence that this subpopulation of hematopoietic progenitors plays a critical role in vascular health and disease. Their angiogenic activity is distinct from putative "endothelial progenitor cells" that become structural cells of the endothelium by differentiation into endothelial cells. Proangiogenic hematopoietic progenitor cell research requires multidisciplinary expertise in flow cytometry, hematology, and vascular biology. This review provides a comprehensive overview of proangiogenic hematopoietic progenitor cell biology and flow cytometric methods to detect these cells in the peripheral blood circulation and BM. © 2014 International Society for Advancement of Cytometry.

  13. LINKING TYPE Ia SUPERNOVA PROGENITORS AND THEIR RESULTING EXPLOSIONS

    International Nuclear Information System (INIS)

    Foley, Ryan J.; Kirshner, Robert P.; Simon, Joshua D.; Burns, Christopher R.; Gal-Yam, Avishay; Hamuy, Mario; Morrell, Nidia I.; Phillips, Mark M.; Shields, Gregory A.; Sternberg, Assaf

    2012-01-01

    Comparing the ejecta velocities at maximum brightness and narrow circumstellar/interstellar Na D absorption line profiles of a sample of 23 Type Ia supernovae (SNe Ia), we determine that the properties of SN Ia progenitor systems and explosions are intimately connected. As demonstrated by Sternberg et al., half of all SNe Ia with detectable Na D absorption at the host-galaxy redshift in high-resolution spectroscopy have Na D line profiles with significant blueshifted absorption relative to the strongest absorption component, which indicates that a large fraction of SN Ia progenitor systems have strong outflows. In this study, we find that SNe Ia with blueshifted circumstellar/interstellar absorption systematically have higher ejecta velocities and redder colors at maximum brightness relative to the rest of the SN Ia population. This result is robust at a 98.9%-99.8% confidence level, providing the first link between the progenitor systems and properties of the explosion. This finding is further evidence that the outflow scenario is the correct interpretation of the blueshifted Na D absorption, adding additional confirmation that some SNe Ia are produced from a single-degenerate progenitor channel. An additional implication is that either SN Ia progenitor systems have highly asymmetric outflows that are also aligned with the SN explosion or SNe Ia come from a variety of progenitor systems where SNe Ia from systems with strong outflows tend to have more kinetic energy per unit mass than those from systems with weak or no outflows.

  14. Epigenetic and molecular profiles of erythroid cells after hydroxyurea treatment in sickle cell anemia

    Science.gov (United States)

    Steward, Shirley; Howard, Thad A.; Mortier, Nicole; Smeltzer, Matthew; Wang, Yong-Dong; Ware, Russell E.

    2011-01-01

    Hydroxyurea has been shown to be efficacious for the treatment of sickle cell anemia (SCA), primarily through the induction of fetal hemoglobin (HbF). However, the exact mechanisms by which hydroxyurea can induce HbF remain incompletely defined, although direct transcriptional effects and altered cell cycle kinetics have been proposed. In this study, we investigated potential epigenetic and alternative molecular mechanisms of hydroxyurea-mediated HbF induction by examining methylation patterns within the Gγ-globin promoter and miRNA expression within primary CD71+ erythrocytes of patients with SCA, both at baseline before beginning hydroxyurea therapy and after reaching maximum tolerated dose (MTD). Using both cross-sectional analysis and paired-sample analysis, we found that the highly methylated Gγ-globin promoter was inversely correlated to baseline HbF levels, but only slightly altered by hydroxyurea treatment. Conversely, expression of several specific miRNAs was significantly increased after hydroxyurea treatment, and expression of miR-26b and miR-151-3p were both associated with HbF levels at MTD. The significant associations identified in these studies suggest that methylation may be important for regulation of baseline HbF, but not after hydroxyurea treatment, whereas changes in miRNA expression may be associated with hydroxyurea-mediated HbF induction. This study was registered at ClinicalTrials.gov (NCT00305175). PMID:21921042

  15. Effects of the activin A-myostatin-follistatin system on aging bone and muscle progenitor cells

    Science.gov (United States)

    Bowser, Matthew; Herberg, Samuel; Arounleut, Phonepasong; Shi, Xingming; Fulzele, Sadanand; Hill, William D.; Isales, Carlos M.; Hamrick, Mark W.

    2013-01-01

    The activin A-myostatin-follistatin system is thought to play an important role in the regulation of muscle and bone mass throughout growth, development, and aging; however, the effects of these ligands on progenitor cell proliferation and differentiation in muscle and bone are not well understood. In addition, age-associated changes in the relative expression of these factors in musculoskeletal tissues have not been described. We therefore examined changes in protein levels of activin A, follistatin, and myostatin (GDF-8) in both muscle and bone with age in C57BL6 mice using ELISA. We then investigated the effects of activin A, myostatin and follistatin on the proliferation and differentiation of primary myoblasts and mouse bone marrow stromal cells (BMSCs) in vitro. Myostatin levels and the myostatin:follistatin ratio increased with age in the primarily slow-twitch mouse soleus muscle, whereas the pattern was reversed with age in the fast-twitch extensor digitorum longus muscle. Myostatin levels and the myostatin: follistatin ratio increased significantly (+75%) in mouse bone marrow with age, as did activin A levels (+17%). Follistatin increased the proliferation of primary myoblasts from both young and aged mice, whereas myostatin increased proliferation of younger myoblasts but decreased proliferation of older myoblasts. Myostatin reduced proliferation of both young and aged BMSCs in a dose-dependent fashion, and activin A increased mineralization in both young and aged BMSCs. Together these data suggest that aging in mice is accompanied by changes in the expression of activin A and myostatin, as well as changes in the response of bone and muscle progenitor cells to these factors. Myostatin appears to play a particularly important role in the impaired proliferative capacity of muscle and bone progenitor cells from aged mice. PMID:23178301

  16. Clues on Type Ia Supernovae Progenitors

    International Nuclear Information System (INIS)

    Piersanti, Luciano; Tornambe, Amedeo

    2005-01-01

    We show that in the framework of canonical stellar evolution it is hard, if not impossible, to determine the growth in mass of a CO White Dwarf, up to the Chandrasekhar limit by means of mass transfer from its companion in a binary system. This is the case either if matter is accreted from a normal companion with an H-rich envelope or if direct CO accretion occurs from a CO WD companion. At variance, we show that if the effects of rotation are taken into account in modeling the accretion process, a CO WD can increase its mass at the expenses of the degenerate CO companion up and beyond 1.4 M· , so that an explosive event of the type Ia class is naturally produced. This theoretical finding revives the Double Degenerate scenario for type Ia SNe progenitors. In such a case the internal spread in the observational properties of type Ia SNe may be interpreted as a consequence of different total masses; hence differences between SNe Ia in nearby elliptical galaxies and the majority of those in spirals should be expected and the current use of type Ia SNe as cosmological distance indicators should be justified

  17. TWEAK induces liver progenitor cell proliferation

    Science.gov (United States)

    Jakubowski, Aniela; Ambrose, Christine; Parr, Michael; Lincecum, John M.; Wang, Monica Z.; Zheng, Timothy S.; Browning, Beth; Michaelson, Jennifer S.; Baestcher, Manfred; Wang, Bruce; Bissell, D. Montgomery; Burkly, Linda C.

    2005-01-01

    Progenitor (“oval”) cell expansion accompanies many forms of liver injury, including alcohol toxicity and submassive parenchymal necrosis as well as experimental injury models featuring blocked hepatocyte replication. Oval cells can potentially become either hepatocytes or biliary epithelial cells and may be critical to liver regeneration, particularly when hepatocyte replication is impaired. The regulation of oval cell proliferation is incompletely understood. Herein we present evidence that a TNF family member called TWEAK (TNF-like weak inducer of apoptosis) stimulates oval cell proliferation in mouse liver through its receptor Fn14. TWEAK has no effect on mature hepatocytes and thus appears to be selective for oval cells. Transgenic mice overexpressing TWEAK in hepatocytes exhibit periportal oval cell hyperplasia. A similar phenotype was obtained in adult wild-type mice, but not Fn14-null mice, by administering TWEAK-expressing adenovirus. Oval cell expansion induced by 3,5-diethoxycarbonyl-1,4-dihydrocollidine (DDC) was significantly reduced in Fn14-null mice as well as in adult wild-type mice with a blocking anti-TWEAK mAb. Importantly, TWEAK stimulated the proliferation of an oval cell culture model. Finally, we show increased Fn14 expression in chronic hepatitis C and other human liver diseases relative to its expression in normal liver, which suggests a role for the TWEAK/Fn14 pathway in human liver injury. We conclude that TWEAK has a selective mitogenic effect for liver oval cells that distinguishes it from other previously described growth factors. PMID:16110324

  18. Harmine stimulates proliferation of human neural progenitors

    Directory of Open Access Journals (Sweden)

    Vanja Dakic

    2016-12-01

    Full Text Available Harmine is the β-carboline alkaloid with the highest concentration in the psychotropic plant decoction Ayahuasca. In rodents, classical antidepressants reverse the symptoms of depression by stimulating neuronal proliferation. It has been shown that Ayahuasca presents antidepressant effects in patients with depressive disorder. In the present study, we investigated the effects of harmine in cell cultures containing human neural progenitor cells (hNPCs, 97% nestin-positive derived from pluripotent stem cells. After 4 days of treatment, the pool of proliferating hNPCs increased by 71.5%. Harmine has been reported as a potent inhibitor of the dual specificity tyrosine-phosphorylation-regulated kinase (DYRK1A, which regulates cell proliferation and brain development. We tested the effect of analogs of harmine, an inhibitor of DYRK1A (INDY, and an irreversible selective inhibitor of monoamine oxidase (MAO but not DYRK1A (pargyline. INDY but not pargyline induced proliferation of hNPCs similarly to harmine, suggesting that inhibition of DYRK1A is a possible mechanism to explain harmine effects upon the proliferation of hNPCs. Our findings show that harmine enhances proliferation of hNPCs and suggest that inhibition of DYRK1A may explain its effects upon proliferation in vitro and antidepressant effects in vivo.

  19. Role of liver progenitors in liver regeneration.

    Science.gov (United States)

    Best, Jan; Manka, Paul; Syn, Wing-Kin; Dollé, Laurent; van Grunsven, Leo A; Canbay, Ali

    2015-02-01

    During massive liver injury and hepatocyte loss, the intrinsic regenerative capacity of the liver by replication of resident hepatocytes is overwhelmed. Treatment of this condition depends on the cause of liver injury, though in many cases liver transplantation (LT) remains the only curative option. LT for end stage chronic and acute liver diseases is hampered by shortage of donor organs and requires immunosuppression. Hepatocyte transplantation is limited by yet unresolved technical difficulties. Since currently no treatment is available to facilitate liver regeneration directly, therapies involving the use of resident liver stem or progenitor cells (LPCs) or non-liver stem cells are coming to fore. LPCs are quiescent in the healthy liver, but may be activated under conditions where the regenerative capacity of mature hepatocytes is severely impaired. Non-liver stem cells include embryonic stem cells (ES cells) and mesenchymal stem cells (MSCs). In the first section, we aim to provide an overview of the role of putative cytokines, growth factors, mitogens and hormones in regulating LPC response and briefly discuss the prognostic value of the LPC response in clinical practice. In the latter section, we will highlight the role of other (non-liver) stem cells in transplantation and discuss advantages and disadvantages of ES cells, induced pluripotent stem cells (iPS), as well as MSCs.

  20. Hepatic progenitors for liver disease: current position

    Directory of Open Access Journals (Sweden)

    Alice Conigliaro

    2010-02-01

    Full Text Available Alice Conigliaro1, David A Brenner2, Tatiana Kisseleva21University “La Sapienza”, Dipartimento di Biotecnologie Cellulari ed Ematologia Policlinico Umberto I, V Clinica Medica, Rome, Italy; 2Department of Medicine, University of California, San Diego, La Jolla, CA, USAAbstract: Liver regeneration restores the original functionality of hepatocytes and cholangiocytes in response to injury. It is regulated on several levels, with different cellular populations contributing to this process, eg, hepatocytes, liver precursor cells, intrahepatic stem cells. In response to injury, mature hepatocytes have the capability to proliferate and give rise to new hepatocytes and cholangiocytes. Meanwhile, liver precursor cells (oval cells have become the most recognized bipotential precursor cells in the damaged liver. They rapidly proliferate, change their cellular composition, and differentiate into hepatocytes and cholangiocytes to compensate for the cellular loss and maintain liver homeostasis. There is a growing body of evidence that oval cells originate from the intrahepatic stem cell(s, which in turn give(s rise to epithelial, including oval cells, and/or other hepatic cells of nonepithelial origin. Since there is a close relationship between the liver and hematopoiesis, bone marrow derived cells can also contribute to liver regeneration by the fusion of myeloid cells with damaged hepatocytes, or differentiation of mesenchymal stem cells into hepatocyte-like cells. The current review discusses the contribution of different cells to liver regeneration and their characteristics.Keywords: hepatic progenitor, liver disease, liver precursor cells, oval cells, hepatocytes, intrahepatic stem cells, cholangiocytes

  1. Optimizing culture medium composition to improve oligodendrocyte progenitor cell yields in vitro from subventricular zone-derived neural progenitor cell neurospheres.

    Directory of Open Access Journals (Sweden)

    Paula G Franco

    Full Text Available Neural Stem and Progenitor Cells (NSC/NPC are gathering tangible recognition for their uses in cell therapy and cell replacement therapies for human disease, as well as a model system to continue research on overall neural developmental processes in vitro. The Subventricular Zone is one of the largest NSC/NPC niches in the developing mammalian Central Nervous System, and persists through to adulthood. Oligodendrocyte progenitor cell (OPC enriched cultures are usefull tools for in vitro studies as well as for cell replacement therapies for treating demyelination diseases. We used Subventricular Zone-derived NSC/NPC primary cultures from newborn mice and compared the effects of different growth factor combinations on cell proliferation and OPC yield. The Platelet Derived Growth Factor-AA and BB homodimers had a positive and significant impact on OPC generation. Furthermore, heparin addition to the culture media contributed to further increase overall culture yields. The OPC generated by this protocol were able to mature into Myelin Basic Protein-expressing cells and to interact with neurons in an in vitro co-culture system. As a whole, we describe an optimized in vitro method for increasing OPC.

  2. Defibrotide in combination with granulocyte colony-stimulating factor significantly enhances the mobilization of primitive and committed peripheral blood progenitor cells in mice.

    Science.gov (United States)

    Carlo-Stella, Carmelo; Di Nicola, Massimo; Magni, Michele; Longoni, Paolo; Milanesi, Marco; Stucchi, Claudio; Cleris, Loredana; Formelli, Franca; Gianni, Massimo A

    2002-11-01

    Defibrotide is a polydeoxyribonucleotide, which significantly reduces the expression of adhesion molecules on endothelial cells. We investigated the activity of Defibrotide alone or in combination with recombinant human granulocyte colony-stimulating factor (rhG-CSF) to mobilize peripheral blood progenitor cells (PBPCs) in BALB/c mice. A 5-day treatment with Defibrotide alone (1-15 mg/mouse/day) had no effect on WBC counts, frequencies and absolute numbers of total circulating colony-forming cells (CFCs), i.e., granulocyte-macrophage colony-forming units, erythroid burst-forming units, and multilineage colony-forming units. As compared with mock-injected mice, administration of rhG-CSF alone (5 micro g/mouse/day) for 5 days significantly (P Defibrotide (15 mg/mouse/day) and rhG-CSF significantly (P Defibrotide plus rhG-CSF resulted in a significant increase (P Defibrotide/rhG-CSF-mobilized mononuclear cells rescued 43% and 71% of recipient mice, respectively. Experiments of CFC homing performed in lethally irradiated or nonirradiated recipients showed that marrow homing of transplanted PBPCs was reduced by 3-fold in Defibrotide-treated animals as compared with mock-injected mice (P Defibrotide might be because of an effect on PBPC trafficking. In conclusion, our data demonstrate that Defibrotide synergizes with rhG-CSF and significantly increases the mobilization of a broad spectrum of PBPCs, including primitive and committed progenitor cells. These data might have relevant implications for autologous and allogeneic anticancer therapy in humans.

  3. 8-Oxoguanine DNA glycosylase 1 (ogg1) maintains the function of cardiac progenitor cells during heart formation in zebrafish

    Energy Technology Data Exchange (ETDEWEB)

    Yan, Lifeng [State Key Laboratory of Reproductive Medicine, Institute of Toxicology, Nanjing Medical University, Nanjing 210029 (China); Key Laboratory of Modern Toxicology of Ministry of Education, School of Public Health, Nanjing Medical University, Nanjing 210029 (China); Zhou, Yong [Key Laboratory of Stem Cell Biology, Institute of Health Sciences, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences and Shanghai Jiao Tong University School of Medicine, Shanghai 200025 (China); Yu, Shanhe [Shanghai Institute of Hematology, RuiJin Hospital, Shanghai Jiao Tong University, School of Medicine, Shanghai 200025 (China); Ji, Guixiang [Nanjing Institute of Environmental Sciences/Key Laboratory of Pesticide Environmental Assessment and Pollution Control, Ministry of Environmental Protection, Nanjing 210042 (China); Wang, Lei [Key Laboratory of Stem Cell Biology, Institute of Health Sciences, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences and Shanghai Jiao Tong University School of Medicine, Shanghai 200025 (China); Liu, Wei [State Key Laboratory of Reproductive Medicine, Institute of Toxicology, Nanjing Medical University, Nanjing 210029 (China); Key Laboratory of Modern Toxicology of Ministry of Education, School of Public Health, Nanjing Medical University, Nanjing 210029 (China); Gu, Aihua, E-mail: aihuagu@njmu.edu.cn [State Key Laboratory of Reproductive Medicine, Institute of Toxicology, Nanjing Medical University, Nanjing 210029 (China); Key Laboratory of Modern Toxicology of Ministry of Education, School of Public Health, Nanjing Medical University, Nanjing 210029 (China)

    2013-11-15

    Genomic damage may devastate the potential of progenitor cells and consequently impair early organogenesis. We found that ogg1, a key enzyme initiating the base-excision repair, was enriched in the embryonic heart in zebrafish. So far, little is known about DNA repair in cardiogenesis. Here, we addressed the critical role of ogg1 in cardiogenesis for the first time. ogg1 mainly expressed in the anterior lateral plate mesoderm (ALPM), the primary heart tube, and subsequently the embryonic myocardium by in situ hybridisation. Loss of ogg1 resulted in severe cardiac morphogenesis and functional abnormalities, including the short heart length, arrhythmia, decreased cardiomyocytes and nkx2.5{sup +} cardiac progenitor cells. Moreover, the increased apoptosis and repressed proliferation of progenitor cells caused by ogg1 deficiency might contribute to the heart phenotype. The microarray analysis showed that the expression of genes involved in embryonic heart tube morphogenesis and heart structure were significantly changed due to the lack of ogg1. Among those, foxh1 is an important partner of ogg1 in the cardiac development in response to DNA damage. Our work demonstrates the requirement of ogg1 in cardiac progenitors and heart development in zebrafish. These findings may be helpful for understanding the aetiology of congenital cardiac deficits. - Highlights: • A key DNA repair enzyme ogg1 is expressed in the embryonic heart in zebrafish. • We found that ogg1 is essential for normal cardiac morphogenesis in zebrafish. • The production of embryonic cardiomyocytes requires appropriate ogg1 expression. • Ogg1 critically regulated proliferation of cardiac progenitor cells in zebrafish. • foxh1 is a partner of ogg1 in the cardiac development in response to DNA damage.

  4. Nuclear factor erythroid 2-related factor 2 deletion impairs glucose tolerance and exacerbates hyperglycemia in type 1 diabetic mice.

    Science.gov (United States)

    Aleksunes, Lauren M; Reisman, Scott A; Yeager, Ronnie L; Goedken, Michael J; Klaassen, Curtis D

    2010-04-01

    The transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) induces a battery of cytoprotective genes after oxidative stress. Nrf2 aids in liver regeneration by altering insulin signaling; however, whether Nrf2 participates in hepatic glucose homeostasis is unknown. Compared with wild-type mice, mice lacking Nrf2 (Nrf2-null) have lower basal serum insulin and prolonged hyperglycemia in response to an intraperitoneal glucose challenge. In the present study, blood glucose, serum insulin, urine flow rate, and hepatic expression of glucose-related genes were quantified in male diabetic wild-type and Nrf2-null mice. Type 1 diabetes was induced with a single intraperitoneal dose (200 mg/kg) of streptozotocin (STZ). Histopathology and serum insulin levels confirmed depleted pancreatic beta-cells in STZ-treated mice of both genotypes. Five days after STZ, Nrf2-null mice had higher blood glucose levels than wild-type mice. Nine days after STZ, polyuria occurred in both genotypes with more urine output from Nrf2-null mice (11-fold) than wild-type mice (7-fold). Moreover, STZ-treated Nrf2-null mice had higher levels of serum beta-hydroxybutyrate, triglycerides, and fatty acids 10 days after STZ compared with wild-type mice. STZ reduced hepatic glycogen in both genotypes, with less observed in Nrf2-null mice. Increased urine output and blood glucose in STZ-treated Nrf2-null mice corresponded with enhanced gluconeogenesis (glucose-6-phosphatase and phosphoenolpyruvate carboxykinase)- and reduced glycolysis (pyruvate kinase)-related mRNA expression in their livers. Furthermore, the Nrf2 activator oltipraz lowered blood glucose in wild-type but not Nrf2-null mice administered STZ. Collectively, these data indicate that the absence of Nrf2 worsens hyperglycemia in type I diabetic mice and Nrf2 may represent a therapeutic target for reducing circulating glucose levels.

  5. Inhibition of erythroid cell growth by allogeneic murine lymphocytes. Evidence for a synergism between lymph node cells and thymocytes

    International Nuclear Information System (INIS)

    Blomgren, H.; Jacobsson, H.

    1974-01-01

    Murine lymphoid cells from thymus and lymph nodes were tested for synergistic response in a graft-vs-host test. The test is based on the principle that allogeneic lymphocytes inhibit erythroid cell proliferation in the spleens of irradiated mice infused with syngeneic bone marrow cells. Mixtures of thymocytes and lymph node cells from the same parental strain yielded graft-vs-host responses in irradiated F 1 -hybrids higher than expected by summing the responses of the two cell populations tested separately. A similar synergistic response was obtained using mixtures of thymocytes and lymph node cells obtained from the two parental strains of the hybrid, whereas such an effect was not detected using mixtures of lymph node cells or mixtures of thymocytes from the two parental strains. Nor could synergy be demonstrated between parental strain lymph node cells and thymocytes syngeneic with the bone marrow target cells. Thymocytes obtained from one parental strain which was injected into its irradiated F 1 -hybrid transformed into a population of sensitized cells in the spleens of the recipients. This transformation was suppressed by the simultaneous injection of lymph node cells from the second parental strain. Since there is a synergistic immune response by such cell mixtures it is concluded that thymocytes may enhance the graft-vs-host response of lymph node cells. Parental strain thymocytes and lymph node cells, the latter being specifically immunologically tolerant to the bone marrow target cells, failed to give a synergistic response indicating that thymocytes do not transform unresponsive lymphocytes into responsive, but rather enhance the reactivity of existing, specifically responsive cells. The results thus show that thymocytes may enhance the response of lymph node cells in this specific graft-vs-host assay

  6. Distinct roles of the receptor tyrosine kinases c-ErbB and c-Kit in regulating the balance between erythroid cell proliferation and differentiation

    NARCIS (Netherlands)

    Wessely, O.; Mellitzer, G.; von Lindern, M.; Levitzki, A.; Gazit, A.; Ischenko, I.; Hayman, M. J.; Beug, H.

    1997-01-01

    In the bone marrow, multipotent and committed hematopoietic progenitors have to closely regulate their balance between sustained proliferation without differentiation (self renewal) and entering a terminal differentiation pathway. A useful model to analyze this regulation at the molecular level is

  7. Notch signaling and progenitor/ductular reaction in steatohepatitis.

    Directory of Open Access Journals (Sweden)

    Carola M Morell

    Full Text Available Persistent hepatic progenitor cells (HPC activation resulting in ductular reaction (DR is responsible for pathologic liver repair in cholangiopathies. Also, HPC/DR expansion correlates with fibrosis in several chronic liver diseases, including steatohepatitis. Increasing evidence indicates Notch signaling as a key regulator of HPC/DR response in biliary and more in general liver injuries. Therefore, we aimed to investigate the role of Notch during HPC/DR activation in a mouse model of steatohepatitis.Steatohepatitis was generated using methionine-choline deficient (MCD diet. For hepatocyte lineage tracing, R26R-YFP mice were infected with AAV8-TBG-Cre.MCD diet promoted a strong HPC/DR response that progressively diffused in the lobule, and correlated with increased fibrosis and TGF-β1 expression. Notch signaling was unchanged in laser-capture microdissected HPC/DR, whereas Notch receptors were down regulated in hepatocytes. However, in-vivo lineage tracing experiments identified discrete hepatocytes showing Notch-1 activation and expressing (the Notch-dependent Sox9. Stimulation of AML-12 hepatocyte-cell line with immobilized Jag1 induced Sox9 and down-regulated albumin and BSEP expression. TGF-β1 treatment in primary hepatic stellate cells (HSC induced Jag1 expression. In MCD diet-fed mice, αSMA-positive HSC were localized around Sox9 expressing hepatocytes, suggesting that Notch activation in hepatocytes was promoted by TGF-β1 stimulated HSC. In-vivo Notch inhibition reduced HPC response and fibrosis progression.Our data suggest that Notch signaling is an important regulator of DR and that in steatohepatitis, hepatocytes exposed to Jag1-positive HSC, contribute to pathologic DR by undergoing Notch-mediated differentiation towards an HPC-like phenotype. Given the roles of Notch in fibrosis and liver cancer, these data suggest mesenchymal expression of Jag1 as an alternative therapeutic target.

  8. Renal blood flow and oxygenation drive nephron progenitor differentiation.

    Science.gov (United States)

    Rymer, Christopher; Paredes, Jose; Halt, Kimmo; Schaefer, Caitlin; Wiersch, John; Zhang, Guangfeng; Potoka, Douglas; Vainio, Seppo; Gittes, George K; Bates, Carlton M; Sims-Lucas, Sunder

    2014-08-01

    During kidney development, the vasculature develops via both angiogenesis (branching from major vessels) and vasculogenesis (de novo vessel formation). The formation and perfusion of renal blood vessels are vastly understudied. In the present study, we investigated the regulatory role of renal blood flow and O2 concentration on nephron progenitor differentiation during ontogeny. To elucidate the presence of blood flow, ultrasound-guided intracardiac microinjection was performed, and FITC-tagged tomato lectin was perfused through the embryo. Kidneys were costained for the vasculature, ureteric epithelium, nephron progenitors, and nephron structures. We also analyzed nephron differentiation in normoxia compared with hypoxia. At embryonic day 13.5 (E13.5), the major vascular branches were perfused; however, smaller-caliber peripheral vessels remained unperfused. By E15.5, peripheral vessels started to be perfused as well as glomeruli. While the interior kidney vessels were perfused, the peripheral vessels (nephrogenic zone) remained unperfused. Directly adjacent and internal to the nephrogenic zone, we found differentiated nephron structures surrounded and infiltrated by perfused vessels. Furthermore, we determined that at low O2 concentration, little nephron progenitor differentiation was observed; at higher O2 concentrations, more differentiation of the nephron progenitors was induced. The formation of the developing renal vessels occurs before the onset of blood flow. Furthermore, renal blood flow and oxygenation are critical for nephron progenitor differentiation. Copyright © 2014 the American Physiological Society.

  9. THE TYPE IIb SUPERNOVA 2011dh FROM A SUPERGIANT PROGENITOR

    International Nuclear Information System (INIS)

    Bersten, Melina C.; Nomoto, Ken'ichi; Folatelli, Gastón; Maeda, Keiichi; Benvenuto, Omar G.; Ergon, Mattias; Sollerman, Jesper; Benetti, Stefano; Ochner, Paolo; Tomasella, Lina; Botticella, Maria Teresa; Fraser, Morgan; Kotak, Rubina

    2012-01-01

    A set of hydrodynamical models based on stellar evolutionary progenitors is used to study the nature of SN 2011dh. Our modeling suggests that a large progenitor star—with R ∼ 200 R ☉ —is needed to reproduce the early light curve (LC) of SN 2011dh. This is consistent with the suggestion that the yellow super-giant star detected at the location of the supernova (SN) in deep pre-explosion images is the progenitor star. From the main peak of the bolometric LC and expansion velocities, we constrain the mass of the ejecta to be ≈2 M ☉ , the explosion energy to be E = (6-10) × 10 50 erg, and the 56 Ni mass to be approximately 0.06 M ☉ . The progenitor star was composed of a helium core of 3-4 M ☉ and a thin hydrogen-rich envelope of ≈0.1M ☉ with a main-sequence mass estimated to be in the range of 12-15 M ☉ . Our models rule out progenitors with helium-core masses larger than 8 M ☉ , which correspond to M ZAMS ∼> 25M ☉ . This suggests that a single star evolutionary scenario for SN 2011dh is unlikely.

  10. NFIX Regulates Neural Progenitor Cell Differentiation During Hippocampal Morphogenesis

    Science.gov (United States)

    Heng, Yee Hsieh Evelyn; McLeay, Robert C.; Harvey, Tracey J.; Smith, Aaron G.; Barry, Guy; Cato, Kathleen; Plachez, Céline; Little, Erica; Mason, Sharon; Dixon, Chantelle; Gronostajski, Richard M.; Bailey, Timothy L.; Richards, Linda J.; Piper, Michael

    2014-01-01

    Neural progenitor cells have the ability to give rise to neurons and glia in the embryonic, postnatal and adult brain. During development, the program regulating whether these cells divide and self-renew or exit the cell cycle and differentiate is tightly controlled, and imbalances to the normal trajectory of this process can lead to severe functional consequences. However, our understanding of the molecular regulation of these fundamental events remains limited. Moreover, processes underpinning development of the postnatal neurogenic niches within the cortex remain poorly defined. Here, we demonstrate that Nuclear factor one X (NFIX) is expressed by neural progenitor cells within the embryonic hippocampus, and that progenitor cell differentiation is delayed within Nfix−/− mice. Moreover, we reveal that the morphology of the dentate gyrus in postnatal Nfix−/− mice is abnormal, with fewer subgranular zone neural progenitor cells being generated in the absence of this transcription factor. Mechanistically, we demonstrate that the progenitor cell maintenance factor Sry-related HMG box 9 (SOX9) is upregulated in the hippocampus of Nfix−/− mice and demonstrate that NFIX can repress Sox9 promoter-driven transcription. Collectively, our findings demonstrate that NFIX plays a central role in hippocampal morphogenesis, regulating the formation of neuronal and glial populations within this structure. PMID:23042739

  11. Strategies to reverse endothelial progenitor cell dysfunction in diabetes.

    Science.gov (United States)

    Petrelli, Alessandra; Di Fenza, Raffaele; Carvello, Michele; Gatti, Francesca; Secchi, Antonio; Fiorina, Paolo

    2012-01-01

    Bone-marrow-derived cells-mediated postnatal vasculogenesis has been reported as the main responsible for the regulation of vascular homeostasis in adults. Since their discovery, endothelial progenitor cells have been depicted as mediators of postnatal vasculogenesis for their peculiar phenotype (partially staminal and partially endothelial), their ability to differentiate in endothelial cell line and to be incorporated into the vessels wall during ischemia/damage. Diabetes mellitus, a condition characterized by cardiovascular disease, nephropathy, and micro- and macroangiopathy, showed a dysfunction of endothelial progenitor cells. Herein, we review the mechanisms involved in diabetes-related dysfunction of endothelial progenitor cells, highlighting how hyperglycemia affects the different steps of endothelial progenitor cells lifetime (i.e., bone marrow mobilization, trafficking into the bloodstream, differentiation in endothelial cells, and homing in damaged tissues/organs). Finally, we review preclinical and clinical strategies that aim to revert diabetes-induced dysfunction of endothelial progenitor cells as a means of finding new strategies to prevent diabetic complications.

  12. Strategies to Reverse Endothelial Progenitor Cell Dysfunction in Diabetes

    Directory of Open Access Journals (Sweden)

    Alessandra Petrelli

    2012-01-01

    Full Text Available Bone-marrow-derived cells-mediated postnatal vasculogenesis has been reported as the main responsible for the regulation of vascular homeostasis in adults. Since their discovery, endothelial progenitor cells have been depicted as mediators of postnatal vasculogenesis for their peculiar phenotype (partially staminal and partially endothelial, their ability to differentiate in endothelial cell line and to be incorporated into the vessels wall during ischemia/damage. Diabetes mellitus, a condition characterized by cardiovascular disease, nephropathy, and micro- and macroangiopathy, showed a dysfunction of endothelial progenitor cells. Herein, we review the mechanisms involved in diabetes-related dysfunction of endothelial progenitor cells, highlighting how hyperglycemia affects the different steps of endothelial progenitor cells lifetime (i.e., bone marrow mobilization, trafficking into the bloodstream, differentiation in endothelial cells, and homing in damaged tissues/organs. Finally, we review preclinical and clinical strategies that aim to revert diabetes-induced dysfunction of endothelial progenitor cells as a means of finding new strategies to prevent diabetic complications.

  13. Identification of Stages of Erythroid Differentiation in Bone Marrow and Erythrocyte Subpopulations in Blood Circulation that Are Preferentially Lost in Autoimmune Hemolytic Anemia in Mouse.

    Directory of Open Access Journals (Sweden)

    Sreoshi Chatterjee

    Full Text Available Repeated weekly injections of rat erythrocytes produced autoimmune hemolytic anemia (AIHA in C57BL/6 mice after 5-6 weeks. Using the double in vivo biotinylation (DIB technique, recently developed in our laboratory, turnover of erythrocyte cohorts of different age groups during AIHA was monitored. Results indicate a significant decline in the proportion of reticulocytes, young and intermediate age groups of erythrocytes, but a significant increase in the proportion of old erythrocytes in blood circulation. Binding of the autoantibody was relatively higher to the young erythrocytes and higher levels of intracellular reactive oxygen species (ROS were also seen in these cells. Erythropoietic activity in the bone marrows and the spleen of AIHA induced mice was examined by monitoring the relative proportion of erythroid cells at various stages of differentiation in these organs. Cells at different stages of differentiation were enumerated flow cytometrically by double staining with anti-Ter119 and anti-transferrin receptor (CD71 monoclonal antibodies. Erythroid cells in bone marrow declined significantly in AIHA induced mice, erythroblast C being most affected (50% decline. Erythroblast C also recorded high intracellular ROS level along with increased levels of membrane-bound autoantibody. No such decline was observed in spleen. A model of AIHA has been proposed indicating that binding of autoantibodies may not be a sufficient condition for destruction of erythroid cells in bone marrow and in blood circulation. Last stage of erythropoietic differentiation in bone marrow and early stages of erythrocytes in blood circulation are specifically susceptible to removal in AIHA.

  14. Roles of CDX2 and EOMES in human induced trophoblast progenitor cells

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Ying, E-mail: ying.chen@hc.msu.edu [Department of Obstetrics, Gynecology and Reproductive Biology, College of Human Medicine, Michigan State University, Grand Rapids, MI 49503 (United States); Wang, Kai [Department of Obstetrics, Gynecology and Reproductive Biology, College of Human Medicine, Michigan State University, Grand Rapids, MI 49503 (United States); Gong, Yun Guo; Khoo, Sok Kean [Genomic Microarray Core Facility, Van Andel Research Institute, Grand Rapids, MI 49503 (United States); Leach, Richard, E-mail: Richard.Leach@hc.msu.edu [Department of Obstetrics, Gynecology and Reproductive Biology, College of Human Medicine, Michigan State University, Grand Rapids, MI 49503 (United States); Department of Obstetrics, Gynecology and Women’s Health, Spectrum Health Medical Group, Grand Rapids, MI 49503 (United States)

    2013-02-08

    Highlights: ► CDX2 and EOMES play critical roles in human induced trophoblast progenitors (iTP). ► iTP cells directly transformed from fibroblasts. ► Differentiation of iTP cells into extravillous trophoblasts and syncytiotrophoblasts. -- Abstract: Abnormal trophoblast lineage proliferation and differentiation in early pregnancy have been associated with the pathogenesis of placenta diseases of pregnancy. However, there is still a gap in understanding the molecular mechanisms of early placental development due to the limited primary trophoblast cultures and fidelity of immortalized trophoblast lines. Trophoblasts stem (TS) cells, an in vitro model of trophectoderm that can differentiate into syncytiotrophoblasts and extravillous trophoblasts, can be an attractive tool for early pregnancy research. TS cells are well established in mouse but not in humans due to insufficient knowledge of which trophoblast lineage-specific transcription factors are involved in human trophectoderm (TE) proliferation and differentiation. Here, we applied induced pluripotent stem cell technique to investigate the human trophoblast lineage-specific transcription factors. We established human induced trophoblast progenitor (iTP) cells by direct reprogramming the fibroblasts with a pool of mouse trophoblast lineage-specific transcription factors consisting of CDX2, EOMES, and ELF5. The human iTP cells exhibit epithelial morphology and can be maintained in vitro for more than 2 months. Gene expression profile of these cells was tightly clustered with human trophectoderm but not with human neuron progenitor cells, mesenchymal stem cells, or endoderm cells. These cells are capable of differentiating into cells with an invasive capacity, suggesting extravillous trophoblasts. They also form multi-nucleated cells which secrete human chorionic gonadotropin and estradiol, consistent with a syncytiotrophoblast phenotype. Our results provide the evidence that transcription factors CDX2 and

  15. In vitro expansion of the mammary stem/progenitor cell population by xanthosine treatment

    Directory of Open Access Journals (Sweden)

    Choudhary Ratan K

    2012-06-01

    Full Text Available Abstract Background Mammary stem cells are critical for growth and maintenance of the mammary gland and therefore are of considerable interest for improving productivity and efficiency of dairy animals. Xanthosine treatment has been demonstrated to promote expansion of putative mammary stem cells in vivo, and hepatic and hair follicle stem cells in vitro. In the latter, xanthosine promoted the symmetrical division of hepatic and hair follicle stem cells. The objective of this study was to determine if treating primary cultures of bovine mammary epithelial cells (MEC with xanthosine increases the stem/progenitor cell population by promoting symmetrical division of mammary stem cells. Results In vitro treatment with xanthosine increased the population of MEC during the exponential phase of cell growth, reducing the doubling time from 86 h in control cultures to 60 h in xanthosine-treated cultures. The bromodeoxyuridine (BrdU labeling index and the proportion of MEC in S-phase both were increased by xanthosine treatment, indicating that increased cell accretion was due to increased cell proliferation. Analysis of daughter-pairs indicated that xanthosine promoted a shift from asymmetric to symmetric cell division. Moreover, the 30 % increase in symmetric cell division was concomitant with an increase in the proportion of MEC that were positive for a putative stem cell marker (FNDC3B and a trend toward increased telomerase activity. These results suggest that xanthosine treatment in vitro can increase cell proliferation, promote symmetric cell division and enhance stem/progenitor cell activity. Conclusions Xanthosine treatment increased the proliferation rate of bovine MEC in vitro. This was likely to be mediated by an increase in the proportion of stem/progenitor cells in the MEC population due to promotion of symmetrical stem cell division by xanthosine.

  16. Airway Progenitor Clone Formation Is Enhanced by Y-27632-Dependent Changes in the Transcriptome.

    Science.gov (United States)

    Reynolds, Susan D; Rios, Cydney; Wesolowska-Andersen, Agata; Zhuang, Yongbin; Pinter, Mary; Happoldt, Carrie; Hill, Cynthia L; Lallier, Scott W; Cosgrove, Gregory P; Solomon, George M; Nichols, David P; Seibold, Max A

    2016-09-01

    The application of conditional reprogramming culture (CRC) methods to nasal airway epithelial cells would allow more wide-spread incorporation of primary airway epithelial culture models into complex lung disease research. In this study, we adapted the CRC method to nasal airway epithelial cells, investigated the growth advantages afforded by this technique over standard culture methods, and determined the cellular and molecular basis of CRC cell culture effects. We found that the CRC method allowed the production of 7.1 × 10(10) cells after 4 passages, approximately 379 times more cells than were generated by the standard bronchial epithelial growth media (BEGM) method. These nasal airway epithelial cells expressed normal basal cell markers and could be induced to form a mucociliary epithelium. Progenitor cell frequency was significantly higher using the CRC method in comparison to the standard culture method, and progenitor cell maintenance was dependent on addition of the Rho-kinase inhibitor Y-27632. Whole-transcriptome sequencing analysis demonstrated widespread gene expression changes in Y-27632-treated basal cells. We found that Y-27632 treatment altered expression of genes fundamental to the formation of the basal cell cytoskeleton, cell-cell junctions, and cell-extracellular matrix (ECM) interactions. Importantly, we found that Y-27632 treatment up-regulated expression of unique basal cell intermediate filament and desmosomal genes. Conversely, Y-27632 down-regulated multiple families of protease/antiprotease genes involved in ECM remodeling. We conclude that Y-27632 fundamentally alters cell-cell and cell-ECM interactions, which preserves basal progenitor cells and allows greater cell amplification.

  17. Human endothelial progenitor cells rescue cortical neurons from oxygen-glucose deprivation induced death.

    Science.gov (United States)

    Bacigaluppi, Susanna; Donzelli, Elisabetta; De Cristofaro, Valentina; Bragazzi, Nicola Luigi; D'Amico, Giovanna; Scuteri, Arianna; Tredici, Giovanni

    2016-09-19

    Cerebral ischemia is characterized by both acute and delayed neuronal injuries. Neuro-protection is a major issue that should be properly addressed from a pharmacological point of view, and cell-based treatment approaches are of interest due to their potential pleiotropic effects. Endothelial progenitor cells have the advantage of being mobilized from the bone marrow into the circulation, but have been less studied than other stem cells, such as mesenchymal stem cells. Therefore, the comparison between human endothelial progenitor cells (hEPC) and human mesenchymal progenitor cells (hMSC) in terms of efficacy in rescuing neurons from cell death after transitory ischemia is the aim of the current study, in the effort to address further directions. In vitro model of oxygen-glucose deprivation (OGD) on a primary culture of rodent cortical neurons was set up with different durations of exposure: 1, 2 and 3hrs with assessment of neuron survival. The 2hrs OGD was chosen for the subsequent experiments. After 2hrs OGD neurons were either placed in indirect co-culture with hMSC or hEPC or cultured in hMSC or hEPC conditioned medium and cell viability was evaluated by MTT assay. At day 2 after 2hrs OGD exposure, mean neuronal survival was 47.9±24.2%. In contrast, after treatment with hEPC and hMSC indirect co-culture was 74.1±27.3%; and 69.4±18.8%, respectively. In contrast, treatment with conditioned medium did not provide any advantage in terms of survival to OGD neurons The study shows the efficacy of hEPC in indirect co-culture to rescue neurons from cell death after OGD, comparable to that of hMSC. hEPC deserve further studies given their potential interest for ischemia. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  18. Development and molecular composition of the hepatic progenitor cell niche.

    Science.gov (United States)

    Vestentoft, Peter Siig

    2013-05-01

    End-stage liver diseases represent major health problems that are currently treated by liver transplantation. However, given the world-wide shortage of donor livers novel strategies are needed for therapeutic treatment. Adult stem cells have the ability to self-renew and differentiate into the more specialized cell types of a given organ and are found in tissues throughout the body. These cells, whose progeny are termed progenitor cells in human liver and oval cells in rodents, have the potential to treat patients through the generation of hepatic parenchymal cells, even from the patient's own tissue. Little is known regarding the nature of the hepatic progenitor cells. Though they are suggested to reside in the most distal part of the biliary tree, the canal of Hering, the lack of unique surface markers for these cells has hindered their isolation and characterization. Upon activation, they proliferate and form ductular structures, termed "ductular reactions", which radiate into the hepatic parenchyma. The ductular reactions contain activated progenitor cells that not only acquire a phenotype resembling that observed in developing liver but also display markers of differentiation shared with the cholangiocytic or hepatocytic lineages, the two parenchymal hepatic cell types. Interactions between the putative progenitor cells, the surrounding support cells and the extracellular matrix scaffold, all constituting the progenitor cell niche, are likely to be important for regulating progenitor cell activity and differentiation. Therefore, identifying novel progenitor cell markers and deciphering their microenvironment could facilitate clinical use. The aims of the present PhD thesis were to expand knowledge of the hepatic progenitor cell niche and characterize it both during development and in disease. Several animal models of hepatic injury are known to induce activation of the progenitor cells. In order to identify possible progenitor cell markers and niche components

  19. ABO alleles are linked with haplotypes of an erythroid cell-specific regulatory element in intron 1 with a few exceptions attributable to genetic recombination.

    Science.gov (United States)

    Nakajima, T; Sano, R; Takahashi, Y; Watanabe, K; Kubo, R; Kobayashi, M; Takahashi, K; Takeshita, H; Kominato, Y

    2016-01-01

    Recent investigation of transcriptional regulation of the ABO genes has identified a candidate erythroid cell-specific regulatory element, named the +5·8-kb site, in the first intron of ABO. Six haplotypes of the site have been reported previously. The present genetic population study demonstrated that each haplotype was mostly linked with specific ABO alleles with a few exceptions, possibly as a result of hybrid formation between common ABO alleles. Thus, investigation of these haplotypes could provide a clue to further elucidation of ABO alleles. © 2015 International Society of Blood Transfusion.

  20. Omega 3 fatty acids reduce myeloid progenitor cell frequency in the bone marrow of mice and promote progenitor cell differentiation

    Directory of Open Access Journals (Sweden)

    Sollars Vincent E

    2009-03-01

    Full Text Available Abstract Background Omega 3 fatty acids have been found to inhibit proliferation, induce apoptosis, and promote differentiation in various cell types. The processes of cell survival, expansion, and differentiation are of key importance in the regulation of hematopoiesis. We investigated the role of omega 3 fatty acids in controlling the frequency of various myeloid progenitor cells in the bone marrow of mice. Increased progenitor cell frequency and blocked differentiation are characteristics of hematopoietic disorders of the myeloid lineage, such as myeloproliferative diseases and myeloid leukemias. Results We found that increasing the proportion of omega 3 fatty acids relative to the proportion of omega 6 fatty acids in the diet caused increased differentiation and reduced the frequency of myeloid progenitor cells in the bone marrow of mice. Furthermore, this had no adverse effect on peripheral white blood cell counts. Conclusion Our results indicate that omega 3 fatty acids impact hematopoietic differentiation by reducing myeloid progenitor cell frequency in the bone marrow and promoting progenitor cell differentiation. Further exploration of this discovery could lead to the use of omega 3 fatty acids as a therapeutic option for patients that have various disorders of hematopoiesis.

  1. Establishment of bipotent progenitor cell clone from rat skeletal muscle.

    Science.gov (United States)

    Murakami, Yousuke; Yada, Erica; Nakano, Shin-ichi; Miyagoe-Suzuki, Yuko; Hosoyama, Tohru; Matsuwaki, Takashi; Yamanouchi, Keitaro; Nishihara, Masugi

    2011-12-01

    The present study describes the isolation, cloning and characterization of adipogenic progenitor cells from rat skeletal muscle. Among the obtained 10 clones, the most highly adipogenic progenitor, 2G11 cells, were further characterized. In addition to their adipogenicity, 2G11 cells retain myogenic potential as revealed by formation of multinucleated myotubes when co-cultured with myoblasts. 2G11 cells were resistant to an inhibitory effect of basic fibroblast growth factor on adipogenesis, while adipogenesis of widely used preadipogenic cell line, 3T3-L1 cells, was suppressed almost completely by the same treatment. In vivo transplantation experiments revealed that 2G11 cells are able to possess both adipogenicity and myogenicity in vivo. These results indicate the presence of bipotent progenitor cells in rat skeletal muscle, and suggest that such cells may contribute to ectopic fat formation in skeletal muscle. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.

  2. Rates and progenitors of type Ia supernovae

    Energy Technology Data Exchange (ETDEWEB)

    Wood-Vasey, William Michael [Univ. of California, Berkeley, CA (United States)

    2004-01-01

    analyzing the true sensitivity of a multi-epoch supernova search and finds a Type Ia supernova rate from z ~ 0.01-0.1 of rV = 4.26$+1.39 +0.10\\atop{-1.93 -0.10}$h3 x 10-4 SNe Ia/yr/Mpc3 from a preliminary analysis of a subsample of the SNfactory prototype search. Several unusual supernovae were found in the course of the SNfactory prototype search. One in particular, SN 2002ic, was the first SN Ia to exhibit convincing evidence for a circumstellar medium and offers valuable insight into the progenitors of Type Ia supernovae.

  3. Rates and progenitors of type Ia supernovae

    International Nuclear Information System (INIS)

    Wood-Vasey, William Michael

    2004-01-01

    analyzing the true sensitivity of a multi-epoch supernova search and finds a Type Ia supernova rate from z ∼ 0.01-0.1 of r V = 4.26 -1.93 -0.10 +1.39 +0.10 h 3 x 10 -4 SNe Ia/yr/Mpc 3 from a preliminary analysis of a subsample of the SNfactory prototype search. Several unusual supernovae were found in the course of the SNfactory prototype search. One in particular, SN 2002ic, was the first SN Ia to exhibit convincing evidence for a circumstellar medium and offers valuable insight into the progenitors of Type Ia supernovae

  4. Obstructive sleep apnea and endothelial progenitor cells

    Directory of Open Access Journals (Sweden)

    Wang Q

    2013-10-01

    Full Text Available Qing Wang,1,* Qi Wu,2,* Jing Feng,3,4 Xin Sun5 1The Second Respiratory Department of the First People's Hospital of Kunming, Yunnan, People's Republic of China; 2Tianjin Haihe Hospital, Tianjin, People's Republic of China; 3Respiratory Department of Tianjin Medical University General Hospital, Tianjin, People's Republic of China; 4Division of Pulmonary and Critical Care Medicine, Duke University Medical Center, Durham, NC, USA; 5Respiratory Department of Tianjin Haihe Hospital, Tianjin, People's Republic of China *These authors contributed equally to this work Background: Obstructive sleep apnea (OSA occurs in 4% of middle-aged men and 2% of middle-aged women in the general population, and the prevalence is even higher in specific patient groups. OSA is an independent risk factor for a variety of cardiovascular diseases. Endothelial injury could be the pivotal determinant in the development of cardiovascular pathology in OSA. Endothelial damage ultimately represents a dynamic balance between the magnitude of injury and the capacity for repair. Bone marrow–derived endothelial progenitor cells (EPCs within adult peripheral blood present a possible means of vascular maintenance that could home to sites of injury and restore endothelial integrity and normal function. Methods: We summarized pathogenetic mechanisms of OSA and searched for available studies on numbers and functions of EPCs in patients with OSA to explore the potential links between the numbers and functions of EPCs and OSA. In particular, we tried to elucidate the molecular mechanisms of the effects of OSA on EPCs. Conclusion: Intermittent hypoxia cycles and sleep fragmentation are major pathophysiologic characters of OSA. Intermittent hypoxia acts as a trigger of oxidative stress, systemic inflammation, and sympathetic activation. Sleep fragmentation is associated with a burst of sympathetic activation and systemic inflammation. In most studies, a reduction in circulating EPCs has

  5. File list: ALL.Oth.50.AllAg.Multipotent_otic_progenitor [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ALL.Oth.50.AllAg.Multipotent_otic_progenitor mm9 All antigens Others Multipotent otic progeni...ncedbc.jp/kyushu-u/mm9/assembled/ALL.Oth.50.AllAg.Multipotent_otic_progenitor.bed ...

  6. File list: ALL.Neu.05.AllAg.Induced_neural_progenitors [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ALL.Neu.05.AllAg.Induced_neural_progenitors mm9 All antigens Neural Induced neural progeni....biosciencedbc.jp/kyushu-u/mm9/assembled/ALL.Neu.05.AllAg.Induced_neural_progenitors.bed ...

  7. File list: ALL.Neu.10.AllAg.Induced_neural_progenitors [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ALL.Neu.10.AllAg.Induced_neural_progenitors mm9 All antigens Neural Induced neural progeni....biosciencedbc.jp/kyushu-u/mm9/assembled/ALL.Neu.10.AllAg.Induced_neural_progenitors.bed ...

  8. Regulation of Mammary Progenitor Cells by p53 and Parity

    Science.gov (United States)

    2011-01-01

    quantitative PCR system (Stratagene). To knockdown Notch1 in TM40A cells, siRNA (s70698 and s70700) were purchased from Ambion. s70698 siRNA sense sequence: 5...hours after transfect ion and real-tim e quantitative P CR was used to confirm the knockdown efficiency. Results Label and chase progenitor cells...cells contained 0.8% o f DsRed positiv e (DsR +) progenitor cells (Fig. 1B). The mammosphere-forming capacity of DsR+ cells is 3.8-fold greater

  9. Expression of P190 and P210 BCR/ABL1 in normal human CD34(+) cells induces similar gene expression profiles and results in a STAT5-dependent expansion of the erythroid lineage

    DEFF Research Database (Denmark)

    Järås, Marcus; Johnels, Petra; Agerstam, Helena

    2009-01-01

    OBJECTIVE: The P190 and P210 BCR/ABL1 fusion genes are mainly associated with different types of hematologic malignancies, but it is presently unclear whether they are functionally different following expression in primitive human hematopoietic cells. MATERIALS AND METHODS: We investigated...... and systematically compared the effects of retroviral P190 BCR/ABL1 and P210 BCR/ABL1 expression on cell proliferation, differentiation, and global gene expression in human CD34(+) cells from cord blood. RESULTS: Expression of either P190 BCR/ABL1 or P210 BCR/ABL1 resulted in expansion of erythroid cells...... and stimulated erythropoietin-independent burst-forming unit-erythroid colony formation. By using a lentiviral anti-signal transducer and activator of transcription 5 (STAT5) short-hairpin RNA, we found that both P190 BCR/ABL1- and P210 BCR/ABL1-induced erythroid cell expansion were STAT5-dependent. Under...

  10. Subsequent donation requests among 2472 unrelated hematopoietic progenitor cell donors are associated with bone marrow harvest

    Science.gov (United States)

    Lown, Robert N.; Tulpule, Sameer; Russell, Nigel H.; Craddock, Charles F.; Roest, Rochelle; Madrigal, J. Alejandro; Shaw, Bronwen E.

    2013-01-01

    Approximately 1 in 20 unrelated donors are asked to make a second donation of hematopoietic progenitor cells, the majority for the same patient. Anthony Nolan undertook a study of subsequent hematopoietic progenitor cell donations made by its donors from 2005 to 2011, with the aims of predicting those donors more likely to be called for a second donation, assessing rates of serious adverse reactions and examining harvest yields. This was not a study of factors predictive of second allografts. During the study period 2591 donations were made, of which 120 (4.6%) were subsequent donations. The median time between donations was 179 days (range, 21–4016). Indications for a second allogeneic transplant included primary graft failure (11.7%), secondary graft failure (53.2%), relapse (30.6%) and others (1.8%). On multivariate analysis, bone marrow harvest at first donation was associated with subsequent donation requests (odds ratio 2.00, P=0.001). The rate of serious adverse reactions in donors making a subsequent donation appeared greater than the rate in those making a first donation (relative risk=3.29, P=0.005). Harvest yields per kilogram recipient body weight were equivalent between donations, although females appeared to have a lower yield at the subsequent donation. Knowledge of these factors will help unrelated donor registries to counsel their donors. PMID:23812935

  11. Development of hematopoietic stem and progenitor cells from human pluripotent stem cells.

    Science.gov (United States)

    Chen, Tong; Wang, Fen; Wu, Mengyao; Wang, Zack Z

    2015-07-01

    Human pluripotent stem cells (hPSCs), including human embryonic stem cells (hESCs) and human induced pluripotent stem cells (hiPSCs), provide a new cell source for regenerative medicine, disease modeling, drug discovery, and preclinical toxicity screening. Understanding of the onset and the sequential process of hematopoietic cells from differentiated hPSCs will enable the achievement of personalized medicine and provide an in vitro platform for studying of human hematopoietic development and disease. During embryogenesis, hemogenic endothelial cells, a specified subset of endothelial cells in embryonic endothelium, are the primary source of multipotent hematopoietic stem cells. In this review, we discuss current status in the generation of multipotent hematopoietic stem and progenitor cells from hPSCs via hemogenic endothelial cells. We also review the achievements in direct reprogramming from non-hematopoietic cells to hematopoietic stem and progenitor cells. Further characterization of hematopoietic differentiation in hPSCs will improve our understanding of blood development and expedite the development of hPSC-derived blood products for therapeutic purpose. © 2015 Wiley Periodicals, Inc.

  12. Towards consistent generation of pancreatic lineage progenitors from human pluripotent stem cells.

    Science.gov (United States)

    Rostovskaya, Maria; Bredenkamp, Nicholas; Smith, Austin

    2015-10-19

    Human pluripotent stem cells can in principle be used as a source of any differentiated cell type for disease modelling, drug screening, toxicology testing or cell replacement therapy. Type I diabetes is considered a major target for stem cell applications due to the shortage of primary human beta cells. Several protocols have been reported for generating pancreatic progenitors by in vitro differentiation of human pluripotent stem cells. Here we first assessed one of these protocols on a panel of pluripotent stem cell lines for capacity to engender glucose sensitive insulin-producing cells after engraftment in immunocompromised mice. We observed variable outcomes with only one cell line showing a low level of glucose response. We, therefore, undertook a systematic comparison of different methods for inducing definitive endoderm and subsequently pancreatic differentiation. Of several protocols tested, we identified a combined approach that robustly generated pancreatic progenitors in vitro from both embryo-derived and induced pluripotent stem cells. These findings suggest that, although there are intrinsic differences in lineage specification propensity between pluripotent stem cell lines, optimal differentiation procedures may consistently direct a substantial fraction of cells into pancreatic specification. © 2015 The Authors.

  13. Feline Neural Progenitor Cells I: Long-Term Expansion under Defined Culture Conditions

    Directory of Open Access Journals (Sweden)

    Jing Yang

    2012-01-01

    Full Text Available Neural progenitor cells (NPCs of feline origin (cNPCs have demonstrated utility in transplantation experiments, yet are difficult to grow in culture beyond the 1 month time frame. Here we use an enriched, serum-free base medium (Ultraculture and report the successful long-term propagation of these cells. Primary cultures were derived from fetal brain tissue and passaged in DMEM/F12-based or Ultraculture-based proliferation media, both in the presence of EGF + bFGF. Cells in standard DMEM/F12-based medium ceased to proliferate by 1-month, whereas the cells in the Ultraculture-based medium continued to grow for at least 5 months (end of study with no evidence of senescence. The Ultraculture-based cultures expressed lower levels of progenitor and lineage-associated markers under proliferation conditions but retained multipotency as evidenced by the ability to differentiate into neurons and glia following growth factor removal in the presence of FBS. Importantly, later passage cNPCs did not develop chromosomal aberrations.

  14. Differential Reponses of Hematopoietic Stem and Progenitor Cells to mTOR Inhibition

    Directory of Open Access Journals (Sweden)

    Aimin Yang

    2015-01-01

    Full Text Available Abnormal activation of the mammalian target of rapamycin (mTOR signaling pathway has been observed in a variety of human cancers. Therefore, targeting of the mTOR pathway is an attractive strategy for cancer treatment and several mTOR inhibitors, including AZD8055 (AZD, a novel dual mTORC1/2 inhibitor, are currently in clinical trials. Although bone marrow (BM suppression is one of the primary side effects of anticancer drugs, it is not known if pharmacological inhibition of dual mTORC1/2 affects BM hematopoietic stem and progenitor cells (HSPCs function and plasticity. Here we report that dual inhibition of mTORC1/2 by AZD or its analogue (KU-63794 depletes mouse BM Lin−Sca-1+c-Kit+ cells in cultures via the induction of apoptotic cell death. Subsequent colony-forming unit (CFU assays revealed that inhibition of mTORC1/2 suppresses the clonogenic function of hematopoietic progenitor cells (HPCs in a dose-dependent manner. Surprisingly, we found that dual inhibition of mTORC1/2 markedly inhibits the growth of day-14 cobblestone area-forming cells (CAFCs but enhances the generation of day-35 CAFCs. Given the fact that day-14 and day-35 CAFCs are functional surrogates of HPCs and hematopoietic stem cells (HSCs, respectively, these results suggest that dual inhibition of mTORC1/2 may have distinct effects on HPCs versus HSCs.

  15. Adipose progenitor cells increase fibronectin matrix strain and unfolding in breast tumors

    Science.gov (United States)

    Chandler, E. M.; Saunders, M. P.; Yoon, C. J.; Gourdon, D.; Fischbach, C.

    2011-02-01

    Increased stiffness represents a hallmark of breast cancer that has been attributed to the altered physicochemical properties of the extracellular matrix (ECM). However, the role of fibronectin (Fn) in modulating the composition and mechanical properties of the tumor-associated ECM remains unclear. We have utilized a combination of biochemical and physical science tools to evaluate whether paracrine signaling between breast cancer cells and adipose progenitor cells regulates Fn matrix assembly and stiffness enhancement in the tumor stroma. In particular, we utilized fluorescence resonance energy transfer imaging to map the molecular conformation and stiffness of Fn that has been assembled by 3T3-L1 preadipocytes in response to conditioned media from MDA-MB231 breast cancer cells. Our results reveal that soluble factors secreted by tumor cells promote Fn expression, unfolding, and stiffening by adipose progenitor cells and that transforming growth factor-β serves as a soluble cue underlying these changes. In vivo experiments using orthotopic co-transplantation of primary human adipose-derived stem cells and MDA-MB231 into SCID mice support the pathological relevance of our results. Insights gained by these studies advance our understanding of the role of Fn in mammary tumorigenesis and may ultimately lead to improved anti-cancer therapies.

  16. Adipose progenitor cells increase fibronectin matrix strain and unfolding in breast tumors

    International Nuclear Information System (INIS)

    Chandler, E M; Saunders, M P; Yoon, C J; Fischbach, C; Gourdon, D

    2011-01-01

    Increased stiffness represents a hallmark of breast cancer that has been attributed to the altered physicochemical properties of the extracellular matrix (ECM). However, the role of fibronectin (Fn) in modulating the composition and mechanical properties of the tumor-associated ECM remains unclear. We have utilized a combination of biochemical and physical science tools to evaluate whether paracrine signaling between breast cancer cells and adipose progenitor cells regulates Fn matrix assembly and stiffness enhancement in the tumor stroma. In particular, we utilized fluorescence resonance energy transfer imaging to map the molecular conformation and stiffness of Fn that has been assembled by 3T3-L1 preadipocytes in response to conditioned media from MDA-MB231 breast cancer cells. Our results reveal that soluble factors secreted by tumor cells promote Fn expression, unfolding, and stiffening by adipose progenitor cells and that transforming growth factor-β serves as a soluble cue underlying these changes. In vivo experiments using orthotopic co-transplantation of primary human adipose-derived stem cells and MDA-MB231 into SCID mice support the pathological relevance of our results. Insights gained by these studies advance our understanding of the role of Fn in mammary tumorigenesis and may ultimately lead to improved anti-cancer therapies

  17. File list: Oth.Oth.05.AllAg.Multipotent_otic_progenitor [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Oth.05.AllAg.Multipotent_otic_progenitor mm9 TFs and others Others Multipotent otic progeni...tor SRX736459,SRX736458,SRX736460,SRX736461 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Oth.Oth.05.AllAg.Multipotent_otic_progenitor.bed ...

  18. File list: His.Neu.20.AllAg.Induced_neural_progenitors [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available His.Neu.20.AllAg.Induced_neural_progenitors mm9 Histone Neural Induced neural progeni...tors SRX667381,SRX668240 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/His.Neu.20.AllAg.Induced_neural_progenitors.bed ...

  19. File list: DNS.Neu.10.AllAg.Induced_neural_progenitors [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available DNS.Neu.10.AllAg.Induced_neural_progenitors mm9 DNase-seq Neural Induced neural progeni...tors http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/DNS.Neu.10.AllAg.Induced_neural_progenitors.bed ...

  20. File list: Unc.Adp.10.AllAg.Adipose_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Adp.10.AllAg.Adipose_progenitor_cells mm9 Unclassified Adipocyte Adipose progeni...tor cells http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Unc.Adp.10.AllAg.Adipose_progenitor_cells.bed ...

  1. File list: Oth.Adp.20.AllAg.Adipose_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Adp.20.AllAg.Adipose_progenitor_cells mm9 TFs and others Adipocyte Adipose progeni...tor cells http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Oth.Adp.20.AllAg.Adipose_progenitor_cells.bed ...

  2. File list: DNS.Adp.20.AllAg.Adipose_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available DNS.Adp.20.AllAg.Adipose_progenitor_cells mm9 DNase-seq Adipocyte Adipose progenito...r cells http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/DNS.Adp.20.AllAg.Adipose_progenitor_cells.bed ...

  3. File list: DNS.Adp.10.AllAg.Adipose_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available DNS.Adp.10.AllAg.Adipose_progenitor_cells mm9 DNase-seq Adipocyte Adipose progenito...r cells http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/DNS.Adp.10.AllAg.Adipose_progenitor_cells.bed ...

  4. File list: Unc.Neu.05.AllAg.Neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Neu.05.AllAg.Neural_progenitor_cells mm9 Unclassified Neural Neural progenitor ...cells http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Unc.Neu.05.AllAg.Neural_progenitor_cells.bed ...

  5. File list: Unc.Neu.20.AllAg.Induced_neural_progenitors [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Neu.20.AllAg.Induced_neural_progenitors mm9 Unclassified Neural Induced neural progeni...tors http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Unc.Neu.20.AllAg.Induced_neural_progenitors.bed ...

  6. File list: His.Adp.10.AllAg.Adipose_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available His.Adp.10.AllAg.Adipose_progenitor_cells mm9 Histone Adipocyte Adipose progenitor ...cells SRX127409,SRX127394,SRX127396,SRX127407,SRX127383,SRX127381 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/His.Adp.10.AllAg.Adipose_progenitor_cells.bed ...

  7. File list: DNS.Neu.50.AllAg.Neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available DNS.Neu.50.AllAg.Neural_progenitor_cells mm9 DNase-seq Neural Neural progenitor cel...ls SRX238870,SRX238868 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/DNS.Neu.50.AllAg.Neural_progenitor_cells.bed ...

  8. File list: Oth.Adp.50.AllAg.Adipose_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Adp.50.AllAg.Adipose_progenitor_cells mm9 TFs and others Adipocyte Adipose progeni...tor cells http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Oth.Adp.50.AllAg.Adipose_progenitor_cells.bed ...

  9. File list: DNS.Oth.05.AllAg.Multipotent_otic_progenitor [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available DNS.Oth.05.AllAg.Multipotent_otic_progenitor mm9 DNase-seq Others Multipotent otic progeni...tor http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/DNS.Oth.05.AllAg.Multipotent_otic_progenitor.bed ...

  10. File list: DNS.Neu.50.AllAg.Induced_neural_progenitors [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available DNS.Neu.50.AllAg.Induced_neural_progenitors mm9 DNase-seq Neural Induced neural progeni...tors http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/DNS.Neu.50.AllAg.Induced_neural_progenitors.bed ...

  11. File list: His.Neu.50.AllAg.Induced_neural_progenitors [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available His.Neu.50.AllAg.Induced_neural_progenitors mm9 Histone Neural Induced neural progeni...tors SRX667381,SRX668240 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/His.Neu.50.AllAg.Induced_neural_progenitors.bed ...

  12. File list: His.Oth.50.AllAg.Multipotent_otic_progenitor [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available His.Oth.50.AllAg.Multipotent_otic_progenitor mm9 Histone Others Multipotent otic progeni...tor http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/His.Oth.50.AllAg.Multipotent_otic_progenitor.bed ...

  13. File list: His.Oth.10.AllAg.Multipotent_otic_progenitor [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available His.Oth.10.AllAg.Multipotent_otic_progenitor mm9 Histone Others Multipotent otic progeni...tor http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/His.Oth.10.AllAg.Multipotent_otic_progenitor.bed ...

  14. File list: His.Oth.05.AllAg.Multipotent_otic_progenitor [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available His.Oth.05.AllAg.Multipotent_otic_progenitor mm9 Histone Others Multipotent otic progeni...tor http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/His.Oth.05.AllAg.Multipotent_otic_progenitor.bed ...

  15. File list: Oth.Neu.05.AllAg.Neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Neu.05.AllAg.Neural_progenitor_cells mm9 TFs and others Neural Neural progenito...r cells SRX109472,SRX315274,SRX109471,SRX802060 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Oth.Neu.05.AllAg.Neural_progenitor_cells.bed ...

  16. File list: DNS.Neu.05.AllAg.Neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available DNS.Neu.05.AllAg.Neural_progenitor_cells mm9 DNase-seq Neural Neural progenitor cel...ls SRX238870,SRX238868 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/DNS.Neu.05.AllAg.Neural_progenitor_cells.bed ...

  17. File list: Pol.Neu.10.AllAg.Neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Neu.10.AllAg.Neural_progenitor_cells mm9 RNA polymerase Neural Neural progenito...r cells http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Neu.10.AllAg.Neural_progenitor_cells.bed ...

  18. File list: Oth.Adp.10.AllAg.Adipose_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Adp.10.AllAg.Adipose_progenitor_cells mm9 TFs and others Adipocyte Adipose progeni...tor cells http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Oth.Adp.10.AllAg.Adipose_progenitor_cells.bed ...

  19. File list: Pol.Adp.05.AllAg.Adipose_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Adp.05.AllAg.Adipose_progenitor_cells mm9 RNA polymerase Adipocyte Adipose progeni...tor cells http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Adp.05.AllAg.Adipose_progenitor_cells.bed ...

  20. File list: Pol.Oth.50.AllAg.Multipotent_otic_progenitor [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Oth.50.AllAg.Multipotent_otic_progenitor mm9 RNA polymerase Others Multipotent otic progeni...tor SRX736457,SRX736456 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Oth.50.AllAg.Multipotent_otic_progenitor.bed ...

  1. File list: Oth.Neu.20.AllAg.Neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Neu.20.AllAg.Neural_progenitor_cells mm9 TFs and others Neural Neural progenito...r cells SRX109472,SRX315274,SRX802060,SRX109471 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Oth.Neu.20.AllAg.Neural_progenitor_cells.bed ...

  2. File list: His.Neu.20.AllAg.Neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available His.Neu.20.AllAg.Neural_progenitor_cells mm9 Histone Neural Neural progenitor cells... SRX315278,SRX667383,SRX668241,SRX315277,SRX315276 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/His.Neu.20.AllAg.Neural_progenitor_cells.bed ...

  3. File list: Pol.Adp.20.AllAg.Adipose_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Adp.20.AllAg.Adipose_progenitor_cells mm9 RNA polymerase Adipocyte Adipose progeni...tor cells http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Adp.20.AllAg.Adipose_progenitor_cells.bed ...

  4. File list: DNS.Neu.10.AllAg.Neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available DNS.Neu.10.AllAg.Neural_progenitor_cells mm9 DNase-seq Neural Neural progenitor cel...ls SRX238868,SRX238870 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/DNS.Neu.10.AllAg.Neural_progenitor_cells.bed ...

  5. File list: Unc.Adp.05.AllAg.Adipose_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Adp.05.AllAg.Adipose_progenitor_cells mm9 Unclassified Adipocyte Adipose progeni...tor cells http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Unc.Adp.05.AllAg.Adipose_progenitor_cells.bed ...

  6. File list: Unc.Neu.20.AllAg.Neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Neu.20.AllAg.Neural_progenitor_cells mm9 Unclassified Neural Neural progenitor ...cells http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Unc.Neu.20.AllAg.Neural_progenitor_cells.bed ...

  7. File list: Oth.Oth.10.AllAg.Multipotent_otic_progenitor [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Oth.10.AllAg.Multipotent_otic_progenitor mm9 TFs and others Others Multipotent otic progeni...tor SRX736459,SRX736458,SRX736460,SRX736461 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Oth.Oth.10.AllAg.Multipotent_otic_progenitor.bed ...

  8. File list: DNS.Adp.50.AllAg.Adipose_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available DNS.Adp.50.AllAg.Adipose_progenitor_cells mm9 DNase-seq Adipocyte Adipose progenito...r cells http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/DNS.Adp.50.AllAg.Adipose_progenitor_cells.bed ...

  9. File list: His.Neu.05.AllAg.Neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available His.Neu.05.AllAg.Neural_progenitor_cells mm9 Histone Neural Neural progenitor cells... SRX315277,SRX667383,SRX668241,SRX315278,SRX315276 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/His.Neu.05.AllAg.Neural_progenitor_cells.bed ...

  10. File list: Unc.Adp.20.AllAg.Adipose_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Adp.20.AllAg.Adipose_progenitor_cells mm9 Unclassified Adipocyte Adipose progeni...tor cells http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Unc.Adp.20.AllAg.Adipose_progenitor_cells.bed ...

  11. File list: Unc.Oth.05.AllAg.Multipotent_otic_progenitor [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Oth.05.AllAg.Multipotent_otic_progenitor mm9 Unclassified Others Multipotent otic progeni...tor http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Unc.Oth.05.AllAg.Multipotent_otic_progenitor.bed ...

  12. File list: Unc.Oth.10.AllAg.Multipotent_otic_progenitor [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Oth.10.AllAg.Multipotent_otic_progenitor mm9 Unclassified Others Multipotent otic progeni...tor http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Unc.Oth.10.AllAg.Multipotent_otic_progenitor.bed ...

  13. File list: Unc.Adp.50.AllAg.Adipose_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Adp.50.AllAg.Adipose_progenitor_cells mm9 Unclassified Adipocyte Adipose progeni...tor cells http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Unc.Adp.50.AllAg.Adipose_progenitor_cells.bed ...

  14. File list: Pol.Oth.05.AllAg.Multipotent_otic_progenitor [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Oth.05.AllAg.Multipotent_otic_progenitor mm9 RNA polymerase Others Multipotent otic progeni...tor SRX736456,SRX736457 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Oth.05.AllAg.Multipotent_otic_progenitor.bed ...

  15. File list: His.Adp.05.AllAg.Adipose_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available His.Adp.05.AllAg.Adipose_progenitor_cells mm9 Histone Adipocyte Adipose progenitor ...cells SRX127409,SRX127407,SRX127394,SRX127396,SRX127383,SRX127381 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/His.Adp.05.AllAg.Adipose_progenitor_cells.bed ...

  16. File list: Pol.Adp.50.AllAg.Adipose_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Adp.50.AllAg.Adipose_progenitor_cells mm9 RNA polymerase Adipocyte Adipose progeni...tor cells http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Adp.50.AllAg.Adipose_progenitor_cells.bed ...

  17. File list: Pol.Neu.50.AllAg.Induced_neural_progenitors [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Neu.50.AllAg.Induced_neural_progenitors mm9 RNA polymerase Neural Induced neural... progenitors http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Neu.50.AllAg.Induced_neural_progenitors.bed ...

  18. File list: Pol.Neu.20.AllAg.Induced_neural_progenitors [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Neu.20.AllAg.Induced_neural_progenitors mm9 RNA polymerase Neural Induced neural... progenitors http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Neu.20.AllAg.Induced_neural_progenitors.bed ...

  19. File list: Pol.Neu.05.AllAg.Induced_neural_progenitors [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Neu.05.AllAg.Induced_neural_progenitors mm9 RNA polymerase Neural Induced neural... progenitors http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Neu.05.AllAg.Induced_neural_progenitors.bed ...

  20. File list: Oth.Neu.50.AllAg.Induced_neural_progenitors [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Neu.50.AllAg.Induced_neural_progenitors mm9 TFs and others Neural Induced neural... progenitors SRX323564,SRX323573 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Oth.Neu.50.AllAg.Induced_neural_progenitors.bed ...

  1. File list: Unc.Neu.50.AllAg.Induced_neural_progenitors [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Neu.50.AllAg.Induced_neural_progenitors mm9 Unclassified Neural Induced neural ...progenitors http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Unc.Neu.50.AllAg.Induced_neural_progenitors.bed ...

  2. File list: Unc.Neu.10.AllAg.Induced_neural_progenitors [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Neu.10.AllAg.Induced_neural_progenitors mm9 Unclassified Neural Induced neural ...progenitors http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Unc.Neu.10.AllAg.Induced_neural_progenitors.bed ...

  3. File list: His.Neu.05.AllAg.Induced_neural_progenitors [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available His.Neu.05.AllAg.Induced_neural_progenitors mm9 Histone Neural Induced neural proge...nitors SRX667381,SRX668240 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/His.Neu.05.AllAg.Induced_neural_progenitors.bed ...

  4. File list: Oth.Neu.05.AllAg.Induced_neural_progenitors [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Neu.05.AllAg.Induced_neural_progenitors mm9 TFs and others Neural Induced neural... progenitors SRX323573,SRX323564 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Oth.Neu.05.AllAg.Induced_neural_progenitors.bed ...

  5. File list: Oth.Neu.20.AllAg.Induced_neural_progenitors [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Neu.20.AllAg.Induced_neural_progenitors mm9 TFs and others Neural Induced neural... progenitors SRX323564,SRX323573 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Oth.Neu.20.AllAg.Induced_neural_progenitors.bed ...

  6. File list: Pol.Neu.10.AllAg.Induced_neural_progenitors [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Neu.10.AllAg.Induced_neural_progenitors mm9 RNA polymerase Neural Induced neural... progenitors http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Neu.10.AllAg.Induced_neural_progenitors.bed ...

  7. File list: His.Neu.10.AllAg.Induced_neural_progenitors [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available His.Neu.10.AllAg.Induced_neural_progenitors mm9 Histone Neural Induced neural proge...nitors SRX667381,SRX668240 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/His.Neu.10.AllAg.Induced_neural_progenitors.bed ...

  8. File list: Unc.Neu.05.AllAg.Induced_neural_progenitors [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Neu.05.AllAg.Induced_neural_progenitors mm9 Unclassified Neural Induced neural ...progenitors http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Unc.Neu.05.AllAg.Induced_neural_progenitors.bed ...

  9. File list: DNS.Neu.05.AllAg.Induced_neural_progenitors [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available DNS.Neu.05.AllAg.Induced_neural_progenitors mm9 DNase-seq Neural Induced neural pro...genitors http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/DNS.Neu.05.AllAg.Induced_neural_progenitors.bed ...

  10. Effects of low-level (1.0 R) x-irradiation on the erythroid response of the rat bone marrow

    International Nuclear Information System (INIS)

    Gong, J.K.; Glomski, C.A.; Frederiksen, N.L.; Lawson, A.J.; Daley, J.P.

    1976-01-01

    The levels of normoblasts in the bone marrow of six groups of female Sprague--Dawley rats previously exposed to a 1.0 R dose of x rays were compared with those in sham-exposed animals at intervals from 14 hr to 10 weeks postirradiation. Four parameters were analyzed, the percentage of normoblasts in Wright's Giemsa stained marrow smears, and the number of erythroid precursors per milligram of isolated marrow sample, per whole femur, and per entire skeleton. The studies were based on marrow examinations and on 59 Fe tracer data. At all intervals except the earliest, [14 hr], significant elevations in the percentage of normoblasts were found in the bone marrow. In addition, at 6 and 10 weeks postirradiation increases were found in the number of normoblasts in the isolated marrow samples, whole femurs, and total skeletons. When compared 81 hr after phlebotomy, subnormal increases in normoblast levels were found in all four parameters of the irradiated subjects. The results suggest that x irradiation at this dose level can induce an abnormal marrow function manifested by an elevated number of normoblasts and, after phlebotomy, by a subnormal proliferation of the erythroid precursors

  11. Human Pluripotent Stem Cell Differentiation into Functional Epicardial Progenitor Cells

    Directory of Open Access Journals (Sweden)

    Juan Antonio Guadix

    2017-12-01

    Full Text Available Summary: Human pluripotent stem cells (hPSCs are widely used to study cardiovascular cell differentiation and function. Here, we induced differentiation of hPSCs (both embryonic and induced to proepicardial/epicardial progenitor cells that cover the heart during development. Addition of retinoic acid (RA and bone morphogenetic protein 4 (BMP4 promoted expression of the mesodermal marker PDGFRα, upregulated characteristic (proepicardial progenitor cell genes, and downregulated transcription of myocardial genes. We confirmed the (proepicardial-like properties of these cells using in vitro co-culture assays and in ovo grafting of hPSC-epicardial cells into chick embryos. Our data show that RA + BMP4-treated hPSCs differentiate into (proepicardial-like cells displaying functional properties (adhesion and spreading over the myocardium of their in vivo counterpart. The results extend evidence that hPSCs are an excellent model to study (proepicardial differentiation into cardiovascular cells in human development and evaluate their potential for cardiac regeneration. : The authors have shown that hPSCs can be instructed in vitro to differentiate into a specific cardiac embryonic progenitor cell population called the proepicardium. Proepicardial cells are required for normal formation of the heart during development and might contribute to the development of cell-based therapies for heart repair. Keywords: human pluripotent stem cells, proepicardium, progenitor cells, cardiovascular, differentiation

  12. Cellular therapy after spinal cord injury using neural progenitor cells

    NARCIS (Netherlands)

    Vroemen, Maurice

    2006-01-01

    In this thesis, the possibilities and limitations of cell-based therapies after spinal cord injury are explored. Particularly, the potential of adult derived neural progenitor cell (NPC) grafts to function as a permissive substrate for axonal regeneration was investigated. It was found that syngenic

  13. Progenitor cells in the kidney: biology and therapeutic perspectives

    NARCIS (Netherlands)

    Rookmaaker, M.B.; Verhaar, M.C.; Zonneveld, A.J. van; Rabelink, T.J.

    2004-01-01

    Progenitor cells in the kidney: Biology and therapeutic perspectives. The stem cell may be viewed as an engineer who can read the blue print and become the building. The role of this fascinating cell in physiology and pathophysiology has recently attracted a great deal of interest. The archetype of

  14. Long GRBs from binary stars: runaway, Wolf-Rayet progenitors

    NARCIS (Netherlands)

    Cantiello, M.; Yoon, S.C.; Langer, N.; Livio, M.

    2007-01-01

    The collapsar model for long gamma-ray bursts requires a rapidly rotating Wolf-Rayet star as progenitor. We test the idea of producing rapidly rotating Wolf-Rayet stars in massive close binaries through mass accretion and consecutive quasi-chemically homogeneous evolution — the latter had previously

  15. Long GRBs from Binary Stars: Runaway, Wolf-Rayet Progenitors

    NARCIS (Netherlands)

    Cantiello, M.; Yoon, S.C.; Langer, N.; Livio, M.

    2007-01-01

    The collapsar model for long gamma-ray bursts requires a rapidly rotating Wolf-Rayet star as progenitor. We test the idea of producing rapidly rotating Wolf-Rayet stars in massive close binaries through mass accretion and consecutive quasi-chemically homogeneous evolution - the latter had previously

  16. Transcriptional Heterogeneity and Lineage Commitment in Myeloid Progenitors

    DEFF Research Database (Denmark)

    Paul, Franziska; Arkin, Ya'ara; Giladi, Amir

    2015-01-01

    Within the bone marrow, stem cells differentiate and give rise to diverse blood cell types and functions. Currently, hematopoietic progenitors are defined using surface markers combined with functional assays that are not directly linked with in vivo differentiation potential or gene regulatory m...

  17. Intersections of lung progenitor cells, lung disease and lung cancer.

    Science.gov (United States)

    Kim, Carla F

    2017-06-30

    The use of stem cell biology approaches to study adult lung progenitor cells and lung cancer has brought a variety of new techniques to the field of lung biology and has elucidated new pathways that may be therapeutic targets in lung cancer. Recent results have begun to identify the ways in which different cell populations interact to regulate progenitor activity, and this has implications for the interventions that are possible in cancer and in a variety of lung diseases. Today's better understanding of the mechanisms that regulate lung progenitor cell self-renewal and differentiation, including understanding how multiple epigenetic factors affect lung injury repair, holds the promise for future better treatments for lung cancer and for optimising the response to therapy in lung cancer. Working between platforms in sophisticated organoid culture techniques, genetically engineered mouse models of injury and cancer, and human cell lines and specimens, lung progenitor cell studies can begin with basic biology, progress to translational research and finally lead to the beginnings of clinical trials. Copyright ©ERS 2017.

  18. Human Pluripotent Stem Cell Differentiation into Functional Epicardial Progenitor Cells

    NARCIS (Netherlands)

    Guadix, Juan Antonio; Orlova, Valeria V.; Giacomelli, Elisa; Bellin, Milena; Ribeiro, Marcelo C.; Mummery, Christine L.; Pérez-Pomares, José M.; Passier, Robert

    2017-01-01

    Human pluripotent stem cells (hPSCs) are widely used to study cardiovascular cell differentiation and function. Here, we induced differentiation of hPSCs (both embryonic and induced) to proepicardial/epicardial progenitor cells that cover the heart during development. Addition of retinoic acid (RA)

  19. Mobilization of hematopoietic stem and progenitor cells in mice

    NARCIS (Netherlands)

    Robinson, Simon N; van Os, Ronald P; Bunting, Kevin

    2008-01-01

    Animal models have added significantly to our understanding of the mechanism(s) of hematopoietic stem and progenitor cell (HSPC) mobilization. Such models suggest that changes in the interaction between the HSPC and the hematopoietic microenvironmental 'niche' (cellular and extracellular components)

  20. Endothelial progenitor cell-based neovascularization : implications for therapy

    NARCIS (Netherlands)

    Krenning, Guido; van Luyn, Marja J. A.; Harmsen, Martin C.

    Ischemic cardiovascular events are a major cause of death globally. Endothelial progenitor cell (EPC)-based approaches can result in improvement of vascular perfusion and might offer clinical benefit. However, although functional improvement is observed, the lack of long-term engraftment of EPCs

  1. The progenitor of Nova Cygni 2006 (=V2362 Cyg)

    NARCIS (Netherlands)

    Steeghs, D.; Greimel, R.; Drew, J.; Irwin, M.; Gaensicke, B.; Groot, P.J.; Knigge, C.

    2006-01-01

    We report on the detection of the likely progenitor to Nova Cygni 2006 = V2362 Cyg (IAUC #8697, #8698, ATel #792) using images from the INT Photometric H-Alpha Survey (IPHAS; http://www.iphas.org). The field containing the classical nova was observed as part of our galactic plane survey on Aug. 3rd

  2. Retinal progenitor cell xenografts to the pig retina

    DEFF Research Database (Denmark)

    Warfvinge, Karin; Kiilgaard, Jens Folke; Klassen, Henry

    2006-01-01

    We evaluated the host response to murine retinal progenitor cells (RPCs) following transplantation to the subretinal space (SRS) of the pig. RPCs from GFP mice were transplanted subretinally in 18 nonimmunosuppressed normal or laser-treated pigs. Evaluation of the SRS was performed on hematoxylin-eosin...

  3. Mass ejection in failed supernovae: variation with stellar progenitor

    Science.gov (United States)

    Fernández, Rodrigo; Quataert, Eliot; Kashiyama, Kazumi; Coughlin, Eric R.

    2018-05-01

    We study the ejection of mass during stellar core-collapse when the stalled shock does not revive and a black hole forms. Neutrino emission during the protoneutron star phase causes a decrease in the gravitational mass of the core, resulting in an outward going sound pulse that steepens into a shock as it travels out through the star. We explore the properties of this mass ejection mechanism over a range of stellar progenitors using spherically symmetric, time-dependent hydrodynamic simulations that treat neutrino mass-loss parametrically and follow the shock propagation over the entire star. We find that all types of stellar progenitor can eject mass through this mechanism. The ejected mass is a decreasing function of the surface gravity of the star, ranging from several M⊙ for red supergiants to ˜0.1 M⊙ for blue supergiants and ˜10-3 M⊙ for Wolf-Rayet stars. We find that the final shock energy at the surface is a decreasing function of the core-compactness, and is ≲ 1047-1048 erg in all cases. In progenitors with a sufficiently large envelope, high core-compactness, or a combination of both, the sound pulse fails to unbind mass. Successful mass ejection is accompanied by significant fallback accretion that can last from hours to years. We predict the properties of shock breakout and thermal plateau emission produced by the ejection of the outer envelope of blue supergiant and Wolf-Rayet progenitors in otherwise failed supernovae.

  4. Hmga2 regulates self-renewal of retinal progenitors.

    Science.gov (United States)

    Parameswaran, Sowmya; Xia, Xiaohuan; Hegde, Ganapati; Ahmad, Iqbal

    2014-11-01

    In vertebrate retina, histogenesis occurs over an extended period. To sustain the temporal generation of diverse cell types, retinal progenitor cells (RPCs) must self-renew. However, self-renewal and regulation of RPCs remain poorly understood. Here, we demonstrate that cell-extrinsic factors coordinate with the epigenetic regulator high-mobility group AT-hook 2 (Hmga2) to regulate self-renewal of late retinal progenitor cells (RPCs). We observed that a small subset of RPCs was capable of clonal propagation and retained multipotentiality of parents in the presence of endothelial cells (ECs), known self-renewal regulators in various stem cell niches. The self-renewing effects, also observed in vivo, involve multiple intercellular signaling pathways, engaging Hmga2. As progenitors exhaust during retinal development, expression of Hmga2 progressively decreases. Analyses of Hmga2-expression perturbation, in vitro and in vivo, revealed that Hmga2 functionally helps to mediate cell-extrinsic influences on late-retinal progenitor self-renewal. Our results provide a framework for integrating the diverse intercellular influences elicited by epigenetic regulators for self-renewal in a dynamic stem cell niche: the developing vertebrate retina. © 2014. Published by The Company of Biologists Ltd.

  5. Intersections of lung progenitor cells, lung disease and lung cancer

    Directory of Open Access Journals (Sweden)

    Carla F. Kim

    2017-06-01

    Full Text Available The use of stem cell biology approaches to study adult lung progenitor cells and lung cancer has brought a variety of new techniques to the field of lung biology and has elucidated new pathways that may be therapeutic targets in lung cancer. Recent results have begun to identify the ways in which different cell populations interact to regulate progenitor activity, and this has implications for the interventions that are possible in cancer and in a variety of lung diseases. Today's better understanding of the mechanisms that regulate lung progenitor cell self-renewal and differentiation, including understanding how multiple epigenetic factors affect lung injury repair, holds the promise for future better treatments for lung cancer and for optimising the response to therapy in lung cancer. Working between platforms in sophisticated organoid culture techniques, genetically engineered mouse models of injury and cancer, and human cell lines and specimens, lung progenitor cell studies can begin with basic biology, progress to translational research and finally lead to the beginnings of clinical trials.

  6. Characteristics of meniscus progenitor cells migrated from injured meniscus.

    Science.gov (United States)

    Seol, Dongrim; Zhou, Cheng; Brouillette, Marc J; Song, Ino; Yu, Yin; Choe, Hyeong Hun; Lehman, Abigail D; Jang, Kee W; Fredericks, Douglas C; Laughlin, Barbara J; Martin, James A

    2017-09-01

    Serious meniscus injuries seldom heal and increase the risk for knee osteoarthritis; thus, there is a need to develop new reparative therapies. In that regard, stimulating tissue regeneration by autologous stem/progenitor cells has emerged as a promising new strategy. We showed previously that migratory chondrogenic progenitor cells (CPCs) were recruited to injured cartilage, where they showed a capability in situ tissue repair. Here, we tested the hypothesis that the meniscus contains a similar population of regenerative cells. Explant studies revealed that migrating cells were mainly confined to the red zone in normal menisci: However, these cells were capable of repopulating defects made in the white zone. In vivo, migrating cell numbers increased dramatically in damaged meniscus. Relative to non-migrating meniscus cells, migrating cells were more clonogenic, overexpressed progenitor cell markers, and included a larger side population. Gene expression profiling showed that the migrating population was more similar to CPCs than other meniscus cells. Finally, migrating cells equaled CPCs in chondrogenic potential, indicating a capacity for repair of the cartilaginous white zone of the meniscus. These findings demonstrate that, much as in articular cartilage, injuries to the meniscus mobilize an intrinsic progenitor cell population with strong reparative potential. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 35:1966-1972, 2017. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

  7. TYPE IIb SUPERNOVAE WITH COMPACT AND EXTENDED PROGENITORS

    International Nuclear Information System (INIS)

    Chevalier, Roger A.; Soderberg, Alicia M.

    2010-01-01

    The classic example of a Type IIb supernova is SN 1993J, which had a cool extended progenitor surrounded by a dense wind. There is evidence for another category of Type IIb supernova that has a more compact progenitor with a lower density, probably fast, wind. Distinguishing features of the compact category are weak optical emission from the shock heated envelope at early times, nonexistent or very weak H emission in the late nebular phase, rapidly evolving radio emission, rapid expansion of the radio shell, and expected nonthermal as opposed to thermal X-ray emission. Type IIb supernovae that have one or more of these features include SNe 1996cb, 2001ig, 2003bg, 2008ax, and 2008bo. All of these with sufficient radio data (the last four) show evidence for presupernova wind variability. We estimate a progenitor envelope radius ∼1 x 10 11 cm for SN 2008ax, a value consistent with a compact Wolf-Rayet progenitor. Supernovae in the SN 1993J extended category include SN 2001gd and probably the Cas A supernova. We suggest that the compact Type IIb events be designated Type cIIb and the extended ones Type eIIb. The H envelope mass dividing these categories is ∼0.1 M sun .

  8. Cardiac stem/progenitor cells, secreted proteins, and proteomics

    Czech Academy of Sciences Publication Activity Database

    Šťastná, Miroslava; Abraham, M.R.; Van Eyk, J.E.

    2009-01-01

    Roč. 583, č. 11 (2009), s. 1800-1807 ISSN 0014-5793 Institutional research plan: CEZ:AV0Z40310501 Keywords : Cardiac stem/progenitor cell * paracrine factor * secretome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.541, year: 2009

  9. Putative oncogene Brachyury (T) is essential to specify cell fate but dispensable for notochord progenitor proliferation and EMT.

    Science.gov (United States)

    Zhu, Jianjian; Kwan, Kin Ming; Mackem, Susan

    2016-04-05

    The transcription factor Brachyury (T) gene is expressed throughout primary mesoderm (primitive streak and notochord) during early embryonic development and has been strongly implicated in the genesis of chordoma, a sarcoma of notochord cell origin. Additionally, T expression has been found in and proposed to play a role in promoting epithelial-mesenchymal transition (EMT) in various other types of human tumors. However, the role of T in normal mammalian notochord development and function is still not well-understood. We have generated an inducible knockdown model to efficiently and selectively deplete T from notochord in mouse embryos. In combination with genetic lineage tracing, we show that T function is essential for maintaining notochord cell fate and function. Progenitors adopt predominantly a neural fate in the absence of T, consistent with an origin from a common chordoneural progenitor. However, T function is dispensable for progenitor cell survival, proliferation, and EMT, which has implications for the therapeutic targeting of T in chordoma and other cancers.

  10. Apoptosis in chronic myeloid leukaemia: normal responses by progenitor cells to growth factor deprivation, X-irradiation and glucocorticoids

    Energy Technology Data Exchange (ETDEWEB)

    Amos, T.A.S.; Lewis, J.L.; Grand, F.H.; Gooding, R.P.; Goldman, J.M.; Gordon, M.Y. [Royal Postgraduate Medical School, London (United Kingdom)

    1995-10-01

    Inhibition of apoptosis (genetically programmed active cell death) by p210 BCR-ABL expression is a mechanism that might contribute to clonal expansion in chronic myeloid leukaemia (CML). Since cell death following exposure to ionizing radiation and many chemotherapeutic agents can occur by the apoptotic pathway, inhibition of apoptosis would be expected to confer a relative resistance to these treatments. Similarly, cells deprived of growth factors in vitro die by apoptosis, and inhibition of apoptosis would therefore be expected to allow cells to survive better in growth factor-deprived conditions. We found that the survival of normal and CML myeloid progenitors was the same after in vitro incubation in deprived conditions and after treatment with X-irradiation or glucocorticoids. We also found that mature cells in colonies produced by CML progenitors (CFU-GM) did not survive better than those produced by normal progenitor cells. Flow cytometric analysis of propidium iodide-stained cells provided a direct indication that the degree of apoptosis may correspond to the degree of deprivation. These results suggest that inhibition of apoptosis may not be the primary mechanism whereby BCR-ABL influences the expansion of the malignant clone in CML. (Author).

  11. Apoptosis in chronic myeloid leukaemia: normal responses by progenitor cells to growth factor deprivation, X-irradiation and glucocorticoids

    International Nuclear Information System (INIS)

    Amos, T.A.S.; Lewis, J.L.; Grand, F.H.; Gooding, R.P.; Goldman, J.M.; Gordon, M.Y.

    1995-01-01

    Inhibition of apoptosis (genetically programmed active cell death) by p210 BCR-ABL expression is a mechanism that might contribute to clonal expansion in chronic myeloid leukaemia (CML). Since cell death following exposure to ionizing radiation and many chemotherapeutic agents can occur by the apoptotic pathway, inhibition of apoptosis would be expected to confer a relative resistance to these treatments. Similarly, cells deprived of growth factors in vitro die by apoptosis, and inhibition of apoptosis would therefore be expected to allow cells to survive better in growth factor-deprived conditions. We found that the survival of normal and CML myeloid progenitors was the same after in vitro incubation in deprived conditions and after treatment with X-irradiation or glucocorticoids. We also found that mature cells in colonies produced by CML progenitors (CFU-GM) did not survive better than those produced by normal progenitor cells. Flow cytometric analysis of propidium iodide-stained cells provided a direct indication that the degree of apoptosis may correspond to the degree of deprivation. These results suggest that inhibition of apoptosis may not be the primary mechanism whereby BCR-ABL influences the expansion of the malignant clone in CML. (Author)

  12. α-Ketoglutarate Promotes Pancreatic Progenitor-Like Cell Proliferation

    Directory of Open Access Journals (Sweden)

    Jing Song

    2018-03-01

    Full Text Available A major source of β cell generation is pancreatic progenitor-like cell differentiation. Multiple studies have confirmed that stem cell metabolism plays important roles in self-renewal and proliferation. In the absence of glucose, glutamine provides the energy for cell division and growth. Furthermore, α-ketoglutarate (αKG, a precursor for glutamine synthesis, is sufficient for enabling glutamine-independent cell proliferation. We have demonstrated that αKG contributes to the large-scale proliferation of pancreatic progenitor-like cells that can provide an ample amount of clinically relevant β cells. We compared the mRNA expression of a subset of genes, the abundance of ATP, reactive oxide species, mitochondrial number, and the colony-forming frequency between mouse pancreatic CD133+ and CD133− cells. We employed Real-Time PCR, immunostaining and passage assays to investigate self-renewal and proliferation of pancreatic progenitor-like cells in a 3D culture system in the presence and absence of αKG. The energy metabolism of CD133+ cells was more prone to oxidative phosphorylation. However, in the 3D culture system, when αKG was supplemented to the culture medium, the proliferation of the pancreatic progenitor-like cells was significantly elevated. We confirmed that the presence of αKG correlated with the up-regulation of Ten-Eleven Translocation (Tet. αKG can promote the proliferation of pancreatic progenitor-like cells via the up-regulation of Tet.

  13. α-Ketoglutarate Promotes Pancreatic Progenitor-Like Cell Proliferation.

    Science.gov (United States)

    Song, Jing; Ma, Dongshen; Xing, Yun; Tang, Shanshan; Alahdal, Murad; Guo, Jiamin; Pan, Yi; Zhang, Yanfeng; Shen, Yumeng; Wu, Qiong; Lu, Zhou; Jin, Liang

    2018-03-22

    A major source of β cell generation is pancreatic progenitor-like cell differentiation. Multiple studies have confirmed that stem cell metabolism plays important roles in self-renewal and proliferation. In the absence of glucose, glutamine provides the energy for cell division and growth. Furthermore, α-ketoglutarate (αKG), a precursor for glutamine synthesis, is sufficient for enabling glutamine-independent cell proliferation. We have demonstrated that αKG contributes to the large-scale proliferation of pancreatic progenitor-like cells that can provide an ample amount of clinically relevant β cells. We compared the mRNA expression of a subset of genes, the abundance of ATP, reactive oxide species, mitochondrial number, and the colony-forming frequency between mouse pancreatic CD133⁺ and CD133 - cells. We employed Real-Time PCR, immunostaining and passage assays to investigate self-renewal and proliferation of pancreatic progenitor-like cells in a 3D culture system in the presence and absence of αKG. The energy metabolism of CD133⁺ cells was more prone to oxidative phosphorylation. However, in the 3D culture system, when αKG was supplemented to the culture medium, the proliferation of the pancreatic progenitor-like cells was significantly elevated. We confirmed that the presence of αKG correlated with the up-regulation of Ten-Eleven Translocation (Tet). αKG can promote the proliferation of pancreatic progenitor-like cells via the up-regulation of Tet.

  14. [Stem and progenitor cells in biostructure of blood vessel walls].

    Science.gov (United States)

    Korta, Krzysztof; Kupczyk, Piotr; Skóra, Jan; Pupka, Artur; Zejler, Paweł; Hołysz, Marcin; Gajda, Mariusz; Nowakowska, Beata; Barć, Piotr; Dorobisz, Andrzej T; Dawiskiba, Tomasz; Szyber, Piotr; Bar, Julia

    2013-09-18

    Development of vascular and hematopoietic systems during organogenesis occurs at the same time. During vasculogenesis, a small part of cells does not undergo complete differentiation but stays on this level, "anchored" in tissue structures described as stem cell niches. The presence of blood vessels within tissue stem cell niches is typical and led to identification of niches and ensures that they are functioning. The three-layer biostructure of vessel walls for artery and vein, tunica: intima, media and adventitia, for a long time was defined as a mechanical barrier between vessel light and the local tissue environment. Recent findings from vascular biology studies indicate that vessel walls are dynamic biostructures, which are equipped with stem and progenitor cells, described as vascular wall-resident stem cells/progenitor cells (VW-SC/PC). Distinct zones for vessel wall harbor heterogeneous subpopulations of VW-SC/PC, which are described as "subendothelial or vasculogenic zones". Recent evidence from in vitro and in vivo studies show that prenatal activity of stem and progenitor cells is not only limited to organogenesis but also exists in postnatal life, where it is responsible for vessel wall homeostasis, remodeling and regeneration. It is believed that VW-SC/PC could be engaged in progression of vascular disorders and development of neointima. We would like to summarize current knowledge about mesenchymal and progenitor stem cell phenotype with special attention to distribution and biological properties of VW-SC/PC in biostructures of intima, media and adventitia niches. It is postulated that in the near future, niches for VW-SC/PC could be a good source of stem and progenitor cells, especially in the context of vessel tissue bioengineering as a new alternative to traditional revascularization therapies.

  15. Stem and progenitor cells in biostructure of blood vessel walls

    Directory of Open Access Journals (Sweden)

    Krzysztof Korta

    2013-09-01

    Full Text Available Development of vascular and hematopoietic systems during organogenesis occurs at the same time. During vasculogenesis, a small part of cells does not undergo complete differentiation but stays on this level, “anchored” in tissue structures described as stem cell niches. The presence of blood vessels within tissue stem cell niches is typical and led to identification of niches and ensures that they are functioning. The three-layer biostructure of vessel walls for artery and vein, tunica: intima, media and adventitia, for a long time was defined as a mechanical barrier between vessel light and the local tissue environment. Recent findings from vascular biology studies indicate that vessel walls are dynamic biostructures, which are equipped with stem and progenitor cells, described as vascular wall-resident stem cells/progenitor cells (VW-SC/PC. Distinct zones for vessel wall harbor heterogeneous subpopulations of VW-SC/PC, which are described as “subendothelial or vasculogenic zones”. Recent evidence from in vitro and in vivo studies show that prenatal activity of stem and progenitor cells is not only limited to organogenesis but also exists in postnatal life, where it is responsible for vessel wall homeostasis, remodeling and regeneration. It is believed that VW-SC/PC could be engaged in progression of vascular disorders and development of neointima. We would like to summarize current knowledge about mesenchymal and progenitor stem cell phenotype with special attention to distribution and biological properties of VW-SC/PC in biostructures of intima, media and adventitia niches. It is postulated that in the near future, niches for VW-SC/PC could be a good source of stem and progenitor cells, especially in the context of vessel tissue bioengineering as a new alternative to traditional revascularization therapies.

  16. Uncovering the Number and Clonal Dynamics of Mesp1 Progenitors during Heart Morphogenesis

    Directory of Open Access Journals (Sweden)

    Samira Chabab

    2016-01-01

    Full Text Available The heart arises from distinct sources of cardiac progenitors that independently express Mesp1 during gastrulation. The precise number of Mesp1 progenitors that are specified during the early stage of gastrulation, and their clonal behavior during heart morphogenesis, is currently unknown. Here, we used clonal and mosaic tracing of Mesp1-expressing cells combined with quantitative biophysical analysis of the clonal data to define the number of cardiac progenitors and their mode of growth during heart development. Our data indicate that the myocardial layer of the heart derive from ∼250 Mesp1-expressing cardiac progenitors born during gastrulation. Despite arising at different time points and contributing to different heart regions, the temporally distinct cardiac progenitors present very similar clonal dynamics. These results provide insights into the number of cardiac progenitors and their mode of growth and open up avenues to decipher the clonal dynamics of progenitors in other organs and tissues.

  17. Accumulation of multipotent progenitors with a basal differentiation bias during aging of human mammary epithelia

    DEFF Research Database (Denmark)

    Garbe, James C; Pepin, Francois; Pelissier, Fanny A

    2012-01-01

    of the cellular and molecular mechanisms that underlies these observations is lacking. In this study, we generated a large collection of normal human mammary epithelial cell strains from women ages 16 to 91 years, derived from primary tissues, to investigate the molecular changes that occur in aging breast cells....... We found that in finite lifespan cultured and uncultured epithelial cells, aging is associated with a reduction of myoepithelial cells and an increase in luminal cells that express keratin 14 and integrin-a6, a phenotype that is usually expressed exclusively in myoepithelial cells in women younger...... than 30 years. Changes to the luminal lineage resulted from age-dependent expansion of defective multipotent progenitors that gave rise to incompletely differentiated luminal or myoepithelial cells. The aging process therefore results in both a shift in the balance of luminal/myoepithelial lineages...

  18. PROGENITOR-EXPLOSION CONNECTION AND REMNANT BIRTH MASSES FOR NEUTRINO-DRIVEN SUPERNOVAE OF IRON-CORE PROGENITORS

    Energy Technology Data Exchange (ETDEWEB)

    Ugliano, Marcella; Janka, Hans-Thomas; Marek, Andreas [Max-Planck-Institut fuer Astrophysik, Karl-Schwarzschild-Str. 1, D-85748 Garching (Germany); Arcones, Almudena [Institut fuer Kernphysik, Technische Universitaet Darmstadt, Schlossgartenstr. 2, D-64289 Darmstadt (Germany)

    2012-09-20

    We perform hydrodynamic supernova (SN) simulations in spherical symmetry for over 100 single stars of solar metallicity to explore the progenitor-explosion and progenitor-remnant connections established by the neutrino-driven mechanism. We use an approximative treatment of neutrino transport and replace the high-density interior of the neutron star (NS) by an inner boundary condition based on an analytic proto-NS core-cooling model, whose free parameters are chosen such that explosion energy, nickel production, and energy release by the compact remnant of progenitors around 20 M{sub Sun} are compatible with SN 1987A. Thus, we are able to simulate the accretion phase, initiation of the explosion, subsequent neutrino-driven wind phase for 15-20 s, and the further evolution of the blast wave for hours to days until fallback is completed. Our results challenge long-standing paradigms. We find that remnant mass, launch time, and properties of the explosion depend strongly on the stellar structure and exhibit large variability even in narrow intervals of the progenitors' zero-age main-sequence mass. While all progenitors with masses below {approx}15 M{sub Sun} yield NSs, black hole (BH) as well as NS formation is possible for more massive stars, where partial loss of the hydrogen envelope leads to weak reverse shocks and weak fallback. Our NS baryonic masses of {approx}1.2-2.0 M{sub Sun} and BH masses >6 M{sub Sun} are compatible with a possible lack of low-mass BHs in the empirical distribution. Neutrino heating accounts for SN energies between some 10{sup 50} erg and {approx}2 Multiplication-Sign 10{sup 51} erg but can hardly explain more energetic explosions and nickel masses higher than 0.1-0.2 M{sub Sun }. These seem to require an alternative SN mechanism.

  19. MicroRNA-200, associated with metastatic breast cancer, promotes traits of mammary luminal progenitor cells.

    Science.gov (United States)

    Sánchez-Cid, Lourdes; Pons, Mònica; Lozano, Juan José; Rubio, Nuria; Guerra-Rebollo, Marta; Soriano, Aroa; Paris-Coderch, Laia; Segura, Miquel F; Fueyo, Raquel; Arguimbau, Judit; Zodda, Erika; Bermudo, Raquel; Alonso, Immaculada; Caparrós, Xavier; Cascante, Marta; Rafii, Arash; Kang, Yibin; Martínez-Balbás, Marian; Weiss, Stephen J; Blanco, Jerónimo; Muñoz, Montserrat; Fernández, Pedro L; Thomson, Timothy M

    2017-10-13

    MicroRNAs are critical regulators of gene networks in normal and abnormal biological processes. Focusing on invasive ductal breast cancer (IDC), we have found dysregulated expression in tumor samples of several microRNAs, including the miR-200 family, along progression from primary tumors to distant metastases, further reflected in higher blood levels of miR-200b and miR-7 in IDC patients with regional or distant metastases relative to patients with primary node-negative tumors. Forced expression of miR-200s in MCF10CA1h mammary cells induced an enhanced epithelial program, aldehyde dehydrogenase (ALDH) activity, mammosphere growth and ability to form branched tubuloalveolar structures while promoting orthotopic tumor growth and lung colonization in vivo . MiR-200s also induced the constitutive activation of the PI3K-Akt signaling through downregulation of PTEN, and the enhanced mammosphere growth and ALDH activity induced in MCF10CA1h cells by miR-200s required the activation of this signaling pathway. Interestingly, the morphology of tumors formed in vivo by cells expressing miR-200s was reminiscent of metaplastic breast cancer (MBC). Indeed, the epithelial components of MBC samples expressed significantly higher levels of miR-200s than their mesenchymal components and displayed a marker profile compatible with luminal progenitor cells. We propose that microRNAs of the miR-200 family promote traits of highly proliferative breast luminal progenitor cells, thereby exacerbating the growth and metastatic properties of transformed mammary epithelial cells.

  20. Single progenitor model for GW150914 and GW170104

    Science.gov (United States)

    D'Orazio, Daniel J.; Loeb, Abraham

    2018-04-01

    The merger of stellar-mass black holes (BHs) is not expected to generate detectable electromagnetic (EM) emission. However, the gravitational wave (GW) events GW150914 and GW170104, detected by the Laser Interferometer Gravitational Wave Observatory to be the result of merging, ˜60 M⊙ binary black holes (BBHs), each have claimed coincident gamma-ray emission. Motivated by the intriguing possibility of an EM counterpart to BBH mergers, we construct a model that can reproduce the observed EM and GW signals for GW150914- and GW170104-like events, from a single-star progenitor. Following Loeb [Astrophys. J. Lett. 819, L21 (2016), 10.3847/2041-8205/819/2/L21], we envision a massive, rapidly rotating star within which a rotating-bar instability fractures the core into two overdensities that fragment into clumps which merge to form BHs in a tight binary with arbitrary spin-orbit alignment. Once formed, the BBH inspirals due to gas and gravitational-wave drag until tidal forces trigger strong feeding of the BHs with the surrounding stellar-density gas about 10 sec before merger. The resulting giga-Eddington accretion peak launches a jet that breaks out of the progenitor star and drives a powerful outflow that clears the gas from the orbit of the binary within 1 sec, preserving the vacuum GW waveform in the Laser Interferometer Gravitational Wave Observatory band. The single-progenitor scenario predicts the existence of variability of the gamma-ray burst, modulated at the ˜0.2 sec chirping period of the BBH due to relativistic Doppler boost. The jet breakout should be accompanied by a low-luminosity supernova. Finally, because the BBHs of the single-progenitor model do not exist at large separations, they will not be detectable in the low-frequency gravitational-wave band of the Laser Interferometer Space Antenna. Hence, the single-progenitor BBHs will be unambiguously discernible from BBHs formed through alternate, double-progenitor evolution scenarios.

  1. Breeding value of primary synthetic wheat genotypes for grain yield

    Science.gov (United States)

    To introduce new genetic diversity into the bread wheat gene pool from its progenitor, Aegilops tauschii (Coss.) Schmalh, 33 primary synthetic hexaploid wheat genotypes (SYN) were crossed to 20 spring bread wheat (BW) cultivars at the International Wheat and Maize Improvement Center. Modified single...

  2. La violencia de hijos adolescentes contra sus progenitores La violencia de hijos adolescentes contra sus progenitores

    Directory of Open Access Journals (Sweden)

    Concepción Aroca Montolío

    2013-10-01

    Full Text Available According to Prosecutor’s Office of the Minor, the accusation interposed by mothers and/or fathers victims by theirs children, along 2007 were 2603, in 2008 amounted 4.211, in 2009 there were 5.209 and in 2010 there were 8.000 accusations. Suede this worrying increase, the principal aim of our article is to check the scientific international and national documentation, from 1957 until the year 2010 that analyses the phenomenon of the adolescent violence against parents, to achieve an approximation to its keys that there allows us the comprehension and analysis of this serious familiar problem. For it we will analyse: (a the importance of this crime by means of criminological mediators: prevalence and incidence; (b the age and sex variables’ aggressors to be able to establish a basic profile about theirs and, (c the violence types that the teenagers wield to damage, prejudice and suffering against their progenitors, with the aim to obtain what they want. The information obtained in this research review and qualitative analysis, change in base to the methodology used and the type of sample under study to obtain conclusions. Even though, we wantto do research into needs to investigate this type of familiar violence, and from there, to do researches with rigorous scientific methodologies, unifying criteria and variables to be investigating, to be able to anticipate in this increasing problem that the parents have. Según la Fiscalía del Menor en el año 2007, las denuncias interpuestas por madres y/o padres, víctimas de malos tratos por sus hijos e hijas menores de edad, fueron 2.683. En 2008 ascendieron a 4.211, en 2009 se presentaron 5.209 y en el año 2010 se registraron 8.000 denuncias. Ante éste preocupante incremento, el objetivo principal de nuestro artículo es revisar la documentación científica que analiza la violencia filio-parental,  desde 1957 hasta el año 2011, para lograr una aproximación a sus claves que nos permita la

  3. Progenitors of type Ia supernovae in elliptical galaxies

    International Nuclear Information System (INIS)

    Gilfanov, M.; Bogdan, A.

    2011-01-01

    Although there is a nearly universal agreement that type Ia supernovae are associated with the thermonuclear disruption of a CO white dwarf, the exact nature of their progenitors is still unknown. The single degenerate scenario envisages a white dwarf accreting matter from a non-degenerate companion in a binary system. Nuclear energy of the accreted matter is released in the form of electromagnetic radiation or gives rise to numerous classical nova explosions prior to the supernova event. We show that combined X-ray output of supernova progenitors and statistics of classical novae predicted in the single degenerate scenario are inconsistent with X-ray and optical observations of nearby early type galaxies and galaxy bulges. White dwarfs accreting from a donor star in a binary system and detonating at the Chandrasekhar mass limit can account for no more than ∼5% of type Ia supernovae observed in old stellar populations.

  4. Pericytes Stimulate Oligodendrocyte Progenitor Cell Differentiation during CNS Remyelination

    Directory of Open Access Journals (Sweden)

    Alerie Guzman De La Fuente

    2017-08-01

    Full Text Available The role of the neurovascular niche in CNS myelin regeneration is incompletely understood. Here, we show that, upon demyelination, CNS-resident pericytes (PCs proliferate, and parenchymal non-vessel-associated PC-like cells (PLCs rapidly develop. During remyelination, mature oligodendrocytes were found in close proximity to PCs. In Pdgfbret/ret mice, which have reduced PC numbers, oligodendrocyte progenitor cell (OPC differentiation was delayed, although remyelination proceeded to completion. PC-conditioned medium accelerated and enhanced OPC differentiation in vitro and increased the rate of remyelination in an ex vivo cerebellar slice model of demyelination. We identified Lama2 as a PC-derived factor that promotes OPC differentiation. Thus, the functional role of PCs is not restricted to vascular homeostasis but includes the modulation of adult CNS progenitor cells involved in regeneration.

  5. Is black-hole ringdown a memory of its progenitor?

    Science.gov (United States)

    Kamaretsos, Ioannis; Hannam, Mark; Sathyaprakash, B S

    2012-10-05

    We perform an extensive numerical study of coalescing black-hole binaries to understand the gravitational-wave spectrum of quasinormal modes excited in the merged black hole. Remarkably, we find that the masses and spins of the progenitor are clearly encoded in the mode spectrum of the ringdown signal. Some of the mode amplitudes carry the signature of the binary's mass ratio, while others depend critically on the spins. Simulations of precessing binaries suggest that our results carry over to generic systems. Using Bayesian inference, we demonstrate that it is possible to accurately measure the mass ratio and a proper combination of spins even when the binary is itself invisible to a detector. Using a mapping of the binary masses and spins to the final black-hole spin allows us to further extract the spin components of the progenitor. Our results could have tremendous implications for gravitational astronomy by facilitating novel tests of general relativity using merging black holes.

  6. THE POPULATION OF HELIUM-MERGER PROGENITORS: OBSERVATIONAL PREDICTIONS

    International Nuclear Information System (INIS)

    Fryer, Chris L.; Belczynski, Krzysztof; Bulik, Tomasz; Berger, Edo; Thöne, Christina; Ellinger, Carola

    2013-01-01

    The helium-merger gamma-ray burst (GRB) progenitor is produced by the rapid accretion onto a compact remnant (neutron star or black hole) when it undergoes a common envelope inspiral with its companion's helium core. This merger phase produces a very distinct environment around these outbursts and recent observations suggest that, in some cases, we are detecting the signatures of the past merger in the GRB afterglow. These observations allow us, for the first time, to study the specific features of the helium-merger progenitor. In this paper, we couple population synthesis calculations to our current understanding of GRB engines and common envelope evolution to make observational predictions for the helium-merger GRB population. Many mergers do not produce GRB outbursts and we discuss the implications of these mergers with the broader population of astrophysical transients.

  7. Progenitor cell populations in the periodontal ligament of mice

    International Nuclear Information System (INIS)

    McCulloch, C.A.

    1985-01-01

    Stem cells in a variety of renewal tissues exhibit a slow rate of cell proliferation. The periodontal ligament of mouse molars was examined for the presence of slowly cycling progenitor cells to provide evidence for the existence of stem cells in this tissue. A pulse injection of 3 H-thymidine was administered and mice were sacrificed between 1 hour and 14 days after injection. Analysis of radioautographs using percentage of labeled cells and grain counts demonstrated that a population of label-retaining cells within 10 micron of blood vessels traversed the cell cycle more slowly than proliferating cells located greater than 10 micron from blood vessels. These data suggest that there is a slowly dividing population of progenitor cells in paravascular sites in mouse molar periodontal ligament which may be stem cells

  8. In vitro pancreas organogenesis from dispersed mouse embryonic progenitors

    DEFF Research Database (Denmark)

    Greggio, Chiara; De Franceschi, Filippo; Figueiredo-Larsen, Evan Manuel

    2014-01-01

    The pancreas is an essential organ that regulates glucose homeostasis and secretes digestive enzymes. Research on pancreas embryogenesis has led to the development of protocols to produce pancreatic cells from stem cells (1). The whole embryonic organ can be cultured at multiple stages...... expanding progenitors and differentiate into endocrine, acinar and ductal cells and which spontaneously self-organize to resemble the embryonic pancreas. We show here that the in vitro process recapitulates many aspects of natural pancreas development. This culture system is suitable to investigate how...... cells cooperate to form an organ by reducing its initial complexity to few progenitors. It is a model that reproduces the 3D architecture of the pancreas and that is therefore useful to study morphogenesis, including polarization of epithelial structures and branching. It is also appropriate to assess...

  9. The Progenitor Dependence of Core-collapse Supernovae from Three-dimensional Simulations with Progenitor Models of 12–40 M ⊙

    Science.gov (United States)

    Ott, Christian D.; Roberts, Luke F.; da Silva Schneider, André; Fedrow, Joseph M.; Haas, Roland; Schnetter, Erik

    2018-03-01

    We present a first study of the progenitor star dependence of the three-dimensional (3D) neutrino mechanism of core-collapse supernovae. We employ full 3D general-relativistic multi-group neutrino radiation-hydrodynamics and simulate the postbounce evolutions of progenitors with zero-age main sequence masses of 12, 15, 20, 27, and 40 M ⊙. All progenitors, with the exception of the 12 M ⊙ star, experience shock runaway by the end of their simulations. In most cases, a strongly asymmetric explosion will result. We find three qualitatively distinct evolutions that suggest a complex dependence of explosion dynamics on progenitor density structure, neutrino heating, and 3D flow. (1) Progenitors with massive cores, shallow density profiles, and high post-core-bounce accretion rates experience very strong neutrino heating and neutrino-driven turbulent convection, leading to early shock runaway. Accretion continues at a high rate, likely leading to black hole formation. (2) Intermediate progenitors experience neutrino-driven, turbulence-aided explosions triggered by the arrival of density discontinuities at the shock. These occur typically at the silicon/silicon–oxygen shell boundary. (3) Progenitors with small cores and density profiles without strong discontinuities experience shock recession and develop the 3D standing-accretion shock instability (SASI). Shock runaway ensues late, once declining accretion rate, SASI, and neutrino-driven convection create favorable conditions. These differences in explosion times and dynamics result in a non-monotonic relationship between progenitor and compact remnant mass.

  10. Efficacy and Safety of Human Retinal Progenitor Cells

    Science.gov (United States)

    Semo, Ma'ayan; Haamedi, Nasrin; Stevanato, Lara; Carter, David; Brooke, Gary; Young, Michael; Coffey, Peter; Sinden, John; Patel, Sara; Vugler, Anthony

    2016-01-01

    Purpose We assessed the long-term efficacy and safety of human retinal progenitor cells (hRPC) using established rodent models. Methods Efficacy of hRPC was tested initially in Royal College of Surgeons (RCS) dystrophic rats immunosuppressed with cyclosporine/dexamethasone. Due to adverse effects of dexamethasone, this drug was omitted from a subsequent dose-ranging study, where different hRPC doses were tested for their ability to preserve visual function (measured by optokinetic head tracking) and retinal structure in RCS rats at 3 to 6 months after grafting. Safety of hRPC was assessed by subretinal transplantation into wild type (WT) rats and NIH-III nude mice, with analysis at 3 to 6 and 9 months after grafting, respectively. Results The optimal dose of hRPC for preserving visual function/retinal structure in dystrophic rats was 50,000 to 100,000 cells. Human retinal progenitor cells integrated/survived in dystrophic and WT rat retina up to 6 months after grafting and expressed nestin, vimentin, GFAP, and βIII tubulin. Vision and retinal structure remained normal in WT rats injected with hRPC and there was no evidence of tumors. A comparison between dexamethasone-treated and untreated dystrophic rats at 3 months after grafting revealed an unexpected reduction in the baseline visual acuity of dexamethasone-treated animals. Conclusions Human retinal progenitor cells appear safe and efficacious in the preclinical models used here. Translational Relevance Human retinal progenitor cells could be deployed during early stages of retinal degeneration or in regions of intact retina, without adverse effects on visual function. The ability of dexamethasone to reduce baseline visual acuity in RCS dystrophic rats has important implications for the interpretation of preclinical and clinical cell transplant studies. PMID:27486556

  11. Constraints on the Progenitor System of SN 2016gkg from a Comprehensive Statistical Analysis

    Science.gov (United States)

    Sravan, Niharika; Marchant, Pablo; Kalogera, Vassiliki; Margutti, Raffaella

    2018-01-01

    Type IIb supernovae (SNe) present a unique opportunity for understanding the progenitors of stripped-envelope SNe because the stellar progenitor of several SNe IIb have been identified in pre-explosion images. In this paper, we use Bayesian inference and a large grid of non-rotating solar-metallicity single and binary stellar models to derive the associated probability distributions of single and binary progenitors of the SN IIb 2016gkg using existing observational constraints. We find that potential binary star progenitors have smaller pre-SN hydrogen-envelope and helium-core masses than potential single-star progenitors typically by 0.1 M ⊙ and 2 M ⊙, respectively. We find that, a binary companion, if present, is a main-sequence or red-giant star. Apart from this, we do not find strong constraints on the nature of the companion star. We demonstrate that the range of progenitor helium-core mass inferred from observations could help improve constraints on the progenitor. We find that the probability that the progenitor of SN 2016gkg was a binary is 22% when we use constraints only on the progenitor luminosity and effective temperature. Imposing the range of pre-SN progenitor hydrogen-envelope mass and radius inferred from SN light curves, the probability that the progenitor is a binary increases to 44%. However, there is no clear preference for a binary progenitor. This is in contrast to binaries being the currently favored formation channel for SNe IIb. Our analysis demonstrates the importance of statistical inference methods to constrain progenitor channels.

  12. Endothelial Progenitor Cells as Shuttle of Anticancer Agents.

    Science.gov (United States)

    Laurenzana, Anna; Margheri, Francesca; Chillà, Anastasia; Biagioni, Alessio; Margheri, Giancarlo; Calorini, Lido; Fibbi, Gabriella; Del Rosso, Mario

    2016-10-01

    Cell therapies are treatments in which stem or progenitor cells are stimulated to differentiate into specialized cells able to home to and repair damaged tissues. After their discovery, endothelial progenitor cells (EPCs) stimulated worldwide interest as possible vehicles to perform autologous cell therapy of tumors. Taking into account the tumor-homing properties of EPCs, two different approaches to control cancer progression have been pursued by combining cell-based therapy with gene therapy or with nanomedicine. The first approach is based on the possibility of engineering EPCs to express different transgenes, and the second is based on the capacity of EPCs to take up nanomaterials. Here we review the most important progress covering the following issues: the characterization of bona fide endothelial progenitor cells, their role in tumor vascularization and metastasis, and preclinical data about their use in cell-based tumor therapy, considering antiangiogenic, suicide, immune-stimulating, and oncolytic virus gene therapy. The mixed approach of EPC cell therapy and nanomedicine is discussed in terms of plasmonic-dependent thermoablation and molecular imaging.

  13. NEUTRONIZATION DURING CARBON SIMMERING IN TYPE IA SUPERNOVA PROGENITORS

    Energy Technology Data Exchange (ETDEWEB)

    Martínez-Rodríguez, Héctor; Badenes, Carles [Department of Physics and Astronomy and Pittsburgh Particle Physics, Astrophysics and Cosmology Center (PITT PACC), University of Pittsburgh, 3941 O’Hara Street, Pittsburgh, PA 15260 (United States); Piro, Anthony L. [Carnegie Observatories, 813 Santa Barbara Street, Pasadena, CA 91101 (United States); Schwab, Josiah, E-mail: hector.mr@pitt.edu [Department of Physics, University of California, Berkeley, CA 94720 (United States)

    2016-07-01

    When a Type Ia supernova (SN Ia) progenitor first ignites carbon in its core, it undergoes ∼10{sup 3}–10{sup 4} years of convective burning prior to the onset of thermonuclear runaway. This carbon simmering phase is important for setting the thermal profile and composition of the white dwarf. Using the MESA stellar evolution code, we follow this convective burning and examine the production of neutron-rich isotopes. The neutron content of the SN fuel has important consequences for the ensuing nucleosynthesis, and in particular, for the production of secondary Fe-peak nuclei like Mn and stable Ni. These elements have been observed in the X-ray spectra of SN remnants like Tycho, Kepler, and 3C 397, and their yields can provide valuable insights into the physics of SNe Ia and the properties of their progenitors. We find that weak reactions during simmering can at most generate a neutron excess of ≈ 3 × 10{sup −4}. This is ≈ 70% lower than that found in previous studies that do not take the full density and temperature profile of the simmering region into account. Our results imply that the progenitor metallicity is the main contributor to the neutron excess in SN Ia fuel for Z ≳ 1/3 Z {sub ⊙}. Alternatively, at lower metallicities, this neutron excess provides a floor that should be present in any centrally-ignited SN Ia scenario.

  14. Epigenome profiling and editing of neocortical progenitor cells during development.

    Science.gov (United States)

    Albert, Mareike; Kalebic, Nereo; Florio, Marta; Lakshmanaperumal, Naharajan; Haffner, Christiane; Brandl, Holger; Henry, Ian; Huttner, Wieland B

    2017-09-01

    The generation of neocortical neurons from neural progenitor cells (NPCs) is primarily controlled by transcription factors binding to DNA in the context of chromatin. To understand the complex layer of regulation that orchestrates different NPC types from the same DNA sequence, epigenome maps with cell type resolution are required. Here, we present genomewide histone methylation maps for distinct neural cell populations in the developing mouse neocortex. Using different chromatin features, we identify potential novel regulators of cortical NPCs. Moreover, we identify extensive H3K27me3 changes between NPC subtypes coinciding with major developmental and cell biological transitions. Interestingly, we detect dynamic H3K27me3 changes on promoters of several crucial transcription factors, including the basal progenitor regulator Eomes We use catalytically inactive Cas9 fused with the histone methyltransferase Ezh2 to edit H3K27me3 at the Eomes locus in vivo , which results in reduced Tbr2 expression and lower basal progenitor abundance, underscoring the relevance of dynamic H3K27me3 changes during neocortex development. Taken together, we provide a rich resource of neocortical histone methylation data and outline an approach to investigate its contribution to the regulation of selected genes during neocortical development. © 2017 The Authors.

  15. Chlorpyrifos induces oxidative stress in oligodendrocyte progenitor cells

    International Nuclear Information System (INIS)

    Saulsbury, Marilyn D.; Heyliger, Simone O.; Wang, Kaiyu; Johnson, Deadre J.

    2009-01-01

    There are increasing concerns regarding the relative safety of chlorpyrifos (CPF) to various facets of the environment. Although published works suggest that CPF is relatively safe in adult animals, recent evidence indicates that juveniles, both animals and humans, may be more sensitive to CPF toxicity than adults. In young animals, CPF is neurotoxic and mechanistically interferes with cellular replication and cellular differentiation, which culminates in the alteration of synaptic neurotransmission in neurons. However, the effects of CPF on glial cells are not fully elucidated. Here we report that chlorpyrifos is toxic to oligodendrocyte progenitors. In addition, CPF produced dose-dependent increases in 2',7'-dichlorodihydrofluorescein diacetate (H 2 DCF-DA) and dihydroethidium (DHE) fluorescence intensities relative to the vehicle control. Moreover, CPF toxicity is associated with nuclear condensation and elevation of caspase 3/7 activity and Heme oxygenase-1 mRNA expression. Pan-caspase inhibitor QVDOPh and cholinergic receptor antagonists' atropine and mecamylamine failed to protect oligodendrocyte progenitors from CPF-induced injury. Finally, glutathione (GSH) depletion enhanced CPF-induced toxicity whereas nitric oxide synthetase inhibitor L-NAME partially protected progenitors and the non-specific antioxidant vitamin E (alpha-tocopherol) completely spared cells from injury. Collectively, this data suggests that CPF induced toxicity is independent of cholinergic stimulation and is most likely caused by the induction of oxidative stress.

  16. Dendritic Cell Lineage Potential in Human Early Hematopoietic Progenitors

    Directory of Open Access Journals (Sweden)

    Julie Helft

    2017-07-01

    Full Text Available Conventional dendritic cells (cDCs are thought to descend from a DC precursor downstream of the common myeloid progenitor (CMP. However, a mouse lymphoid-primed multipotent progenitor has been shown to generate cDCs following a DC-specific developmental pathway independent of monocyte and granulocyte poiesis. Similarly, here we show that, in humans, a large fraction of multipotent lymphoid early progenitors (MLPs gives rise to cDCs, in particular the subset known as cDC1, identified by co-expression of DNGR-1 (CLEC9A and CD141 (BDCA-3. Single-cell analysis indicates that over one-third of MLPs have the potential to efficiently generate cDCs. cDC1s generated from CMPs or MLPs do not exhibit differences in transcriptome or phenotype. These results demonstrate an early imprinting of the cDC lineage in human hematopoiesis and highlight the plasticity of developmental pathways giving rise to human DCs.

  17. Towards the therapeutic use of vascular smooth muscle progenitor cells.

    Science.gov (United States)

    Merkulova-Rainon, Tatyana; Broquères-You, Dong; Kubis, Nathalie; Silvestre, Jean-Sébastien; Lévy, Bernard I

    2012-07-15

    Recent advances in the development of alternative proangiogenic and revascularization processes, including recombinant protein delivery, gene therapy, and cell therapy, hold the promise of greater efficacy in the management of cardiovascular disease in the coming years. In particular, vascular progenitor cell-based strategies have emerged as an efficient treatment approach to promote vessel formation and repair and to improve tissue perfusion. During the past decade, considerable progress has been achieved in understanding therapeutic properties of endothelial progenitor cells, while the therapeutic potential of vascular smooth muscle progenitor cells (SMPC) has only recently been explored; the number of the circulating SMPC being correlated with cardiovascular health. Several endogenous SMPC populations with varying phenotypes have been identified and characterized in the peripheral blood, bone marrow, and vascular wall. While the phenotypic entity of vascular SMPC is not fully defined and remains an evolving area of research, SMPC are increasingly recognized to play a special role in cardiovascular biology. In this review, we describe the current approaches used to define vascular SMPC. We further summarize the data on phenotype and functional properties of SMPC from various sources in adults. Finally, we discuss the role of SMPC in cardiovascular disease, including the contribution of SMPC to intimal proliferation, angiogenesis, and atherosclerotic plaque instability as well as the benefits resulting from the therapeutic use of SMPC.

  18. NEUTRONIZATION DURING CARBON SIMMERING IN TYPE IA SUPERNOVA PROGENITORS

    International Nuclear Information System (INIS)

    Martínez-Rodríguez, Héctor; Badenes, Carles; Piro, Anthony L.; Schwab, Josiah

    2016-01-01

    When a Type Ia supernova (SN Ia) progenitor first ignites carbon in its core, it undergoes ∼10 3 –10 4 years of convective burning prior to the onset of thermonuclear runaway. This carbon simmering phase is important for setting the thermal profile and composition of the white dwarf. Using the MESA stellar evolution code, we follow this convective burning and examine the production of neutron-rich isotopes. The neutron content of the SN fuel has important consequences for the ensuing nucleosynthesis, and in particular, for the production of secondary Fe-peak nuclei like Mn and stable Ni. These elements have been observed in the X-ray spectra of SN remnants like Tycho, Kepler, and 3C 397, and their yields can provide valuable insights into the physics of SNe Ia and the properties of their progenitors. We find that weak reactions during simmering can at most generate a neutron excess of ≈ 3 × 10 −4 . This is ≈ 70% lower than that found in previous studies that do not take the full density and temperature profile of the simmering region into account. Our results imply that the progenitor metallicity is the main contributor to the neutron excess in SN Ia fuel for Z ≳ 1/3 Z ⊙ . Alternatively, at lower metallicities, this neutron excess provides a floor that should be present in any centrally-ignited SN Ia scenario.

  19. Endothelial Progenitor Cells for Diagnosis and Prognosis in Cardiovascular Disease

    Directory of Open Access Journals (Sweden)

    Caterina Oriana Aragona

    2016-01-01

    Full Text Available Objective. To identify, evaluate, and synthesize evidence on the predictive power of circulating endothelial progenitor cells (EPCs in cardiovascular disease, through a systematic review of quantitative studies. Data Sources. MEDLINE was searched using keywords related to “endothelial progenitor cells” and “endothelium” and, for the different categories, respectively, “smoking”; “blood pressure”; “diabetes mellitus” or “insulin resistance”; “dyslipidemia”; “aging” or “elderly”; “angina pectoris” or “myocardial infarction”; “stroke” or “cerebrovascular disease”; “homocysteine”; “C-reactive protein”; “vitamin D”. Study Selection. Database hits were evaluated against explicit inclusion criteria. From 927 database hits, 43 quantitative studies were included. Data Syntheses. EPC count has been suggested for cardiovascular risk estimation in the clinical practice, since it is currently accepted that EPCs can work as proangiogenic support cells, maintaining their importance as regenerative/reparative potential, and also as prognostic markers. Conclusions. EPCs showed an important role in identifying cardiovascular risk conditions, and to suggest their evaluation as predictor of outcomes appears to be reasonable in different defined clinical settings. Due to their capability of proliferation, circulation, and the development of functional progeny, great interest has been directed to therapeutic use of progenitor cells in atherosclerotic diseases. This trial is registered with registration number: Prospero CRD42015023717.

  20. Requirement of mouse BCCIP for neural development and progenitor proliferation.

    Directory of Open Access Journals (Sweden)

    Yi-Yuan Huang

    Full Text Available Multiple DNA repair pathways are involved in the orderly development of neural systems at distinct stages. The homologous recombination (HR pathway is required to resolve stalled replication forks and critical for the proliferation of progenitor cells during neural development. BCCIP is a BRCA2 and CDKN1A interacting protein implicated in HR and inhibition of DNA replication stress. In this study, we determined the role of BCCIP in neural development using a conditional BCCIP knock-down mouse model. BCCIP deficiency impaired embryonic and postnatal neural development, causing severe ataxia, cerebral and cerebellar defects, and microcephaly. These development defects are associated with spontaneous DNA damage and subsequent cell death in the proliferative cell populations of the neural system during embryogenesis. With in vitro neural spheroid cultures, BCCIP deficiency impaired neural progenitor's self-renewal capability, and spontaneously activated p53. These data suggest that BCCIP and its anti-replication stress functions are essential for normal neural development by maintaining an orderly proliferation of neural progenitors.

  1. Effect of increased exercise in school children on physical fitness and endothelial progenitor cells: a prospective randomized trial.

    Science.gov (United States)

    Walther, Claudia; Gaede, Luise; Adams, Volker; Gelbrich, Götz; Leichtle, Alexander; Erbs, Sandra; Sonnabend, Melanie; Fikenzer, Kati; Körner, Antje; Kiess, Wieland; Bruegel, Mathias; Thiery, Joachim; Schuler, Gerhard

    2009-12-01

    The aim of this prospective, randomized study was to examine whether additional school exercise lessons would result in improved peak oxygen uptake (primary end point) and body mass index-standard deviation score, motor and coordinative abilities, circulating progenitor cells, and high-density lipoprotein cholesterol (major secondary end points). Seven sixth-grade classes (182 children, aged 11.1+/-0.7 years) were randomized to an intervention group (4 classes with 109 students) with daily school exercise lessons for 1 year and a control group (3 classes with 73 students) with regular school sports twice weekly. The significant effects of intervention estimated from ANCOVA adjusted for intraclass correlation were the following: increase of peak o(2) (3.7 mL/kg per minute; 95% confidence interval, 0.3 to 7.2) and increase of circulating progenitor cells evaluated by flow cytometry (97 cells per 1 x 10(6) leukocytes; 95% confidence interval, 13 to 181). No significant difference was seen for body mass index-standard deviation score (-0.08; 95% confidence interval, -0.28 to 0.13); however, there was a trend to reduction of the prevalence of overweight and obese children in the intervention group (from 12.8% to 7.3%). No treatment effect was seen for motor and coordinative abilities (4; 95% confidence interval, -1 to 8) and high-density lipoprotein cholesterol (0.03 mmol/L; 95% confidence interval, -0.08 to 0.14). Regular physical activity by means of daily school exercise lessons has a significant positive effect on physical fitness (o(2)max). Furthermore, the number of circulating progenitor cells can be increased, and there is a positive trend in body mass index-standard deviation score reduction and motor ability improvement. Therefore, we conclude that primary prevention by means of increasing physical activity should start in childhood. URL: http://www.clinicaltrials.gov. Identifier: NCT00176371.

  2. Dimethyl Fumarate Protects Neural Stem/Progenitor Cells and Neurons from Oxidative Damage through Nrf2-ERK1/2 MAPK Pathway

    Directory of Open Access Journals (Sweden)

    Qin Wang

    2015-06-01

    Full Text Available Multiple sclerosis (MS is the most common multifocal inflammatory demyelinating disease of the central nervous system (CNS. Due to the progressive neurodegenerative nature of MS, developing treatments that exhibit direct neuroprotective effects are needed. Tecfidera™ (BG-12 is an oral formulation of the fumaric acid esters (FAE, containing the active metabolite dimethyl fumarate (DMF. Although BG-12 showed remarkable efficacy in lowering relapse rates in clinical trials, its mechanism of action in MS is not yet well understood. In this study, we reported the potential neuroprotective effects of dimethyl fumarate (DMF on mouse and rat neural stem/progenitor cells (NPCs and neurons. We found that DMF increased the frequency of the multipotent neurospheres and the survival of NPCs following oxidative stress with hydrogen peroxide (H2O2 treatment. In addition, utilizing the reactive oxygen species (ROS assay, we showed that DMF reduced ROS production induced by H2O2. DMF also decreased oxidative stress-induced apoptosis. Using motor neuron survival assay, DMF significantly promoted survival of motor neurons under oxidative stress. We further analyzed the expression of oxidative stress-induced genes in the NPC cultures and showed that DMF increased the expression of transcription factor nuclear factor-erythroid 2-related factor 2 (Nrf2 at both levels of RNA and protein. Furthermore, we demonstrated the involvement of Nrf2-ERK1/2 MAPK pathway in DMF-mediated neuroprotection. Finally, we utilized SuperArray gene screen technology to identify additional anti-oxidative stress genes (Gstp1, Sod2, Nqo1, Srxn1, Fth1. Our data suggests that analysis of anti-oxidative stress mechanisms may yield further insights into new targets for treatment of multiple sclerosis (MS.

  3. REARRANGEMENT IN THE B-GENOME FROM DIPLOID PROGENITOR TO WHEAT ALLOPOLYPOLID

    Directory of Open Access Journals (Sweden)

    Salina E.A.

    2012-08-01

    Full Text Available Three key periods that were accompanied by considerable rearrangements in the B genome of wheat and its progenitor can be considered. The first period covers the period from the divergence of diploid Triticum and Aegilops species from their common progenitor (2.5–6 million years ago to formation of the tetraploid T. diccocoides (about 500 thousand years ago. Significant genomic rearrangements in the diploid progenitor of the B genome, Ae. speltoides (SS genome, involved a considerable amplification of repeated DNA sequences, which led to an increase in the number of heterochromatin blocks on chromosomes relative to other diploid Aegilops and Triticum species. Our analysis has demonstrated that during this period the Spelt1 repeats intensively amplified as well as several mobile elements proliferated, in particular, the genome-specific gypsy LTR-retrotransposon Fatima and CACTA DNA-transposon Caspar. The second period in the B-genome evolution was associated with the emergence of tetraploid (BBAA genome and its subsequent evolution. The third most important event leading to the next rearrangement of the B genome took place relatively recently, 7000–9500 years ago, being associated with the emergence of hexaploid wheat with the genomic formula BBAADD. The evolution of the B/S genome involved intergenomic and intragenomic translocations and chromosome inversions. So far, five rearrangements in the B-genome chromosomes of polyploid wheats has been observed and described; the majority of them took place during the formation and evolution of tetraploid species. The mapping of the S-genome chromosomes and comparison with the B-genome chromosome maps have demonstrated that individual rearrangements pre-existed in Ae. speltoides; moreover, Ae. speltoides is polymorphic for these rearrangements.Chromosome 5B is nearly 870 Mbp (5BL = 580 Mbp and 5BS = 290 Mbp and is known to carry important genes controlling the key aspects of wheat biology, in

  4. Core-Collapse Supernova Progenitors In The Era Of Untargeted Transient Searches

    Science.gov (United States)

    Sanders, Nathan Edward

    2014-04-01

    Core-collapse supernovae (SNe) are the highly energetic explosions of massive stars (≳ 8 M⊙) that are pervasive in their influence throughout astrophysics. They are the phenomenon with primary responsibility for enriching the universe with many of the heavy elements (like carbon and oxygen) that are needed for life, provide a critical feedback pressure which helps to shape the galaxies that host them, and are the likely formation mechanism for stellar mass black holes. In the past decade, the study of these explosions has been revolutionized by the advent of wide field, untargeted transient searches like Pan-STARRS1 (PS1). These new searches permit the discovery of SNe at unprecedented rates, and absent of many of the selection effects that have enforced biases on past, targeted transient searches. This thesis presents a broad survey of core-collapse SN phenomenology exhibited in the discoveries of untargeted searches, and statistically quantifies population properties of these explosions that link them to distinct classes of progenitor stars. Through studies of the host galaxy and explosion properties of extreme PS1-discovered events, and controlled samples of specific classes of core-collapse objects, we constrain the effect of progenitor star chemical composition (metallicity) on their eventual death states. We provide a new observational, photometric tool which lowers the cost of precisely and accurately measuring the metallicities of distant galaxies and supernova host environments. Moreover, we develop and apply a novel, multi-level Bayesian model for optical transient light curves which we apply to simultaneously interpret more than 20,000 PS1 images. This study illustrates how population-level modeling of data from large photometric surveys can yield improved physical inference on their progenitor stars through comparison to physical models. In the coming era, as next-generation facilities like the Large Synoptic Survey Telescope come online, the

  5. Reversible immortalisation enables genetic correction of human muscle progenitors and engineering of next-generation human artificial chromosomes for Duchenne muscular dystrophy.

    Science.gov (United States)

    Benedetti, Sara; Uno, Narumi; Hoshiya, Hidetoshi; Ragazzi, Martina; Ferrari, Giulia; Kazuki, Yasuhiro; Moyle, Louise Anne; Tonlorenzi, Rossana; Lombardo, Angelo; Chaouch, Soraya; Mouly, Vincent; Moore, Marc; Popplewell, Linda; Kazuki, Kanako; Katoh, Motonobu; Naldini, Luigi; Dickson, George; Messina, Graziella; Oshimura, Mitsuo; Cossu, Giulio; Tedesco, Francesco Saverio

    2018-02-01

    Transferring large or multiple genes into primary human stem/progenitor cells is challenged by restrictions in vector capacity, and this hurdle limits the success of gene therapy. A paradigm is Duchenne muscular dystrophy (DMD), an incurable disorder caused by mutations in the largest human gene: dystrophin. The combination of large-capacity vectors, such as human artificial chromosomes (HACs), with stem/progenitor cells may overcome this limitation. We previously reported amelioration of the dystrophic phenotype in mice transplanted with murine muscle progenitors containing a HAC with the entire dystrophin locus (DYS-HAC). However, translation of this strategy to human muscle progenitors requires extension of their proliferative potential to withstand clonal cell expansion after HAC transfer. Here, we show that reversible cell immortalisation mediated by lentivirally delivered excisable hTERT and Bmi1 transgenes extended cell proliferation, enabling transfer of a novel DYS-HAC into DMD satellite cell-derived myoblasts and perivascular cell-derived mesoangioblasts. Genetically corrected cells maintained a stable karyotype, did not undergo tumorigenic transformation and retained their migration ability. Cells remained myogenic in vitro (spontaneously or upon MyoD induction) and engrafted murine skeletal muscle upon transplantation. Finally, we combined the aforementioned functions into a next-generation HAC capable of delivering reversible immortalisation, complete genetic correction, additional dystrophin expression, inducible differentiation and controllable cell death. This work establishes a novel platform for complex gene transfer into clinically relevant human muscle progenitors for DMD gene therapy. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

  6. bantam miRNA is important for Drosophila blood cell homeostasis and a regulator of proliferation in the hematopoietic progenitor niche

    Energy Technology Data Exchange (ETDEWEB)

    Lam, Victoria; Tokusumi, Tsuyoshi; Tokusumi, Yumiko; Schulz, Robert A., E-mail: rschulz@nd.edu

    2014-10-24

    Highlights: • bantam miRNA is endogenously expressed in the hematopoietic progenitor niche. • bantam is necessary and sufficient to induce cellular proliferation in the PSC. • bantam is upstream of the Insulin Receptor signaling pathway. • A model for positive regulation of hematopoietic niche growth is proposed. - Abstract: The Drosophila hematopoietic system is utilized in this study to gain novel insights into the process of growth control of the hematopoietic progenitor niche in blood development. The niche microenvironment is an essential component controlling the balance between progenitor populations and differentiated, mature blood cells and has been shown to lead to hematopoietic malignancies in humans when misregulated. MicroRNAs are one class of regulators associated with blood malignancies; however, there remains a relative paucity of information about the role of miRNAs in the niche. Here we demonstrate that bantam miRNA is endogenously active in the Drosophila hematopoietic progenitor niche, the posterior signaling center (PSC), and functions in the primary hematopoietic organ, the lymph gland, as a positive regulator of growth. Loss of bantam leads to a significant reduction in the PSC and overall lymph gland size, as well as a loss of the progenitor population and correlative premature differentiation of mature hemocytes. Interestingly, in addition to being essential for proper lymph gland development, we have determined bantam to be a novel upstream component of the insulin signaling cascade in the PSC and have unveiled dMyc as one factor central to bantam activity. These important findings identify bantam as a new hematopoietic regulator, place it in an evolutionarily conserved signaling pathway, present one way in which it is regulated, and provide a mechanism through which it facilitates cellular proliferation in the hematopoietic niche.

  7. bantam miRNA is important for Drosophila blood cell homeostasis and a regulator of proliferation in the hematopoietic progenitor niche

    International Nuclear Information System (INIS)

    Lam, Victoria; Tokusumi, Tsuyoshi; Tokusumi, Yumiko; Schulz, Robert A.

    2014-01-01

    Highlights: • bantam miRNA is endogenously expressed in the hematopoietic progenitor niche. • bantam is necessary and sufficient to induce cellular proliferation in the PSC. • bantam is upstream of the Insulin Receptor signaling pathway. • A model for positive regulation of hematopoietic niche growth is proposed. - Abstract: The Drosophila hematopoietic system is utilized in this study to gain novel insights into the process of growth control of the hematopoietic progenitor niche in blood development. The niche microenvironment is an essential component controlling the balance between progenitor populations and differentiated, mature blood cells and has been shown to lead to hematopoietic malignancies in humans when misregulated. MicroRNAs are one class of regulators associated with blood malignancies; however, there remains a relative paucity of information about the role of miRNAs in the niche. Here we demonstrate that bantam miRNA is endogenously active in the Drosophila hematopoietic progenitor niche, the posterior signaling center (PSC), and functions in the primary hematopoietic organ, the lymph gland, as a positive regulator of growth. Loss of bantam leads to a significant reduction in the PSC and overall lymph gland size, as well as a loss of the progenitor population and correlative premature differentiation of mature hemocytes. Interestingly, in addition to being essential for proper lymph gland development, we have determined bantam to be a novel upstream component of the insulin signaling cascade in the PSC and have unveiled dMyc as one factor central to bantam activity. These important findings identify bantam as a new hematopoietic regulator, place it in an evolutionarily conserved signaling pathway, present one way in which it is regulated, and provide a mechanism through which it facilitates cellular proliferation in the hematopoietic niche

  8. Catalase inhibits ionizing radiation-induced apoptosis in hematopoietic stem and progenitor cells.

    Science.gov (United States)

    Xiao, Xia; Luo, Hongmei; Vanek, Kenneth N; LaRue, Amanda C; Schulte, Bradley A; Wang, Gavin Y

    2015-06-01

    Hematologic toxicity is a major cause of mortality in radiation emergency scenarios and a primary side effect concern in patients undergoing chemo-radiotherapy. Therefore, there is a critical need for the development of novel and more effective approaches to manage this side effect. Catalase is a potent antioxidant enzyme that coverts hydrogen peroxide into hydrogen and water. In this study, we evaluated the efficacy of catalase as a protectant against ionizing radiation (IR)-induced toxicity in hematopoietic stem and progenitor cells (HSPCs). The results revealed that catalase treatment markedly inhibits IR-induced apoptosis in murine hematopoietic stem cells and hematopoietic progenitor cells. Subsequent colony-forming cell and cobble-stone area-forming cell assays showed that catalase-treated HSPCs can not only survive irradiation-induced apoptosis but also have higher clonogenic capacity, compared with vehicle-treated cells. Moreover, transplantation of catalase-treated irradiated HSPCs results in high levels of multi-lineage and long-term engraftments, whereas vehicle-treated irradiated HSPCs exhibit very limited hematopoiesis reconstituting capacity. Mechanistically, catalase treatment attenuates IR-induced DNA double-strand breaks and inhibits reactive oxygen species. Unexpectedly, we found that the radioprotective effect of catalase is associated with activation of the signal transducer and activator of transcription 3 (STAT3) signaling pathway and pharmacological inhibition of STAT3 abolishes the protective activity of catalase, suggesting that catalase may protect HSPCs against IR-induced toxicity via promoting STAT3 activation. Collectively, these results demonstrate a previously unrecognized mechanism by which catalase inhibits IR-induced DNA damage and apoptosis in HSPCs.

  9. Observational properties of SNe Ia progenitors close to the explosion

    Science.gov (United States)

    Tornambé, A.; Piersanti, L.; Raimondo, G.; Delgrande, R.

    2018-04-01

    We determine the expected signal in various observational bands of supernovae Ia progenitors just before the explosion by assuming the rotating double-degenerate scenario. Our results are valid also for all the evolutionary scenarios invoking rotation as the driving mechanism of the accretion process as well as the evolution up to the explosion. We find that the observational properties depend mainly on the mass of the exploding object, even if the angular momentum evolution after the end of the mass accretion phase and before the onset of C-burning plays a non-negligible role. Just before the explosion, the magnitude MV ranges between 9 and 11 mag, while the colour (F225W - F555W) is about -1.64 mag. The photometric properties remain constant for a few decades before the explosion. During the last few months, the luminosity decreases very rapidly. The corresponding decline in the optical bands varies from a few hundredths up to one magnitude, the exact value depending on both the white dwarf total mass and the braking efficiency at the end of the mass transfer. This feature is related to the exponentially increasing energy production, which drives the formation of a convective core rapidly extending over a large part of the exploding object. Also, a drop in the angular velocity occurs. We find that observations in the soft X band (0.5-2 keV) may be used to check if the evolution of the SNe Ia progenitors up to the explosion is driven by rotation and, hence, to discriminate among different progenitor scenarios.

  10. Amenorrhea - primary

    Science.gov (United States)

    ... of periods - primary Images Primary amenorrhea Normal uterine anatomy (cut section) Absence of menstruation (amenorrhea) References Bulun SE. The physiology and pathology of the female reproductive axis. In: ...

  11. A novel approach for amplification and purification of mouse oligodendrocyte progenitor cells

    Directory of Open Access Journals (Sweden)

    Junlin Yang

    2016-08-01

    Full Text Available Although transgenic and knockout mice are widely used to study the specification and differentiation of oligodendrocyte precursor cells (OPCs, mouse primary OPCs are difficult to be purified and maintained, and many in vitro studies have to resort to rat OPCs as substitutes. In this study, we reported that mouse O4 negative early-stage OPCs can be obtained by culturing cortical tissue blocks, and the simultaneous treatment of OPCs with PDGFaa, bFGF and EGF is the key for the propagation of mouse OPCs in culture. Epidermal growth factor (EGF was found to be a potent mitogen for OPCs and cooperate with Platelet Derived Growth Factor-AA (PDGFaa to extend cell division and inhibit their differentiation. EGF also collaborates with PDGFaa and basic fibroblast growth factor (bFGF to convert bipolar or tripolar OPCs to more vital fibroblast-like OPCs without compromising their oligodendrocyte differentiation potential. In addition, EGF promoted the survival and proliferation of glial progenitor cells (GPCs derived from primary OPC cultures, and a mixture of GPCs and OPCs can be obtained and propagated in the presence of EGF, bFGF and PDGFaa. Once EGF is withdrawn, GPC population decreased sharply and fibroblast-like OPCs changed into typical OPCs morphology, then homogeneous OPCs were obtained subsequently.

  12. Differentiation of Inflammation-Responsive Astrocytes from Glial Progenitors Generated from Human Induced Pluripotent Stem Cells

    Directory of Open Access Journals (Sweden)

    Renata Santos

    2017-06-01

    Full Text Available Astrocyte dysfunction and neuroinflammation are detrimental features in multiple pathologies of the CNS. Therefore, the development of methods that produce functional human astrocytes represents an advance in the study of neurological diseases. Here we report an efficient method for inflammation-responsive astrocyte generation from induced pluripotent stem cells (iPSCs and embryonic stem cells. This protocol uses an intermediate glial progenitor stage and generates functional astrocytes that show levels of glutamate uptake and calcium activation comparable with those observed in human primary astrocytes. Stimulation of stem cell-derived astrocytes with interleukin-1β or tumor necrosis factor α elicits a strong and rapid pro-inflammatory response. RNA-sequencing transcriptome profiling confirmed that similar gene expression changes occurred in iPSC-derived and primary astrocytes upon stimulation with interleukin-1β. This protocol represents an important tool for modeling in-a-dish neurological diseases with an inflammatory component, allowing for the investigation of the role of diseased astrocytes in neuronal degeneration.

  13. Differentiation of Inflammation-Responsive Astrocytes from Glial Progenitors Generated from Human Induced Pluripotent Stem Cells.

    Science.gov (United States)

    Santos, Renata; Vadodaria, Krishna C; Jaeger, Baptiste N; Mei, Arianna; Lefcochilos-Fogelquist, Sabrina; Mendes, Ana P D; Erikson, Galina; Shokhirev, Maxim; Randolph-Moore, Lynne; Fredlender, Callie; Dave, Sonia; Oefner, Ruth; Fitzpatrick, Conor; Pena, Monique; Barron, Jerika J; Ku, Manching; Denli, Ahmet M; Kerman, Bilal E; Charnay, Patrick; Kelsoe, John R; Marchetto, Maria C; Gage, Fred H

    2017-06-06

    Astrocyte dysfunction and neuroinflammation are detrimental features in multiple pathologies of the CNS. Therefore, the development of methods that produce functional human astrocytes represents an advance in the study of neurological diseases. Here we report an efficient method for inflammation-responsive astrocyte generation from induced pluripotent stem cells (iPSCs) and embryonic stem cells. This protocol uses an intermediate glial progenitor stage and generates functional astrocytes that show levels of glutamate uptake and calcium activation comparable with those observed in human primary astrocytes. Stimulation of stem cell-derived astrocytes with interleukin-1β or tumor necrosis factor α elicits a strong and rapid pro-inflammatory response. RNA-sequencing transcriptome profiling confirmed that similar gene expression changes occurred in iPSC-derived and primary astrocytes upon stimulation with interleukin-1β. This protocol represents an important tool for modeling in-a-dish neurological diseases with an inflammatory component, allowing for the investigation of the role of diseased astrocytes in neuronal degeneration. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  14. Neurotoxic effect of 2,5-hexanedione on neural progenitor cells and hippocampal neurogenesis

    International Nuclear Information System (INIS)

    Kim, Min-Sun; Park, Hee Ra; Park, Mikyung; Kim, So Jung; Kwon, Mugil; Yu, Byung Pal; Chung, Hae Young; Kim, Hyung Sik; Kwack, Seung Jun; Kang, Tae Seok; Kim, Seung Hee; Lee, Jaewon

    2009-01-01

    2,5-Hexanedione (HD), a metabolite of n-hexane, causes central and peripheral neuropathy leading to motor neuron deficits. Although chronic exposure to n-hexane is known to cause gradual sensorimotor neuropathy, there are no reports on the effects of low doses of HD on neurogenesis in the central nervous system. In the current study, we explored HD toxicity in murine neural progenitor cells (NPC), primary neuronal culture and young adult mice. HD (500 nM∼50 μM) dose-dependently suppressed NPC proliferation and cell viability, and also increased the production of reactive oxygen species (ROS). HD (10 or 50 mg/kg for 2 weeks) inhibited hippocampal neuronal and NPC proliferation in 6-week-old male ICR mice, as measured by BrdU incorporation in the dentate gyrus, indicating HD impaired hippocampal neurogenesis. In addition, elevated microglial activation was observed in the hippocampal CA3 region and lateral ventricles of HD-treated mice. Lastly, HD dose-dependently decreased the viability of primary cultured neurons. Based on biochemical and histochemical evidence from both cell culture and HD-treated animals, the neurotoxic mechanisms by which HD inhibits NPC proliferation and hippocampal neurogenesis may relate to its ability to elicit an increased generation of deleterious ROS.

  15. Enrichment of rat oligodendrocyte progenitor cells by magnetic cell sorting

    Czech Academy of Sciences Publication Activity Database

    Čížková, D.; Čížek, M.; Nagyová, M.; Slovinská, L.; Novotná, I.; Jergová, S.; Radoňák, J.; Hlučilová, Jana; Vanický, I.

    2009-01-01

    Roč. 184, č. 1 (2009), s. 88-94 ISSN 0165-0270 R&D Projects: GA MŠk MEB0808108 Grant - others:Agentúra na podporu výskumu a vývoja(SK) APVV-51002105; Agentúra na podporu výskumu a vývoja(SK) APVV SK-CZ-0045-07 Institutional research plan: CEZ:AV0Z50450515 Keywords : Oligodendrocytes progenitors Lineage * Magnetic separation Subject RIV: FH - Neurology Impact factor: 2.295, year: 2009

  16. TRAIL (Apo2L) suppresses growth of primary human leukemia and myelodysplasia progenitors

    Czech Academy of Sciences Publication Activity Database

    Plašilová, M.; Živný, J.; Jelínek, J.; Neuwirtová, R.; Čermák, J.; Nečas, E.; Anděra, Ladislav; Stopka, T.

    2002-01-01

    Roč. 16, č. 1 (2002), s. 67-73 ISSN 0887-6924 R&D Projects: GA AV ČR IAA5052001; GA ČR GA301/99/0350 Institutional research plan: CEZ:AV0Z5052915 Keywords : TRAIL * leukemia * apoptosis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.693, year: 2002

  17. Inter-progenitor pool wiring: An evolutionarily conserved strategy that expands neural circuit diversity.

    Science.gov (United States)

    Suzuki, Takumi; Sato, Makoto

    2017-11-15

    Diversification of neuronal types is key to establishing functional variations in neural circuits. The first critical step to generate neuronal diversity is to organize the compartmental domains of developing brains into spatially distinct neural progenitor pools. Neural progenitors in each pool then generate a unique set of diverse neurons through specific spatiotemporal specification processes. In this review article, we focus on an additional mechanism, 'inter-progenitor pool wiring', that further expands the diversity of neural circuits. After diverse types of neurons are generated in one progenitor pool, a fraction of these neurons start migrating toward a remote brain region containing neurons that originate from another progenitor pool. Finally, neurons of different origins are intermingled and eventually form complex but precise neural circuits. The developing cerebral cortex of mammalian brains is one of the best examples of inter-progenitor pool wiring. However, Drosophila visual system development has revealed similar mechanisms in invertebrate brains, suggesting that inter-progenitor pool wiring is an evolutionarily conserved strategy that expands neural circuit diversity. Here, we will discuss how inter-progenitor pool wiring is accomplished in mammalian and fly brain systems. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Selective In Vitro Propagation of Nephron Progenitors Derived from Embryos and Pluripotent Stem Cells

    Directory of Open Access Journals (Sweden)

    Shunsuke Tanigawa

    2016-04-01

    Full Text Available Nephron progenitors in the embryonic kidney propagate while generating differentiated nephrons. However, in mice, the progenitors terminally differentiate shortly after birth. Here, we report a method for selectively expanding nephron progenitors in vitro in an undifferentiated state. Combinatorial and concentration-dependent stimulation with LIF, FGF2/9, BMP7, and a WNT agonist is critical for expansion. The purified progenitors proliferated beyond the physiological limits observed in vivo, both for cell numbers and lifespan. Neonatal progenitors were maintained for a week, while progenitors from embryonic day 11.5 expanded 1,800-fold for nearly 20 days and still reconstituted 3D nephrons containing glomeruli and renal tubules. Furthermore, progenitors generated from mouse embryonic stem cells and human induced pluripotent cells could be expanded with retained nephron-forming potential. Thus, we have established in vitro conditions for promoting the propagation of nephron progenitors, which will be essential for dissecting the mechanisms of kidney organogenesis and for regenerative medicine.

  19. Selective In Vitro Propagation of Nephron Progenitors Derived from Embryos and Pluripotent Stem Cells.

    Science.gov (United States)

    Tanigawa, Shunsuke; Taguchi, Atsuhiro; Sharma, Nirmala; Perantoni, Alan O; Nishinakamura, Ryuichi

    2016-04-26

    Nephron progenitors in the embryonic kidney propagate while generating differentiated nephrons. However, in mice, the progenitors terminally differentiate shortly after birth. Here, we report a method for selectively expanding nephron progenitors in vitro in an undifferentiated state. Combinatorial and concentration-dependent stimulation with LIF, FGF2/9, BMP7, and a WNT agonist is critical for expansion. The purified progenitors proliferated beyond the physiological limits observed in vivo, both for cell numbers and lifespan. Neonatal progenitors were maintained for a week, while progenitors from embryonic day 11.5 expanded 1,800-fold for nearly 20 days and still reconstituted 3D nephrons containing glomeruli and renal tubules. Furthermore, progenitors generated from mouse embryonic stem cells and human induced pluripotent cells could be expanded with retained nephron-forming potential. Thus, we have established in vitro conditions for promoting the propagation of nephron progenitors, which will be essential for dissecting the mechanisms of kidney organogenesis and for regenerative medicine. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  20. Progress of stem/progenitor cell-based therapy for retinal degeneration.

    Science.gov (United States)

    Tang, Zhimin; Zhang, Yi; Wang, Yuyao; Zhang, Dandan; Shen, Bingqiao; Luo, Min; Gu, Ping

    2017-05-10

    Retinal degeneration (RD), such as age-related macular degeneration (AMD) and retinitis pigmentosa, is one of the leading causes of blindness. Presently, no satisfactory therapeutic options are available for these diseases principally because the retina and retinal pigmented epithelium (RPE) do not regenerate, although wet AMD can be prevented from further progression by anti-vascular endothelial growth factor therapy. Nevertheless, stem/progenitor cell approaches exhibit enormous potential for RD treatment using strategies mainly aimed at the rescue and replacement of photoreceptors and RPE. The sources of stem/progenitor cells are classified into two broad categories in this review, which are (1) ocular-derived progenitor cells, such as retinal progenitor cells, and (2) non-ocular-derived stem cells, including embryonic stem cells, induced pluripotent stem cells, and mesenchymal stromal cells. Here, we discuss in detail the progress in the study of four predominant stem/progenitor cell types used in animal models of RD. A short overview of clinical trials involving the stem/progenitor cells is also presented. Currently, stem/progenitor cell therapies for RD still have some drawbacks such as inhibited proliferation and/or differentiation in vitro (with the exception of the RPE) and limited long-term survival and function of grafts in vivo. Despite these challenges, stem/progenitor cells represent the most promising strategy for RD treatment in the near future.

  1. Proof of region-specific multipotent progenitors in human breast epithelia

    DEFF Research Database (Denmark)

    Fridriksdottir, Agla J; Villadsen, René; Morsing, Mikkel

    2017-01-01

    in luminal progenitors to interrogate the differentiation repertoire of candidate stem cells in TDLUs. We show that stem-like activity in serial passage culture and in vivo breast morphogenesis relies on the preservation of a myoepithelial phenotype. By enrichment for region-specific progenitors, we identify...

  2. Effects of hematopoietic growth factors on purified bone marrow progenitor cells

    NARCIS (Netherlands)

    F.J. Bot (Freek)

    1992-01-01

    textabstractWe have used highly enriched hematopoietic progenitor cells and in-vitro culture to examine the following questions: 1. The effects of recombinant lL-3 and GM-CSF on proliferation and differentiation of enriched hematopoietic progenitor cells have not been clearly defined: - how do IL~3

  3. Delta-like 1 participates in the specification of ventral midbrain progenitor derived dopaminergic neurons

    DEFF Research Database (Denmark)

    Bauer, Matthias; Szulc, Jolanta; Meyer, Morten

    2008-01-01

    function of Dlk1 in VM neuron development, we investigated the effect of soluble Dlk1 protein as well as the intrinsic Dlk1 function in the course of VM progenitor expansion and dopaminergic (DA) neuron differentiation in vitro. Dlk1 treatment during expansion increased DA progenitor proliferation...

  4. Direct observation of hematopoietic progenitor chimerism in fetal freemartin cattle

    Directory of Open Access Journals (Sweden)

    Taponen Juhani

    2007-11-01

    Full Text Available Abstract Background Cattle twins are well known as blood chimeras. However, chimerism in the actual hematopoietic progenitor compartment has not been directly investigated. Here, we analyzed fetal liver of chimeric freemartin cattle by combining a new anti-bovine CD34 antibody and Y-chromosome specific in situ hybridization. Results Bull-derived CD34+ cells were detected in the liver of the female sibling (freemartin at 60 days gestation. The level of bull-derived CD34+ cells was lower in the freemartin than in its male siblings. Bull (Y+ and cow hematopoietic cells often occurred in separate clusters. Around clusters of Y+CD34+ cells, Y+CD34- cells were typically observed. The thymi were also strongly chimeric at 60 days of gestation. Conclusion The fetal freemartin liver contains clusters of bull-derived hematopoietic progenitors, suggesting clonal expansion and differentiation. Even the roots of the hematopoietic system in cattle twins are thus strongly chimeric from the early stages of fetal development. However, the hematopoietic seeding of fetal liver apparently started already before the onset of functional vascular anastomosis.

  5. Selection of progenitors for increase in oil content in soybean

    Directory of Open Access Journals (Sweden)

    Josiane Isabela da Silva Rodrigues

    Full Text Available ABSTRACT The low genetic diversity brings limitation to breeding, because genetically similar genotypes share alleles in common, causing little complementarity and low vigor due to the low levels of heterozygosity in crosses. The objective of this work was to analyze the oil content and genetic diversity of soybean genotypes (Glycine max (L. Merrill based on QTL regions of this trait for choice of progenitors for increase in oil content. Twenty-two genotypes with wide variation in oil content, including cultivars with high oil contents, were cultivated in different Brazilian conditions and the oil content of the grains was quantified by infrared spectrometry. Microsatellite markers selected based on QTL regions for oil content in soybean were analyzed to estimate the genetic diversity. In these studies, a wide variation in oil content (17.28-23.01% and a reasonable diversity among the genotypes were observed, being PI181544 the most divergent genotype, followed by Suprema. The genotypes PI371610/Suprema and Suprema/CD01RR8384 showed genetic distance and higher oil contents in the grains, while the cultivars Suprema and CD01RR8384 had the highest oil contents and proved to be little genetically related. These genotypes are promising progenitors for selection of high oil content in soybean.

  6. Metallicity gradient of the thick disc progenitor at high redshift

    Science.gov (United States)

    Kawata, Daisuke; Allende Prieto, Carlos; Brook, Chris B.; Casagrande, Luca; Ciucă, Ioana; Gibson, Brad K.; Grand, Robert J. J.; Hayden, Michael R.; Hunt, Jason A. S.

    2018-01-01

    We have developed a novel Markov Chain Monte Carlo chemical 'painting' technique to explore possible radial and vertical metallicity gradients for the thick disc progenitor. In our analysis, we match an N-body simulation to the data from the Apache Point Observatory Galactic Evolution Experiment survey. We assume that the thick disc has a constant scaleheight and has completed its formation at an early epoch, after which time radial mixing of its stars has taken place. Under these assumptions, we find that the initial radial metallicity gradient of the thick disc progenitor should not be negative, but either flat or even positive, to explain the current negative vertical metallicity gradient of the thick disc. Our study suggests that the thick disc was built-up in an inside-out and upside-down fashion, and older, smaller and thicker populations are more metal poor. In this case, star-forming discs at different epochs of the thick disc formation are allowed to have different radial metallicity gradients, including a negative one, which helps to explain a variety of slopes observed in high-redshift disc galaxies. This scenario helps to explain the positive slope of the metallicity-rotation velocity relation observed for the Galactic thick disc. On the other hand, radial mixing flattens the slope of an existing gradient.

  7. Lin28 sustains early renal progenitors and induces Wilms tumor

    Science.gov (United States)

    Urbach, Achia; Yermalovich, Alena; Zhang, Jin; Spina, Catherine S.; Zhu, Hao; Perez-Atayde, Antonio R.; Shukrun, Rachel; Charlton, Jocelyn; Sebire, Neil; Mifsud, William; Dekel, Benjamin; Pritchard-Jones, Kathy; Daley, George Q.

    2014-01-01

    Wilms Tumor, the most common pediatric kidney cancer, evolves from the failure of terminal differentiation of the embryonic kidney. Here we show that overexpression of the heterochronic regulator Lin28 during kidney development in mice markedly expands nephrogenic progenitors by blocking their final wave of differentiation, ultimately resulting in a pathology highly reminiscent of Wilms tumor. Using lineage-specific promoters to target Lin28 to specific cell types, we observed Wilms tumor only when Lin28 is aberrantly expressed in multiple derivatives of the intermediate mesoderm, implicating the cell of origin as a multipotential renal progenitor. We show that withdrawal of Lin28 expression reverts tumorigenesis and markedly expands the numbers of glomerulus-like structures and that tumor formation is suppressed by enforced expression of Let-7 microRNA. Finally, we demonstrate overexpression of the LIN28B paralog in a significant percentage of human Wilms tumor. Our data thus implicate the Lin28/Let-7 pathway in kidney development and tumorigenesis. PMID:24732380

  8. Cancer Progenitor Cells: The Result of an Epigenetic Event?

    Science.gov (United States)

    Lapinska, Karolina; Faria, Gabriela; McGonagle, Sandra; Macumber, Kate Morgan; Heerboth, Sarah; Sarkar, Sibaji

    2018-01-01

    The concept of cancer stem cells was proposed in the late 1990s. Although initially the idea seemed controversial, the existence of cancer stem cells is now well established. However, the process leading to the formation of cancer stem cells is still not clear and thus requires further research. This article discusses epigenetic events that possibly produce cancer progenitor cells from predisposed cells by the influence of their environment. Every somatic cell possesses an epigenetic signature in terms of histone modifications and DNA methylation, which are obtained during lineage-specific differentiation of pluripotent stem cells, which is specific to that particular tissue. We call this signature an epigenetic switch. The epigenetic switch is not fixed. Our epigenome alters with aging. However, depending on the predisposition of the cells of a particular tissue and their microenvironment, the balance of the switch (histone modifications and the DNA methylation) may be tilted to immortality in a few cells, which generates cancer progenitor cells. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  9. Using Strong Gravitational Lensing to Identify Fossil Group Progenitors

    Science.gov (United States)

    Johnson, Lucas E.; Irwin, Jimmy A.; White, Raymond E., III; Wong, Ka-Wah; Maksym, W. Peter; Dupke, Renato A.; Miller, Eric D.; Carrasco, Eleazar R.

    2018-04-01

    Fossil galaxy systems are classically thought to be the end result of galaxy group/cluster evolution, as galaxies experiencing dynamical friction sink to the center of the group potential and merge into a single, giant elliptical that dominates the rest of the members in both mass and luminosity. Most fossil systems discovered lie within z fossil criteria within the look forward time. Since strong gravitational lensing preferentially selects groups merging along the line of sight, or systems with a high mass concentration like fossil systems, we searched the CASSOWARY survey of strong-lensing events with the goal of determining whether lensing systems have any predisposition to being fossil systems or progenitors. We find that ∼13% of lensing groups are identified as traditional fossils while only ∼3% of nonlensing control groups are. We also find that ∼23% of lensing systems are traditional fossil progenitors compared to ∼17% for the control sample. Our findings show that strong-lensing systems are more likely to be fossil/pre-fossil systems than comparable nonlensing systems. Cumulative galaxy luminosity functions of the lensing and nonlensing groups also indicate a possible, fundamental difference between strong-lensing and nonlensing systems’ galaxy populations, with lensing systems housing a greater number of bright galaxies even in the outskirts of groups.

  10. Human neonatal cardiovascular progenitors: unlocking the secret to regenerative ability.

    Directory of Open Access Journals (Sweden)

    Tania I Fuentes

    Full Text Available Although clinical benefit can be achieved after cardiac transplantation of adult c-kit+ or cardiosphere-derived cells for myocardial repair, these stem cells lack the regenerative capacity unique to neonatal cardiovascular stem cells. Unraveling the molecular basis for this age-related discrepancy in function could potentially transform cardiovascular stem cell transplantation. In this report, clonal populations of human neonatal and adult cardiovascular progenitor cells were isolated and characterized, revealing the existence of a novel subpopulation of endogenous cardiovascular stem cells that persist throughout life and co-express both c-kit and isl1. Epigenetic profiling identified 41 microRNAs whose expression was significantly altered with age in phenotypically-matched clones. These differences were correlated with reduced proliferation and a limited capacity to invade in response to growth factor stimulation, despite high levels of growth factor receptor on progenitors isolated from adults. Further understanding of these differences may provide novel therapeutic targets to enhance cardiovascular regenerative capacity.

  11. Notch3 marks clonogenic mammary luminal progenitor cells in vivo.

    Science.gov (United States)

    Lafkas, Daniel; Rodilla, Veronica; Huyghe, Mathilde; Mourao, Larissa; Kiaris, Hippokratis; Fre, Silvia

    2013-10-14

    The identity of mammary stem and progenitor cells remains poorly understood, mainly as a result of the lack of robust markers. The Notch signaling pathway has been implicated in mammary gland development as well as in tumorigenesis in this tissue. Elevated expression of the Notch3 receptor has been correlated to the highly aggressive "triple negative" human breast cancer. However, the specific cells expressing this Notch paralogue in the mammary gland remain unknown. Using a conditionally inducible Notch3-CreERT2(SAT) transgenic mouse, we genetically marked Notch3-expressing cells throughout mammary gland development and followed their lineage in vivo. We demonstrate that Notch3 is expressed in a highly clonogenic and transiently quiescent luminal progenitor population that gives rise to a ductal lineage. These cells are capable of surviving multiple successive pregnancies, suggesting a capacity to self-renew. Our results also uncover a role for the Notch3 receptor in restricting the proliferation and consequent clonal expansion of these cells.

  12. Pancreatic β-cell regeneration: Facultative or dedicated progenitors?

    Science.gov (United States)

    Afelik, Solomon; Rovira, Meritxell

    2017-04-15

    The adult pancreas is only capable of limited regeneration. Unlike highly regenerative tissues such as the skin, intestinal crypts and hematopoietic system, no dedicated adult stem cells or stem cell niche have so far been identified within the adult pancreas. New β cells have been shown to form in the adult pancreas, in response to high physiological demand or experimental β-cell ablation, mostly by replication of existing β cells. The possibility that new β cells are formed from other sources is currently a point of major controversy. Under particular injury conditions, fully differentiated pancreatic duct and acinar cells have been shown to dedifferentiate into a progenitor-like state, however the extent, to which ductal, acinar or other endocrine cells contribute to restoring pancreatic β-cell mass remains to be resolved. In this review we focus on regenerative events in the pancreas with emphasis on the restoration of β-cell mass. We present an overview of regenerative responses noted within the different pancreatic lineages, following injury. We also highlight the intrinsic plasticity of the adult pancreas that allows for inter-conversion of fully differentiated pancreatic lineages through manipulation of few genes or growth factors. Taken together, evidence from a number of studies suggest that differentiated pancreatic lineages could act as facultative progenitor cells, but the extent to which these contribute to β-cell regeneration in vivo is still a matter of contention. Copyright © 2016. Published by Elsevier B.V.

  13. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  14. Lack of association between nuclear factor erythroid-derived 2-like 2 promoter gene polymorphisms and oxidative stress biomarkers in amyotrophic lateral sclerosis patients.

    Science.gov (United States)

    LoGerfo, Annalisa; Chico, Lucia; Borgia, Loredana; Petrozzi, Lucia; Rocchi, Anna; D'Amelio, Antonia; Carlesi, Cecilia; Caldarazzo Ienco, Elena; Mancuso, Michelangelo; Siciliano, Gabriele

    2014-01-01

    Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS). The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2) pathways. We genotyped, in a cohort of ALS patients (n = 145) and healthy controls (n = 168), three SNPs in Nrf2 gene promoter: -653 A/G, -651 G/A, and -617 C/A and evaluated, in a subset (n = 73) of patients, advanced oxidation protein products (AOPP), iron-reducing ability of plasma (FRAP), and plasma thiols (-SH) as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P < 0.05) and decreased levels of FRAP (P < 0.001) have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the -653 A/G, -651 G/A, and -617 C/A Nrf2 SNPs in ALS patients.

  15. Lack of Association between Nuclear Factor Erythroid-Derived 2-Like 2 Promoter Gene Polymorphisms and Oxidative Stress Biomarkers in Amyotrophic Lateral Sclerosis Patients

    Directory of Open Access Journals (Sweden)

    Annalisa LoGerfo

    2014-01-01

    Full Text Available Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS. The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2 pathways. We genotyped, in a cohort of ALS patients (n=145 and healthy controls (n=168, three SNPs in Nrf2 gene promoter: −653 A/G, −651 G/A, and −617 C/A and evaluated, in a subset (n=73 of patients, advanced oxidation protein products (AOPP, iron-reducing ability of plasma (FRAP, and plasma thiols (-SH as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P<0.05 and decreased levels of FRAP (P<0.001 have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the −653 A/G, −651 G/A, and −617 C/A Nrf2 SNPs in ALS patients.

  16. Production of β-globin and adult hemoglobin following G418 treatment of erythroid precursor cells from homozygous β039 thalassemia patients

    Science.gov (United States)

    Salvatori, Francesca; Breveglieri, Giulia; Zuccato, Cristina; Finotti, Alessia; Bianchi, Nicoletta; Borgatti, Monica; Feriotto, Giordana; Destro, Federica; Canella, Alessandro; Brognara, Eleonora; Lampronti, Ilaria; Breda, Laura; Rivella, Stefano; Gambari, Roberto

    2013-01-01

    In several types of thalassemia (including β039-thalassemia), stop codon mutations lead to premature translation termination and to mRNA destabilization through nonsense-mediated decay. Drugs (for instance aminoglycosides) can be designed to suppress premature termination, inducing a ribosomal readthrough. These findings have introduced new hopes for the development of a pharmacologic approach to the cure of this disease. However, the effects of aminoglycosides on globin mRNA carrying β-thalassemia stop mutations have not yet been investigated. In this study, we have used a lentiviral construct containing the β039- thalassemia globin gene under control of the β-globin promoter and a LCR cassette. We demonstrated by fluorescence-activated cell sorting (FACS) analysis the production of β-globin by K562 cell clones expressing the β039-thalassemia globin gene and treated with G418. More importantly, after FACS and high-performance liquid chromatography (HPLC) analyses, erythroid precursor cells from β039-thalassemia patients were demonstrated to be able to produce β-globin and adult hemoglobin after treatment with G418. This study strongly suggests that ribosomal readthrough should be considered a strategy for developing experimental strategies for the treatment of β0-thalassemia caused by stop codon mutations. PMID:19810011

  17. Progenitor outgrowth from the niche in Drosophila trachea is guided by FGF from decaying branches.

    Science.gov (United States)

    Chen, Feng; Krasnow, Mark A

    2014-01-10

    Although there has been progress identifying adult stem and progenitor cells and the signals that control their proliferation and differentiation, little is known about the substrates and signals that guide them out of their niche. By examining Drosophila tracheal outgrowth during metamorphosis, we show that progenitors follow a stereotyped path out of the niche, tracking along a subset of tracheal branches destined for destruction. The embryonic tracheal inducer branchless FGF (fibroblast growth factor) is expressed dynamically just ahead of progenitor outgrowth in decaying branches. Knockdown of branchless abrogates progenitor outgrowth, whereas misexpression redirects it. Thus, reactivation of an embryonic tracheal inducer in decaying branches directs outgrowth of progenitors that replace them. This explains how the structure of a newly generated tissue is coordinated with that of the old.

  18. Adaptive remodeling of the biliary tree: the essence of liver progenitor cell expansion.

    Science.gov (United States)

    Kok, Cindy Yuet-Yin; Miyajima, Atsushi; Itoh, Tohru

    2015-07-01

    The liver progenitor cell population has long been thought to exist within the liver. However, there are no standardized criteria for defining the liver progenitor cells, and there has been intense debate about the origin of these cells in the adult liver. The characteristics of such cells vary depending on the disease model used and also on the method of analysis. Visualization of three-dimensional biliary structures has revealed that the emergence of liver progenitor cells essentially reflects the adaptive remodeling of the hepatic biliary network in response to liver injury. We propose that the progenitor cell exists as a subpopulation in the biliary tree and show that the appearance of liver progenitor cells in injured parenchyma is reflective of extensive remodeling of the biliary structure. © 2015 Japanese Society of Hepato-Biliary-Pancreatic Surgery.

  19. Nf2-Yap signaling controls the expansion of DRG progenitors and glia during DRG development.

    Science.gov (United States)

    Serinagaoglu, Yelda; Paré, Joshua; Giovannini, Marco; Cao, Xinwei

    2015-02-01

    Molecular mechanisms governing the maintenance and proliferation of dorsal root ganglia (DRG) progenitors are largely unknown. Here we reveal that the Hippo pathway regulates the expansion of DRG progenitors and glia during mammalian DRG development. The key effectors of this pathway, transcriptional coactivators Yap and Taz, are expressed in DRG progenitors and glia during DRG development but are at least partially inhibited from activating transcription. Aberrant YAP activation leads to overexpansion of DRG progenitor and glial populations. We further show that the Neurofibromatosis 2 (Nf2) tumor suppressor inhibits Yap during DRG development. Loss of Nf2 leads to similar phenotypes as does YAP hyperactivation, and deleting Yap suppresses these phenotypes. Our study demonstrates that Nf2-Yap signaling plays important roles in controlling the expansion of DRG progenitors and glia during DRG development. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. Gdf5 progenitors give rise to fibrocartilage cells that mineralize via hedgehog signaling to form the zonal enthesis.

    Science.gov (United States)

    Dyment, Nathaniel A; Breidenbach, Andrew P; Schwartz, Andrea G; Russell, Ryan P; Aschbacher-Smith, Lindsey; Liu, Han; Hagiwara, Yusuke; Jiang, Rulang; Thomopoulos, Stavros; Butler, David L; Rowe, David W

    2015-09-01

    The sequence of events that leads to the formation of a functionally graded enthesis is not clearly defined. The current study demonstrates that clonal expansion of Gdf5 progenitors contributes to linear growth of the enthesis. Prior to mineralization, Col1+ cells in the enthesis appose Col2+ cells of the underlying primary cartilage. At the onset of enthesis mineralization, cells at the base of the enthesis express alkaline phosphatase, Indian hedgehog, and ColX as they mineralize. The mineralization front then extends towards the tendon midsubstance as cells above the front become encapsulated in mineralized fibrocartilage over time. The hedgehog (Hh) pathway regulates this process, as Hh-responsive Gli1+ cells within the developing enthesis mature from unmineralized to mineralized fibrochondrocytes in response to activated signaling. Hh signaling is required for mineralization, as tissue-specific deletion of its obligate transducer Smoothened in the developing tendon and enthesis cells leads to significant reductions in the apposition of mineralized fibrocartilage. Together, these findings provide a spatiotemporal map of events - from expansion of the embryonic progenitor pool to synthesis of the collagen template and finally mineralization of this template - that leads to the formation of the mature zonal enthesis. These results can inform future tendon-to-bone repair strategies to create a mechanically functional enthesis in which tendon collagen fibers are anchored to bone through mineralized fibrocartilage. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. File list: Oth.Neu.05.AllAg.Fetal_neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Neu.05.AllAg.Fetal_neural_progenitor_cells hg19 TFs and others Neural Fetal neural progeni...tor cells SRX109477 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.05.AllAg.Fetal_neural_progenitor_cells.bed ...

  2. File list: InP.Neu.50.AllAg.Fetal_neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available InP.Neu.50.AllAg.Fetal_neural_progenitor_cells hg19 Input control Neural Fetal neural progeni...tor cells SRX109478 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/InP.Neu.50.AllAg.Fetal_neural_progenitor_cells.bed ...

  3. File list: InP.Neu.20.AllAg.Neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available InP.Neu.20.AllAg.Neural_progenitor_cells mm9 Input control Neural Neural progenitor... cells SRX109476,SRX315272,SRX315273,SRX109475,SRX668239,SRX667382 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/InP.Neu.20.AllAg.Neural_progenitor_cells.bed ...

  4. File list: ALL.Neu.50.AllAg.Fetal_neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ALL.Neu.50.AllAg.Fetal_neural_progenitor_cells hg19 All antigens Neural Fetal neural progeni...tor cells SRX109477,SRX109478 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/ALL.Neu.50.AllAg.Fetal_neural_progenitor_cells.bed ...

  5. File list: NoD.Adp.20.AllAg.Adipose_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available NoD.Adp.20.AllAg.Adipose_progenitor_cells mm9 No description Adipocyte Adipose progeni...tor cells http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/NoD.Adp.20.AllAg.Adipose_progenitor_cells.bed ...

  6. File list: Pol.Neu.05.AllAg.Fetal_neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Neu.05.AllAg.Fetal_neural_progenitor_cells hg19 RNA polymerase Neural Fetal neural progeni...tor cells http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Neu.05.AllAg.Fetal_neural_progenitor_cells.bed ...

  7. File list: ALL.Neu.10.AllAg.Fetal_neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ALL.Neu.10.AllAg.Fetal_neural_progenitor_cells hg19 All antigens Neural Fetal neural progeni...tor cells SRX109477,SRX109478 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/ALL.Neu.10.AllAg.Fetal_neural_progenitor_cells.bed ...

  8. File list: DNS.Neu.20.AllAg.Fetal_neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available DNS.Neu.20.AllAg.Fetal_neural_progenitor_cells hg19 DNase-seq Neural Fetal neural progeni...tor cells http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/DNS.Neu.20.AllAg.Fetal_neural_progenitor_cells.bed ...

  9. File list: Unc.Neu.50.AllAg.Fetal_neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Neu.50.AllAg.Fetal_neural_progenitor_cells hg19 Unclassified Neural Fetal neural progeni...tor cells http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Unc.Neu.50.AllAg.Fetal_neural_progenitor_cells.bed ...

  10. File list: InP.Adp.05.AllAg.Adipose_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available InP.Adp.05.AllAg.Adipose_progenitor_cells mm9 Input control Adipocyte Adipose progeni...tor cells SRX127367,SRX127370 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/InP.Adp.05.AllAg.Adipose_progenitor_cells.bed ...

  11. File list: InP.Adp.20.AllAg.Adipose_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available InP.Adp.20.AllAg.Adipose_progenitor_cells mm9 Input control Adipocyte Adipose progeni...tor cells SRX127370,SRX127367 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/InP.Adp.20.AllAg.Adipose_progenitor_cells.bed ...

  12. File list: Pol.Neu.10.AllAg.Fetal_neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Neu.10.AllAg.Fetal_neural_progenitor_cells hg19 RNA polymerase Neural Fetal neural progeni...tor cells http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Neu.10.AllAg.Fetal_neural_progenitor_cells.bed ...

  13. File list: InP.Neu.10.AllAg.Neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available InP.Neu.10.AllAg.Neural_progenitor_cells mm9 Input control Neural Neural progenitor... cells SRX109476,SRX315272,SRX315273,SRX109475,SRX667382,SRX668239 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/InP.Neu.10.AllAg.Neural_progenitor_cells.bed ...

  14. File list: NoD.Neu.50.AllAg.Fetal_neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available NoD.Neu.50.AllAg.Fetal_neural_progenitor_cells hg19 No description Neural Fetal neural progeni...tor cells http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/NoD.Neu.50.AllAg.Fetal_neural_progenitor_cells.bed ...

  15. File list: NoD.Adp.50.AllAg.Adipose_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available NoD.Adp.50.AllAg.Adipose_progenitor_cells mm9 No description Adipocyte Adipose progeni...tor cells http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/NoD.Adp.50.AllAg.Adipose_progenitor_cells.bed ...

  16. File list: NoD.Adp.05.AllAg.Adipose_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available NoD.Adp.05.AllAg.Adipose_progenitor_cells mm9 No description Adipocyte Adipose progeni...tor cells http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/NoD.Adp.05.AllAg.Adipose_progenitor_cells.bed ...

  17. File list: InP.Neu.20.AllAg.Fetal_neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available InP.Neu.20.AllAg.Fetal_neural_progenitor_cells hg19 Input control Neural Fetal neural progeni...tor cells SRX109478 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/InP.Neu.20.AllAg.Fetal_neural_progenitor_cells.bed ...

  18. File list: InP.Adp.50.AllAg.Adipose_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available InP.Adp.50.AllAg.Adipose_progenitor_cells mm9 Input control Adipocyte Adipose progeni...tor cells SRX127370,SRX127367 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/InP.Adp.50.AllAg.Adipose_progenitor_cells.bed ...

  19. File list: NoD.Oth.05.AllAg.Multipotent_otic_progenitor [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available NoD.Oth.05.AllAg.Multipotent_otic_progenitor mm9 No description Others Multipotent otic progeni...tor http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/NoD.Oth.05.AllAg.Multipotent_otic_progenitor.bed ...

  20. File list: DNS.Neu.50.AllAg.Fetal_neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available DNS.Neu.50.AllAg.Fetal_neural_progenitor_cells hg19 DNase-seq Neural Fetal neural progeni...tor cells http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/DNS.Neu.50.AllAg.Fetal_neural_progenitor_cells.bed ...

  1. File list: InP.Neu.05.AllAg.Neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available InP.Neu.05.AllAg.Neural_progenitor_cells mm9 Input control Neural Neural progenitor... cells SRX109476,SRX667382,SRX109475,SRX315272,SRX315273,SRX668239 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/InP.Neu.05.AllAg.Neural_progenitor_cells.bed ...

  2. File list: Unc.Neu.10.AllAg.Fetal_neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Neu.10.AllAg.Fetal_neural_progenitor_cells hg19 Unclassified Neural Fetal neural... progenitor cells http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Unc.Neu.10.AllAg.Fetal_neural_progenitor_cells.bed ...

  3. File list: Oth.Neu.20.AllAg.Fetal_neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Neu.20.AllAg.Fetal_neural_progenitor_cells hg19 TFs and others Neural Fetal neural... progenitor cells SRX109477 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.20.AllAg.Fetal_neural_progenitor_cells.bed ...

  4. File list: His.Neu.10.AllAg.Fetal_neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available His.Neu.10.AllAg.Fetal_neural_progenitor_cells hg19 Histone Neural Fetal neural pro...genitor cells http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/His.Neu.10.AllAg.Fetal_neural_progenitor_cells.bed ...

  5. File list: InP.Neu.05.AllAg.Fetal_neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available InP.Neu.05.AllAg.Fetal_neural_progenitor_cells hg19 Input control Neural Fetal neural... progenitor cells SRX109478 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/InP.Neu.05.AllAg.Fetal_neural_progenitor_cells.bed ...

  6. File list: Pol.Neu.20.AllAg.Fetal_neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Neu.20.AllAg.Fetal_neural_progenitor_cells hg19 RNA polymerase Neural Fetal neural... progenitor cells http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Neu.20.AllAg.Fetal_neural_progenitor_cells.bed ...

  7. File list: Oth.Neu.50.AllAg.Fetal_neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Neu.50.AllAg.Fetal_neural_progenitor_cells hg19 TFs and others Neural Fetal neural... progenitor cells SRX109477 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.50.AllAg.Fetal_neural_progenitor_cells.bed ...

  8. File list: NoD.Neu.20.AllAg.Fetal_neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available NoD.Neu.20.AllAg.Fetal_neural_progenitor_cells hg19 No description Neural Fetal neural... progenitor cells http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/NoD.Neu.20.AllAg.Fetal_neural_progenitor_cells.bed ...

  9. File list: InP.Neu.20.AllAg.Induced_neural_progenitors [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available InP.Neu.20.AllAg.Induced_neural_progenitors mm9 Input control Neural Induced neural... progenitors SRX323563,SRX323574,SRX667380,SRX668238 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/InP.Neu.20.AllAg.Induced_neural_progenitors.bed ...

  10. File list: Pol.Neu.50.AllAg.Fetal_neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Neu.50.AllAg.Fetal_neural_progenitor_cells hg19 RNA polymerase Neural Fetal neural... progenitor cells http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Neu.50.AllAg.Fetal_neural_progenitor_cells.bed ...

  11. File list: NoD.Neu.20.AllAg.Induced_neural_progenitors [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available NoD.Neu.20.AllAg.Induced_neural_progenitors mm9 No description Neural Induced neural... progenitors http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/NoD.Neu.20.AllAg.Induced_neural_progenitors.bed ...

  12. File list: ALL.Neu.05.AllAg.Fetal_neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ALL.Neu.05.AllAg.Fetal_neural_progenitor_cells hg19 All antigens Neural Fetal neural... progenitor cells SRX109477,SRX109478 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/ALL.Neu.05.AllAg.Fetal_neural_progenitor_cells.bed ...

  13. File list: InP.Neu.50.AllAg.Induced_neural_progenitors [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available InP.Neu.50.AllAg.Induced_neural_progenitors mm9 Input control Neural Induced neural... progenitors SRX323563,SRX323574,SRX667380,SRX668238 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/InP.Neu.50.AllAg.Induced_neural_progenitors.bed ...

  14. File list: InP.Neu.10.AllAg.Induced_neural_progenitors [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available InP.Neu.10.AllAg.Induced_neural_progenitors mm9 Input control Neural Induced neural... progenitors SRX668238,SRX667380,SRX323563,SRX323574 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/InP.Neu.10.AllAg.Induced_neural_progenitors.bed ...

  15. File list: NoD.Neu.05.AllAg.Induced_neural_progenitors [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available NoD.Neu.05.AllAg.Induced_neural_progenitors mm9 No description Neural Induced neural... progenitors http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/NoD.Neu.05.AllAg.Induced_neural_progenitors.bed ...

  16. File list: InP.Neu.05.AllAg.Induced_neural_progenitors [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available InP.Neu.05.AllAg.Induced_neural_progenitors mm9 Input control Neural Induced neural... progenitors SRX667380,SRX668238,SRX323563,SRX323574 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/InP.Neu.05.AllAg.Induced_neural_progenitors.bed ...

  17. File list: Unc.Neu.05.AllAg.Fetal_neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Neu.05.AllAg.Fetal_neural_progenitor_cells hg19 Unclassified Neural Fetal neural... progenitor cells http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Unc.Neu.05.AllAg.Fetal_neural_progenitor_cells.bed ...

  18. File list: His.Neu.50.AllAg.Fetal_neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available His.Neu.50.AllAg.Fetal_neural_progenitor_cells hg19 Histone Neural Fetal neural pro...genitor cells http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/His.Neu.50.AllAg.Fetal_neural_progenitor_cells.bed ...

  19. File list: His.Neu.20.AllAg.Fetal_neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available His.Neu.20.AllAg.Fetal_neural_progenitor_cells hg19 Histone Neural Fetal neural pro...genitor cells http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/His.Neu.20.AllAg.Fetal_neural_progenitor_cells.bed ...

  20. File list: NoD.Neu.05.AllAg.Fetal_neural_progenitor_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available NoD.Neu.05.AllAg.Fetal_neural_progenitor_cells hg19 No description Neural Fetal neural... progenitor cells http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/NoD.Neu.05.AllAg.Fetal_neural_progenitor_cells.bed ...

  1. File list: NoD.Neu.10.AllAg.Induced_neural_progenitors [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available NoD.Neu.10.AllAg.Induced_neural_progenitors mm9 No description Neural Induced neural... progenitors http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/NoD.Neu.10.AllAg.Induced_neural_progenitors.bed ...

  2. Erythropoietin Receptor Positive Circulating Progenitor Cells and Endothelial Progenitor Cells in Patients with Different Stages of Diabetic Retinopathy

    Institute of Scientific and Technical Information of China (English)

    Liu-mei Hu; Guo-xu Xu; Guo-tong XU; Wei-ye Li; Xia Lei; Bo Ma; Yu Zhang; Yan Yan; Ya-lan Wu; Ge-zhi Xu; Wen Ye; Ling Wang

    2011-01-01

    Objective To investigate the possible involvement of erythropoietin (EPO)/erythropoietin receptor(EPOR) system in neovascularization and vascular regeneration in diabetic retinopathy (DR).Methods EPOR positive circulating progenitor cells (CPCs: CD34+) and endothelial progenitor cells (EPCs: CD34+KDR+) were assessed by flow cytometry in type 2 diabetic patients with different stages of DR. The cohort consisted of age- and sex-matched control patients without diabetes (n=7), non-prolif-erative DR (NPDR, n=7), proliferative DR (PDR, n=8), and PDR complicated with diabetic nephropathy (PDR-DN, n=7). Results The numbers of EPOR+ CPCs and EPOR+ EPCs were reduced remarkably in NPDR compared with the control group (both P<0.01), whereas rebounded in PDR and PDR-DN groups in varying degrees. Similar changes were observed in respect of the proportion of EPOR+ CPCs in CPCs (NPDR vs.control, P< 0.01) and that of EPOR+ EPCs in EPCs (NPDR vs. control, P< 0.05). Conclusion Exogenous EPO, mediated via the EPO/EPOR system of EPCs, may alleviate the im-paired vascular regeneration in NPDR, whereas it might aggravate retinal neovascularization in PDR due to a rebound of EPOR+ EPCs associated with ischemia.

  3. v-erbA overexpression is required to extinguish c-erbA function in erythroid cell differentiation and regulation of the erbA target gene CAII

    DEFF Research Database (Denmark)

    Disela, C; Glineur, C; Bugge, T

    1991-01-01

    The v-erbA oncoprotein represents a retrovirus-transduced oncogenic version of the thyroid hormone (T3/T4) receptor c-erbA (type alpha). It contributes to virus-induced erythroleukemia by efficiently arresting differentiation of red cell progenitors and by suppressing transcription of erythrocyte...... of this CAII reporter construct could only be suppressed by very high amounts of v-erbA. Our results suggest that overexpression of v-erbA is required for its function as an oncoprotein....

  4. TRASTORNOS DEL ESPECTRO AUTISTA Y EXPOSICIONES OCUPACIONALES DE LOS PROGENITORES

    Directory of Open Access Journals (Sweden)

    Manuel Pino-López

    2013-01-01

    Full Text Available Fundamentos: Estudios con hermanos y gemelos sugieren un componente genético en el origen del autismo que no explica su crecimiento actual. El objetivo es investigar si factores ambientales como algunas exposiciones profesionales (trabajo nocturno, manejo de disolventes y/o campos electromagnéticos incrementan la probabilidad de trastornos del espectro autista (TEA en los hijos. Métodos: Estudio observacional de casos y controles mediante análisis de expedientes de 206 niños entre 16 y 36 meses de edad evaluados en el Servicio de Atención Temprana de Ciudad Real (70 con TEA y 136 no afectados. Para medir el riesgo de TEA asociado al trabajo nocturno, con disolventes y/o campos electromagnéticos se calculó la odds ratio (OR con un intervalo de confianza (IC del 95%. Resultados: El riesgo de TEA se multiplica por 2,22 cuando un progenitor trabaja en las ocupaciones estudiadas (OR=2,22, IC 95%=1,42-3,48, destacando trabajo con disolventes (OR=2,81, IC 95%=1,28-6,17 y nocturno (OR=2,18, IC 95%=1,21-3,93. El riesgo se multiplica por 3 si la madre trabaja en estas ocupaciones (OR=3, IC95%=1,44-6,26, destacando trabajo nocturno (OR=3,47, IC 95%=1,39-8,63 y con disolventes (OR=2,88, IC 95%=1,28-6,17. El riesgo se multiplica por 1,94 si el padre trabaja en estas ocupaciones(OR=1,94, IC 95%=1,07-3,53 y por 2,81 con disolventes (OR=2,81, IC 95%=1,01-7,86. Se encontró asociación positiva entre nivel educativo de los progenitores y TEA. Conclusiones: Encontramos relación significativa entre exposición de los progenitores a los riesgos estudiados y TEA en los hijos. Los resultados sugieren la participación de alteraciones genéticas ocasionadas por factores ambientales en el origen del trastorno.

  5. Functional evaluation of circulating hematopoietic progenitors in Noonan syndrome

    Science.gov (United States)

    TIMEUS, FABIO; CRESCENZIO, NICOLETTA; BALDASSARRE, GIUSEPPINA; DORIA, ALESSANDRA; VALLERO, STEFANO; FOGLIA, LUISELDA; PAGLIANO, SARA; ROSSI, CESARE; SILENGO, MARGHERITA CIRILLO; RAMENGHI, UGO; FAGIOLI, FRANCA; DI MONTEZEMOLO, LUCA CORDERO; FERRERO, GIOVANNI BATTISTA

    2013-01-01

    Noonan syndrome (NS) is an autosomal dominant disorder, characterized by short stature, multiple dysmorphisms and congenital heart defects. A myeloproliferative disorder (NS/MPD), resembling juvenile myelomonocytic leukemia (JMML), is occasionally diagnosed in infants with NS. In the present study, we performed a functional evaluation of the circulating hematopoietic progenitors in a series of NS, NS/MPD and JMML patients. The different functional patterns were compared with the aim to identify a possible NS subgroup worthy of stringent hematological follow-up for an increased risk of MPD development. We studied 27 NS and 5 JMML patients fulfilling EWOG-MDS criteria. The more frequent molecular defects observed in NS were mutations in the PTPN11 and SOS genes. The absolute count of monocytes, circulating CD34+ hematopoietic progenitors, their apoptotic rate and the number of circulating CFU-GMs cultured in the presence of decreasing concentrations or in the absence of granulocyte-macrophage colony-stimulating factor (GM-CSF) were evaluated. All JMML patients showed monocytosis >1,000/μl. Ten out of the 27 NS patients showed monocytosis >1,000/μl, which included the 3 NS/MPD patients. In JMML patients, circulating CD34+ cells were significantly increased (median, 109.8/μl; range, 44–232) with a low rate of apoptosis (median, 2.1%; range, 0.4–12.1%), and circulating CFU-GMs were hyper-responsive to GM-CSF. NS/MPD patients showed the same flow cytometric pattern as the JMML patients (median, CD34+ cells/μl, 205.7; range, 58–1374; median apoptotic rate, 1.4%; range, 0.2–2.4%) and their circulating CFU-GMs were hyper-responsive to GM-CSF. These functional alterations appeared 10 months before the typical clinical manifestations in 1 NS/MPD patient. In NS, the CD34+ absolute cell count and circulating CFU-GMs showed a normal pattern (median CD34+ cells/μl, 4.9; range, 1.3–17.5), whereas the CD34+ cell apoptotic rate was significantly decreased in

  6. Analysis of neural progenitors from embryogenesis to juvenile adult in Xenopus laevis reveals biphasic neurogenesis and continuous lengthening of the cell cycle

    Directory of Open Access Journals (Sweden)

    Raphaël Thuret

    2015-12-01

    Full Text Available Xenopus laevis is a prominent model system for studying neural development, but our understanding of the long-term temporal dynamics of neurogenesis remains incomplete. Here, we present the first continuous description of neurogenesis in X. laevis, covering the entire period of development from the specification of neural ectoderm during gastrulation to juvenile frog. We have used molecular markers to identify progenitors and neurons, short-term bromodeoxyuridine (BrdU incorporation to map the generation of newborn neurons and dual pulse S-phase labelling to characterise changes in their cell cycle length. Our study revealed the persistence of Sox3-positive progenitor cells from the earliest stages of neural development through to the juvenile adult. Two periods of intense neuronal generation were observed, confirming the existence of primary and secondary waves of neurogenesis, punctuated by a period of quiescence before metamorphosis and culminating in another period of quiescence in the young adult. Analysis of multiple parameters indicates that neural progenitors alternate between global phases of differentiation and amplification and that, regardless of their behaviour, their cell cycle lengthens monotonically during development, at least at the population level.

  7. [Acute lymphoblastic leukemia of T progenitors: from biology to clinics].

    Science.gov (United States)

    Genescà, Eulàlia; Ribera, Jordi; Ribera, Josep-Maria

    2015-03-09

    Acute lymphoblastic leukemia (ALL) is the most common cancer in children and the main cause of morbidity among childhood blood disorders. There are 2 subtypes according to the affected lymphoid progenitor: B-ALL and T-ALL. The T-ALL is the less common and, although historically was associated with poor prognosis in both adults and children, at present, treatment outcomes do not differ significantly between the 2 types of ALL. The T-ALL subtype is the most complex and heterogeneous at the genetic level and currently the one with less new therapeutic alternatives available. This trend is changing thanks to the remarkable progress upon understanding its biology. This review summarizes the most recent and important biological findings in T-ALL and their possible therapeutic implications. Copyright © 2013 Elsevier España, S.L.U. All rights reserved.

  8. Fibro/Adipogenic Progenitors (FAPs): Isolation by FACS and Culture.

    Science.gov (United States)

    Low, Marcela; Eisner, Christine; Rossi, Fabio

    2017-01-01

    Fibro/adipogenic progenitors (FAPs ) are tissue-resident mesenchymal stromal cells (MSCs). Current literature supports a role for these cells in the homeostasis and repair of multiple tissues suggesting that FAPs may have extensive therapeutic potential in the treatment of numerous diseases. In this context, it is crucial to establish efficient and reproducible procedures to purify FAP populations from various tissues. Here, we describe a protocol for the isolation and cell culture of FAPs from murine skeletal muscle using fluorescence -activated cell sorting (FACS), which is particularly useful for experiments where high cell purity is an essential requirement. Identification, isolation, and cell culture of FAPs represent powerful tools that will help us to understand the role of these cells in different conditions and facilitate the development of safe and effective new treatments for diseases.

  9. Sphingosine-1-Phosphate (S1P) Signaling in Neural Progenitors.

    Science.gov (United States)

    Callihan, Phillip; Alqinyah, Mohammed; Hooks, Shelley B

    2018-01-01

    Sphingosine-1-phosphate (S1P) and its receptors are important in nervous system development. Reliable in vitro human model systems are needed to further define specific roles for S1P signaling in neural development. We have described S1P-regulated signaling, survival, and differentiation in a human embryonic stem cell-derived neuroepithelial progenitor cell line (hNP1) that expresses functional S1P receptors. These cells can be further differentiated to a neuronal cell type and therefore represent a good model system to study the role of S1P signaling in human neural development. The following sections describe in detail the culture and differentiation of hNP1 cells and two assays to measure S1P signaling in these cells.

  10. Imaging retinal progenitor lineages in developing zebrafish embryos.

    Science.gov (United States)

    Jusuf, Patricia; Harris, William A; Poggi, Lucia

    2013-03-01

    In this protocol, we describe how to make and analyze four dimensional (4D) movies of retinal lineage in the zebrafish embryo in vivo. 4D consists of three spatial dimensions (3D) reconstructed from stacks of confocal planes plus one time dimension. Our imaging is performed on transgenic cells that express fluorescent proteins under the control of cell-specific promoters or on cells that transiently express such reporters in specific retinal cell progenitors. An important aspect of lineage tracing is the ability to follow individual cells as they undergo multiple cell divisions, final migration, and differentiation. This may mean many hours of 4D imaging, requiring that cells be kept healthy and maintained under conditions suitable for normal development. The longest movies we have made are ∼50 h. By analyzing these movies, we can see when a specific cell was born and who its sister was, allowing us to reconstruct its retinal lineages in vivo.

  11. Relationship between spontaneous γH2AX foci formation and progenitor functions in circulating hematopoietic stem and progenitor cells among atomic-bomb survivors.

    Science.gov (United States)

    Kajimura, Junko; Kyoizumi, Seishi; Kubo, Yoshiko; Misumi, Munechika; Yoshida, Kengo; Hayashi, Tomonori; Imai, Kazue; Ohishi, Waka; Nakachi, Kei; Weng, Nan-Ping; Young, Lauren F; Shieh, Jae-Hung; Moore, Malcolm A; van den Brink, Marcel R M; Kusunoki, Yoichiro

    2016-05-01

    Accumulated DNA damage in hematopoietic stem cells is a primary mechanism of aging-associated dysfunction in human hematopoiesis. About 70 years ago, atomic-bomb (A-bomb) radiation induced DNA damage and functional decreases in the hematopoietic system of A-bomb survivors in a radiation dose-dependent manner. The peripheral blood cell populations then recovered to a normal range, but accompanying cells derived from hematopoietic stem cells still remain that bear molecular changes possibly caused by past radiation exposure and aging. In the present study, we evaluated radiation-related changes in the frequency of phosphorylated (Ser-139) H2AX (γH2AX) foci formation in circulating CD34-positive/lineage marker-negative (CD34+Lin-) hematopoietic stem and progenitor cells (HSPCs) among 226Hiroshima A-bomb survivors. An association between the frequency of γH2AX foci formation in HSPCs and the radiation dose was observed, but the γH2AX foci frequency was not significantly elevated by past radiation. We found a negative correlation between the frequency of γH2AX foci formation and the length of granulocyte telomeres. A negative interaction effect between the radiation dose and the frequency of γH2AX foci was suggested in a proportion of a subset of HSPCs as assessed by the cobblestone area-forming cell assay (CAFC), indicating that the self-renewability of HSPCs may decrease in survivors who were exposed to a higher radiation dose and who had more DNA damage in their HSPCs. Thus, although many years after radiation exposure and with advancing age, the effect of DNA damage on the self-renewability of HSPCs may be modified by A-bomb radiation exposure. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Protein-energy malnutrition halts hemopoietic progenitor cells in the G0/G1 cell cycle stage, thereby altering cell production rates

    Directory of Open Access Journals (Sweden)

    P. Borelli

    2009-06-01

    Full Text Available Protein energy malnutrition (PEM is a syndrome that often results in immunodeficiency coupled with pancytopenia. Hemopoietic tissue requires a high nutrient supply and the proliferation, differentiation and maturation of cells occur in a constant and balanced manner, sensitive to the demands of specific cell lineages and dependent on the stem cell population. In the present study, we evaluated the effect of PEM on some aspects of hemopoiesis, analyzing the cell cycle of bone marrow cells and the percentage of progenitor cells in the bone marrow. Two-month-old male Swiss mice (N = 7-9 per group were submitted to PEM with a low-protein diet (4% or were fed a control diet (20% protein ad libitum. When the experimental group had lost about 20% of their original body weight after 14 days, we collected blood and bone marrow cells to determine the percentage of progenitor cells and the number of cells in each phase of the cell cycle. Animals of both groups were stimulated with 5-fluorouracil. Blood analysis, bone marrow cell composition and cell cycle evaluation was performed after 10 days. Malnourished animals presented anemia, reticulocytopenia and leukopenia. Their bone marrow was hypocellular and depleted of progenitor cells. Malnourished animals also presented more cells than normal in phases G0 and G1 of the cell cycle. Thus, we conclude that PEM leads to the depletion of progenitor hemopoietic populations and changes in cellular development. We suggest that these changes are some of the primary causes of pancytopenia in cases of PEM.

  13. Detection of Quiescent Radioresistant Epithelial Progenitors in the Adult Thymus

    Directory of Open Access Journals (Sweden)

    Maude Dumont-Lagacé

    2017-12-01

    Full Text Available Thymic aging precedes that of other organs and is initiated by the gradual loss of thymic epithelial cells (TECs. Based on in vitro culture and transplantation assays, recent studies have reported on the presence of thymic epithelial progenitor cells (TEPCs in young adult mice. However, the physiological role and properties of TEPC populations reported to date remain unclear. Using an in vivo label-retention assay, we previously identified a population of quiescent but non-senescent TECs. The goals of this study were therefore (i to evaluate the contribution of these quiescent TECs to thymic regeneration following irradiation-induced acute thymic injury and (ii to characterize their phenotypic and molecular profiles using flow cytometry, immunohistology, and transcriptome sequencing. We report that while UEA1+ cells cycle the most in steady state, they are greatly affected by irradiation, leading to cell loss and proliferative arrest following acute thymic involution. On the opposite, the UEA1– subset of quiescent TECs is radioresistant and proliferate in situ following acute thymic involution, thereby contributing to thymic regeneration in 28- to 30-week-old mice. UEA1– quiescent TECs display an undifferentiated phenotype (co-expression of K8 and K5 cytokeratins and express high levels of genes that regulate stem cell activity in different tissues (e.g., Podxl and Ptprz1. In addition, two features suggest that UEA1– quiescent TECs occupy discrete stromal niches: (i their preferential location in clusters adjacent to the cortico-medullary junction and (ii their high expression of genes involved in cross talk with mesenchymal cells. The ability of UEA1– quiescent TECs to participate to TEC regeneration qualifies them as in vivo progenitor cells particularly relevant in the context of regeneration following acute thymic injury.

  14. Presence of stem/progenitor cells in the rat penis.

    Science.gov (United States)

    Lin, Guiting; Alwaal, Amjad; Zhang, Xiaoyu; Wang, Jianwen; Wang, Lin; Li, Huixi; Wang, Guifang; Ning, Hongxiu; Lin, Ching-Shwun; Xin, Zhongcheng; Lue, Tom F

    2015-01-15

    Tissue resident stem cells are believed to exist in every organ, and their identification is commonly done using a combination of immunostaining for putative stem cell markers and label-retaining cell (LRC) strategy. In this study, we employed these approaches to identify potential stem cells in the penis. Newborn rats were intraperitoneally injected with thymidine analog, 5-ethynyl-2-deoxyuridine (EdU), and their penis was harvested at 7 h, 3 days, 1 week, and 4 weeks. It was processed for EdU stains and immunofluorescence staining for stem cell markers A2B5, PCNA, and c-kit. EdU-positive cells were counted for each time point and co-localized with each stem cell marker, then isolated and cultured in vitro followed by their characterization using flowcytometry and immunofluorescence. At 7 h post-EdU injection, 410 ± 105.3 penile corporal cells were labeled in each cross-section (∼28%). The number of EdU-positive cells at 3 days increased to 536 ± 115.6, while their percentage dropped to 25%. Progressively fewer EdU-positive cells were present in the sacrificed rat penis at longer time points (1 and 4 weeks). They were mainly distributed in the subtunic and perisinusoidal spaces, and defined as subtunic penile progenitor cells (STPCs) and perisinusoidal penile progenitor cells (PPCs). These cells expressed c-kit, A2B5, and PCNA. After culturing in vitro, only ∼0.324% corporal cells were EdU-labeled LRCs and expressed A2B5/PCNA. Therefore, labeling of penis cells by EdU occurred randomly, and label retaining was not associated with expression of c-kit, A2B5, or PCNA. The penile LRCs are mainly distributed within the subtunic and perisinusoidal space.

  15. Progenitors of low-luminosity Type II-Plateau supernovae

    Science.gov (United States)

    Lisakov, Sergey M.; Dessart, Luc; Hillier, D. John; Waldman, Roni; Livne, Eli

    2018-01-01

    The progenitors of low-luminosity Type II-Plateau supernovae (SNe II-P) are believed to be red supergiant (RSG) stars, but there is much disparity in the literature concerning their mass at core collapse and therefore on the main sequence. Here, we model the SN radiation arising from the low-energy explosion of RSG stars of 12, 25 and 27 M⊙ on the main sequence and formed through single star evolution. Despite the narrow range in ejecta kinetic energy (2.5-4.2 × 1050 erg) in our model set, the SN observables from our three models are significantly distinct, reflecting the differences in progenitor structure (e.g. surface radius, H-rich envelope mass and He-core mass). Our higher mass RSG stars give rise to Type II SNe that tend to have bluer colours at early times, a shorter photospheric phase, and a faster declining V-band light curve (LC) more typical of Type II-linear SNe, in conflict with the LC plateau observed for low-luminosity SNe II. The complete fallback of the CO core in the low-energy explosions of our high-mass RSG stars prevents the ejection of any 56Ni (nor any core O or Si), in contrast to low-luminosity SNe II-P, which eject at least 0.001 M⊙ of 56Ni. In contrast to observations, Type II SN models from higher mass RSGs tend to show an H α absorption that remains broad at late times (due to a larger velocity at the base of the H-rich envelope). In agreement with the analyses of pre-explosion photometry, we conclude that low-luminosity SNe II-P likely arise from low-mass rather than high-mass RSG stars.

  16. Two populations of progenitors for Type Ia supernovae?

    Science.gov (United States)

    Mannucci, F.; Della Valle, M.; Panagia, N.

    2006-08-01

    We use recent observations of the evolution of the Type Ia supernova (SN Ia) rate with redshift, the dependence of the SN Ia rate on the colours of the parent galaxies, and the enhancement of the SN Ia rate in radio-loud early-type galaxies to derive on robust empirical grounds, the delay time distribution (DTD) between the formation of the progenitor star and its explosion as an SN. Our analysis finds: (i) delay times as long as 3-4 Gyr, derived from observations of SNe Ia at high redshift, cannot reproduce the dependence of the SN Ia rate on the colours and on the radio-luminosity of the parent galaxies, as observed in the local Universe; (ii) the comparison between observed SN rates and a grid of theoretical `single-population' DTDs shows that only a few of them are possibly consistent with observations. The most successful models are all predicting a peak of SN explosions soon after star formation and an extended tail in the DTD, and can reproduce the data but only at a modest statistical confidence level; (iii) present data are best matched by a bimodal DTD, in which about 50 per cent of SNe Ia (dubbed `prompt' SNe Ia) explode soon after their stellar birth, in a time of the order of 108 yr, while the remaining 50 per cent (`tardy' SNe Ia) have a much wider distribution, well described by an exponential function with a decay time of about 3 Gyr. The presence in the DTD of both a strong peak at early times and a prolonged exponential tail, coupled with the well-established bimodal distribution of the decay rate (Δm15) and the systematic difference observed in the expansion velocities of the ejecta of SNe Ia in ellipticals and spirals, suggests the existence of two classes of progenitors. We discuss the cosmological implications of this result and make simple predictions, which are testable with future instrumentation.

  17. Characterization of vascular endothelial progenitor cells from chicken bone marrow

    Directory of Open Access Journals (Sweden)

    Bai Chunyu

    2012-05-01

    Full Text Available Abstract Background Endothelial progenitor cells (EPC are a type of stem cell used in the treatment of atherosclerosis, vascular injury and regeneration. At present, most of the EPCs studied are from human and mouse, whereas the study of poultry-derived EPCs has rarely been reported. In the present study, chicken bone marrow-derived EPCs were isolated and studied at the cellular level using immunofluorescence and RT-PCR. Results We found that the majority of chicken EPCs were spindle shaped. The growth-curves of chicken EPCs at passages (P 1, -5 and -9 were typically “S”-shaped. The viability of chicken EPCs, before and after cryopreservation was 92.2% and 81.1%, respectively. Thus, cryopreservation had no obvious effects on the viability of chicken EPCs. Dil-ac-LDL and FITC-UAE-1 uptake assays and immunofluorescent detection of the cell surface markers CD34, CD133, VEGFR-2 confirmed that the cells obtained in vitro were EPCs. Observation of endothelial-specific Weibel-Palade bodies using transmission electron microscopy further confirmed that the cells were of endothelial lineage. In addition, chicken EPCs differentiated into endothelial cells and smooth muscle cells upon induction with VEGF and PDGF-BB, respectively, suggesting that the chicken EPCs retained multipotency in vitro. Conclusions These results suggest that chicken EPCs not only have strong self-renewal capacity, but also the potential to differentiate into endothelial and smooth muscle cells. This research provides theoretical basis and experimental evidence for potential therapeutic application of endothelial progenitor cells in the treatment of atherosclerosis, vascular injury and diabetic complications.

  18. PRMT5 is essential for the maintenance of chondrogenic progenitor cells in the limb bud.

    Science.gov (United States)

    Norrie, Jacqueline L; Li, Qiang; Co, Swanie; Huang, Bau-Lin; Ding, Ding; Uy, Jann C; Ji, Zhicheng; Mackem, Susan; Bedford, Mark T; Galli, Antonella; Ji, Hongkai; Vokes, Steven A

    2016-12-15

    During embryonic development, undifferentiated progenitor cells balance the generation of additional progenitor cells with differentiation. Within the developing limb, cartilage cells differentiate from mesodermal progenitors in an ordered process that results in the specification of the correct number of appropriately sized skeletal elements. The internal pathways by which these cells maintain an undifferentiated state while preserving their capacity to differentiate is unknown. Here, we report that the arginine methyltransferase PRMT5 has a crucial role in maintaining progenitor cells. Mouse embryonic buds lacking PRMT5 have severely truncated bones with wispy digits lacking joints. This novel phenotype is caused by widespread cell death that includes mesodermal progenitor cells that have begun to precociously differentiate into cartilage cells. We propose that PRMT5 maintains progenitor cells through its regulation of Bmp4 Intriguingly, adult and embryonic stem cells also require PRMT5 for maintaining pluripotency, suggesting that similar mechanisms might regulate lineage-restricted progenitor cells during organogenesis. © 2016. Published by The Company of Biologists Ltd.

  19. Characterization of Proliferating Neural Progenitors after Spinal Cord Injury in Adult Zebrafish.

    Directory of Open Access Journals (Sweden)

    Subhra Prakash Hui

    Full Text Available Zebrafish can repair their injured brain and spinal cord after injury unlike adult mammalian central nervous system. Any injury to zebrafish spinal cord would lead to increased proliferation and neurogenesis. There are presences of proliferating progenitors from which both neuronal and glial loss can be reversed by appropriately generating new neurons and glia. We have demonstrated the presence of multiple progenitors, which are different types of proliferating populations like Sox2+ neural progenitor, A2B5+ astrocyte/ glial progenitor, NG2+ oligodendrocyte progenitor, radial glia and Schwann cell like progenitor. We analyzed the expression levels of two common markers of dedifferentiation like msx-b and vimentin during regeneration along with some of the pluripotency associated factors to explore the possible role of these two processes. Among the several key factors related to pluripotency, pou5f1 and sox2 are upregulated during regeneration and associated with activation of neural progenitor cells. Uncovering the molecular mechanism for endogenous regeneration of adult zebrafish spinal cord would give us more clues on important targets for future therapeutic approach in mammalian spinal cord repair and regeneration.

  20. SVCT2 vitamin C transporter expression in progenitor cells of the postnatal neurogenic niche

    Science.gov (United States)

    Pastor, Patricia; Cisternas, Pedro; Salazar, Katterine; Silva-Alvarez, Carmen; Oyarce, Karina; Jara, Nery; Espinoza, Francisca; Martínez, Agustín D.; Nualart, Francisco

    2013-01-01

    Known as a critical antioxidant, recent studies suggest that vitamin C plays an important role in stem cell generation, proliferation and differentiation. Vitamin C also enhances neural differentiation during cerebral development, a function that has not been studied in brain precursor cells. We observed that the rat neurogenic niche is structurally organized at day 15 of postnatal development, and proliferation and neural differentiation increase at day 21. In the human brain, a similar subventricular niche was observed at 1-month of postnatal development. Using immunohistochemistry, sodium-vitamin C cotransporter 2 (SVCT2) expression was detected in the subventricular zone (SVZ) and rostral migratory stream (RMS). Low co-distribution of SVCT2 and βIII-tubulin in neuroblasts or type-A cells was detected, and minimal co-localization of SVCT2 and GFAP in type-B or precursor cells was observed. Similar results were obtained in the human neurogenic niche. However, BrdU-positive cells also expressed SVCT2, suggesting a role of vitamin C in neural progenitor proliferation. Primary neurospheres prepared from rat brain and the P19 teratocarcinoma cell line, which forms neurospheres in vitro, were used to analyze the effect of vitamin C in neural stem cells. Both cell types expressed functional SVCT2 in vitro, and ascorbic acid (AA) induced their neural differentiation, increased βIII-tubulin and SVCT2 expression, and amplified vitamin C uptake. PMID:23964197

  1. Cyp26 Enzymes Facilitate Second Heart Field Progenitor Addition and Maintenance of Ventricular Integrity.

    Directory of Open Access Journals (Sweden)

    Ariel B Rydeen

    2016-11-01

    Full Text Available Although retinoic acid (RA teratogenicity has been investigated for decades, the mechanisms underlying RA-induced outflow tract (OFT malformations are not understood. Here, we show zebrafish embryos deficient for Cyp26a1 and Cyp26c1 enzymes, which promote RA degradation, have OFT defects resulting from two mechanisms: first, a failure of second heart field (SHF progenitors to join the OFT, instead contributing to the pharyngeal arch arteries (PAAs, and second, a loss of first heart field (FHF ventricular cardiomyocytes due to disrupted cell polarity and extrusion from the heart tube. Molecularly, excess RA signaling negatively regulates fibroblast growth factor 8a (fgf8a expression and positively regulates matrix metalloproteinase 9 (mmp9 expression. Although restoring Fibroblast growth factor (FGF signaling can partially rescue SHF addition in Cyp26 deficient embryos, attenuating matrix metalloproteinase (MMP function can rescue both ventricular SHF addition and FHF integrity. These novel findings indicate a primary effect of RA-induced OFT defects is disruption of the extracellular environment, which compromises both SHF recruitment and FHF ventricular integrity.

  2. Clonal Heterogeneity in the Neuronal and Glial Differentiation of Dental Pulp Stem/Progenitor Cells

    Directory of Open Access Journals (Sweden)

    Fraser I. Young

    2016-01-01

    Full Text Available Cellular heterogeneity presents an important challenge to the development of cell-based therapies where there is a fundamental requirement for predictable and reproducible outcomes. Transplanted Dental Pulp Stem/Progenitor Cells (DPSCs have demonstrated early promise in experimental models of spinal cord injury and stroke, despite limited evidence of neuronal and glial-like differentiation after transplantation. Here, we report, for the first time, on the ability of single cell-derived clonal cultures of murine DPSCs to differentiate in vitro into immature neuronal-like and oligodendrocyte-like cells. Importantly, only DPSC clones with high nestin mRNA expression levels were found to successfully differentiate into Map2 and NF-positive neuronal-like cells. Neuronally differentiated DPSCs possessed a membrane capacitance comparable with primary cultured striatal neurons and small inward voltage-activated K+ but not outward Na+ currents were recorded suggesting a functionally immature phenotype. Similarly, only high nestin-expressing clones demonstrated the ability to adopt Olig1, Olig2, and MBP-positive immature oligodendrocyte-like phenotype. Together, these results demonstrate that appropriate markers may be used to provide an early indication of the suitability of a cell population for purposes where differentiation into a specific lineage may be beneficial and highlight that further understanding of heterogeneity within mixed cellular populations is required.

  3. Elimination of the geomagnetic field stimulates the proliferation of mouse neural progenitor and stem cells

    Directory of Open Access Journals (Sweden)

    Jing-Peng Fu

    2016-08-01

    Full Text Available Abstract Living organisms are exposed to the geomagnetic field (GMF throughout their lifespan. Elimination of the GMF, resulting in a hypogeomagnetic field (HMF, leads to central nervous system dysfunction and abnormal development in animals. However, the cellular mechanisms underlying these effects have not been identified so far. Here, we show that exposure to an HMF (<200 nT, produced by a magnetic field shielding chamber, promotes the proliferation of neural progenitor/stem cells (NPCs/NSCs from C57BL/6 mice. Following seven-day HMF-exposure, the primary neurospheres (NSs were significantly larger in size, and twice more NPCs/NSCs were harvested from neonatal NSs, when compared to the GMF controls. The self-renewal capacity and multipotency of the NSs were maintained, as HMF-exposed NSs were positive for NSC markers (Nestin and Sox2, and could differentiate into neurons and astrocyte/glial cells and be passaged continuously. In addition, adult mice exposed to the HMF for one month were observed to have a greater number of proliferative cells in the subventricular zone. These findings indicate that continuous HMF-exposure increases the proliferation of NPCs/NSCs, in vitro and in vivo. HMF-disturbed NPCs/NSCs production probably affects brain development and function, which provides a novel clue for elucidating the cellular mechanisms of the bio-HMF response.

  4. Cigarette Smoking Is Associated with a Lower Concentration of CD105+ Bone Marrow Progenitor Cells

    Directory of Open Access Journals (Sweden)

    Shaul Beyth

    2015-01-01

    Full Text Available Cigarette smoking is associated with musculoskeletal degenerative disorders, delayed fracture healing, and nonunion. Bone marrow progenitor cells (BMPCs, known to express CD105, are important in local trophic and immunomodulatory activity and central to musculoskeletal healing/regeneration. We hypothesized that smoking is associated with lower levels of BMPC. Iliac bone marrow samples were collected from individuals aged 18–65 years during the first steps of pelvic surgery, under IRB approval with informed consent. Patients with active infectious or neoplastic disease, a history of cytotoxic or radiation therapy, primary or secondary metabolic bone disease, or bone marrow dysfunction were excluded. Separation process purity and the number of BMPCs recovered were assessed with FACS. BMPC populations in self-reported smokers and nonsmokers were compared using the two-tailed t-test. 13 smokers and 13 nonsmokers of comparable age and gender were included. The average concentration of BMPCs was 3.52 × 105/mL ± 2.45 × 105/mL for nonsmokers versus 1.31 × 105/mL ± 1.61 × 105/mL for smokers (t= 3.2, P=0.004. This suggests that cigarette smoking is linked to a significant decrease in the concentration of BMPCs, which may contribute to the reduced regenerative capacity of smokers, with implications for musculoskeletal maintenance and repair.

  5. Bone marrow niche-inspired, multi-phase expansion of megakaryocytic progenitors with high polyploidization potential

    Science.gov (United States)

    Panuganti, Swapna; Papoutsakis, Eleftherios T.; Miller, William M.

    2010-01-01

    Background Megakaryopoiesis encompasses hematopoietic stem and progenitor cell (HSPC) commitment to the megakaryocytic cell (Mk) lineage, expansion of Mk progenitors and mature Mks, polyploidization, and platelet release. pH and pO2 increase from the endosteum to sinuses, and different cytokines are important for various stages of differentiation. We hypothesized that mimicking the changing conditions during Mk differentiation in the bone marrow would facilitate expansion of progenitors that could generate many high-ploidy Mks. Methods CD34+ HSPCs were cultured at pH 7.2 and 5% O2 with stem cell factor (SCF), thrombopoietin (Tpo), and all combinations of Interleukin (IL)-3, IL-6, IL-11, and Flt-3 ligand to promote Mk progenitor expansion. Cells cultured with selected cytokines were shifted to pH 7.4 and 20% O2 to generate mature Mks, and treated with nicotinamide to enhance polyploidization. Results Using Tpo+SCF+IL-3+IL-11, we obtained 3.5 CD34+CD41+ Mk progenitors per input HSPC, while increasing purity from 1% to 17%. Cytokine cocktails with IL-3 yielded more progenitors and mature Mks, although the purities were lower. Mk production was much greater at higher pH and pO2. Although fewer progenitors were present, shifting to 20% O2/pH 7.4 at day 5 (versus days 7 or 9) yielded the greatest mature Mk production, 14 per input HSPC. Nicotinamide more than doubled the percentage of high-ploidy Mks to 40%. Discussion We obtained extensive Mk progenitor expansion, while ensuring that the progenitors could produce high-ploidy Mks. We anticipate that subsequent optimization of cytokines for mature Mk production and delayed nicotinamide addition will greatly increase high-ploidy Mk production. PMID:20482285

  6. Bone marrow niche-inspired, multiphase expansion of megakaryocytic progenitors with high polyploidization potential.

    Science.gov (United States)

    Panuganti, Swapna; Papoutsakis, Eleftherios T; Miller, William M

    2010-10-01

    Megakaryopoiesis encompasses hematopoietic stem and progenitor cell (HSPC) commitment to the megakaryocytic cell (Mk) lineage, expansion of Mk progenitors and mature Mks, polyploidization and platelet release. pH and pO2 increase from the endosteum to sinuses, and different cytokines are important for various stages of differentiation. We hypothesized that mimicking the changing conditions during Mk differentiation in the bone marrow would facilitate expansion of progenitors that could generate many high-ploidy Mks. CD34+ HSPCs were cultured at pH 7.2 and 5% O2 with stem cell factor (SCF), thrombopoietin (Tpo) and all combinations of Interleukin (IL)-3, IL-6, IL-11 and Flt-3 ligand to promote Mk progenitor expansion. Cells cultured with selected cytokines were shifted to pH 7.4 and 20% O2 to generate mature Mks, and treated with nicotinamide (NIC) to enhance polyploidization. Using Tpo + SCF + IL-3 + IL-11, we obtained 3.5 CD34+ CD41+ Mk progenitors per input HSPC, while increasing purity from 1% to 17%. Cytokine cocktails with IL-3 yielded more progenitors and mature Mks, although the purities were lower. Mk production was much greater at higher pH and pO2. Although fewer progenitors were present, shifting to 20% O2 /pH 7.4 at day 5 (versus days 7 or 9) yielded the greatest mature Mk production, 14 per input HSPC. NIC more than doubled the percentage of high-ploidy Mks to 40%. We obtained extensive Mk progenitor expansion, while ensuring that the progenitors could produce high-ploidy Mks. We anticipate that subsequent optimization of cytokines for mature Mk production and delayed NIC addition will greatly increase high-ploidy Mk production.

  7. Molecular Evolution of the Nuclear Factor (Erythroid-Derived 2)-Like 2 Gene Nrf2 in Old World Fruit Bats (Chiroptera: Pteropodidae).

    Science.gov (United States)

    Yin, Qiuyuan; Zhu, Lei; Liu, Di; Irwin, David M; Zhang, Shuyi; Pan, Yi-Hsuan

    2016-01-01

    Mammals developed antioxidant systems to defend against oxidative damage in their daily life. Enzymatic antioxidants and low molecular weight antioxidants (LMWAs) constitute major parts of the antioxidant systems. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2, encoded by the Nrf2 gene) is a central transcriptional regulator, regulating transcription, of many antioxidant enzymes. Frugivorous bats eat large amounts of fruits that contain high levels of LMWAs such as vitamin C, thus, a reliance on LMWAs might greatly reduce the need for antioxidant enzymes in comparison to insectivorous bats. Therefore, it is possible that frugivorous bats have a reduced need for Nrf2 function due to their substantial intake of diet-antioxidants. To test whether the Nrf2 gene has undergone relaxed evolution in fruit-eating bats, we obtained Nrf2 sequences from 16 species of bats, including four Old World fruit bats (Pteropodidae) and one New World fruit bat (Phyllostomidae). Our molecular evolutionary analyses revealed changes in the selection pressure acting on Nrf2 gene and identified seven specific amino acid substitutions that occurred on the ancestral lineage leading to Old World fruit bats. Biochemical experiments were conducted to examine Nrf2 in Old World fruit bats and showed that the amount of catalase, which is regulated by Nrf2, was significantly lower in the brain, heart and liver of Old World fruit bats despite higher levels of Nrf2 protein in Old World fruit bats. Computational predictions suggest that three of these seven amino acid replacements might be deleterious to Nrf2 function. Therefore, the results suggest that Nrf2 gene might have experienced relaxed constraint in Old World fruit bats, however, we cannot rule out the possibility of positive selection. Our study provides the first data on the molecular adaptation of Nrf2 gene in frugivorous bats in compensation to the increased levels of LWMAs from their fruit-diet.

  8. Catalase overexpression prevents nuclear factor erythroid 2-related factor 2 stimulation of renal angiotensinogen gene expression, hypertension, and kidney injury in diabetic mice.

    Science.gov (United States)

    Abdo, Shaaban; Shi, Yixuan; Otoukesh, Abouzar; Ghosh, Anindya; Lo, Chao-Sheng; Chenier, Isabelle; Filep, Janos G; Ingelfinger, Julie R; Zhang, Shao Ling; Chan, John S D

    2014-10-01

    This study investigated the impact of catalase (Cat) overexpression in renal proximal tubule cells (RPTCs) on nuclear factor erythroid 2-related factor 2 (Nrf2) stimulation of angiotensinogen (Agt) gene expression and the development of hypertension and renal injury in diabetic Akita transgenic mice. Additionally, adult male mice were treated with the Nrf2 activator oltipraz with or without the inhibitor trigonelline. Rat RPTCs, stably transfected with plasmid containing either rat Agt or Nrf2 gene promoter, were also studied. Cat overexpression normalized systolic BP, attenuated renal injury, and inhibited RPTC Nrf2, Agt, and heme oxygenase-1 (HO-1) gene expression in Akita Cat transgenic mice compared with Akita mice. In vitro, high glucose level, hydrogen peroxide, and oltipraz stimulated Nrf2 and Agt gene expression; these changes were blocked by trigonelline, small interfering RNAs of Nrf2, antioxidants, or pharmacological inhibitors of nuclear factor-κB and p38 mitogen-activated protein kinase. The deletion of Nrf2-responsive elements in the rat Agt gene promoter abolished the stimulatory effect of oltipraz. Oltipraz administration also augmented Agt, HO-1, and Nrf2 gene expression in mouse RPTCs and was reversed by trigonelline. These data identify a novel mechanism, Nrf2-mediated stimulation of intrarenal Agt gene expression and activation of the renin-angiotensin system, by which hyperglycemia induces hypertension and renal injury in diabetic mice. © 2014 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

  9. Hemistepsin A ameliorates acute inflammation in macrophages via inhibition of nuclear factor-κB and activation of nuclear factor erythroid 2-related factor 2.

    Science.gov (United States)

    Kim, Jae Kwang; Lee, Ji Eun; Jung, Eun Hye; Jung, Ji Yun; Jung, Dae Hwa; Ku, Sae Kwang; Cho, Il Je; Kim, Sang Chan

    2018-01-01

    Hemistepsin A (HsA) is a sesquiterpene lactone isolated from Hemistepta lyrata (Bunge) Bunge. We investigated the anti-inflammatory effects of HsA and sought to determine its mechanisms of action in macrophages. HsA pretreatment inhibited nitric oxide production, and reduced the expression of iNOS and COX-2 in Toll-like receptor ligand-stimulated RAW 264.7 cells. Additionally, HsA decreased the secretion of proinflammatory cytokines in lipopolysaccharide (LPS)-stimulated Kupffer cells as well as in RAW 264.7 cells. HsA inhibited phosphorylation of IKKα/β and degradation of IκBα, resulting in decreased nuclear translocation of nuclear factor-κB (NF-κB) and its transcriptional activity. Moreover, HsA phosphorylated nuclear factor erythroid 2-related factor 2 (Nrf2), increased expression levels of antioxidant genes, and attenuated LPS-stimulated H 2 O 2 production. Phosphorylation of p38 and c-Jun N-terminal kinase was required for HsA-mediated Nrf2 phosphorylation. In a D-galactosamine/LPS-induced liver injury model, HsA ameliorated D-galactosamine/LPS-induced hepatocyte degeneration and inflammatory cells infiltration. Moreover, immunohistochemical analyses using nitrotyrosine, 4-hydroxynonenal, and cleaved poly (ADP-ribose) polymerase antibodies revealed that HsA protected the liver from oxidative stress. Furthermore, HsA reduced the numbers of proinflammatory cytokine-positive cells in hepatic tissues. Thus, these results suggest HsA may be a promising natural product to manage inflammation-mediated tissue injuries through inhibition of NF-κB and activation of Nrf2. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Heme-dependent up-regulation of the α-globin gene expression by transcriptional repressor Bach1 in erythroid cells

    International Nuclear Information System (INIS)

    Tahara, Tsuyoshi; Sun Jiying; Igarashi, Kazuhiko; Taketani, Shigeru

    2004-01-01

    The transcriptional factor Bach1 forms a heterodimer with small Maf family, and functions as a repressor of the Maf recognition element (MARE) in vivo. To investigate the involvement of Bach1 in the heme-dependent regulation of the expression of the α-globin gene, human erythroleukemia K562 cells were cultured with succinylacetone (SA), a heme biosynthetic inhibitor, and the level of α-globin mRNA was examined. A decrease of α-globin mRNA was observed in SA-treated cells, which was restored by the addition of hemin. The heme-dependent expression of α-globin occurred at the transcriptional level since the expression of human α-globin gene promoter-reporter gene containing hypersensitive site-40 (HS-40) was decreased when K562 cells were cultured with SA. Hemin treatment restored the decrease of the promoter activity by SA. The regulation of the HS-40 activity by heme was dependent on the NF-E2/AP-1 (NA) site, which is similar to MARE. The NA site-binding activity of Bach1 in K562 increased upon SA-treatment, and the increase was diminished by the addition of hemin. The transient expression of Bach1 and mutated Bach1 lacking CP motifs suppressed the HS-40 activity, and cancellation of the repressor activity by hemin was observed when wild-type Bach1 was expressed. The expression of NF-E2 strengthened the restoration of the Bach1-effect by hemin. Interestingly, nuclear localization of Bach1 increased when cells were treated with SA, while hemin induced the nuclear export of Bach1. These results indicated that heme plays an important role in the induction of α-globin gene expression through disrupting the interaction of Bach1 and the NA site in HS-40 enhancer in erythroid cells

  11. FGF signalling controls the specification of hair placode-derived SOX9 positive progenitors to Merkel cells.

    Science.gov (United States)

    Nguyen, Minh Binh; Cohen, Idan; Kumar, Vinod; Xu, Zijian; Bar, Carmit; Dauber-Decker, Katherine L; Tsai, Pai-Chi; Marangoni, Pauline; Klein, Ophir D; Hsu, Ya-Chieh; Chen, Ting; Mikkola, Marja L; Ezhkova, Elena

    2018-06-13

    Merkel cells are innervated mechanosensory cells responsible for light-touch sensations. In murine dorsal skin, Merkel cells are located in touch domes and found in the epidermis around primary hairs. While it has been shown that Merkel cells are skin epithelial cells, the progenitor cell population that gives rise to these cells is unknown. Here, we show that during embryogenesis, SOX9-positive (+) cells inside hair follicles, which were previously known to give rise to hair follicle stem cells (HFSCs) and cells of the hair follicle lineage, can also give rise to Merkel Cells. Interestingly, while SOX9 is critical for HFSC specification, it is dispensable for Merkel cell formation. Conversely, FGFR2 is required for Merkel cell formation but is dispensable for HFSCs. Together, our studies uncover SOX9(+) cells as precursors of Merkel cells and show the requirement for FGFR2-mediated epithelial signalling in Merkel cell specification.

  12. Endothelial progenitor cells physiology and metabolic plasticity in brain angiogenesis and blood-brain barrier modeling

    Directory of Open Access Journals (Sweden)

    Natalia Malinovskaya

    2016-12-01

    Full Text Available Currently, there is a considerable interest to the assessment of blood-brain barrier (BBB development as a part of cerebral angiogenesis developmental program. Embryonic and adult angiogenesis in the brain is governed by the coordinated activity of endothelial progenitor cells, brain microvascular endothelial cells, and non-endothelial cells contributing to the establishment of the BBB (pericytes, astrocytes, neurons. Metabolic and functional plasticity of endothelial progenitor cells controls their timely recruitment, precise homing to the brain microvessels, and efficient support of brain angiogenesis. Deciphering endothelial progenitor cells physiology would provide novel engineering approaches to establish adequate microfluidically-supported BBB models and brain microphysiological systems for translational studies.

  13. The Progenitors of Local Ultra-massive Galaxies Across Cosmic Time

    DEFF Research Database (Denmark)

    Marchesini, Danilo; Muzzin, Adam; Stefanon, Mauro

    2014-01-01

    in age of $z=0$ UMGs as derived from their fossil records. The progenitors of local UMGs, including the star-forming ones, never lived on the blue cloud since $z=3$. We propose an alternative path for the formation of local UMGs that refines previously proposed pictures and that is fully consistent......-forming galaxies progressively increases, with the progenitors at $2z 1$, whereas the remaining was assembled via merging from $z\\sim 1$ to the present. Most of the quenching of the star-forming progenitors happened between $z=2.75$ and $z=1.25$, in good agreement with the typical formation redshift and scatter...

  14. Violencia Filio Parental: Comparando lo que informan los adolescentes y sus progenitores

    OpenAIRE

    Calvete, Esther; Orue, Izaskun; González-Cabrera, Joaquín

    2017-01-01

    El objetivo principal del presente estudio fue examinar la consistencia de los informes de progenitores e hijos a la hora de informar sobre la violencia filio-parental en una muestra comunitaria. Como objetivo secundario, se exploraron las propiedades psicométricas de la versión para progenitores del Cuestionario de Violencia Filio-Parental (Calvete, Gámez-Guadix et al., 2013). Participaron en el estudio un total de 880 adolescentes (51.70% chicas, entre 13 y 19 años) y sus progenitores (76....

  15. An in vitro clonogenic assay to assess radiation damage in rat CNS glial progenitor cells

    International Nuclear Information System (INIS)

    Maazen, R.W.M. van der; Verhagen, I.; Kogel, A.J. van der

    1990-01-01

    Normal glial progenitor cells can be isolated from the rat central nervous system (CNS) and cultured in vitro on a monolayer of type-1 astrocytes. These monolayers are able to support and stimulate explanted glial progenitor cells to proliferate. Employing these in vitro interactions of specific glial cell types, an in vivo-in vitro clonogenic assay has been developed. This method offers the possibility to study the intrinsic radiosensitivity, repair and regeneration of glial progenitor cells after in vitro or in vivo irradiation. (author)

  16. High-content phenotypic screening and triaging strategy to identify small molecules driving oligodendrocyte progenitor cell differentiation.

    Science.gov (United States)

    Peppard, Jane V; Rugg, Catherine A; Smicker, Matthew A; Powers, Elaine; Harnish, Erica; Prisco, Joy; Cirovic, Dragan; Wright, Paul S; August, Paul R; Chandross, Karen J

    2015-03-01

    Multiple Sclerosis is a demyelinating disease of the CNS and the primary cause of neurological disability in young adults. Loss of myelinating oligodendrocytes leads to neuronal dysfunction and death and is an important contributing factor to this disease. Endogenous oligodendrocyte precursor cells (OPCs), which on differentiation are responsible for replacing myelin, are present in the adult CNS. As such, therapeutic agents that can stimulate OPCs to differentiate and remyelinate demyelinated axons under pathologic conditions may improve neuronal function and clinical outcome. We describe the details of an automated, cell-based, morphometric-based, high-content screen that is used to identify small molecules eliciting the differentiation of OPCs after 3 days. Primary screening was performed using rat CG-4 cells maintained in culture conditions that normally support a progenitor cell-like state. From a library of 73,000 diverse small molecules within the Sanofi collection, 342 compounds were identified that increased OPC morphological complexity as an indicator of oligodendrocyte maturation. Subsequent to the primary high-content screen, a suite of cellular assays was established that identified 22 nontoxic compounds that selectively stimulated primary rat OPCs but not C2C12 muscle cell differentiation. This rigorous triaging yielded several chemical series for further expansion and bio- or cheminformatics studies, and their compelling biological activity merits further investigation. © 2014 Society for Laboratory Automation and Screening.

  17. Primary explosives

    Energy Technology Data Exchange (ETDEWEB)

    Matyas, Robert; Pachman, Jiri [Pardubice Univ. (Czech Republic). Faculty of Chemical Technology

    2013-06-01

    The first chapter provides background such as the basics of initiation and differences between requirements on primary explosives used in detonators and igniters. The authors then clarify the influence of physical characteristics on explosive properties, focusing on those properties required for primary explosives. Furthermore, the issue of sensitivity is discussed. All the chapters on particular groups of primary explosives are structured in the same way, including introduction, physical and chemical properties, explosive properties, preparation and documented use.

  18. Primary fibromyalgia

    DEFF Research Database (Denmark)

    Jacobsen, S; Jensen, L T; Foldager, M

    1990-01-01

    Serum concentrations of procollagen type III aminoterminal peptide have previously been reported to be low in some patients with primary fibromyalgia and the aim of this study was to determine if such patients differ clinically from primary fibromyalgia patients with normal levels of procollagen...... type III aminoterminal peptide. Subjective symptoms, tender points and dynamic muscle strength in 45 women with primary fibromyalgia were related to serum concentrations of procollagen type III aminoterminal peptide. Patients with low serum concentrations of procollagen type III aminoterminal peptide...... concentrations of procollagen type III aminoterminal peptide of primary fibromyalgia patients are connected to the disease impact....

  19. Hepatic progenitor cell resistance to TGF-β1's proliferative and apoptotic effects

    International Nuclear Information System (INIS)

    Clark, J. Brian; Rice, Lisa; Sadiq, Tim; Brittain, Evan; Song, Lujun; Wang Jian; Gerber, David A.

    2005-01-01

    The success of hepatocellular therapies using stem or progenitor cell populations is dependent upon multiple factors including the donor cell, microenvironment, and etiology of the liver injury. The following experiments investigated the impact of TGF-β1 on a previously described population of hepatic progenitor cells (HPC). The majority of the hepatic progenitor cells were resistant to endogenously produced TGF-β1's proapoptotic and anti-proliferative effects unlike more well-differentiated cellular populations (e.g., mature hepatocytes). Surprisingly, in vitro TGF-β1 supplementation significantly inhibited de novo hepatic progenitor cell colony formation possibly via an indirect mechanism(s). Therefore despite the HPC's direct resistance to supplemental TGF-β1, this cytokine's inhibitory effect on colony formation could have a potential negative impact on the use of these cells as a therapy for patients with liver disease

  20. PLZF regulates fibroblast growth factor responsiveness and maintenance of neural progenitors.

    Science.gov (United States)

    Gaber, Zachary B; Butler, Samantha J; Novitch, Bennett G

    2013-10-01

    Distinct classes of neurons and glial cells in the developing spinal cord arise at specific times and in specific quantities from spatially discrete neural progenitor domains. Thus, adjacent domains can exhibit marked differences in their proliferative potential and timing of differentiation. However, remarkably little is known about the mechanisms that account for this regional control. Here, we show that the transcription factor Promyelocytic Leukemia Zinc Finger (PLZF) plays a critical role shaping patterns of neuronal differentiation by gating the expression of Fibroblast Growth Factor (FGF) Receptor 3 and responsiveness of progenitors to FGFs. PLZF elevation increases FGFR3 expression and STAT3 pathway activity, suppresses neurogenesis, and biases progenitors towards glial cell production. In contrast, PLZF loss reduces FGFR3 levels, leading to premature neuronal differentiation. Together, these findings reveal a novel transcriptional strategy for spatially tuning the responsiveness of distinct neural progenitor groups to broadly distributed mitogenic signals in the embryonic environment.