DEFF Research Database (Denmark)
Witting, Nanna; Andersen, Linda K; Vissing, John
2016-01-01
Classically, myopathies are categorized according to limb or cranial nerve muscle affection, but with the growing use of magnetic resonance imaging it has become evident that many well-known myopathies have significant involvement of the axial musculature. New disease entities with selective axial...
Fulminant lipid storage myopathy due to multiple acyl-coenzyme a dehydrogenase deficiency.
Whitaker, Charles H; Felice, Kevin J; Silvers, David; Wu, Qian
2015-08-01
The lipid storage myopathies, primary carnitine deficiency, neutral lipid storage disease, and multiple acyl coenzyme A dehydrogenase deficiency (MADD), are progressive disorders that cause permanent weakness. These disorders of fatty acid metabolism and intracellular triglyceride degradation cause marked fat deposition and damage to muscle cells. We describe a rapidly progressive myopathy in a previously healthy 33-year-old woman. Over 4 months, she developed a proximal and axial myopathy associated with diffuse myalgia and dysphagia, ultimately leading to respiratory failure and death. Muscle biopsy showed massive accumulation of lipid. Plasma acylcarnitine and urine organic acid analysis was consistent with MADD. This was confirmed by molecular genetic testing, which revealed 2 pathogenic mutations in the ETFDH gene. This report illustrates a late-onset case of MADD and reviews the differential diagnosis and evaluation of patients with proximal myopathy and excessive accumulation of lipid on muscle biopsy. © 2014 Wiley Periodicals, Inc.
de Freitas, M R; Nascimento, O J
1975-06-01
The case of a 23 years old female patient, with primary involvement of the extraocular and faringeal muscles without familiar history is reported. Electromyographic and muscular biopsy studies proved the myogenic nature of the process. A clinical comparison between the ocular myopathy and the descending ocular myopathy is made, the authors thinking that both of them would be variants of the same muscle disease.
Evidence-based treatment of metabolic myopathy
Directory of Open Access Journals (Sweden)
Yan LIN
2014-05-01
Full Text Available Objective To evaluate the current treatments and possible adverse reactions of metabolic myopathy, and to develop the best solution for evidence-based treatment. Methods Taking metabolic myopathy, mitochondrial myopathy, lipid storage myopathy, glycogen storage diseases, endocrine myopathy, drug toxicity myopathy and treatment as search terms, retrieve in databases such as PubMed, Cochrane Library, ClinicalKey database, National Science and Technology Library (NSTL, in order to collect the relevant literature database including clinical guidelines, systematic reviews (SR, randomized controlled trials (RCT, controlled clinical trials, retrospective case analysis and case study. Jadad Scale was used to evaluate the quality of literature. Results Twenty-eight related articles were selected, including 6 clinical guidelines, 5 systematic reviews, 10 randomized controlled trials and 7 clinical controlled trials. According to Jadad Scale, 23 articles were evaluated as high-quality literature (≥ 4, and the remaining 5 were evaluated as low-quality literature (< 4. Treatment principles of these clinical trials, efficacy of different therapies and drug safety evaluation suggest that: 1 Acid α-glycosidase (GAA enzyme replacement therapy (ERT is the main treatment for glycogen storage diseases, with taking a high-protein diet, exercising before taking a small amount of fructose orally and reducing the patient's physical activity gradually. 2 Carnitine supplementation is used in the treatment of lipid storage myopathy, with carbohydrate and low fat diet provided before exercise or sports. 3 Patients with mitochondrial myopathy can take coenzyme Q10, vitamin B, vitamin K, vitamin C, etc. Proper aerobic exercise combined with strength training is safe, and it can also enhance the exercise tolerance of patients effectively. 4 The first choice to treat the endocrine myopathy is treating primary affection. 5 Myopathies due to drugs and toxins should
Amyloid myopathy: a diagnostic challenge
Directory of Open Access Journals (Sweden)
Heli Tuomaala
2009-08-01
Full Text Available Amyloid myopathy (AM is a rare manifestation of primary systemic amyloidosis (AL. Like inflammatory myopathies, it presents with proximal muscle weakness and an increased creatine kinase level. We describe a case of AL with severe, rapidly progressive myopathy as the initial symptom. The clinical manifestation and muscle biopsy were suggestive of inclusion body myositis. AM was not suspected until amyloidosis was seen in the gastric mucosal biopsy. The muscle biopsy was then re-examined more specifically, and Congo red staining eventually showed vascular and interstitial amyloid accumulation, which led to a diagnosis of AM. The present case illustrates the fact that the clinical picture of AM can mimic that of inclusion body myositis.
Dimachkie, Mazen M.; Barohn, Richard J.
2014-01-01
Over a century ago, Gowers described two young patients in whom distal muscles weakness involved the hand, foot, sternocleidomastoid, and facial muscles in the other case the shoulder and distal leg musculature. Soon after, , similar distal myopathy cases were reported whereby the absence of sensory symptoms and of pathologic changes in the peripheral nerves and spinal cord at postmortem examination allowed differentiation from Charcot-Marie-Tooth disease. In 1951, Welander described autosomal dominant (AD) distal arm myopathy in a large Scandanavian cohort. Since then the number of well-characterized distal myopathies has continued to grow such that the distal myopathies have formed a clinically and genetically heterogeneous group of disorders. Affected kindred commonly manifest weakness that is limited to foot and toe muscles even in advanced stages of the disease, with variable mild proximal leg, distal arm, neck and laryngeal muscle involvement in selected individuals. An interesting consequence of the molecular characterization of the distal myopathies has been the recognition that mutation in a single gene can lead to more than one clinical disorder. For example, Myoshi myopathy (MM) and limb girdle muscular dystrophy (LGMD) type 2B are allelic disorders due to defects in the gene that encodes dysferlin. The six well described distal myopathy syndromes are shown in Table 1. Table 2 lists advances in our understanding of the myofibrillar myopathy group and Table 3 includes more recently delineated and less common distal myopathies. In the same manner, the first section of this review pertains to the more traditional six distal myopathies followed by discussion of the myofibrillar myopathies. In the third section, we review other clinically and genetically distinctive distal myopathy syndromes usually based upon single or smaller family cohorts. The fourth section considers other neuromuscular disorders that are important to recognize as they display prominent
Whole-body muscle MRI to detect myopathies in non-extrapyramidal bent spine syndrome
International Nuclear Information System (INIS)
Ohana, Mickael; Durand, Marie-Christine; Marty, Catherine; Lazareth, Jean-Philippe; Maisonobe, Thierry; Mompoint, Dominique; Carlier, Robert-Yves
2014-01-01
Bent spine syndrome (BSS), defined as an abnormal forward flexion of the trunk resolving in supine position, is usually related to parkinsonism, but can also be encountered in myopathies. This study evaluates whole-body muscle MRI (WB-mMRI) as a tool for detecting underlying myopathy in non-extrapyramidal BSS. Forty-three patients (90 % women; 53-86 years old) with a non-extrapyramidal BSS were prospectively included. All underwent a 1.5-T WB-mMRI and a nerve conduction study. Muscle biopsy was performed if a myopathy could not be eliminated based on clinical examination and all tests. Systematic MRI interpretation focused on peripheral and axial muscle injury; spinal posture and incidental findings were also reported. WB-mMRI was completed for all patients, with 13 muscle biopsies ultimately needed and myopathy revealed as the final etiological diagnosis in five cases (12 %). All biopsy-proven myopathies were detected by the WB-mMRI. Relevant incidental MRI findings were made in seven patients. This study supports WB-mMRI as a sensitive and feasible tool for detecting myopathy in BSS patients. Associated with electroneuromyography, it can better indicate when a muscle biopsy is needed and guide it when required. Rigorous radiological interpretation is mandatory, so as not to miss incidental findings of clinical consequence. (orig.)
Whole-body muscle MRI to detect myopathies in non-extrapyramidal bent spine syndrome
Energy Technology Data Exchange (ETDEWEB)
Ohana, Mickael [Nouvel Hopital Civil - Hopitaux Universitaires de Strasbourg, Service de Radiologie B, Strasbourg (France); Durand, Marie-Christine [AP-HP - Hopital Raymond Poincare, Service de Neurologie, Garches (France); Marty, Catherine; Lazareth, Jean-Philippe [AP-HP - Hopital Raymond Poincare, Service de Rhumatologie, Garches (France); Maisonobe, Thierry [APH-HP - Hopital de la Pitie-Salpetriere, Service de Neuropathologie, Paris (France); Mompoint, Dominique; Carlier, Robert-Yves [AP-HP - Hopital Raymond Poincare, Service de Radiologie, Garches (France)
2014-08-15
Bent spine syndrome (BSS), defined as an abnormal forward flexion of the trunk resolving in supine position, is usually related to parkinsonism, but can also be encountered in myopathies. This study evaluates whole-body muscle MRI (WB-mMRI) as a tool for detecting underlying myopathy in non-extrapyramidal BSS. Forty-three patients (90 % women; 53-86 years old) with a non-extrapyramidal BSS were prospectively included. All underwent a 1.5-T WB-mMRI and a nerve conduction study. Muscle biopsy was performed if a myopathy could not be eliminated based on clinical examination and all tests. Systematic MRI interpretation focused on peripheral and axial muscle injury; spinal posture and incidental findings were also reported. WB-mMRI was completed for all patients, with 13 muscle biopsies ultimately needed and myopathy revealed as the final etiological diagnosis in five cases (12 %). All biopsy-proven myopathies were detected by the WB-mMRI. Relevant incidental MRI findings were made in seven patients. This study supports WB-mMRI as a sensitive and feasible tool for detecting myopathy in BSS patients. Associated with electroneuromyography, it can better indicate when a muscle biopsy is needed and guide it when required. Rigorous radiological interpretation is mandatory, so as not to miss incidental findings of clinical consequence. (orig.)
... find appropri- ate therapists, and to locate and purchase important assistive devices. And today, people with disabilities ... in inheritable myopathies • Anesthesia: People with myopathies can experience a range of adverse reactions to certain anesthetic ...
Tarnopolsky, Mark A
2016-12-01
Metabolic myopathies are genetic disorders that impair intermediary metabolism in skeletal muscle. Impairments in glycolysis/glycogenolysis (glycogen-storage disease), fatty acid transport and oxidation (fatty acid oxidation defects), and the mitochondrial respiratory chain (mitochondrial myopathies) represent the majority of known defects. The purpose of this review is to develop a diagnostic and treatment algorithm for the metabolic myopathies. The metabolic myopathies can present in the neonatal and infant period as part of more systemic involvement with hypotonia, hypoglycemia, and encephalopathy; however, most cases present in childhood or in adulthood with exercise intolerance (often with rhabdomyolysis) and weakness. The glycogen-storage diseases present during brief bouts of high-intensity exercise, whereas fatty acid oxidation defects and mitochondrial myopathies present during a long-duration/low-intensity endurance-type activity or during fasting or another metabolically stressful event (eg, surgery, fever). The clinical examination is often normal between acute events, and evaluation involves exercise testing, blood testing (creatine kinase, acylcarnitine profile, lactate, amino acids), urine organic acids (ketones, dicarboxylic acids, 3-methylglutaconic acid), muscle biopsy (histology, ultrastructure, enzyme testing), MRI/spectroscopy, and targeted or untargeted genetic testing. Accurate and early identification of metabolic myopathies can lead to therapeutic interventions with lifestyle and nutritional modification, cofactor treatment, and rapid treatment of rhabdomyolysis.
CT and the diagnosis of myopathies. Preliminary findings in 42 cases
Energy Technology Data Exchange (ETDEWEB)
Calgo, M; Crisi, G; Martinelli, C; Colombo, A; Schoenhuber, R; Gibertoni, M
1986-01-01
A total of 42 patients with myopathies underwent CT scans in order to study the relationship between CT images and clinical findings. CT is a valuable diagnostic aid to distinguish primary from neurogenic myopathies, to facilitate directed biopsy and finally to classify the disease according to the degree and extent of the muscular lesion. (orig.).
Mitochondrial disorders in congenital myopathies
Directory of Open Access Journals (Sweden)
D. A. Kharlamov
2014-01-01
Full Text Available The literature review gives data on the role of mitochondrial disorders in the pathogenesis of congenital myopathies: congenital muscular dystrophies and congenital structural myopathies. It describes changes in congenital muscular dystrophies with type VI collagen, in myodystrophy with giant mitochondria, in congenital central core myopathies, myotubular myopathy, etc. Clinical and experimental findings are presented. Approaches to therapy for energy disorders in congenital myopathies are depicted.
GNE Myopathy in Turkish Sisters with a Novel Homozygous Mutation
Diniz, Gulden; Secil, Yaprak; Ceylaner, Serdar; Tokucoglu, Figen; Türe, Sabiha; Celebisoy, Mehmet; İncesu, Tülay Kurt; Akhan, Galip
2016-01-01
Background. Hereditary inclusion body myopathy is caused by biallelic defects in the GNE gene located on chromosome 9p13. It generally affects adults older than 20 years of age. Methods and Results. In this study, we present two Turkish sisters with progressive myopathy and describe a novel mutation in the GNE gene. Both sisters had slightly higher levels of creatine kinase (CK) and muscle weakness. The older sister presented at 38 years of age with an inability to climb steps, weakness, and a steppage gait. Her younger sister was 36 years old and had similar symptoms. The first symptoms of the disorder were seen when the sisters were 30 and 34 years old, respectively. The muscle biopsy showed primary myopathic features and presence of rimmed vacuoles. DNA analysis demonstrated the presence of previously unknown homozygous mutations [c.2152 G>A (p.A718T)] in the GNE genes. Conclusion. Based on our literature survey, we believe that ours is the first confirmed case of primary GNE myopathy with a novel missense mutation in Turkey. These patients illustrate that the muscle biopsy is still an important method for the differential diagnosis of vacuolar myopathies in that the detection of inclusions is required for the definitive diagnosis. PMID:27298745
Molecular and Genetic Studies of Congenital Myopathies
2018-03-21
Central Core Disease; Centronuclear Myopathy; Congenital Fiber Type Disproportion; Multiminicore Disease; Myotubular Myopathy; Nemaline Myopathy; Rigid Spine Muscular Dystrophy; Undefined Congenital Myopathy
Endocrine myopathy: Case-based review
Directory of Open Access Journals (Sweden)
Babul Reddy Hanmayyagari
2016-01-01
Full Text Available Endocrine myopathy means muscle weakness in the presence of an abnormal endocrine state. Most of the endocrine disorders are associated with myopathy and it is usually reversible with correction of the underlying disturbance, though, there is an increasing knowledge of the metabolic effects of hormones, endocrine myopathy is a less recognized and often overlooked entity in clinical practice. Here, we describe this association in three of our patients, then, we discuss systematically about endocrine myopathy.
Myopathy in acute hypothyroidism
Ma, JTC; Yu, YL; Kung, AWC
1987-01-01
Hypothyroid myopathy has so far been reported in long standing cases of hypothyroidism. We describe two adult patients with myopathy associated with acute transient hypothyroidism. Both presented with severe muscle aches and cramps, stiffness and spasms. Muscle enzymes were markedly elevated and electromyography in one patient showed myopathic features. Histological changes were absent in muscle biopsy, probably because of the short duration of metabolic disturbance. The myopathy subsided pro...
Myopathy in acute hypothyroidism.
Kung, A. W.; Ma, J. T.; Yu, Y. L.; Wang, C. C.; Woo, E. K.; Lam, K. S.; Huang, C. Y.; Yeung, R. T.
1987-01-01
Hypothyroid myopathy has so far been reported in long standing cases of hypothyroidism. We describe two adult patients with myopathy associated with acute transient hypothyroidism. Both presented with severe muscle aches and cramps, stiffness and spasms. Muscle enzymes were markedly elevated and electromyography in one patient showed myopathic features. Histological changes were absent in muscle biopsy, probably because of the short duration of metabolic disturbance. The myopathy subsided pro...
Muscle regeneration in mitochondrial myopathies
DEFF Research Database (Denmark)
Krag, T O; Hauerslev, S; Jeppesen, T D
2013-01-01
Mitochondrial myopathies cover a diverse group of disorders in which ragged red and COX-negative fibers are common findings on muscle morphology. In contrast, muscle degeneration and regeneration, typically found in muscular dystrophies, are not considered characteristic features of mitochondrial...... myopathies. We investigated regeneration in muscle biopsies from 61 genetically well-defined patients affected by mitochondrial myopathy. Our results show that the perturbed energy metabolism in mitochondrial myopathies causes ongoing muscle regeneration in a majority of patients, and some were even affected...
Stepwise approach to myopathy in systemic disease.
Chawla, Jasvinder
2011-01-01
Muscle diseases can constitute a large variety of both acquired and hereditary disorders. Myopathies in systemic disease results from several different disease processes including endocrine, inflammatory, paraneoplastic, infectious, drug- and toxin-induced, critical illness myopathy, metabolic, and myopathies with other systemic disorders. Patients with systemic myopathies often present acutely or sub acutely. On the other hand, familial myopathies or dystrophies generally present in a chronic fashion with exceptions of metabolic myopathies where symptoms on occasion can be precipitated acutely. Most of the inflammatory myopathies can have a chance association with malignant lesions; the incidence appears to be specifically increased only in patients with dermatomyositis. In dealing with myopathies associated with systemic illnesses, the focus will be on the acquired causes. Management is beyond the scope of this chapter. Prognosis is based upon the underlying cause and, most of the time, carries a good prognosis. In order to approach a patient with suspected myopathy from systemic disease, a stepwise approach is utilized.
STATINS AND MYOPATHY: MOLECULAR MECHANISMS
Directory of Open Access Journals (Sweden)
O. M. Drapkina
2012-01-01
Full Text Available The safety of statin therapy is considered. In particular the reasons of a complication such as myopathy are discussed in detail. The molecular mechanisms of statin myopathy , as well as its risk factors are presented. The role of coenzyme Q10 in the myopathy development and coenzyme Q10 application for the prevention of this complication are considered.
Genetics Home Reference: Miyoshi myopathy
... links) Centers for Disease Control and Prevention: Muscular Dystrophy Cincinnati Children's Hospital: Molkentin Lab: Mechanisms of Duchenne and Miyoshi Myopathy Disease InfoSearch: Miyoshi myopathy Jain ...
A diagnostic algorithm for metabolic myopathies.
Berardo, Andres; DiMauro, Salvatore; Hirano, Michio
2010-03-01
Metabolic myopathies comprise a clinically and etiologically diverse group of disorders caused by defects in cellular energy metabolism, including the breakdown of carbohydrates and fatty acids to generate adenosine triphosphate, predominantly through mitochondrial oxidative phosphorylation. Accordingly, the three main categories of metabolic myopathies are glycogen storage diseases, fatty acid oxidation defects, and mitochondrial disorders due to respiratory chain impairment. The wide clinical spectrum of metabolic myopathies ranges from severe infantile-onset multisystemic diseases to adult-onset isolated myopathies with exertional cramps. Diagnosing these diverse disorders often is challenging because clinical features such as recurrent myoglobinuria and exercise intolerance are common to all three types of metabolic myopathy. Nevertheless, distinct clinical manifestations are important to recognize as they can guide diagnostic testing and lead to the correct diagnosis. This article briefly reviews general clinical aspects of metabolic myopathies and highlights approaches to diagnosing the relatively more frequent subtypes (Fig. 1). Fig. 1 Clinical algorithm for patients with exercise intolerance in whom a metabolic myopathy is suspected. CK-creatine kinase; COX-cytochrome c oxidase; CPT-carnitine palmitoyl transferase; cyt b-cytochrome b; mtDNA-mitochondrial DNA; nDNA-nuclear DNA; PFK-phosphofructokinase; PGAM-phosphoglycerate mutase; PGK-phosphoglycerate kinase; PPL-myophosphorylase; RRF-ragged red fibers; TFP-trifunctional protein deficiency; VLCAD-very long-chain acyl-coenzyme A dehydrogenase.
Hereditary myopathies with early respiratory insufficiency in adults.
Naddaf, Elie; Milone, Margherita
2017-11-01
Hereditary myopathies with early respiratory insufficiency as a predominant feature of the clinical phenotype are uncommon and underestimated in adults. We reviewed the clinical and laboratory data of patients with hereditary myopathies who demonstrated early respiratory insufficiency before the need for ambulatory assistance. Only patients with disease-causing mutations or a specific histopathological diagnosis were included. Patients with cardiomyopathy were excluded. We identified 22 patients; half had isolated respiratory symptoms at onset. The diagnosis of the myopathy was often delayed, resulting in delayed ventilatory support. The most common myopathies were adult-onset Pompe disease, myofibrillar myopathy, multi-minicore disease, and myotonic dystrophy type 1. Single cases of laminopathy, MELAS (mitochondrial encephalomyopathy with lactic acidosis and strokelike events), centronuclear myopathy, and cytoplasmic body myopathy were identified. We highlighted the most common hereditary myopathies associated with early respiratory insufficiency as the predominant clinical feature, and underscored the importance of a timely diagnosis for patient care. Muscle Nerve 56: 881-886, 2017. © 2017 Wiley Periodicals, Inc.
Localized scleroderma and regional inflammatory myopathy.
Zivković, Saša A; Freiberg, William; Lacomis, David; Domsic, Robyn T; Medsger, Thomas A
2014-05-01
Inflammatory myopathy is rare in localized scleroderma. We report 2 new cases of regional inflammatory myopathy associated with localized scleroderma and review 10 reported cases of localized scleroderma associated with an inflammatory myopathy with regional muscle involvement, more often in the upper extremities. Serum creatine kinase was mildly elevated or normal. Histopathology often showed perimysial inflammation and plasma cell infiltration. These cases demonstrate that inflammatory myopathy should be considered in patients with localized scleroderma and regional muscle weakness, pain or atrophy. Muscle biopsy can confirm the diagnosis of myositis, which if identified, will require anti-inflammatory and/or immunosuppressive therapy. Published by Elsevier B.V.
Exercise training in metabolic myopathies
DEFF Research Database (Denmark)
Vissing, J
2016-01-01
metabolic adaptations, such as increased dependence on glycogen use and a reduced capacity for fatty acid oxidation, which is detrimental in GSDs. Training has not been studied systematically in any FAODs and in just a few GSDs. However, studies on single bouts of exercise in most metabolic myopathies show......Metabolic myopathies encompass muscle glycogenoses (GSD) and disorders of muscle fat oxidation (FAOD). FAODs and GSDs can be divided into two main clinical phenotypes; those with static symptoms related to fixed muscle weakness and atrophy, and those with dynamic, exercise-related symptoms...... that are brought about by a deficient supply of ATP. Together with mitochondrial myopathies, metabolic myopathies are unique among muscle diseases, as the limitation in exercise performance is not solely caused by structural damage of muscle, but also or exclusively related to energy deficiency. ATP consumption...
DiMauro, Salvatore
2006-11-01
Our understanding of mitochondrial diseases (defined restrictively as defects of the mitochondrial respiratory chain) is expanding rapidly. In this review, I will give the latest information on disorders affecting predominantly or exclusively skeletal muscle. The most recently described mitochondrial myopathies are due to defects in nuclear DNA, including coenzyme Q10 deficiency and mutations in genes controlling mitochondrial DNA abundance and structure, such as POLG, TK2, and MPV17. Barth syndrome, an X-linked recessive mitochondrial myopathy/cardiopathy, is associated with decreased amount and altered structure of cardiolipin, the main phospholipid of the inner mitochondrial membrane, but a secondary impairment of respiratory chain function is plausible. The role of mutations in protein-coding genes of mitochondrial DNA in causing isolated myopathies has been confirmed. Mutations in tRNA genes of mitochondrial DNA can also cause predominantly myopathic syndromes and--contrary to conventional wisdom--these mutations can be homoplasmic. Defects in the mitochondrial respiratory chain impair energy production and almost invariably involve skeletal muscle, causing exercise intolerance, cramps, recurrent myoglobinuria, or fixed weakness, which often affects extraocular muscles and results in droopy eyelids (ptosis) and progressive external ophthalmoplegia.
Inherited myopathies and muscular dystrophies
Cardamone, Michael; Darras, Basil T.; Ryan, Monique M.
The inherited myopathies and muscular dystrophies are a diverse group of muscle diseases presenting with common complaints and physical signs: weakness, motor delay, and respiratory and bulbar dysfunction. The myopathies are caused by genetic defects in the contractile apparatus of muscle, and
Severe polysaccharide storage myopathy in Belgian and Percheron draught horses.
Valentine, B A; Credille, K M; Lavoie, J P; Fatone, S; Guard, C; Cummings, J F; Cooper, B J
1997-05-01
A severe myopathy leading to death or euthanasia was identified in 4 Belgian and 4 Percheron draught horses age 2-21 years. Clinical signs ranged from overt weakness and muscle atrophy in 2 horses age 2 and 3 years, to recumbency with inability to rise in 6 horses age 4-21 years. In 5 horses there was mild to severe increases in muscle enzyme levels. Clinical diagnoses included equine motor neuron disease (2 horses), post anaesthetic myopathy (2 horses), exertional myopathy (2 horses), myopathy due to unknown (one horse), and equine protozoal myelitis (one horse). Characteristic histopathology of muscle from affected horses was the presence of excessive complex polysaccharide and/or glycogen, revealed by periodic acid-Schiff staining in all cases and by electron microscopy in one case. Evaluation of frozen section histochemistry performed on 2 cases indicated that affected fibres were Type 2 glycolytic fibres. Subsarcolemmal and intracytoplasmic vacuoles were most prominent in 3 horses age 2-4 years, and excessive glycogen, with little or no complex polysaccharide, was the primary compound stored in affected muscle in these young horses. Myopathic changes, including fibre size variation, fibre hypertrophy, internal nuclei, and interstitial fat infiltration, were most prominent in 5 horses age 6-21 years, and the accumulation of complex polysaccharide appeared to increase with age. Mild to moderate segmental myofibre necrosis was present in all cases.
... alternating episodes of twitching and stiffness; and stiff-man syndrome: characterized by episodes of rigidity and reflex spasms common muscle cramps and stiffness, and tetany: characterized by prolonged spasms of the arms and legs × Definition The myopathies are neuromuscular disorders in which the ...
Adult-onset nemaline myopathy presenting as respiratory failure.
LENUS (Irish Health Repository)
Kelly, Emer
2008-11-01
Nemaline myopathy is a rare congenital myopathy that generally presents in childhood. We report a case of a 44-year-old man who presented with severe hypoxic hypercapnic respiratory failure as the initial manifestation of nemaline myopathy. After starting noninvasive ventilation, his pulmonary function test results improved substantially, and over the 4 years since diagnosis his respiratory function remained stable. There are few reported cases of respiratory failure in patients with adult-onset nemaline myopathy, and the insidious onset in this case is even more unusual. This case highlights the varied presenting features of adult-onset nemaline myopathy and that noninvasive ventilation improves respiratory function.
Miopatia ocular descendente Descending ocular myopathy: a case report
Directory of Open Access Journals (Sweden)
Marcos R. G. de Freitas
1975-06-01
Full Text Available Os autores apresentam caso de paciente jovem, do sexo feminino, com afecção muscular primária ocular e faríngea sem caráter familial. Foram feitos estudos eletromiográficos e histopatológicos musculares que confirmam o caráter miogênico do processo. É feita comparação entre a miopatia ocular e a miopatia ocular descendente, acreditando os autores que seriam variantesThe case of a 23 years old female patient, with primary involvement of the extraocular and faringeal muscles without familiar history is reported. Electromyographic and muscular biopsy studies proved the myogenic nature of the process. A clinical comparison between the ocular myopathy and the descending ocular myopathy is made, the authors thinking that both of them would be variants of the same muscle disease.
Saroja, Aralikatte Onkarappa; Naik, Karkal Ravishankar; Nalini, Atcharayam; Gayathri, Narayanappa
2013-10-01
Bethlem myopathy and Ullrich congenital muscular dystrophy form a spectrum of collagenopathies caused by genetic mutations encoding for any of the three subunits of collagen VI. Bethlem phenotype is relatively benign and is characterized by proximal dominant myopathy, keloids, contractures, distal hyperextensibility, and follicular hyperkeratosis. Three patients from a single family were diagnosed to have Bethlem myopathy based on European Neuromuscular Centre Bethlem Consortium criteria. Affected father and his both sons had slowly progressive proximal dominant weakness and recurrent falls from the first decade. Both children aged 18 and 20 years were ambulant at presentation. All had flexion contractures, keloids, and follicular hyperkeratosis without muscle hypertrophy. Creatinine kinase was mildly elevated and electromyography revealed myopathic features. Muscle imaging revealed severe involvement of glutei and vasti with "central shadow" in rectus femoris. Muscle biopsy in the father showed dystrophic changes with normal immmunostaining for collagen VI, sarcoglycans, and dysferlin.
Directory of Open Access Journals (Sweden)
Aralikatte Onkarappa Saroja
2013-01-01
Full Text Available Bethlem myopathy and Ullrich congenital muscular dystrophy form a spectrum of collagenopathies caused by genetic mutations encoding for any of the three subunits of collagen VI. Bethlem phenotype is relatively benign and is characterized by proximal dominant myopathy, keloids, contractures, distal hyperextensibility, and follicular hyperkeratosis. Three patients from a single family were diagnosed to have Bethlem myopathy based on European Neuromuscular Centre Bethlem Consortium criteria. Affected father and his both sons had slowly progressive proximal dominant weakness and recurrent falls from the first decade. Both children aged 18 and 20 years were ambulant at presentation. All had flexion contractures, keloids, and follicular hyperkeratosis without muscle hypertrophy. Creatinine kinase was mildly elevated and electromyography revealed myopathic features. Muscle imaging revealed severe involvement of glutei and vasti with "central shadow" in rectus femoris. Muscle biopsy in the father showed dystrophic changes with normal immmunostaining for collagen VI, sarcoglycans, and dysferlin.
BAG3-related myopathy, polyneuropathy and cardiomyopathy with long QT syndrome.
Kostera-Pruszczyk, Anna; Suszek, Małgorzata; Płoski, Rafał; Franaszczyk, Maria; Potulska-Chromik, Anna; Pruszczyk, Piotr; Sadurska, Elżbieta; Karolczak, Justyna; Kamińska, Anna M; Rędowicz, Maria Jolanta
2015-12-01
BAG3 belongs to BAG family of molecular chaperone regulators interacting with HSP70 and anti-apoptotic protein Bcl-2. It is ubiquitously expressed with strong expression in skeletal and cardiac muscle, and is involved in a panoply of cellular processes. Mutations in BAG3 and aberrations in its expression cause fulminant myopathies, presenting with progressive limb and axial muscle weakness, and respiratory insufficiency and neuropathy. Herein, we report a sporadic case of a 15-years old girl with symptoms of myopathy, demyelinating polyneuropathy and asymptomatic long QT syndrome. Genetic testing demonstrated heterozygous mutation Pro209Leu (c.626C > T) in exon 3 of BAG3 gene causing severe myopathy and neuropathy, often associated with restrictive cardiomyopathy. We did not find a mutation in any known LQT syndrome genes. Analysis of muscle biopsy revealed profound disintegration of Z-discs with extensive accumulation of granular debris and large inclusions within fibers. We demonstrated profound alterations in BAG3 distribution as the protein localized to long filamentous structures present across the fibers that were positively stained not only for α-actinin but also for desmin and filamin indicating that those disintegrated Z-disc regions contained also other sarcomeric proteins. The mutation caused a decrease in the content of BAG3 and HSP70, and also of α-actinin desmin, filamin and fast myosin heavy chain, confirming its severe effect on the muscle fiber morphology and thus function. We provide further evidence that BAG3 is associated with Z-disc maintenance, and the Pro209Leu mutation may occur worldwide. We also provide a summary of cases associated with this mutation reported so far.
Myopathies of endocrine disorders: A prospective clinical and biochemical study
Directory of Open Access Journals (Sweden)
Vikas Sharma
2014-01-01
Full Text Available Introduction: Major categories of endocrine myopathy include those associated with: Adrenal dysfunction (as in Cushing′s disease or steroid myopathy; thyroid dysfunction (as in myxedema coma or thyrotoxic myopathy; vitamin D deficiency; parathyroid dysfunction; and pituitary dysfunction. Steroid myopathy is the most common endocrine myopathy. Objective: To study the etiology, varied presentations, and outcome after therapy of patients with endocrine myopathies. Materials and Methods: Myopathy was evaluated by the standard clinical procedures: Detailed clinical history, manual muscle strength testing, and creatine phosphokinase (CPK. Endocrine disorders were diagnosed as per clinical features and biochemical parameters. The treatment was given to patients as per underlying endocrine disease. Myopathy was assessed before and after treatment. Results: Out of the 37 patients who were diagnosed with endocrine myopathies, thyroid dysfunction was the most common cause (17 cases, followed by vitamin D deficiency in nine, adrenal dysfunction in six, parathyroid dysfunction in three, and pituitary dysfunction in two. Some patients had atypical presentation (repeated falls in one, tongue fasciculations in one, neck weakness in five, one with ptosis and facial weakness, asymmetrical onset in one, and calf hypertrophy in one. The serum creatine kinase (CK concentration did not correlate with muscle weakness. Following the treatment regimen which was specific for a given myopathy, 26 patients recovered fully. Conclusion: We found varied clinical presentations of endocrine myopathies. All the patients with neuromuscular complaints should be investigated for endocrine causes because significant number of them recovers fully with specific treatment.
Systemic calciphylaxis presenting as a painful, proximal myopathy.
Edelstein, C. L.; Wickham, M. K.; Kirby, P. A.
1992-01-01
A renal transplant patient who presented with a painful, proximal myopathy due to systemic calciphylaxis is described. The myopathy preceded the characteristic skin and soft tissue necrosis. Systemic calciphylaxis should be considered in a dialysis or a renal transplant patient presenting with a painful proximal myopathy even in the absence of necrotic skin lesions.
Muscle MRI in neutral lipid storage disease with myopathy carrying mutation c.187+1G>A.
Xu, Chunxiao; Zhao, Yawen; Liu, Jing; Zhang, Wei; Wang, Zhaoxia; Yuan, Yun
2015-06-01
We describe the clinical and muscle MRI changes in 2 siblings with neutral lipid storage disease with myopathy (NLSDM) carrying the mutation c.187+1G>A. Peripheral blood smears, genetic tests, and muscle biopsies were performed. Thigh MRI was performed to observe fatty replacement, muscle edema, and muscle bulk from axial sections. Both siblings had similar fatty infiltration and edema. T1-weighted images of the gluteus maximus, adductor magnus, semitendinosus, and semimembranosus revealed marked and diffuse fatty infiltration. There was asymmetric involvement in biceps femoris and quadriceps. There was extensive fatty infiltration in the quadriceps, except for the rectus femoris. Gracilis and sartorius were relatively spared. Thigh muscle volume was decreased, while the gracilis and sartorius appeared to show compensatory hypertrophy. Compared with previous reports in NLSDM, MRI changes in this myopathy tended to be more severe. Asymmetry and relatively selective fatty infiltration were characteristics. © 2014 Wiley Periodicals, Inc.
Treatment Opportunities in Patients With Metabolic Myopathies
DEFF Research Database (Denmark)
Ørngreen, Mette Cathrine; Vissing, John
2017-01-01
the development of new therapeutic options. Enzyme replacement therapy with rGAA has revolutionized treatment of early onset Pompe disease. Supplements of riboflavin, carnitine, and sucrose show promise in patients with respectively riboflavin-responsive multiple acyl-CoA dehydrogenase deficiency, primary...... carnitine deficiency, and McArdle disease. Treatment with citric acid cycle intermediates supply by triheptanoin seems promising in patients with glucogenoses, and studies are ongoing in patients with McArdle disease. Summary Treatment of metabolic myopathies primarily relies on avoiding precipitating...
Idiopathic Inflammatory Myopathies: An update
Directory of Open Access Journals (Sweden)
Bulent KURT
2016-06-01
Full Text Available Idiopathic inflammatory myopathies (IIM are a heterogeneous group of disease with complex clinical features. It has been sub-classified as: (1 Dermatomyositis, (2 Polymyositis, and (3 Inclusion body myositis (IBM. Nowadays, there are some studies in literature suggest necrotizing autoimmune myopathy and immune-mediated necrotizing myopathy should also be added to this group of disease. There is a debate in the diagnosis of IIMs and up until now, about 12 criteria systems have been proposed. Some of the criteria systems have been used widely such as Griggs et al.'s proposal for IBM. Clinical findings, autoantibodies, enzymes, electrophysiological, and muscle biopsy findings are diagnostic tools. Because of diseases' complexity, none of the findings are diagnostic alone. In this study, we discussed the diagnostic criteria of IMMs and described detailed morphological features. [J Interdiscipl Histopathol 2016; 4(2.000: 41-45
Spectrum of metabolic myopathies.
Angelini, Corrado
2015-04-01
Metabolic myopathies are disorders of utilization of carbohydrates or fat in muscles. The acute nature of energy failure is manifested either by a metabolic crisis with weakness, sometimes associated with respiratory failure, or by myoglobinuria. A typical disorder where permanent weakness occurs is glycogenosis type II (GSDII or Pompe disease) both in infantile and late-onset forms, where respiratory insufficiency is manifested by a large number of cases. In GSDII the pathogenetic mechanism is still poorly understood, and has to be attributed more to structural muscle alterations, possibly in correlation to macro-autophagy, rather than to energetic failure. This review is focused on recent advances about GSDII and its treatment, and the most recent notions about the management and treatment of other metabolic myopathies will be briefly reviewed, including glycogenosis type V (McArdle disease), glycogenosis type III (debrancher enzyme deficiency or Cori disease), CPT-II deficiency, and ETF-dehydrogenase deficiency (also known as riboflavin-responsive multiple acyl-CoA dehydrogenase deficiency or RR-MADD). The discovery of the genetic defect in ETF dehydrogenase confirms the etiology of this syndrome. Other metabolic myopathies with massive lipid storage and weakness are carnitine deficiency, neutral lipid storage-myopathy (NLSD-M), besides RR-MADD. Enzyme replacement therapy is presented with critical consideration and for each of the lipid storage disorders, representative cases and their response to therapy is included. This article is part of a Special Issue entitled: Neuromuscular Diseases: Pathology and Molecular Pathogenesis. Copyright © 2014. Published by Elsevier B.V.
Mitochondrial myopathy presenting as fibromyalgia: a case report
Directory of Open Access Journals (Sweden)
Abdullah Mishal
2012-02-01
Full Text Available Abstract Introduction To the best of our knowledge, we describe for the first time the case of a woman who met the diagnostic criteria for fibromyalgia, did not respond to therapy for that disorder, and was subsequently diagnosed by biochemical and genetic studies with a mitochondrial myopathy. Treatment of the mitochondrial myopathy resulted in resolution of symptoms. This case demonstrates that mitochondrial myopathy may present in an adult with a symptom complex consistent with fibromyalgia. Case presentation Our patient was a 41-year-old Caucasian woman with symptoms of fatigue, exercise intolerance, headache, and multiple trigger points. Treatment for fibromyalgia with a wide spectrum of medications including non-steroidal anti-inflammatory drugs, antidepressants, gabapentin and pregabalin had no impact on her symptoms. A six-minute walk study demonstrated an elevated lactic acid level (5 mmol/L; normal Conclusions This case demonstrates that adults diagnosed with fibromyalgia may have their symptom complex related to an adult onset mitochondrial myopathy. This is an important finding since treatment of mitochondrial myopathy resulted in resolution of symptoms.
Statin-associated immune-mediated myopathy: biology and clinical implications.
Christopher-Stine, Lisa; Basharat, Pari
2017-04-01
In the last 6 years, our understanding of statin-associated myopathy expanded to include not only a toxic myopathy with limited and reversible side-effects but also an autoimmune variety in which statins likely induce an autoimmune myopathy that is both associated with a specific autoantibody and responsive to immunosuppression and immune modulation. This review widens the reader's understanding of statin myopathy to include an autoimmune process. Statin-associated immune-mediated myopathy provides an example of an environmental trigger (statins) directly implicated in an autoimmune disease associated with a genetic predisposition as well as potential risk factors including concomitant diseases and specific statins. Given a median exposure to statins of 38 months, providers should be aware that anti-3-hydroxy-3-methyl-glutaryl-coenzyme A reductase (HMGCR) myopathy may occur even after several years of statin exposure. It is important for the reader to understand the clinical presentation of statin-associated immune-mediated myopathy and the difference in its clinical presentation to that of statins as direct myotoxins. Prompt recognition of such an entity allows the clinician to immediately stop the offending agent if it has not already been discontinued as well as to recognize that statin rechallenge is not a likely option, and that prompt treatment with immunosuppression and/or immunomodulation is usually of enormous benefit to the patient in restoring muscle strength and physical function. VIDEO ABSTRACT.
A study of acute muscle dysfunction with particular reference to dengue myopathy
Directory of Open Access Journals (Sweden)
Rajesh Verma
2017-01-01
; dermatomyositis, polymyositis, thyrotoxicosis, systemic lupus erythematosus, and unknown etiology in one each. Only eight patients had abnormal electrophysiology and seven among nine biopsies done were abnormal. At 1 month, 24 (80.0% and 23 (76.7% patients had achieved normal MBI and MRS scores with 28 (93.3 and 27 (90% patients, respectively, at 3 months. Dengue with hypokalemia had less myalgia, more of hyporeflexia, and lower serum CK compared to those without hypokalemia. Conclusion: Dengue infection and hypokalemia due to various causes are the most common causes of acute myopathy and are associated with rapid and complete recovery within 1 month. Shorter duration of illness, higher MRC sum score, better disability status at presentation, lower serum CK correlate with better outcome. Biopsy was decisive in <20% cases; hence, it is not primary investigation in acute myopathy.
Mitochondrial Myopathy: A Rare Cause of Early-Onset Vocal Fold Atrophy
Kelly, Elizabeth A.; Bock, Jonathan M.; Peltier, Amanda C.; Oh, Shin J.; Garrett, C. Gaelyn
2014-01-01
Objectives We present the second published case of laryngeal involvement in mitochondrial myopathy. Methods A patient with laryngeal involvement of mitochondrial myopathy is presented, together with a literature review. Results A 41-year-old man presented with progressive breathy dysphonia. His brother had mitochondrial myopathy. Biopsy of the biceps muscle demonstrated cytochrome C oxidase–negative ragged blue fibers confirming mitochondrial myopathy. Videostroboscopy showed marked vocal fold atrophy, but subsequent injection laryngoplasty did not significantly improve the patient’s voice, despite improved postoperative glottic closure. Conclusions Mitochondrial myopathy should be considered in the differential diagnosis of severe early-onset vocal fold atrophy. PMID:23577570
An integrated diagnosis strategy for congenital myopathies.
Directory of Open Access Journals (Sweden)
Johann Böhm
Full Text Available Congenital myopathies are severe muscle disorders affecting adults as well as children in all populations. The diagnosis of congenital myopathies is constrained by strong clinical and genetic heterogeneity. Moreover, the majority of patients present with unspecific histological features, precluding purposive molecular diagnosis and demonstrating the need for an alternative and more efficient diagnostic approach. We used exome sequencing complemented by histological and ultrastructural analysis of muscle biopsies to identify the causative mutations in eight patients with clinically different skeletal muscle pathologies, ranging from a fatal neonatal myopathy to a mild and slowly progressive myopathy with adult onset. We identified RYR1 (ryanodine receptor mutations in six patients and NEB (nebulin mutations in two patients. We found novel missense and nonsense mutations, unraveled small insertions/deletions and confirmed their impact on splicing and mRNA/protein stability. Histological and ultrastructural findings of the muscle biopsies of the patients validated the exome sequencing results. We provide the evidence that an integrated strategy combining exome sequencing with clinical and histopathological investigations overcomes the limitations of the individual approaches to allow a fast and efficient diagnosis, accelerating the patient's access to a better healthcare and disease management. This is of particular interest for the diagnosis of congenital myopathies, which involve very large genes like RYR1 and NEB as well as genetic and phenotypic heterogeneity.
International Nuclear Information System (INIS)
Schaefer, William H.; Lawrence, Jeffery W.; Loughlin, Amy F.; Stoffregen, Dana A.; Mixson, Lori A.; Dean, Dennis C.; Raab, Conrad E.; Yu, Nathan X.; Lankas, George R.; Frederick, Clay B.
2004-01-01
with circulating CK levels in treated animals. The results of this study suggest that neither mitochondrial injury, nor a decrease in muscle ubiquinone levels, is the primary cause of skeletal myopathy in cerivastatin-dosed rats
Acute steroid myopathy: a highly overlooked entity.
Haran, Michal; Schattner, Ami; Kozak, Natasha; Mate, Andras; Berrebi, Alain; Shvidel, Lev
2018-02-15
Myopathy in patients being treated with corticosteroids is known primarily among chronically-treated patients or in critically ill and mechanically-ventilated patients receiving corticosteroids, often in high doses. To highlight the entity of acute, early-onset corticosteroid-treatment-associated myopathy and its characteristics. Reporting our experience with four patients and reviewing all published reports of myopathy developing ≤14 days of initiating corticosteroid-treatment. Acute corticosteroid myopathy (ASM) exists, though the syndrome appears to be rare. It is characterized by unpredictability and heterogeneity, sometimes developing within 1-3 days, after a single dose, which may not be high and administered by varied routes. Proximal limb muscle weakness is the most common form, but distal limb, bulbar and respiratory muscles may be involved. Steroid cessation often leads to improvement/resolution, but irreversibility may occur. A high index of suspicion for the possibility of ASM is necessary, to ensure drug discontinuation and recovery. This is particularly true since the entity is not widely recognized and its symptoms are often erroneously interpreted as due to the patient's underlying disease.
Statin Induced Myopathy a Patient with Multiple Systemic Diseases
Directory of Open Access Journals (Sweden)
Özgül Uçar
2011-04-01
Full Text Available Hydroxymethylglutaryl-coenzyme A reductase inhibitors (statins are the most successful class of drugs for the treatment of hypercholesterolaemia and dyslipidaemia. However, the popular profile of statins in terms of efficacy has been maligned by theiradverse effects. Statin induced myopathy, which can be seen at any time during the course of therapy, is a clinically important cause of statin intolerance and discontinuation. When a patient with multiple systemic diseases who use numerous medications represent with myalgia and muscle cramps, statin induced myopathy may not be remembered at first. We present a patient with multiple systemic diseases, alcohol and morphine abuse in whom myopathy developed. After exclusion of other etiologies, we concluded that myopathy was related to statin therapy.
International Nuclear Information System (INIS)
Edstroem, L.; Wroblewski, R.; Mair, W.G.
1982-01-01
Two patients, a father and his 14-year-old son, were suffering from a facioperoneal syndrome, and muscle biopsy findings were consistent with a myotubular myopathy. The father exhibited central nuclei in most muscle fibers, but his son had typical changes exclusively in hypotrophic type I fibers. The cytochemical and ultrastructural analysis revealed a spectrum of pathological changes typical of myotubular myopathy. Energy-dispersive electron probe x-ray microanalysis was performed on 6- to 12-microns thick freeze-dried cryosections visualized in the scanning or scanning transmission mode of electron microscopy. We found a high intracellular sodium and chlorine concentration and a low potassium concentration in comparison with control muscles. These changes pointed in the direction similar to results from human fetal muscle. The changes in the intracellular elemental composition may indicate a membrane pump dysfunction, which might be caused by a partial arrest in muscle fiber maturation
Is Vitamin D Deficiency a Confounder in Alcoholic Skeletal Muscle Myopathy?
Wijnia, J.W.; Wielders, J.P.M.; Lips, P.T.A.M.; van der Wiel, A.; Mulder, C.L.; Nieuwenhuis, K.G.A.
2013-01-01
Background: Excessive intake of alcohol is often associated with low or subnormal levels of vitamin D even in the absence of active liver disease. As vitamin D deficiency is a well-recognized cause of myopathy, alcoholic myopathy might be related to vitamin D deficiency. Chronic alcoholic myopathy
Immune-mediated statin myopathy.
Loganathan, Priyadarshini; Oddis, Chester V; Aggarwal, Rohit
2016-01-01
Statin-induced necrotizing autoimmune myopathy (SINAM) is associated with a unique clinical 5 phenotype of severe proximal muscle weakness during or after exposure to statins in patients with high creatine kinase (CK) levels. Electromyography (EMG) and muscle biopsy reveal features of a necrotizing myopathy and the anti-HMGCR autoantibody is frequently detected. Treatment requires a combination of statin discontinuation as well as immunomodulatory or immunosuppressive therapy. HLA typing (HLADRB1*1101) is strongly associated with anti-10 HMGCR autoantibody positivity in statin-exposed patients. It is well documented that statin triggers autoimmune disease in those with a genetic susceptibility. With the commercial availability of an accurate ELISA test, the natural history of the disease and its phenotypic features are becoming increasingly understood.
Bethlem myopathy is not allelic to limb-girdle muscular dystrophy type 1A
Energy Technology Data Exchange (ETDEWEB)
Speer, M.C.; Yamaoka, L.H.; Stajich, J.; Lewis, K. [and others
1995-08-28
The Bethlem myopathy, an autosomal-dominant myopathy, shows a distribution of proximal muscle weakness similar to that observed in dominant limb-girdle muscular dystrophy (LGMD). Yet the Bethlem myopathy differs from most limb-girdle dystrophies in two important regards. First, the Bethlem myopathy presents with joint contractures most commonly observed at the elbows, ankles, and neck. Secondly, disease onset in the Bethlem myopathy is in early childhood, while most dominant LGMDs present with adult onset. 6 refs., 1 fig.
International Nuclear Information System (INIS)
Zvaritch, Elena; MacLennan, David H.
2015-01-01
Muscle spindles from the hind limb muscles of adult Ryr1 I4895T/wt (IT/+) mice exhibit severe structural abnormalities. Up to 85% of the spindles are separated from skeletal muscle fascicles by a thick layer of connective tissue. Many intrafusal fibers exhibit degeneration, with Z-line streaming, compaction and collapse of myofibrillar bundles, mitochondrial clumping, nuclear shrinkage and pyknosis. The lesions resemble cores observed in the extrafusal myofibers of this animal model and of core myopathy patients. Spindle abnormalities precede those in extrafusal fibers, indicating that they are a primary pathological feature in this murine Ryr1-related core myopathy. Muscle spindle involvement, if confirmed for human core myopathy patients, would provide an explanation for an array of devastating clinical features characteristic of these diseases and provide novel insights into the pathology of RYR1-related myopathies. - Highlights: • Muscle spindles exhibit structural abnormalities in a mouse model of core myopathy. • Myofibrillar collapse and mitochondrial clumping is observed in intrafusal fibers. • Myofibrillar degeneration follows a pattern similar to core formation in extrafusal myofibers. • Muscle spindle abnormalities are a part of the pathological phenotype in the mouse model of core myopathy. • Direct involvement of muscle spindles in the pathology of human RYR1-related myopathies is proposed
Association between statin-associated myopathy and skeletal muscle damage.
Mohaupt, Markus G; Karas, Richard H; Babiychuk, Eduard B; Sanchez-Freire, Verónica; Monastyrskaya, Katia; Iyer, Lakshmanan; Hoppeler, Hans; Breil, Fabio; Draeger, Annette
2009-07-07
Many patients taking statins often complain of muscle pain and weakness. The extent to which muscle pain reflects muscle injury is unknown. We obtained biopsy samples from the vastus lateralis muscle of 83 patients. Of the 44 patients with clinically diagnosed statin-associated myopathy, 29 were currently taking a statin, and 15 had discontinued statin therapy before the biopsy (minimal duration of discontinuation 3 weeks). We also included 19 patients who were taking statins and had no myopathy, and 20 patients who had never taken statins and had no myopathy. We classified the muscles as injured if 2% or more of the muscle fibres in a biopsy sample showed damage. Using reverse transcriptase polymerase chain reaction, we evaluated the expression levels of candidate genes potentially related to myocyte injury. Muscle injury was observed in 25 (of 44) patients with myopathy and in 1 patient without myopathy. Only 1 patient with structural injury had a circulating level of creatine phosphokinase that was elevated more than 1950 U/L (10x the upper limit of normal). Expression of ryanodine receptor 3 was significantly upregulated in patients with biopsy evidence of structural damage (1.7, standard error of the mean 0.3). Persistent myopathy in patients taking statins reflects structural muscle damage. A lack of elevated levels of circulating creatine phosphokinase does not rule out structural muscle injury. Upregulation of the expression of ryanodine receptor 3 is suggestive of an intracellular calcium leak.
Meeting the challenges in the diagnosis of inflammatory myopathies ...
African Journals Online (AJOL)
Conditions that mimic IM include other causes of myopathy such as endocrine disorders, adverse effects of medication, metabolic myopathies and muscle dystrophies. Atypical features suggesting an alternative diagnosis are acute onset, severe pain, assymmetrical involvement, distal weakness and wasting. Appropriate ...
Atypical presentation of GNE myopathy with asymmetric hand weakness
de Dios, John Karl L.; Shrader, Joseph A.; Joe, Galen O.; McClean, Jeffrey C.; Williams, Kayla; Evers, Robert; Malicdan, May Christine V.; Ciccone, Carla; Mankodi, Ami; Huizing, Marjan; McKew, John C.; Bluemke, David A.; Gahl, William A.; Carrillo-Carrasco, Nuria
2014-01-01
GNE myopathy is a rare autosomal recessive muscle disease caused by mutations in GNE, the gene encoding the rate-limiting enzyme in sialic acid biosynthesis. GNE myopathy usually manifests in early adulthood with distal myopathy that progresses slowly and symmetrically, first involving distal muscles of the lower extremities, followed by proximal muscles with relative sparing of the quadriceps. Upper extremities are typically affected later in the disease. We report a patient with GNE myopathy who presented with asymmetric hand weakness. He had considerably decreased left grip strength, atrophy of the left anterior forearm and fibro-fatty tissue replacement of left forearm flexor muscles on T1-weighted magnetic resonance imaging. The patient was an endoscopist and thus the asymmetric hand involvement may be associated with left hand overuse in daily repetitive pinching and gripping movements, highlighting the possible impact of environmental factors on the progression of genetic muscle conditions. PMID:25182749
Congenital myopathy is caused by mutation of HACD1.
Muhammad, Emad; Reish, Orit; Ohno, Yusuke; Scheetz, Todd; Deluca, Adam; Searby, Charles; Regev, Miriam; Benyamini, Lilach; Fellig, Yakov; Kihara, Akio; Sheffield, Val C; Parvari, Ruti
2013-12-20
Congenital myopathies are heterogeneous inherited diseases of muscle characterized by a range of distinctive histologic abnormalities. We have studied a consanguineous family with congenital myopathy. Genome-wide linkage analysis and whole-exome sequencing identified a homozygous non-sense mutation in 3-hydroxyacyl-CoA dehydratase 1 (HACD1) in affected individuals. The mutation results in non-sense mediated decay of the HACD1 mRNA to 31% of control levels in patient muscle and completely abrogates the enzymatic activity of dehydration of 3-hydroxyacyl-CoA, the third step in the elongation of very long-chain fatty acids (VLCFAs). We describe clinical findings correlated with a deleterious mutation in a gene not previously known to be associated with congenital myopathy in humans. We suggest that the mutation in the HACD1 gene causes a reduction in the synthesis of VLCFAs, which are components of membrane lipids and participants in physiological processes, leading to congenital myopathy. These data indicate that HACD1 is necessary for muscle function.
Autosomal dominant distal myopathy: Linkage to chromosome 14
Energy Technology Data Exchange (ETDEWEB)
Laing, N.G.; Laing, B.A.; Wilton, S.D.; Dorosz, S.; Mastaglia, F.L.; Kakulas, B.A. [Australian Neuromuscular Research Institute, Perth (Australia); Robbins, P.; Meredith, C.; Honeyman, K.; Kozman, H.
1995-02-01
We have studied a family segregating a form of autosomal dominant distal myopathy (MIM 160500) and containing nine living affected individuals. The myopathy in this family is closest in clinical phenotype to that first described by Gowers in 1902. A search for linkage was conducted using microsatellite, VNTR, and RFLP markers. In total, 92 markers on all 22 autosomes were run. Positive linkage was obtained with 14 of 15 markers tested on chromosome 14, with little indication of linkage elsewhere in the genome. Maximum two-point LOD scores of 2.60 at recombination fraction .00 were obtained for the markers MYH7 and D14S64 - the family structure precludes a two-point LOD score {ge} 3. Recombinations with D14S72 and D14S49 indicate that this distal myopathy locus, MPD1, should lie between these markers. A multipoint analysis assuming 100% penetrance and using the markers D14S72, D14S50, MYH7, D14S64, D14S54, and D14S49 gave a LOD score of exactly 3 at MYH7. Analysis at a penetrance of 80% gave a LOD score of 2.8 at this marker. This probable localization of a gene for distal myopathy, MPD1, on chromosome 14 should allow other investigators studying distal myopathy families to test this region for linkage in other types of the disease, to confirm linkage or to demonstrate the likely genetic heterogeneity. 24 refs., 3 figs., 1 tab.
The expanding phenotype of mitochondrial myopathy.
DiMauro, Salvatore; Gurgel-Giannetti, Juliana
2005-10-01
Our understanding of mitochondrial diseases (defined restrictively as defects in the mitochondrial respiratory chain) continues to progress apace. In this review we provide an update of information regarding disorders that predominantly or exclusively affect skeletal muscle. Most recently described mitochondrial myopathies are due to defects in nuclear DNA, including coenzyme Q10 deficiency, and mutations in genes that control mitochondrial DNA (mtDNA) abundance and structure such as POLG and TK2. Barth syndrome, an X-linked recessive mitochondrial myopathy/cardiopathy, is associated with altered lipid composition of the inner mitochondrial membrane, but a putative secondary impairment of the respiratory chain remains to be documented. Concerning the 'other genome', the role played by mutations in protein encoding genes of mtDNA in causing isolated myopathies has been confirmed. It has also been confirmed that mutations in tRNA genes of mtDNA can cause predominantly myopathic syndromes and - contrary to conventional wisdom - these mutations can be homoplasmic. Defects in the mitochondrial respiratory chain impair energy production and almost invariably involve skeletal muscle, causing exercise intolerance, myalgia, cramps, or fixed weakness, which often affects extraocular muscles and results in droopy eyelids (ptosis) and progressive external ophthalmoplegia.
Refractory Hyperlactatemia with Organ Insufficiency in Lipid Storage Myopathy.
Xu, Yuanda; Zhou, Li; Liang, Weibo; He, Weiqun; Liu, Xiaoqing; Liang, Xiuling; Zhong, Nanshan; Li, Yimin
2015-08-01
Lipid storage myopathy is a metabolic disorder characterized by abnormal lipid accumulation in muscle fibers and progressive muscle weakness. Here, we report the case of a 17-year-old woman with progressive muscle weakness, refractory hyperlactatemia, and multiple organ insufficiency. Severe pneumonia was the initial diagnosis. After anti-infective treatment, fluid resuscitation, and mechanical ventilation, the patient's symptoms improved but hyperlactatemia and muscle weakness persisted. She was empirically treated with carnitine. Biochemical tests, electromyography, and muscle biopsy confirmed lipid storage myopathy. After 7 weeks of treatment, the patient resumed normal daily life. An empirical treatment with carnitine may be beneficial for patients before an accurate diagnosis of lipid storage myopathy is made.
A Case Report of Inflammatory Myopathy and Sideroblastic Anemia
Directory of Open Access Journals (Sweden)
F Binesh
2007-01-01
Full Text Available Mitochondrial myopathy, lactic acidosis, and siderobastic anemia (MLA SA syndrome is one of the newly reported mitochondrial diseases, seven cases of which have been reported. We report a child with inflammatory myopathy, sideroblastic anemia and lactic acidosis .The patient is a 8.5 year old boy with normal cognitive function suffering from chronic progressive weakness in lower extremities, inability to walk since four months and pallor. In paraclinical evaluation, sideroblastic anemia, mild lactic acidosis and elevated muscle enzymes were seen. Inflammatory myopathy (myositis in muscle biopsy was detected as well .The patient was administered oral prednisolone, folic acid, B6 and underwent regular physiotherapy. He ambulated after four months and resumed education and schooling.
Mutation Spectrum of GNE Myopathy in the Indian Sub-Continent.
Bhattacharya, Sudha; Khadilkar, Satish V; Nalini, Atchayaram; Ganapathy, Aparna; Mannan, Ashraf U; Majumder, Partha P; Bhattacharya, Alok
GNE myopathy is an adult onset recessive genetic disorder that affects distal muscles sparing the quadriceps. GNE gene mutations have been identified in GNE myopathy patients all over the world. Homozygosity is a common feature in GNE myopathy patients worldwide. The major objective of this study was to investigate the mutation spectrum of GNE myopathy in India in relation to the population diversity in the country. We have collated GNE mutation data of Indian GNE myopathy patients from published literature and from recently identified patients. We also used data of people of Indian subcontinent from 1000 genomes database, South Asian Genome database and Strand Life Science database to determine frequency of GNE mutations in the general population. A total of 67 GNE myopathy patients were studied, of whom 21% were homozygous for GNE variants, while the rest were compound heterozygous. Thirty-five different mutations in the GNE gene were recorded, of which 5 have not been reported earlier. The most frequent mutation was p.Val727Met (65%) found mainly in the heterozygous form. Another mutation, p.Ile618Thr was also common (16%) but was found mainly in patients from Rajasthan, while p.Val727Met was more widely distributed. The latter was also seen at a high frequency in general population of Indian subcontinent in all the databases. It was also present in Thailand but was absent in general population elsewhere in the world. p.Val727Met is likely to be a founder mutation of Indian subcontinent.
Cerebrovascular Accidents In Myopathies
Directory of Open Access Journals (Sweden)
Farzad Fatehi
2017-02-01
Full Text Available Several types of stroke in myopathies are described: ischemic, metabolic, or cryptogenic. Ischemic stroke may be categorized as cardioembolic, angiopathic, hemodynamic, or thrombophilic. Cardiac involvement in the form of atrial fibrillation/flutter, dilated cardiomyopathy, or non-compaction Cardioembolic could ensue in stroke. Angiopathic stroke occurs provided that there is atherosclerosis or mitochondrial disorders. Thrombophilic stroke may happen in polymyositis or dermatomyositis along with anti-phospholipid syndrome. Metabolic stroke usually manifests as stroke-like episode and is a distinct feature of various mitochondrial disorders, principally MELAS syndrome. The clinical manifestations are as a result of a vasogenic edema, demonstrating as hyperintensity on T2, DWI, and apparent diffusion coefficient mapping. Differentiation between ischemic and metabolic stroke is essential in terms of diagnosis, therapy, and prognosis. In conclusion, ischemic stroke attributable to cardioembolism, arteriopathy, or thrombophilia are occasional events in myopathies, but metabolic stroke is a frequent feature of mitochondrial disorders.
Genetics Home Reference: nemaline myopathy
... deformities, abnormal curvature of the spine ( scoliosis ), and joint deformities (contractures). Most people with nemaline myopathy are ... Centre for Rare Diseases Washington University, St. Louis: Neuromuscular Disease Center Patient Support and Advocacy Resources (3 ...
Myopathy With SQSTM1 and TIA1 Variants: Clinical and Pathological Features
Directory of Open Access Journals (Sweden)
Zhiyv Niu
2018-03-01
Full Text Available ObjectiveThe aim of this study is to identify the molecular defect of three unrelated individuals with late-onset predominant distal myopathy; to describe the spectrum of phenotype resulting from the contributing role of two variants in genes located on two different chromosomes; and to highlight the underappreciated complex forms of genetic myopathies.Patients and methodsClinical and laboratory data of three unrelated probands with predominantly distal weakness manifesting in the sixth-seventh decade of life, and available affected and unaffected family members were reviewed. Next-generation sequencing panel, whole exome sequencing, and targeted analyses of family members were performed to elucidate the genetic etiology of the myopathy.ResultsGenetic analyses detected two contributing variants located on different chromosomes in three unrelated probands: a heterozygous pathogenic mutation in SQSTM1 (c.1175C>T, p.Pro392Leu and a heterozygous variant in TIA1 (c.1070A>G, p.Asn357Ser. The affected fraternal twin of one proband also carries both variants, while the unaffected family members harbor one or none. Two unrelated probands (family 1, II.3, and family 3, II.1 have a distal myopathy with rimmed vacuoles that manifested with index extensor weakness; the other proband (family 2, I.1 has myofibrillar myopathy manifesting with hypercapnic respiratory insufficiency and distal weakness.ConclusionThe findings indicate that all the affected individuals have a myopathy associated with both variants in SQSTM1 and TIA1, respectively, suggesting that the two variants determine the phenotype and likely functionally interact. We speculate that the TIA1 variant is a modifier of the SQSTM1 mutation. We identify the combination of SQSTM1 and TIA1 variants as a novel genetic defect associated with myofibrillar myopathy and suggest to consider sequencing both genes in the molecular investigation of myopathy with rimmed vacuoles and myofibrillar myopathy
Myopathy With SQSTM1 and TIA1 Variants: Clinical and Pathological Features.
Niu, Zhiyv; Pontifex, Carly Sabine; Berini, Sarah; Hamilton, Leslie E; Naddaf, Elie; Wieben, Eric; Aleff, Ross A; Martens, Kristina; Gruber, Angela; Engel, Andrew G; Pfeffer, Gerald; Milone, Margherita
2018-01-01
The aim of this study is to identify the molecular defect of three unrelated individuals with late-onset predominant distal myopathy; to describe the spectrum of phenotype resulting from the contributing role of two variants in genes located on two different chromosomes; and to highlight the underappreciated complex forms of genetic myopathies. Clinical and laboratory data of three unrelated probands with predominantly distal weakness manifesting in the sixth-seventh decade of life, and available affected and unaffected family members were reviewed. Next-generation sequencing panel, whole exome sequencing, and targeted analyses of family members were performed to elucidate the genetic etiology of the myopathy. Genetic analyses detected two contributing variants located on different chromosomes in three unrelated probands: a heterozygous pathogenic mutation in SQSTM1 (c.1175C>T, p.Pro392Leu) and a heterozygous variant in TIA1 (c.1070A>G, p.Asn357Ser). The affected fraternal twin of one proband also carries both variants, while the unaffected family members harbor one or none. Two unrelated probands (family 1, II.3, and family 3, II.1) have a distal myopathy with rimmed vacuoles that manifested with index extensor weakness; the other proband (family 2, I.1) has myofibrillar myopathy manifesting with hypercapnic respiratory insufficiency and distal weakness. The findings indicate that all the affected individuals have a myopathy associated with both variants in SQSTM1 and TIA1 , respectively, suggesting that the two variants determine the phenotype and likely functionally interact. We speculate that the TIA1 variant is a modifier of the SQSTM1 mutation. We identify the combination of SQSTM1 and TIA1 variants as a novel genetic defect associated with myofibrillar myopathy and suggest to consider sequencing both genes in the molecular investigation of myopathy with rimmed vacuoles and myofibrillar myopathy although additional studies are needed to investigate the
Statin-Associated Autoimmune Myopathy: A Systematic Review of 100 Cases.
Nazir, Salik; Lohani, Saroj; Tachamo, Niranjan; Poudel, Dilliram; Donato, Anthony
2017-04-01
Statins are a group of drugs that reduce the levels of triglycerides and cholesterol in blood by inhibiting HMG-CoA reductase, an enzyme involved in rate limiting step in cholesterol synthesis. About 2-20% patients on statins develop toxic myopathies, which usually resolve on discontinuation of statin. More recently, an immune-mediated necrotizing myopathy has been found to be associated with statin use which in most cases requires treatment with immunosuppressants. To perform a systematic review on published case reports and case series of statin-associated autoimmune myopathy. A comprehensive search of PUBMED, EMBASE, Cochrane library and ClinicalTrials.gov databases was performed for relevant articles from inception until March 19, 2016 to identify cases of statin-associated necrotizing myopathy and characterize their symptoms, evaluation and response to treatment. A total of 16 articles describing 100 patients with statin-associated autoimmune myopathy were identified. The mean age of presentation was 64.72 years, and 54.44% were males. The main presenting clinical feature was proximal muscle weakness, which was symmetric in 83.33% of patients. The mean creatine kinase (CK) was 6853 IU/l. Anti-HMG-CoA reductase antibody was positive in all cases tested (n = 57/57, 100%). In patients with no anti-HMG-CoA antibody results, diagnosis was established by findings of necrotizing myopathy on biopsy. Among the 83 cases where muscle biopsy information was available, 81.48% had necrosis, while 18.51% had combination of necrosis and inflammation. Most (83.82%) patients received two or more immunosuppressants to induce remission. Ninety-one percent had resolution of symptoms after treatment. Statin-associated necrotizing myopathy is a symmetric proximal muscle weakness associated with extreme elevations of CK. It is common in males and can occur after months of statin use. It is associated with necrosis on muscle biopsy and the presence of anti-HMG-CoA reductase antibodies
White striping and woody breast myopathies in the modern poultry industry: a review.
Kuttappan, V A; Hargis, B M; Owens, C M
2016-11-01
Myopathies are gaining the attention of poultry meat producers globally. White Striping (WS) is a condition characterized by the occurrence of white striations parallel to muscle fibers on breast, thigh, and tender muscles of broilers, while Woody Breast (WB) imparts tougher consistency to raw breast fillets. Histologically, both conditions have been characterized with myodegeneration and necrosis, fibrosis, lipidosis, and regenerative changes. The occurrence of these modern myopathies has been associated with increased growth rate in birds. The severity of the myopathies can adversely affect consumer acceptance of raw cut up parts and/or quality of further processed poultry meat products, resulting in huge economic loss to the industry. Even though gross and/or histologic characteristics of modern myopathies are similar to some of the known conditions, such as hereditary muscular dystrophy, nutritional myopathy, toxic myopathies, and marbling, WS and WB could have a different etiology. As a result, there is a need for future studies to identify markers for WS and WB in live birds and genetic, nutritional, and/or management strategies to alleviate the condition. © 2016 Poultry Science Association Inc.
Absence of anti-HMG-CoA reductase autoantibodies in severe self-limited statin-related myopathy.
Floyd, James S; Brody, Jennifer A; Tiniakou, Eleni; Psaty, Bruce M; Mammen, Andrew
2016-06-01
Patients with self-limited statin-related myopathy improve spontaneously when statins are stopped. In contrast, patients with statin-associated autoimmune myopathy have autoantibodies recognizing 3-hydroxy-3-methyl-glutaryl-coenzyme A reductase (HMGCR) and usually require immunosuppressive therapy to control their disease. On initial presentation, it can sometimes be difficult to distinguish between these 2 diseases, as both present with muscle pain, weakness, and elevated serum creatine kinase (CK) levels. The goal of this study was to determine whether patients with severe self-limited statin-related myopathy also make anti-HMGCR autoantibodies. We screened 101 subjects with severe self-limited cerivastatin-related myopathy for anti-HMGCR autoantibodies. No patient with severe self-limited cerivastatin-related myopathy had anti-HMGCR autoantibodies. Anti-HMGCR autoantibody testing can be used to help differentiate whether a patient has self-limited myopathy due to cerivastatin or autoimmune statin-associated myopathy; these findings may apply to other statins as well. Muscle Nerve 54: 142-144, 2016. © 2016 Wiley Periodicals, Inc.
REV-ERB and ROR: therapeutic targets for treating myopathies
Welch, Ryan D.; Flaveny, Colin A.
2017-08-01
Muscle is primarily known for its mechanical roles in locomotion, maintenance of posture, and regulation of cardiac and respiratory function. There are numerous medical conditions that adversely affect muscle, myopathies that disrupt muscle development, regeneration and protein turnover to detrimental effect. Skeletal muscle is also a vital secretory organ that regulates thermogenesis, inflammatory signaling and directs context specific global metabolic changes in energy substrate preference on a daily basis. Myopathies differ in the causative factors that drive them but share common features including severe reduction in quality of life and significantly increased mortality all due irrefutably to the loss of muscle mass. Thus far clinically viable approaches for preserving muscle proteins and stimulating new muscle growth without unwanted side effects or limited efficacy has been elusive. Over the last few decades, evidence has emerged through in vitro and in vivo studies that suggest the nuclear receptors REV-ERB and ROR might modulate pathways involved in myogenesis and mitochondrial biogenesis. Hinting that REV-ERB and ROR might be targeted to treat myopathies. However there is still a need for substantial investigation into the roles of these nuclear receptors in in vivo rodent models of degenerative muscle diseases and acute injury. Although exciting, REV-ERB and ROR have somewhat confounding roles in muscle physiology and therefore more studies utilizing in vivo models of skeletal muscle myopathies are needed. In this review we highlight the molecular forces driving some of the major degenerative muscular diseases and showcase two promising molecular targets that may have the potential to treat myopathies: ROR and REV-ERB.
Papazian, Óscar; Rivas-Chacón, Rafael
2013-09-06
To review the metabolic myopathies manifested only by crisis of myalgias, cramps and rigidity of the muscles with decreased voluntary contractions and normal inter crisis neurologic examination in children and adolescents. These metabolic myopathies are autosomic recessive inherited enzymatic deficiencies of the carbohydrates and lipids metabolisms. The end result is a reduction of intra muscle adenosine triphosphate, mainly through mitochondrial oxidative phosphorylation, with decrease of available energy for muscle contraction. The one secondary to carbohydrates intra muscle metabolism disorders are triggered by high intensity brief (fatty acids metabolism disorders are triggered by low intensity prolonged (> 10 min) exercises. The conditions in the first group in order of decreasing frequency are the deficiencies of myophosforilase (GSD V), muscle phosphofructokinase (GSD VII), phosphoglycerate mutase 1 (GSD X) and beta enolase (GSD XIII). The conditions in the second group in order of decreasing frequency are the deficiencies of carnitine palmitoyl transferase II and very long chain acyl CoA dehydrogenase. The differential characteristics of patients in each group and within each group will allow to make the initial presumptive clinical diagnosis in the majority and then to order only the necessary tests to achieve the final diagnosis. Treatment during the crisis includes hydration, glucose and alkalinization of urine if myoglobin in blood and urine are elevated. Prevention includes avoiding exercise which may induce the crisis and fasting. The prognosis is good with the exception of rare cases of acute renal failure due to hipermyoglobinemia because of severe rabdomyolisis.
Myofibrillar myopathies: State of the art, present and future challenges.
Béhin, A; Salort-Campana, E; Wahbi, K; Richard, P; Carlier, R-Y; Carlier, P; Laforêt, P; Stojkovic, T; Maisonobe, T; Verschueren, A; Franques, J; Attarian, S; Maues de Paula, A; Figarella-Branger, D; Bécane, H-M; Nelson, I; Duboc, D; Bonne, G; Vicart, P; Udd, B; Romero, N; Pouget, J; Eymard, B
2015-10-01
Myofibrillar myopathies (MFM) have been described in the mid-1990s as a group of diseases sharing common histological features, including an abnormal accumulation of intrasarcoplasmic proteins, the presence of vacuoles and a disorganization of the intermyofibrillar network beginning at the Z-disk. The boundaries of this concept are still uncertain, and whereas six genes (DES, CRYAB, LDB3/ZASP, MYOT, FLNC and BAG3) are now classically considered as responsible for MFM, other entities such as FHL1 myopathy or Hereditary Myopathy with Early Respiratory Failure linked to mutations of titin can now as well be included in this group. The diagnosis of MFM is not always easy; as histological lesions can be focal, and muscle biopsy may be disappointing; this has led to a growing importance of muscle imaging, and the selectivity of muscle involvement has now been described in several disorders. Due to the rarity of these myopathies, if some clinical patterns (such as distal myopathy associated with cardiomyopathy due to desmin mutations) are now well known, surprises remain possible and should lead to systematic testing of the known genes in case of a typical histological presentation. In this paper, we aim at reviewing the data acquired on the six main genes listed above as well as presenting the experience from two French reference centres, Paris and Marseilles. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Prevalence and phenotypes of congenital myopathy due to α-actin 1 gene mutations
DEFF Research Database (Denmark)
Witting, Nanna; Werlauff, Ulla; Duno, Morten
2016-01-01
airway pressure. Limb flexor/extensor muscles and upper and lower extremities were affected equally. Pronounced neck flexor weakness was noted. CONCLUSIONS: Congenital myopathy caused by ACTA1 mutations is fatal in infancy in most cases. This study shows that the prevalence of α-actin myopathy in older...... patients with congenital myopathy is not negligible and that phenotypes can be quite mild....
Morphologic imaging in muscular dystrophies and inflammatory myopathies
International Nuclear Information System (INIS)
Degardin, Adrian; Lacour, Arnaud; Vermersch, Patrick; Morillon, David; Cotten, Anne; Stojkovic, Tanya
2010-01-01
To determine if magnetic resonance imaging (MR imaging) is useful in the diagnostic workup of muscular dystrophies and idiopathic inflammatory myopathies for describing the topography of muscle involvement. MR imaging was performed in 31 patients: 8 with dystrophic myotony types 1 (n = 4) or 2 (n = 4); 11 with limb-girdle muscular dystrophy, including dysferlinopathy, calpainopathy, sarcoglycanopathy, and dystrophy associated with fukutin-related protein mutation; 3 with Becker muscular dystrophy; and 9 with idiopathic inflammatory myopathies, including polymyositis, dermatomyositis, and sporadic inclusion body myositis. Analysis of T1 images enabled us to describe the most affected muscles and the muscles usually spared for each muscular disease. In particular, examination of pelvis, thigh, and leg muscles demonstrated significant differences between the muscular diseases. On STIR images, hyperintensities were present in 62% of our patients with muscular dystrophies. A specific pattern of muscular involvement was established for each muscular disease. Hyperintensities observed on STIR images precede fatty degeneration and are not specific for inflammatory myopathies. (orig.)
Morphologic imaging in muscular dystrophies and inflammatory myopathies
Energy Technology Data Exchange (ETDEWEB)
Degardin, Adrian; Lacour, Arnaud; Vermersch, Patrick [CHU de Lille, Clinique neurologique, Lille (France); Morillon, David; Cotten, Anne [CHRU de Lille, Service de Radiologie Osteoarticulaire, Hopital Roger Salengro, Lille (France); Stojkovic, Tanya [G-H Pitie-Salpetriere, Institut de Myologie, Paris (France)
2010-12-15
To determine if magnetic resonance imaging (MR imaging) is useful in the diagnostic workup of muscular dystrophies and idiopathic inflammatory myopathies for describing the topography of muscle involvement. MR imaging was performed in 31 patients: 8 with dystrophic myotony types 1 (n = 4) or 2 (n = 4); 11 with limb-girdle muscular dystrophy, including dysferlinopathy, calpainopathy, sarcoglycanopathy, and dystrophy associated with fukutin-related protein mutation; 3 with Becker muscular dystrophy; and 9 with idiopathic inflammatory myopathies, including polymyositis, dermatomyositis, and sporadic inclusion body myositis. Analysis of T1 images enabled us to describe the most affected muscles and the muscles usually spared for each muscular disease. In particular, examination of pelvis, thigh, and leg muscles demonstrated significant differences between the muscular diseases. On STIR images, hyperintensities were present in 62% of our patients with muscular dystrophies. A specific pattern of muscular involvement was established for each muscular disease. Hyperintensities observed on STIR images precede fatty degeneration and are not specific for inflammatory myopathies. (orig.)
A Rare Manifestation of Hypothyroid Myopathy: Hoffmann's Syndrome
Directory of Open Access Journals (Sweden)
Kang Won Lee
2015-12-01
Full Text Available Hypothyroid myopathy is observed frequently and the resolution of the clinical manifestations of myopathy following thyroid hormone replacement is well known. However, a specific subtype of hypothyroid myopathy, Hoffmann's syndrome, characterized by increased muscular mass (pseudohypertrophy, proximal muscle weakness, muscle stiffness and cramps, is rarely reported. Herein, we describe a 34-year-old male who presented with proximal muscle weakness and non-pitting edema of the lower extremities. He initially visited the neurology department where he was suspected of having polymyositis. Additional laboratory evaluation revealed profound autoimmune hypothyroidism and elevated muscle enzymes including creatine kinase. The patient was started on levothyroxine treatment and, subsequently, clinical symptoms and biochemical parameters resolved with the treatment. The present case highlights that hypothyroidism should be considered in the differential diagnosis of musculoskeletal symptoms even in the absence of overt manifestations of hypothyroidism. To our knowledge, this is the first case reported in Korea.
Study of cognitive sphere in children and adolescents with congenital myopathy (theoretical review
Directory of Open Access Journals (Sweden)
V. A. Erokhina
2013-08-01
Full Text Available This paper presents an analysis of current approaches to the study of states of higher mental functions in children and adolescents suffering from various forms of hereditary myopathies. The aim of this work is to study the theoretical rationale and the possibility of specific disorders of mental function in children and adolescents with congenital myopathies. To achieve this objective during the study it was necessary to solve the following problems: give a description of the various groups and forms of congenital myopathies, their clinical characteristics; justify the possibility of considering the hereditary myopathies as a factor in the formation of changes in visual-spatial activities and thinking; evaluate the possibility to use complex neuropsychological psycho-diagnostic techniques for investigating the state of the higher mental functions of children with congenital myopathies. The possibility of neuropsychological correction for this category of patients is discussed also.
Glucocorticoid-induced myopathy in the intensive care unit
DEFF Research Database (Denmark)
Eddelien, Heidi Shil; Hoffmeyer, Henrik Westy; Lund, Eva Charlotte Løbner
2015-01-01
Glucocorticoids (GC) are used for intensive care unit (ICU) patients on several indications. We present a patient who was admitted to the ICU due to severe respiratory failure caused by bronchospasm requiring mechanical ventilation and treated with methylprednisolone 240 mg/day in addition...... to antibiotics and bronchiolytics. When the sedation was lifted on day 10, the patient was awake but quadriplegic. Blood samples revealed elevated muscle enzymes, electromyography showed myopathy, and a muscle biopsy was performed. Glucocorticoid-induced myopathy was suspected, GC treatment was tapered...
Genetics Home Reference: myopathy with deficiency of iron-sulfur cluster assembly enzyme
... Myopathy with deficiency of iron-sulfur cluster assembly enzyme Printable PDF Open All Close All Enable Javascript ... Myopathy with deficiency of iron-sulfur cluster assembly enzyme is an inherited disorder that primarily affects muscles ...
Huckriede, A; Heikema, A; Sjollema, K; Briones, P; Agsteribbe, E
1995-01-01
We have described two mitochondrial (mt) myopathy patients with reduced activities of various mt enzymes associated with significantly decreased amounts of heat shock protein 60 (hsp60). Experimental evidence suggested that the lack of hsp60 was the primary defect. Since hsp60 is essential for the
Genetics Home Reference: idiopathic inflammatory myopathy
... stumble while walking and find it difficult to grasp items. As in dermatomyositis and polymyositis, swallowing can ... and development? More about Mutations and Health Inheritance Pattern Most cases of idiopathic inflammatory myopathy are sporadic, ...
Acute liver failure after recommended doses of acetaminophen in patients with myopathies
I. Ceelie (Ilse); L.P. James (Laura); V.M.G.J. Gijsen (Violette); R.A.A. Mathôt (Ron); S. Ito (Shinya); C.D. Tesselaar (Coranne); D. Tibboel (Dick); G. Koren (Gideon); S.N. de Wildt (Saskia)
2011-01-01
textabstractObjective: To determine the likelihood that recommended doses of acetaminophen are associated with acute liver failure in patients with myopathies. Design: Retrospective analysis. Setting: Level III pediatric intensive care unit. Patients: Two pediatric patients with myopathies and acute
Acute liver failure after recommended doses of acetaminophen in patients with myopathies
Ceelie, Ilse; James, Laura P.; Gijsen, Violette; Mathot, Ron A. A.; Ito, Shinya; Tesselaar, Coranne D.; Tibboel, Dick; Koren, Gideon; de Wildt, Saskia N.
2011-01-01
To determine the likelihood that recommended doses of acetaminophen are associated with acute liver failure in patients with myopathies. Retrospective analysis. Level III pediatric intensive care unit. Two pediatric patients with myopathies and acute liver failure. CLINICAL INVESTIGATIONS: We
Congenital myopathy is caused by mutation of HACD1
Muhammad, Emad; Reish, Orit; Ohno, Yusuke; Scheetz, Todd; DeLuca, Adam; Searby, Charles; Regev, Miriam; Benyamini, Lilach; Fellig, Yakov; Kihara, Akio; Sheffield, Val C.; Parvari, Ruti
2013-01-01
Congenital myopathies are heterogeneous inherited diseases of muscle characterized by a range of distinctive histologic abnormalities. We have studied a consanguineous family with congenital myopathy. Genome-wide linkage analysis and whole-exome sequencing identified a homozygous non-sense mutation in 3-hydroxyacyl-CoA dehydratase 1 (HACD1) in affected individuals. The mutation results in non-sense mediated decay of the HACD1 mRNA to 31% of control levels in patient muscle and completely abro...
Autosomal dominant distal myopathy due to a novel ACTA1 mutation.
Liewluck, Teerin; Sorenson, Eric J; Walkiewicz, Magdalena A; Rumilla, Kandelaria M; Milone, Margherita
2017-08-01
Mutations in skeletal muscle α-actin 1-encoding gene (ACTA1) cause autosomal dominant or recessive myopathies with marked clinical and pathological heterogeneity. Patients typically develop generalized or limb-girdle pattern of weakness, but recently a family with scapuloperoneal myopathy was reported. We describe a father and 2 children with childhood-to-juvenile onset distal myopathy, carrying a novel dominant ACTA1 variant, c.757G>C (p.Gly253Arg). Father had delayed motor development and developed significant proximal weakness later in life; he was initially misdiagnosed as having spinal muscular atrophy based on electromyographic findings. His children had predominant anterior distal leg and finger extensor involvement. Nemaline rods were abundant on the daughter's biopsy, absent on the father's initial biopsy, and extremely rare on the father's subsequent biopsy a decade later. The father's second biopsy also showed myofibrillar pathology and rare fibers with actin filament aggregates. The present family expands the spectrum of actinopathy to include a distal myopathy. Copyright © 2017 Elsevier B.V. All rights reserved.
... Hereditary fibrosing poikiloderma with tendon contractures, myopathy, and pulmonary fibrosis Printable PDF Open All Close All Enable Javascript ... Fibrosing Poikiloderma with Tendon Contractures, Myopathy, and Pulmonary ... Lung, and Blood Institute (NHLBI): Pulmonary Function Tests National ...
Restrictive extraocular myopathy: A presenting feature of acromegaly
Directory of Open Access Journals (Sweden)
Steven Heireman
2011-01-01
Full Text Available A 45-year-old man presented with binocular diplopia in primary gaze for 1 year. Orthoptic evaluation showed 10-prism diopter right eye hypotropia and 6-prism diopter right eye esotropia. The elevation and abduction of the right eye were mechanically restricted. This was associated with systemic features suggestive of acromegaly. Magnetic resonance imaging (MRI of the brain demonstrated a pituitary macroadenoma. An elevated serum insulin-like growth factor I level and the failure of growth hormone suppression after an oral glucose load biochemically confirmed the diagnosis of acromegaly. Computed tomography (CT of the orbit demonstrated bilateral symmetrical enlargement of the medial rectus and inferior rectus muscle bellies. All tests regarding Graves-Basedow disease were negative. Although rare, diplopia due to a restrictive extraocular myopathy could be the presenting symptom of acromegaly.
Centronuclear myopathy in a Border collie dog.
Eminaga, S; Cherubini, G B; Shelton, G D
2012-10-01
A two-year old, male entire Border collie was presented with a one-year history of exercise-induced collapsing on the pelvic limbs. Physical examination revealed generalised muscle atrophy. Neurological examination supported a generalised neuromuscular disorder. Electromyography revealed spontaneous electrical activity in almost all muscles. Unfixed and formaldehyde-fixed biopsy samples were collected from the triceps brachii, longissimus and vastus lateralis muscles. Histopathological, histochemical and ultrastructural examinations of biopsy specimens were consistent with either centronuclear or myotubular myopathy. The dog clinically improved with supportive treatment with L-carnitine, co-enzyme Q10 and vitamin B compound. To the authors' knowledge, this is the first report of centronuclear/myotubular myopathy in a Border collie. © 2012 British Small Animal Veterinary Association.
Fibrous Myopathy as a Complication of Repeated Intramuscular Injections for Chronic Headache
Directory of Open Access Journals (Sweden)
R Burnham
2006-01-01
Full Text Available Two cases of fibrous myopathy associated with repeated, long-term intramuscular injections for treatment of chronic temporomandibular joint pain and chronic headache, respectively, are described. Both patients developed severe, function-limiting contractures in upper and lower extremity muscles used as injection sites. In one of the cases, the contractures were painful. Electrophysiological testing, magnetic resonance imaging and muscle biopsy results were all consistent with myopathy and replacement of skeletal muscle with noncontractile fibrous tissue. These cases are presented to increase awareness of fibrous myopathy and to promote surveillance for this serious potential complication of long-term intramuscular injections in chronic headache and other pain patients.
Myopathy and hepatic lipidosis in weaned lambs due to vitamin E deficiency.
Menzies, Paula; Langs, Lisa; Boermans, Herman; Martin, John; McNally, John
2004-03-01
A sheep flock experienced losses in weaned lambs from myopathy and hepatic lipidosis. Investigation revealed painful ambulation, illthrift, and unexpected death in lambs with normal selenium levels, deficient vitamin E levels, and elevated muscle and liver enzyme levels. Vitamin E deficiency should be considered when investigating myopathy and illthrift in lambs.
Myopathy and hepatic lipidosis in weaned lambs due to vitamin E deficiency
Menzies, Paula; Langs, Lisa; Boermans, Herman; Martin, John; McNally, John
2004-01-01
A sheep flock experienced losses in weaned lambs from myopathy and hepatic lipidosis. Investigation revealed painful ambulation, illthrift, and unexpected death in lambs with normal selenium levels, deficient vitamin E levels, and elevated muscle and liver enzyme levels. Vitamin E deficiency should be considered when investigating myopathy and illthrift in lambs.
Skeletal muscle repair in a mouse model of nemaline myopathy
Sanoudou, Despina; Corbett, Mark A.; Han, Mei; Ghoddusi, Majid; Nguyen, Mai-Anh T.; Vlahovich, Nicole; Hardeman, Edna C.; Beggs, Alan H.
2006-01-01
Nemaline myopathy (NM), the most common non-dystrophic congenital myopathy, is a variably severe neuromuscular disorder for which no effective treatment is available. Although a number of genes have been identified in which mutations can cause NM, the pathogenetic mechanisms leading to the phenotypes are poorly understood. To address this question, we examined gene expression patterns in an NM mouse model carrying the human Met9Arg mutation of alpha-tropomyosin slow (Tpm3). We assessed five d...
ColVI myopathies: where do we stand, where do we go?
Directory of Open Access Journals (Sweden)
Allamand Valérie
2011-09-01
Full Text Available Abstract Collagen VI myopathies, caused by mutations in the genes encoding collagen type VI (ColVI, represent a clinical continuum with Ullrich congenital muscular dystrophy (UCMD and Bethlem myopathy (BM at each end of the spectrum, and less well-defined intermediate phenotypes in between. ColVI myopathies also share common features with other disorders associated with prominent muscle contractures, making differential diagnosis difficult. This group of disorders, under-recognized for a long time, has aroused much interest over the past decade, with important advances made in understanding its molecular pathogenesis. Indeed, numerous mutations have now been reported in the COL6A1, COL6A2 and COL6A3 genes, a large proportion of which are de novo and exert dominant-negative effects. Genotype-phenotype correlations have also started to emerge, which reflect the various pathogenic mechanisms at play in these disorders: dominant de novo exon splicing that enables the synthesis and secretion of mutant tetramers and homozygous nonsense mutations that lead to premature termination of translation and complete loss of function are associated with early-onset, severe phenotypes. In this review, we present the current state of diagnosis and research in the field of ColVI myopathies. The past decade has provided significant advances, with the identification of altered cellular functions in animal models of ColVI myopathies and in patient samples. In particular, mitochondrial dysfunction and a defect in the autophagic clearance system of skeletal muscle have recently been reported, thereby opening potential therapeutic avenues.
... Share: Email Facebook Twitter Home Health Conditions IBMPFD Inclusion body myopathy with early-onset Paget disease and ... Javascript to view the expand/collapse boxes. Description Inclusion body myopathy with early-onset Paget disease and ...
The Impact of Exercise on Statin-Associated Skeletal Muscle Myopathy
Chung, Hae R.; Vakil, Mayand; Munroe, Michael; Parikh, Alay; Meador, Benjamin M.; Wu, Pei T.; Jeong, Jin H.; Woods, Jeffrey A.; Wilund, Kenneth R.; Boppart, Marni D.
2016-01-01
HMG-CoA reductase inhibitors (statins) are the most effective pharmacological means of reducing cardiovascular disease risk. The most common side effect of statin use is skeletal muscle myopathy, which may be exacerbated by exercise. Hypercholesterolemia and training status are factors that are rarely considered in the progression of myopathy. The purpose of this study was to determine the extent to which acute and chronic exercise can influence statin-induced myopathy in hypercholesterolemic (ApoE-/-) mice. Mice either received daily injections of saline or simvastatin (20 mg/kg) while: 1) remaining sedentary (Sed), 2) engaging in daily exercise for two weeks (novel, Nov), or 3) engaging in daily exercise for two weeks after a brief period of training (accustomed, Acct) (2x3 design, n = 60). Cholesterol, activity, strength, and indices of myofiber damage and atrophy were assessed. Running wheel activity declined in both exercise groups receiving statins (statin x time interaction, pstatin treatment (statin main effect, pstatin x exercise interaction, pstatin treatment. Exercise (Acct and Nov) increased atrogin-1 mRNA in combination with statin treatment, yet enhanced fiber damage or atrophy was not observed. The results from this study suggest that exercise (Nov, Acct) does not exacerbate statin-induced myopathy in ApoE-/- mice, yet statin treatment reduces activity in a manner that prevents muscle from mounting a beneficial adaptive response to training. PMID:27936249
Imagenological characterization by Computerized Axial Tomography of the primary intracranial tumors
International Nuclear Information System (INIS)
Sosa Rivera, Manuel; Quintas Santana, Maria
2009-01-01
A descriptive observational study to 56 patients with imagenological diagnosis of primary intracranial neoplasia attended in the service of imagenology of the Provincial Docent Hospital 'Dr. Antonio Luaces Iraola' was carried out from March 1st 2006 to February 1st 2008, with the aim of characterizing these injuries by Computerized Axial Tomography and establishing an evaluation with the histological diagnosis. A questionnaire with the following variables was applied: sex, presuntive age, clinic, topographical characteristics (location, size, tumoral density, changes with administration of the resistance, calcifications, effect of mass and evaluation of the imagenological diagnosis with the histological diagnosis. Masculine sex and the group of ages of 60 are more predominated. The more frequent clinical manifestations were migraine, convulsions, difficulty to walk and vertigo. The size of the injury that prevailed was of 5, 9 and 2, 1 cm with supratentorial location. The majority of primary intracranial neoplasms were hypodense, and enhancement of the injuries with the administration of the resistance was observed. The mass effect bears a close relation with the location and size of the injury. The imagenological diagnosis fitted in with the histological one, being the gliomas the more frequent histological type
Search for Pompe disease among patients with undetermined myopathies.
Lindberg, C; Anderson, B; Engvall, M; Hult, M; Oldfors, A
2015-07-20
Pompe disease is a rare treatable glycogen storage disease with in adults - a limb-girdle muscle weakness. Muscle biopsy may fail to show the typical vacuolar myopathy. We asked if we had un-diagnosed patients with Pompe disease in western Sweden. We searched the muscle biopsy registry during the time period 1986 until 2006 including 3665 biopsies and included patients at our Neuromuscular Center with unspecified myopathy or limb-girdle muscular dystrophy. The dry blood spot test was used to identify patients with Pompe disease. A total of 82 patients (46 from the biopsy register and 36 from our center) were seen and dry blood spot test was obtained. No patient with Pompe disease was found. The dry blood spot test was low in three cases (11, 16, and 18% of normal) but a second blood sample showed a normal result based on GAA enzyme activity in lymphocytes in all three patients. In one patient with low normal result of the analysis in lymphocytes a genetic test showed no pathogenic mutations. Further investigation gave a definite diagnose of another myopathy in 12 patients. The prevalence of Pompe disease in western Sweden (3 in 1.27 million or 0.24 per 100.000 inhabitants) is lower than in the Netherlands and New York. Re-evaluation of patients with myopathies but without definite diagnosis is rewarding since 12 of 82 patients in our study had a definite molecular diagnosis after workup. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
[Biologic therapy in idiopathic inflammatory myopathy].
Selva-O'Callaghan, Albert; Ramos Casals, Manel; Grau Junyent, Josep M
2014-09-15
The aim of this article is to study the evidence-based knowledge related to the use of biological therapies in patients diagnosed with idiopathic inflammatory myopathy (dermatomyositis, polymyositis and inclusion body myositis). In this review the leading published studies related to the use of biological therapy in patients with myositis are analysed; mainly those with high methodological standards, that means randomized and controlled studies. Methodological drawbacks due to the rarity and heterogeneity of these complex diseases are also addressed. Up to now is not possible to ascertain the biologics as a recommended therapy in patients with myositis, at least based in the current evidence-based knowledge, although it can not be neglected as a therapeutic option in some clinical situations, taking into account the scarce of effective treatments in those patients, especially in refractory myositis. Future studies probably will help to better define the role of biological therapies in patients with idiopathic inflammatory myopathy. Copyright © 2013 Elsevier España, S.L.U. All rights reserved.
Hoffmann's disease: MR imaging of hypothyroid myopathy
Energy Technology Data Exchange (ETDEWEB)
Chung, Jeewon; Ahn, Kyung-Sik; Kang, Chang Ho [Korea University Anam Hospital, Korea University College of Medicine, Department of Radiology, Seoul (Korea, Republic of); Hong, Suk-Joo [Korea University Guro Hospital, Korea University College of Medicine, Department of Radiology, Seoul (Korea, Republic of); Kim, Beak Hyun [Korea University Ansan Hospital, Korea University College of Medicine, Department of Radiology, Gyeonggi-do (Korea, Republic of)
2015-11-15
Hoffmann's syndrome is a hypothyroid myopathy presenting as muscle stiffness and hypertrophy. It is a rare complication of hypothyroidism. MRI features of this syndrome have seldom been described in the literature. We present a case of Hoffmann's syndrome in a 34-year-old man who underwent lower extremity contrast-enhanced MRI. MRI can demonstrate the hypertrophic configuration, T2 hyperintensity, and enhancement of the involved muscles in Hoffmann's syndrome. Along with clinical, laboratory, and electromyography findings, MRI may be helpful in distinguishing between inflammatory myopathy, myonecrosis, subacute muscle denervation, and infectious myositis. (orig.)
Hoffmann's disease: MR imaging of hypothyroid myopathy
International Nuclear Information System (INIS)
Chung, Jeewon; Ahn, Kyung-Sik; Kang, Chang Ho; Hong, Suk-Joo; Kim, Beak Hyun
2015-01-01
Hoffmann's syndrome is a hypothyroid myopathy presenting as muscle stiffness and hypertrophy. It is a rare complication of hypothyroidism. MRI features of this syndrome have seldom been described in the literature. We present a case of Hoffmann's syndrome in a 34-year-old man who underwent lower extremity contrast-enhanced MRI. MRI can demonstrate the hypertrophic configuration, T2 hyperintensity, and enhancement of the involved muscles in Hoffmann's syndrome. Along with clinical, laboratory, and electromyography findings, MRI may be helpful in distinguishing between inflammatory myopathy, myonecrosis, subacute muscle denervation, and infectious myositis. (orig.)
Zidovudine-induced myopathy: A study in Indian patients.
Sagar, Amitabh; Mohanty, Ambika P; Bahal, Ashish
2010-07-01
Literature is replete with studies on zidovudine-induced myopathy after prolonged use (use beyond 270 days on an average). However, all these studies have been done on patients of Caucasian, American and African ethnic origin. No such study has been carried out in Indian patients to our knowledge. To determine the correlation of zidovudine usage with serum creatine phosphokinase (CK) levels, clinical muscular weakness and muscle histology in Indian patients, we studied 147 physically active, Human Immunodeficiency Virus infected men on prolonged zidovudine-based antiretroviral therapy (ART). Cross-sectional study on hospital follow-up patients of HIV infection. All cases on ART who reported to our canter during a period of 18 months were evaluated for symptoms (muscle fatigue, myalgia), objective muscle strength (testing clinically) and serum CK levels, and a select group was evaluated by muscle biopsy. These patients were on zidovudine for 1 to 7 years. None of the patients studied had significant symptoms or objective muscle weakness and only a small fraction (10.8% of cases) had marginally raised serum CK levels. All muscle biopsies were normal on light microscopy. Zidovudine myopathy may be a constraint for use of the drug in the western population; however, it is a well-tolerated drug as regards myopathy in our study on Indian patients.
Directory of Open Access Journals (Sweden)
Pari Basharat
2016-07-01
Full Text Available Idiopathic inflammatory myopathies (IIM are traditionally identified as a group of disorders that target skeletal muscle due to autoimmune dysfunction. The IIM can be divided into subtypes based on certain clinical characteristics, and several classification schemes have been proposed. The predominant diagnostic criteria for IIM is the Bohan and Peter criteria, which subdivides IIM into primary polymyositis (PM, primary dermatomyositis (DM, myositis with another connective tissue disease, and myositis associated with cancer. However, this measure has been criticised for several reasons including lack of specific criteria to help distinguish between muscle biopsy findings of PM, DM, and immune-mediated necrotising myopathy, as well as the lack of identification of cases of overlap myositis (OM. Because of this issue, other classification criteria for IIM have been proposed, which include utilising myositis-associated antibodies and myositis-specific antibodies, as well as overlap features such as Raynaud’s phenomenon, polyarthritis, oesophageal abnormalities, interstitial lung disease, small bowel abnormalities such as hypomotility and malabsorption, and renal crises, amongst others. Indeed, the identification of autoantibodies associated with certain clinical phenotypes of myositis, in particular connective tissue disease-myositis overlap, has further helped divide IIM into distinct clinical subsets, which include OM and overlap syndromes (OS. This paper reviews the concepts of OM and OS as they pertain to IIM, including definitions in the literature, clinical characteristics, and overlap autoantibodies.
Leiomodin-3-deficient mice display nemaline myopathy with fast-myofiber atrophy
Directory of Open Access Journals (Sweden)
Lei Tian
2015-06-01
Full Text Available Nemaline myopathy (NM is one of the most common forms of congenital myopathy, and affects either fast myofibers, slow myofibers, or both. However, an animal model for congenital myopathy with fast-myofiber-specific atrophy is not available. Furthermore, mutations in the leiomodin-3 (LMOD3 gene have recently been identified in a group of individuals with NM. However, it is not clear how loss of LMOD3 leads to NM. Here, we report a mouse mutant in which the piggyBac (PB transposon is inserted into the Lmod3 gene and disrupts its expression. Lmod3PB/PB mice show severe muscle weakness and postnatal growth retardation. Electron microscopy and immunofluorescence studies of the mutant skeletal muscles revealed the presence of nemaline bodies, a hallmark of NM, and disorganized sarcomeric structures. Interestingly, Lmod3 deficiency caused muscle atrophy specific to the fast fibers. Together, our results show that Lmod3 is required in the fast fibers for sarcomere integrity, and this study offers the first NM mouse model with muscle atrophy that is specific to fast fibers. This model could be a valuable resource for interrogating myopathy pathogenesis and developing therapeutics for NM as well as other pathophysiological conditions with preferential atrophy of fast fibers, including cancer cachexia and sarcopenia.
Votion, D-M; van Galen, G; Sweetman, L; Boemer, F; de Tullio, P; Dopagne, C; Lefère, L; Mouithys-Mickalad, A; Patarin, F; Rouxhet, S; van Loon, G; Serteyn, D; Sponseller, B T; Valberg, S J
2014-03-01
It is hypothesised that European atypical myopathy (AM) has a similar basis as seasonal pasture myopathy in North America, which is now known to be caused by ingestion of hypoglycin A contained in seeds from the tree Acer negundo. Serum from horses with seasonal pasture myopathy contained the conjugated toxic metabolite of hypoglycin A, methylenecyclopropyl acetic acid (MCPA). Retrospective study on archived samples. 1) To determine whether MCPA-carnitine was present in serum of European horses confirmed to have AM; 2) to determine whether Acer negundo or related Acer species were present on AM pastures in Europe. Concentrations of MCPA-carnitine were analysed in banked serum samples of 17 AM horses from Europe and 3 diseased controls (tetanus, neoplasia and exertional rhabdomyolysis) using tandem mass spectrometry. Atypical myopathy was diagnosed by characteristic serum acylcarnitine profiles. Pastures of 12 AM farms were visited by experienced botanists and plant species were documented. Methylenecyclopropyl acetic acid-carnitine at high concentrations (20.39 ± 17.24 nmol/l; range 0.95-57.63 nmol/l; reference: <0.01 nmol/l) was identified in serum of AM but not disease controls (0.00 ± 0.00 nmol/l). Acer pseudoplatanus but not Acer negundo was present on all AM farms. Atypical myopathy in Europe, like seasonal pasture myopathy in North America, is highly associated with the toxic metabolite of hypoglycin A, MCPA-carnitine. This finding coupled with the presence of a tree of which seeds are known to also contain hypoglycin A indicates that ingestion of Acer pseudoplatanus is the probable cause of AM. This finding has major implications for the prevention of AM. © 2013 EVJ Ltd.
Myopathy in hyperthyroidism as a consequence of rapid reduction of thyroid hormone
Li, Qianrui; Liu, Yuping; Zhang, Qianying; Tian, Haoming; Li, Jianwei; Li, Sheyu
2017-01-01
Abstract Rationale: Myalgia and elevated creatine kinase (CK) are occasionally observed during the treatment of hyperthyroid patients. Relative hypothyroidism resulted from rapid thyroid hormone reduction had been promoted as a plausible cause of these myopathic changes, however rarely reported. Patient concerns: We hereby presented a 20-year-old female with Grave's disease, who developed myopathy and elevated CK during rapid correction of thyroid hormone. Diagnoses: Relative hypothyroidism-induced myopathy. Interventions: Antithyroid drug (ATD) dosage was reduced without levothyroxine replacement. Outcomes: The muscular symptoms were recovered with CK level returned to normal after adoption of the euthyroid status. Lessons: Differentiation of relative hypothyroidism from other causes of myopathy, especially with the effect of ATD, is important for clinical practice, although difficult in many cases. PMID:28746208
Role of Autophagy in Glycogen Breakdown and Its Relevance to Chloroquine Myopathy
Zirin, Jonathan; Nieuwenhuis, Joppe; Perrimon, Norbert
2013-01-01
Several myopathies are associated with defects in autophagic and lysosomal degradation of glycogen, but it remains unclear how glycogen is targeted to the lysosome and what significance this process has for muscle cells. We have established a Drosophila melanogaster model to study glycogen autophagy in skeletal muscles, using chloroquine (CQ) to simulate a vacuolar myopathy that is completely dependent on the core autophagy genes. We show that autophagy is required for the most efficient degradation of glycogen in response to starvation. Furthermore, we show that CQ-induced myopathy can be improved by reduction of either autophagy or glycogen synthesis, the latter possibly due to a direct role of Glycogen Synthase in regulating autophagy through its interaction with Atg8. PMID:24265594
Elucidation of the mechanism of atorvastatin-induced myopathy in a rat model.
El-Ganainy, Samar O; El-Mallah, Ahmed; Abdallah, Dina; Khattab, Mahmoud M; Mohy El-Din, Mahmoud M; El-Khatib, Aiman S
2016-06-01
Myopathy is among the well documented and the most disturbing adverse effects of statins. The underlying mechanism is still unknown. Mitochondrial dysfunction related to coenzyme Q10 decline is one of the proposed theories. The present study aimed to investigate the mechanism of atorvastatin-induced myopathy in rats. In addition, the mechanism of the coenzyme Q10 protection was investigated with special focus of mitochondrial alterations. Sprague-Dawely rats were treated orally either with atorvastatin (100mg/kg) or atorvastatin and coenzyme Q10 (100mg/kg). Myopathy was assessed by measuring serum creatine kinase (CK) and myoglobin levels together with examination of necrosis in type IIB fiber muscles. Mitochondrial dysfunction was evaluated by measuring muscle lactate/pyruvate ratio, ATP level, pAkt as well as mitochondrial ultrastructure examination. Atorvastatin treatment resulted in a rise in both CK (2X) and myoglobin (6X) level with graded degrees of muscle necrosis. Biochemical determinations showed prominent increase in lactate/pyruvate ratio and a decline in both ATP (>80%) and pAkt (>50%) levels. Ultrastructure examination showed mitochondrial swelling with disrupted organelle membrane. Co-treatment with coenzyme Q10 induced reduction in muscle necrosis as well as in CK and myoglobin levels. In addition, coenzyme Q10 improved all mitochondrial dysfunction parameters including mitochondrial swelling and disruption. These results presented a model for atorvastatin-induced myopathy in rats and proved that mitochondrial dysfunction is the main contributor in statin-myopathy pathophysiology. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Flaccid quadriplegia due to thyrotoxic myopathy.
Couillard, Philippe; Wijdicks, Eelco F M
2014-04-01
Acute flaccid paralysis is an important clinical problem in neurological critical care. After implementing life-supporting measures, it is imperative to identify the correct diagnosis to provide timely appropriate care. Thyrotoxicosis is a recognized cause of myopathy, but rarely of quadriplegia. Here, we report a case of hyperthyroidism with severe weakness. Case report and video demonstration of clinical examination. We describe a case of a 59-year-old woman with Grave's disease who presented to the hospital with progressive shortness of breath secondary to atrial fibrillation with rapid ventricular response. Following contrast administration, she had a pulseless electrical activity arrest from which she recovered without cognitive sequelae, but with flaccid quadriplegia, facial diplegia, and hypophonia. CK was mildly elevated and electrolytes were essentially normal. Nerve conduction studies and electromyography demonstrated features supporting an acute myopathy without evidence of neuromuscular junction conduction abnormality. Normalization of thyroid hormones resulted in slow, but steady improvement over months after which she regained ambulation. Acute flaccid quadriplegia can result from thyrotoxicosis. With normalization of thyroid function, recovery can be expected.
Analysis of lipid profile in lipid storage myopathy.
Aguennouz, M'hammed; Beccaria, Marco; Purcaro, Giorgia; Oteri, Marianna; Micalizzi, Giuseppe; Musumesci, Olimpia; Ciranni, Annmaria; Di Giorgio, Rosa Maria; Toscano, Antonio; Dugo, Paola; Mondello, Luigi
2016-09-01
Lipid dysmetabolism disease is a condition in which lipids are stored abnormally in organs and tissues throughout the body, causing muscle weakness (myopathy). Usually, the diagnosis of this disease and its characterization goes through dosage of Acyl CoA in plasma accompanied with evidence of droplets of intra-fibrils lipids in the patient muscle biopsy. However, to understand the pathophysiological mechanisms of lipid storage diseases, it is useful to identify the nature of lipids deposited in muscle fiber. In this work fatty acids and triglycerides profile of lipid accumulated in the muscle of people suffering from myopathies syndromes was characterized. In particular, the analyses were carried out on the muscle biopsy of people afflicted by lipid storage myopathy, such as multiple acyl-coenzyme A dehydrogenase deficiency, and neutral lipid storage disease with myopathy, and by the intramitochondrial lipid storage dysfunctions, such as deficiencies of carnitine palmitoyltransferase II enzyme. A single step extraction and derivatization procedure was applied to analyze fatty acids from muscle tissues by gas chromatography with a flame ionization detector and with an electronic impact mass spectrometer. Triglycerides, extracted by using n-hexane, were analyzed by high performance liquid chromatography coupled to mass spectrometer equipped with an atmospheric pressure chemical ionization interface. The most representative fatty acids in all samples were: C16:0 in the 13-24% range, C18:1n9 in the 20-52% range, and C18:2n6 in the 10-25% range. These fatty acids were part of the most representative triglycerides in all samples. The data obtained was statistically elaborated performing a principal component analysis. A satisfactory discrimination was obtained among the different diseases. Using component 1 vs component 3 a 43.3% of total variance was explained. Such results suggest the important role that lipid profile characterization can have in supporting a correct
Tasoniero, G; Cullere, M; Cecchinato, M; Puolanne, E; Dalle Zotte, A
2016-11-01
The aim of the research was to study the impact of white striping and wooden breast myopathies on the technological quality, mineral, and sensory profile of poultry meat. With this purpose, a total of 138 breasts were selected for a control group with normal breasts (N), a group of breasts characterised by white striping (WS) myopathy, and a group of breasts having both white striping and wooden breast myopathies (WSWB). Data revealed that the simultaneous presence of the two myopathies, with respect to the WS lesion individually considered, had a further detrimental effect on pH (6.04 vs. 5.96; P white striping and wooden breast myopathies. © 2016 Poultry Science Association Inc.
Sarcoidosis Presenting as Löfgren’s Syndrome with Myopathy
Directory of Open Access Journals (Sweden)
Şenol Kobak
2013-01-01
Full Text Available A 34-year-old female patient, who had proximal muscle weakness for 8 months, presented with erythema nodosum lesions on the pretibial region in addition to pain, swelling, and movement restriction in both ankles for the last one month. Thoracic CT demonstrated hilar and mediastinal lymphadenopathy. She underwent mediastinoscopic lymph node biopsy; biopsy result was consistent with noncaseating granuloma. Serum angiotensin converting enzyme level and muscle enzymes have been elevated. Muscular MRI and EMG findings were consistent with myositis. Muscle biopsy was done, and myopathy was found. The patient was diagnosed with sarcoidosis, Löfgren's syndrome, and sarcoid myopathy. The patient displayed remarkable clinical and radiological regression after 6-month corticosteroid and MTX therapy.
Tzoufi, Meropi; Makis, Alexandros; Chaliasos, Nikolaos; Nakou, Iliada; Siomou, Ekaterini; Tsatsoulis, Agathoklis; Zikou, Anastasia; Argyropoulou, Maria; Bonnefont, Jean Paul; Siamopoulou, Antigone
2013-04-01
Kearns-Sayre syndrome (KSS) is a rare mitochondrial DNA deletion syndrome defined as the presence of ophthalmoplegia, pigmentary retinopathy, onset less than age 20 years, and one of the following: cardiac conduction defects, cerebellar syndrome, or cerebrospinal fluid protein above 100 mg/dl. KSS may affect many organ systems causing endocrinopathies, encephalomyopathy, sensorineural hearing loss, and renal tubulopathy. Clinical presentation at diagnosis is quite heterogeneous and, usually, few organs are affected with progression to generalized disease early in adulthood. We present the case of a boy with KSS presenting at the age of 5 years with myopathy, Addison's disease, primary hypoparathyroidism, and Fanconi syndrome. The proper replacement treatment along with the administration of mitochondrial metabolism-improving agents had a brief ameliorating effect, but gradual severe multisystemic deterioration was inevitable over the next 5 years. This report highlights the fact that in case of simultaneous presentation of polyendocrinopathies and renal disease early in childhood, KSS should be considered.
Ileocolonic transfer of solid chyme in small intestinal neuropathies and myopathies
Energy Technology Data Exchange (ETDEWEB)
Greydanus, M.P.; Camilleri, M.; Colemont, L.J.; Phillips, S.F.; Brown, M.L.; Thomforde, G.M. (Mayo Clinic and Foundation, Rochester, MN (USA))
1990-07-01
The aims of this study were to assess gastric emptying, small bowel transit and colonic filling in patients with motility disorders, with particular attention to the patterns of colonic filling. Gastrointestinal transit was assessed using a previously validated radiolabeled mixed meal. Fourteen patients with clinical and manometric features of chronic intestinal pseudoobstruction classified as intestinal neuropathy and 6 as intestinal myopathy, were studied. The results were compared with those from 10 healthy controls studied similarly. Gastric emptying and small bowel transit of solids were significantly slower in both groups of patients than in healthy controls (P less than 0.05). In health, the ileocolonic transit of solid chyme was characterized by intermittent bolus transfers. The mean size of boluses transferred to the colon (expressed as a percentage of ingested radiolabel) was significantly less (P less than 0.05) in patients with intestinal myopathy (10% +/- 4% (SEM)) than in healthy controls (25% +/- 4%) or in patients with intestinal neuropathy (25% +/- 4%). The intervals between bolus transfer of solids (plateaus in the colonic filling curve) were longer (P less than 0.05) in myopathies (212 +/- 89 minutes) than in health (45 +/- 7 minutes) or neuropathies (53 +/- 11 minutes). Thus, gastric emptying and small bowel transit were delayed in small bowel neuropathies and myopathies. Bolus filling of the colon was less frequent and less effective in patients with myopathic intestinal pseudoobstruction, whereas bolus transfer was preserved in patients with neuropathic intestinal pseudoobstruction.
Treatment of critical illness polyneuropathy and/or myopathy - a systematic review
DEFF Research Database (Denmark)
Ydemann, Mogens; Eddelien, Heidi Shil; Lauritsen, Anne Øberg
2012-01-01
The objective was to search the literature with a view to providing a general description of critical illness myopathy/polyneuropathy (CIM/CIP), including its genesis and prevention. Furthermore, it was our aim to determine whether new treatments have occurred in the past five years.......The objective was to search the literature with a view to providing a general description of critical illness myopathy/polyneuropathy (CIM/CIP), including its genesis and prevention. Furthermore, it was our aim to determine whether new treatments have occurred in the past five years....
Myopathy in Childhood Muscle-Specific Kinase Myasthenia Gravis.
Kirzinger, Lukas; Khomenko, Andrei; Schulte-Mattler, Wilhelm; Backhaus, Roland; Platen, Sabine; Schalke, Berthold
2016-12-01
Adult and pediatric patients suffering from MuSK (muscle-specific kinase) -antibody positive myasthenia gravis exhibit similar features to individuals with acetylcholine receptor (AChR) antibodies, but they differ in several characteristics such as a predominant bulbar, respiratory and neck weakness, a generally worse disease severity and a tendency to develop muscle atrophy. Muscle atrophy is a rare phenomenon that is usually restricted to the facial muscles. We describe a girl with MuSK-antibody positive myasthenia gravis who developed a myopathy with severe generalized muscular weakness, muscle atrophy, and myopathic changes on electromyography. This is the first published example of a generalized myopathic syndrome in myasthenia gravis. We review the relevant literature and discuss the hypothesis of a mitochondrial myopathy as a pathogenic mechanism in MuSK-antibody positive myasthenia gravis. Copyright © 2016 Elsevier Inc. All rights reserved.
The genetic basis of pectoralis major myopathies in modern broiler chicken lines
Bailey, Richard A.; Watson, Kellie A.; Bilgili, S. F.; Avendano, Santiago
2015-01-01
This is the first report providing estimates of the genetic basis of breast muscle myopathies (BMM) and their relationship with growth and yield in broiler chickens. In addition, this paper addresses the hypothesis that genetic selection for increase breast yield has contributed to the onset of BMM. Data were analyzed from ongoing recording of BMM within the Aviagen breeding program. This study focused on three BMM: deep pectoral myopathy (DPM; binary trait), white striping (WS; 4 categories)...
Directory of Open Access Journals (Sweden)
M. T. Muñoz-Yagüe
2006-04-01
Full Text Available Chronic intestinal pseudo-obstruction is an uncommon syndrome characterized by relapsing episodes suggesting intestinal obstruction during which no mechanical causes are identified to account for symptoms. Etiologic factors may be manifold. Among them a number of neurologic conditions, gastrointestinal smooth muscle myopathies, endocrino-metabolic and autoimmune diseases, and the use of selected drugs stand out. We report a case of chronic intestinal pseudo-obstruction originating in a sporadic, primary intestinal myopathy that corresponds to no type thus far described. A histological study of the intestinal wall showed disrupted muscle bundles and the presence of interstitial edema. Myocytes had severe degenerative changes, and no alterations were seen in submucosal and myenteric plexus neurons. The activity of enzyme complexes in the mitochondrial respiratory chain, and of thymidine phosphorylase was normal. No mitochondrial DNA changes were seen.La pseudo-obstrucción intestinal crónica es un síndrome infrecuente caracterizado por episodios recidivantes, sugestivos de obstrucción intestinal, durante los cuales no se detectan causas mecánicas que justifiquen la sintomatología. Los factores etiológicos pueden ser múltiples. Entre ellos destacan diversas enfermedades neurológicas, miopatías de la musculatura lisa gastrointestinal, enfermedades endocrino-metabólicas y autoinmunes y el uso de determinados fármacos. Presentamos un caso de pseudo-obstrucción intestinal crónica originada por una miopatía intestinal primaria y esporádica que no corresponde a ningún tipo descrito hasta el momento. El estudio histológico de la pared intestinal mostró que los haces musculares estaban desestructurados y que existía edema intersticial. Los miocitos presentaban marcados cambios degenerativos y no existían alteraciones en las neuronas de los plexos submucoso y mientérico. La actividad de los complejos enzimáticos de la cadena
Suspected myofibrillar myopathy in Arabian horses with a history of exertional rhabdomyolysis.
Valberg, S J; McKenzie, E C; Eyrich, L V; Shivers, J; Barnes, N E; Finno, C J
2016-09-01
Although exertional rhabdomyolysis (ER) is common in Arabian horses, there are no dedicated studies describing histopathological characteristics of muscle from Arabian horses with ER. To prospectively identify distinctive histopathological features of muscle from Arabian endurance horses with a history of ER (pro-ER) and to retrospectively determine their prevalence in archived samples from Arabian horses with exertional myopathies (retro-ER). Prospective and retrospective histopathological description. Middle gluteal muscle biopsies obtained from Arabian controls (n = 14), pro-ER (n = 13) as well as archived retro-ER (n = 25) muscle samples previously classified with type 2 polysaccharide storage myopathy (15/25), recurrent exertional rhabdomyolysis (7/25) and no pathology (3/25) were scored for histopathology and immunohistochemical staining of cytoskeletal proteins. Glutaraldehyde-fixed samples (2 pro-ER, one control) were processed for electron microscopy. Pro-ER and retro-ER groups were compared with controls using Mann-Whitney U and Fisher's exact tests. Centrally located myonuclei in mature myofibres were found in significantly more (Prhabdomyolysis, ectopic accumulation of cytoskeletal proteins and Z-disc degeneration bear a strong resemblance to a myofibrillar myopathy. While many of these horses were previously diagnosed with type 2 polysaccharide storage myopathy, pools of glycogen forming within disrupted myofibrils appeared to give the false appearance of a glycogen storage disorder. © 2015 EVJ Ltd.
SCLERAL AND CHOROIDAL THICKNESS IN SECONDARY HIGH AXIAL MYOPIA.
Shen, Ling; You, Qi Sheng; Xu, Xiaolin; Gao, Fei; Zhang, Zhibao; Li, Bin; Jonas, Jost B
2016-08-01
To assess differences in scleral and choroidal thickness between eyes with secondary high axial myopia caused by congenital glaucoma, eyes with primary high axial myopia, and nonhighly myopic eyes. The study consisted of 301 Chinese individuals with a mean age of 23.9 ± 22.6 years and mean axial length of 24.8 ± 4.2 mm. It included the "secondary highly myopic group" (SHMG) because of congenital glaucoma (n = 20 eyes; axial length >26.0 mm), the "primary highly myopic group" (PHMG) (n = 73; axial length >26.0 mm), and the remaining nonhighly myopic group (NHMG). The secondary highly myopic group versus the primary highly myopic group had significantly thinner sclera in the pars plana region (343 ± 71 μm versus 398 ± 83 μm; P = 0.006), whereas scleral thickness in other regions did not differ significantly between both highly myopic groups and was significantly thinner in both highly myopic groups than in the NHMG. Mean total scleral volume did not differ significantly (P > 0.20) between any group (SHMG: 659 ± 106 μm; PHMG: 667 ± 128 μm; NHMG: 626 ± 135 μm). Choroidal thickness was significantly thinner in both highly myopic groups than in the NHMG, with no significant differences between both highly myopic groups. Choroidal volume did not differ significantly (P > 0.40) between any of the groups (SHMG: 43 ± 12 μm; PHMG: 43 ± 13 μm; NHMG: 46 ± 17 μm). In secondary high axial myopia, the sclera gets thinner anterior and posterior to the equator; whereas in primary high axial myopia, scleral thinning is predominantly found posterior to the equator. Because volume of sclera and choroid did not differ between any group, scleral and choroidal thinning in myopia may be due to a rearrangement of tissue and not due to the new formation of tissue.
Nakamura, R K; Russell, N J; Shelton, G D
2012-06-01
A nine-year-old neutered female mixed breed dog presented for evaluation following a five-day history of lethargy, inappetence, weakness, abdominal distension and generalised muscle atrophy. Persistent vatrial standstill with a junctional rhythm was identified on electrocardiogram. Echocardiogram identified moderate dilation of all cardiac chambers and mild thickening of the mitral and tricuspid valves. Serology was negative for Neospora caninum and Toxoplasma gondii. Permanent pacemaker implantation was performed in addition to endomyocardial and skeletal muscle biopsies. Cryosections from the biceps femoris muscle showed numerous nemaline rod bodies while endomyocardial biopsies were possibly consistent with end-stage myocarditis. Rod bodies have rarely been reported in the veterinary literature. To the authors' knowledge, this is the first report of adult-onset nemaline rod myopathy and hypothyroidism with concurrent cardiac disease in a dog. © 2012 British Small Animal Veterinary Association.
Marttila, Minttu; Lehtokari, Vilma-Lotta; Marston, Steven; Nyman, Tuula A.; Barnerias, Christine; Beggs, Alan H.; Bertini, Enrico; Ceyhan-Birsoy, Ozge; Cintas, Pascal; Gerard, Marion; Gilbert-Dussardier, Brigitte; Hogue, Jacob S.; Longman, Cheryl; Eymard, Bruno; Frydman, Moshe; Kang, Peter B.; Klinge, Lars; Kolski, Hanna; Lochmüller, Hans; Magy, Laurent; Manel, Véronique; Mayer, Michèle; Mercuri, Eugenio; North, Kathryn N.; Peudenier-Robert, Sylviane; Pihko, Helena; Probst, Frank J.; Reisin, Ricardo; Stewart, Willie; Taratuto, Ana Lia; de Visser, Marianne; Wilichowski, Ekkehard; Winer, John; Nowak, Kristen; Laing, Nigel G.; Winder, Tom L.; Monnier, Nicole; Clarke, Nigel F.; Pelin, Katarina; Grönholm, Mikaela; Wallgren-Pettersson, Carina
2014-01-01
Mutations affecting skeletal muscle isoforms of the tropomyosin genes may cause nemaline myopathy, cap myopathy, core-rod myopathy, congenital fiber-type disproportion, distal arthrogryposes, and Escobar syndrome. We correlate the clinical picture of these diseases with novel (19) and previously
Mutation-specific effects on thin filament length in thin filament myopathy.
Winter, Josine M de; Joureau, Barbara; Lee, Eun-Jeong; Kiss, Balázs; Yuen, Michaela; Gupta, Vandana A; Pappas, Christopher T; Gregorio, Carol C; Stienen, Ger J M; Edvardson, Simon; Wallgren-Pettersson, Carina; Lehtokari, Vilma-Lotta; Pelin, Katarina; Malfatti, Edoardo; Romero, Norma B; Engelen, Baziel G van; Voermans, Nicol C; Donkervoort, Sandra; Bönnemann, C G; Clarke, Nigel F; Beggs, Alan H; Granzier, Henk; Ottenheijm, Coen A C
2016-06-01
Thin filament myopathies are among the most common nondystrophic congenital muscular disorders, and are caused by mutations in genes encoding proteins that are associated with the skeletal muscle thin filament. Mechanisms underlying muscle weakness are poorly understood, but might involve the length of the thin filament, an important determinant of force generation. We investigated the sarcomere length-dependence of force, a functional assay that provides insights into the contractile strength of muscle fibers as well as the length of the thin filaments, in muscle fibers from 51 patients with thin filament myopathy caused by mutations in NEB, ACTA1, TPM2, TPM3, TNNT1, KBTBD13, KLHL40, and KLHL41. Lower force generation was observed in muscle fibers from patients of all genotypes. In a subset of patients who harbor mutations in NEB and ACTA1, the lower force was associated with downward shifted force-sarcomere length relations, indicative of shorter thin filaments. Confocal microscopy confirmed shorter thin filaments in muscle fibers of these patients. A conditional Neb knockout mouse model, which recapitulates thin filament myopathy, revealed a compensatory mechanism; the lower force generation that was associated with shorter thin filaments was compensated for by increasing the number of sarcomeres in series. This allowed muscle fibers to operate at a shorter sarcomere length and maintain optimal thin-thick filament overlap. These findings might provide a novel direction for the development of therapeutic strategies for thin filament myopathy patients with shortened thin filament lengths. Ann Neurol 2016;79:959-969. © 2016 American Neurological Association.
Unfolded protein response and activated degradative pathways regulation in GNE myopathy.
Directory of Open Access Journals (Sweden)
Honghao Li
Full Text Available Although intracellular beta amyloid (Aβ accumulation is known as an early upstream event in the degenerative course of UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase (GNE myopathy, the process by which Aβdeposits initiate various degradative pathways, and their relationship have not been fully clarified. We studied the possible secondary responses after amyloid beta precursor protein (AβPP deposition including unfolded protein response (UPR, ubiquitin proteasome system (UPS activation and its correlation with autophagy system. Eight GNE myopathy patients and five individuals with normal muscle morphology were included in this study. We performed immunofluorescence and immunoblotting to investigate the expression of AβPP, phosphorylated tau (p-tau and endoplasmic reticulum molecular chaperones. Proteasome activities were measured by cleavage of fluorogenic substrates. The expression of proteasome subunits and linkers between proteasomal and autophagy systems were also evaluated by immunoblotting and relative quantitative real-time RT-PCR. Four molecular chaperones, glucose-regulated protein 94 (GRP94, glucose-regulated protein 78 (GRP78, calreticulin and calnexin and valosin containing protein (VCP were highly expressed in GNE myopathy. 20S proteasome subunits, three main proteasome proteolytic activities, and the factors linking UPS and autophagy system were also increased. Our study suggests that AβPP deposition results in endoplasmic reticulum stress (ERS and highly expressed VCP deliver unfolded proteins from endoplasmic reticulum to proteosomal system which is activated in endoplasmic reticulum associated degradation (ERAD in GNE myopathy. Excessive ubiquitinated unfolded proteins are exported by proteins that connect UPS and autophagy to autophagy system, which is activated as an alternative pathway for degradation.
Lipid storage myopathy with clinical markers of Marfan syndrome: A rare association
Directory of Open Access Journals (Sweden)
Subasree Ramakrishnan
2012-01-01
Full Text Available Disorders of lipid metabolism can cause variable clinical presentations, often involving skeletal muscle, alone or together with other tissues. A 19-year-old boy presented with a 2-year history of muscle pain, cramps, exercise intolerance and progressive weakness of proximal lower limbs. Examination revealed skeletal markers of Marfan syndrome in the form of increased arm span compared with height, Kyphoscoliois, moderate pectus excavatum, high arched palate and wrist sign. He also had mild neck flexor weakness and proximal lower limb weakness with areflexia. Pathologic findings revealed lipid-laden fine vacuoles in the muscle fibers. Possibility of carnitine deficiency myopathy was considered and the patient was started on carnitine and Co Q. The patient made remarkable clinical improvement over the next 2 months. This case is reported for rarity of the association of clinical markers of Marfan syndrome and lipid storage myopathy and sparse literature on lipid storage myopathy in the Indian context.
Hypothyroid myopathy. A clinical and pathologaical study.
McKeran, R O; Slavin, G; Ward, P; Paul, E; Mair, W G
1980-09-01
Ten patients with varying degrees of hypothroid myopathy were studied clinically and by serial percutaneous needle muscle biopsies before and during treatment with L-thyroxine. The biochemical evidence of hypothyroidism was related to the severity of the myopathic and signs before treatment. The severity of myopathic symptoms before and during treatment correlated with the biochemical evidence of hypothyrodism, a type II fibre atrophy and increased central nuclear counts. Likewise, the clinical evidence of a myopathy before and during treatment was correlated with both a type II fibre atrophy and loss and increased central nuclear counts but was not related to the biochemical parameters of hypothyroidism, except the level of thyroid stimulating hormone. In the muscle, before and during treatment, of the two most severely affected patients, intracellular glycogen inclusions were seen in scattered muscle fibres. On light microscopy and on electronmicroscopy, numerous mitochondria were seen responding to L-thyroxine with accumulations of subsarcolemmal honey-combing. Vesicular abnormalities, an electron dense matrix or occasional crystalline deposits were seen in muscle mitochondria from less severely azffected patients. Severely myopathic muscle contained excessive glycogen, membrane bound glycogen and excess lipid in a mainly perinuclear distribution. Occasional myelin and membranous bodies were seen and satellite cells during the recovery phase. A group of patients with hypothyroid myopathy who are likely to have a delayed recovery of full muscle strength on L-thyroxine may be recognised by the presence of severe proximal muscle weakness and characteristic changes on histochemical and electronmicroscopic examination of muscle. The spectrum of histochemical and electronmicroscopic abnormalities of muscle revealed with increasing degree of hypothyrodism, suggests that a generally reversible acquired glycogen storage and mictochondrial disorder is an important feature
Genetics Home Reference: early-onset myopathy with fatal cardiomyopathy
... in childhood, people with EOMFC may also develop joint deformities called contractures that restrict the movement of ... Home Edition for Patients and Caregivers: Dilated Cardiomyopathy Neuromuscular Disease Center, Washington University Orphanet: Early-onset myopathy ...
Rodine, Robert J; Tibbles, Anthony C; Kim, Peter SY; Alikhan, Neetan
2010-01-01
Lipid lowering drugs, such as statins, are commonly used to treat approximately 10 million Canadians affected by hypercholesterolemia. The most commonly experienced side-effect of statin medication is muscle pain. Statin induced myopathy consists of a spectrum of myopathic disorders ranging from mild myalgia to fatal rhabdomyolysis. The following is a presentation of 2 cases of statin induced myopathy in patients presenting in a chiropractic setting. In addition, discussion will surround the ...
Eosinophilic fasciitis in a child mimicking a myopathy.
Pillen, S.; Engelen, B.G.M. van; Hoogen, F.H.J. van den; Fiselier, T.J.W.; Vossen, P. van der; Drost, G.
2006-01-01
A 14-year-old boy was suspected of having a myopathy with joint contractures. He presented with progressive painless joint contractures of his right wrist and fingers, and reduced muscle strength of his right arm, without obvious skin changes. Laboratory investigation showed a normal CK,
Genetics Home Reference: CAV3-related distal myopathy
... gene causes a peculiar form of distal myopathy. Neurology. 2002 Jan 22;58(2):323-5. Erratum in: Neurology 2002 Mar 12;58(5):839. Itoyoma Y [ ... 3 cause four distinct autosomal dominant muscle diseases. Neurology. 2004 Feb 24;62(4):538-43. Review. ...
Myopathy in hyperthyroidism as a consequence of rapid reduction of thyroid hormone: A case report.
Li, Qianrui; Liu, Yuping; Zhang, Qianying; Tian, Haoming; Li, Jianwei; Li, Sheyu
2017-07-01
Myalgia and elevated creatine kinase (CK) are occasionally observed during the treatment of hyperthyroid patients. Relative hypothyroidism resulted from rapid thyroid hormone reduction had been promoted as a plausible cause of these myopathic changes, however rarely reported. We hereby presented a 20-year-old female with Grave's disease, who developed myopathy and elevated CK during rapid correction of thyroid hormone. Relative hypothyroidism-induced myopathy. Antithyroid drug (ATD) dosage was reduced without levothyroxine replacement. The muscular symptoms were recovered with CK level returned to normal after adoption of the euthyroid status. Differentiation of relative hypothyroidism from other causes of myopathy, especially with the effect of ATD, is important for clinical practice, although difficult in many cases.
A novel mutation in PNPLA2 leading to neutral lipid storage disease with myopathy.
Ash, Daniel B; Papadimitriou, Dimitra; Hays, Arthur P; Dimauro, Salvatore; Hirano, Michio
2012-09-01
Mutations in PNPLA2, a gene encoding adipose triglyceride lipase, lead to neutral lipid storage disease with myopathy. To report the clinical and molecular features of a case of neutral lipid storage disease with myopathy resulting from a novel mutation in PNPLA2. Case report. University hospital. A 65-year-old man with progressive muscle weakness and high serum creatine kinase levels. Direct sequencing of the PNPLA2 gene. Identification of a novel homozygous mutation in the patient's PNPLA2 gene confirmed the suspected diagnosis of neutral lipid storage disease with myopathy. Screening of the PNPLA2 gene should be considered for patients presenting with high levels of creatine kinase, progressive muscle weakness, and systemic lipid accumulation. The presence of Jordans anomaly can be a strong diagnostic clue.
[Value of MRI in the treatment of Grave's disease orbital myopathy].
Oğuz, V; Yolar, M; Yetik, H; Cakirer, D; Uysal, O; Pazarli, H
2001-10-01
In order to evaluate the predictability of the results in the treatment of myopathy in cases with the clinical signs of muscle involvement, 177 extraocular muscles of 27 cases whose oedematous status was detected by MRI and who were given antiinflammatory treatment according to the data of this method, were studied. The nature of involvement was detected in respect with the signal intensity and thickness of each rectus muscle prior to the treatment and at the end of the sixth month following a three months' application of combined treatment of steroids and irradiation of 2000 rads. When the initial and final results were compared, the signal intensities of four involved recti showed significant decrease at the end of the treatment, as they were evaluated separately or together. Besides the thicknesses of these groups of involved recti which were evaluated separately showed significant decrease. The evaluation of the signal intensities by MRI is a way that enables noninvasive detection of the edema and prediction of the anti-inflammatory treatment's results of dysthyroid myopathy. Therefore a systematic follow up by MRI is recommended for the treatment choice in dysthyroid myopathy.
Opposed-phase MR imaging of lipid storage myopathy in a case of Chanarin-Dorfman disease
International Nuclear Information System (INIS)
Gaeta, Michele; Celona, Antonio; Racchiusa, Sergio; Mazziotti, Silvio; Minutoli, Fabio; Toscano, Antonio; Musumeci, Olimpia
2008-01-01
Chanarin-Dorfman disease (CDD) is a rare genetic disorder characterized by ichthyosis, myopathy, central nervous system disturbances, and intracellular lipid storage in muscle fibers, hepatocytes, and granulocytes. We describe skeletal muscle magnetic resonance imaging findings in a case of CDD, outlining the potential role of GE T1-weighted opposed-phase sequence (chemical shift imaging) in the evaluation of lipid storage myopathies. (orig.)
Opposed-phase MR imaging of lipid storage myopathy in a case of Chanarin-Dorfman disease
Energy Technology Data Exchange (ETDEWEB)
Gaeta, Michele; Celona, Antonio; Racchiusa, Sergio; Mazziotti, Silvio [University of Messina, Department of Radiological Sciences, Messina (Italy); Minutoli, Fabio [University of Messina, Department of Radiological Sciences, Messina (Italy); A.O.U. ' ' Policlinico G. Martino' ' , Dipartimento di Scienze Radiologiche, Messina (Italy); Toscano, Antonio; Musumeci, Olimpia [University of Messina, Department of Neurosciences, Psychiatry and Anaesthesiology, Messina (Italy)
2008-11-15
Chanarin-Dorfman disease (CDD) is a rare genetic disorder characterized by ichthyosis, myopathy, central nervous system disturbances, and intracellular lipid storage in muscle fibers, hepatocytes, and granulocytes. We describe skeletal muscle magnetic resonance imaging findings in a case of CDD, outlining the potential role of GE T1-weighted opposed-phase sequence (chemical shift imaging) in the evaluation of lipid storage myopathies. (orig.)
A Novel Axial Foldable Mechanism for a Segmented Primary Mirror of Space Telescope
Directory of Open Access Journals (Sweden)
Dignesh Thesiya
2015-09-01
Full Text Available Future space missions will have larger telescopes in order to look deeper into space while improvising on spatial resolution. The primary mirrors for these telescopes will be so large that using a monolithic mirror will be nearly impossible because of the difficulties associated with its fabrication, transportation, and installation on a launch vehicle. The feasibility of launching these huge mirrors is limited because of their small launch fairing diameter. The aerodynamic shape of the fairing requires a small diameter, but the height of the launch vehicle, which is available for designers to utilize, is larger than the fairing diameter. This paper presents the development of an axial deployment mechanism based on the screw jack principle. The mechanism was designed and developed, and a prototype was constructed in order to demonstrate a lab model.
Whole-body MRI for full assessment and characterization of diffuse inflammatory myopathy
Directory of Open Access Journals (Sweden)
Saleh Saleh Elessawy
2016-09-01
Full Text Available Background Conventional magnetic resonance imaging (MRI is a highly valuable tool for full assessment of the extent of bilateral symmetrical diffuse inflammatory myopathy, owing to its high sensitivity in the detection of edema which correlates with, and sometimes precedes, clinical findings. Purpose To evaluate the use of whole-body (WB-MRI in characterization and full assessment of the extent and distribution of diffuse inflammatory myopathy. Material and Methods A prospective study on 15 patients presenting with clinical evidence of inflammatory myopathy. It included 4 boys/men and 11 girls/women (age range, 6–44 years; mean age, 25.5 years. 1.5 T WB-MRI was performed and the distribution and extent of disease severity was assessed according to muscle edema on STIR images. Results Four cases of dermatomyositis showed lower limb disease predilection with edema in gluteal, thigh, and calf muscles. The same finding was seen in one case with recurrent polymyositis and three cases with overlap myositis with systemic lupus erythematosus (SLE. Bilateral upper and lower limb myositis was demonstrated in three cases of polymyositis and one case of overlap myositis with scleroderma. Bilateral edema involving all scanned muscle groups was detected in three cases of polymyositis with paraneoplastic syndrome, SLE, and severe active dermatomyositis (including the neck muscles. Conclusion WB-MRI is the diagnostic modality of choice for cases of inflammatory myopathy. It accurately detects the most severely affected muscles candidate for biopsy and provides a reliable baseline study for follow-up of disease progression as well as response to treatment.
The effect of coenzyme Q10 in statin myopathy.
Zlatohlavek, Lukas; Vrablik, Michal; Grauova, Barbora; Motykova, Eva; Ceska, Richard
2012-01-01
Statins significantly reduce CV morbidity and mortality. Unfortunately, one of the side effects of statins is myopathy, for which statins cannot be administered in sufficient doses or administered at all. The aim of this study was to demonstrate the effect of coenzyme Q10 in patients with statin myopathy. Twenty eight patients aged 60.6±10.7 years were monitored (18 women and 10 men) and treated with different types and doses of statin. Muscle weakness and pain was monitored using a scale of one to ten, on which patients expressed the degree of their inconvenience. Examination of muscle problems was performed prior to administration of CQ10 and after 3 and 6 months of dosing. Statistical analysis was performed using Friedman test, Annova and Students t-test. Pain decreased on average by 53.8% (pmuscle weakness by 44.4% (pmuscle pain and sensitivity statistically significantly decreased.
Aerobic Training in Patients with Congenital Myopathy
DEFF Research Database (Denmark)
Hedermann, Gitte; Vissing, Christoffer Rasmus; Jensen, Karen
2016-01-01
INTRODUCTION: Congenital myopathies (CM) often affect contractile proteins of the sarcomere, which could render patients susceptible to exercise-induced muscle damage. We investigated if exercise is safe and beneficial in patients with CM. METHODS: Patients exercised on a stationary bike for 30......: The Regional Committee on Health Research Ethics of the Capital Region of Denmark H-2-2013-066 and ClinicalTrials.gov H2-2013-066....
Muscle imaging in patients with tubular aggregate myopathy caused by mutations in STIM1
DEFF Research Database (Denmark)
Tasca, Giorgio; D'Amico, Adele; Monforte, Mauro
2015-01-01
Tubular aggregate myopathy is a genetically heterogeneous disease characterized by tubular aggregates as the hallmark on muscle biopsy. Mutations in STIM1 have recently been identified as one genetic cause in a number of tubular aggregate myopathy cases. To characterize the pattern of muscle...... involvement in this disease, upper and lower girdles and lower limbs were imaged in five patients with mutations in STIM1, and the scans were compared with two patients with tubular aggregate myopathy not caused by mutations in STIM1. A common pattern of involvement was found in STIM1-mutated patients...... of thigh and posterior leg with sparing of gracilis, tibialis anterior and, to a lesser extent, short head of biceps femoris. Mutations in STIM1 are associated with a homogeneous involvement on imaging despite variable clinical features. Muscle imaging can be useful in identifying STIM1-mutated patients...
Radiological features of Paget disease of bone associated with VCP myopathy
Energy Technology Data Exchange (ETDEWEB)
Farpour, Farzin [University of California, Department of Radiology, VA Long Beach Health Care, Irvine, CA (United States); Queens Hospital Center, Mount Sinai School of Medicine, New York, NY (United States); Tehranzadeh, Jamshid [University of California, Department of Radiology, VA Long Beach Health Care, Irvine, CA (United States); Donkervoort, Sandra; Vanjara, Pari [University of California, Division of Genetics and Metabolism, Department of Pediatrics, Irvine, CA (United States); Smith, Charles [University of Kentucky, Department of Neurology and Sanders-Brown Center on Aging, Lexington, KY (United States); Martin, Barbara [University of Kentucky, Lexington, KY (United States); Osann, Kathryn [University of California, Department of Medicine, Division of Hematology/Oncology, Irvine, CA (United States); Kimonis, Virginia E. [University of California, Division of Genetics and Metabolism, Department of Pediatrics, Irvine, CA (United States); UC Irvine Medical Center, Division of Genetics and Metabolism, Orange, CA (United States)
2012-03-15
Mutations in the Valosin-containing protein (VCP) gene cause a unique disorder characterized by classic Paget disease of bone (PDB), inclusion body myopathy, and frontotemporal dementia (IBMPFD). Our objective was to analyze the radiographic features of PDB associated with VCP mutations since there is a dearth of literature on the PDB component of VCP disease. Radiographic bone surveys were examined in 23 individuals with VCP mutation and compared with their unaffected relatives. Laboratory testing relevant for VCP disease was performed in all individuals. Of the 17 affected individuals with clinical manifestations of VCP disease, 16 of whom had myopathy, radiographic analysis revealed classic PDB in 11 individuals (65%). The mean age of diagnosis for myopathy was 43.8 years and for PDB was 38.1 years of age. Radiological evidence of PDB was seen in one individual (16%) amongst six clinically asymptomatic VCP mutation carriers. Alkaline phosphatase was a useful marker for diagnosing PDB in VCP disease. Radiographic findings of classic PDB are seen in 52% of individuals carrying VCP mutations at a significantly younger age than conventional PDB. Screening for PDB is warranted in at-risk individuals because of the benefit of early treatment with the new powerful bisphosphonates that hold the potential for prevention of disease. (orig.)
de la Portilla, Fernando; Borrero, Juan José; Rafel, Enrique
2005-03-01
Hereditary anal sphincter myopathy is rare. We present a family with one affected member with proctalgia fugax, constipation and internal anal sphincter hypertrophy. Ultrastructural findings show vacuolization of smooth muscle cells without the characteristic polyglucosan inclusion. Further relief of symptoms was obtained using an oral calcium antagonist. Based on clinical presentation, endosonography and morphological findings, we consider our case is a histological variant of the vacuolar myopathy originally described.
Whole-body MRI in adult inflammatory myopathies: Do we need imaging of the trunk?
International Nuclear Information System (INIS)
Filli, Lukas; Manoliu, Andrei; Andreisek, Gustav; Guggenberger, Roman; Maurer, Britta
2015-01-01
To evaluate whether imaging of the trunk could be omitted in patients with inflammatory myopathies without losing diagnostic accuracy using a restricted whole-body magnetic resonance imaging (rWB-MRI) protocol. After approval by the institutional review board, this study was performed in 63 patients (male/female, 13/50; median age, 52 years; range, 20-81 years) with new-onset myopathic symptoms (group 1, n = 41) or previously diagnosed inflammatory myopathy (group 2, n = 22). After performing whole-body MRI (WB-MRI) at 3.0 Tesla, myositis and fatty atrophy were evaluated in different muscles by two independent radiologists. The intra-class correlation coefficient (ICC) was calculated to evaluate inter-observer reliability. Acquisition time was 56:01 minutes for WB-MRI and 37:37 minutes (32.8 % shorter) for rWB-MRI. In group 1, 14 patients were diagnosed with inflammatory myopathy based on muscle biopsy. rWB-MRI and WB-MRI showed equal sensitivity (42.9 %) and specificity (100 %) for myositis, and showed equal sensitivity (71.4 %) and similar specificity (63.0 % and 48.1 %, respectively) for fatty atrophy. No myositis was found in the body trunk in any patient. Inter-observer reliability was between substantial and perfect (ICC, 0.77-1.00). rWB-MRI showed diagnostic accuracy similar to WB-MRI for inflammatory myopathy at markedly reduced overall acquisition time. (orig.)
Whole-body MRI in adult inflammatory myopathies: Do we need imaging of the trunk?
Energy Technology Data Exchange (ETDEWEB)
Filli, Lukas; Manoliu, Andrei; Andreisek, Gustav; Guggenberger, Roman [University Hospital Zurich, University of Zurich, Institute of Diagnostic and Interventional Radiology, Zurich (Switzerland); Maurer, Britta [University Hospital Zurich, University of Zurich, Division of Rheumatology, Zurich (Switzerland)
2015-12-15
To evaluate whether imaging of the trunk could be omitted in patients with inflammatory myopathies without losing diagnostic accuracy using a restricted whole-body magnetic resonance imaging (rWB-MRI) protocol. After approval by the institutional review board, this study was performed in 63 patients (male/female, 13/50; median age, 52 years; range, 20-81 years) with new-onset myopathic symptoms (group 1, n = 41) or previously diagnosed inflammatory myopathy (group 2, n = 22). After performing whole-body MRI (WB-MRI) at 3.0 Tesla, myositis and fatty atrophy were evaluated in different muscles by two independent radiologists. The intra-class correlation coefficient (ICC) was calculated to evaluate inter-observer reliability. Acquisition time was 56:01 minutes for WB-MRI and 37:37 minutes (32.8 % shorter) for rWB-MRI. In group 1, 14 patients were diagnosed with inflammatory myopathy based on muscle biopsy. rWB-MRI and WB-MRI showed equal sensitivity (42.9 %) and specificity (100 %) for myositis, and showed equal sensitivity (71.4 %) and similar specificity (63.0 % and 48.1 %, respectively) for fatty atrophy. No myositis was found in the body trunk in any patient. Inter-observer reliability was between substantial and perfect (ICC, 0.77-1.00). rWB-MRI showed diagnostic accuracy similar to WB-MRI for inflammatory myopathy at markedly reduced overall acquisition time. (orig.)
Directory of Open Access Journals (Sweden)
Stephanie S. L. Cheung
2017-01-01
Full Text Available A 78-year-old woman complained of gradual, painless onset of horizontal binocular diplopia associated with progressive axial weakness. Physical examination revealed esotropia that was greater at distance than at near vision, bilateral levator dehiscence, and normal abducting saccadic speeds. Given the age of the patient and compatible clinical findings, the diagnosis of Sagging Eye Syndrome (SES was made. However, further work-up with a muscle biopsy suggested Sporadic Late-Onset Nemaline Myopathy (SLONM as the cause of her progressive muscle weakness. Although rare, external ophthalmoplegia has been described in the literature as a presenting symptom in SLONM. To elucidate the pathological mechanism for the patient’s diplopia, an MRI of the orbits was performed, which revealed findings consistent with SES. This case aims to highlight the importance of integrating clinical findings during the diagnostic process and serves as a reminder that diplopia can be a common symptom for an uncommon diagnosis.
Keen, Helen I; Krishnarajah, Janakan; Bates, Timothy R; Watts, Gerald F
2014-09-01
Cardiovascular disease (CVD) remains the leading cause of death in industrialized nations. Despite clear evidence of CVD risk reduction with HMG-CoA reductase inhibitors (statins), the side effects of these medications, particularly myopathy, limit their effectiveness. Studies into the mechanisms, aetiology and management of statin myopathy are limited by lack of an internationally agreed clinical definition and tools for assessing outcomes. Currently there is a paucity of evidence to guide the management of patients affected by statin myopathy; with the exception of dose reduction, there is little evidence that other strategies can improve statin tolerance, and even less evidence to suggest these alternate dosing strategies reduce cardiovascular risk. This review will cover current definitions, clinical presentations, risk factors, pathogenesis and management. PubMed was searched (English language, to 2014) for key articles pertaining to statin myopathy. This review then briefly describes our experience of managing this condition in a tertiary lipid disorders clinic, in the setting of limited guiding evidence. Knowledge gaps in the field of statin myopathy are identified and future research directions are suggested. We urge the need for international attention to address this important, but largely neglected clinical problem, that if unresolved will remain an impediment to the effective prevention and treatment of CVD.
Ravenscroft, Gianina; Jackaman, Connie; Sewry, Caroline A.; McNamara, Elyshia; Squire, Sarah E.; Potter, Allyson C.; Papadimitriou, John; Griffiths, Lisa M.; Bakker, Anthony J.; Davies, Kay E.; Laing, Nigel G.; Nowak, Kristen J.
2011-01-01
Mutations in the skeletal muscle α-actin gene (ACTA1) cause congenital myopathies including nemaline myopathy, actin aggregate myopathy and rod-core disease. The majority of patients with ACTA1 mutations have severe hypotonia and do not survive beyond the age of one. A transgenic mouse model was generated expressing an autosomal dominant mutant (D286G) of ACTA1 (identified in a severe nemaline myopathy patient) fused with EGFP. Nemaline bodies were observed in multiple skeletal muscles, with serial sections showing these correlated to aggregates of the mutant skeletal muscle α-actin-EGFP. Isolated extensor digitorum longus and soleus muscles were significantly weaker than wild-type (WT) muscle at 4 weeks of age, coinciding with the peak in structural lesions. These 4 week-old mice were ∼30% less active on voluntary running wheels than WT mice. The α-actin-EGFP protein clearly demonstrated that the transgene was expressed equally in all myosin heavy chain (MHC) fibre types during the early postnatal period, but subsequently became largely confined to MHCIIB fibres. Ringbinden fibres, internal nuclei and myofibrillar myopathy pathologies, not typical features in nemaline myopathy or patients with ACTA1 mutations, were frequently observed. Ringbinden were found in fast fibre predominant muscles of adult mice and were exclusively MHCIIB-positive fibres. Thus, this mouse model presents a reliable model for the investigation of the pathobiology of nemaline body formation and muscle weakness and for evaluation of potential therapeutic interventions. The occurrence of core-like regions, internal nuclei and ringbinden will allow analysis of the mechanisms underlying these lesions. The occurrence of ringbinden and features of myofibrillar myopathy in this mouse model of ACTA1 disease suggests that patients with these pathologies and no genetic explanation should be screened for ACTA1 mutations. PMID:22174871
Goldberger, Jeffrey J.; Arora, Rishi; Green, David; Greenland, Philip; Lee, Daniel C.; Lloyd-Jones, Donald M.; Markl, Michael; Ng, Jason; Shah, Sanjiv J.
2015-01-01
Atrial disease or myopathy forms the substrate for atrial fibrillation (AF) and underlies the potential for atrial thrombus formation and subsequent stroke. Current diagnostic approaches in patients with AF focus on identifying clinical predictors with evaluation of left atrial size by echocardiography serving as the sole measure specifically evaluating the atrium. Although the atrial substrate underlying AF is likely developing for years prior to the onset of AF, there is no current evaluation to identify the pre-clinical atrial myopathy. Atrial fibrosis is one component of the atrial substrate that has garnered recent attention based on newer MRI techniques that have been applied to visualize atrial fibrosis in humans with prognostic implications regarding success of treatment. Advanced ECG signal processing, echocardiographic techniques, and MRI imaging of fibrosis and flow provide up-to-date approaches to evaluate the atrial myopathy underlying AF. While thromboembolic risk is currently defined by clinical scores, their predictive value is mediocre. Evaluation of stasis via imaging and biomarkers associated with thrombogenesis may provide enhanced approaches to assess risk for stroke in patients with AF. Better delineation of the atrial myopathy that serves as the substrate for AF and thromboembolic complications might improve treatment outcomes. Furthermore, better delineation of the pathophysiologic mechanisms underlying the development of the atrial substrate for AF, particularly in its earlier stages, could help identify blood and imaging biomarkers that could be useful to assess risk for developing new onset AF and suggest specific pathways that could be targeted for prevention. PMID:26216085
Phenotypes, genotypes, and prevalence of congenital myopathies older than 5 years in Denmark
DEFF Research Database (Denmark)
Witting, Nanna; Werlauff, Ulla; Duno, Morten
2017-01-01
.3% NEB mutations. Less than 5% had mutations in ACTA1, TPM2/3, MTM1, TTN, SEPN1, or SC4NA. A genetic cause was established in 83% with specific histology (cores/rods/centronuclear myopathy) vs 29% with unspecific histology. The detailed clinical examination found gene-dependent discrepancies...... in the pattern of muscle affection and walking ability. Although walking ability was delayed in patients with ACTA1, TPM2/3, and RYR1 mutations, it was within normal limits in patients with NEB and DNM2 mutations. CONCLUSIONS: We found that overall, genetic and histologic prevalence of congenital myopathy...
Rapid diagnosis of hypoglycin A intoxication in atypical myopathy of horses.
Sander, Johannes; Cavalleri, Jessika-M V; Terhardt, Michael; Bochnia, Mandy; Zeyner, Annette; Zuraw, Aleksandra; Sander, Stefanie; Peter, Michael; Janzen, Nils
2016-03-01
Hypoglycin A (2-amino-3-(2-methylidenecyclopropyl)propanoic acid) is the plant toxin shown to cause atypical myopathy in horses. It is converted in vivo to methylenecyclopropyl acetic acid, which is transformed to a coenzyme A ester that subsequently blocks beta oxidation of fatty acids. Methylenecyclopropyl acetic acid is also conjugated with carnitine and glycine. Acute atypical myopathy may be diagnosed by quantifying the conjugates of methylenecyclopropyl acetic acid plus a selection of acyl conjugates in urine and serum. We describe a new mass spectrometric method for sample volumes of acid in urine, the coefficients of variation for intraday quantification were 2.9% and 3.0%, respectively. The respective values for interday were 9.3% and 8.0%. Methylenecyclopropyl acetyl carnitine was detected as high as 1.18 µmol/L in serum (median: 0.46 µmol/L) and 1.98 mmol/mol creatinine in urine (median: 0.79 mmol/mol creatinine) of diseased horses, while the glycine derivative accumulated up to 1.97 mmol/mol creatinine in urine but was undetectable in most serum samples. In serum samples from horses with atypical myopathy, the intraday coefficients of variation for C4-C8 carnitines and glycines were ≤4.5%. Measured concentrations exceeded those in healthy horses by ~10 to 1,400 times. © 2015 The Author(s).
Bauquier, J; Stent, A; Gibney, J; Jerrett, I; White, J; Tennent-Brown, B; Pearce, A; Pitt, J
2017-05-01
Investigation of toxicosis caused by Malva parviflora was required after 4 horses from the same farm developed severe muscle fasciculations, tachycardia, sweating and periods of recumbency leading to death or euthanasia after ingesting the plant. To describe historical, clinical, clinicopathological and pathological findings of 4 horses with suspected M. parviflora toxicosis. The role of cyclopropene fatty acids (found in M. parviflora) and mechanism for toxicosis are proposed. Case series. Historical, physical examination, clinicopathological and pathological findings are reported. Due to similarities with atypical myopathy or seasonal pasture myopathy acyl carnitine profiles were performed on sera from 2 cases and equine controls. Presence of cyclopropene fatty acids was also examined in sera of 2 cases. M. parviflora had been heavily grazed by the horses with little other feed available. Horse 1 deteriorated rapidly and was subjected to euthanasia. Horse 2 was referred to hospital where severe myocardial disease and generalised myopathy was determined; this horse was subjected to euthanasia 36 h after admission. Horse 3 died rapidly and Horse 4 was subjected to euthanasia at onset of clinical signs. Post-mortem examinations performed on 3 horses revealed acute, multifocal cardiac and skeletal myonecrosis. Myocyte glycogen accumulation was absent when examined in Horse 2. Acyl carnitine profiles revealed increased C14-C18 acyl carnitine concentrations in cases relative to controls. Cyclopropene fatty acids were detected in sera of cases but not controls. These findings suggest aetiology different to that of atypical myopathy or seasonal pasture myopathy. We hypothesise that cyclopropene fatty acids in M. parviflora interfere with fatty acid β-oxidation in horses in negative energy balance, causing the clinical signs and abnormal acyl carnitine profiles. These equine cases suggest a pathophysiological course that closely mimics the human genetic condition very
Nakanishi, Hideo; Suda, Kenji; Yoshikawa, Munemitsu; Akagi, Tadamichi; Kameda, Takanori; Ikeda, Hanako Ohashi; Yokota, Satoshi; Kurimoto, Yasuo; Tsujikawa, Akitaka
2018-03-01
To examine the morphology of Bruch's membrane opening (BMO), optic disc, and peripapillary atrophy (PPA) by scanning laser ophthalmoscopy (SLO) and spectral-domain optical coherence tomography (SD-OCT), and to determine their association with the axial length and visual field defects. This was a cross-sectional study of 94 eyes of 56 subjects; 77 eyes were diagnosed with primary open-angle glaucoma and 17 eyes as normal. The margins of the optic disc were determined in the SLO images, and that of the BMO in the SD-OCT images. The ovality and area of the BMO and the optic disc were measured. The beta and gamma-PPA areas were also measured. The association of each parameter with the axial length and the mean deviation (MD) of the visual field tests was determined by generalized estimating equations (GEEs). The optic disc ovality was associated with the axial length and the MD (β = -0.47, P = 7.6 × 10 -4 and β = 0.12, P = 0.040). The BMO ovality was not significantly associated with the axial length and the MD. The BMO area was associated with the axial length (β = 0.30, P = 0.029). A larger BMO area was associated with a thinner BMO-based neuroretinal rim width (BMO-MRW) after adjustments for the MD (β = -0.30, P = 2.1 × 10 -4 ). The beta- and gamma-PPA areas were associated with the axial length (β = 0.50, P = 7.4 × 10 -5 and β = 0.62, P = 4.2 × 10 -6 ). The optic disc ovality was associated with both the axial length and MD, whereas BMO ovality was not. Attention should be paid to the influence of the axial length-related enlargement of the BMO.
Brunham, L. R.; Lansberg, P. J.; Zhang, L.; Miao, F.; Carter, C.; Hovingh, G. K.; Visscher, H.; Jukema, J. W.; Stalenhoef, A. F.; Ross, C. J. D.; Carleton, B. C.; Kastelein, J. J. P.; Hayden, M. R.
2012-01-01
Statins reduce cardiovascular morbidity and mortality in appropriately selected patients. However, statin-associated myopathy is a significant risk associated with these agents. Recently, variation in the SLCO1B1 gene was reported to predict simvastatin-associated myopathy. The aim of this study was
Free radicals in alcoholic myopathy: indices of damage and preventive studies.
Preedy, Victor R; Adachi, Junko; Asano, Migiwa; Koll, Michael; Mantle, David; Niemela, Onni; Parkkila, Seppo; Paice, Alistair G; Peters, Timothy; Rajendram, Rajkumar; Seitz, Helmut; Ueno, Yasuhiro; Worrall, Simon
2002-04-15
Chronic alcoholic myopathy affects up to two-thirds of all alcohol misusers and is characterized by selective atrophy of Type II (glycolytic, fast-twitch, anaerobic) fibers. In contrast, the Type I fibers (oxidative, slow-twitch, aerobic) are relatively protected. Alcohol increases the concentration of cholesterol hydroperoxides and malondialdehyde-protein adducts, though protein-carbonyl concentration levels do not appear to be overtly increased and may actually decrease in some studies. In alcoholics, plasma concentrations of alpha-tocopherol may be reduced in myopathic patients. However, alpha-tocopherol supplementation has failed to prevent either the loss of skeletal muscle protein or the reductions in protein synthesis in alcohol-dosed animals. The evidence for increased oxidative stress in alcohol-exposed skeletal muscle is thus inconsistent. Further work into the role of ROS in alcoholic myopathy is clearly warranted.
Insulin resistance and increased muscle cytokine levels in patients with mitochondrial myopathy.
Rue, Nana; Vissing, John; Galbo, Henrik
2014-10-01
Mitochondrial dysfunction has been proposed to cause insulin resistance and that might stimulate cytokine production. The objective of the study was to elucidate the association between mitochondrial myopathy, insulin sensitivity, and cytokine levels in muscle. This was an experimental, controlled study in outpatients. Eight overnight-fasted patients (P) with various inherited mitochondrial myopathies and eight healthy subjects (C) matched for sex, age, weight, height, and physical activity participated in the study. The intervention included a 120-minute hyperinsulinemic, euglycemic clamp. Another morning, microdialysis of both vastus lateralis muscles for 4 hours, including one-legged, knee extension exercise for 30 minutes, was performed. Glucose infusion rate during 90-120 minutes of insulin infusion was measured. Cytokine concentrations in dialysate were also measured. Muscle strength, percentage fat mass, and creatine kinase in plasma did not differ between groups. The maximal oxygen uptake was 21 ± 3 (SE) (P) and 36 ± 3(C) mL/kg·min (2P fatty acids and glycerol at 120 minutes were higher in P vs C (2P myopathies, insulin sensitivity of muscle, adipose tissue, and pancreatic A cells is reduced, supporting that mitochondrial function influences insulin action. Furthermore, a local, low-grade inflammation of potential clinical importance exists in the muscle of these patients.
Energy Technology Data Exchange (ETDEWEB)
Kropp, J.; Briele, B.; Smekal, A.V.; Hotze, A.L.; Biersack, H.J.; Koehler, U.; Zierz, St. [Bonn Univ. (Germany); Knapp, F.F. [Oak Ridge National Lab., TN (United States)
1992-03-01
Involvement of the myocardium in non-infectious myopathies presents in most cases as systolic dysfunction or a disturbed cardiac rhythm. We are interested in exploring how often cardiac involvement can be evaluated with various diagnostic techniques in patients with proven myopathy. We investigated 41 patients with myopathies of various etiology, including mitochondrial and congenital myopathies, Curshmann-Steinert disease, muscular dystrophy, and others. Myopathy was proven by muscular biopsy usually from the bicep. Fatty acid imaging was performed with 15-(p-[I-123]iodophenyl)pentadecanoic acid (IP-PA) and sequential SPECT-scintigraphy with a 180 deg. rotation starting at the 45 deg. RAO position. 190 MBq were injected at the maximal stage of a submaximal exercise. Filtered backprojection and reorientation of the slices were achieved by standard techniques. The quantitative comparison of the oblique slices (bulls-eye technique) of the SPECT-studies revealed turnover-rates as a qualitative measure of {beta}-oxidation. Serum levels of lactate (L), pyruvate (P), glucose (G) and triglycerides (TG) were measured at rest and stress. Ventricular function was investigated by radionuclide ventriculography (MUGA) at rest and under stress with Tc-99m labeled red blood cells. In addition, ECG, 24 hour-ECG, and echocardiography were also performed with standard techniques.
Energy Technology Data Exchange (ETDEWEB)
Kropp, J.; Briele, B.; Smekal, A.V.; Hotze, A.L.; Biersack, H.J.; Koehler, U.; Zierz, St. (Bonn Univ. (Germany)); Knapp, F.F. (Oak Ridge National Lab., TN (United States))
1992-01-01
Involvement of the myocardium in non-infectious myopathies presents in most cases as systolic dysfunction or a disturbed cardiac rhythm. We are interested in exploring how often cardiac involvement can be evaluated with various diagnostic techniques in patients with proven myopathy. We investigated 41 patients with myopathies of various etiology, including mitochondrial and congenital myopathies, Curshmann-Steinert disease, muscular dystrophy, and others. Myopathy was proven by muscular biopsy usually from the bicep. Fatty acid imaging was performed with 15-(p-(I-123)iodophenyl)pentadecanoic acid (IP-PA) and sequential SPECT-scintigraphy with a 180 deg. rotation starting at the 45 deg. RAO position. 190 MBq were injected at the maximal stage of a submaximal exercise. Filtered backprojection and reorientation of the slices were achieved by standard techniques. The quantitative comparison of the oblique slices (bulls-eye technique) of the SPECT-studies revealed turnover-rates as a qualitative measure of {beta}-oxidation. Serum levels of lactate (L), pyruvate (P), glucose (G) and triglycerides (TG) were measured at rest and stress. Ventricular function was investigated by radionuclide ventriculography (MUGA) at rest and under stress with Tc-99m labeled red blood cells. In addition, ECG, 24 hour-ECG, and echocardiography were also performed with standard techniques.
International Nuclear Information System (INIS)
Kropp, J.; Briele, B.; Smekal, A.V.; Hotze, A.L.; Biersack, H.J.; Koehler, U.; Zierz, St.; Knapp, F.F.
1992-01-01
Involvement of the myocardium in non-infectious myopathies presents in most cases as systolic dysfunction or a disturbed cardiac rhythm. We are interested in exploring how often cardiac involvement can be evaluated with various diagnostic techniques in patients with proven myopathy. We investigated 41 patients with myopathies of various etiology, including mitochondrial and congenital myopathies, Curshmann-Steinert disease, muscular dystrophy, and others. Myopathy was proven by muscular biopsy usually from the bicep. Fatty acid imaging was performed with 15-(p-[I-123]iodophenyl)pentadecanoic acid (IP-PA) and sequential SPECT-scintigraphy with a 180 deg. rotation starting at the 45 deg. RAO position. 190 MBq were injected at the maximal stage of a submaximal exercise. Filtered backprojection and reorientation of the slices were achieved by standard techniques. The quantitative comparison of the oblique slices (bulls-eye technique) of the SPECT-studies revealed turnover-rates as a qualitative measure of β-oxidation. Serum levels of lactate (L), pyruvate (P), glucose (G) and triglycerides (TG) were measured at rest and stress. Ventricular function was investigated by radionuclide ventriculography (MUGA) at rest and under stress with Tc-99m labeled red blood cells. In addition, ECG, 24 hour-ECG, and echocardiography were also performed with standard techniques
Clinical, serologic, and immunogenetic features of familial idiopathic inflammatory myopathy
Rider, L. G.; Gurley, R. C.; Pandey, J. P.; Garcia de la Torre, I.; Kalovidouris, A. E.; O'Hanlon, T. P.; Love, L. A.; Hennekam, R. C.; Baumbach, L. L.; Neville, H. E.; Garcia, C. A.; Klingman, J.; Gibbs, M.; Weisman, M. H.; Targoff, I. N.; Miller, F. W.
1998-01-01
OBJECTIVE: To describe the clinical, serologic, and immunogenetic features of familial idiopathic inflammatory myopathy (IIM) and to compare these with the features of sporadic IIM. METHODS: Clinical signs and symptoms, autoantibodies, HLA-DRB1 and DQA1 alleles, and GM/KM phenotypes were compared
Muir, Paul; Choe, Michelle S; Croxson, Michael S
2012-06-01
Anterior compartment syndrome (ACS) and rhabdomyolysis are rare complications of hypothyroid myopathy. We report the case of a young man with rapid onset of ACS who presented with simultaneous primary hypothyroidism and adrenal insufficiency associated with acute renal failure, hyponatremia, and hyperkalemia. A 22-year-old man presenting with a one-month history of tiredness, hyperpigmentation, and cramps in his calves was found to have severe bilateral foot drop. Investigations revealed severe primary hypothyroidism and adrenal insufficiency, renal failure, and evidence of rhabdomyolysis with myoglobinuria. Abnormal biochemical findings included serum sodium of 110 mM, serum potassium of 6.9 mM, and serum creatine kinase (CK) of >25,000 IU/L. Magnetic resonance imaging (MRI) of his legs showed changes of myonecrosis confined to anterior tibial muscles typical of ACS. After treatment with intravenous fluids, potassium-lowering therapies, thyroxine, and hydrocortisone, his renal and metabolic function returned to normal, but irreversible bilateral foot drop persisted. A young man with primary hypothyroidism, adrenal insufficiency, hyponatremia, and hyperkalemia presented with severe myopathy, such that muscle necrosis, apparently confined to the anterior tibial compartment on MRI, led to rhabdomyolysis, acute renal failure, and irreversible bilateral peroneal nerve damage. It is possible that other patients with primary hypothyroidism and marked elevations of CK without widespread myopathy or rhabdomyolysis may demonstrate evidence of differential muscle effects in the anterior compartment when assessed by MRI, but that this patient also had adrenal insufficiency raises the possibility that this was a contributing factor. Severe thyroid myopathy and rhabdomyolysis may be associated with anatomic susceptibility to ACS, particularly in the presence of concomitant adrenal insufficiency. MRI examination reveals a distinctive appearance of myonecrosis confined to
Axial magnetic field produced by axially and radially magnetized permanent rings
International Nuclear Information System (INIS)
Peng, Q.L.; McMurry, S.M.; Coey, J.M.D.
2004-01-01
Axial magnetic fields produced by axially and radially magnetized permanent magnet rings were studied. First, the axial magnetic field produced by a current loop is introduced, from which the axial field generated by an infinitely thin solenoid and by an infinitely thin current disk can be derived. Then the axial fields produced by axially and by radially magnetized permanent magnet rings can be obtained. An analytic formula for the axial fields produced by two axially magnetized rings is given. A permanent magnet with a high axial gradient field is fabricated, the measured results agree with the theoretical calculation very well. As an example, the axial periodic field produced by an arrangement of alternating axially and radially magnetized rings has been discussed
Lipid myopathy associated with renal tubular acidosis and spastic diplegia in two brothers.
Tung, Y C; Tsau, Y K; Chu, L W; Young, C; Shen, Y Z
2001-07-01
Lipid myopathy is a group of disorders involving mitochondrial fatty acid oxidation. We describe two brothers, 3 years 8 months old and 2 years 9 months old, respectively, with progressive spastic diplegia, developmental delay, failure to thrive, and chronic metabolic acidosis who had lipid myopathy and renal tubular acidosis. Brain magnetic resonance imaging revealed demyelinating changes in the periventricular white matter, which was compatible with spastic diplegia. These symptoms may be related to errors in fatty acid metabolism. Cerebral palsy had been misdiagnosed in both of these patients at another hospital. Therefore, for patients with late-onset and progressive spastic diplegia, detailed investigations for underlying diseases are warranted.
Collagen XII myopathy with rectus femoris atrophy and collagen XII retention in fibroblasts
DEFF Research Database (Denmark)
Witting, Nanna; Krag, Thomas; Werlauff, Ulla
2018-01-01
INTRODUCTION: Mutation in the collagen XII gene (COL12A1) was recently reported to induce Bethlem myopathy. We describe a family affected by collagen XII-related myopathy in 3 generations. METHODS: Systematic interview, clinical examination, skin biopsies, and MRI of muscle were used. RESULTS...... affection and abnormal collagen XII retention in fibroblasts. MRI disclosed a selective wasting of the rectus femoris muscle. DISCUSSION: COL12A1 mutations should be considered in patients with a mild Bethlem phenotype who present with selective wasting of the rectus femoris, absence of the outside......-in phenomenon on MRI, and abnormal collagen XII retention in fibroblasts. Muscle Nerve, 2018....
DNAJB6 myopathies: Focused review on an emerging and expanding group of myopathies
Directory of Open Access Journals (Sweden)
Alessandra Ruggieri
2016-09-01
Full Text Available Mutations in the DNAJB6 gene have been associated with the autosomal dominant limb girdle muscular dystrophy type 1D (LGMD1D, a disorder characterized by abnormal protein aggregates and rimmed vacuoles in muscle fibers. DNAJB6 is a ubiquitously expressed Hsp40 co-chaperone characterized by a J domain that specifies Hsp70 functions in the cellular environment. DNAJB6 is also a potent inhibitor of expanded polyglutamine (polyQ aggregation preventing aggregate toxicity in cells. In DNAJB6-mutated patients this anti-aggregation property is significantly reduced, albeit not completely lost. To elucidate the pathogenetic mechanisms underlying the DNAJB6-related myopathy, animal models have been created showing that, indeed, conditional muscular expression of a DNAJB6 mutant in the mouse causes a LGMD1D myofibrillary muscle tissue phenotype. Both mutations and phenotypes reported until recently were rather homogeneous, being exclusively missense mutations of a few amino acids of the protein G/F domain, and with a phenotype characterized by adult-onset slowly progressive muscular dystrophy predominantly affecting proximal muscles. Lately, several novel mutations and new phenotypes of DNAJB6 have been described. These mutations once more affect the G/F domain of DNAJB6 with missense changes and a splice site mutation; and the phenotypes include childhood onset and distal involvement of muscles, or childhood-onset LGMD1D with loss of ambulation in early adulthood and respiratory involvement. Thus, the spectrum of DNAJB6-related phenotypes is widening. Although our knowledge about the role of DNAJB6 in the pathogenesis of muscle diseases has made great progression, several questions remain unsolved, including why a ubiquitous protein affects only, or predominantly, skeletal muscle; why only the G/F domain is involved; and what is the possible role of the DNAJB6a isoform. Clarification of these issues will provide clues to implement possible therapeutic
Vignola, María Belén; Dávila, Soledad; Cremonezzi, David; Simes, Juan C; Palma, José A; Campana, Vilma R
2012-12-01
The effect of pulsed electromagnetic field (PEMF) therapy, also called magnetic therapy, upon inflammatory biomarkers associated with oxidative stress plasma fibrinogen, nitric oxide (NO), L-citrulline, carbonyl groups, and superoxide dismutase (SOD) was evaluated through histological assessment, in rats with experimental myopathy. The groups studied were: (A) control (intact rats that received PEMF sham exposures); (B) rats with myopathy and sacrificed 24 h later; (C) rats with myopathy; (D) rats with myopathy and treated with PEMF; and (E) intact rats treated with PEMF. Groups A, C, D, and E were sacrificed 8 days later. Myopathy was induced by injecting 50 μl of 1% carrageenan λ (type IV) once sub-plantar. Treatment was carried out with PEMF emitting equipment with two flat solenoid disks for 8 consecutive days in groups D and E, at 20 mT and 50 Hz for 30 min/day/rat. The biomarkers were determined by spectrophotometry. The muscles (5/8) were stained with Hematoxylin-Eosin and examined by optic microscopy. Quantitative variables were statistically analyzed by the Fisher test, and categorical applying Pearson's Chi Squared test at p < 0.05 for all cases. In Groups B and C, the biomarkers were significantly increased compared to A, D, and E groups: fibrinogen (p < 0.001); NO, L-citrulline and carbonyl groups (p < 0.05); SOD (p < 0.01) as well as the percentage of area with inflammatory infiltration (p < 0.001). PEMF caused decreased levels of fibrinogen, L-citrulline, NO, SOD, and carbonyl groups and significant muscle recovery in rats with experimental myopathies.
Akiyama, Masashi; Sakai, Kaori; Ogawa, Masaya; McMillan, James R; Sawamura, Daisuke; Shimizu, Hiroshi
2007-12-01
Recently, mutations in PNPLA2 encoding adipose triglyceride lipase (ATGL) were reported to underlie a neutral lipid storage disease (NLSD) subgroup characterized by mild myopathy and the absence of ichthyosis. In the present study a novel homozygous PNPLA2 mutation c.475_478dupCTCC (p.Gln160ProfsX19) in the patatin domain, the ATGL active site, was detected in a woman with NLSD and severe myopathy. The present results suggest that a premature truncation mutation in the patatin domain causes NLSD with severe myopathy.
Diagnostic value of MHC class I staining in idiopathic inflammatory myopathies.
Pas, J. van der; Hengstman, G.J.D.; Laak, H.J. ter; Borm, G.F.; Engelen, B.G.M. van
2004-01-01
BACKGROUND: Identification of mononuclear cellular infiltrates in skeletal muscle tissue is the histological cornerstone of the diagnosis of idiopathic inflammatory myopathy (IIM). However, these infiltrates are not always present. OBJECTIVE: To determine whether MHC class I antigen expression on
Diagnosis and treatment of the idiopathic inflammatory myopathies
Gazeley, David J.; Cronin, Mary E.
2011-01-01
The idiopathic inflammatory myopathies (IIMs) are rare disorders with the unifying feature of proximal muscle weakness. These diseases include polymyositis(PM), dermatomyositis (DM) and inclusion body myositis (IBM) as the most common. The diagnosis is based on the finding of weakness on exam, elevated muscles enzymes, characteristic histopathology of muscle biopsies, electromyography abnormalities and rash in DM. Myositis-specific antibodies have been helpful in defining subsets of patients ...
Yilmaz, Ali; Gdynia, Hans-Jürgen; Ponfick, Matthias; Rösch, Sabine; Lindner, Alfred; Ludolph, Albert C; Sechtem, Udo
2012-04-01
Mitochondrial myopathy comprises various clinical subforms of neuromuscular disorders that are characterised by impaired mitochondrial energy metabolism due to dysfunction of the mitochondrial respiratory chain. No comprehensive and targeted cardiovascular magnetic resonance (CMR) studies have been performed so far in patients with mitochondrial disorders. The present study aimed at characterising cardiac disease manifestations in patients with mitochondrial myopathy and elucidating the in vivo cardiac damage pattern of patients with different subforms of mitochondrial disease by CMR studies. In a prospective study, 37 patients with mitochondrial myopathy underwent comprehensive neurological and cardiac evaluations including physical examination, resting ECG and CMR. The CMR studies comprised cine-CMR, T2-weighted "edema" imaging and T1-weighted late-gadolinium-enhancement (LGE) imaging. Various patterns and degrees of skeletal myopathy were present in the participants of this study, whereas clinical symptoms such as chest pain symptoms (in eight (22%) patients) and various degrees of dyspnea (in 16 (43%) patients) were less frequent. Pathological ECG findings were documented in eight (22%) patients. T2-weighted "edema" imaging was positive in one (3%) patient with MELAS (mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes) only. LGE imaging demonstrated the presence of non-ischemic LGE in 12 (32%) patients: 10 out of 24 (42%) patients with CPEO (chronic progressive external ophthalmoplegia) or KSS (Kearns-Sayre syndrome) and 2 of 3 (67%) patients with MELAS were LGE positive. All 10 LGE-positive patients with CPEO or KSS demonstrated a potentially typical pattern of diffuse intramural LGE in the left-ventricular (LV) inferolateral segments. Cardiac involvement is a frequent finding in patients with mitochondrial myopathy. A potentially characteristic pattern of diffuse intramural LGE in the LV inferolateral segments was identified in
Directory of Open Access Journals (Sweden)
Bruno Cupertino Migueletto
1999-10-01
Full Text Available Primary biliary cirrhosis (PBC is a cholestatic liver disease, which is characterized by a chronic inflammatory destruction of intrahepatic bile ducts. It is a rare disorder whose precise etiology is still to be elucidated. Even though the liver is the principal target of PBC, other organ systems also might be affected. Muscular involvement has rarely been described in this disease, and in the majority of cases, muscular weakness has been interpreted as polymyositis. We report the case of a 48-year-old woman suffering from classic PBC, in association with a myopathy whose histological features are distinct from the cases reported before. We also performed a MEDLINE research for PBC and concomitant muscular diseases.A cirrose biliar primária (CBP é uma doença hepática colestática crônica de etiologia desconhecida e rara. Apesar do principal órgão acometido na CBP ser o fígado, outros órgãos podem também ser afetados. O acometimento muscular raramente tem sido relatado em pacientes com CBP e na maioria destes casos, a fraqueza muscular tem sido interpretada como Polimiosite. Nós relatamos o caso de uma mulher de 48 anos com CBP e miopatia com achados histopatológicos distintos dos casos anteriormente descritos e fizemos uma revisão da literatura sobre o acometimento muscular na CBP.
Atypical myopathy in Denmark confirmed with the aTRAQ assay
DEFF Research Database (Denmark)
Høffer, Sofie Esbjørn; Votion, Dominique-Marie; Anderberg, Marie
2016-01-01
Atypical myopathy is a severe form of rhabdomyolysis that occurs in grazing horses. Over the past decades, the disease has been emerging in Europe. The disease is widespread in Europe and has been suspected in Denmark since 2000, yet no cases have been confirmed. The objective of this study...
Exertional myopathy in a grizzly bear (Ursus arctos) captured by leghold snare.
Cattet, Marc; Stenhouse, Gordon; Bollinger, Trent
2008-10-01
We diagnosed exertional myopathy (EM) in a grizzly bear (Ursus arctos) that died approximately 10 days after capture by leghold snare in west-central Alberta, Canada, in June 2003. The diagnosis was based on history, post-capture movement data, gross necropsy, histopathology, and serum enzyme levels. We were unable to determine whether EM was the primary cause of death because autolysis precluded accurate evaluation of all tissues. Nevertheless, comparison of serum aspartate aminotransferase and creatine kinase concentrations and survival between the affected bear and other grizzly bears captured by leghold snare in the same research project suggests EM also occurred in other bears, but that it is not generally a cause of mortality. We propose, however, occurrence of nonfatal EM in grizzly bears after capture by leghold snare has potential implications for use of this capture method, including negative effects on wildlife welfare and research data.
[Rhabdomyolysis - may it be a metabolic myopathy? Case report and diagnostic algorithm].
Sebők, Ágnes; Pál, Endre; Molnár, Gergő Attila; Wittmann, István; Berenténé Bene, Judit; Melegh, Béla; Komoly, Sámuel; Hidvégi, Tibor; Balogh, Lídia; Szabó, Attila; Zsidegh, Petra
2017-11-01
We report the case of a 46-year-old female patient with recurrent rhabdomyolysis. In the background of her metabolic myopathy an inherited metabolic disorder of the fatty acid oxidation, very long-chain acyl-coenzyme A-dehydrogenase deficiency was diagnosed. The diagnosis was based on abnormal acyl-carnitine- and urine organic-acid profile in addition to low residual enzyme activity, and was confirmed by genetic testing. After introduction of dietotherapy metabolic crisis necessitating hospital admission has not occurred neither have fixed myopathic changes developed. We present here the differential diagnosis of rhabdomyolysis and exertional muscle complaints, with the metabolic myopathies in focus. The main features of fatty acid oxidation disorders are highlighted, acute and chronic managements of very long-chain acyl-coenzyme A-dehydrogenase deficiency are discussed. Metabolic myopathies respond well to treatment, so good quality of life can be achieved. However, especially in fatty acid oxidation disorders, a metabolic crisis may develop quickly and can be fatal, albeit rarely. Some of these disorders can be identified by newborn screening, but occasionally the symptoms may manifest only in adulthood. With the presentation of this case we would like to point out that in the differential diagnosis of recurrent rhabdomyolysis inherited metabolic disorders should be considered regardless of the patient's age. Orv Hetil. 2017; 158(46): 1873-1882.
Three-dimensional magnetotelluric axial anisotropic forward modeling and inversion
Cao, Hui; Wang, Kunpeng; Wang, Tao; Hua, Boguang
2018-06-01
Magnetotelluric (MT) data has been widely used to image underground electrical structural. However, when the significant axial resistivity anisotropy presents, how this influences three-dimensional MT data has not been resolved clearly yet. We here propose a scheme for three-dimensional modeling of MT data in presence of axial anisotropic resistivity, where the electromagnetic fields are decomposed into primary and secondary components. A 3D staggered-grid finite difference method is then used to resolve the resulting 3D governing equations. Numerical tests have completed to validate the correctness and accuracy of the present algorithm. A limited-memory Broyden-Fletcher-Goldfarb-Shanno method is then utilized to realize the 3D MT axial anisotropic inversion. The testing results show that, compared to the results of isotropic resistivity inversion, taking account the axial anisotropy can much improve the inverted results.
RYR1-related myopathies: a wide spectrum of phenotypes throughout life
Snoeck, M.; Engelen, B.G.M. van; Kusters, B.; Lammens, M.M.; Meijer, R.; Molenaar, J.P.F.; Raaphorst, J.; Verschuuren-Bemelmans, C.C.; Straathof, C.S.; Sie, L.T.L.; Coo, I.F.M. de; Pol, W.L. van der; Visser, M de; Scheffer, H.; Treves, S.; Jungbluth, H.; Voermans, N.C.; Kamsteeg, E.J.
2015-01-01
BACKGROUND AND PURPOSE: Although several recent studies have implicated RYR1 mutations as a common cause of various myopathies and the malignant hyperthermia susceptibility (MHS) trait, many of these studies have been limited to certain age groups, confined geographical regions or specific
Statin-associated myopathy: from genetic predisposition to clinical management.
Vrablik, M; Zlatohlavek, L; Stulc, T; Adamkova, V; Prusikova, M; Schwarzova, L; Hubacek, J A; Ceska, R
2014-01-01
Statin-associated myopathy (SAM) represents a broad spectrum of disorders from insignificant myalgia to fatal rhabdomyolysis. Its frequency ranges from 1-5 % in clinical trials to 15-20 % in everyday clinical practice. To a large extent, these variations can be explained by the definition used. Thus, we propose a scoring system to classify statin-induced myopathy according to clinical and biochemical criteria as 1) possible, 2) probable or 3) definite. The etiology of this disorder remains poorly understood. Most probably, an underlying genetic cause is necessary for overt SAM to develop. Variants in a few gene groups that encode proteins involved in: i) statin metabolism and distribution (e.g. membrane transporters and enzymes; OATP1B1, ABCA1, MRP, CYP3A4), ii) coenzyme Q10 production (e.g. COQ10A and B), iii) energy metabolism of muscle tissue (e.g. PYGM, GAA, CPT2) and several others have been proposed as candidates which can predispose to SAM. Pharmacological properties of individual statin molecules (e.g. lipophilicity, excretion pathways) and patients´ characteristics influence the likelihood of SAM development. This review summarizes current data as well as our own results.
Effects of ubiquinone (coenzyme Q10) on myopathy in statin users.
Schaars, C.F.; Stalenhoef, A.F.H.
2008-01-01
PURPOSE OF REVIEW: Statins are associated with muscle complaints, including myositis. The mechanism through which statin use causes muscle toxicity is unknown. One of the theories is that statin therapy reduces coenzyme Q10 levels in muscle mitochondria, which leads to muscle injury and myopathy.
Osaki, Yoshinori; Nakagawa, Yoshimi; Miyahara, Shoko; Iwasaki, Hitoshi; Ishii, Akiko; Matsuzaka, Takashi; Kobayashi, Kazuto; Yatoh, Shigeru; Takahashi, Akimitsu; Yahagi, Naoya; Suzuki, Hiroaki; Sone, Hirohito; Ohashi, Ken; Ishibashi, Shun; Yamada, Nobuhiro; Shimano, Hitoshi
2015-10-23
HMG-CoA reductase (HMGCR) catalyzes the conversion of HMG-CoA to mevalonic acid (MVA); this is the rate-limiting enzyme of the mevalonate pathway that synthesizes cholesterol. Statins, HMGCR inhibitors, are widely used as cholesterol-reducing drugs. However, statin-induced myopathy is the most adverse side effect of statins. To eludicate the mechanisms underlying statin the myotoxicity and HMGCR function in the skeletal muscle, we developed the skeletal muscle-specific HMGCR knockout mice. Knockout mice exhibited postnatal myopathy with elevated serum creatine kinase levels and necrosis. Myopathy in knockout mice was completely rescued by the oral administration of MVA. These results suggest that skeletal muscle toxicity caused by statins is dependent on the deficiencies of HMGCR enzyme activity and downstream metabolites of the mevalonate pathway in skeletal muscles rather than the liver or other organs. Copyright © 2015 Elsevier Inc. All rights reserved.
[Cardiac myopathy due to overt hypothyroidism].
Harbeck, B; Berndt, M J; Lehnert, H
2014-03-01
A 51-year-old man presented with progressive tiredness, proximal muscle weakness, hair loss and weight gain for months. The patient showed mild pretibial myxedema and dry skin. Laboratory findings revealed strongly elevated cardiac enzymes as well as marked hypothyroidism. The electrocardiogram, echocardiography, abdominal sonography and chest X-ray were unremarkable. Thyroid ultrasound demonstrated features of Hashimoto thyroiditis. The findings supported the diagnosis of an overt hypothyroidism with myxedema and rhabdomyolysis. After starting levothyroxine and volume substitution laboratory parameters and clinical condition slowly normalized. Severe overt hypothyroidism may rarely present primarily as myopathy with myositis and cardiac involvement. © Georg Thieme Verlag KG Stuttgart · New York.
[Insight into the training of patients with idiopathic inflammatory myopathy].
Váncsa, Andrea
2016-09-01
Using current recommended treatment, a majority of patients with idiopathic inflammatory myopathy develop muscle impairment and poor health. Beneficial effects of exercise have been reported on muscle performance, aerobic capacity and health in chronic polymyositis and dermatomyositis, as well as in active disease and inclusion body myositis to some extent. Importantly, randomized controlled trials indicate that improved health and decreased clinical disease activity could be mediated through increased aerobic capacity. Recently, reports seeking pathomechanisms of the underlying effects of exercise on skeletal muscle indicate increased aerobic capacity (i.e. increased mitochondrial capacity and capillary density, reduced lactate levels), activation of genes of aerobic phenotype and muscle growth programs and down regulation of genes related to inflammation. Exercise contributes to both systemic and within-muscle adaptations demonstrating that it is fundamental for improving muscle performance and health in patients with idiopathic inflammatory myopathy. There is a need for randomized controlled trials to study the effects of exercise in patients with active disease and inclusion body myositis. Orv. Hetil., 2016, 157(39), 1557-1562.
The genetic basis of pectoralis major myopathies in modern broiler chicken lines.
Bailey, Richard A; Watson, Kellie A; Bilgili, S F; Avendano, Santiago
2015-12-01
This is the first report providing estimates of the genetic basis of breast muscle myopathies (BMM) and their relationship with growth and yield in broiler chickens. In addition, this paper addresses the hypothesis that genetic selection for increase breast yield has contributed to the onset of BMM. Data were analyzed from ongoing recording of BMM within the Aviagen breeding program. This study focused on three BMM: deep pectoral myopathy (DPM; binary trait), white striping (WS; 4 categories) and wooden breast (WB; 3 categories). Data from two purebred commercial broiler lines (A and B) were utilized providing greater than 40,000 meat quality records per line. The difference in selection history between these two lines has resulted in contrasting breast yield (BY): 29% for Line A and 21% for Line B. Data were analyzed to estimate genetic parameters using a multivariate animal model including six traits: body weight (BW), processing body weight (PW), BY, DPM, WB, and WS, in addition to the appropriate fixed effects and permanent environmental effect of the dam. Results indicate similar patterns of heritability and genetic correlations for the two lines. Heritabilities (h2) of BW, PW and BY ranged from 0.271-0.418; for DPM and WB h2white striping of breast muscle and more than 90% of the variance of the incidence of wooden breast and deep pectoral myopathy in broiler chickens. © The Author 2015. Published by Oxford University Press on behalf of Poultry Science Association.
The heart in Becker muscular dystrophy, facioscapulohumeral dystrophy, and Bethlem myopathy
de Visser, M.; de Voogt, W. G.; la Rivière, G. V.
1992-01-01
We report a study, assessing involvement of the heart in 33 familial cases of Becker muscular dystrophy (BMD), 31 familiar cases of facioscapulohumeral (FSH) dystrophy, and 27 familial cases of Bethlem myopathy. In the patients with BMD, correlations of myocardial involvement with age and extent of
Axial Dispersion during Hanford Saltcake Washing
International Nuclear Information System (INIS)
Josephson, Gary B.; Geeting, John GH; Lessor, Delbert L.; Barton, William B.
2006-01-01
Clean up of Hanford salt cake wastes begins with dissolution retrieval of the sodium rich salts that make up the dominant majority of mass in the tanks. Water moving through the porous salt cake dissolves the soluble components and also displaces the soluble radionuclides (e.g. 137Cs and 99TcO4- ). The separation that occurs from this displacement, known as Selective dissolution, is an important component in Hanford?s pretreatment of low activity wastes for subsequent Supplemental treatment. This paper describes lab scale testing conducted to evaluate Selective dissolution of cesium from non-radioactive Hanford tank 241-S-112 salt cake simulant containing the primary chemicals found the actual tank. An modified axial dispersion model with increasing axial dispersion was developed to predict cesium removal. The model recognizes that water dissolves the salt cake during washing, which causes an increase in the axial dispersion during the wash. This model was subsequently compared with on-line cesium measurements from the retrieval of tank 241-S-112. The model had remarkably good agreement with both the lab scale and full scale data
Fatal hepatic hemorrhage by peliosis hepatis in X-linked myotubular myopathy: a case report.
Motoki, T; Fukuda, M; Nakano, T; Matsukage, S; Fukui, A; Akiyoshi, S; Hayashi, Y K; Ishii, E; Nishino, I
2013-11-01
We report a 5-year-old boy with X-linked myotubular myopathy complicated by peliosis hepatis. At birth, he was affected with marked generalized muscle hypotonia and weakness, which required permanent ventilatory support, and was bedridden for life. He died of acute fatal hepatic hemorrhage after using a mechanical in-exsufflator. Peliosis hepatis, defined as multiple, variable-sized, cystic blood-filled spaces through the liver parenchyma, was confirmed by autopsy. To avoid fatal hepatic hemorrhage by peliosis hepatis, routine hepatic function tests and abdominal imaging tests should be performed for patients with X-linked myotubular myopathy, especially at the time of using artificial respiration. Copyright © 2013 Elsevier B.V. All rights reserved.
Elasto-optics in double-coated optical fibers induced by axial strain and hydrostatic pressure.
Yang, Yu-Ching; Lee, Haw-Long; Chou, Huann-Ming
2002-04-01
Stresses, microbending loss, and refractive-index changes induced simultaneously by axial strain and hydrostatic pressure in double-coated optical fibers are analyzed. The lateral pressure and normal stresses in the optical fiber, primary coating, and secondary coating are derived. Also presented are the microbending loss and refractive-index changes in the glass fiber. The normal stresses are affected by axial strain, hydrostatic pressure, material properties, and thickness of the primary and secondary coatings. It is found that microbending loss decreases with increasing thickness, the Young's modulus, and the Poisson's ratio of the secondary coating but increases with the increasing Young's modulus and Poisson's ratio of the primary coating. Similarly, changes in refractive index in the glass fiber decrease with the increasing Young's modulus and Poisson's ratio of the secondary coating but increase with the increasing Young's modulus and Poisson's ratio of the primary coating. Therefore, to minimize microbending loss induced simultaneously by axial strain and hydrostatic pressure in the glass fiber, the polymeric coatings should be suitably selected. An optimal design procedure is also indicated.
Using axial magnetized permanent rings to build axial gradient magnetic field
International Nuclear Information System (INIS)
Peng Quanling
2003-01-01
Axial field produced by an axially magnetized permanent ring was studied. For two permanent magnet rings, if they are magnetized in the same direction, a nearly uniform axial field can be produced; if they are magnetized in opposite direction, an axial gradient field can be produced in the region between the two permanent rings, with the field strength changing from -B 0 to B 0 . A high gradient axial magnetic field has been built by using two axially magnetized permanent rings, the measured field results agree with the PANDIRA calculation very well. It is desirable that the field gradient can be varied to match various requirements. A method to produce the variable gradient field is presented. Axial gradient field can also be used as a beam focusing facility for linear accelerator if axial periodic field can be produced. Its magnetic field is similar to that of a solenoid, in which, large stray field will leak to the outside environment. A method for shielding the outside stray field is discussed
Bastin, Jean; Djouadi, Fatima
2016-01-01
Resveratrol is a natural polyphenolic compound produced by plants under various stress conditions. Resveratrol has been reported to exhibit antioxidant, anti-inflammatory, and anti-proliferative properties in mammalian cells and animal models, and might therefore exert pleiotropic beneficial effects in different pathophysiological states. More recently, resveratrol has also been shown to potentially target many mitochondrial metabolic pathways, including fatty acid β-oxidation or oxidative phosphorylation, leading to the up-regulation of the energy metabolism via signaling pathways involving PGC-1α, SIRT1, and/or AMP-kinase, which are not yet fully delineated. Some of resveratrol beneficial effects likely arise from its cellular effects in the skeletal muscle, which, surprisingly, has been given relatively little attention, compared to other target tissues. Here, we review the potential for resveratrol to ameliorate or correct mitochondrial metabolic deficiencies responsible for myopathies, due to inherited fatty acid β-oxidation or to respiratory chain defects, for which no treatment exists to date. We also review recent data supporting therapeutic effects of resveratrol in the Duchenne Muscular Dystrophy, a fatal genetic disease affecting the production of muscle dystrophin, associated to a variety of mitochondrial dysfunctions, which likely contribute to disease pathogenesis. PMID:27136581
Joo, Jung-Chul; Seol, Myung Do; Yoon, Jin Won; Lee, Young Soo; Kim, Dong-Keun; Choi, Yong Hoon; Ahn, Hyo Seong; Cho, Wook Hyun
2013-03-01
Myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS) is a multisystem clinical syndrome manifested by mitochondrial myopathy, encephalopathy, lactic acidosis and recurrent stroke-like episodes. A 27-year-old female with MELAS syndrome presented with cerebral infarction. Echocardiography revealed a thrombus attached to the apex of the hypertrophied left ventricle, with decreased systolic function. The embolism of the intracardiac thrombus might have been the cause of stroke. There should be more consideration given to the increased possibility of intracardiac thrombus formation when a MELAS patient with cardiac involvement is encountered.
Genetic factors affecting statin concentrations and subsequent myopathy: a HuGENet systematic review
Canestaro, William J.; Austin, Melissa A.; Thummel, Kenneth E.
2015-01-01
Statins, 3-hydroxy-3-methyl-glutaryl-coenzyme A reductase inhibitors, have proven efficacy in both lowering low-density-lipoprotein levels and preventing major coronary events, making them one of the most commonly prescribed drugs in the United States. Statins exhibit a class-wide side effect of muscle toxicity and weakness, which has led regulators to impose both dosage limitations and a recall. This review focuses on the best-characterized genetic factors associated with increased statin muscle concentrations, including the genes encoding cytochrome P450 enzymes (CYP2D6, CYP3A4, and CYP3A5), a mitochondrial enzyme (GATM), an influx transporter (SLCO1B1), and efflux transporters (ABCB1 and ABCG2). A systematic literature review was conducted to identify relevant research evaluating the significance of genetic variants predictive of altered statin concentrations and subsequent statin-related myopathy. Studies eligible for inclusion must have incorporated genotype information and must have associated it with some measure of myopathy, either creatine kinase levels or self-reported muscle aches and pains. After an initial review, focus was placed on seven genes that were adequately characterized to provide a substantive review: CYP2D6, CYP3A4, CYP3A5, GATM, SLCO1B1, ABCB1, and ABCG2. All statins were included in this review. Among the genetic factors evaluated, statin-related myopathy appears to be most strongly associated with variants in SLCO1B1. PMID:24810685
Nuclear actin aggregation is a hallmark of anti-synthetase syndrome-induced dysimmune myopathy
Stenzel, Werner; Preuße, Corinna; Allenbach, Yves; Pehl, Debora; Junckerstorff, Reimar; Heppner, Frank L.; Nolte, Kay; Aronica, Eleonora; Kana, Veronika; Rushing, Elisabeth; Schneider, Udo; Claeys, Kristl G.; Benveniste, Olivier; Weis, Joachim; Goebel, Hans H.
2015-01-01
To analyze antisynthetase syndrome-associated myositis by modern myopathologic methods and to define its place in the spectrum of idiopathic inflammatory myopathies (IIMs). Skeletal muscle biopsies from antisynthetase syndrome-associated myositis and other IIMs from different institutions worldwide
Meyer, Hans-Jonas; Ziemann, Oliver; Kornhuber, Malte; Emmer, Alexander; Quäschling, Ulf; Schob, Stefan; Surov, Alexey
2018-06-01
Background Magnetic resonance imaging (MRI) is widely used in several muscle disorders. Diffusion-weighted imaging (DWI) is an imaging modality, which can reflect microstructural tissue composition. The apparent diffusion coefficient (ADC) is used to quantify the random motion of water molecules in tissue. Purpose To investigate ADC values in patients with myositis and non-inflammatory myopathy and to analyze possible associations between ADC and laboratory parameters in these patients. Material and Methods Overall, 17 patients with several myositis entities, eight patients with non-inflammatory myopathies, and nine patients without muscle disorder as a control group were included in the study (mean age = 55.3 ± 14.3 years). The diagnosis was confirmed by histopathology in every case. DWI was obtained in a 1.5-T scanner using two b-values: 0 and 1000 s/mm 2 . In all patients, the blood sample was acquired within three days to the MRI. The following serological parameters were estimated: C-reactive protein, lactate dehydrogenase, alanine aminotransferase, aspartate aminotransferase, creatine kinase, and myoglobine. Results The estimated mean ADC value for the myositis group was 1.89 ± 0.37 × 10 -3 mm 2 /s and for the non-inflammatory myopathy group was 1.79 ± 0.33 × 10 -3 mm 2 /s, respectively. The mean ADC values (1.15 ± 0.37 × 10 -3 mm 2 /s) were significantly higher to unaffected muscles (vs. myositis P = 0.0002 and vs. myopathy P = 0.0021). There were no significant correlations between serological parameters and ADC values. Conclusion Affected muscles showed statistically significantly higher ADC values than normal muscles. No linear correlations between ADC and serological parameters were identified.
Optimization of residual heat removal pump axial thrust and axial bearing
International Nuclear Information System (INIS)
Schubert, F.
1996-01-01
The residual heat removal (RHR) pumps of German 1300 megawatt pressurized-water reactor (PWR) power plants are of the single stage end suction type with volute casing or with diffuser and forged circular casing. Due to the service conditions the pumps have to cover the full capacity range as well as a big variation in suction static pressure. This results in a big difference in the axial thrust that has to be borne by the axial bearing. Because these pumps are designed to operate without auxiliary systems (things that do not exist can not fail), they are equipped with antifriction bearings and sump oil lubrication. To minimize the heat production within the bearing casing, a number of PWR plants have pumps with combined axial/radial bearings of the ball type. Due to the fact that the maximum axial thrust caused by static pressure and hydrodynamic forces on the impeller is too big to be borne by that type of axial bearing, the impellers were designed to produce a hydrodynamic axial force that counteracts the static axial force. Thus, the resulting axial thrust may change direction when the static pressure varies
Optimization of residual heat removal pump axial thrust and axial bearing
Energy Technology Data Exchange (ETDEWEB)
Schubert, F.
1996-12-01
The residual heat removal (RHR) pumps of German 1300 megawatt pressurized-water reactor (PWR) power plants are of the single stage end suction type with volute casing or with diffuser and forged circular casing. Due to the service conditions the pumps have to cover the full capacity range as well as a big variation in suction static pressure. This results in a big difference in the axial thrust that has to be borne by the axial bearing. Because these pumps are designed to operate without auxiliary systems (things that do not exist can not fail), they are equipped with antifriction bearings and sump oil lubrication. To minimize the heat production within the bearing casing, a number of PWR plants have pumps with combined axial/radial bearings of the ball type. Due to the fact that the maximum axial thrust caused by static pressure and hydrodynamic forces on the impeller is too big to be borne by that type of axial bearing, the impellers were designed to produce a hydrodynamic axial force that counteracts the static axial force. Thus, the resulting axial thrust may change direction when the static pressure varies.
Elevated Cardiac Troponin T in Patients With Skeletal Myopathies.
Schmid, Johannes; Liesinger, Laura; Birner-Gruenberger, Ruth; Stojakovic, Tatjana; Scharnagl, Hubert; Dieplinger, Benjamin; Asslaber, Martin; Radl, Roman; Beer, Meinrad; Polacin, Malgorzata; Mair, Johannes; Szolar, Dieter; Berghold, Andrea; Quasthoff, Stefan; Binder, Josepha S; Rainer, Peter P
2018-04-10
Cardiac troponins are often elevated in patients with skeletal muscle disease who have no evidence of cardiac disease. The goal of this study was to characterize cardiac troponin concentrations in patients with myopathies and derive insights regarding the source of elevated troponin T measurements. Cardiac troponin T (cTnT) and cardiac troponin I (cTnI) concentrations were determined by using high sensitivity assays in 74 patients with hereditary and acquired skeletal myopathies. Patients underwent comprehensive cardiac evaluation, including 12-lead electrocardiogram, 24-h electrocardiogram, cardiac magnetic resonance imaging, and coronary artery computed tomography. cTnT and cTnI protein expression was determined in skeletal muscle samples of 9 patients and in control tissues derived from autopsy using antibodies that are used in commercial assays. Relevant Western blot bands were subjected to liquid chromatography tandem mass spectrometry for protein identification. Levels of cTnT (median: 24 ng/l; interquartile range: 11 to 54 ng/l) were elevated (>14 ng/l) in 68.9% of patients; cTnI was elevated (>26 ng/l) in 4.1% of patients. Serum cTnT levels significantly correlated with creatine kinase and myoglobin (r = 0.679 and 0.786, respectively; both p < 0.001). Based on cTnT serial testing, 30.1% would have fulfilled current rule-in criteria for myocardial infarction. Noncoronary cardiac disease was present in 23%. Using cTnT antibodies, positive bands were found in both diseased and healthy skeletal muscle at molecular weights approximately 5 kDa below cTnT. Liquid chromatography tandem mass spectrometry identified the presence of skeletal troponin T isoforms in these bands. Measured cTnT concentrations were chronically elevated in the majority of patients with skeletal myopathies, whereas cTnI elevation was rare. Our data indicate that cross-reaction of the cTnT immunoassay with skeletal muscle troponin isoforms was the likely cause. Copyright © 2018 The
Aerobic Training in Patients with Congenital Myopathy.
Directory of Open Access Journals (Sweden)
Gitte Hedermann
Full Text Available Congenital myopathies (CM often affect contractile proteins of the sarcomere, which could render patients susceptible to exercise-induced muscle damage. We investigated if exercise is safe and beneficial in patients with CM.Patients exercised on a stationary bike for 30 minutes, three times weekly, for 10 weeks at 70% of their maximal oxygen uptake (VO2max. Creatine kinase (CK was monitored as a marker of muscle damage. VO2max, functional tests, and questionnaires evaluated efficacy.Sixteen patients with CM were included in a controlled study. VO2max increased by 14% (range, 6-25%; 95% CI 7-20; p < 0.001 in the seven patients who completed training, and tended to decrease in a non-intervention group (n = 7; change -3.5%; range, -11-3%, p = 0.083. CK levels were normal and remained stable during training. Baseline Fatigue Severity Scale scores were high, 4.9 (SE 1.9, and tended to decrease (to 4.4 (SE 1.7; p = 0.08 with training. Nine patients dropped out of the training program. Fatigue was the major single reason.Ten weeks of endurance training is safe and improves fitness in patients with congenital myopathies. The training did not cause sarcomeric injury, even though sarcomeric function is affected by the genetic abnormalities in most patients with CM. Severe fatigue, which characterizes patients with CM, is a limiting factor for initiating training in CM, but tends to improve in those who train.The Regional Committee on Health Research Ethics of the Capital Region of Denmark H-2-2013-066 and ClinicalTrials.gov H2-2013-066.
Association between statin-associated myopathy and skeletal muscle damage.
Mohaupt Markus G; Karas Richard H; Babiychuk Eduard B; Sanchez-Freire Verónica; Monastyrskaya Katia; Iyer Lakshmanan; Hoppeler Hans; Breil Fabio; Draeger Annette
2009-01-01
BACKGROUND Many patients taking statins often complain of muscle pain and weakness. The extent to which muscle pain reflects muscle injury is unknown. METHODS We obtained biopsy samples from the vastus lateralis muscle of 83 patients. Of the 44 patients with clinically diagnosed statin associated myopathy 29 were currently taking a statin and 15 had discontinued statin therapy before the biopsy (minimal duration of discontinuation 3 weeks). We also included 19 patients who were taking stat...
Cardiac involvement in adult and juvenile idiopathic inflammatory myopathies
DEFF Research Database (Denmark)
Schwartz, TThomas W; Diederichsen, L. P.; Lundberg, Ingrid E.
2016-01-01
Idiopathic inflammatory myopathies (IIM) include the main subgroups polymyositis (PM), dermatomyositis (DM), inclusion body myositis (IBM) and juvenile DM ( JDM). The mentioned subgroups are characterised by inflammation of skeletal muscles leading to muscle weakness and other organs can also...... that statins might worsen muscle symptoms mimicking myositis relapse. On the basis of recent studies, we recommend a low threshold for cardiac workup and follow-up in patients with IIM. © 2016 Published by the BMJ Publishing Group Limited....
Congenital myotonic myopathy in the miniature schnauzer: an autosomal recessive trait.
Vite, C H; Melniczek, J; Patterson, D; Giger, U
1999-01-01
Myotonia is a clinical sign characterized by a delay in skeletal muscle relaxation following electrical or mechanical stimulation. A series of related miniature schnauzer dogs with congenital myotonic myopathy were studied. A composite pedigree of six affected litters and the results of a planned breeding between two affected animals are consistent with an autosomal recessive mode of inheritance.
Miopatia por corpos esferóides: relato de caso Spheroid body myopathy: case report
Directory of Open Access Journals (Sweden)
Rosana Hermínia Scola
2005-06-01
Full Text Available A miopatia por corpos esferóides é doença rara, classificada no grupo das miopatias congênitas relacionadas aos distúrbios da desmina; apresenta, em geral, origem autossômica dominante e com início dos sintomas na fase adulta. Relatamos o caso de menina de sete anos, com diparesia facial, hipotrofia e hipotonia muscular generalizadas, arreflexia profunda generalizada, força muscular proximal nos membros superiores e inferiores e distal dos membros superiores grau 3 e distal nos membros inferiores grau 1. A eletromiografia de agulha evidenciou recrutamento aumentado e potenciais de unidade motora de curta duração e baixa amplitude, caracterizando um padrão miopático. A biópsia muscular revelou padrão misto para miopatia e desinervação e presença de corpos esferóides intracitoplasmáticos compatíveis com a miopatia por corpos esferóides. No presente caso, a paciente apresentou precocemente o início dos sintomas e não há relatos de casos semelhantes na família.Spheroid body myopathy is a rare illness classified in the group of the congenital myopathies as a desmin-related neuromuscular disorder, presenting dominant autosomical origin with the beginning of the symptoms in the adult phase. We report on a seven years old girl with facial paresia, generalized muscular hypotrophy and hypotony, generalized deep areflexia, proximal upper and lower limbs muscular strengh and distal upper limbs grade 3 and distal lower limbs grade 1. Needle electromyography evidenced increased conscription and potentials of motor unit of short duration and low amplitude, characterizing a myopathic standard. The muscle biopsy disclosed mixed standard to myopathy, denervation and inclusion bodies that are consistent to spheroid body myopathy. In this case, the patient presented, in advance, early beginning of the symptoms and there are no similar cases in the family.
Tu, Guo-Wei; Song, Jie-Qiong; Ting, Simon Kang Seng; Ju, Min-Jie; He, Hong-Yu; Dong, Ji-Hong; Luo, Zhe
2015-02-03
Critical illness polyneuropathy and myopathy are multifaceted complications that follow severe illnesses involving the sensorimotor axons and proximal skeletal muscles. These syndromes have rarely been reported among renal transplant recipients. In this paper, we report a case of acute quadriplegia caused by necrotizing myopathy in a renal transplant recipient with severe pneumonia. The muscle strength in the patient's extremities improved gradually after four weeks of comprehensive treatment, and his daily life activities were normal a year after being discharged.
Fatigue in patients with spinal muscular atrophy type II and congenital myopathies
DEFF Research Database (Denmark)
Werlauff, Ulla; Højberg, A; Firla-Holme, R
2014-01-01
PURPOSE: The aim of this study was to evaluate whether the fatigue severity scale (FSS) is an appropriate instrument to assess fatigue in patients with spinal muscular atrophy type II (SMA II) and congenital myopathies (CM). METHODS: FSS and visual analog scale (VAS) were administered to 33 SMA II...
Serum and tissue markers of myopathy in patients with colorectal cancer
Directory of Open Access Journals (Sweden)
Nicoletta Adami
2012-09-01
Full Text Available Skeletal muscles in patients with cancer undergo many changes due to immuno-inflammatory factors of tumor origin, or to chemotherapy and irradiation. Aim of the present study is to identify serological biomarkers and early myopathic features in skeletal muscle biopsies from weight stable patients bearing colorectal cancer at the onset of disease. Morphometric analyses by histochemistry and immunohistochemistry were performed on intraoperative muscle biopsies from patients with early colorectal cancer and from weight stable patients undergoing surgery for benign non-inflammatory conditions. Serological analyses for testing markers of inflammation (C Reactive Protein, CRP, muscle enzymes, (Creatin Kinase, CK, soluble isoforms of adhesion molecules (Neural Cell Adhesion Molecule, NCAM, and a marker of protein turnover (prealbumin, a typical indicator of caloric and protein malnutrition were also performed. Fifty oncologic patients (28 male/22 female and 25 non oncologic patients (18 male/7 female (p=N.S. were studied. In muscles from cancer patients we observed a subclinical myopathy characterized by an abnormal distribution of myonuclei. The percentage of myofibers with internalized nuclei was significantly higher in oncologic (median= 13.1%, IQR= 6.0-20.3 than in non oncologic patients (median= 3%, IQR= 2.5-6.1 (p<0.0001. The frequency of these internally nucleated myofibers is even higher in a subgroup of oncologic patients taking myotoxic drugs. In cancer patients, we observed an inverse correlation between the number of internally nucleated fibers and the presence of node metastasis (N+ (ρ=-0.30 (p=0.03. Moreover, in patients with colorectal cancer, low serum levels of preoperative prealbumin (median= 167,7 mg/L, normal range 200-400 mg/L, were detected. The link between the observed early myopathy and long-term cachexia is supported also by the altered expression of sarcolemma associated proteins, in particular laminin and dystrophin
International Nuclear Information System (INIS)
Huffer, J.
2004-01-01
The purpose of this calculation is to develop axial profiles for estimating the axial variation in burnup of a boiling water reactor (BWR) assembly spent nuclear fuel (SNF) given the average burnup of an assembly. A discharged fuel assembly typically exhibits higher burnup in the center and lower burnup at the ends of the assembly. Criticality safety analyses taking credit for SNF burnup must account for axially varying burnup relative to calculations based on uniformly distributed assembly average burnup due to the under-burned tips. Thus, accounting for axially varying burnup in criticality analyses is also referred to as accounting for the ''end effect'' reactivity. The magnitude of the reactivity change due to ''end effect'' is dependent on the initial assembly enrichment, the assembly average burnup, and the particular axial profile characterizing the burnup distribution. The set of bounding axial profiles should incorporate multiple BWR core designs and provide statistical confidence (95 percent confidence that 95 percent of the population is bound by the profile) that end nodes are conservatively represented. The profiles should also conserve the overall burnup of the fuel assembly. More background on BWR axial profiles is provided in Attachment I
Guglielmi, V; Oosterhof, A; Voermans, N C; Cardani, R; Molenaar, J P; van Kuppevelt, T H; Meola, G; van Engelen, B G; Tomelleri, G; Vattemi, G
2016-06-01
Sarcoplasmic/endoplasmic reticulum Ca(2+) ATPase (SERCA) pumps play the major role in lowering cytoplasmic calcium concentration in skeletal muscle by catalyzing the ATP-dependent transport of Ca(2+) from the cytosol to the lumen of the sarcoplasmic reticulum (SR). Although SERCA abnormalities have been hypothesized to contribute to the dysregulation of intracellular Ca(2+) homeostasis and signaling in muscle of patients with myotonic dystrophy (DM) and hypothyroid myopathy, the characterization of SERCA pumps remains elusive and their impairment is still unclear. We assessed the activity of SR Ca(2+)-ATPase, expression levels and fiber distribution of SERCA1 and SERCA2, and oligomerization of SERCA1 protein in muscle of patients with DM type 1 and 2, and with hypothyroid myopathy. Our data provide evidence that SR Ca(2+) ATPase activity, protein levels and muscle fiber distribution of total SERCA1 and SERCA2, and SERCA1 oligomerization pattern are similar in patients with both DM1 and DM2, hypothyroid myopathy and in control subjects. We prove that SERCA1b, the neonatal isoform of SERCA1, is expressed at protein level in muscle of patients with DM2 and, in lower amount, of patients with DM1. Our present study demonstrates that SERCA function is not altered in muscle of patients with DM and with hypothyroid myopathy. Copyright © 2016 Elsevier B.V. All rights reserved.
Quantitative nailfold video capillaroscopy in patients with idiopathic inflammatory myopathy
Mercer, Louise K.; Moore, Tonia L.; Chinoy, Hector; Murray, Andrea K.; Vail, Andy; Cooper, Robert G.; Herrick, Ariane L.
2010-01-01
Objectives. To quantify nailfold capillary density and dimensions in patients with idiopathic inflammatory myopathy (IIM) and compare them with those in healthy controls; to look for associations with microvascular disease in IIM; and to determine whether nailfold capillary density and dimensions change over time. Methods. Nailfold video microscopy (×300 magnification) was performed on 24 patients with IIM and 35 healthy controls. Capillary density and dimensions (total width and apical width...
Bruno, Claudio; Dimauro, Salvatore
2008-10-01
The aim of this review is to provide an update on disorders of lipid metabolism affecting skeletal muscle exclusively or predominantly and to summarize recent clinical, genetic, and therapeutic studies in this field. Over the past 5 years, new clinical phenotypes and genetic loci have been described, unusual pathogenic mechanisms have been elucidated, and novel pharmacological approaches have been developed. At least one genetic defect responsible for the myopathic form of CoQ10 deficiency has been identified, causing a disorder that is allelic with the late-onset riboflavine-responsive form of multiple acyl-coenzyme A dehydrogenation deficiency. Novel mechanisms involved in the lipolytic breakdown of cellular lipid depots have been described and have led to the identification of genes and mutations responsible for multisystemic neutral lipid storage disorders, characterized by accumulation of triglyceride in multiple tissues, including muscle. Defects in lipid metabolism can affect either the mitochondrial transport and oxidation of exogenous fatty acid or the catabolism of endogenous triglycerides. These disorders impair energy production and almost invariably involve skeletal muscle, causing progressive myopathy with muscle weakness, or recurrent acute episodes of rhabdomyolysis triggered by exercise, fasting, or infections. Clinical and genetic characterization of these disorders has important implications both for accurate diagnostic approach and for development of therapeutic strategies.
Acquired multiple Acyl-CoA dehydrogenase deficiency in 10 horses with atypical myopathy
Westermann, C. M.; Dorland, L.; Votion, D. M.; de Sain-van der Velden, M. G. M.; Wijnberg, I. D.; Wanders, R. J. A.; Spliet, W. G. M.; Testerink, N.; Berger, R.; Ruiter, J. P. N.; van der Kolk, J. H.
2008-01-01
The aim of the current study was to assess lipid metabolism in horses with atypical myopathy. Urine samples from 10 cases were subjected to analysis of organic acids, glycine conjugates, and acylcarnitines revealing increased mean excretion of lactic acid, ethylmalonic acid, 2-methylsuccinic acid,
Kaneko, Kimihiko; Kuroda, Hiroshi; Izumi, Rumiko; Tateyama, Maki; Kato, Masaaki; Sugimura, Koichiro; Sakata, Yasuhiko; Ikeda, Yoshihiko; Hirano, Ken-Ichi; Aoki, Masashi
2014-07-01
Mutations in PNPLA2 cause neutral lipid storage disease with myopathy (NLSDM) or triglyceride deposit cardiomyovasculopathy (TGCV). We report a 59-year-old patient with NLSDM/TGCV presenting marked asymmetric skeletal myopathy and cardiomyovasculopathy. Skeletal muscle and endomyocardial biopsies showed cytoplasmic vacuoles containing neutral lipid. Gene analysis revealed a novel homozygous mutation (c.576delC) in PNPLA2. We reviewed 37 genetically-proven NLSDM/TGCV cases; median age was 30 years; distribution of myopathy was proximal (69%) and distal predominant (16%); asymmetric myopathy (right>left) was reported in 41% of the patients. Frequently-affected muscles were posterior compartment of leg (75%), shoulder girdle to upper arm (50%), and paraspinal (33%). Skeletal muscle biopsies showed lipid accumulation in 100% and rimmed vacuoles in 22%. Frequent comorbidities were cardiomyopathy (44%), hyperlipidemia (23%), diabetes mellitus (24%), and pancreatitis (14%). PNPLA2 mutations concentrated in Exon 4-7 without apparent genotype-phenotype correlations. To know the characteristic features is essential for the early diagnosis of NLSDM/TGCV. Copyright © 2014 Elsevier B.V. All rights reserved.
Schistosomiasis and nutritional myopathy in a Brazilian tapir (Tapirus terrestris).
Yamini, B; Schillhorn van Veen, T W
1988-10-01
Gross lesions suggestive of severe hepatoenteropathy and myopathy were noted in a 4.5-yr-old Brazilian tapir (Tapirus terrestris) from a zoo in Michigan (USA). The major microscopic lesions were granulomatous hepatitis and hemorrhagic enteritis associated with non-operculated eggs compatible with those of the Schistosomatidae (Digenea). Skeletal muscle and tongue contained foci of severe acute myodegeneration and necrosis. The hepatic vitamin E value of 1.3 ppm dry weight was considered critically low.
Energy Technology Data Exchange (ETDEWEB)
Wolf, M. [Universitaetsklinikum Heidelberg, Abteilung fuer Neuroradiologie, Heidelberg (Germany); Wolf, C. [Reha-Zentrum Gernsbach, Neurologie, Gernsbach (Germany); Weber, M.A. [Universitaetsklinikum Heidelberg, Abteilung fuer Diagnostische und Interventionelle Radiologie, Heidelberg (Germany)
2017-12-15
Neurogenic myopathies are primary diseases of the nervous system, which secondarily result in denervation of the target musculature. The spectrum of potential causes is manifold ranging from acute traumatic injuries and chronic compression to neurodegenerative, inflammatory, metabolic and neoplastic processes. The medical history, clinical neurological examination, and electrophysiological tests including electromyography and nerve conduction studies are crucial in diagnosing neuropathic myopathies. Electromyography is the gold standard for diagnosing muscle denervation. Additional imaging methods and magnetic resonance imaging (MRI) in particular, are capable of contributing valuable information. The MRI examination of denervated musculature shows edema, an increase in the apparent diffusion coefficient (ADC) and hyperperfusion. Chronic denervation results in fatty degeneration and atrophy of affected muscles, which are also detectable by MRI. Although the MRI findings in muscle denervation are relatively unspecific, they show a high sensitivity, comparable to electromyography. Dedicated MR neurography may often visualize the underlying lesion(s) of the innervating nerve(s). Besides high sensitivity, comparable to electromyography, MRI is capable of evaluating muscles which are inaccessible for needle electromyography. Due to its non-invasive character, MRI is ideal for follow-up examinations. The use of MRI is often a meaningful addition to the diagnostics of neurogenic myopathies. The extent and distribution pattern of muscular alterations often provide information on the localization of the causative nerve damage. A correct diagnosis or at least a narrowing down of possible differential diagnoses can often be achieved using MRI. (orig.) [German] Neurogene Myopathien sind Erkrankungen des Nervensystems, die sekundaer zur Denervierung der Zielmuskulatur fuehren. Das Spektrum potenzieller Ursachen ist vielfaeltig und umfasst akute traumatische Verletzungen
Exertional Myopathy in a Juvenile Green Sea Turtle (Chelonia mydas Entangled in a Large Mesh Gillnet
Directory of Open Access Journals (Sweden)
Brianne E. Phillips
2015-01-01
Full Text Available A juvenile female green sea turtle (Chelonia mydas was found entangled in a large mesh gillnet in Pamlico Sound, NC, and was weak upon presentation for treatment. Blood gas analysis revealed severe metabolic acidosis and hyperlactatemia. Plasma biochemistry analysis showed elevated aspartate aminotransferase and creatine kinase, marked hypercalcemia, hyperphosphatemia, and hyperkalemia. Death occurred within 24 hours of presentation despite treatment with intravenous and subcutaneous fluids and sodium bicarbonate. Necropsy revealed multifocal to diffuse pallor of the superficial and deep pectoral muscles. Mild, multifocal, and acute myofiber necrosis was identified by histopathological examination. While histological changes in the examined muscle were modest, the acid-base, mineral, and electrolyte abnormalities were sufficiently severe to contribute to this animal’s mortality. Exertional myopathy in reptiles has not been well characterized. Sea turtle mortality resulting from forced submergence has been attributed to blood gas derangements and seawater aspiration; however, exertional myopathy may also be an important contributing factor. If possible, sea turtles subjected to incidental capture and entanglement that exhibit weakness or dull mentation should be clinically evaluated prior to release to minimize the risk of delayed mortality. Treatment with appropriate fluid therapy and supportive care may mitigate the effects of exertional myopathy in some cases.
The Effect of the Wooden Breast Myopathy on Sarcomere Structure and Organization.
Velleman, Sandra G; Clark, Daniel L; Tonniges, Jeffrey R
2018-03-01
The wooden breast (WB) has been classically identified by the phenotypic presence of a wood-like pectoralis major (p. major) muscle. The WB-affected p. major muscle is characterized by necrotic muscle fibers and the replacement of muscle with connective tissue, water, and fat. The objective of the current study was to determine the effect of the WB myopathy on sarcomere organization by transmission electron microscopy. Sarcomere structure and organization were examined in two broiler lines with a high incidence of WB (Lines A and B) and another broiler line without WB (Line C). Affected muscle had an increase in smaller myofibers with diameters of 20 μm or less. Sarcomere organization decreased with fiber diameter in both Lines A and B. The structure and organization of sarcomeres in Line C were similar to WB-unaffected muscle in Lines A and B. Taken together, these data demonstrate that the WB myopathy detrimentally affects sarcomere organization in a broiler line-specific manner. Disorganization of sarcomere structure will affect the function of the p. major muscle as well as meat quality.
Anaesthetic management of a paediatric patient with congenital fibre type disproportion myopathy.
Buisán, F; de la Varga, O; Flores, M; Sánchez-Ruano, J
2018-04-23
Congenital fibre type disproportion (CFTD) is a rare type of myopathy that is characterised by muscle weakness and hypotonia during childhood. Clinical features include motor delay, feeding difficulties, limb weakness, joint contractures, and scoliosis. A report is presented of the anaesthetic management of a 3-year-old girl with CFTD myopathy associated with a mutation of the TPM3 gene, scheduled for adenotonsillectomy because of obstructive sleep apnoea hypopnoea syndrome (OSAHS). The main concerns were the possible susceptibility to malignant hyperthermia, the risk of anaesthesia-induced rhabdomyolysis, a greater sensitivity to non-depolarising muscle relaxants, and the presence of OSAHS. Total intravenous anaesthesia with propofol and the use of rocuronium/sugammadex appear to be safe options. Given the high risk of respiratory compromise and other complications, patients should be closely monitored in the post-operative period. Copyright © 2018 Sociedad Española de Anestesiología, Reanimación y Terapéutica del Dolor. Publicado por Elsevier España, S.L.U. All rights reserved.
Acquired multiple Acyl-CoA dehydrogenase deficiency in 10 horses with atypical myopathy.
Westermann, C M; Dorland, L; Votion, D M; de Sain-van der Velden, M G M; Wijnberg, I D; Wanders, R J A; Spliet, W G M; Testerink, N; Berger, R; Ruiter, J P N; van der Kolk, J H
2008-05-01
The aim of the current study was to assess lipid metabolism in horses with atypical myopathy. Urine samples from 10 cases were subjected to analysis of organic acids, glycine conjugates, and acylcarnitines revealing increased mean excretion of lactic acid, ethylmalonic acid, 2-methylsuccinic acid, butyrylglycine, (iso)valerylglycine, hexanoylglycine, free carnitine, C2-, C3-, C4-, C5-, C6-, C8-, C8:1-, C10:1-, and C10:2-carnitine as compared with 15 control horses (12 healthy and three with acute myopathy due to other causes). Analysis of plasma revealed similar results for these predominantly short-chain acylcarnitines. Furthermore, measurement of dehydrogenase activities in lateral vastus muscle from one horse with atypical myopathy indeed showed deficiencies of short-chain acyl-CoA dehydrogenase (0.66 as compared with 2.27 and 2.48 in two controls), medium-chain acyl-CoA dehydrogenase (0.36 as compared with 4.31 and 4.82 in two controls) and isovaleryl-CoA dehydrogenase (0.74 as compared with 1.43 and 1.61 nmol min(-1) mg(-1) in two controls). A deficiency of several mitochondrial dehydrogenases that utilize flavin adenine dinucleotide as cofactor including the acyl-CoA dehydrogenases of fatty acid beta-oxidation, and enzymes that degrade the CoA-esters of glutaric acid, isovaleric acid, 2-methylbutyric acid, isobutyric acid, and sarcosine was suspected in 10 out of 10 cases as the possible etiology for a highly fatal and prevalent toxic equine muscle disease similar to the combined metabolic derangements seen in human multiple acyl-CoA dehydrogenase deficiency also known as glutaric acidemia type II.
Directory of Open Access Journals (Sweden)
Ting Chen
2016-01-01
Conclusions: We reported a novel autosomal dominant myopathy with rimmed vacuoles characterized by dysarthria, dysphagia, external ophthalmoplegia, limb weakness, hypophrenia, deafness, and impaired vision, but the causative gene has not been found and needs further study.
Muscle structural changes in mitochondrial myopathy relate to genotype
DEFF Research Database (Denmark)
Olsen, David B.; Langkilde, Annika Reynberg; Ørngreen, Mette C.
2003-01-01
It is well known that morphological changes at the cellular level occur in muscle of patients with mitochondrial myopathy (MM), but changes in muscle structure with fat infiltration and gross variation of muscle fiber size with giant fibers, normally encountered in the muscular dystrophies, have...... typically not been associated with mitochondrial disease. We investigated gross and microscopic muscle morphology in thigh muscles by muscle biopsy and MRI in 16 patients with MM, and compared findings with those obtained in muscular dystrophy patients and healthy subjects. Changes of muscle architecture...
Constitutive relations describing creep deformation for multi-axial time-dependent stress states
McCartney, L. N.
1981-02-01
A THEORY of primary and secondary creep deformation in metals is presented, which is based upon the concept of tensor internal state variables and the principles of continuum mechanics and thermodynamics. The theory is able to account for both multi-axial and time-dependent stress and strain states. The wellknown concepts of elastic, anelastic and plastic strains follow naturally from the theory. Homogeneous stress states are considered in detail and a simplified theory is derived by linearizing with respect to the internal state variables. It is demonstrated that the model can be developed in such a way that multi-axial constant-stress creep data can be presented as a single relationship between an equivalent stress and an equivalent strain. It is shown how the theory may be used to describe the multi-axial deformation of metals which are subjected to constant stress states. The multi-axial strain response to a general cyclic stress state is calculated. For uni-axial stress states, square-wave loading and a thermal fatigue stress cycle are analysed.
DEFF Research Database (Denmark)
van Galen Verwilghen, Gaby; Votion, D.-M.
2013-01-01
Atypical myopathy is highly fatal, but about a quarter of affected horses survive. This highlights the need for provision of supportive treatment for these cases. This review is a practical guideline for equine practitioners and includes suggestions for close monitoring of involved organ systems ...
DEFF Research Database (Denmark)
van Galen Verwilghen, Gaby; Votion, D.-M.
2013-01-01
Atypical myopathy is highly fatal, but about a quarter of affected horses survive. This highlights the need for provision of supportive treatment for these patients. This review is a practical guideline for equine practitioners and includes suggestions for close monitoring of involved organ systems...
Ajroud-Driss, Senda; Fecto, Faisal; Ajroud, Kaouther; Lalani, Irfan; Calvo, Sarah E; Mootha, Vamsi K; Deng, Han-Xiang; Siddique, Nailah; Tahmoush, Albert J; Heiman-Patterson, Terry D; Siddique, Teepu
2015-01-01
Mitochondrial myopathies belong to a larger group of systemic diseases caused by morphological or biochemical abnormalities of mitochondria. Mitochondrial disorders can be caused by mutations in either the mitochondrial or nuclear genome. Only 5% of all mitochondrial disorders are autosomal dominant. We analyzed DNA from members of the previously reported Puerto Rican kindred with an autosomal dominant mitochondrial myopathy (Heimann-Patterson et al. 1997). Linkage analysis suggested a putative locus on the pericentric region of the long arm of chromosome 22 (22q11). Using the tools of integrative genomics, we established chromosome 22 open reading frame 16 (C22orf16) (later designated as CHCHD10) as the only high-scoring mitochondrial candidate gene in our minimal candidate region. Sequence analysis revealed a double-missense mutation (R15S and G58R) in cis in CHCHD10 which encodes a coiled coil-helix-coiled coil-helix protein of unknown function. These two mutations completely co-segregated with the disease phenotype and were absent in 1,481 Caucasian and 80 Hispanic (including 32 Puerto Rican) controls. Expression profiling showed that CHCHD10 is enriched in skeletal muscle. Mitochondrial localization of the CHCHD10 protein was confirmed using immunofluorescence in cells expressing either wild-type or mutant CHCHD10. We found that the expression of the G58R, but not the R15S, mutation induced mitochondrial fragmentation. Our findings identify a novel gene causing mitochondrial myopathy, thereby expanding the spectrum of mitochondrial myopathies caused by nuclear genes. Our findings also suggest a role for CHCHD10 in the morphologic remodeling of the mitochondria.
Córdova-Noboa, H A; Oviedo-Rondón, E O; Sarsour, A H; Barnes, J; Ferzola, P; Rademacher-Heilshorn, M; Braun, U
2018-04-13
One experiment was conducted to evaluate the effects of guanidinoacetic acid (GAA) supplementation in broilers fed corn or sorghum-based diets on live performance, carcass and cut up yields, meat quality, and pectoral myopathies. The treatments consisted of corn or sorghum-based diets with or without the addition of GAA (600 g/ton). A total of 800 one-d-old male Ross 708 broiler chicks were randomly placed in 40 floor pens with 10 replicates (20 birds per pen) per each of the four treatments. At hatch, 14, 35, and 50 d, BW and feed intake were recorded. BW gain and FCR were calculated at the end of each phase. Four broilers per pen were selected and slaughtered at 51d and 55d of age to determine carcass and cut up yields, meat quality and myopathies (spaghetti muscle, white striping, and wooden breast) severity in the Pectoralis major. Data were analyzed as a randomized complete block design in a 2 × 2 factorial arrangement with grain type and GAA supplementation as main effects. At 50 d, diets containing GAA improved (P broilers fed corn diets with GAA had higher breast meat yield (P 0.05) by GAA supplementation at any slaughter ages. However, GAA decreased (P broilers supplemented with GAA had double (P broilers fed non-supplemented diets, therefore reducing the severity of this myopathy. In conclusion, GAA supplementation improved broiler live performance in broilers raised up to 50 d independently of grain source, increased breast meat yield in corn-based diets and reduced the severity of wooden breast myopathy.
Efficient primary and parametric resonance excitation of bistable resonators
Ramini, Abdallah
2016-09-12
We experimentally demonstrate an efficient approach to excite primary and parametric (up to the 4th) resonance of Microelectromechanical system MEMS arch resonators with large vibrational amplitudes. A single crystal silicon in-plane arch microbeam is fabricated such that it can be excited axially from one of its ends by a parallel-plate electrode. Its micro/nano scale vibrations are transduced using a high speed camera. Through the parallel-plate electrode, a time varying electrostatic force is applied, which is converted into a time varying axial force that modulates dynamically the stiffness of the arch resonator. Due to the initial curvature of the structure, not only parametric excitation is induced, but also primary resonance. Experimental investigation is conducted comparing the response of the arch near primary resonance using the axial excitation to that of a classical parallel-plate actuation where the arch itself forms an electrode. The results show that the axial excitation can be more efficient and requires less power for primary resonance excitation. Moreover, unlike the classical method where the structure is vulnerable to the dynamic pull-in instability, the axial excitation technique can provide large amplitude motion while protecting the structure from pull-in. In addition to primary resonance, parametrical resonances are demonstrated at twice, one-half, and two-thirds the primary resonance frequency. The ability to actuate primary and/or parametric resonances can serve various applications, such as for resonator based logic and memory devices. (C) 2016 Author(s). All article content, except where otherwise noted, is licensed under a Creative Commons Attribution (CC BY) license
Zhang, Junhui; Li, Ying; Xu, Bing; Pan, Min; Lv, Fei
2017-01-01
Pressure and performance requirements of axial piston pumps and the proportion of churning losses in axial piston pumps increase significantly with increasing speed. To investigate the primary distribution of churning losses in axial piston pumps at various ranges of speed, a test rig was set up in which other friction losses can be eliminated, thus making it possible to investigate the net churning losses in an axial piston pump. The influence of the rotating cylinder block and pistons on ch...
Neutral lipid-storage disease with myopathy and extended phenotype with novel PNPLA2 mutation.
Massa, Roberto; Pozzessere, Simone; Rastelli, Emanuele; Serra, Laura; Terracciano, Chiara; Gibellini, Manuela; Bozzali, Marco; Arca, Marcello
2016-04-01
Neutral lipid-storage disease with myopathy is caused by mutations in PNPLA2, which produce skeletal and cardiac myopathy. We report a man with multiorgan neutral lipid storage and unusual multisystem clinical involvement, including cognitive impairment. Quantitative brain MRI with voxel-based morphometry and extended neuropsychological assessment were performed. In parallel, the coding sequences and intron/exon boundaries of the PNPLA2 gene were screened by direct sequencing. Neuropsychological assessment revealed global cognitive impairment, and brain MRI showed reduced gray matter volume in the temporal lobes. Molecular characterization revealed a novel homozygous mutation in exon 5 of PNPLA2 (c.714C>A), resulting in a premature stop codon (p.Cys238*). Some PNPLA2 mutations, such as the one described here, may present with an extended phenotype, including brain involvement. In these cases, complete neuropsychological testing, combined with quantitative brain MRI, may help to characterize and quantify cognitive impairment. © 2016 Wiley Periodicals, Inc.
Dilrukshi, M D S A; Sandakumari, G V N; Abeysundara, P K; Chang, T
2017-02-05
Craniopharyngiomas are rare intracranial tumors commonly presenting with neurological symptoms. Reports of severe hyponatremia as a presenting manifestation of a craniopharyngioma and hyponatremia-induced myopathy are rare. We report the case of a patient with craniopharyngioma presenting with severe hyponatremia, panhypopituitarism, and hyponatremia-induced myopathy. A 52-year-old Sri Lankan man presented with anorexia, nausea, fatigue, generalized muscle weakness, and cramps for 1 week. The onset of his illness had been preceded by vomiting and diarrhea for 1 day which he attributed to food poisoning. On examination, he had an apathetic disposition with a generalized "sallow complexion." He was not dehydrated. Apart from reduced muscle power (4/5) and hyporeflexia, the neurological examination was normal. His serum sodium was 102 mmol/l; potassium 4.1 mmol/l; chloride 63 mmol/l; plasma osmolality 272 mosm/KgH 2 O; urine osmolality 642 mosm/KgH 2 O; and urine sodium 79 mmol/l. His creatine phosphokinase was 12,400 U/l, lactate dehydrogenase 628 U/l, aspartate aminotransferase 360 U/l, and alanine aminotransferase 64 U/l. His hormone profile revealed panhypopituitarism. An electromyogram showed nonspecific abnormalities while a muscle biopsy did not show any pathology. Magnetic resonance imaging of his brain demonstrated a well-defined craniopharyngioma with suprasellar extension. His pituitary gland was compressed and the pituitary stalk was displaced by the tumor. He had marked improvement in muscle power and rapid reduction of serum creatine phosphokinase levels paralleling the correction of severe hyponatremia, even before the initiation of hormone replacement. This case illustrates the rare presentation of severe hyponatremia and hyponatremia-induced myopathy in patients with craniopharyngioma, awareness of which would facilitate early appropriate investigations and treatment.
Toxic myopathies: muscle biopsy features Miopatia tóxica: biópsia muscular
Directory of Open Access Journals (Sweden)
Rosana Herminia Scola
2007-03-01
Full Text Available Several drugs and toxic substances can cause muscular abnormalities and are frequent causes of acquired myopathies. We present a series of 32 patients, predominance of young adult patients, diagnosed with toxic myopathy. The most common substances inducing myopathy were corticosteroids (56.2% followed by the propoxyphene, neuroleptics, zidovudine and drug-induced hypokalemia. The investigation showed normal serum creatine kinase levels in 65.4%, myopathic pattern of the needle electromyography in 40% and the more frequent histological diagnosis of the muscle biopsy was type 2 fiber atrophy (59.3%. Clinical features, etiology, course of the disease, serum levels of muscular enzymes, electromyographic features and, especially, muscle biopsy features are discussed.Diversos medicamentos e substâncias tóxicas podem causar alterações musculares e são causas freqüentes de miopatia adquirida. Apresentamos uma série de 32 pacientes, predomínio de pacientes adulto jovens, com miopatia tóxica. As substâncias mais relacionadas com a miopatia foram os corticosteróides (56,2% seguidos pelo propoxifeno, neurolépticos, zidovudina e drogas indutoras de hipocalemia. A investigação mostrou níveis normais de creatino quinase sérica em 65,4%, eletromiografia de agulha com padrão miopático em 40% e o mais freqüente diagnóstico histológico da biópsia muscular foi atrofia de fibras do tipo 2 (59,3%. As manifestações clínicas, etiologia, tempo de evolução, nível sérico das enzimas musculares, alterações da eletroneuromiografia e, especialmente, da biópsia muscular são discutidos.
Novel autosomal dominant TNNT1 mutation causing nemaline myopathy.
Konersman, Chamindra G; Freyermuth, Fernande; Winder, Thomas L; Lawlor, Michael W; Lagier-Tourenne, Clotilde; Patel, Shailendra B
2017-11-01
Nemaline myopathy (NEM) is one of the three major forms of congenital myopathy and is characterized by diffuse muscle weakness, hypotonia, respiratory insufficiency, and the presence of nemaline rod structures on muscle biopsy. Mutations in troponin T1 (TNNT1) is 1 of 10 genes known to cause NEM. To date, only homozygous nonsense mutations or compound heterozygous truncating or internal deletion mutations in TNNT1 gene have been identified in NEM. This extended family is of historical importance as some members were reported in the 1960s as initial evidence that NEM is a hereditary disorder. Proband and extended family underwent Sanger sequencing for TNNT1. We performed RT-PCR and immunoblot on muscle to assess TNNT1 RNA expression and protein levels in proband and father. We report a novel heterozygous missense mutation of TNNT1 c.311A>T (p.E104V) that segregated in an autosomal dominant fashion in a large family residing in the United States. Extensive sequencing of the other known genes for NEM failed to identify any other mutant alleles. Muscle biopsies revealed a characteristic pattern of nemaline rods and severe myofiber hypotrophy that was almost entirely restricted to the type 1 fiber population. This novel mutation alters a residue that is highly conserved among vertebrates. This report highlights not only a family with autosomal dominant inheritance of NEM, but that this novel mutation likely acts via a dominant negative mechanism. © 2017 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.
Walmsley, Gemma L; Blot, Stéphane; Venner, Kerrie; Sewry, Caroline; Laporte, Jocelyn; Blondelle, Jordan; Barthélémy, Inès; Maurer, Marie; Blanchard-Gutton, Nicolas; Pilot-Storck, Fanny; Tiret, Laurent; Piercy, Richard J
2017-02-01
Mutations in HACD1/PTPLA cause recessive congenital myopathies in humans and dogs. Hydroxyacyl-coA dehydratases are required for elongation of very long chain fatty acids, and HACD1 has a role in early myogenesis, but the functions of this striated muscle-specific enzyme in more differentiated skeletal muscle remain unknown. Canine HACD1 deficiency is histopathologically classified as a centronuclear myopathy (CNM). We investigated the hypothesis that muscle from HACD1-deficient dogs has membrane abnormalities in common with CNMs with different genetic causes. We found progressive changes in tubuloreticular and sarcolemmal membranes and mislocalized triads and mitochondria in skeletal muscle from animals deficient in HACD1. Furthermore, comparable membranous abnormalities in cultured HACD1-deficient myotubes provide additional evidence that these defects are a primary consequence of altered HACD1 expression. Our novel findings, including T-tubule dilatation and disorganization, associated with defects in this additional CNM-associated gene provide a definitive pathophysiologic link with these disorders, confirm that dogs deficient in HACD1 are relevant models, and strengthen the evidence for a unifying pathogenesis in CNMs via defective membrane trafficking and excitation-contraction coupling in muscle. These results build on previous work by determining further functional roles of HACD1 in muscle and provide new insight into the pathology and pathogenetic mechanisms of HACD1 CNM. Consequently, alterations in membrane properties associated with HACD1 mutations should be investigated in humans with related phenotypes. Copyright © 2017 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.
Roef, MJ; de Meer, K; Reijngoud, DJ; Straver, HWHC; de Barse, M; Kalhan, SC; Berger, R
Background: A high-fat diet has been recommended for the treatment of patients with mitochondrial myopathy due to complex I (NADH dehydrogenase) deficiency (CID). Objective: This study evaluated the effects of intravenous infusion of isoenergetic amounts of triacylglycerol or glucose on substrate
Horiuchi, Noriyuki; Aihara, Naoyuki; Mizutani, Hiroshi; Kousaka, Shinichi; Nagafuchi, Tsuneyuki; Ochiai, Mariko; Ochiai, Kazuhiko; Kobayashi, Yoshiyasu; Furuoka, Hidefumi; Asai, Tetsuo; Oishi, Koji
2014-03-01
We describe a case of human Becker muscular dystrophy (BMD)-like myopathy that was characterized by the declined stainability of dystrophin at sarcolemma in a pig and the immunostaining for dystrophin on the formalin-fixed, paraffin-embedded (FFPE) tissue. The present case was found in a meat inspection center. The pig looked appeared healthy at the ante-mortem inspection. Muscular abnormalities were detected after carcass dressing as pale, discolored skeletal muscles with prominent fat infiltrations and considered so-called "fatty muscular dystrophy". Microscopic examination revealed following characteristics: diffused fat infiltration into the skeletal muscle and degeneration and regeneration of the remaining skeletal muscle fibers. Any lesions that were suspected of neurogenic atrophy, traumatic muscular degeneration, glycogen storage disease or other porcine muscular disorders were not observed. The immunostaining for dystrophin was conducted and confirmed to be applicable on FFPE porcine muscular tissues and revealed diminished stainability of dystrophin at the sarcolemma in the present case. Based on the histological observations and immunostaining results, the present case was diagnosed with BMD-like myopathy associated with dystrophin abnormality in a pig. Although the genetic properties were not clear, the present BMD-like myopathy implied the occurrence of dystrophinopathy in pigs. To the best of our knowledge, this is the first report of a natural case of myopathy associated with dystrophin abnormalities in a pig.
Autism in the Son of a Woman with Mitochondrial Myopathy and Dysautonomia: A Case Report.
Brown, Bradley D; Rais, Theodore
2015-01-01
The relationship between autism spectrum disorders and mitochondrial dysfunction, including mitochondrial myopathies and other mitochondrial diseases, is an area of ongoing research. All autism spectrum disorders are known to be heritable, via genetic and/or epigenetic mechanisms, but specific modes of inheritance are not well characterized. Nevertheless, autism spectrum disorders have been linked to many specific genes associated with mitochondrial function, especially to genes involved in mitochondrial tRNA and the electron transport chain, both particularly vulnerable to point mutations, and clinical research also supports a relationship between the two pathologies. Although only a small minority of patients with autism have a mitochondrial disease, many patients with mitochondrial myopathies have autism spectrum disorder symptoms, and these symptoms may be the presenting symptoms, which presents a diagnostic challenge for clinicians. The authors report the case of a 15-year-old boy with a history of autism spectrum disorder and neurocardiogenic syncope, admitted to the inpatient unit for self-injury, whose young mother, age 35, was discovered to suffer from mitochondrial myopathy, dysautonomia, neurocardiogenic syncope, Ehler-Danlos syndrome, and other uncommon multisystem pathologies likely related to mitochondrial dysfunction. This case illustrates the need for a high index of suspicion for mitochondrial disease in patients with autism, as they have two orders of magnitude greater risk for such diseases than the general population. The literature shows that mitochondrial disease is underdiagnosed in autism spectrum disorder patients and should not be viewed as a "zebra" (i.e., an obscure diagnosis that is made when a more common explanation is more likely).
The myositis autoantibody phenotypes of the juvenile idiopathic inflammatory myopathies.
Rider, Lisa G; Shah, Mona; Mamyrova, Gulnara; Huber, Adam M; Rice, Madeline Murguia; Targoff, Ira N; Miller, Frederick W
2013-07-01
The juvenile idiopathic inflammatory myopathies (JIIM) are systemic autoimmune diseases characterized by skeletal muscle weakness, characteristic rashes, and other systemic features. In follow-up to our study defining the major clinical subgroup phenotypes of JIIM, we compared demographics, clinical features, laboratory measures, and outcomes among myositis-specific autoantibody (MSA) subgroups, as well as with published data on adult idiopathic inflammatory myopathy patients enrolled in a separate natural history study. In the present study, of 430 patients enrolled in a nationwide registry study who had serum tested for myositis autoantibodies, 374 had either a single specific MSA (n = 253) or no identified MSA (n = 121) and were the subject of the present report. Following univariate analysis, we used random forest classification and exact logistic regression modeling to compare autoantibody subgroups. Anti-p155/140 autoantibodies were the most frequent subgroup, present in 32% of patients with juvenile dermatomyositis (JDM) or overlap myositis with JDM, followed by anti-MJ autoantibodies, which were seen in 20% of JIIM patients, primarily in JDM. Other MSAs, including anti-synthetase, anti-signal recognition particle (SRP), and anti-Mi-2, were present in only 10% of JIIM patients. Features that characterized the anti-p155/140 autoantibody subgroup included Gottron papules, malar rash, "shawl-sign" rash, photosensitivity, cuticular overgrowth, lowest creatine kinase (CK) levels, and a predominantly chronic illness course. The features that differed for patients with anti-MJ antibodies included muscle cramps, dysphonia, intermediate CK levels, a high frequency of hospitalization, and a monocyclic disease course. Patients with anti-synthetase antibodies had higher frequencies of interstitial lung disease, arthralgia, and "mechanic's hands," and had an older age at diagnosis. The anti-SRP group, which had exclusively juvenile polymyositis, was characterized by high
Skeletal muscle repair in a mouse model of nemaline myopathy.
Sanoudou, Despina; Corbett, Mark A; Han, Mei; Ghoddusi, Majid; Nguyen, Mai-Anh T; Vlahovich, Nicole; Hardeman, Edna C; Beggs, Alan H
2006-09-01
Nemaline myopathy (NM), the most common non-dystrophic congenital myopathy, is a variably severe neuromuscular disorder for which no effective treatment is available. Although a number of genes have been identified in which mutations can cause NM, the pathogenetic mechanisms leading to the phenotypes are poorly understood. To address this question, we examined gene expression patterns in an NM mouse model carrying the human Met9Arg mutation of alpha-tropomyosin slow (Tpm3). We assessed five different skeletal muscles from affected mice, which are representative of muscles with differing fiber-type compositions, different physiological specializations and variable degrees of pathology. Although these same muscles in non-affected mice showed marked variation in patterns of gene expression, with diaphragm being the most dissimilar, the presence of the mutant protein in nemaline muscles resulted in a more similar pattern of gene expression among the muscles. This result suggests a common process or mechanism operating in nemaline muscles independent of the variable degrees of pathology. Transcriptional and protein expression data indicate the presence of a repair process and possibly delayed maturation in nemaline muscles. Markers indicative of satellite cell number, activated satellite cells and immature fibers including M-Cadherin, MyoD, desmin, Pax7 and Myf6 were elevated by western-blot analysis or immunohistochemistry. Evidence suggesting elevated focal repair was observed in nemaline muscle in electron micrographs. This analysis reveals that NM is characterized by a novel repair feature operating in multiple different muscles.
Tc-99m ECD brain SPECT in MELAS syndrome and mitochondrial myopathy: comparison with MR findings
International Nuclear Information System (INIS)
Park, Sang Joon; Ryu, Young Hoon; Jeon, Tae Joo; Kim, Jai Keun; Nam, Ji Eun; Yoon, Pyeong Ho; Yoon, Choon Sik; Lee, Jong Doo
1998-01-01
We evaluated brain perfusion SPECT findings of MELAS syndrome and mitochondrial myopathy in correlation with MR imaging in search of specific imaging features. Subjects were five patients (four females and one male; age range, 1 to 25 year) who presented with repeated stroke like episodes, seizures or developmental delay or asymptomatic but had elevated lactic acid in CSF and serum. Conventional non-contrast MR imaging and Tc-99m-ethyl cysteinate dimer (ECD) brain perfusion SPECT were performed and imaging features were analyzed. MRI demonstrated increased T2 signal intensities in the affected areas of gray and white matters mainly in the parietal (4/5) and occipital lobes (4/5) and in the basal ganglia (1/5), which were not restricted to a specific vascular territory. SPECT demonstrated decreased perfusion in the corresponding regions of MRI lesions. In addition, there were perfusion defects in parietal (1 patient), temporal (2), and frontal (1) lobes and basal ganglia (1) and thalami (2). In a patient with mitochondrial myopathy who had normal MRI, decreased perfusion was noted in left parietal area and bilateral thalami. Tc-99m ECD SPECT imaging in patients with MELAS syndrome and mitochondrial myopathy showed hypoperfusion of parieto-occipital cortex, basal ganglia, thalamus and temporal cortex, which were not restricted to a specific vascular territory. There were no specific imaging features on SPECT. The significance of abnormal perfusion on SPECT without corresponding MR abnormalities needs to be evaluated further in larger number of patients
Leshinsky-Silver, E; Michelson, M; Cohen, S; Ginsberg, M; Sadeh, M; Barash, V; Lerman-Sagie, T; Lev, D
2008-07-01
Isolated mitochondrial myopathies (IMM) are either due to primary defects in mtDNA, in nuclear genes that control mtDNA abundance and structure such as thymidine kinase 2 (TK2), or due to CoQ deficiency. Defects in the TK2 gene have been found to be associated with mtDNA depletion attributed to a depleted mitochondrial dNTP pool in non-dividing cells. We report an unusual case of IMM, homozygous for the H90N mutation in the TK2 gene but unlike other cases with the same mutation, does not demonstrate mtDNA depletion. The patient's clinical course is relatively mild and a muscle biopsy showed ragged red muscle fibers with a mild decrease in complexes I and an increase in complexes IV and II activities. This report extends the phenotypic expression of TK2 defects and suggests that all patients who present with an IMM even with normal quantities of mtDNA should be screened for TK2 mutations.
Directory of Open Access Journals (Sweden)
Teet Seene
2012-01-01
Full Text Available Changes in skeletal muscle quantity and quality lead to disability in the aging population. Physiological changes in aging skeletal muscle are associated with a decline in mass, strength, and inability to maintain balance. Glucocorticoids, which are in wide exploitation in various clinical scenarios, lead to the loss of the myofibrillar apparatus, changes in the extracellular matrix, and a decrease in muscle strength and motor activity, particularly in the elderly. Exercise therapy has shown to be a useful tool for the prevention of different diseases, including glucocorticoid myopathy and muscle unloading in the elderly. The purpose of the paper is to discuss the possibilities of using exercise therapy in the prevention of glucocorticoid caused myopathy and unloading in the elderly and to describe relationships between the muscle contractile apparatus and the extracellular matrix in different types of aging muscles.
Myopathy in hyperthyroidism as a consequence of rapid reduction of thyroid hormone
Li, Qianrui; Liu, Yuping; Zhang, Qianying; Tian, Haoming; Li, Jianwei; Li, Sheyu
2017-01-01
Abstract Rationale: Myalgia and elevated creatine kinase (CK) are occasionally observed during the treatment of hyperthyroid patients. Relative hypothyroidism resulted from rapid thyroid hormone reduction had been promoted as a plausible cause of these myopathic changes, however rarely reported. Patient concerns: We hereby presented a 20-year-old female with Grave's disease, who developed myopathy and elevated CK during rapid correction of thyroid hormone. Diagnoses: Relative hypothyroidism-i...
Nuclear actin aggregation is a hallmark of anti-synthetase syndrome-induced dysimmune myopathy
Stenzel, W; Preusse, C; Allenbach, Y; Pehl, D; Junckerstorff, R; Heppner, F L; Nolte, K; Aronica, E; Kana, V; Rushing, E; Schneider, U; Claeys, K G; Benveniste, O; Weis, J; Goebel, H H
2015-01-01
Objective: To analyze antisynthetase syndrome–associated myositis by modern myopathologic methods and to define its place in the spectrum of idiopathic inflammatory myopathies (IIMs). Methods: Skeletal muscle biopsies from antisynthetase syndrome–associated myositis and other IIMs from different institutions worldwide were analyzed by histopathology, quantitative PCR, and electron microscopy. Results: Myonuclear actin filament inclusions were identified as a unique morphologic hallmark of a...
Uremic myopathy: Is oxidative stress implicated in muscle dysfunction in uremia?
Directory of Open Access Journals (Sweden)
Antonia eKaltsatou
2015-03-01
Full Text Available Renal failure is accompanied by progressive muscle weakness and premature fatigue, in part linked to hypokinesis and in part to uremic toxicity. These changes are associated with various detrimental biochemical and morphological alterations. All of these pathological parameters are collectively termed ureamic myopathy. Various interventions while helpful can’t fully remedy the pathological phenotype. Complex mechanisms that stimulate muscle dysfunction in uremia have been proposed, and oxidative stress could be implicated. Skeletal muscles continuously produce reactive oxygen species (ROS and reactive nitrogen species (RNS at rest and more so during contraction. The aim of this mini review is to provide an update on recent advances in our understanding of how ROS and RNS generation might contribute to muscle dysfunction in uremia. Thus a systematic review was conducted searching PubMed and Scopus by using the Cochrane and PRISMA guidelines. While few studies met our criteria their findings are discussed making reference to other available literature data. Oxidative stress can direct muscle cells into a catabolic state and chronic exposure to it leads to wasting. Moreover, redox disturbances can significantly affect force production per se. We conclude that oxidative stress can be in part responsible for some aspects of uremic myopathy. Further research is needed to discern clear mechanisms and to help efforts to counteract muscle weakness and exercise intolerance in uremic patients.
DEFF Research Database (Denmark)
Zaharieva, Irina T; Thor, Michael G; Oates, Emily C
2016-01-01
Congenital myopathies are a clinically and genetically heterogeneous group of muscle disorders characterized by congenital or early-onset hypotonia and muscle weakness, and specific pathological features on muscle biopsy. The phenotype ranges from foetal akinesia resulting in in utero or neonatal...
MYOPATHY AS A SIDE EFFECT OF STATIN THERAPY: MECHANISMS OF DEVELOPMENT AND PROSPECTS FOR TREATMENT
Directory of Open Access Journals (Sweden)
O. M. Drapkina
2015-01-01
Full Text Available Statins are lipid-lowering drugs with proven efficacy that reduce cardiovascular risk and are well tolerated by most patients. Myopathy as a side effect of statin therapy is one of the most common reasons for their withdrawal. Its severity can range from asymptomatic increase of serum CPK to life-threatening rhabdomyolysis. Therefore it is necessary to remember about the possibility of its occurrence.The exact molecular mechanisms of muscle damage by statins are still unknown. Various hypotheses are suggested in this respect: fatty acid oxidation disorders, mitochondrial dysfunction, increased protein degradation in myocytes due to changes in atrogin-1 and ubiquitin activity, activation of autoimmune processes, intracellular depletion of essential metabolites, destabilization of cell membranes, impaired expression of genes involved in apoptosis and protein degradation. The theory that the reduction of intramuscular CoQ10 level is the cause of myopathy prevails. Additional intake of CoQ10 seems promising, but is not evidence-based.
MYOPATHY AS A SIDE EFFECT OF STATIN THERAPY: MECHANISMS OF DEVELOPMENT AND PROSPECTS FOR TREATMENT
Directory of Open Access Journals (Sweden)
O. M. Drapkina
2015-09-01
Full Text Available Statins are lipid-lowering drugs with proven efficacy that reduce cardiovascular risk and are well tolerated by most patients. Myopathy as a side effect of statin therapy is one of the most common reasons for their withdrawal. Its severity can range from asymptomatic increase of serum CPK to life-threatening rhabdomyolysis. Therefore it is necessary to remember about the possibility of its occurrence.The exact molecular mechanisms of muscle damage by statins are still unknown. Various hypotheses are suggested in this respect: fatty acid oxidation disorders, mitochondrial dysfunction, increased protein degradation in myocytes due to changes in atrogin-1 and ubiquitin activity, activation of autoimmune processes, intracellular depletion of essential metabolites, destabilization of cell membranes, impaired expression of genes involved in apoptosis and protein degradation. The theory that the reduction of intramuscular CoQ10 level is the cause of myopathy prevails. Additional intake of CoQ10 seems promising, but is not evidence-based.
Hypothyroid myopathy: A peculiar clinical presentation of thyroid failure. Review of the literature.
Sindoni, Alessandro; Rodolico, Carmelo; Pappalardo, Maria Angela; Portaro, Simona; Benvenga, Salvatore
2016-12-01
Abnormalities in thyroid function are common endocrine disorders that affect 5-10 % of the general population, with hypothyroidism occurring more frequently than hyperthyroidism. Clinical symptoms and signs are often nonspecific, particularly in hypothyroidism. Muscular symptoms (stiffness, myalgias, cramps, easy fatigability) are mentioned by the majority of patients with frank hypothyroidism. Often underestimated is the fact that muscle symptoms may represent the predominant or the only clinical manifestation of hypothyroidism, raising the issue of a differential diagnosis with other causes of myopathy, which sometimes can be difficult. Elevated serum creatine kinase, which not necessarily correlates with the severity of the myopathic symptoms, is certainly suggestive of muscle impairment, though it does not explain the cause. Rare muscular manifestations, associated with hypothyroidism, are rhabdomyolysis, acute compartment syndrome, Hoffman's syndrome and Kocher-Debré-Sémélaigne syndrome. Though the pathogenesis of hypothyroid myopathy is not entirely known, proposed mechanisms include altered glycogenolytic and oxidative metabolism, altered expression of contractile proteins, and neuro-mediated damage. Correlation studies of haplotype, muscle gene expression and protein characterization, could help understanding the pathophysiological mechanisms of this myopathic presentation of hypothyroidism.
Organophosphate-induced intermediate syndrome: aetiology and relationships with myopathy.
Karalliedde, Lakshman; Baker, David; Marrs, Timothy C
2006-01-01
-15 days and even up to 21 days. Weaning from ventilatory care is best carried out in stages, with provision of continuous positive airway pressure prior to complete weaning. Continuous and close monitoring of respiratory function (arterial oxygen saturation, partial pressure of oxygen in arterial blood, partial pressure of carbon dioxide in arterial blood) and acid-base status are an absolute necessity. Prophylactic antibiotics are usually not required unless there has been evidence of aspiration of material into the lungs. Close monitoring of fluid and electrolyte balance is mandatory in view of the profuse offensive diarrhoea that most patients develop. Maintenance of nutrition, physiotherapy, prevention of bed sores and other routine measures to minimise discomfort during ventilatory care are necessary. Recovery from the intermediate syndrome is normally complete and without any sequelae. The usefulness of oximes during the IMS remains uncertain. In animal experiments, very early administration of oximes has prevented the occurrence of myopathy. There are reports from developed countries where administration of oximes at recommended doses and within 2 hours of ingestion of OP insecticide did not prevent the onset of the IMS. Controlled randomised clinical studies are necessary to evaluate the efficacy of oximes in combating the IMS. Electrophysiological studies following OP poisoning have revealed three characteristic phenomena: (i) repetitive firing following a single stimulus; (ii) gradual reduction in twitch height or compound muscle action potential followed by an increase with repetitive stimulation (the 'decrement-increment response'); and (iii) continued reduction in twitch height or compound muscle action potential with repetitive simulation ('decrementing response'). Of these, the decrementing response is the most frequent finding during the IMS, whilst repetitive firing is observed during the acute cholinergic syndrome. The distribution of the weakness in
International Nuclear Information System (INIS)
Kihara, Koichi; Nakajo, Masayuki; Shono, Hirohisa
1992-01-01
Myocardial imaging with β-methyl-p-( 123 I)-iodophenyl-pentadecanoic acid ( 123 I-BMIPP), a new radiopharmaceutical designed to evaluate myocardial fatty acid metabolism, was performed in 7 patients with mitochondrial myopathy to detect their myocardial damages in comparison with 201 Tl myocardial imaging. These patients were divided into 4 chronic progressive external ophthalmoplegia (CPEO) cases, 2 mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) cases and 1 myoclonus epilepsy with ragged-red fibers (MERRF). In visual assessment, we observed more myocardial segments with decreased uptake of 123 I-BMIPP compared to 201 Tl in MELAS cases than in CPEO cases. The mean myocardial uptake of 123 I-BMIPP was higher than that of 201 Tl in CPEO cases. On the other hand, in MELAS and MERRF cases, the mean myocardial uptake of 123 I-BMIPP was lower than that of 201 Tl. Abnormal findings suggesting myocardial damages were observed in echocardiogram and/or in electrocardiogram in MELAS and MERRF cases, while no such abnormal findings were observed in CPEO cases. Along with the previously reported experimental result that the impairment of rat myocardial mitochondria decreased myocardial uptake of 123 I-BMIPP, these results suggest that 123 I-BMIPP may be useful to detect myocardial damages in patients with mitochondrial myopathy. (author)
Żuraw, A; Dietert, K; Kühnel, S; Sander, J; Klopfleisch, R
2016-07-01
Evidence suggest there is a link between equine atypical myopathy (EAM) and ingestion of sycamore maple tree seeds. To further evaluate the hypothesis that the ingestion of hypoglycin A (HGA) containing sycamore maple tree seeds causes acquired multiple acyl-CoA dehydrogenase deficiency and might be associated with the clinical and pathological signs of EAM. Case report. Necropsy and histopathology, using hematoxylin and eosin and Sudan III stains, were performed on a 2.5-year-old mare that died following the development of clinical signs of progressive muscle stiffness and recumbency. Prior to death, the animal ingested sycamore maple tree seeds (Acer pseudoplatanus). Detection of metabolites in blood and urine obtained post mortem was performed by rapid ultra-performance liquid chromatography-tandem mass spectrometry. Data from this case were compared with 3 geldings with no clinical history of myopathy. Macroscopic examination revealed fragments of maple tree seeds in the stomach and severe myopathy of several muscle groups including Mm. intercostales, deltoidei and trapezii. Histologically, the affected muscles showed severe, acute rhabdomyolysis with extensive accumulation of finely dispersed fat droplets in the cytoplasm of degenerated skeletal muscle cells not present in controls. Urine and serum concentrations of several acyl carnitines and acyl glycines were increased, and both contained metabolites of HGA, a toxic amino acid present in sycamore maple tree seeds. The study supports the hypothesis that ingestion of HGA-containing maple tree seeds may cause EAM due to acquired multiple acyl-CoA dehydrogenase deficiency. © 2015 EVJ Ltd.
Lukjanowicz, Małgorzata; Trzcińska-Butkiewicz, Beata; Brzosko, Marek
2006-01-01
Hypothyroidism is one of the common causes of the secondary hypercholesterolemia. The prevalence of hypothyroidism in the general population is estimated to be as high as about 1.5%. Frequency of the hypothyroidism in patients with hyperlipidemia is high, and can be observed in 4.2-10% in different populations. Most commonly, there is no need to treat the hypothyroid patients with the hypolipidemic drugs. Substitution treatment with the thyroid hormones usually results in either normalization or significant decreasing of the lipid levels. Hypothyroidism with symptoms of involvement of skeletal muscles is referred as to hypothyroid myopathy in English literature, and can be present in 30-80% patients with deficiency of the thyroid hormones. Hypothyroidism is a risk factor of developing of toxic injury of muscles, what is thought to be related to hypolipidemic drug intake. We report a case of a patient with undiagnosed hypothyroidism with muscle involvement manifestation, who was treated with fenofibrate due to accidentally diagnosed hypercholesterolemia. Hypolipidemic management resulted in rapid exacerbation of previously moderate myopathy. High concentrations of muscle enzymes and moderate increasing of creatinine concentration were detected. Improvement was observed after discontinuation of fenofibrate administration, but muscle symptoms and elevation of muscle enzymes and creatinine persisted. After administration of levothyroxin, muscle weakness and laboratory abnormalities were observed no longer. After several months of follow-up we believe that treatment with fenofibrate in our patient was complicated with muscle tissue damage and exacerbated symptoms of myopathy originally related to decompensated hypothyroidism.
Guy, R J; Kamm, M A; Martin, J E
1997-02-01
We report a case of a distinctive familial internal anal sphincter myopathy with unique histological and radiological features. A 67-year-old woman presented with a 20-year history of proctalgia fugax and outlet obstruction; other family members were similarly affected. Computed tomograpy and magnetic resonance imaging demonstrated a grossly hypertrophied internal anal sphincter. Strip myectomy of the sphincter was carried out with improvement in evacuation but little relief of proctalgia. Further relief of symptoms was obtained using oral and transdermal nitrates and a calcium antagonist. Histological examination of the excised muscle revealed hypertrophy and an abnormal arrangement of fibres in whorls; many fibres contained vacuoles with inclusion bodies positive for periodic acid-Schiff. This description of a specific anal sphincter myopathy illustrates the potential importance of histopathological studies of smooth muscle in functional disorders of the gut.
Horstick, Eric J.; Linsley, Jeremy W.; Dowling, James J.; Hauser, Michael A.; McDonald, Kristin K.; Ashley-Koch, Allison; Saint-Amant, Louis; Satish, Akhila; Cui, Wilson W.; Zhou, Weibin; Sprague, Shawn M.; Stamm, Demetra S.; Powell, Cynthia M.; Speer, Marcy C.; Franzini-Armstrong, Clara; Hirata, Hiromi; Kuwada, John Y.
2013-01-01
Excitation-contraction coupling, the process that regulates contractions by skeletal muscles, transduces changes in membrane voltage by activating release of Ca2+ from internal stores to initiate muscle contraction. Defects in EC coupling are associated with muscle diseases. Here we identify Stac3 as a novel component of the EC coupling machinery. Using a zebrafish genetic screen, we generate a locomotor mutation that is mapped to stac3. We provide electrophysiological, Ca2+ imaging, immunocytochemical and biochemical evidence that Stac3 participates in excitation-contraction coupling in muscles. Furthermore, we reveal that a mutation in human STAC3 as the genetic basis of the debilitating Native American myopathy (NAM). Analysis of NAM stac3 in zebrafish shows that the NAM mutation decreases excitation-contraction coupling. These findings enhance our understanding of both excitation-contraction coupling and the pathology of myopathies. PMID:23736855
Computerised Axial Tomography (CAT)
1990-06-01
Ministry of’ Defence, Defence Research Information Centre, UK. Computerised Axial Tomography ( CAT ) Report Secufty C"uMiauion tide Onadtiicadon (U. R, Cor S...DRIC T 8485 COMPUTERISED AXIAL TOMOGRAPHY ( CAT ) F.P. GENTILE, F. SABETTA, V. TRO1* ISS R 78/4.Rome, 1.5 Mlarch 1978 (from Italian) B Distribution(f...dello Radiazioni ISSN 0390--6477 F.P. GENTILE, F. SABETTA. V. TROI Computerised Axial Tomography ( CAT ) March 15, 1978). This paper is a review of
International Nuclear Information System (INIS)
Bradford, R.A.W.; Tipping, D.J.
2015-01-01
The ratchet and shakedown boundaries are derived analytically for a thin cylinder composed of elastic-perfectly plastic Tresca material subject to constant internal pressure with capped ends, plus an additional constant axial load, F, and a cycling secondary global bending load. The analytic solution is in good agreement with solutions found using the linear matching method. When F is tensile, ratcheting can occur for sufficiently large cyclic bending loads in which the pipe gets longer and thinner but its diameter remains the same. When F is compressive, ratcheting can occur in which the pipe diameter increases and the pipe gets shorter, but its wall thickness remains the same. When subject to internal pressure and cyclic bending alone (F = 0), no ratcheting is possible, even for arbitrarily large bending loads, despite the presence of the axial pressure load. The reason is that the case with a primary axial membrane stress exactly equal to half the primary hoop membrane stress is equipoised between tensile and compressive axial ratcheting, and hence does not ratchet at all. This remarkable result appears to have escaped previous attention. - Highlights: • A thin cylinder is subject to pressure and cyclic global bending and additional axial load. • Ratchet and shakedown boundaries are derived analytically and using LMM. • Good agreement is found. • No ratcheting occurs for zero additional axial load.
Hypoglycin A in maple trees in the Netherlands and the risk of equine atypical myopathy
Westermann, C.M.; van Leeuwen, Robbert; Mol, Hans
2016-01-01
The Acer (maple) genus of trees comprises over 120 species worldwide. Some of these contain the plant-toxin hypoglycin-A which has been proven to be a cause of the highly fatal condition called atypical myopathy (AM) in horses and ponies. In an earlier study of maple-tree samples (leaves and seeds)
Dietary intervention rescues myopathy associated with neurofibromatosis type 1.
Summers, Matthew A; Rupasinghe, Thusitha; Vasiljevski, Emily R; Evesson, Frances J; Mikulec, Kathy; Peacock, Lauren; Quinlan, Kate GR; Cooper, Sandra T; Roessner, Ute; Stevenson, David A; Little, David G; Schindeler, Aaron
2018-02-15
Neurofibromatosis type 1 (NF1) is an autosomal dominant genetic disorder with complex symptomology. In addition to a predisposition to tumors, children with NF1 can present with reduced muscle mass, global muscle weakness, and impaired motor skills, which can have a significant impact on quality of life. Genetic mouse models have shown a lipid storage disease phenotype may underlie muscle weakness in NF1. Herein we confirm that biopsy specimens from six individuals with NF1 similarly manifest features of a lipid storage myopathy, with marked accumulation of intramyocellular lipid, fibrosis, and mononuclear cell infiltrates. Intramyocellular lipid was also correlated with reductions in neurofibromin protein expression by western analysis. An RNASeq profile of Nf1null muscle from a muscle-specific Nf1 knockout mouse (Nf1MyoD-/-) revealed alterations in genes associated with glucose regulation and cell signaling. Comparison by lipid mass spectrometry demonstrated that Nf1null muscle specimens were enriched for long chain fatty acid (LCFA) containing neutral lipids, such as cholesterol esters and triacylglycerides, suggesting fundamentally impaired LCFA metabolism. The subsequent generation of a limb-specific Nf1 knockout mouse (Nf1Prx1-/-) recapitulated all observed features of human NF1 myopathy, including lipid storage, fibrosis, and muscle weakness. Collectively, these insights led to the evaluation of a dietary intervention of reduced LCFAs, and enrichment of medium-chain fatty acids (MCFAs) with L-carnitine. Following 8-weeks of dietary treatment, Nf1Prx1-/- mice showed a 45% increase in maximal grip strength, and a 71% reduction in intramyocellular lipid staining compared with littermates fed standard chow. These data link NF1 deficiency to fundamental shifts in muscle metabolism, and provide strong proof of principal that a dietary intervention can ameliorate symptoms. © The Author(s) 2017. Published by Oxford University Press. All rights reserved. For
Evaluation of the inner wall axial cracks of steam generator tubes by eddy current test
International Nuclear Information System (INIS)
Hur, Do Haeng; Choi, Myung Sik; Lee, Doek Hyun; Han, Jung Ho
2001-01-01
For the enhancement of ECT reliability on the primary water stress corrosion cracks of nuclear steam generator tubes, it is important to comprehend the signal characteristics on crack morphology and to select an appropriate probe type. In this paper, the sizing accuracy and the detectability for the inner wall axial cracks of tubes were quantitatively evaluated using the electric discharge machined notches and the corrosion cracks which were developed on the operating steam generator tubes. The difference of eddy current signal characteristics between pancake and axial coil were also investigated. The results obtained from this study provide a useful information for more precise evaluation on the inner wall axial cracks of steam generator tubes.
Zolotov, Sagit; Xing, Chao; Mahamid, Riad; Shalata, Adel; Sheikh-Ahmad, Mohammed; Garg, Abhimanyu
2016-01-01
Despite considerable progress in identifying causal genes for lipodystrophy syndromes, the molecular basis of some peculiar adipose tissue disorders remains obscure. In an Israeli–Arab pedigree with a novel autosomal recessive, multiple symmetric lipomatosis (MSL), partial lipodystrophy and myopathy, we conducted exome sequencing of two affected siblings to identify the disease-causingmutation. The 41-year-old female proband and her 36-year-old brother reported marked accumulation of subcutan...
Numerical investigations on axial and radial blade rubs in turbo-machinery
Abdelrhman, Ahmed M.; Tang, Eric Sang Sung; Salman Leong, M.; Al-Qrimli, Haidar F.; Rajamohan, G.
2017-07-01
In the recent years, the clearance between the rotor blades and stator/casing had been getting smaller and smaller prior improving the aerodynamic efficiency of the turbomachines as demand in the engineering field. Due to the clearance reduction between the blade tip and the rotor casing and between rotor blades and stator blades, axial and radial blade rubbing could be occurred, especially at high speed resulting into complex nonlinear vibrations. The primary aim of this study is to address the blade axial rubbing phenomenon using numerical analysis of rotor system. A comparison between rubbing caused impacts of axial and radial blade rubbing and rubbing forces are also aims of this study. Tow rotor models (rotor-stator and rotor casing models) has been designed and sketched using SOILDSWORKS software. ANSYS software has been used for the simulation and the numerical analysis. The rubbing conditions were simulated at speed range of 1000rpm, 1500rpm and 2000rpm. Analysis results for axial blade rubbing showed the appearance of blade passing frequency and its multiple frequencies (lx, 2x 3x etc.) and these frequencies will more excited with increasing the rotational speed. Also, it has been observed that when the rotating speed increased, the rubbing force and the harmonics frequencies in x, y and z-direction become higher and severe. The comparison study showed that axial blade rub is more dangerous and would generate a higher vibration impacts and higher blade rubbing force than radial blade rub.
Directory of Open Access Journals (Sweden)
Massimo Vecchiato
2012-03-01
Full Text Available Skeletal muscle in patients with cancer undergoes many morphological changes due to immuno-inflammatory factors of tumor origin or treatment.T he latest event of these changes is cancer cachexia. Aim of the study is to identify myopathic features in skeletal muscle biopsies from weight stable patients with colorectal cancer and without cachexia or asthenia / weakness, that could possibly provide new diagnostic and prognostic cancer biomarkers. Morphometric analyses and immunohistochemical studies were performed on intraoperative muscle biopsies from patients with colorectal cancer and from weight stable patients undergoing surgery for benign non-inflammatory conditions. A rectus abdominis biopsy was taken in all patients and controls.A correlation between histopathologic findings and clinical characteristics, circulating inflammatory biomarkers and markers of muscle necrosis,surgery data and cancer phenotype were investigated.. Forty four patients (21male/23 female and 17 controls (6 male/11 female (p=NS were studied. In cancer patients’biopsies we observed asubclinical myopathy characterized by an abnormal distribution of myonuclei, which are localized inside the myofiber rather than at the periphery, and by the presence of regenerating muscle fibers. The percentage of myofibers with internalized nuclei is significantly higher in patients (median= 9%, IQR= 3.7-18.8 than in controls (median= 2.7%, IQR= 1.7-3.2 ( p=0.0002. In patients we observed an inverse correlation between the number of centronucleated fibers and the presence of node metastasis (N+(ρ=-0.64 (p=0.002. Patients affected with colorectal cancer display early sign of a myopathy, characterized by centronucleated and regenerating myofibers. This myopathy appears to be associated with an early stage of neoplasia and it could be an adaptive response of muscle to cancer. We hope a future application of these findings as a possible early diagnostic and prognostic biomarker of
Effects of aerobic training on exercise-related oxidative stress in mitochondrial myopathies.
Siciliano, Gabriele; Simoncini, Costanza; Lo Gerfo, Annalisa; Orsucci, Daniele; Ricci, Giulia; Mancuso, Michelangelo
2012-12-01
In mitochondrial myopathies with respiratory chain deficiency impairment of energy cell production may lead to in excess reactive oxygen species generation with consequent oxidative stress and cell damage. Aerobic training has been showed to increase muscle performance in patients with mitochondrial myopathies. Aim of this study has been to evaluate, in 7 patients (6 F e 1M, mean age 44.9 ± 12.1 years) affected by mitochondrial disease, concomitantly to lactate exercise curve, the occurrence of oxidative stress, as indicated by circulating levels of lipoperoxides, in rest condition and as effect of exercise, and also, to verify if an aerobic training program is able to modify, in these patients, ox-redox balance efficiency. At rest and before training blood level of lipoperoxides was 382.4 ± 37.8 AU, compared to controls (318.7 ± 63.8; Pstress degree according to the adopted scale. During incremental exercise blood level of lipoperoxides did not increase, but maintained significantly higher compared to controls. After an aerobic training of 10 weeks the blood level of lipoperoxides decreased by 13.7% at rest (Pexercise test (P=0.06). These data indicate that, in mitochondrial patients, oxidative stress occurs and that an aerobic training is useful in partially reverting this condition. Copyright © 2012 Elsevier B.V. All rights reserved.
Deformation and collapse of zircaloy fuel rod cladding into plenum axial gaps
International Nuclear Information System (INIS)
Pfennigwerth, P.L.; Gorscak, D.A.; Selsley, I.A.
1983-01-01
To minimize support structure, blanket and reflector fuel rods of the thoria urania-fueled Light Water Breeder Reactor (LWBR) were designed with non-freestanding Zircaloy-4 cladding. An analytical model was developed to predict deformation of unirradiated cladding into axial gaps of fuel rod plenum regions where it is unsupported. This model uses the ACCEPT finite element computer program to calculate elastic-plastic deformation of cladding due to external pressure. The finite element is 20-node, triquadratic, isoparametric, and 3-dimensional. Its curved surface permits accurate modeling of the tube geometry, including geometric nonuniformities such as circumferential wall thickness variation and initial tube out-of-roundness. Progressive increases in axial gap length due to cladding elongation and fuel stack shrinkage are modeled, as are deformations of fuel pellets and stainless steel support sleeves which bound plenum axial gaps in LWBR type blanket fuel rods. Zircaloy-4 primary and secondary thermal creep representations were developed from uniaxial creep testing of fuel rod tubing. Creep response to multi-axial loading is modeled with a variation of Hill's formulation for anisotropic materials. Coefficients accounting for anisotropic thermal creep in Zircaloy-4 tubes were developed from creep testing of externally pressurized tubes having fixed axial gaps in the range 2.5 cm to 5.7 cm and radial clearances over simulated fuel pellets ranging from zero to 0.089 mm. (orig./RW)
DEFF Research Database (Denmark)
Böhm, Johann; Biancalana, Valérie; Dechene, Elizabeth T
2012-01-01
Centronuclear myopathy (CNM) is a genetically heterogeneous disorder associated with general skeletal muscle weakness, type I fiber predominance and atrophy, and abnormally centralized nuclei. Autosomal dominant CNM is due to mutations in the large GTPase dynamin 2 (DNM2), a mechanochemical enzym...
Resolution of axial shear strain elastography
International Nuclear Information System (INIS)
Thitaikumar, Arun; Righetti, Raffaella; Krouskop, Thomas A; Ophir, Jonathan
2006-01-01
The technique of mapping the local axial component of the shear strain due to quasi-static axial compression is defined as axial shear strain elastography. In this paper, the spatial resolution of axial shear strain elastography is investigated through simulations, using an elastically stiff cylindrical lesion embedded in a homogeneously softer background. Resolution was defined as the smallest size of the inclusion for which the strain value at the inclusion/background interface was greater than the average of the axial shear strain values at the interface and inside the inclusion. The resolution was measured from the axial shear strain profile oriented at 45 0 to the axis of beam propagation, due to the absence of axial shear strain along the normal directions. The effects of the ultrasound system parameters such as bandwidth, beamwidth and transducer element pitch along with signal processing parameters such as correlation window length (W) and axial shift (ΔW) on the estimated resolution were investigated. The results show that the resolution (at 45 0 orientation) is determined by the bandwidth and the beamwidth. However, the upper bound on the resolution is limited by the larger of the beamwidth and the window length, which is scaled inversely to the bandwidth. The results also show that the resolution is proportional to the pitch and not significantly affected by the axial window shift
Blijham, P.J.; Hengstman, G.J.D.; Laak, H.J. ter; Engelen, B.G.M. van; Zwarts, M.J.
2004-01-01
Combinations of different techniques can increase the diagnostic yield from neurophysiological examination of muscle. In 25 patients with suspected inflammatory myopathy, we prospectively performed needle electromyography (EMG) and measured muscle-fiber conduction velocity (MFCV) in a single muscle,
Signatures for axial chromodynamics
International Nuclear Information System (INIS)
Pati, J.C.
1978-07-01
Within the context of basic left-right symmetry and the hypothesis of unification of weak, electromagnetic and strong forces at a mass level approximately equal to 10 4 -10 6 GeV, relatively light ''mass'' axial gluons, confined or liberated, must be postulated. The authors remark that the existence of such ''light'' axial gluons supplementing the familiar vector octet preserves the successes of QCD, both for deep inelastic processes and charmonium physics. Through the characteristic spin-spin force, generated by their exchange, they may even help resolve some of the discrepancies between vector QCD predictions and charmonium physics. The main remark of this note is that if colour is liberated, not only vector but also axial-vector gluons are produced in high-energy e - e + experiments, e.g. at PETRA and PEP, with fairly large cross-section. Distinctive decay modes of such liberated axial gluons are noted
Evaluation of Eddy Current Signals from the Inner Wall Axial Cracks of Steam Generator Tubes
International Nuclear Information System (INIS)
Choi, Myung Sik; Hur, Do Haeng; Lee, Doek Hyun; Han, Jung Ho; Park, Jung Am
2001-01-01
For the enhancement of ECT reliability on the primary water stress corrosion cracks of nuclear steam generator tubes, of which the occurrence is on the increase, it is important to comprehend the signal characteristics on crack morphology and to select an appropriate probe type. In this paper, the sizing accuracy and the detectability for the inner wall axial cracks of tubes were quantitatively evaluated using the following specimens: the electric discharge machined notches and the corrosion cracks which were developed on the operating steam generator tubes. The difference of eddy current signal characteristics between pancake and axial coil were also Investigated. The results obtained from this study provide a useful information for more precise evaluation on the inner wall axial tracks oi steam generator tubes
A new strategy of axial power distribution control based on three axial offsets concept
International Nuclear Information System (INIS)
Shimazu, Yoichiro
2009-01-01
We have proposed a very simple control procedure for axial xenon oscillation control based on a characteristic trajectory. The trajectory is drawn by three offsets of power distributions, namely, AOp, AOi and AOx. They are defined as the offset of axial power distribution, the offset of the power distribution under which the current iodine distribution is obtained as the equilibrium and that for xenon distribution, respectively. When these offsets are plotted on X-Y plane for (AOp-AOx, AOi-AOx) the trajectory draws a quite characteristic ellipse (or an elliptic spiral). On the other hands, Constant Axial Offset Control (CAOC) procedure is adopted as axial power distribution control strategy during both base load and load following operations in domestic PWRs. In the previous paper, we have presented an innovative procedure of axial power distribution control during load following in PWRs based on this trajectory such that the AOp-AOx is to be controlled to zero when the value deviates the pre-determined limiting values. In this paper we propose a modified control strategy to get more stability of axial power distributions. In this strategy, we control the trajectory to be close to the major axis of the ellipse when the power distribution reaches the limiting values. In other words, the plot is not controlled only to reduce AOp-AOx but also AOi-AOx is taken into account at the same time. It is known that when the plot is controlled to the major axis, it means that the point gives the peak position of axial xenon oscillation. Therefore xenon oscillation will not increase its amplitude any more. Thus more stable axial power distribution control is attained. This kind of design concept is quite important especially for the future PWRs with elongated fuel length and longer core life. Because in a longer effective core and also the longer core life, it has been known that the stability of axial xenon oscillation becomes more unstable. In this paper, some simulation
Vernengo, Luis; Chourbagi, Oussama; Panuncio, Ana; Lilienbaum, Alain; Batonnet-Pichon, Sabrina; Bruston, Francine; Rodrigues-Lima, Fernando; Mesa, Rosario; Pizzarossa, Carlos; Demay, Laurence; Richard, Pascale; Vicart, Patrick; Rodriguez, Maria-Mirta
2010-03-01
Desmin myopathy is a heterogeneous neuromuscular disorder characterized by skeletal myopathy and cardiomyopathy, inherited mostly in an autosomal dominant pattern. We report a five generation Uruguayan family with severe cardiomyopathy and skeletal myopathy. Its most striking features are: atrial dilation, arrhythmia, conduction block and sudden death due to conduction impairment. Affected skeletal muscle shows alteration of mitochondria with paracrystallin inclusions and granulofilamentous material scattered in the muscle fibres. This family carries an unusual deletion p.E114del within the 1A rod domain of desmin. Transfected cells expressing the mutated desmin show punctuated and speckled cytoplasmic aggregates. The mutation causes a local conformational change in heptads a/d residues and charge positions. These findings lead to the hypothesis that coiled-coil interactions may be impaired, resulting in severe alterations in the desmin network. This is the first time that a mutation affecting this domain in the desmin molecule is described in a desminopathy. Copyright 2010. Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
Alessandra eZulian
2014-11-01
Full Text Available Ullrich congenital muscular dystrophy and Bethlem myopathy are caused by mutations in collagen VI genes, which encode an extracellular matrix protein; yet mitochondria play a major role in disease pathogenesis through a short circuit caused by inappropriate opening of the permeability transition pore, a high conductance channel which causes a shortage in ATP production. We find that melanocytes do not produce collagen VI yet they bind it at the cell surface, suggesting that this protein may play a trophic role and that its absence may cause lesions similar to those seen in skeletal muscle. We show that mitochondria in melanocytes of Ullrich congenital muscular dystrophy and Bethlem myooathy patients display increased size, reduced matrix density and disrupted cristae, findings that suggest a functional impairment. In keeping with this hypothesis, mitochondria (i underwent anomalous depolarization after inhibition of the F-ATP synthase with oligomycin, and (ii displayed decreased respiratory reserve capacity. The non-immunosuppressive cyclophilin inhibitor NIM811 prevented mitochondrial depolarization in response to oligomycin in melanocytes from both Ullrich congenital muscular dystrophy and Bethlem myopathy patients, and partially restored the respiratory reserve of melanocytes from one Bethlem myopathy patient. These results match our recent findings on melanocytes from patients affected by Duchenne muscular dystrophy (Pellegrini et al., 2013 Melanocytes--a novel tool to study mitochondrial dysfunction in Duchenne muscular dystrophy. J Cell Physiol 228, 1323-1331, and suggest that skin biopsies may represent a minimally invasive tool to investigate mitochondrial dysfunction and to evaluate drug efficacy in collagen VI-related myopathies and possibly in other muscle wasting conditions like aging sarcopenia.
Modernity: A new axial (era culture?
Directory of Open Access Journals (Sweden)
Wolfgang Schluchter
2017-10-01
Full Text Available The proposition of an axial age, lasting roughly from 800 to 200 B.C. and occurring in major civilizations (China, India, Near East independent of each other, first introduced by Alfred Weber and Karl Jaspers, then further developed by Robert Bellah and S. N. Eisenstadt among others, implied from the outset the question whether there has been a second axial age, leading to modernity, and if so, whether this second axial age consists in a secularization of the achievements of the first axial age. In this article it is argued that the notion of a second axial age is meaningful, but that the emergence of modernity can›t be accounted for in terms of secularization of the achievements of the first axial age. Rather, a new axial principle was institutionalized which separates the modern from the premodern world. This new principle is spelled out with reference to Hans Blumenberg, Charles Taylor and especially Max Weber. The emphasis is on the dialectics of disenchantment and the place of religion in a secular age
Bottai, Matteo; Tjärnlund, Anna; Santoni, Giola; Werth, Victoria P.; Pilkington, Clarissa; de Visser, Marianne; Alfredsson, Lars; Amato, Anthony A.; Barohn, Richard J.; Liang, Matthew H.; Singh, Jasvinder A.; Aggarwal, Rohit; Arnardottir, Snjolaug; Chinoy, Hector; Cooper, Robert G.; Danko, Katalin; Dimachkie, Mazen M.; Feldman, Brian M.; García-de la Torre, Ignacio; Gordon, Patrick; Hayashi, Taichi; Katz, James D.; Kohsaka, Hitoshi; Lachenbruch, Peter A.; Lang, Bianca A.; Li, Yuhui; Oddis, Chester V.; Olesinka, Marzena; Reed, Ann M.; Rutkowska-Sak, Lidia; Sanner, Helga; Selva-O'Callaghan, Albert; Wook Song, Yeong; Vencovsky, Jiri; Ytterberg, Steven R.; Miller, Frederick W.; Rider, Lisa G.; Lundberg, Ingrid E.; Amoruso, Maria; Andersson, Helena; Bayat, Nastaran; Bhansing, Kavish J.; Bucher, Sara; Champbell, Richard; Charles-Schoeman, Christina; Chaudhry, Vinay; Christopher-Stine, Lisa; Chung, Lorinda; Cronin, Mary; Curry, Theresa; Dahlbom, Kathe; Distler, Oliver; Efthimiou, Petros; van Engelen, Baziel G. M.; Faiq, Abdullah; Farhadi, Payam Noroozi; Fiorentino, David; Hengstman, Gerald; Hoogendijk, Jessica; Huber, Adam; Kataoka, Hiroshi; Katsumata, Yasuhiro; Kim, Susan; Kong-Rosario, Michelle; Kontzias, Apostolos; Krol, Petra; Kurita, Takashi; Li, Zhan-Guo; Lindvall, Björn; Linklater, Helen; Maillard, Sue; Mamyrova, Gulnara; Mantegazza, Renato; Marder, Galina S.; Nagahashi Marie, Suely Kazue; Mathiesen, Pernille; Mavragani, Clio P.; McHugh, Neil J.; Michaels, Mimi; Mohammed, Reem; Morgan, Gabrielle; Moser, David W.; Moutsopoulos, Haralampos M.
2017-01-01
To describe the methodology used to develop new classification criteria for adult and juvenile idiopathic inflammatory myopathies (IIMs) and their major subgroups. An international, multidisciplinary group of myositis experts produced a set of 93 potentially relevant variables to be tested for
Elevated risk of venous thromboembolic events in patients with inflammatory myopathies
Directory of Open Access Journals (Sweden)
Nowak M
2016-06-01
Full Text Available Michał Nowak, Katarzyna Królak-Nowak, Aleksandra Sobolewska-Włodarczyk, Jakub Fichna, Marcin Włodarczyk Department of Biochemistry, Faculty of Medicine, Medical University of Lodz, Lodz, Poland Abstract: Venous thromboembolism (VTE is a multifactorial disease manifesting as either deep vein thrombosis or pulmonary embolism. Its prevalence makes VTE a significant issue for both the individual – as a negative factor influencing the quality of life and prognosis – and the society due to economic burden. VTE is the third most common vascular disorder in Western countries, after myocardial infarction and stroke, making it a major cause of in-hospital mortality, responsible for 5%–10% of hospital deaths. Despite many studies conducted, only 50%–60% provoking factors have been identified, while the remaining 40%–50% have been classified as idiopathic or unprovoked. Chronic inflammatory disorders, with their underlying prothrombotic state, reveal an increased risk of VTE (six to eight times compared with the general population. Among the inflammatory disorders, we can identify inflammatory myopathies – a group of rare, chronic diseases featuring weakness and inflammation of muscles with periods of exacerbation and remission; their main classes are polymyositis and dermatomyositis. The objective of this review is to emphasize the need of VTE prophylaxis in individuals with inflammatory myopathies in order to reduce morbidity and mortality rates among those patients and improve their quality of life and prognosis. Keywords: deep vein thrombosis, pulmonary embolism, inflammation, polymyositis, dermatomyositis, prothrombotic state
Yatabe, K; Kawai, M
1997-08-01
Ulex europaeus agglutinin I (UEA I) binding was studied in 83 patients with various neuromuscular disorders. UEA I labelled endomysial capillaries and endothelial cells of perimysial blood vessels in all the examined muscles. There was no UEA I binding to muscle fibres except for all (9) cases of distal myopathy with rimmed vacuole formation (DMRV), 1 of 5 cases of inclusion body myositis and 1 of 36 cases of inflammatory myopathies. The UEA I binding was completely eliminated by preincubation of UEA I solution with L-fucose. Using electron microscopy, the UEA I binding was localized to sarcolemma and intrasarco-plasmic membranous organelles other than mitochondria. Myosatellite cells were not labelled. These findings revealed the existence of fucosylated proteins or lipids in a subset of skeletal muscles suffering from DMRV. Biochemical identification of the fucosylated substance and further detailed study on subcellular localization of UEA I binding may yield important clues to the unknown pathogenesis of DMRV.
International Nuclear Information System (INIS)
Hasuo, K.; Tamura, S.; Yasumori, K.; Uchino, A.; Masuda, K.; Goda, S.; Ishimoto, S.; Kamikaseda, K.; Wakuta, Y.; Kishi, M.
1987-01-01
Among mitochondrial encephalomyopathies, MELAS (mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes, Pavlakis et al., 1983) is recognized as a distinct syndrome characterized by generalized convulsions and recurrrent stroke-like episodes. The neuroradiological findings of three patients with MELAS are reported here. Retrospective review shows that MELAS should be included in the differential diagnosis of infarct-like lesions of the cerebrum. (orig.)
van der Heijde, Désirée; Sieper, Joachim; Elewaut, Dirk; Deodhar, Atul; Pangan, Aileen L; Dorr, Alexander P
2014-12-01
Recognition, diagnosis, and management of axial spondyloarthritis (axial SpA) continue to advance. The objectives of this study were to compare referrals, diagnosis, and management of axial SpA in Western Europe (WE), North America (US and Canada), and the rest of world (RoW) in academic and community rheumatology practices and to identify areas for further education. Rheumatologists responded online to the MAXIMA (Management of Axial SpA International and Multicentric Approaches) survey. Questions pertained to referral, diagnosis, and management of axial SpA. Rheumatologists (N = 809) from 56 countries completed the survey about patients with chronic back pain (≥3 months) starting before age 45 years. Responses from academic and community practice rheumatologists were generally similar. Most referrals were from primary care providers. Symptom duration of 3 years or more at referral was reported more frequently by WE and RoW than US respondents. More WE and RoW than US rheumatologists referred to the Assessment of SpondyloArthritis International Society criteria for axial SpA in clinical practice. Rheumatologists reported prescribing disease-modifying antirheumatic drugs for the management of axial SpA. Sulfasalazine was frequently prescribed across regions; methotrexate was more commonly prescribed by US rheumatologists compared with other regions. Referral patterns, diagnosis, and disease management for axial SpA were similar among WE, North America, and RoW rheumatologists and in academic/community practices, although more WE and RoW rheumatologists referred to Assessment of SpondyloArthritis International Society criteria in clinical practice. Disease-modifying antirheumatic drugs were commonly prescribed for axial SpA patients, although it was unclear whether these were prescribed for axial or peripheral symptoms.
DEFF Research Database (Denmark)
Andersen, Ditte C; Petersson, Stine J; Jørgensen, Louise H
2009-01-01
, DLK1 was upregulated in all human myopathies analyzed, including Duchenne- and Becker muscular dystrophies. Substantial numbers of DLK1(+) satellite cells were observed in normal neonatal and Duchenne muscle, and furthermore, myogenic DLK1(+) cells were identified during muscle regeneration in animal...
König, P; Ambrose, N S; Scott, N
2000-01-01
Hereditary internal anal sphincter myopathy is a very rare condition, only three families have so far been described in the literature. In this case report further clinical and histological findings of one affected member of one of the above families are presented.
Energy Technology Data Exchange (ETDEWEB)
Kihara, Koichi; Nakajo, Masayuki; Shono, Hirohisa (Kagoshima Univ. (Japan). Faculty of Medicine) (and others)
1992-04-01
Myocardial imaging with {beta}-methyl-p-({sup 123}I)-iodophenyl-pentadecanoic acid ({sup 123}I-BMIPP), a new radiopharmaceutical designed to evaluate myocardial fatty acid metabolism, was performed in 7 patients with mitochondrial myopathy to detect their myocardial damages in comparison with {sup 201}Tl myocardial imaging. These patients were divided into 4 chronic progressive external ophthalmoplegia (CPEO) cases, 2 mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) cases and 1 myoclonus epilepsy with ragged-red fibers (MERRF). In visual assessment, we observed more myocardial segments with decreased uptake of {sup 123}I-BMIPP compared to {sup 201}Tl in MELAS cases than in CPEO cases. The mean myocardial uptake of {sup 123}I-BMIPP was higher than that of {sup 201}Tl in CPEO cases. On the other hand, in MELAS and MERRF cases, the mean myocardial uptake of {sup 123}I-BMIPP was lower than that of {sup 201}Tl. Abnormal findings suggesting myocardial damages were observed in echocardiogram and/or in electrocardiogram in MELAS and MERRF cases, while no such abnormal findings were observed in CPEO cases. Along with the previously reported experimental result that the impairment of rat myocardial mitochondria decreased myocardial uptake of {sup 123}I-BMIPP, these results suggest that {sup 123}I-BMIPP may be useful to detect myocardial damages in patients with mitochondrial myopathy. (author)
Meloche, K J; Fancher, B I; Emmerson, D A; Bilgili, S F; Dozier, W A
2018-05-01
Two experiments (Exp) were conducted to determine if reductions in the incidence and severity of wooden breast (WB) and white striping (WS) may be obtained by reducing dietary nutrient density. In each Exp, Yield Plus × Ross 708 male broiler chicks were placed into 63 pens (22 birds/pen). All birds received an identical prestarter diet until 7 d of age, after which time each pen was randomly assigned to 1 of the following 7 dietary treatments (TRT) for the starter (8 to 14 d), grower (15 to 24 d), finisher 1 (Exp 1: 26 to 35 d; Exp 2: 26 to 42 d), and withdrawal (Exp 2: 43 to 48 d) phases: 1) 100% of primary breeder recommendations for digestible amino acid and metabolizable energy density throughout Exp; 2) 95% of TRT 1 until 14 d of age, then as TRT 1; 3) 95% of TRT 1 until 24 d of age, then as TRT 1; 4) 95% of TRT 1 throughout Exp; 5) 90% of TRT 1 until 14 d of age, then as TRT 1; 6) 90% of TRT 1 until 24 d of age, then as TRT 1; 7) 90% of TRT 1 throughout Exp. At 36 d (Exp 1) and 49 d (Exp 2), 18 birds per pen were processed and evaluated for WS and WB. In Exp 1, reduced dietary density in the starter phase (TRT 2 and TRT 5) resulted in increased (P ≤ 0.05) incidences of severe WB (32.9% and 34.7%) relative to TRT 1 (18.2%). In Exp 2, broilers assigned to TRT 7 had reduced (P 36.5%; WS: 64.5%). In both Exp, plasma creatine kinase and lactate dehydrogenase increased (P ≤ 0.05) with increasing scores for WB and WS. Reducing dietary nutrient density from 8 to 14 d may exacerbate fillet myopathies in broilers reared to 35 d of age. Although reducing dietary energy and amino acid density to 90% of recommendations from 1 to 48 d reduced the severity of myopathies, these reductions occurred with compromises in live performance. Altogether, these results indicated that concurrent manipulation of dietary amino acid and energy density is not a viable practical solution for breast myopathies.
Guptha, V. L. Jagannatha; Sharma, Ramesh S.
2017-11-01
The use of FRP composite materials in aerospace, aviation, marine, automotive and civil engineering industry has increased rapidly in recent years due to their high specific strength and stiffness properties. The structural members contrived from such composite materials are generally subjected to complex loading conditions and leads to multi-axial stress conditions at critical surface localities. Presence of notches, much required for joining process of composites, makes it further significant. The current practice of using uni-axial test data alone to validate proposed material models is inadequate leading to evaluation and consideration of bi-axial test data. In order to correlate the bi-axial strengths with the uni-axial strengths of GFRP composite laminates in the presence of a circular notch, bi-axial tests using four servo-hydraulic actuators with four load cells were carried out. To determine the in-plane strength parameters, bi-axial cruciform test specimen model was considered. Three different fibre orientations, namely, 0°, 45°, and 90° are considered with a central circular notch of 10 mm diameter in the present investigation. From the results obtained, it is observed that there is a reduction in strength of 5.36, 2.41 and 13.92% in 0°, 45°, and 90° fibre orientation, respectively, under bi-axial loading condition as compared to that of uni-axial loading in laminated composite.
Tafakhori, Abbas; Yu Jin Ng, Alvin; Tohari, Sumanty; Venkatesh, Byrappa; Lee, Hane; Eskin, Ascia; Nelson, Stanley F; Bonnard, Carine; Reversade, Bruno; Kariminejad, Ariana
2016-02-01
TWINKLE (c10orf2) gene is responsible for autosomal dominant progressive external ophthalmoplegia (PEO). In rare cases, additional features such as muscle weakness, peripheral neuropathy, ataxia, cardiomyopathy, dysphagia, dysphonia, cataracts, depression, dementia, parkinsonism, and hearing loss have been reported in association with heterozygous mutations of the TWINKLE gene. We have studied a large Iranian family with myopathy, dysphonia, dysphagia, and behavior change in addition to PEO in affected members. We identified a missense mutation c.1121G > A in the c10orf2 gene in all affected members. Early death is a novel feature seen in affected members of this family that has not been reported to date. The association of PEO, myopathy, dysphonia, dysphagia, behavior change and early death has not been previously reported in the literature or other patients with this mutation.
Toni, Silvia; Morandi, Riccardo; Busacchi, Marcello; Tardini, Lucia; Merlini, Luciano; Battistini, Nino Carlo; Pellegrini, Massimo
2014-01-01
Collagen VI mutations lead to disabling myopathies like Bethlem myopathy (BM) and Ullrich congenital muscular dystrophy (UCMD). We have investigated the nutritional and metabolic status of one UCMD and seven BM patients (five female, three male, mean age 31 ± 9 years) in order to find a potential metabolic target for nutritional intervention. For this study, we used standard anthropometric tools, such as BMI evaluation and body circumference measurements. All results were compared to dual-energy X-ray absorptiometry (DXA), considered the "gold standard" method. Energy intake of each patient was evaluated through longitudinal methods (7-day food diary) while resting energy expenditure (REE) was predicted using specific equations and measured by indirect calorimetry. Clinical evaluation included general and nutritional blood and urine laboratory analyses and quantitative muscle strength measurement by hand-held dynamometry. BM and UCMD patients showed an altered body composition, characterized by low free fat mass (FFM) and high fat mass (FM), allowing us to classify them as sarcopenic, and all but one as sarcopenic-obese. Another main result was the negative correlation between REE/FFM ratio (basal energy expenditure per kilograms of fat-free mass) and the severity of the disease, as defined by the muscle megascore (correlation coefficient -0.955, P-value nutritional intervention in these patients.
The Nucleon Axial Form Factor and Staggered Lattice QCD
Energy Technology Data Exchange (ETDEWEB)
Meyer, Aaron Scott [Chicago U.
2017-01-01
The study of neutrino oscillation physics is a major research goal of the worldwide particle physics program over the upcoming decade. Many new experiments are being built to study the properties of neutrinos and to answer questions about the phenomenon of neutrino oscillation. These experiments need precise theoretical cross sections in order to access fundamental neutrino properties. Neutrino oscillation experiments often use large atomic nuclei as scattering targets, which are challenging for theorists to model. Nuclear models rely on free-nucleon amplitudes as inputs. These amplitudes are constrained by scattering experiments with large nuclear targets that rely on the very same nuclear models. The work in this dissertation is the rst step of a new initiative to isolate and compute elementary amplitudes with theoretical calculations to support the neutrino oscillation experimental program. Here, the eort focuses on computing the axial form factor, which is the largest contributor of systematic error in the primary signal measurement process for neutrino oscillation studies, quasielastic scattering. Two approaches are taken. First, neutrino scattering data on a deuterium target are reanalyzed with a model-independent parametrization of the axial form factor to quantify the present uncertainty in the free-nucleon amplitudes. The uncertainties on the free-nucleon cross section are found to be underestimated by about an order of magnitude compared to the ubiquitous dipole model parametrization. The second approach uses lattice QCD to perform a rst-principles computation of the nucleon axial form factor. The Highly Improved Staggered Quark (HISQ) action is employed for both valence and sea quarks. The results presented in this dissertation are computed at physical pion mass for one lattice spacing. This work presents a computation of the axial form factor at zero momentum transfer, and forms the basis for a computation of the axial form factor momentum dependence
International Nuclear Information System (INIS)
Lim, Byeung Jun; Kwon, Se Jin; Park, Tae Choon
2014-01-01
Characteristic changes in the stall inception in a single-stage transonic axial compressor with an axial skewed slot casing treatment were investigated experimentally. A rotating stall occurred intermittently in a compressor with an axial skewed slot, whereas spike-type rotating stalls occurred in the case of smooth casing. The axial skewed slot suppressed stall cell growth and increased the operating range. A mild surge, the frequency of which is the Helmholtz frequency of the compressor system, occurred with the rotating stall. The irregularity in the pressure signals at the slot bottom increased decreasing flow rate. An autocorrelation-based stall warning method was applied to the measured pressure signals. Results estimate and warn against the stall margin in a compressor with an axial skewed slot.
DEFF Research Database (Denmark)
Diederichsen, Louise Pyndt; Simonsen, Jane Angel; Diederichsen, Axel Cosmus Pyndt
2015-01-01
inflammatory myopathies (IIM) by means of non-invasive techniques. METHODS: Fourteen patients with IIM (8 polymyositis, 4 dermatomyositis, 2 cancer-associated dermatomyositis) and 14 gender- and age- matched healthy control subjects were investigated. Participant assessments included a cardiac questionnaire...... in 8 (57%) of the patients compared to none of the controls (pgroup (p=0.01). Two patients had systolic dysfunction, and one diastolic dysfunction...
Characterization of Multiflux Axial Compressors
International Nuclear Information System (INIS)
Brasnarof, Daniel; Kyung Kyu-Hyung; Rivarola, Martin; Gonzalez Jose; Florido, Pablo; Orellano, Pablo; Bergallo, Juan
2003-01-01
In the present work the results of analytical models of performance are compared with experimental data acquired in the multi flux axial compressor test facility, built in The Pilcaniyeu Technological Complex for the SIGMA project.We describe the experimental circuit and the data of the dispersion inside the axial compressor obtained using a tracer gas through one of the annular inlets.The attained results can be used to validate the design code for the multi flux axial compressors and SIGMA industrial plant
Toxic myopathy in a dog associated with the presence of monensin in dry food.
Wilson, J S
1980-01-01
This report describes a case of toxic myopathy in a two year old sheltie dog with clinical signs of profound weakness, myoglobinuria, and muscle enzyme elevations. The clinical signs were likely related to the accidental inclusion of monensin sodium in the dog's food. This food was prepared by a small feed milling company that also prepares cattle and chicken rations. A change of dog food resulted in remission of the clinical signs.
Toxic Myopathy in a Dog Associated with the Presence of Monensin in Dry Food
Wilson, J. S.
1980-01-01
This report describes a case of toxic myopathy in a two year old sheltie dog with clinical signs of profound weakness, myoglobinuria, and muscle enzyme elevations. The clinical signs were likely related to the accidental inclusion of monensin sodium in the dog's food. This food was prepared by a small feed milling company that also prepares cattle and chicken rations. A change of dog food resulted in remission of the clinical signs.
Satoh, Minoru; Tanaka, Shin; Ceribelli, Angela; Calise, S. John; Chan, Edward K. L.
2018-01-01
Autoantibodies specific for idiopathic inflammatory myopathy (myositis-specific autoantibodies (MSAs)) are clinically useful biomarkers to help the diagnosis of polymyositis/dermatomyositis (PM/DM). Many of these are also associated with a unique clinical subset of PM/DM, making them useful in predicting and monitoring certain clinical manifestations. Classic MSAs known for over 30 years include antibodies to Jo-1 (histidyl transfer RNA (tRNA) synthetase) and other aminoacyl tRNA synthetases (ARS), anti-Mi-2, and anti-signal recognition particle (SRP). Anti-Jo-1 is the first autoantibodies to ARS detected in 15–25 % of patients. In addition to anti-Jo-1, antibodies to seven other aminoacyl tRNA synthetases (ARS) have been reported with prevalence, usually 1–5 % or lower. Patients with any antiARS antibodies are associated with anti-synthetase syndrome characterized by myositis, interstitial lung disease (ILD), arthritis, Raynaud’s phenomenon, and others. Several recent studies suggested heterogeneity in clinical features among different anti-ARS antibody-positive patients and anti-ARS may also be found in idiopathic ILD without myositis. Anti-Mi-2 is a classic marker for DM and associated with good response to steroid treatment and good prognosis. Anti-SRP is specific for PM and associated with treatment-resistant myopathy histologically characterized as necrotizing myopathy. In addition to classic MSAs, several new autoantibodies with strong clinical significance have been described in DM. Antibodies to transcription intermediary factor 1γ/α (TIF1γ/α, p155/140) are frequently found in DM associated with malignancy while anti-melanoma differentiation-associated gene 5 (MDA5; CADM140) are associated with clinically amyopathic DM (CADM) complicated by rapidly progressive ILD. Also, anti-MJ/nuclear matrix protein 2 (NXP-2) and anti-small ubiquitin-like modifier-1 (SUMO-1) activating enzyme (SAE) are recognized as new DM-specific autoantibodies. Addition of
Understanding mitochondrial myopathies: a review
Directory of Open Access Journals (Sweden)
Abhimanyu S. Ahuja
2018-05-01
Full Text Available Mitochondria are small, energy-producing structures vital to the energy needs of the body. Genetic mutations cause mitochondria to fail to produce the energy needed by cells and organs which can cause severe disease and death. These genetic mutations are likely to be in the mitochondrial DNA (mtDNA, or possibly in the nuclear DNA (nDNA. The goal of this review is to assess the current understanding of mitochondrial diseases. This review focuses on the pathology, causes, risk factors, symptoms, prevalence data, symptomatic treatments, and new research aimed at possible preventions and/or treatments of mitochondrial diseases. Mitochondrial myopathies are mitochondrial diseases that cause prominent muscular symptoms such as muscle weakness and usually present with a multitude of symptoms and can affect virtually all organ systems. There is no cure for these diseases as of today. Treatment is generally supportive and emphasizes symptom management. Mitochondrial diseases occur infrequently and hence research funding levels tend to be low in comparison with more common diseases. On the positive side, quite a few genetic defects responsible for mitochondrial diseases have been identified, which are in turn being used to investigate potential treatments. Speech therapy, physical therapy, and respiratory therapy have been used in mitochondrial diseases with variable results. These therapies are not curative and at best help with maintaining a patient’s current abilities to move and function.
Roef, MJ; Kalhan, SC; Reijngoud, DJ; De Meer, K; Berger, Ruud
This study evaluated lactate disposal via gluconeogenesis as well as effects of FFA availability on gluconeogenesis via pyruvate (GNG(PYR)) in patients with mitochondrial myopathy due to complex I deficiency (CID). The rates of GNG(PYR) were measured in three CID patients and six healthy controls at
Westermann, C.M.; Van Leeuwen, Robbert; Van Raamsdonk, L.W.D.; Mol, H.G.J.
BACKGROUND: Atypical myopathy (AM) in horses is caused by the plant toxin hypoglycin A, which in Europe typically is found in the sycamore maple tree (Acer pseudoplatanus). Owners are concerned about whether their horses are in danger if they graze near maple trees. HYPOTHESIS/OBJECTIVES: To measure
Westermann, C.M.; Leeuwen, van R.; Raamsdonk, van L.W.D.; Mol, H.G.J.
2016-01-01
Background: Atypical myopathy (AM) in horses is caused by the plant toxin hypoglycin A, which in Europe typically is found in the sycamore maple tree (Acer pseudoplatanus). Owners are concerned about whether their horses are in danger if they graze near maple trees. Hypothesis/Objectives: To
Factors related to axial length elongation and myopia progression in orthokeratology practice.
Directory of Open Access Journals (Sweden)
Bingjie Wang
Full Text Available To investigate which baseline factors are predictive for axial length growth over an average period of 2.5 years in a group of children wearing orthokeratology (OK contact lenses.In this retrospective study, the clinical records of 249 new OK wearers between January 2012 and December 2013 from the contact lens clinic at the Eye and ENT Hospital of Fudan University were reviewed. The primary outcome measure was axial length change from baseline to the time of review (July-August 2015. Independent variables included baseline measures of age at initiation of OK wear, gender, refractive error (spherical equivalent, astigmatism, average keratometry, corneal toricity, central corneal thickness, white-to-white corneal diameter, pupil size, corneal topography eccentricity value (e-value, intraocular pressure (IOP and total time in follow-up (months total. The contributions of all independent variables on axial length change at the time of review were assessed using univariate and multivariable regression analyses.Univariate analyses of the right eyes of 249 OK patients showed that smaller increases in axial length were associated with older age at the onset of OK lens wear, greater baseline spherical equivalent myopic refractive error, less time in follow-up and a smaller e-value. Multivariable analyses of the significant right eye variables showed that the factors associated with smaller axial length growth were older age at the onset of OK lens wear (p<0.0001, greater baseline spherical equivalent myopic refractive error (p = 0.0046 and less time in follow-up (p<0.0001.The baseline factors demonstrating the greatest correlation with reduced axial length elongation during OK lens wear in myopic children included greater baseline spherical equivalent myopic refractive error and older age at the onset of OK lens wear.
Bednarz, M.; Stunnenberg, B.C.; Kusters, B.; Kamsteeg, E.J.; Saris, C.G.J.; Groome, J.; Winston, V.; Meola, G.; Jurkat-Rott, K.; Voermans, N.C.
2017-01-01
In sodium channelopathies, a severe fixed myopathy caused by a dominant mutation is rare. We describe two unrelated patients with a novel variant, p.Ile1455Thr, with phenotypes of paramyotonia in one case and fixed proximal myopathy with latent myotonia in another. In-vitro whole cell patch-clamp
Nabben, M.; Schmitz, J.P.J.; Ciapaite, J.; le Clercq, C.M.P.; van Riel, N.A.; Haak, H.R.; Nicolay, K.; de Coo, I.F.M.; Smeets, H.; Praet, S.F.; van Loon, L.J.; Prompers, J.J.
2017-01-01
Muscle weakness and exercise intol erance negatively affect the quality of life of patients with mitochondrial myopathy. Short-term dietary nitrate supplementation has been shown to improve exercise performance and reduce oxygen cost of exercise in healthy humans and trained athletes. We
McKenzie, R K; Hill, F I; Habyarimana, J A; Boemer, F; Votion, D M
2016-05-01
During April and May 2014 four horses aged between 5 months and 9 years, located in the Canterbury, Marlborough and Southland regions, presented with a variety of clinical signs including recumbency, stiffness, lethargy, dehydration, depression, and myoglobinuria suggestive of acute muscle damage. Two horses were subjected to euthanasia and two recovered. In all cases seeds of sycamore maple (Acer pseudoplatanus) or box elder (A. negundo) were present in the area where the horse had been grazing. The samaras (seeds) of some Acer spp. may contain hypoglycin A, that has been associated with cases of atypical myopathy in Europe and North America. To determine if hypoglycin A is present in the samaras of Acer spp. in New Zealand, samples were collected from trees throughout the country that were associated with historical and/or current cases of atypical myopathy, and analysed for hypoglycin A. Serum samples from the four cases and four unaffected horses were analysed for the presence of hypoglycin A, profiles of acylcarnitines (the definitive diagnosis for atypical myopathy) and activities of creatine kinase and aspartate aminotransferase.Markedly elevated serum activities of creatine kinase and aspartate aminotransferase, and increased concentrations of selected acylcarnitines were found in the case horses. Hypoglycin A was detected in the serum of those horses but not in the healthy controls. Hypoglycin A was detected in 10/15 samples of samaras from sycamore maple and box elder from throughout New Zealand. Cases of atypical myopathy were diagnosed on properties where samaras containing hypoglycin A were also found. Sycamore and box elder trees in New Zealand are a source of hypoglycin A associated with the development of atypical myopathy. If pastured horses present with clinical and biochemical signs of severe muscle damage then the environment should be checked for the presence of these trees. Horses should be prevented from grazing samaras from Acer spp. in the
Thapa, S.S.; Paudyal, I.; Khanal, S.; Paudel, N.; van Rens, G.H.M.B.
2011-01-01
Purpose. To compare the anterior chamber depth (ACD) and axial length of eyes in a population-based sample among normal, occludable angle, and primary angle-closure glaucoma (PACG) groups. Methods. Totally, 3979 subjects from a population-based glaucoma prevalence study underwent complete ocular
BAG3 myofibrillar myopathy presenting with cardiomyopathy.
Konersman, Chamindra G; Bordini, Brett J; Scharer, Gunter; Lawlor, Michael W; Zangwill, Steven; Southern, James F; Amos, Louella; Geddes, Gabrielle C; Kliegman, Robert; Collins, Michael P
2015-05-01
Myofibrillar myopathies (MFMs) are a heterogeneous group of neuromuscular disorders distinguished by the pathological hallmark of myofibrillar dissolution. Most patients present in adulthood, but mutations in several genes including BCL2-associated athanogene 3 (BAG3) cause predominantly childhood-onset disease. BAG3-related MFM is particularly severe, featuring weakness, cardiomyopathy, neuropathy, and early lethality. While prior cases reported either neuromuscular weakness or concurrent weakness and cardiomyopathy at onset, we describe the first case in which cardiomyopathy and cardiac transplantation (age eight) preceded neuromuscular weakness by several years (age 12). The phenotype comprised distal weakness and severe sensorimotor neuropathy. Nerve biopsy was primarily axonal with secondary demyelinating/remyelinating changes without "giant axons." Muscle biopsy showed extensive neuropathic changes that made myopathic changes difficult to interpret. Similar to previous cases, a p.Pro209Leu mutation in exon 3 of BAG3 was found. This case underlines the importance of evaluating for MFMs in patients with combined neuromuscular weakness and cardiomyopathy. Copyright © 2015 Elsevier B.V. All rights reserved.
Calderón-Garcidueñas, A L; Pérez-Loria, O; Alberto-Sagástegui, J; Farías-García, R
2000-01-01
Progressive limitation of occular motility, accompanied by ptosis but usually without diplopia, occurs in many pathologic states, including mitochondrial diseases. A case with chronic progressive external ophthalmoplegia with onset during childhood, associated with proximal myopathy and dysphasia is presented. The muscle biopsy showed a myopathic pattern and abnormal subsarcolemmal mitochondrial deposits. Muscle biopsy for important in the correct diagnosis of this entity.
Directory of Open Access Journals (Sweden)
DilipkumarBhanudasji Alone
2016-09-01
Full Text Available This paper presents the experimental results to understand the performance of moderately loaded high speed single stage transonic axial flow compressor subjected to various configurations of axial extensions of bend skewed casing treatment with moderate porosity. The bend skewed casing treatment of 33% porosity was coupled with rectangular plenum chamber of depth equal to the slots depth. The five axial extensions of 20%, 40%, 60%, 80% and 100% were used for the experimental evaluations of compressor performance. The main objective was to identify the optimum extension of the casing treatment with reference to rotor leading edge which results in maximum stall margin improvements with minimum loss in the stage efficiency. At each axial extension the compressor performance is distinctive. The improvement in the stall margin was very significant at some axial extensions with 4%–5% penalty in the stage efficiency. The compressors stage shows recovery in terms of efficiency at lower axial extensions of 20% and 40% with increase in the peak stage efficiency. Measurements of flow parameters showed the typical behaviors at near stall flow conditions. Hot wire sensor was placed at the rotor upstream in the tip region to capture the oscillations in the inlet axial and tangential velocities at stall conditions. In the absence of casing treatment the compressor exhibit abrupt stall with very high oscillations in the inlet axial and tangential velocity of the flow. The extents of oscillations reduce with bend skewed casing treatment. Few measurements were also performed in the plenum chamber and salient results are presented in this paper.
On renormalization of axial anomaly
International Nuclear Information System (INIS)
Efremov, A.V.; Teryaev, O.V.
1989-01-01
It is shown that multiplicative renormalization of the axial singlet current results in renormalization of the axial anomaly in all orders of perturbation theory. It is a necessary condition for the Adler - Bardeen theorem being valid. 10 refs.; 2 figs
High temperature co-axial winding transformers
Divan, Deepakraj M.; Novotny, Donald W.
1993-01-01
The analysis and design of co-axial winding transformers is presented. The design equations are derived and the different design approaches are discussed. One of the most important features of co-axial winding transformers is the fact that the leakage inductance is well controlled and can be made low. This is not the case in conventional winding transformers. In addition, the power density of co-axial winding transformers is higher than conventional ones. Hence, using co-axial winding transformers in a certain converter topology improves the power density of the converter. The design methodology used in meeting the proposed specifications of the co-axial winding transformer specifications are presented and discussed. The final transformer design was constructed in the lab. Co-axial winding transformers proved to be a good choice for high power density and high frequency applications. They have a more predictable performance compared with conventional transformers. In addition, the leakage inductance of the transformer can be controlled easily to suit a specific application. For space applications, one major concern is the extraction of heat from power apparatus to prevent excessive heating and hence damaging of these units. Because of the vacuum environment, the only way to extract heat is by using a cold plate. One advantage of co-axial winding transformers is that the surface area available to extract heat from is very large compared to conventional transformers. This stems from the unique structure of the co-axial transformer where the whole core surface area is exposed and can be utilized for cooling effectively. This is a crucial issue here since most of the losses are core losses.
Directory of Open Access Journals (Sweden)
Yasuyuki Nishi
2016-01-01
Full Text Available We proposed a portable and ultra-small axial flow hydraulic turbine that can generate electric power comparatively easily using the low head of open channels such as existing pipe conduits or small rivers. In addition, we proposed a simple design method for axial flow runners in combination with the conventional one-dimensional design method and the design method of axial flow velocity uniformization, with the support of three-dimensional flow analysis. Applying our design method to the runner of an ultra-small axial flow hydraulic turbine, the performance and internal flow of the designed runner were investigated using CFD analysis and experiment (performance test and PIV measurement. As a result, the runners designed with our design method were significantly improved in turbine efficiency compared to the original runner. Specifically, in the experiment, a new design of the runner achieved a turbine efficiency of 0.768. This reason was that the axial component of absolute velocity of the new design of the runner was relatively uniform at the runner outlet in comparison with that of the original runner, and as a result, the negative rotational flow was improved. Thus, the validity of our design method has been verified.
DEFF Research Database (Denmark)
Frederiksen, A.L.; Jeppesen, T.D.; Vissing, J.
2009-01-01
controls were subjected to an oral glucose tolerance test. Twenty-six adult 3243A>G carriers with unknown myopathy status and 17 healthy controls had a maximal cycle test and a muscle biopsy performed. The mutation loads were quantified in blood and muscle biopsies and correlated to the clinical......INTRODUCTION: The point mutation of 3243A>G mtDNA is the most frequent cause of mitochondrial diabetes, often presenting as the syndrome maternally inherited diabetes and deafness (MIDD). The mutation may also cause myopathy, ataxia, strokes, ophthalmoplegia, epilepsy, and cardiomyopathy in various...... combinations. Consequently, it is difficult to predict the "phenotypic risk profile" of 3243A>G mutation-positive subjects. The 3243A>G mutation coexists in cells with wild-type mtDNA, a phenomenon called heteroplasmy. The marked variability in mutation loads in different tissues is the main explanation...
Origin of axial current in scyllac
International Nuclear Information System (INIS)
Sugisaki, K.
1975-12-01
The origin of the axial current observed in Scyllac (a high beta stellarator experiment) is discussed. A shaped coil and/or helical winding produce rotational transform which links magnetic lines of force to the plasma column and the axial current is induced electromagnetically. This phenomenon is inherent in a pulsed high-beta stellarator. The rotational transform produced by the induced axial current is much smaller than that associated with the l = 1, 0 equilibrium fields. The effect of the axial current on the equilibrium and stability of the plasma column is thus small. It is also shown that the magnetic field shear near a plasma surface is very strong
DEFF Research Database (Denmark)
Klein, H H; Müller, R; Vestergaard, H
1999-01-01
We studied insulin receptor kinase activation in two brothers with congenital muscle fibre type disproportion myopathy and compound heterozygous mutations of the insulin receptor gene, their parents, and their unaffected brother. In the father who has a heterozygote Arg1174-->Gln mutation, in sit...
Zolotov, Sagit; Xing, Chao; Mahamid, Riad; Shalata, Adel; Sheikh-Ahmad, Mohammed; Garg, Abhimanyu
2017-01-01
Despite considerable progress in identifying causal genes for lipodystrophy syndromes, the molecular basis of some peculiar adipose tissue disorders remains obscure. In an Israeli-Arab pedigree with a novel autosomal recessive, multiple symmetric lipomatosis (MSL), partial lipodystrophy and myopathy, we conducted exome sequencing of two affected siblings to identify the disease-causing mutation. The 41-year-old female proband and her 36-year-old brother reported marked accumulation of subcutaneous fat in the face, neck, axillae, and trunk but loss of subcutaneous fat from the lower extremities and progressive distal symmetric myopathy during adulthood. They had increased serum creatine kinase levels, hypertriglyceridemia and low levels of high-density lipoprotein cholesterol. Exome sequencing identified a novel homozygous NC_000019.9:g.42906092C>A variant on chromosome 19, leading to a NM_005357.3:c.3103G>T nucleotide change in coding DNA and corresponding p.(Glu1035*) protein change in hormone sensitive lipase (LIPE) gene as the disease-causing variant. Sanger sequencing further confirmed the segregation of the mutation in the family. Hormone sensitive lipase is the predominant regulator of lipolysis from adipocytes, releasing free fatty acids from stored triglycerides. The homozygous null LIPE mutation could result in marked inhibition of lipolysis from some adipose tissue depots and thus may induce an extremely rare phenotype of MSL and partial lipodystrophy in adulthood associated with complications of insulin resistance, such as diabetes, hypertriglyceridemia and hepatic steatosis. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Ziegler, Alexander; Faber, Cornelius; Bartolomaeus, Thomas
2009-06-09
The axial complex of echinoderms (Echinodermata) is composed of various primary and secondary body cavities that interact with each other. In sea urchins (Echinoidea), structural differences of the axial complex in "regular" and irregular species have been observed, but the reasons underlying these differences are not fully understood. In addition, a better knowledge of axial complex diversity could not only be useful for phylogenetic inferences, but improve also an understanding of the function of this enigmatic structure. We therefore analyzed numerous species of almost all sea urchin orders by magnetic resonance imaging, dissection, histology, and transmission electron microscopy and compared the results with findings from published studies spanning almost two centuries. These combined analyses demonstrate that the axial complex is present in all sea urchin orders and has remained structurally conserved for a long time, at least in the "regular" species. Within the Irregularia, a considerable morphological variation of the axial complex can be observed with gradual changes in topography, size, and internal architecture. These modifications are related to the growing size of the gastric caecum as well as to the rearrangement of the morphology of the digestive tract as a whole. The structurally most divergent axial complex can be observed in the highly derived Atelostomata in which the reorganization of the digestive tract is most pronounced. Our findings demonstrate a structural interdependence of various internal organs, including digestive tract, mesenteries, and the axial complex.
Vector and axial constants of the baryon decuplet
International Nuclear Information System (INIS)
Belyaev, V.M.; Blok, B.Y.; Kogan, Y.I.
1985-01-01
On the basis of the QCD sum rules for the polarization operator in external axial and vector fields we determine the vector and axial transition constants in the 3/2 + baryon decuplet. We show that the renormalization of the axial constant is due to the interaction of the external axial field with the quark condensate
Axial gap rotating electrical machine
None
2016-02-23
Direct drive rotating electrical machines with axial air gaps are disclosed. In these machines, a rotor ring and stator ring define an axial air gap between them. Sets of gap-maintaining rolling supports bear between the rotor ring and the stator ring at their peripheries to maintain the axial air gap. Also disclosed are wind turbines using these generators, and structures and methods for mounting direct drive rotating electrical generators to the hubs of wind turbines. In particular, the rotor ring of the generator may be carried directly by the hub of a wind turbine to rotate relative to a shaft without being mounted directly to the shaft.
Study of axial magnetic effect
Energy Technology Data Exchange (ETDEWEB)
Braguta, Victor [IHEP, Protvino, Moscow region, 142284 Russia ITEP, B. Cheremushkinskaya street 25, Moscow, 117218 (Russian Federation); School of Biomedicine, Far Eastern Federal University, Ajax 10 Building 25, Russian island, Vladivostok, 690922 (Russian Federation); Chernodub, M. N. [CNRS, Laboratoire de Mathématiques et Physique Théorique, Université François-Rabelais Tours, Fédération Denis Poisson, Parc de Grandmont, 37200 Tours, France Department of Physics and Astronomy, University of Gent, Krijgslaan 281, S9, B-9000 Gent (Belgium); School of Biomedicine, Far Eastern Federal University, Ajax 10 Building 25, Russian island, Vladivostok, 690922 (Russian Federation); Goy, V. A. [School of Natural Sciences, Far Eastern Federal University, Sukhanova street 8, Vladivostok, 690950 (Russian Federation); Landsteiner, K. [Instituto de Física Teórica UAM/CSIC, C/ Nicolás Cabrera 13-15, Universidad Autónoma de Madrid, Cantoblanco, 28049 Madrid (Spain); Molochkov, A. V. [School of Biomedicine, Far Eastern Federal University, Ajax 10 Building 25, Russian island, Vladivostok, 690922 (Russian Federation); Ulybyshev, M. [ITEP, B. Cheremushkinskaya street 25, Moscow, 117218 Russia Institute for Theoretical Problems of Microphysics, Moscow State University, Moscow, 119899 (Russian Federation)
2016-01-22
The Axial Magnetic Effect manifests itself as an equilibrium energy flow of massless fermions induced by the axial (chiral) magnetic field. Here we study the Axial Magnetic Effect in the quenched SU(2) lattice gauge theory with massless overlap fermions at finite temperature. We numerically observe that in the low-temperature hadron phase the effect is absent due to the quark confinement. In the high-temperature deconfinement phase the energy flow is an increasing function of the temperature which reaches the predicted asymptotic T{sup 2} behavior at high temperatures. We find, however, that energy flow is about one order of magnitude lower compared to a theoretical prediction.
Diagnostic criteria for idiopathic inflammatory myopathies. Problems of their optimization
Directory of Open Access Journals (Sweden)
O. A. Antelava
2014-01-01
Full Text Available The paper deals with the problems of optimizing the diagnostic criteria for idiopathic inflammatory myopathies (IIM, a group of heterogeneous rare autoimmune diseases characterized by inflammatory lesion in the skeletal muscles. The representatives of this group are traditionally considered to be polymyositis (PM, dermatomyositis (DM, and inclusion-body myositis. The authors detail the history of classification criteria for IIM from those proposed by T.A. Medsger et al. (1970 relying on its clinical picture, laboratory data and instrumental findings, as well as the criteria (including the first introduced exclusion ones elaborated by A. Bohan and J.B. Peter in 1975, which remain fundamental in both clinical practice and researches. The basis for the clinical and serological criteria proposed by Y. Troyanov et al. (2005 for IIM is the identification of myositis-overlap syndromes. The classificational (subtype identification and therapeutic value of the criteria based on clinical and serological characteristics was supported by the Hungarian investigators A. Vancsa et al. (2010 who investigated the relationship between the clinical and therapeutic characteristics of IIM and positivity for myositis-specific and myositis-associated antibodies. The criteria developed by M.C. Dalakas (1991, 2003 are based on the specific immunopathological features of a histological pattern, which allow the differentiation of DM, PM, and inclusion-body myositis from other myopathic syndromes. The 2004 European Neuromuscular Center (ENMC criteria first identify necrotizing autoimmune myopathy and nonspecific myositis as individual subtypes. The serological classification of IIM, which is based onthe assessment of autoantibodies that play an important role in the pathogenesis of the disease, is of indubitable interest. There is an obvious need for the correct and timely diagnosis of both IIM as a whole and its subtypes in particular, which is complicated by
Electric machines with axial magnetic flux
Nuca, I.; Ambros, T.; Burduniuc, M.; Deaconu, S. I.; Turcanu, A.
2018-01-01
The paper contains information on the performance of axial machines compared to cylindrical ones. At the same time, various constructive schemes of synchronous electromechanical converters with permanent magnets and asynchronous with short-circuited rotor are presented. In the developed constructions, the aim is to maximize the usage of the material of the stator windings. The design elements of the axial machine magnetic system are presented. The FEMM application depicted the array of the magnetic field of an axial machine.
Energy Technology Data Exchange (ETDEWEB)
Lee, Ryan K.L.; Griffith, James F.; Ng, Alex W.H.; Law, Eric K.C. [The Chinese University of Hong Kong, Department of Imaging and Interventional Radiology, Prince Of Wales Hospital, Hong Kong (China); Tse, W.L.; Wong, Clara W.Y.; Ho, P.C. [The Chinese University of Hong Kong, Department of Orthopedics and Traumatology, Prince Of Wales Hospital, Hong Kong (China)
2017-03-15
To compare axial and oblique axial planes on MR arthrography (MRA) and multidetector CT arthrography (CTA) to evaluate dorsal and volar parts of scapholunate (SLIL) and lunotriquetral interosseous (LTIL) ligaments. Nine cadaveric wrists of five male subjects were studied. The visibility of dorsal and volar parts of the SLIL and LTIL was graded semi-quantitatively (good, intermediate, poor) on MRA and CTA. The presence of a ligament tear was determined on arthrosocopy and sensitivity, specificity and accuracy of tear detection were calculated. Oblique axial imaging was particularly useful for delineating dorsal and volar parts of the LTIL on MRA with overall 'good' visibility increased from 11 % to 78 %. The accuracy of MRA and CTA in revealing SLIL and LTIL tear was higher using the oblique axial plane. The overall accuracy for detecting SLIL tear on CTA improved from 94 % to 100 % and from 89 % to 94 % on MRA; the overall accuracy of detecting LTIL tear on CTA improved from 89 % to 100 % and from 72 % to 89 % on MRA Oblique axial imaging during CT and MR arthrography improves detection of tears in the dorsal and volar parts of both SLIL and LTIL. (orig.)
Feinstein-Linial, Miora; Buvoli, Massimo; Buvoli, Ada; Sadeh, Menachem; Dabby, Ron; Straussberg, Rachel; Shelef, Ilan; Dayan, Daniel; Leinwand, Leslie Anne; Birk, Ohad S
2016-08-12
Human skeletal muscles express three major myosin heavy chain (MyHC) isoforms: MyHCIIx (MYH1) in fast type 2B muscle fibers, MyHCIIa (MYH2) in fast type 2A fibers and MyHCI/β-cardiac MyHC (MYH7) in slow type I skeletal fibers and cardiac ventricles. In line with its expression pattern, MYH7 mutations have been reported in association with hypertrophic or dilated cardiomyopathy, skeletal myopathies or a combination of both. We analyzed the clinical and molecular phenotype of two unrelated families of Jewish Moroccan ancestry that presented with apparently autosomal dominant inheritance of progressive Laing-like distal myopathy with non-specific myopathic changes, but uncommon marked contractures and wasting of the neck extensors. Clinical phenotyping, whole exome sequencing and restriction analysis, generation of mutants followed by cell culture transfection and imaging. Using whole exome sequencing we identified in both families two novel heterozygous proline substitutions located in exon 31 of MYH7 within its rod domain: c.4309G>C (p.Ala1437Pro) and c.4301G>C (p.Arg1434Pro). Here we show that the phenotype caused by these mutations includes marked cervical muscle contracture, and report that the severity of the phenotype varies significantly, to the extent of non-penetrance in one of the families. Finally, we provide evidence that both proline substitutions impair myosin self-assembly in non-muscle cells transfected with β-myosin constructs carrying the mutations, but do not prevent incorporation of the mutant molecules into the sarcomere. This study expands our clinical and molecular knowledge of MYH7 rod mutations causing skeletal myopathies, and underscores the importance of discussing disease penetrance during genetic counseling.
Radial and axial compression of pure electron
International Nuclear Information System (INIS)
Park, Y.; Soga, Y.; Mihara, Y.; Takeda, M.; Kamada, K.
2013-01-01
Experimental studies are carried out on compression of the density distribution of a pure electron plasma confined in a Malmberg-Penning Trap in Kanazawa University. More than six times increase of the on-axis density is observed under application of an external rotating electric field that couples to low-order Trivelpiece-Gould modes. Axial compression of the density distribution with the axial length of a factor of two is achieved by controlling the confining potential at both ends of the plasma. Substantial increase of the axial kinetic energy is observed during the axial compression. (author)
View of the Axial Field Spectrometer
1980-01-01
The Axial Field Spectrometer, with the vertical uranium/scintillator calorimeter and the central drift chamber retracted for service. One coil of the Open Axial Field Magnet is just visible to the right.
DEFF Research Database (Denmark)
Vestergaard, H; Klein, H H; Hansen, T
1995-01-01
Congenital muscle fiber type disproportion myopathy (CFTDM) is a chronic, nonprogressive muscle disorder characterized by universal muscle hypotrophy and growth retardation. Histomorphometric examination of muscle shows a preponderance of smaller than normal type 1 fibers and overall fiber size....... Insulin receptor function and glycogen synthase (GS) activity and expression were examined in biopsies of vastus lateralis muscle. Despite a 45-90-fold increase in both fasting and postprandial serum insulin levels, both CFTDM patients had diabetes mellitus. Clamp studies revealed that the oldest boy had...
Smith, M. C.; Perfit, M. R.; Davis, C.; Kamenov, G. D.
2011-12-01
Three spatially related volcanic eruptions along the CoAxial Segment of the Juan de Fuca Ridge (JdFR) have documented emplacements between 1981 and 1993. Two of the historic flows outcrop at the "Flow Site" and were emplaced within less than 12 years and 500 m from one another. The third was emplaced at the "Floc Site" to the south in the 1980s. Previous studies have documented that CoAxial lavas are among the most incompatible element and isotopically depleted lavas along the entire JdFR, whereas the Axial Seamount segment immediately south of CoAxial has erupted the most chemically enriched lavas south of the Endeavor Segment. Geochemical studies have shown little temporal change in the chemistry of recent Axial Seamount eruptives, whereas CoAxial lavas exhibit distinct chemical differences over short time periods. Significant chemical differences observed among depleted CoAxial lavas emplaced close to one another in space and time are in marked contrast to the relatively constant chemical characteristics of enriched lavas erupted at the magmatically more robust Axial segment only 10's of kilometers to the south and west. New trace element and isotopic (Sr, Nd, Pb) geochemical analyses of historic and older CoAxial lavas have resulted in better documentation of interflow and intraflow chemical variation providing an improved understanding of spatial/temporal chemical variability in lavas, and further insight into JdFR magmatic processes. Modeling of major and trace element abundances suggest that the observed intraflow chemical variation within CoAxial lavas is largely due to shallow-level fractional crystallization but that a single fractional crystallization model cannot account for all interflow chemical variation. In fact, elemental and isotopic data require different parental magmas for each of the three recent CoAxial Segment lava flows suggesting very short-term differences or changes in the chemical character of the mantle source region. In particular
Directory of Open Access Journals (Sweden)
Hina N. Khan
2016-02-01
Full Text Available Polymyositis is a rare disease with incidence rates at about 1 per 100,000 people annually. In this case report we will review a case of proximal muscle weakness with an elevated creatine phosphokinase that was initially misdiagnosed twice as rhabdomyolysis. Therefore, emphasizing that idiopathic inflammatory myopathy is a potential cause of myasthenia that must be considered in the differential. The case will also describe the current treatment and treatment response in polymyositis.
Huber, AM; Feldman, BM; Rennebohm, RM; Hicks, JE; Lindsley, CB; Perez, MD; Zemel, LS; Wallace, CA; Ballinger, SH; Passo, MH; Reed, AM; Summers, RM; Katona, IM; Miller, FW; Lachenbruch, PA; Rider, LG; White, P.H.
Objective. To examine the measurement characteristics of the Childhood Myositis Assessment Scale (CMAS) in children with juvenile idiopathic inflammatory myopathy (juvenile IIM), and to obtain preliminary data on the clinical significance of CMAS scores. Methods. One hundred eight children with
Rocchiccioli, F.; Wanders, R. J.; Aubourg, P.; Vianey-Liaud, C.; IJlst, L.; Fabre, M.; Cartier, N.; Bougneres, P. F.
1990-01-01
A child presented in early childhood with episodes of coma and hypoglycemia and a rapidly evolutive myopathy and cardiomyopathy leading to death at 9 mo of age. Ketosis was decreased (blood beta-hydroxybutyrate: 0.07 mmol/L) despite normal plasma levels of fatty acids (0.81 mmol/L). The patient's
Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy
Directory of Open Access Journals (Sweden)
Muhammad I. Ullah
2017-12-01
Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.
Nascif, Ana K S; Terreri, Maria T R A; Len, Cláudio A; Andrade, Luis E C; Hilário, Maria O E
2006-01-01
Nailfold capillaroscopy is an important tool for the diagnosis and follow-up of patients with rheumatic diseases, in particular dermatomyositis and scleroderma. A relationship has been observed in adults between improved capillaroscopic findings and reduced disease activity. Our aim was to correlate disease activity (clinical and laboratory data) and nailfold capillaroscopy findings in 18 patients with inflammatory myopathies. This prospective study included 13 juvenile dermatomyositis patients (Bohan and Peter criteria) (mean age of 8.8 years) and five patients with overlap syndrome (mean age of 15.7 years). We evaluated disease activity (skin abnormalities and muscle weakness, muscle enzymes and acute phase reactants) and its correlation with nailfold capillaroscopy findings (dilatation of isolated loops, dropout of surrounding vessels and giant capillary loops). We used a microscope with special light and magnification of 10 to 16X. Eighteen patients underwent a total of 26 capillaroscopic examinations, seven of them on two or more occasions (13 were performed during the active disease phase and 13 during remission). Twelve of the 13 examinations performed during the active phase exhibited scleroderma pattern and 8 of the 13 examinations performed during remission were normal. Therefore, in 20 of the 26 examinations clinical and laboratory data and nailfold capillaroscopy findings correlated (p = 0.01). Nailfold capillaroscopy is a non-invasive examination that offers satisfactory correlation with disease activity and could be a useful tool for the diagnosis and follow-up of inflammatory myopathies.
Kamm, M A; Hoyle, C H; Burleigh, D E; Law, P J; Swash, M; Martin, J E; Nicholls, R J; Northover, J M
1991-03-01
A newly identified myopathy of the internal anal sphincter is described. In the affected family, at least one member from each of five generations had severe proctalgia fugax; onset was usually in the third to fifth decades of life. Three members of the family have been studied in detail. Each had severe pain intermittently during the day and hourly during the night. Constipation was an associated symptom, in particular difficulty with rectal evacuation. Clinically the internal anal sphincter was thickened and of decreased compliance. The maximum anal canal pressure was usually increased with marked ultraslow wave activity. Anal endosonography confirmed a grossly thickened internal anal sphincter. Two patients were treated by internal anal sphincter strip myectomy; one showed marked improvement and one was relieved of the constipation but had only slight improvement of the pain. The hypertrophied muscle in two of the patients showed unique myopathic changes, consisting of vacuolar changes with periodic acid-Schiff-positive polyglycosan bodies in the smooth muscle fibers and increased endomysial fibrosis. In vitro organ-bath studies showed insensitivity of the muscle to noradrenaline, isoprenaline, carbachol, dimethylpiperazinium, and electrical-field stimulation. Immunohistochemical studies for substance P, calcitonin gene-related peptide, galanin, neuropeptide Y, and vasoactive intestinal peptide showed staining in a similar distribution to that in control tissue. A specific autosomal-dominant inherited myopathy of the internal anal sphincter that causes anal pain and constipation has been identified and characterized.
Santa, Kristin M
2010-11-01
Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) syndrome is a rare neurodegenerative disease caused by the decreased ability of cells to produce sufficient energy in the form of adenosine 5'-triphosphate. Although it is one of the most common maternally inherited mitochondrial disorders, its exact incidence is unknown. Caused most frequently by an A-to-G point mutation at the 3243 position in the mitochondrial DNA, MELAS syndrome has a broad range of clinical manifestations and a highly variable course. The classic neurologic characteristics include encephalopathy, seizures, and stroke-like episodes. In addition to its neurologic manifestations, MELAS syndrome exhibits multisystem effects including cardiac conduction defects, diabetes mellitus, short stature, myopathy, and gastrointestinal disturbances. Unfortunately, no consensus guidelines outlining standard drug regimens exist for this syndrome. Many of the accepted therapies used in treating MELAS syndrome have been identified through a small number of clinical trials or isolated case reports. Currently, the drugs most often used include antioxidants and various vitamins aimed at minimizing the demands on the mitochondria and supporting and maximizing their function. Some of the most frequently prescribed agents include coenzyme Q(10), l-arginine, B vitamins, and levocarnitine. Although articles describing MELAS syndrome are available, few specifically target education for clinical pharmacists. This article will provide pharmacists with a practical resource to enhance their understanding of MELAS syndrome in order to provide safe and effective pharmaceutical care.
Directory of Open Access Journals (Sweden)
Benech Philippe
2009-08-01
Full Text Available Abstract Background Several cases of myopathies have been observed in the horse Norman Cob breed. Muscle histology examinations revealed that some families suffer from a polysaccharide storage myopathy (PSSM. It is assumed that a gene expression signature related to PSSM should be observed at the transcriptional level because the glycogen storage disease could also be linked to other dysfunctions in gene regulation. Thus, the functional genomic approach could be conducted in order to provide new knowledge about the metabolic disorders related to PSSM. We propose exploring the PSSM muscle fiber metabolic disorders by measuring gene expression in relationship with the histological phenotype. Results Genotypying analysis of GYS1 mutation revealed 2 homozygous (AA and 5 heterozygous (GA PSSM horses. In the PSSM muscles, histological data revealed PAS positive amylase resistant abnormal polysaccharides, inflammation, necrosis, and lipomatosis and active regeneration of fibers. Ultrastructural evaluation revealed a decrease of mitochondrial number and structural disorders. Extensive accumulation of an abnormal polysaccharide displaced and partially replaced mitochondria and myofibrils. The severity of the disease was higher in the two homozygous PSSM horses. Gene expression analysis revealed 129 genes significantly modulated (p Conclusion The main disorders observed in PSSM muscles could be related to mitochondrial dysfunctions, glycogenesis inhibition and the chronic hypoxia of the PSSM muscles.
[Hot spot mutation screening of RYR1 gene in diagnosis of congenital myopathies].
Chang, Xing-zhi; Jin, Yi-wen; Wang, Jing-min; Yuan, Yun; Xiong, Hui; Wang, Shuang; Qin, Jiong
2014-10-18
To detect hot spot mutation of RYR1 gene in 15 cases of congenital myopathy with different subtypes, and to discuss the value of RYR1 gene hot spot mutation detection in the diagnosis of the disease. Clinical data were collected in all the patients, including clinical manifestations and signs, serum creatine kinase, electromyography. Fourteen of the patients accepted the muscle biopsy. Hot spot mutation in the C-terminal of RYR1 gene (extron 96-106) had been detected in all the 15 patients. All the patients presented with motor development delay, and they could walk at the age of 1 to 3.5 years,but were always easy to fall and could not run or jump. There were no progressive deteriorations. Physical examination showed different degrees of muscle weakness and hypotonia.High arched palates were noted in 3 patients. The serum levels of creatine kinase were mildly elevated in 3 cases, and normal in 12 cases. Electromyography showed "myogenic" features in 11 patients, being normal in the other 4 patients. Muscle biopsy pathologic diagnosis was the central core disease in 3 patients, the central nuclei in 2 patients, the congenital fiber type disproportion in 2 patients, the nameline myopathy in 3 patient, the multiminicore disease in 1 patient, and nonspecific minimal changes in the other 3 patients; one patient was diagnosed with central core disease according to positive family history and gene mutation. In the family case (Patient 2) of central core disease, the c.14678G>A (p.Arg4893Gln) mutation in 102 extron of RYR1 was identified in three members of the family, which had been reported to be a pathogenic mutation. The c.14596A>G(p.Lys4866Gln) mutation in 101 extron was found in one patient with central core disease(Patient 1), and the c.14719G>A(p.Gly4907Ser) mutation in 102 extron was found in another case of the central core disease(Patient 3).The same novel mutation was verified in one of the patients' (Patient 3) asymptomatic father. Congenital myopathies in
Directory of Open Access Journals (Sweden)
Jennifer Settergren
Full Text Available To investigate the extent to which clinicians avoid well-established drug-drug interactions that cause statin-induced myopathy. We hypothesised that clinicians would avoid combining erythromycin or verapamil/diltiazem respectively with atorvastatin or simvastatin. In patients with statin-fibrate combination therapy, we hypothesised that gemfibrozil was avoided to the preference of bezafibrate or fenofibrate. When combined with verapamil/diltiazem or fibrates, we hypothesized that the dispensed doses of atorvastatin/simvastatin would be decreased.Cross-sectional analysis of nationwide dispensing data. Odds ratios of interacting erythromycin, verapamil/diltiazem versus respective prevalence of comparator drugs doxycycline, amlodipine/felodipine in patients co-dispensed interacting statins simvastatin/atorvastatin versus patients unexposed (pravastatin/fluvastatin/rosuvastatin was calculated. For fibrates, OR of gemfibrozil versus fenofibrate/bezafibrate in patients co-dispensed any statin was assessed.OR of interacting erythromycin versus comparator doxycycline did not differ between patients on interacting and comparator statins either in patients dispensed high or low statin doses (adjusted OR 0.87; 95% CI 0.60-1.25 and 0.92; 95% CI 0.69-1.23. Interacting statins were less common among patients dispensed verapamil/diltiazem as compared to patients on amlodipine/felodipine (OR high dose 0.62; CI 0.56-0.68 and low dose 0.63; CI 0.58-0.68. Patients on any statin were to a lesser extent dispensed gemfibrozil compared to patients not dispensed a statin (OR high dose 0.65; CI 0.55-0.76 and low dose 0.70; CI 0.63-0.78. Mean DDD (SD for any statin was substantially higher in patients co-dispensed gemfibrozil 178 (149 compared to patients on statin monotherapy 127 (93, (p<0.001.Prescribers may to some extent avoid co-prescription of statins with calcium blockers and fibrates with an increased risk of myopathy. We found no evidence for avoiding co
Axial power monitoring uncertainty in the Savannah River Reactors
International Nuclear Information System (INIS)
Losey, D.C.; Revolinski, S.M.
1990-01-01
The results of this analysis quantified the uncertainty associated with monitoring the Axial Power Shape (APS) in the Savannah River Reactors. Thermocouples at each assembly flow exit map the radial power distribution and are the primary means of monitoring power in these reactors. The remaining uncertainty in power monitoring is associated with the relative axial power distribution. The APS is monitored by seven sensors that respond to power on each of nine vertical Axial Power Monitor (APM) rods. Computation of the APS uncertainty, for the reactor power limits analysis, started with a large database of APM rod measurements spanning several years of reactor operation. A computer algorithm was used to randomly select a sample of APSs which were input to a code. This code modeled the thermal-hydraulic performance of a single fuel assembly during a design basis Loss-of Coolant Accident. The assembly power limit at Onset of Significant Voiding was computed for each APS. The output was a distribution of expected assembly power limits that was adjusted to account for the biases caused by instrumentation error and by measuring 7 points rather than a continuous APS. Statistical analysis of the final assembly power limit distribution showed that reducing reactor power by approximately 3% was sufficient to account for APS variation. This data confirmed expectations that the assembly exit thermocouples provide all information needed for monitoring core power. The computational analysis results also quantified the contribution to power limits of the various uncertainties such as instrumentation error
Features of the nervous system lesion in primary hypothyroidism (literature review
Directory of Open Access Journals (Sweden)
I.I. Bilous
2018-03-01
Full Text Available The review presents the pathogenetic mechanisms of central and peripheral nervous system pathology in primary hypothyroidism. Lack of thyroid hormones leads to changes in the organization of the central nervous system, decrease in the energy supply of neurons, changes in the synthesis of some specific proteins of the nervous system that cause the development of cretinism in children. The role of hypothyroidism in the development of cognitive impairment in adults, such as decreased cognitive function, memory and attention, has been proved. The impairment of logical thinking is found already in patients with subclinical hypothyroidism. Disorders in mediation exchange lead to the development of depression. Neuromuscular disorders (hypothyroid myopathy and myotonic phenomenon and affection to the peripheral nerves are best studied in hypothyroidism. Primary hypothyroidism may be masked by tunnel neuropathy, polyneuropathy and atactic syndrome. Despite the existing papers on the problem of hypothyroidism and its neurological complications, some issues of pathogenesis, diagnosis, course and treatment of neurological pathology in primary hypothyroidism require further research.
Axial vector mass spectrum and mixing angles
International Nuclear Information System (INIS)
Caffarelli, R.V.; Kang, K.
1976-01-01
Spectral sum rules of the axial-vector current and axial-vector current-pseudoscalar field are used to study the axial-vector mass spectrum and mixing angles, as well as the decay constants and mixing angles of the pseudoscalar mesons. In general, the result is quite persuasive for the existence of the Jsup(PC) = 1 ++ multiplet in which one has a canonical D-E mixing. (Auth.)
Axial flow heat exchanger devices and methods for heat transfer using axial flow devices
Koplow, Jeffrey P.
2016-02-16
Systems and methods described herein are directed to rotary heat exchangers configured to transfer heat to a heat transfer medium flowing in substantially axial direction within the heat exchangers. Exemplary heat exchangers include a heat conducting structure which is configured to be in thermal contact with a thermal load or a thermal sink, and a heat transfer structure rotatably coupled to the heat conducting structure to form a gap region between the heat conducting structure and the heat transfer structure, the heat transfer structure being configured to rotate during operation of the device. In example devices heat may be transferred across the gap region from a heated axial flow of the heat transfer medium to a cool stationary heat conducting structure, or from a heated stationary conducting structure to a cool axial flow of the heat transfer medium.
Inverse axial mounting stiffness design for lithographic projection lenses.
Wen-quan, Yuan; Hong-bo, Shang; Wei, Zhang
2014-09-01
In order to balance axial mounting stiffness of lithographic projection lenses and the image quality under dynamic working conditions, an easy inverse axial mounting stiffness design method is developed in this article. Imaging quality deterioration at the wafer under different axial vibration levels is analyzed. The desired image quality can be determined according to practical requirements, and axial vibrational tolerance of each lens is solved with the damped least-squares method. Based on adaptive interval adjustment, a binary search algorithm, and the finite element method, the axial mounting stiffness of each lens can be traveled in a large interval, and converges to a moderate numerical solution which makes the axial vibrational amplitude of the lens converge to its axial vibrational tolerance. Model simulation is carried out to validate the effectiveness of the method.
A case of congenital myopathy masquerading as paroxysmal dyskinesia
Directory of Open Access Journals (Sweden)
Harsh Patel
2014-01-01
Full Text Available Gastroesophageal reflux (GER disease is a significant comorbidity of neuromuscular disorders. It may present as paroxysmal dyskinesia, an entity known as Sandifer syndrome. A 6-week-old neonate presented with very frequent paroxysms of generalized stiffening and opisthotonic posture since day 22 of life. These were initially diagnosed as seizures and he was started on multiple antiepileptics which did not show any response. After a normal video electroencephalogram (VEEG was documented, possibility of dyskinesia was kept. However, when he did not respond to symptomatic therapy, Sandifer syndrome was thought of and GER scan was done, which revealed severe GER. After his symptoms got reduced to some extent, a detailed clinical examination revealed abnormal facies with flaccid quadriparesis. Muscle biopsy confirmed the diagnosis of a specific congenital myopathy. On antireflux measures, those episodic paroxysms reduced to some extent. Partial response to therapy in GER should prompt search for an underlying secondary etiology.
Supratentorial primary intra-axial tumors in children. MR and CT evaluation
International Nuclear Information System (INIS)
Higano, S.; Takahashi, S.; Kurihara, N.; Singh, L.N.; Yamada, S.; Ishii, K.; Matsumoto, K.; Shirane, R.; Katakura, R.
1997-01-01
Purpose: To evaluate the MR and CT features of pediatric supratentorial intra-axial tumors with respect to different diagnosis and the role of each investigation modality. Material and Methods: MR and CT findings in 40 children with 12 types of pathologically proven histological tumors were reviewed. Results: The location of tumors might be one clue to differential diagnosis. In our material, cysts (60%), calcifications (45%), and intratumoral hemorrhages (27%) were found in the tumors. Characteristic features noted in some lesions included: peritumoral hemosiderin deposition in cavernous angiomas; intratumoral flow void in a choroid plexus carcinoma and in glioblastomas; and hemicerebral atrophy in germinomas. A comparison between malignant and benign tumors showed perifocal edema and a mass effect to be signifcantly more common in malignant lesions. Homogeneous enhancement suggested a benign tumor and an inhomogeneous pattern represented malignancy, while the lack of obvious enhancement did not always suggest benignity. Intratumoral calcium deposition was a not uncommon finding in malignant tumors. Conclusion: In most cases, the exact diagnosis should be made hy histological examination but it is important for treatment planning that the appropriate depiction of tumor extension and tissue characterization be made by MR and CT. (orig.)
DEFF Research Database (Denmark)
Citirak, Gülsenay; Witting, Nanna; Duno, Morten
2014-01-01
, two related female patients and two sporadic, male patients were found to carry mutations in the tropomyosin 2 (TPM2) and tropomyosin 3 (TPM3) genes, respectively. This indicates a low (4.3%) frequency of TPM2 and TPM3 mutations as a cause of congenital myopathy. Compared to previously described...... patients carrying the same mutations as found in our study (c.503G>A, and c.502C>T in TPM3, and c.415_417delGAG in TPM2), clinical presentation and muscle morphological findings differed in our patients. Differences included variation in distribution of muscle weakness, presence of scoliosis and ptosis...... had nemaline myopathy and fiber size disproportion, while three patients had congenital fiber type disproportion (CFTD) on muscle biopsies. TPM2-related CFTD has only been described in two cases, indicating that mutations in TPM2 are rare causes of CFTD....
Energy Dissipation in Sandwich Structures During Axial Compression
DEFF Research Database (Denmark)
Urban, Jesper
2002-01-01
The purpose of this paper is to investigate the energy dissipation in sandwich structures during axial crushing. Axial crushing tests on six sandwich elements are described. The sandwich elements consist of a polyurethane core and E-glass/Polyester skin. The elements compare to full-scale structu......The purpose of this paper is to investigate the energy dissipation in sandwich structures during axial crushing. Axial crushing tests on six sandwich elements are described. The sandwich elements consist of a polyurethane core and E-glass/Polyester skin. The elements compare to full...
Improved axial position detection in optical tweezers measurements
DEFF Research Database (Denmark)
Dreyer, Jakob Kisbye; Berg-Sørensen, Kirstine; Oddershede, Lene
2004-01-01
We investigate the axial position detection of a trapped microsphere in an optical trap by using a quadrant photodiode. By replacing the photodiode with a CCD camera, we obtain detailed information on the light scattered by the microsphere. The correlation of the interference pattern with the axial...... position displays complex behavior with regions of positive and negative interference. By analyzing the scattered light intensity as a function of the axial position of the trapped sphere, we propose a simple method to increase the sensitivity and control the linear range of axial position detection....
Chen, J; Hong, D; Wang, Z; Yuan, Y
2010-01-01
Neutral lipid storage disease with myopathy (NLSDM) is a type of lipid storage myopathy arising due to a mutation in the PNPLA2 gene encoding an adipose triglyceride lipase responsible for the degradation of intracellular triglycerides. Herein, we report the cases of two siblings manifesting slowly progressive proximal and distal limb weakness in adulthood. One of the patients had dilated cardiomyopathy, hearing loss and short stature. Muscle specimens of the 2 patients revealed muscular dystrophic features with massive lipid droplets and numerous rimmed vacuoles in the fibers. A novel homozygous mutation IVS2+1G > A in the PNPLA2 gene was identified in the 2 cases, but not in the healthy familial individuals. The presence of massive lipid droplets with muscular dystrophic changes and rimmed vacuoles in muscle fibers might be one of the characteristic pathological changes of NLSDM.
Maleckis, Kaspars; Deegan, Paul; Poulson, William; Sievers, Cole; Desyatova, Anastasia; MacTaggart, Jason; Kamenskiy, Alexey
2017-11-01
High failure rates of Peripheral Arterial Disease (PAD) stenting appear to be associated with the inability of certain stent designs to accommodate severe biomechanical environment of the femoropopliteal artery (FPA) that bends, twists, and axially compresses during limb flexion. Twelve Nitinol stents (Absolute Pro, Supera, Lifestent, Innova, Zilver, Smart Control, Smart Flex, EverFlex, Viabahn, Tigris, Misago, and Complete SE) were quasi-statically tested under bench-top axial and radial compression, axial tension, bending, and torsional deformations. Stents were compared in terms of force-strain behavior, stiffness, and geometrical shape under each deformation mode. Tigris was the least stiff stent under axial compression (6.6N/m axial stiffness) and bending (0.1N/m) deformations, while Smart Control was the stiffest (575.3N/m and 105.4N/m, respectively). Under radial compression Complete SE was the stiffest (892.8N/m), while Smart Control had the lowest radial stiffness (211.0N/m). Viabahn and Supera had the lowest and highest torsional stiffness (2.2μNm/° and 959.2μNm/°), respectively. None of the 12 PAD stents demonstrated superior characteristics under all deformation modes and many experienced global buckling and diameter pinching. Though it is yet to be determined which of these deformation modes might have greater clinical impact, results of the current analysis may help guide development of new stents with improved mechanical characteristics. Copyright © 2017 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Sone, Shinsuke
1989-01-01
It has recently been demonstrated that several 99m Tc-labeled phosphate compounds accumulate in skeletal muscle in patients with myopathies including Duchenne muscular dystrophy (DMD). However, the mechanism by which these compounds accumulate in skeletal muscles is unknown. In order to analyze the mechanisms of tracer-localization in skeletal muscles of myopathies, the uptake of 99m Tc-methylendiphosphonate ( 99m Tc-MDP) by muscles examined in rats treated by intramuscular injection of a local anesthetic, bupivacaine. At the same time, the histological and biochemical changes of the injured muscles were studied, and findings obtained were correlated with the procedure of 99m Tc-MDP uptake. Intramuscular injection of bupivacaine resulted in markedly increased uptake of 99m Tc-MDP in the injected muscle at 12 and 24 hours after injection. The plasma creatine phosphokinase (CK) concentration increased 2-3 folds during the period from 3 to 24 hours after bupivacaine injection. Four days following injection, the CK isozyme MB activity in muscle increased. Twenty hours after injection of bupivacaine, changes such as hypercontraction and disruptin of myofibrils, Z-band lysis, and swelling of mitochondria occurred. Four days after the injection, myoblasts and myotubes were found in the damaged areas of the muscle. These results show that the increased muscle uptake of 99m Tc-MDP reflects the early degenerative changes of skeletal muscle. (author)
Sporadic late-onset nemaline myopathy with MGUS: long-term follow-up after melphalan and SCT.
Voermans, Nicol C; Benveniste, Olivier; Minnema, Monique C; Lokhorst, Henk; Lammens, Martin; Meersseman, Wouter; Delforge, Michel; Kuntzer, Thierry; Novy, Jan; Pabst, Thomas; Bouhour, Françoise; Romero, Norma; Leblond, Veronique; Bergh, Peter van den; Vekemans, Marie-Christiane; van Engelen, Baziel G; Eymard, Bruno
2014-12-02
Sporadic late-onset nemaline myopathy (SLONM) is a rare, late-onset myopathy that progresses subacutely. If associated with a monoclonal gammopathy of unknown significance (MGUS), the outcome is unfavorable: the majority of these patients die within 1 to 5 years of respiratory failure. This study aims to qualitatively assess the long-term treatment effect of high-dose melphalan (HDM) followed by autologous stem cell transplantation (SCT) in a series of 8 patients with SLONM-MGUS. We performed a retrospective case series study (n = 8) on the long-term (1-8 years) treatment effect of HDM followed by autologous SCT (HDM-SCT) on survival, muscle strength, and functional capacities. Seven patients showed a lasting moderate-good clinical response, 2 of them after the second HDM-SCT. All of them had a complete, a very good partial, or a partial hematologic response. One patient showed no clinical or hematologic response and died. This case series shows the positive effect of HDM-SCT in this rare disorder. Factors that may portend an unfavorable outcome are a long disease course before the hematologic treatment and a poor hematologic response. Age at onset, level and type of M protein (κ vs λ), and severity of muscle weakness were not associated with a specific outcome. This study provides Class IV evidence that for patients with SLONM-MGUS, HDM-SCT increases the probability of survival and functional improvement. © 2014 American Academy of Neurology.
Axial anomaly at finite temperature and finite density
International Nuclear Information System (INIS)
Qian Zhixin; Su Rukeng; Yu, P.K.N.
1994-01-01
The U(1) axial anomaly in a hot fermion medium is investigated by using the real time Green's function method. After calculating the lowest order triangle diagrams, we find that finite temperature as well as finite fermion density does not affect the axial anomaly. The higher order corrections for the axial anomaly are discussed. (orig.)
Missaglia, Sara; Maggi, Lorenzo; Mora, Marina; Gibertini, Sara; Blasevich, Flavia; Agostoni, Piergiuseppe; Moro, Laura; Cassandrini, Denise; Santorelli, Filippo Maria; Gerevini, Simonetta; Tavian, Daniela
2017-05-01
Neutral lipid storage disease with myopathy (NLSDM) presents with skeletal muscle myopathy and severe dilated cardiomyopathy in nearly 40% of cases. NLSDM is caused by mutations in the PNPLA2 gene, which encodes the adipose triglyceride lipase (ATGL). Here we report clinical and genetic findings of a patient carrying two novel PNPLA2 mutations (c.696+4A>G and c.553_565delGTCCCCCTTCTCG). She presented at age 39 with right upper limb abduction weakness slowly progressing over the years with asymmetric involvement of proximal upper and lower limb muscles. Cardiological evaluation through ECG and heart echo scan was normal until the age 53, when mild left ventricular diastolic dysfunction was detected. Molecular analysis revealed that only one type of PNPLA2 transcript, with exon 5 skipping, was expressed in patient cells. Such aberrant mRNA causes the production of a shorter ATGL protein, lacking part of the catalytic domain. This is an intriguing case, displaying severe PNPLA2 mutations with clinical presentation characterized by slight cardiac impairment and full expression of severe asymmetric myopathy. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Rivkees ScottA
2010-08-01
Full Text Available We describe acute myopathy following I-131 treatment for hyperthyroidism due to Graves Disease (GD in an adolescent. A 15 year-old diagnosed with GD required treatment with radioactive iodine (I-131 therapy. Six weeks post I-131, he developed generalized muscle cramps. The CK was 19.800 U/L, the total thyroxine was 2.3 mcg/dL (29.6 nmol/L SI and the estimated free thyroxine (EFT was 0.5 ng/dL (6.4 pmol/L SI. The ALT was 112 U/L and AST was 364 U/L (normal
X linked neonatal centronuclear/myotubular myopathy: evidence for linkage to Xq28 DNA marker loci.
Thomas, N S; Williams, H; Cole, G; Roberts, K; Clarke, A; Liechti-Gallati, S; Braga, S; Gerber, A; Meier, C; Moser, H
1990-01-01
We have studied the inheritance of several polymorphic Xq27/28 DNA marker loci in two three generation families with the X linked neonatal lethal form of centronuclear/myotubular myopathy (XL MTM). We found complete linkage of XLMTM to all four informative Xq28 markers analysed, with GCP/RCP (Z = 3.876, theta = 0.00), with DXS15 (Z = 3.737, theta = 0.00), with DXS52 (Z = 2.709, theta = 0.00), and with F8C (Z = 1.020, theta = 0.00). In the absence of any observable recombination, we are unable...
Review of Axial Burnup Distribution Considerations for Burnup Credit Calculations
International Nuclear Information System (INIS)
Wagner, J.C.; DeHart, M.D.
2000-01-01
This report attempts to summarize and consolidate the existing knowledge on axial burnup distribution issues that are important to burnup credit criticality safety calculations. Recently released Nuclear Regulatory Commission (NRC) staff guidance permits limited burnup credit, and thus, has prompted resolution of the axial burnup distribution issue. The reactivity difference between the neutron multiplication factor (keff) calculated with explicit representation of the axial burnup distribution and keff calculated assuming a uniform axial burnup is referred to as the ''end effect.'' This end effect is shown to be dependent on many factors, including the axial-burnup profile, total accumulated burnup, cooling time, initial enrichment, assembly design, and the isotopics considered (i.e., actinide-only or actinides plus fission products). Axial modeling studies, efforts related to the development of axial-profile databases, and the determination of bounding axial profiles are also discussed. Finally, areas that could benefit from further efforts are identified
Directory of Open Access Journals (Sweden)
Chengde Tong
2017-05-01
Full Text Available The axial-flux magnetic-field-modulated brushless double-rotor machine (MFM-BDRM is a possible alternative as a power-split device for hybrid electric vehicles (HEVs. However, the existence of large axial force may lead to assembly problems and rich inner air-gap harmonics could result in high PM loss and low efficiency. This paper proposes a novel axial-flux MFM-BDRM with improved PM rotor structure. 2-D analytical method to predict the magnetic-field distribution of the proposed MFM-BDRM is developed and the design procedure of the proposed machine is illustrated. The impact of key geometrical parameters on axial force and torque is investigated. To evaluate the advantage of the proposed machine, a comparison is made with a conventional one with respect to electromagnetic performances. Results show that the proposed machine is effective in reducing PM eddy loss and axial force by 60% and 35%, respectively.
Diagnostic value of axial CT scan
International Nuclear Information System (INIS)
Kiuchi, Sousuke
1983-01-01
Axial CT scan was used to investigate the radiological details of the temporal bone of 33 patients with chronic otitis media, secondary cholesteatoma, sensorineural hearing loss, Meniere disease, vertigo, facial spasm, and neoplasma. The axial scans showed anatomic details of the temporal bone, and at the same time clearly demonstrated the extent of the soft-tissue masses in the middle ears, as well as the destructions of the ossicles. Bone changes of the anterior walls of the epitympanum and external auditory meatus were more clearly demonstrated than by coronary CT scan. However, the axial scan had the disadvantages in demonstrating the stapes, crista transversa, and the mastoid portion of the facial canal. (author)
Improving the lattice axial vector current
International Nuclear Information System (INIS)
Horsley, R.; Perlt, H.; Schiller, A.; Zanotti, J.M.
2015-11-01
For Wilson and clover fermions traditional formulations of the axial vector current do not respect the continuum Ward identity which relates the divergence of that current to the pseudoscalar density. Here we propose to use a point-split or one-link axial vector current whose divergence exactly satisfies a lattice Ward identity, involving the pseudoscalar density and a number of irrelevant operators. We check in one-loop lattice perturbation theory with SLiNC fermion and gauge plaquette action that this is indeed the case including order O(a) effects. Including these operators the axial Ward identity remains renormalisation invariant. First preliminary results of a nonperturbative check of the Ward identity are also presented.
International Nuclear Information System (INIS)
1976-01-01
An axial tomographic system is described comprising axial tomographic means for collecting sets of data corresponding to the transmission or absorption of a number of beams of penetrating radiation through a planar slice of an object. It includes means to locate an object to be analyzed, a source and detector for directing one or more beams of penetrating radiation through the object from the source to the detector, and means to rotate (and optionally translate) the source as well as means to process the collected sets of data. Data collection, data processing, and data display can each be conducted independently of each other. An additional advantage of the system described is that the raw data (i.e., the originally collected data) are not destroyed by the data processing but instead are retained intact for further reference or use, if needed
Δ(1232) Axial Charge and Form Factors from Lattice QCD
International Nuclear Information System (INIS)
Alexandrou, Constantia; Gregory, Eric B.; Korzec, Tomasz; Koutsou, Giannis; Negele, John W.; Sato, Toru; Tsapalis, Antonios
2011-01-01
We present the first calculation on the Δ axial vector and pseudoscalar form factors using lattice QCD. Two Goldberger-Treiman relations are derived and examined. A combined chiral fit is performed to the nucleon axial charge, N to Δ axial transition coupling constant and Δ axial charge.
DEFF Research Database (Denmark)
Olsen, Rikke Katrine Jentoft; Pourfarzam, M; Morris, A A M
2004-01-01
response to treatment, she developed respiratory insufficiency at age 14 years and has required long-term overnight ventilation. Thus, MADD is one of the few conditions that can cause a myopathy with weakness of the respiratory muscles out of proportion to the limb muscles. Udgivelsesdato: 2004-null...
Versatility of the Angularis Oris Axial Pattern Flap for Facial Reconstruction.
Losinski, Sara L; Stanley, Bryden J; Schallberger, Sandra P; Nelson, Laura L; Towle Millard, Heather A M
2015-11-01
To describe the versatility of the axial pattern flap based on the cutaneous perforating branch of the angularis oris artery for reconstruction of large facial defects in dogs, including complications and clinical outcomes. Retrospective clinical case series. Client-owned dogs (n = 8). Facial flaps (n = 9) based at the commissure of the lip with a caudodorsal orientation were utilized, with established anatomical borders. Flaps were elevated deep to the panniculus carnosus in a caudal to rostral direction, preserving the angularis oris artery, its cutaneous perforator, and surrounding cutaneous vasculature. Flaps were rotated dorsally or ventrally to cover the defect. Primary closure of the donor site was by direct apposition in all cases. Angularis oris axial pattern flaps were most commonly used to close large defects of the nasomaxillary area rostral to the eyes (6 dogs), followed by orbital (2) and intermandibular (1) defects. Defects occurred because of tumor resection (6 dogs), trauma (2), and a chronic, non-healing wounding (1). All flaps healed with acceptable functional and cosmetic outcomes without major complications. Followup ranged from 10 days to 16 months. Minor postoperative complications included flap edema (8 dogs), partial incisional dehiscence (3), distal tip necrosis (2), and oroantral fistula recurrence (1). Angularis oris axial pattern flaps provided hirsute, full-thickness skin coverage of a variety of large facial defects with minor complications, and should be considered when restructuring large defects of the rostral face or chin. © Copyright 2015 by The American College of Veterinary Surgeons.
Ibdah, J A; Tein, I; Dionisi-Vici, C; Bennett, M J; IJlst, L; Gibson, B; Wanders, R J; Strauss, A W
1998-01-01
Human mitochondrial trifunctional protein (TFP) is a heterooctamer of four alpha- and four beta-subunits that catalyzes three steps in the beta-oxidation spiral of long-chain fatty acids. TFP deficiency causes a Reye-like syndrome, cardiomyopathy, or sudden, unexpected death. We delineated the molecular basis for TFP deficiency in two patients with a unique phenotype characterized by chronic progressive polyneuropathy and myopathy without hepatic or cardiac involvement. Single-stranded confor...
Axial force measurement for esophageal function testing
DEFF Research Database (Denmark)
Gravesen, Flemming Holbæk; Funch-Jensen, Peter; Gregersen, Hans
2009-01-01
force (force in radial direction) whereas the bolus moves along the length of esophagus in a distal direction. Force measurements in the longitudinal (axial) direction provide a more direct measure of esophageal transport function. The technique used to record axial force has developed from external...... force transducers over in-vivo strain gauges of various sizes to electrical impedance based measurements. The amplitude and duration of the axial force has been shown to be as reliable as manometry. Normal, as well as abnormal, manometric recordings occur with normal bolus transit, which have been...... documented using imaging modalities such as radiography and scintigraphy. This inconsistency using manometry has also been documented by axial force recordings. This underlines the lack of information when diagnostics are based on manometry alone. Increasing the volume of a bag mounted on a probe...
International Nuclear Information System (INIS)
Ghayesh, Mergen H.; Amabili, Marco; Farokhi, Hamed
2013-01-01
In the present study, the coupled nonlinear dynamics of an axially moving viscoelastic beam with time-dependent axial speed is investigated employing a numerical technique. The equations of motion for both the transverse and longitudinal motions are obtained using Newton’s second law of motion and the constitutive relations. A two-parameter rheological model of the Kelvin–Voigt energy dissipation mechanism is employed in the modelling of the viscoelastic beam material, in which the material time derivative is used in the viscoelastic constitutive relation. The Galerkin method is then applied to the coupled nonlinear equations, which are in the form of partial differential equations, resulting in a set of nonlinear ordinary differential equations (ODEs) with time-dependent coefficients due to the axial acceleration. A change of variables is then introduced to this set of ODEs to transform them into a set of first-order ordinary differential equations. A variable step-size modified Rosenbrock method is used to conduct direct time integration upon this new set of first-order nonlinear ODEs. The mean axial speed and the amplitude of the speed variations, which are taken as bifurcation parameters, are varied, resulting in the bifurcation diagrams of Poincaré maps of the system. The dynamical characteristics of the system are examined more precisely via plotting time histories, phase-plane portraits, Poincaré sections, and fast Fourier transforms (FFTs)
Stochastic quantization for the axial model
International Nuclear Information System (INIS)
Farina, C.; Montani, H.; Albuquerque, L.C.
1991-01-01
We use bosonization ideas to solve the axial model in the stochastic quantization framework. We obtain the fermion propagator of the theory decoupling directly the Langevin equation, instead of the Fokker-Planck equation. In the Appendix we calculate explicitly the anomalous divergence of the axial-vector current by using a regularization that does not break the Markovian character of the stochastic process
Nonperturbative Aspects of Axial Vector Vertex
Institute of Scientific and Technical Information of China (English)
ZONG Hong-Shi; CHEN Xiang-Song; WANG Fan; CHANG Chao-Hsi; ZHAO En-Guang
2002-01-01
It is shown how the axial vector current of current quarks is related to that of constituent quarks within the framework of the global color symmetry model.Gluon dressing of the axial vector vertex and the quark self-energy functions are described by the inhomogeneous Bethe-Salpeter equation in the ladder approximation and the Schwinger Dyson equation in the rainbow approximation,respectively.
Conservative axial burnup distributions for actinide-only burnup credit
International Nuclear Information System (INIS)
Kang, C.; Lancaster, D.
1997-11-01
Unlike the fresh fuel approach, which assumes the initial isotopic compositions for criticality analyses, any burnup credit methodology must address the proper treatment of axial burnup distributions. A straightforward way of treating a given axial burnup distribution is to segment the fuel assembly into multiple meshes and to model each burnup mesh with the corresponding isotopic compositions. Although this approach represents a significant increase in modeling efforts compared to the uniform average burnup approach, it can adequately determine the reactivity effect of the axial burnup distribution. A major consideration is what axial burnup distributions are appropriate for use in light of many possible distributions depending on core operating conditions and histories. This paper summarizes criticality analyses performed to determine conservative axial burnup distributions. The conservative axial burnup distributions presented in this paper are included in the Topical Report on Actinide-Only Burnup Credit for Pressurized Water Reactor Spent Nuclear Fuel Packages, Revision 1 submitted in May 1997 by the US Department of Energy (DOE) to the US Nuclear Regulatory Commission (NRC). When approved by NRC, the conservative axial burnup distributions may be used to model PWR spent nuclear fuel for the purpose of gaining actinide only burnup credit
Acylcarnitines profile best predicts survival in horses with atypical myopathy.
Directory of Open Access Journals (Sweden)
François Boemer
Full Text Available Equine atypical myopathy (AM is caused by hypoglycin A intoxication and is characterized by a high fatality rate. Predictive estimation of survival in AM horses is necessary to prevent unnecessary suffering of animals that are unlikely to survive and to focus supportive therapy on horses with a possible favourable prognosis of survival. We hypothesized that outcome may be predicted early in the course of disease based on the assumption that the acylcarnitine profile reflects the derangement of muscle energetics. We developed a statistical model to prognosticate the risk of death of diseased animals and found that estimation of outcome may be drawn from three acylcarnitines (C2, C10:2 and C18 -carnitines with a high sensitivity and specificity. The calculation of the prognosis of survival makes it possible to distinguish the horses that will survive from those that will die despite severe signs of acute rhabdomyolysis in both groups.
Acylcarnitines profile best predicts survival in horses with atypical myopathy
Detilleux, Johann; Cello, Christophe; Amory, Hélène; Marcillaud-Pitel, Christel; Richard, Eric; van Galen, Gaby; van Loon, Gunther; Lefère, Laurence; Votion, Dominique-Marie
2017-01-01
Equine atypical myopathy (AM) is caused by hypoglycin A intoxication and is characterized by a high fatality rate. Predictive estimation of survival in AM horses is necessary to prevent unnecessary suffering of animals that are unlikely to survive and to focus supportive therapy on horses with a possible favourable prognosis of survival. We hypothesized that outcome may be predicted early in the course of disease based on the assumption that the acylcarnitine profile reflects the derangement of muscle energetics. We developed a statistical model to prognosticate the risk of death of diseased animals and found that estimation of outcome may be drawn from three acylcarnitines (C2, C10:2 and C18 -carnitines) with a high sensitivity and specificity. The calculation of the prognosis of survival makes it possible to distinguish the horses that will survive from those that will die despite severe signs of acute rhabdomyolysis in both groups. PMID:28846683
Cladding axial elongation models for FRAP-T6
International Nuclear Information System (INIS)
Shah, V.N.; Carlson, E.R.; Berna, G.A.
1983-01-01
This paper presents a description of the cladding axial elongation models developed at the Idaho National Engineering Laboratory (INEL) for use by the FRAP-T6 computer code in analyzing the response of fuel rods during reactor transients in light water reactors (LWR). The FRAP-T6 code contains models (FRACAS-II subcode) that analyze the structural response of a fuel rod including pellet-cladding-mechanical-interaction (PCMI). Recently, four models were incorporated into FRACAS-II to calculate cladding axial deformation: (a) axial PCMI, (b) trapped fuel stack, (c) fuel relocation, and (d) effective fuel thermal expansion. Comparisons of cladding axial elongation measurements from two experiments with the corresponding FRAP-T6 calculations are presented
Directory of Open Access Journals (Sweden)
Andriy V. Shatillo
2014-12-01
Full Text Available Background: Limb girdle muscular dystrophies (LGMDs and several other disorders which share their specific phenotype are rare, predominantly hereditary conditions with no curative treatment. Differential diagnosis of these myopathies is quite challenging and expensive in many cases. Therefore, a significant proportion of patients remains undiagnosed and untreated for a long time. At the same time there is a huge amount of drugs and supplements potentially able to modify the course of some of these muscular dystrophies. That is why a simple empirical approach able to define a patient’s reaction to a specific compound seems rational. Because most common basic pathogenetic mechanisms for these quite different disorders increase the vulnerability of muscle cells (or decrease ability for reparation during mechanical stress, we propose a simple, noninvasive and inexpensive approach for individualized drug screening based on the drug’s influence on the mechanical vulnerability of peripheral blood mononuclear cells (PBMC. Methods: PBMC derived from 8 patients with Duchenne muscular dystrophy (DMD, 2 patients with LGMD2A, 1 patient with LGMD2B, 1 with MERRF syndrome, 1 with facioscapulohumeral muscular dystrophy (FSHD and 13 matched control subjects were irradiated by ultrasound in the presence of several compounds (lisinopril, vitamin D3, prednisolon, tocopherol, topiramate, glutargin, α-lipoic acid, essentiale, and physiological solution. Then viability indexes of the samples were detected by citotoxic assays based on vital dye (neutral red and resazurin metabolism. Results: In cytotoxicity tests with active transport of neutral red into PBMC derived from DMD patients, the cells showed signs of destruction at 1.06±0.52 minutes of ultrasounding compared to 1.75±0.6 minutes in control. PBMCs from patients with other myopathies have either normal or decreased resistance to ultrasound. The addition of tocopherol significantly changes the PBMC
Energy Technology Data Exchange (ETDEWEB)
Sone, Shinsuke
1989-02-01
It has recently been demonstrated that several /sup 99m/Tc-labeled phosphate compounds accumulate in skeletal muscle in patients with myopathies including Duchenne muscular dystrophy (DMD). However, the mechanism by which these compounds accumulate in skeletal muscles is unknown. In order to analyze the mechanisms of tracer-localization in skeletal muscles of myopathies, the uptake of /sup 99m/Tc-methylendiphosphonate (/sup 99m/Tc-MDP) by muscles examined in rats treated by intramuscular injection of a local anesthetic, bupivacaine. At the same time, the histological and biochemical changes of the injured muscles were studied, and findings obtained were correlated with the procedure of /sup 99m/Tc-MDP uptake. Intramuscular injection of bupivacaine resulted in markedly increased uptake of /sup 99m/Tc-MDP in the injected muscle at 12 and 24 hours after injection. The plasma creatine phosphokinase (CK) concentration increased 2-3 folds during the period from 3 to 24 hours after bupivacaine injection. Four days following injection, the CK isozyme MB activity in muscle increased. Twenty hours after injection of bupivacaine, changes such as hypercontraction and disruptin of myofibrils, Z-band lysis, and swelling of mitochondria occurred. Four days after the injection, myoblasts and myotubes were found in the damaged areas of the muscle. These results show that the increased muscle uptake of /sup 99m/Tc-MDP reflects the early degenerative changes of skeletal muscle.
Directory of Open Access Journals (Sweden)
Teet Seene
2016-05-01
Full Text Available Muscle weakness in corticosteroid myopathy is mainly the result of the destruction and atrophy of the myofibrillar compartment of fast-twitch muscle fibers. Decrease of titin and myosin, and the ratio of nebulin and MyHC in myopathic muscle, shows that these changes of contractile and elastic proteins are the result of increased catabolism of the abovementioned proteins in skeletal muscle. Slow regeneration of skeletal muscle is in good correlation with a decreased number of satellite cells under the basal lamina of muscle fibers. Aging causes a reduction of AMP-activated protein kinase (AMPK activity as the result of the reduced function of the mitochondrial compartment. AMPK activity increases as a result of increased functional activity. Resistance exercise causes anabolic and anticatabolic effects in skeletal muscle: muscle fibers experience hypertrophy while higher myofibrillar proteins turn over. These changes are leading to the qualitative remodeling of muscle fibers. As a result of these changes, possible maximal muscle strength is increasing. Endurance exercise improves capillary blood supply, increases mitochondrial biogenesis and muscle oxidative capacity, and causes a faster turnover rate of sarcoplasmic proteins as well as qualitative remodeling of type I and IIA muscle fibers. The combination of resistance and endurance exercise may be the fastest way to prevent or decelerate muscle atrophy due to the anabolic and anticatabolic effects of exercise combined with an increase in oxidative capacity. The aim of the present short review is to assess the role of myofibrillar protein catabolism in the development of glucocorticoid-caused myopathy from aging and physical activity aspects.
Development of submersible axial pump for wastewater
Energy Technology Data Exchange (ETDEWEB)
Yun, Jeong Eui [Kangwon Nat' l Univ., Chuncheon (Korea, Republic of)
2013-02-15
This study was performed to develop a high efficiency submersible axial pump for concentration wastewater treatment. To do this, we simulated the effect of some parameters such as the axial twist angle of a blade({beta}), the radial twist angle of a blade({alpha}) and the length of a blade ({iota}) on pump efficiency using commercial code, ANSYS CFX and BladeGen. The results showed that the axial twist angle of a blade({beta}) was the most sensible parameter on the pump efficiency. And the pump efficiency had a maximum at {beta}=20.deg, {alpha}=110.deg and {iota}=240mm.
Axial displacements in external and internal implant-abutment connection.
Lee, Ji-Hye; Kim, Dae-Gon; Park, Chan-Jin; Cho, Lee-Ra
2014-02-01
The purpose of this study was to evaluate the axial displacement of the abutments during clinical procedures by the tightening torque and cyclic loading. Two different implant-abutment connection systems were used (external butt joint connection [EXT]; internal tapered conical connection [INT]). The master casts with two implant replicas, angulated 10° from each other, were fabricated for each implant connection system. Four types of impression copings were assembled and tightened with the corresponding implants (hex transfer impression coping, non-hex transfer impression coping, hex pick-up impression coping, non-hex pick-up impression coping). Resin splinted abutments and final prosthesis were assembled. The axial displacement was measured from the length of each assembly, which was evaluated repeatedly, after 30 Ncm torque tightening. After 250 N cyclic loading of final prosthesis for 1,000,000 cycles, additional axial displacement was recorded. The mean axial displacement was statistically analyzed (repeated measured ANOVA). There was more axial displacement in the INT group than that of the EXT group in impression copings, resin splinted abutments, and final prosthesis. Less axial displacement was found at 1-piece non-hex transfer type impression coping than other type of impression copings in the INT group. There was more axial displacement at the final prosthesis than resin splinted abutments in the INT and the EXT groups. After 250 N cyclic loading of final prosthesis, the INT group showed more axial displacement than that of the EXT group. Internal tapered conical connection demonstrated a varying amount of axial displacement with tightening torque and cyclic loading. © 2012 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd.
Lepori, Vincent; Mühlhause, Franziska; Sewell, Adrian C; Jagannathan, Vidhya; Janzen, Nils; Rosati, Marco; Alves de Sousa, Filipe Miguel Maximiano; Tschopp, Aurélie; Schüpbach, Gertraud; Matiasek, Kaspar; Tipold, Andrea; Leeb, Tosso; Kornberg, Marion
2018-05-04
Several enzymes are involved in fatty acid oxidation, which is a key process in mitochondrial energy production. Inherited defects affecting any step of fatty acid oxidation can result in clinical disease. We present here an extended family of German Hunting Terriers with 10 dogs affected by clinical signs of exercise induced weakness, muscle pain, and suspected rhabdomyolysis. The combination of clinical signs, muscle histopathology and acylcarnitine analysis with an elevated tetradecenoylcarnitine (C14:1) peak suggested a possible diagnosis of acyl-CoA dehydrogenase very long chain deficiency (ACADVLD). Whole genome sequence analysis of one affected dog and 191 controls revealed a nonsense variant in the ACADVL gene encoding acyl-CoA dehydrogenase very long chain, c.1728C>A or p.(Tyr576*). The variant showed perfect association with the phenotype in the 10 affected and more than 500 control dogs of various breeds. Pathogenic variants in the ACADVL gene have been reported in humans with similar myopathic phenotypes. We therefore considered the detected variant to be the most likely candidate causative variant for the observed exercise induced myopathy. To our knowledge, this is the first description of this disease in dogs, which we propose to name exercise induced metabolic myopathy (EIMM), and the identification of the first canine pathogenic ACADVL variant. Our findings provide a large animal model for a known human disease and will enable genetic testing to avoid the unintentional breeding of affected offspring. Copyright © 2018 Lepori et al.
Directory of Open Access Journals (Sweden)
Vincent Lepori
2018-05-01
Full Text Available Several enzymes are involved in fatty acid oxidation, which is a key process in mitochondrial energy production. Inherited defects affecting any step of fatty acid oxidation can result in clinical disease. We present here an extended family of German Hunting Terriers with 10 dogs affected by clinical signs of exercise induced weakness, muscle pain, and suspected rhabdomyolysis. The combination of clinical signs, muscle histopathology and acylcarnitine analysis with an elevated tetradecenoylcarnitine (C14:1 peak suggested a possible diagnosis of acyl-CoA dehydrogenase very long chain deficiency (ACADVLD. Whole genome sequence analysis of one affected dog and 191 controls revealed a nonsense variant in the ACADVL gene encoding acyl-CoA dehydrogenase very long chain, c.1728C>A or p.(Tyr576*. The variant showed perfect association with the phenotype in the 10 affected and more than 500 control dogs of various breeds. Pathogenic variants in the ACADVL gene have been reported in humans with similar myopathic phenotypes. We therefore considered the detected variant to be the most likely candidate causative variant for the observed exercise induced myopathy. To our knowledge, this is the first description of this disease in dogs, which we propose to name exercise induced metabolic myopathy (EIMM, and the identification of the first canine pathogenic ACADVL variant. Our findings provide a large animal model for a known human disease and will enable genetic testing to avoid the unintentional breeding of affected offspring.
Braem, André; Joram, C; Séguinot, Jacques; Weilhammer, P; De Leo, R; Nappi, E; Lustermann, W; Schinzel, D; Johnson, I; Renker, D; Albrecht, S
2007-01-01
We describe a novel method to extract the axial coordinate from a matrix of long axially oriented crystals, which is based on wavelength shifting plastic strips. The method allows building compact 3-D axial gamma detector modules for PET scanners with excellent 3-dimensional spatial, timing and energy resolution while keeping the number of readout channels reasonably low. A voxel resolution of about 10 mm3 is expected. We assess the performance of the method in two independent ways, using classical PMTs and G-APDs to read out the LYSO (LSO) scintillation crystals and the wavelength shifting strips. We observe yields in excess of 35 photoelectrons from the strips for a 511 keV gamma and reconstruct the axial coordinate with a precision of about 2.5 mm (FWHM).
Dual-detection confocal fluorescence microscopy: fluorescence axial imaging without axial scanning.
Lee, Dong-Ryoung; Kim, Young-Duk; Gweon, Dae-Gab; Yoo, Hongki
2013-07-29
We propose a new method for high-speed, three-dimensional (3-D) fluorescence imaging, which we refer to as dual-detection confocal fluorescence microscopy (DDCFM). In contrast to conventional beam-scanning confocal fluorescence microscopy, where the focal spot must be scanned either optically or mechanically over a sample volume to reconstruct a 3-D image, DDCFM can obtain the depth of a fluorescent emitter without depth scanning. DDCFM comprises two photodetectors, each with a pinhole of different size, in the confocal detection system. Axial information on fluorescent emitters can be measured by the axial response curve through the ratio of intensity signals. DDCFM can rapidly acquire a 3-D fluorescent image from a single two-dimensional scan with less phototoxicity and photobleaching than confocal fluorescence microscopy because no mechanical depth scans are needed. We demonstrated the feasibility of the proposed method by phantom studies.
Health and imaging outcomes in axial spondyloarthritis
Machado, P.M.
2016-01-01
This thesis focuses on the assessment and monitoring of health and imaging outcomes in axial spondyloarthritis (SpA) and the relationship between these outcomes. Four major contributions to the understanding and management of axial SpA were made: 1) the improvement and facilitation of the assessment
LENUS (Irish Health Repository)
Thabit, Hood
2011-05-13
Abstract Introduction Severe proximal myopathy can occasionally be the first presenting complaint of patients with osteomalacia. This may lead to investigations and misdiagnosis of a neuromuscular disease, rather than a metabolic bone disease. Case presentations We present here two cases of severe proximal myopathy in patients who were both of South Asian origin and lacto-vegetarians: a 31-year-old Indian man and a 34-year-old Indian woman. In both cases, their clinical symptoms fully resolved following vitamin D and calcium replacement therapy. These patients were at risk of osteomalacia due to their dietary intake and ethnicity. The role of dietary intake and sunlight exposure in the development of osteomalacia in certain ethnic groups living in Western Europe is reviewed here. Conclusion These two cases emphasize the importance of recognizing osteomalacia in at-risk individuals, as the condition is reversible and easily treated with vitamin D and calcium supplementation. It may also help avoid prolonged and unnecessary investigations of these patients.
Directory of Open Access Journals (Sweden)
Sreenan Seamus
2011-05-01
Full Text Available Abstract Introduction Severe proximal myopathy can occasionally be the first presenting complaint of patients with osteomalacia. This may lead to investigations and misdiagnosis of a neuromuscular disease, rather than a metabolic bone disease. Case presentations We present here two cases of severe proximal myopathy in patients who were both of South Asian origin and lacto-vegetarians: a 31-year-old Indian man and a 34-year-old Indian woman. In both cases, their clinical symptoms fully resolved following vitamin D and calcium replacement therapy. These patients were at risk of osteomalacia due to their dietary intake and ethnicity. The role of dietary intake and sunlight exposure in the development of osteomalacia in certain ethnic groups living in Western Europe is reviewed here. Conclusion These two cases emphasize the importance of recognizing osteomalacia in at-risk individuals, as the condition is reversible and easily treated with vitamin D and calcium supplementation. It may also help avoid prolonged and unnecessary investigations of these patients.
LENUS (Irish Health Repository)
Thabit, Hood
2012-02-01
INTRODUCTION: Severe proximal myopathy can occasionally be the first presenting complaint of patients with osteomalacia. This may lead to investigations and misdiagnosis of a neuromuscular disease, rather than a metabolic bone disease. CASE PRESENTATIONS: We present here two cases of severe proximal myopathy in patients who were both of South Asian origin and lacto-vegetarians: a 31-year-old Indian man and a 34-year-old Indian woman. In both cases, their clinical symptoms fully resolved following vitamin D and calcium replacement therapy. These patients were at risk of osteomalacia due to their dietary intake and ethnicity. The role of dietary intake and sunlight exposure in the development of osteomalacia in certain ethnic groups living in Western Europe is reviewed here. CONCLUSION: These two cases emphasize the importance of recognizing osteomalacia in at-risk individuals, as the condition is reversible and easily treated with vitamin D and calcium supplementation. It may also help avoid prolonged and unnecessary investigations of these patients.
sizing of wind powered axial flux permanent magnet alternator using
African Journals Online (AJOL)
user
2016-10-04
Oct 4, 2016 ... Keywords: Wind-Power, Axial flux, Axial Flux Permanent Machines (AFPM), Axial Flux Permanent Magnet ... energy for power generation, a high constraint is the .... arrangements as Single-Rotor Single-Stator Structure.
Buoyant Helical Twin-Axial Wire Antenna
2016-11-15
February 2017 The below identified patent application is available for licensing. Requests for information should be addressed to...300169 1 of 9 BUOYANT HELICAL TWIN-AXIAL WIRE ANTENNA CROSS REFERENCE TO OTHER PATENT APPLICATIONS [0001] This application is a divisional...application and claims the benefit of the filing date of United States Patent Application No. 14/280,889; filed on May 19, 2014; and entitled “Twin-Axial
Axial forces in centrifugal compressor couplings
Ivanov, A. N.; Ivanov, N. M.; Yun, V. K.
2017-08-01
The article presents the results of the theoretical and experimental investigation of axial forces arising in the toothed and plate couplings of centrifugal compressor shaft lines. Additional loads on the thrust bearing are considered that can develop in the toothed couplings as a result of coupled rotors misalignment. Design relationships to evaluate the level of axial forces and recommendations for their reduction in the operating conditions are given.
Chiral filter, axial charges and Gamow-Teller strengths
International Nuclear Information System (INIS)
Rho, M.
1983-09-01
The different ways that nuclear matter responds to the weak axial-vector current are interpreted in terms of modification of the ''vacuum'' in baryon-rich environments. The notion of ''chiral filter'' is introduced. Use of a ward identity is suggested. The Gamow-Teller quenching and the enhanced axial charge in O + O - transitions follow from this. I also discuss briefly possible relevance of the nucleon as a topological soliton configuration to the global property of nuclear axial response functions
Fuel rod with axial regions of annular and standard fuel pellets
International Nuclear Information System (INIS)
Freeman, T.R.
1991-01-01
This patent describes a fuel rod for use in a nuclear reactor fuel assembly. It comprises: an elongated hollow cladding tube; a pair of end plugs connected to and sealing the cladding tube at opposite ends of thereof; and an axial stack of fuel pellets contained in and extending between the end plugs at the opposite ends of the tube, all of the fuel pellets contained in the tube being composed of fissile material being enriched above the level of natural enrichment; the fuel pellets in the stack thereof being provided in an arrangement of axial regions. The arrangement of axial regions including a pair of first axial regions defined respectively at the opposite ends of the pellet stack adjacent to the respective end plugs. The pellets in the first axial regions being identical in number and having annular configurations with an annulus of a first void size. The arrangement of axial regions also including another axial region defined between the first axial regions, some of the pellets in the another axial region having solid configurations
Chiral lattice fermions, minimal doubling, and the axial anomaly
International Nuclear Information System (INIS)
Tiburzi, B. C.
2010-01-01
Exact chiral symmetry at finite lattice spacing would preclude the axial anomaly. In order to describe a continuum quantum field theory of Dirac fermions, lattice actions with purported exact chiral symmetry must break the flavor-singlet axial symmetry. We demonstrate that this is indeed the case by using a minimally doubled fermion action. For simplicity, we consider the Abelian axial anomaly in two dimensions. At finite lattice spacing and with gauge interactions, the axial anomaly arises from nonconservation of the flavor-singlet current. Similar nonconservation also leads to the axial anomaly in the case of the naieve lattice action. For minimally doubled actions, however, fine-tuning of the action and axial current is necessary to arrive at the anomaly. Conservation of the flavor nonsinglet vector current additionally requires the current to be fine-tuned. Finally, we determine that the chiral projection of a minimally doubled fermion action can be used to arrive at a lattice theory with an undoubled Dirac fermion possessing the correct anomaly in the continuum limit.
Axial Myopia and its Influence on Diabetic Retinopathy
International Nuclear Information System (INIS)
Tayyab, H.; Haider, M. A.; Bukhari, S. A. H.
2014-01-01
Objective: To evaluate the correlation between axial myopia and diabetic retinopathy. Study Design: Cross-sectional study. Place and Duration of Study: Eye Department of Postgraduate Medical Institute, Lahore General Hospital, from August 2012 to February 2013. Methodology: A total of 258 participants suffering from type-2 diabetic retinopathy were included. Axial length was measured by two optometrists using contact type ultrasound biometer. Colored retinal photographs, red free retinal photographs and Fundus Fluorescein Angiography (FFA) were performed on all patients using standard fundus camera. All fundus photographs and angiograms were independently reviewed and graded by two qualified vitreoretinal fellows. Results: Out of 258 patients, 163 were males (63.2%) and 95 (36.8%) were females. Average age of patients was 56.30 +- 7.57 years. Average axial length of right and left eyes were 23.16 mm and 23.15 mm respectively. There was statistically significant negative correlation between axial length and severity of diabetic retinopathy in the right eye, (Spearman correlation = -0.511, p = 0.0001) as well as the left eye (Spearman correlation = -0.522, p = 0.0001). Conclusion: There is a protective influence of longer axial length of globe on the stage and severity of diabetic retinopathy. This study may help in modifying the screening protocol for diabetic retinopathy amongst patients of differing axial lengths. (author)
Transitions in axial morphology along the Southeast Indian Ridge
Ma, Ying; Cochran, James R.
1996-07-01
Shipboard bathymetric and magnetic profiles across the Southeast Indian Ridge (SEIR) were analyzed in order to examine the nature of along-axis variations in axial morphology at this intermediate spreading rate ridge. Three types of axial morphology are observed along the SEIR: an axial high, a shallow (200-700 m deep) axial valley and a deep (>1000 m deep) axial valley. An axial high is found to the east of the Australian-Antarctic Discordance (AAD) (east of 128°E) and between 82°E and 104°E. A shallow rift valley is found from 104°E to 114°E and from 82°E westward past the Amerstdam/St. Paul hotspot (ASP) to about 30°S, 75°E. Deep rift valleys are found from 114°E to 128°E in the vicinity of the AAD and from the Indian Ocean Triple Junction (IOTJ) at 25°S, 70°E to about 30°S, 75°E. The transition near 30°S occurs in an area of constant zero-age depth and does not appear to result from an increase in mantle temperature. It could be the result of the rapid increase in spreading rate along that portion of the SEIR. The most likely cause of the other transitions in axial morphology is variations in mantle temperature. The transitions between the different types of axial morphology are well defined and occur over a limited distance. Transitions in axial morphology are accompanied by significant changes in ridge flank topographic roughness. The transitions from axial valleys to axial highs are also accompanied by changes in the amplitude of the seafloor magnetic anomalies. Our observations suggest that there are distinct modes rather than a continuum of axial morphology on the SEIR and that there appears to be a "threshold" mechanism for a rapid change between different states of axial morphology. The ASP has only a limited influence on the SEIR. The ridge axis is marked by an axial valley for the entire distance from the IOTJ up to and past the ASP. The ridge axis becomes shallower as the ASP is approached from the northwest but only by about 300 m over
The Axially Symmetric One-Monopole
International Nuclear Information System (INIS)
Wong, K.-M.; Teh, Rosy
2009-01-01
We present new classical generalized one-monopole solution of the SU(2) Yang-Mills-Higgs theory with the Higgs field in the adjoint representation. We show that this solution with θ-winding number m = 1 and φ-winding number n = 1 is an axially symmetric generalization of the 't Hooft-Polyakov one-monopole. We construct this axially symmetric one-monopole solution by generalizing the large distance asymptotic solutions of the 't Hooft-Polyakov one-monopole to the Jacobi elliptic functions and solving the second order equations of motion numerically when the Higgs potential is vanishing. This solution is a non-BPS solution.
«FLARES» IN AXIAL SPONDYLOARTHRITIS
Directory of Open Access Journals (Sweden)
Sh. F. Erdes
2016-01-01
Full Text Available The clear definition of the concept of «flare in axial spondyloarthritis» is of paramount importance for clinical trials and routine practice in particular. It will be able to unify the characteristics of outcomes over a particular period of time on the one hand and to standardize therapeutic approaches on the other. On 4 February 2016, the journal Annals of Rheumatic Diseases published the on-line paper «Preliminary definitions of 'flare' in axial spondyloarthritis, based on pain, BASDAI and ASDAS-CRP: an ASAS initiative» by L. Gossec et al., which was devoted to this topic.
Directory of Open Access Journals (Sweden)
D. A. Sychev
2015-09-01
Full Text Available The clinical significance of the SLCO1B1 gene polymorphism (encoding an organic anion transport polipeptide in the development of statin induced myopathy is considered. Possible tactics of statin dose determination on the basis of pharmacogenetic testing is discussed. Indications for the use of this approach in clinical practice that should increase the efficacy and safety of the statin therapy are also considered.
Primary Sjögren’s syndrome with polymyositis, a rare amalgamation
Directory of Open Access Journals (Sweden)
Harpreet Singh
2018-01-01
Full Text Available Sjögren’s syndrome is characterized by diminished lacrimal and salivary gland secretory function. This disorder is not strictly confined to the exocrine glands and its manifestations may extend to extraglandular sites, such as the lungs, kidneys, reticuloendothelial system, and the musculoskeletal system. Although muscular manifestations are very common with Sjögren’s syndrome, true myopathy is very rare. Here, we report a case of a 45-year-old woman who presented with complaints of bilateral progressive weakness of upper and lower limbs associated with difficulty in neck holding with a history of dryness of the mouth and the eyes. The diagnosis of polymyositis associated with Sjögren’s syndrome was established on the basis of clinical picture and diagnostic tests. True polymyositis is very rare in primary Sjögren syndrome and there are scarcely any cases of primary Sjögren’s syndrome with polymyositis reported in the literature.
Efficient primary and parametric resonance excitation of bistable resonators
Ramini, Abdallah; Alcheikh, Nouha; Ilyas, Saad; Younis, Mohammad I.
2016-01-01
efficient and requires less power for primary resonance excitation. Moreover, unlike the classical method where the structure is vulnerable to the dynamic pull-in instability, the axial excitation technique can provide large amplitude motion while protecting
Directory of Open Access Journals (Sweden)
Hazem Akkad
Full Text Available Critical illness myopathy (CIM is a debilitating common consequence of modern intensive care, characterized by severe muscle wasting, weakness and a decreased myosin/actin (M/A ratio. Limb/trunk muscles are primarily affected by this myopathy while cranial nerve innervated muscles are spared or less affected, but the mechanisms underlying these muscle-specific differences remain unknown. In this time-resolved study, the cranial nerve innervated masseter muscle was studied in a unique experimental rat intensive care unit (ICU model, where animals were exposed to sedation, neuromuscular blockade (NMB, mechanical ventilation, and immobilization for durations varying between 6 h and 14d. Gel electrophoresis, immunoblotting, RT-PCR and morphological staining techniques were used to analyze M/A ratios, myofiber size, synthesis and degradation of myofibrillar proteins, and levels of heat shock proteins (HSPs. Results obtained in the masseter muscle were compared with previous observations in experimental and clinical studies of limb muscles. Significant muscle-specific differences were observed, i.e., in the masseter, the decline in M/A ratio and muscle fiber size was small and delayed. Furthermore, transcriptional regulation of myosin and actin synthesis was maintained, and Akt phosphorylation was only briefly reduced. In studied degradation pathways, only mRNA, but not protein levels of MuRF1, atrogin-1 and the autophagy marker LC3b were activated by the ICU condition. The matrix metalloproteinase MMP-2 was inhibited and protective HSPs were up-regulated early. These results confirm that the cranial nerve innervated masticatory muscles is less affected by the ICU-stress response than limb muscles, in accordance with clinical observation in ICU patients with CIM, supporting the model' credibility as a valid CIM model.
X-linked Myotubular Myopathy with a Novel MTM1 Mutation in a Taiwanese Child
Directory of Open Access Journals (Sweden)
Chia-Ying Chang
2008-12-01
Full Text Available We report a male, preterm newborn infant with X-linked myotubular myopathy, the most severe type of the disease. He presented at birth with generalized hypotonia, difficulty in swallowing, and respiratory distress with frequent episodes of atelectasis. The infant had a long thin face, generalized hypotonia, and arachnodactyly. Diagnosis was based on fetal history, muscle histopathology, electron microscopy and a genetic study. A base pair change was detected in exon 11 of the MTM1 gene: c.1160C > A, which caused an amino acid change, p.S387Y. The father's gene was normal but the mother had the same mutation as her son and was thus a carrier.
Mutations in the collagen XII gene define a new form of extracellular matrix-related myopathy.
Hicks, Debbie; Farsani, Golara Torabi; Laval, Steven; Collins, James; Sarkozy, Anna; Martoni, Elena; Shah, Ashoke; Zou, Yaqun; Koch, Manuel; Bönnemann, Carsten G; Roberts, Mark; Lochmüller, Hanns; Bushby, Kate; Straub, Volker
2014-05-01
Bethlem myopathy (BM) [MIM 158810] is a slowly progressive muscle disease characterized by contractures and proximal weakness, which can be caused by mutations in one of the collagen VI genes (COL6A1, COL6A2 and COL6A3). However, there may be additional causal genes to identify as in ∼50% of BM cases no mutations in the COL6 genes are identified. In a cohort of -24 patients with a BM-like phenotype, we first sequenced 12 candidate genes based on their function, including genes for known binding partners of collagen VI, and those enzymes involved in its correct post-translational modification, assembly and secretion. Proceeding to whole-exome sequencing (WES), we identified mutations in the COL12A1 gene, a member of the FACIT collagens (fibril-associated collagens with interrupted triple helices) in five individuals from two families. Both families showed dominant inheritance with a clinical phenotype resembling classical BM. Family 1 had a single-base substitution that led to the replacement of one glycine residue in the triple-helical domain, breaking the Gly-X-Y repeating pattern, and Family 2 had a missense mutation, which created a mutant protein with an unpaired cysteine residue. Abnormality at the protein level was confirmed in both families by the intracellular retention of collagen XII in patient dermal fibroblasts. The mutation in Family 2 leads to the up-regulation of genes associated with the unfolded protein response (UPR) pathway and swollen, dysmorphic rough-ER. We conclude that the spectrum of causative genes in extracellular matrix (ECM)-related myopathies be extended to include COL12A1.
Gearbox Instrumentation for the Investigation of Bearing Axial Cracking
Energy Technology Data Exchange (ETDEWEB)
Keller, Jonathan A [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Lambert, Scott R [National Renewable Energy Laboratory (NREL), Golden, CO (United States)
2018-03-27
Failures in gearbox bearings have been the primary source of reliability issues for wind turbine drivetrains, leading to costly downtime and unplanned maintenance. The most common failure mode is attributed to so-called axial cracks or white-etching cracks, which primarily affect the intermediate and high-speed-stage bearings. The high-speed-shaft and bearing loads and sliding will be measured with a specially instrumented gearbox installed in a 1.5-megawatt turbine at the National Wind Technology Center in an upcoming test campaign. Additional instrumentation will also measure the tribological environment of these bearings, including bearing temperatures, lubricant temperature and water content, air temperature and humidity, and stray electrical current across the bearings. This paper fully describes the instrumentation package and summarizes initial results.
Axial weak currents in the Wess-Zumino term
International Nuclear Information System (INIS)
Fujikawa, Kazuo.
1985-03-01
The conventional axial gauging of the Wess-Zumino term leads to the results which do not necessarily agree with the expectations on the basis of quark level Ward-Takahashi identities. This discrepancy arises from the fact that the quark level anomalous identities reflect the short distance structure of QCD, whereas the gauging of the Wess-Zumino term reflects the axial symmetry in the spontaneously broken chiral phase. The low energy theorem for axial weak fields is not sharply defined, in contrast to the case of vector fields where no such complications arise. (author)
Myopathy in CRPS-I: disuse or neurogenic?
Hulsman, Natalie M; Geertzen, Jan H B; Dijkstra, Pieter U; van den Dungen, Jan J A M; den Dunnen, Wilfred F A
2009-08-01
The diagnosis Complex Regional Pain Syndrome type I (CRPS-I) is based on clinical symptoms, including motor symptoms. Histological changes in muscle tissue may be present in the chronic phase of CRPS-I. Aim of this study was to analyze skeletal muscle tissue from amputated limbs of patients with CRPS-I, in order to gain more insight in factors that may play a role in changes in muscles in CRPS-I. These changes may be helpful in clarifying the pathophysiology of CRPS-I. Fourteen patients with therapy resistant and longstanding CRPS-I, underwent an amputation of the affected limb. In all patients histological analysis showed extensive changes in muscle tissue, such as fatty degeneration, fibre atrophy and nuclear clumping, which was not related to duration of CRPS-I prior to amputation. In all muscles affected, both type 1 and type 2 fibre atrophy was found, without selective type 2 fibre atrophy. In four patients, type grouping was observed, indicating a sequence of denervation and reinnervation of muscle tissue. In two patients even large group atrophy was present, suggesting new denervation after reinnervation. Comparison between subgroups in arms and legs showed no difference in the number of changes in muscle tissue. Intrinsic and extrinsic muscles were affected equally. Our findings show that in the chronic phase of CRPS-I extensive changes can be seen in muscle tissue, not related to duration of CRPS-I symptoms. Signs of neurogenic myopathy were present in five patients.
Insulin Resistance and Increased Muscle Cytokine Levels in Patients With Mitochondrial Myopathy
DEFF Research Database (Denmark)
Rue, Nana; Vissing, John; Galbo, Henrik
2014-01-01
CONTEXT: Mitochondrial dysfunction has been proposed to cause insulin resistance and that might stimulate cytokine production. OBJECTIVE: The objective of the study was to elucidate the association between mitochondrial myopathy, insulin sensitivity, and cytokine levels in muscle. DESIGN......: The intervention included a 120-minute hyperinsulinemic, euglycemic clamp. Another morning, microdialysis of both vastus lateralis muscles for 4 hours, including one-legged, knee extension exercise for 30 minutes, was performed. MAIN OUTCOME MEASURES: Glucose infusion rate during 90-120 minutes of insulin infusion...... was measured. Cytokine concentrations in dialysate were also measured. RESULTS: Muscle strength, percentage fat mass, and creatine kinase in plasma did not differ between groups. The maximal oxygen uptake was 21 ± 3 (SE) (P) and 36 ± 3(C) mL/kg·min (2P insulin, C-peptide, and glucagon were higher...
Directory of Open Access Journals (Sweden)
Hou-min YIN
2014-06-01
Full Text Available Background The main clinical manifestations of mitochondrial myopathy are chronic limb weakness and muscular soreness. Subclinical peripheral nerve injury is also reported, but acute axonal neuropathy.like syndrome concurrent with lactic acidosis is rare. In this paper the clinical features of 2 patients presenting as acute lactic acidosis and sudden muscle weakness were analyzed. Pathological changes and genetic mutations were detected. Methods Electromyography (EMG and muscle biopsy were performed. Modified Gomori trichrome (MGT and succinodehydrogenase (SDH staining were used to identify pathological changes. Changes of ultra microstructure of muscular tissue were observed under electron microscope. Mitochondrial DNA (mtDNA full length sequencing was performed using 24 pairs of partially overlapping primers. Results EMG showed a coexistence of neurogenic and myogenic changes. Dramatic decrease of motor nerve amplitude and moderately reduced sensory nerve amplitude were observed but nerve conduction velocity was normal in both patients. Impressive ragged red fibers were seen on MGT staining. Electron microscope showed dramatic mitochondrial abnormalities in Case 1 and paracrystaline inclusions in Case 2. mtDNA sequencing showed 3243A > G mutation in Case 1 and 8344A > G mutation in Case 2. Conclusions Mitochondrial myopathy can present as metabolic crisis like acute lactic acidosis, dyspnea and acute motor axonal neuropathy.like syndrome. It is a life.threatening phenotype that needs more attention. doi: 10.3969/j.issn.1672-6731.2014.06.007
Unger, L; Nicholson, A; Jewitt, E M; Gerber, V; Hegeman, A; Sweetman, L; Valberg, S
2014-01-01
Hypoglycin A, found in seeds of Acer negundo, appears to cause seasonal pasture myopathy (SPM) in North America and is implicated in atypical myopathy (AM) in Europe. Acer negundo is uncommon in Europe. Thus, the potential source of hypoglycin A in Europe is unknown. We hypothesized that seeds of Acer pseudoplatanus were the source of hypoglycin A in Europe. Our objective was to determine the concentration of hypoglycin A in seeds of A. pseudoplatanus trees located in pastures where previous cases of AM had occurred. None. University of Berne records were searched to retrospectively identify 6 farms with 10 AM cases and 11 suspected AM deaths between 2007 and 2011. During October 2012, A. pseudoplatanus seeds were collected from 2 to 6 trees per pasture on 6 AM farms (7 pastures) from trees in or close to 2 pastures on 2 control farms where AM had not been previously reported. Hypoglycin A in seeds was analyzed by GC-MS. Acer pseudoplatanus trees were identified on all AM pastures. Hypoglycin A was detected in all A. pseudoplatanus seeds in highly variable concentrations ranging from 0.04 to 2.81 μg/mg (mean 0.69) on AM farms and 0.10 to 9.12 μg/mg (mean 1.59) on control farms. Preventing horses from grazing pastures containing A. pseudoplatanus seeds during late fall and early spring might be the best means to prevent AM. Copyright © 2014 by the American College of Veterinary Internal Medicine.
Herszberg, B; McCue, M E; Larcher, T; Mata, X; Vaiman, A; Chaffaux, S; Chérel, Y; Valberg, S J; Mickelson, J R; Guérin, G
2009-02-01
Glycogen storage diseases or glycogenoses are inherited diseases caused by abnormalities of enzymes that regulate the synthesis or degradation of glycogen. Deleterious mutations in many genes of the glyco(geno)lytic or the glycogenesis pathways can potentially cause a glycogenosis, and currently mutations in fourteen different genes are known to cause animal or human glycogenoses, resulting in myopathies and/or hepatic disorders. The genetic bases of two forms of glycogenosis are currently known in horses. A fatal neonatal polysystemic type IV glycogenosis, inherited recessively in affected Quarter Horse foals, is due to a mutation in the glycogen branching enzyme gene (GBE1). A second type of glycogenosis, termed polysaccharide storage myopathy (PSSM), is observed in adult Quarter Horses and other breeds. A severe form of PSSM also occurs in draught horses. A mutation in the skeletal muscle glycogen synthase gene (GYS1) was recently reported to be highly associated with PSSM in Quarter Horses and Belgian draught horses. This GYS1 point mutation appears to cause a gain-of-function of the enzyme and to result in the accumulation of a glycogen-like, less-branched polysaccharide in skeletal muscle. It is inherited as a dominant trait. The aim of this work was to test for possible associations between genetic polymorphisms in four candidate genes of the glycogen pathway or the GYS1 mutation in Cob Normand draught horses diagnosed with PSSM by muscle biopsy.
Role of TGF-β signaling in inherited and acquired myopathies
Directory of Open Access Journals (Sweden)
Burks Tyesha N
2011-05-01
Full Text Available Abstract The transforming growth factor-beta (TGF-β superfamily consists of a variety of cytokines expressed in many different cell types including skeletal muscle. Members of this superfamily that are of particular importance in skeletal muscle are TGF-β1, mitogen-activated protein kinases (MAPKs, and myostatin. These signaling molecules play important roles in skeletal muscle homeostasis and in a variety of inherited and acquired neuromuscular disorders. Expression of these molecules is linked to normal processes in skeletal muscle such as growth, differentiation, regeneration, and stress response. However, chronic elevation of TGF-β1, MAPKs, and myostatin is linked to various features of muscle pathology, including impaired regeneration and atrophy. In this review, we focus on the aberrant signaling of TGF-β in various disorders such as Marfan syndrome, muscular dystrophies, sarcopenia, and critical illness myopathy. We also discuss how the inhibition of several members of the TGF-β signaling pathway has been implicated in ameliorating disease phenotypes, opening up novel therapeutic avenues for a large group of neuromuscular disorders.
Quantitative nailfold video capillaroscopy in patients with idiopathic inflammatory myopathy.
Mercer, Louise K; Moore, Tonia L; Chinoy, Hector; Murray, Andrea K; Vail, Andy; Cooper, Robert G; Herrick, Ariane L
2010-09-01
To quantify nailfold capillary density and dimensions in patients with idiopathic inflammatory myopathy (IIM) and compare them with those in healthy controls; to look for associations with microvascular disease in IIM; and to determine whether nailfold capillary density and dimensions change over time. Nailfold video microscopy (x300 magnification) was performed on 24 patients with IIM and 35 healthy controls. Capillary density and dimensions (total width and apical width) were quantified. Patients were clinically assessed and disease activity recorded using the Myositis Disease Activity Assessment Tool. Disease severity and physical function were assessed using the myositis damage index and Stanford HAQ, respectively. Findings were analysed using linear and logistic regression, adjusted for age and sex. In a subgroup of 16 patients with IIM and 27 controls, the process was repeated 6-12 months later and the results were analysed using Student's t-test. Capillary density was lower and dimensions were higher in patients with IIM compared with healthy controls (P nailfold capillaroscopy, suggesting that nailfold capillaroscopy may be useful as an outcome measure of microvascular disease in studies of IIM.
Magmatic controls on axial relief and faulting at mid-ocean ridges
Liu, Zhonglan; Buck, W. Roger
2018-06-01
Previous models do not simultaneously reproduce the observed range of axial relief and fault patterns at plate spreading centers. We suggest that this failure is due to the approximation that magmatic dikes open continuously rather than in discrete events. During short - lived events, dikes open not only in the strong axial lithosphere but also some distance into the underlying weaker asthenosphere. Axial valley relief affects the partitioning of magma between the lithosphere and asthenosphere during diking events. The deeper the valley, the more magma goes into lithospheric dikes in each event and so the greater the average opening rate of those dikes. The long-term rate of lithospheric dike opening controls faulting rate and axial depth. The feedback between axial valley depth D and lithospheric dike opening rate allows us to analytically relate steady-state values of D to lithospheric thickness HL and crustal thickness HC. A two-dimensional model numerical model with a fixed axial lithospheric structure illustrates the analytic model implications for axial faulting. The predictions of this new model are broadly consistent with global and segment-scale trends of axial depth and fault patterns with HL and HC.
Radial loads and axial thrusts on centrifugal pumps
International Nuclear Information System (INIS)
Anon.
1986-01-01
The proceedings of a seminar organised by the Power Industries Division of the IMechE are presented in this text. Complete contents: Review of parameters influencing hydraulic forces on centrifugal impellers; The effect of fluid forces at various operation conditions on the vibrations of vertical turbine pumps; A review of the pump rotor axial equilibrium problem - some case studies; Dynamic hydraulic loading on a centrifugal pump impeller; Experimental research on axial thrust loads of double suction centrifugal pumps; A comparison of pressure distribution and radial loads on centrifugal pumps; A theoretical and experimental investigation of axial thrusts within a multi-stage centrifugal pump
The effects of initial rise and axial loads on MEMS arches
Tella, Sherif Adekunle
2017-04-07
Arch microbeams have been utilized and proposed for many uses over the past few years due to their large tunability and bistability. However, recent experimental data have shown different mechanical behavior of arches when subjected to axial loads. This paper aims to investigate in depth the influence of the competing effects of initial rise and axial loads on the mechanical behavior of micromachined arches; mainly their static deflection and resonant frequencies. Based on analytical solutions, the static response and eigenvalue problems are analyzed for various values of initial rises and axial loads. Universal curves showing the variation of the first three resonance frequencies of the arch are generated for various values of initial rise under both tensile and compressive axial loads. This study shows that increasing the tensile or compressive axial loads for different values of initial rise may lead to either increase in the stiffness of the beam or initial decrease in the stiffness, which later increases as the axial load is increased depending on the dominant effect of the initial rise of the arch and the axial load. The obtained universal curves represent useful design tools to predict the tunability of arches under axial loads for various values of initial rises. The use of the universal curves is demonstrated with an experimental case study. Analytical formulation is developed to predict the point of minimum where the trend of the resonance frequency versus axial loads changes qualitatively due to the competing effects of axial loads and initial curvature.
Quasi-renormalization of the axial vector model
International Nuclear Information System (INIS)
Schweda, M.
1979-01-01
Using the regulator-free BPHZL renormalization scheme the problem of anomalies in a massive axial vector meson model is reinvestigated. The Adler-Bardeen-Bell-Jackiw anomaly introduces some impressive modifications: the nontrivial self-energy and the counterterm of the longitudinal part of the axial vector field depend on the anomaly via the anomalous Ward identity. The investigations are based on a Fermi-type gauge. (author)
Effect of axial heat flux distribution on CHF
Energy Technology Data Exchange (ETDEWEB)
Park, Cheol
2000-10-01
Previous investigations for the effect of axial heat flux distributions on CHF and the prediction methods are reviewed and summarized. A total of 856 CHF data in a tube with a non-uniform axial heat flux distribution has been compiled from the articles and analyzed using the 1995 Groeneveld look-up table. The results showed that two representative correction factors, K5 of the look-up table and Tongs F factor, can be applied to describe the axial heat flux distribution effect on CHF. However, they overpredict slightly the measured CHF, depending on the quality and flux peak shape. Hence, a corrected K5 factor, which accounts for the axial heat flux distribution effect is suggested to correct these trends. It predicted the CHF power for the compiled data with an average error of 1.5% and a standard deviation of 10.3%, and also provides a reasonable prediction of CHF locations.
Continuous millennial decrease of the Earth's magnetic axial dipole
Poletti, Wilbor; Biggin, Andrew J.; Trindade, Ricardo I. F.; Hartmann, Gelvam A.; Terra-Nova, Filipe
2018-01-01
Since the establishment of direct estimations of the Earth's magnetic field intensity in the first half of the nineteenth century, a continuous decay of the axial dipole component has been observed and variously speculated to be linked to an imminent reversal of the geomagnetic field. Furthermore, indirect estimations from anthropologically made materials and volcanic derivatives suggest that this decrease began significantly earlier than direct measurements have been available. Here, we carefully reassess the available archaeointensity dataset for the last two millennia, and show a good correspondence between direct (observatory/satellite) and indirect (archaeomagnetic) estimates of the axial dipole moment creating, in effect, a proxy to expand our analysis back in time. Our results suggest a continuous linear decay as the most parsimonious long-term description of the axial dipole variation for the last millennium. We thus suggest that a break in the symmetry of axial dipole moment advective sources occurred approximately 1100 years earlier than previously described. In addition, based on the observed dipole secular variation timescale, we speculate that the weakening of the axial dipole may end soon.
Nemaline myopathy and heart failure: role of ivabradine; a case report.
Sarullo, Filippo M; Vitale, Giuseppe; Di Franco, Antonino; Sarullo, Silvia; Salerno, Ylenia; Vassallo, Laura; Baviera, Emanuela Petrona; Marazia, Stefania; Mandalà, Giorgio; Lanza, Gaetano A
2015-01-19
Nemaline myopathy (NM) is a rare congenital myopathy characterized by muscle weakness, hypotonia and the presence in muscle fibers of inclusions known as nemaline bodies and a wide spectrum of clinical phenotypes, ranging from severe forms with neonatal onset to asymptomatic forms. The adult-onset form is heterogeneous in terms of clinical presentation and disease progression. Cardiac involvement occurs in the minority of cases and little is known about medical management in this subgroup of NM patients. We report a rare case of heart failure (HF) in a patient with adult-onset NM in whom ivabradine proved to be able to dramatically improve the clinical picture. We report a case of a 37-year-old man with adult-onset NM, presenting with weakness and hypotonia of the proximal limb muscles and shoulder girdle, severely limiting daily activities. He developed progressive HF over a period of 6 months while attending a rehabilitation program, with reduced left ventricular ejection fraction (LVEF = 20%), manifested by dyspnea and signs of systemic congestion. The patient was started HF therapy with enalapril, carvedilol, spironolactone and loop diuretics. Target HF doses of these drugs (including carvedilol) were not reached because of symptomatic hypotension causing a high resting heart rate (HR) ≥70 beats per minute (bpm). Further deterioration of the clinical picture occurred with several life-threatening arrhythmic episodes requiring external defibrillation. An implantable cardioverter defibrillator (ICD) was then implanted. Persistent high resting HR was successfully treated with ivabradine with HR lowering from 90 bpm to 55 bpm at 1 month follow up, LVEF rising to 50% at 3 month follow up and to 54% at 2,5 year follow up. To date no more hospitalizations for heart failure occurred. A single hospitalization due to aspiration pneumonia required insertion of a tracheostomy tube to protect airways from further aspiration. At present, the patient is attending
Rimmed vacuoles in Becker muscular dystrophy have similar features with inclusion myopathies.
Momma, Kazunari; Noguchi, Satoru; Malicdan, May Christine V; Hayashi, Yukiko K; Minami, Narihiro; Kamakura, Keiko; Nonaka, Ikuya; Nishino, Ichizo
2012-01-01
Rimmed vacuoles in myofibers are thought to be due to the accumulation of autophagic vacuoles, and can be characteristic in certain myopathies with protein inclusions in myofibers. In this study, we performed a detailed clinical, molecular, and pathological characterization of Becker muscular dystrophy patients who have rimmed vacuoles in muscles. Among 65 Becker muscular dystrophy patients, we identified 12 patients who have rimmed vacuoles and 11 patients who have deletions in exons 45-48 in DMD gene. All patients having rimmed vacuoles showed milder clinical features compared to those without rimmed vacuoles. Interestingly, the rimmed vacuoles in Becker muscular dystrophy muscles seem to represent autophagic vacuoles and are also associated with polyubiquitinated protein aggregates. These findings support the notion that rimmed vacuoles can appear in Becker muscular dystrophy, and may be related to the chronic changes in muscle pathology induced by certain mutations in the DMD gene.
Rimmed vacuoles in Becker muscular dystrophy have similar features with inclusion myopathies.
Directory of Open Access Journals (Sweden)
Kazunari Momma
Full Text Available Rimmed vacuoles in myofibers are thought to be due to the accumulation of autophagic vacuoles, and can be characteristic in certain myopathies with protein inclusions in myofibers. In this study, we performed a detailed clinical, molecular, and pathological characterization of Becker muscular dystrophy patients who have rimmed vacuoles in muscles. Among 65 Becker muscular dystrophy patients, we identified 12 patients who have rimmed vacuoles and 11 patients who have deletions in exons 45-48 in DMD gene. All patients having rimmed vacuoles showed milder clinical features compared to those without rimmed vacuoles. Interestingly, the rimmed vacuoles in Becker muscular dystrophy muscles seem to represent autophagic vacuoles and are also associated with polyubiquitinated protein aggregates. These findings support the notion that rimmed vacuoles can appear in Becker muscular dystrophy, and may be related to the chronic changes in muscle pathology induced by certain mutations in the DMD gene.
Dechanneling function for relativistic axially channeled electrons
International Nuclear Information System (INIS)
Muralev, V.A.; Telegin, V.I.
1981-01-01
Behaviour of the x(t) dechanneling function depending on the depth is theoretically studied. Theoretical consideration of x(t) for axial channeled relativistic electrons in anisotropic medium results in two-dimensional kinetic equation with mixed derivatives of the parabolic type. The kinetic equation in the approximation of the continuous Lindchard model for relativistic axial channeled electrons is numerically solved. The depth dependence of the x(t) dechanneling function is obtained [ru
Singlet axial constant from QCD sum rules
International Nuclear Information System (INIS)
Belitskij, A.V.; Teryaev, O.V.
1995-01-01
We analyze the singlet axial form factor of the proton for small momentum transferred in the framework of QCD sum rules using the interpolating nucleon current which explicitly accounts for the gluonic degrees of freedom. As the result we come to the quantitative prediction of the singlet axial constant. It is shown that the bilocal power corrections play the most important role in the analysis. 21 refs., 3 figs
International Nuclear Information System (INIS)
Wang, Xiaojuan; Tse, Peter W; Dordjevich, Alexandar
2011-01-01
The reflection signal from a defect in the process of guided wave-based pipeline inspection usually includes sufficient information to detect and define the defect. In previous research, it has been found that the reflection of guided waves from even a complex defect primarily results from the interference between reflection components generated at the front and the back edges of the defect. The respective contribution of different parameters of a defect to the overall reflection can be affected by the features of the two primary reflection components. The identification of these components embedded in the reflection signal is therefore useful in characterizing the concerned defect. In this research, we propose a method of model-based parameter estimation with the aid of the Hilbert–Huang transform technique for the purpose of decomposition of a reflection signal to enable characterization of the pipeline defect. Once two primary edge reflection components are decomposed and identified, the distance between the reflection positions, which closely relates to the axial length of the defect, could be easily and accurately determined. Considering the irregular profiles of complex pipeline defects at their two edges, which is often the case in real situations, the average of varied axial lengths of such a defect along the circumference of the pipeline is used in this paper as the characteristic value of actual axial length for comparison purpose. The experimental results of artificial defects and real corrosion in sample pipes were considered in this paper to demonstrate the effectiveness of the proposed method
Mutations in the satellite cell gene MEGF10 cause a recessive congenital myopathy with minicores.
Boyden, Steven E; Mahoney, Lane J; Kawahara, Genri; Myers, Jennifer A; Mitsuhashi, Satomi; Estrella, Elicia A; Duncan, Anna R; Dey, Friederike; DeChene, Elizabeth T; Blasko-Goehringer, Jessica M; Bönnemann, Carsten G; Darras, Basil T; Mendell, Jerry R; Lidov, Hart G W; Nishino, Ichizo; Beggs, Alan H; Kunkel, Louis M; Kang, Peter B
2012-05-01
We ascertained a nuclear family in which three of four siblings were affected with an unclassified autosomal recessive myopathy characterized by severe weakness, respiratory impairment, scoliosis, joint contractures, and an unusual combination of dystrophic and myopathic features on muscle biopsy. Whole genome sequence from one affected subject was filtered using linkage data and variant databases. A single gene, MEGF10, contained nonsynonymous mutations that co-segregated with the phenotype. Affected subjects were compound heterozygous for missense mutations c.976T > C (p.C326R) and c.2320T > C (p.C774R). Screening the MEGF10 open reading frame in 190 patients with genetically unexplained myopathies revealed a heterozygous mutation, c.211C > T (p.R71W), in one additional subject with a similar clinical and histological presentation as the discovery family. All three mutations were absent from at least 645 genotyped unaffected control subjects. MEGF10 contains 17 atypical epidermal growth factor-like domains, each of which contains eight cysteine residues that likely form disulfide bonds. Both the p.C326R and p.C774R mutations alter one of these residues, which are completely conserved in vertebrates. Previous work showed that murine Megf10 is required for preserving the undifferentiated, proliferative potential of satellite cells, myogenic precursors that regenerate skeletal muscle in response to injury or disease. Here, knockdown of megf10 in zebrafish by four different morpholinos resulted in abnormal phenotypes including unhatched eggs, curved tails, impaired motility, and disorganized muscle tissue, corroborating the pathogenicity of the human mutations. Our data establish the importance of MEGF10 in human skeletal muscle and suggest satellite cell dysfunction as a novel myopathic mechanism.
Inception mechanism and suppression of rotating stall in an axial-flow fan
International Nuclear Information System (INIS)
Nishioka, T
2013-01-01
Inception patterns of rotating stall at two stagger-angle settings for the highly loaded rotor blades were experimentally investigated in a low-speed axial-flow fan. Rotor-tip flow fields were also numerically investigated to clarify the mechanism behind the rotating stall inception. The stall inception patterns depended on the rotor stagger-angle settings. The stall inception from a rotating instability was confirmed at the design stagger-angle settings. The stall inception from a short length-scale stall cell (spike) was also confirmed at the small stagger-angle setting. The spillage of tip-leakage flow and the tip-leakage vortex breakdown influence the rotating stall inception. An air-separator has been developed based on the clarified inception mechanism of rotating stall. The rotating stall was suppressed by the developed air-separator, and the operating range of fan was extended towards low flow rate. The effect of developed air-separator was also confirmed by application to a primary air fan used in a coal fired power plant. It is concluded from these results that the developed air-separator can provide a wide operating range for an axial-flow fan
Axial clamp for nuclear reactor head penetration conoseal joints
International Nuclear Information System (INIS)
Hackley, T.A.
1986-01-01
A method for forming a sealed coupling between two bodies each body presenting an abutment surface, the bodies being arranged so that their respective abutment surfaces are axially adjacent one another and define a space therebetween in which a deformable gasket is disposed. An axial external force is applied to the bodies for compressing the abutment surfaces together against the gasket to form a seal between the bodies and the bodies are immobilized relative to one another while the external force is being applied to the bodies so that sufficient compression will be maintained by the abutment surfaces to preserve the integrity of the seal when the external axial force is withdrawn. The external axial force is then withdrawn, leaving the two bodies coupled together via the seal. (author)
Directory of Open Access Journals (Sweden)
Akihito Tanaka
Full Text Available The establishment of human induced pluripotent stem cells (hiPSCs has enabled the production of in vitro, patient-specific cell models of human disease. In vitro recreation of disease pathology from patient-derived hiPSCs depends on efficient differentiation protocols producing relevant adult cell types. However, myogenic differentiation of hiPSCs has faced obstacles, namely, low efficiency and/or poor reproducibility. Here, we report the rapid, efficient, and reproducible differentiation of hiPSCs into mature myocytes. We demonstrated that inducible expression of myogenic differentiation1 (MYOD1 in immature hiPSCs for at least 5 days drives cells along the myogenic lineage, with efficiencies reaching 70-90%. Myogenic differentiation driven by MYOD1 occurred even in immature, almost completely undifferentiated hiPSCs, without mesodermal transition. Myocytes induced in this manner reach maturity within 2 weeks of differentiation as assessed by marker gene expression and functional properties, including in vitro and in vivo cell fusion and twitching in response to electrical stimulation. Miyoshi Myopathy (MM is a congenital distal myopathy caused by defective muscle membrane repair due to mutations in DYSFERLIN. Using our induced differentiation technique, we successfully recreated the pathological condition of MM in vitro, demonstrating defective membrane repair in hiPSC-derived myotubes from an MM patient and phenotypic rescue by expression of full-length DYSFERLIN (DYSF. These findings not only facilitate the pathological investigation of MM, but could potentially be applied in modeling of other human muscular diseases by using patient-derived hiPSCs.
Tanaka, Akihito; Woltjen, Knut; Miyake, Katsuya; Hotta, Akitsu; Ikeya, Makoto; Yamamoto, Takuya; Nishino, Tokiko; Shoji, Emi; Sehara-Fujisawa, Atsuko; Manabe, Yasuko; Fujii, Nobuharu; Hanaoka, Kazunori; Era, Takumi; Yamashita, Satoshi; Isobe, Ken-ichi; Kimura, En; Sakurai, Hidetoshi
2013-01-01
The establishment of human induced pluripotent stem cells (hiPSCs) has enabled the production of in vitro, patient-specific cell models of human disease. In vitro recreation of disease pathology from patient-derived hiPSCs depends on efficient differentiation protocols producing relevant adult cell types. However, myogenic differentiation of hiPSCs has faced obstacles, namely, low efficiency and/or poor reproducibility. Here, we report the rapid, efficient, and reproducible differentiation of hiPSCs into mature myocytes. We demonstrated that inducible expression of myogenic differentiation1 (MYOD1) in immature hiPSCs for at least 5 days drives cells along the myogenic lineage, with efficiencies reaching 70–90%. Myogenic differentiation driven by MYOD1 occurred even in immature, almost completely undifferentiated hiPSCs, without mesodermal transition. Myocytes induced in this manner reach maturity within 2 weeks of differentiation as assessed by marker gene expression and functional properties, including in vitro and in vivo cell fusion and twitching in response to electrical stimulation. Miyoshi Myopathy (MM) is a congenital distal myopathy caused by defective muscle membrane repair due to mutations in DYSFERLIN. Using our induced differentiation technique, we successfully recreated the pathological condition of MM in vitro, demonstrating defective membrane repair in hiPSC-derived myotubes from an MM patient and phenotypic rescue by expression of full-length DYSFERLIN (DYSF). These findings not only facilitate the pathological investigation of MM, but could potentially be applied in modeling of other human muscular diseases by using patient-derived hiPSCs. PMID:23626698
Musset, Lucile; Allenbach, Yves; Benveniste, Olivier; Boyer, Olivier; Bossuyt, Xavier; Bentow, Chelsea; Phillips, Joe; Mammen, Andrew; Van Damme, Philip; Westhovens, René; Ghirardello, Anna; Doria, Andrea; Choi, May Y; Fritzler, Marvin J; Schmeling, Heinrike; Muro, Yoshinao; García-De La Torre, Ignacio; Ortiz-Villalvazo, Miguel A; Bizzaro, Nicola; Infantino, Maria; Imbastaro, Tiziana; Peng, Qinglin; Wang, Guochun; Vencovský, Jiří; Klein, Martin; Krystufkova, Olga; Franceschini, Franco; Fredi, Micaela; Hue, Sophie; Belmondo, Thibaut; Danko, Katalin; Mahler, Michael
2016-10-01
In an effort to find naturally occurring substances that reduce cholesterol by inhibiting 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMGCR), statins were first discovered by Endo in 1972. With the widespread prescription and use of statins to decrease morbidity from myocardial infarction and stroke, it was noted that approximately 5% of all statin users experienced muscle pain and weakness during treatment. In a smaller proportion of patients, the myopathy progressed to severe morbidity marked by proximal weakness and severe muscle wasting. Remarkably, Mammen and colleagues were the first to discover that the molecular target of statins, 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGCR), is an autoantibody target in patients that develop an immune-mediated necrotizing myopathy (IMNM). These observations have been confirmed in a number of studies but, until today, a multi-center, international study of IMNM, related idiopathic inflammatory myopathies (IIM), other auto-inflammatory conditions and controls has not been published. Accordingly, an international, multi-center study investigated the utility of anti-HMGCR antibodies in the diagnosis of statin-associated IMNM in comparison to different forms of IIM and controls. This study included samples from patients with different forms of IIM (n=1250) and patients with other diseases (n=656) that were collected from twelve sites and tested for anti-HMGCR antibodies by ELISA. This study confirmed that anti-HMGCR autoantibodies, when found in conjunction with statin use, characterize a subset of IIM who are older and have necrosis on muscle biopsy. Taken together, the data to date indicates that testing for anti-HMGCR antibodies is important in the differential diagnosis of IIM and might be considered for future classification criteria. Copyright © 2016. Published by Elsevier B.V.
[Myopia: frequency of lattice degeneration and axial length].
Martín Sánchez, M D; Roldán Pallarés, M
2001-05-01
To evaluate the relationship between lattice retinal degeneration and axial length of the eye in different grades of myopia. A sample of 200 eyes from 124 myopic patients was collected by chance. The average age was 34.8 years (20-50 years) and the myopia was between 0.5 and 20 diopters (D). The eyes were grouped according to the degree of refraction defect, the mean axial length of each group (Scan A) and the frequency of lattice retinal degeneration and the relationship between these variables was studied. The possible influence of age on our results was also considered. For the statistical analysis, the SAS 6.07 program with the variance analysis for quantitative variables, and chi(2) test for qualitative variables with a 5% significance were used. A multivariable linear regression model was also adjusted. The highest frequency of lattice retinal degeneration occurred in those myopia patients having more than 15 D, and also in the group of myopia patients between 3 and 6 D, but this did not show statistical significance when compared with the other myopic groups. If the axial length is assessed, a greater frequency of lattice retinal degeneration is also found when the axial length is 25-27 mm and 29-30 mm, which correspond, respectively, to myopias between 3-10 D and more than 15 D. When the multivariable linear regression model was adjusted, the axial length showed the existence of lattice retinal degeneration (beta 0.41 mm; p=0.08) adjusted by the number of diopters (beta 0.38 mm; plattice retinal degeneration was found for myopias with axial eye length between 29-30 mm (more than 15 D), and 25-27 mm (between 3-10 D).
Investigation of angular and axial smoothing of PET data
International Nuclear Information System (INIS)
Daube-Witherspoon, M.E.; Carson, R.E.
1996-01-01
Radial filtering of emission and transmission data is routinely performed in PET during reconstruction in order to reduce image noise. Angular smoothing is not typically done, due to the introduction of a non-uniform resolution loss; axial filtering is also not usually performed on data acquired in 2D mode. The goal of this paper was to assess the effects of angular and axial smoothing on noise and resolution. Angular and axial smoothing was incorporated into the reconstruction process on the Scanditronix PC2048-15B brain PET scanner. In-plane spatial resolution and noise reduction were measured for different amounts of radial and angular smoothing. For radial positions away from the center of the scanner, noise reduction and degraded tangential resolution with no loss of radial resolution were seen. Near the center, no resolution loss was observed, but there was also no reduction in noise for angular filters up to a 7 degrees FWHM. These results can be understood by considering the combined effects of smoothing projections across rows (angles) and then summing (backprojecting). Thus, angular smoothing is not optimal due to its anisotropic noise reduction and resolution degradation properties. However, uniform noise reduction comparable to that seen with radial filtering can be achieved with axial smoothing of transmission data. The axial results suggest that combined radial and axial transmission smoothing could lead to improved noise characteristics with more isotropic resolution degradation
Axial clamp for nuclear reactor head penetration conoseal joints
International Nuclear Information System (INIS)
Hackley, T.A.
1987-01-01
A method is described for forming a sealed coupling between two bodies, each body presenting an annular abutment surface. The respective bodies are arranged so that their respective annular abutment surfaces are axially adjacent one another, defining a space therebetween, wherein a deformable gasket is disposed within the space. The method comprises: providing one of the bodies with an annular projection; providing the other body with threads for receiving an annular locknut which can be tightened to bear against the annular projection of the one body; applying an external axial forced to the bodies for compressing the abutment surfaces together against the gasket to form a seal between the bodies; immobilizing the bodies relative to one another while the external force is being applied to the bodies by hand-tightening an annular locknut via the threads of the other body until the locknut abuts the annular projection of the one body, substantially preventing relative axial movement between the bodies when the external axial force is withdrawn; and withdrawing the external axial force applied to the bodies, leaving the two bodies coupled together via the seal
Ball Screw Actuator Including an Axial Soft Stop
Wingett, Paul T. (Inventor); Forrest, Steven Talbert (Inventor); Abel, Steve (Inventor); Woessner, George (Inventor); Hanlon, Casey (Inventor)
2016-01-01
An actuator includes an actuator housing, a ball screw, and an axial soft stop assembly. The ball screw extends through the actuator housing and has a first end and a second end. The ball screw is coupled to receive a drive force and is configured, upon receipt of the drive force, to selectively move in a retract direction and an extend direction. The axial soft stop assembly is disposed within the actuator housing. The axial soft stop assembly is configured to be selectively engaged by the ball screw and, upon being engaged thereby, to translate, with compliance, a predetermined distance in the extend direction, and to prevent further movement of the ball screw upon translating the predetermined distance.
Axial Vircator for Electronic Warfare Applications
Directory of Open Access Journals (Sweden)
L. Drazan
2009-12-01
Full Text Available This paper deals with a high power microwave generator with virtual cathode – vircator in axial release for electronic warfare applications. The classification of directed energy weapons microwave (DEWM is introduced together with basic block diagrams of a particular class of DEWM. In the paper, methods for designing vircator pulsed power supply, axial vircator structure, measurement methods and experimental results are presented. The vircator in electromagnetic ammunition is powered by magneto-cumulative generator and in weapons for defense of objects (WDO, it is powered by Marx generator. The possible applications of a vircator in the DEWM area are discussed.
Generalized dynamic model and control of ambiguous mono axial vehicle robot
Directory of Open Access Journals (Sweden)
Frantisek Duchon
2016-09-01
Full Text Available This article deals with the novel concept of ambiguous mono axial vehicle robot. Such robot is a combination of Segway and dicycle, which utilizes the advantages of each chassis. The advantage of dicycle is lower energy consumption during the movement and the higher safety of carried payload. The movable platform inside the ambiguous mono axial vehicle allows using the various sensors or devices. This will change the ambiguous mono axial vehicle to the Segway type robot. Both these modes are necessary to control in the stable mode to ensure the safety of the ambiguous mono axial vehicle’s movement. The main contents of the article contain description of generalized dynamic model of ambiguous mono axial vehicle and related control of ambiguous mono axial vehicle. The proposal is unique in that the same controller is used for both modes. Several simulations verify proposed control schemes and identified parameters. Moreover, the dicycle type of platform has never been used in robotics and that is another novelty.
Measurement for cobalt target activity and its axial distribution
International Nuclear Information System (INIS)
Li Xingyuan; Chen Zigen.
1985-01-01
Cobalt target activity and its axial distribution are measured in process of producing radioactive isotopes 60 Co by irradiation in HFETR. Cobalt target activity is obtained with measured data at 3.60 m and 4.60 m, relative axial distribution of cobalt target activity is obtained with one at 30 cm, and axial distribution of cobalt target activity(or specific activity) is obtained with both of data. The difference between this specific activity and measured result for 60 Co teletherapy sources in the end is less than +- 5%
The spin of the proton and the axial anomaly
International Nuclear Information System (INIS)
Hatsuda, T.; Zahed, I.
1989-01-01
We show that a consistent treatment of the abelian axial anomaly in a two-phase model of the proton yields a flavor singlet axial current that is saturated by the anomaly at Q 2 =0 in the chiral limit. This result suggests that at Q 2 =0 the matrix element of the flavor singlet axial current in a polarized proton state is small while the proton spin is still one-half. Modulo the QCD evolution equation, this result is in fair agreement with the recent EMC data. (orig.)
Axial to transverse energy mixing dynamics in octupole-based magnetostatic antihydrogen traps
Zhong, M.; Fajans, J.; Zukor, A. F.
2018-05-01
The nature of the trajectories of antihydrogen atoms confined in an octupole minimum-B trap is of great importance for upcoming spectroscopy, cooling, and gravity experiments. Of particular interest is the mixing time between the axial and transverse energies for the antiatoms. Here, using computer simulations, we establish that almost all trajectories are chaotic, and then quantify the characteristic mixing time between the axial and transverse energies. We find that there are two classes of trajectories: for trajectories whose axial energy is higher than about 20% of the total energy, the axial energy substantially mixes within about 10 s, whereas for trajectories whose axial energy is lower than about 10% of the total energy, the axial energy remains nearly constant for 1000 s or longer.
Test Setup for Axially Loaded Piles in Sand
DEFF Research Database (Denmark)
Thomassen, Kristina
The test setup for testing axially static and cyclic loaded piles in sand is described in the following. The purpose for the tests is to examine the tensile capacity of axially loaded piles in dense fully saturated sand. The pile dimensions are chosen to resemble full scale dimension of piles used...... in offshore pile foundations today....
An axial calculation method for accurate two-dimensional PWR core simulation
International Nuclear Information System (INIS)
Grimm, P.
1985-02-01
An axial calculation method, which improves the agreement of the multiplication factors determined by two- and three-dimensional PWR neutronic calculations, is presented. The axial buckling is determined at each time point so as to reproduce the increase of the leakage due to the flattening of the axial power distribution and the effect of the axial variation of the group constants of the fuel on the reactivity is taken into account. The results of a test example show that the differences of k-eff and cycle length between two- and three-dimensional calculations, which are unsatisfactorily large if a constant buckling is used, become negligible if the results of the axial calculation are used in the two-dimensional core simulation. (Auth.)
OCULAR ASPECTS OF HYPERTHYROIDISM WITH SPECIAL REFERENCE TO OCULAR MYOPATHY
Directory of Open Access Journals (Sweden)
Mallika O. U
2017-04-01
Full Text Available BACKGROUND Hyperthyroidism can result in ocular manifestations even before systemic signs and symptoms develop. It is seen more in females and severe forms are more common in males. Early detection of ocular involvement can prevent vision threatening complications and troublesome discomforts affecting quality of vision. This clinical study highlights the importance of detailed ocular examination in hyperthyroidism. MATERIALS AND METHODS Fifty consecutive patients with ocular signs of hyperthyroidism were evaluated and followed up for an average period of 1 year. Detailed ocular examination included exophthalmometric measurements, ocular movements and Worth four-dot test. T3, T4, TSH, CT scan and antimicrosomal antibodies and antithyroglobulin antibodies were done along with routine investigations. Study Design- Prospective cohort study. RESULTS Statistical analysis did not reveal any correlation between the level of serum T3 and severity of ocular findings. Majority of the cases were euthyroid with moderate ocular myopathy having multiple muscle involvement. Inferior rectus was affected most. CONCLUSION The ocular signs of hyperthyroidism in the present study seem to be mild. The severe eye changes like corneal involvement and optic nerve changes were less common.
Directory of Open Access Journals (Sweden)
Roberto E. P. Sica
1975-06-01
Full Text Available Un estudio electrofisiológico detallado fué hecho en los músculos extensor corto de los dedos, de la eminencia tenar, de la eminencia hipotenar y soleo en un paciente con el diagnóstico de miopatía miotubular o centronuclear. El hallazgo principal fué una notoria reducción en el número de unidades motoras activas en todos los músculos investigados, en tanto que las unidades remanentes mostraron tamaño conservado. Las observaciones hechas se han interpretado como favoreciéndo la génesis neurógena en el desarrollo de este proceso.A detailed electrophysiological study has been made of the extensor digitorum brevis, thenar, hypothenar and soleus muscles in one patient with myotubular or centronuclear myopathy. The main finding was a noticeable reduction in the population of active motor units in all the investigated muscles. The remainer units showed normal sizes. The experimental observations have been interpreted in terms of a neuropathic process.
Directory of Open Access Journals (Sweden)
Zhiming Lin
2015-01-01
Full Text Available Objectives. To evaluate the efficiency and the predictive factors of clinical response of infliximab in active nonradiographic axial spondyloarthritis patients. Methods. Active nonradiographic patients fulfilling ESSG criteria for SpA but not fulfilling modified New York criteria were included. All patients received infliximab treatment for 24 weeks. The primary endpoint was ASAS20 response at weeks 12 and 24. The abilities of baseline parameters and response at week 2 to predict ASAS20 response at weeks 12 and 24 were assessed using ROC curve and logistic regression analysis, respectively. Results. Of 70 axial SpA patients included, the proportions of patients achieving an ASAS20 response at weeks 2, 6, 12, and 24 were 85.7%, 88.6%, 87.1%, and 84.3%, respectively. Baseline MRI sacroiliitis score (AUC = 0.791; P=0.005, CRP (AUC = 0.75; P=0.017, and ASDAS (AUC = 0.778, P=0.007 significantly predicted ASAS20 response at week 12. However, only ASDAS (AUC = 0.696, P=0.040 significantly predicted ASAS20 response at week 24. Achievement of ASAS20 response after the first infliximab infusion was a significant predictor of subsequent ASAS20 response at weeks 12 and 24 (wald χ2=6.87, P=0.009, and wald χ2=5.171, P=0.023. Conclusions. Infliximab shows efficiency in active nonradiographic axial spondyloarthritis patients. ASDAS score and first-dose response could help predicting clinical efficacy of infliximab therapy in these patients.
Reactive control of subsonic axial fan noise in a duct.
Liu, Y; Choy, Y S; Huang, L; Cheng, L
2014-10-01
Suppressing the ducted fan noise at low frequencies without varying the flow capacity is still a technical challenge. This study examines a conceived device consisting of two tensioned membranes backed with cavities housing the axial fan for suppression of the sound radiation from the axial fan directly. The noise suppression is achieved by destructive interference between the sound fields from the axial fan of a dipole nature and sound radiation from the membrane via vibroacoustics coupling. A two-dimensional model with the flow effect is presented which allows the performance of the device to be explored analytically. The air flow influences the symmetrical behavior and excites the odd in vacuo mode response of the membrane due to kinematic coupling. Such an asymmetrical effect can be compromised with off-center alignment of the axial fan. Tension plays an important role to sustain the performance to revoke the deformation of the membrane during the axial fan operation. With the design of four appropriately tensioned membranes covered by a cylindrical cavity, the first and second blade passage frequencies of the axial fan can be reduced by at least 20 dB. The satisfactory agreement between experiment and theory demonstrates that its feasibility is practical.
Dilaver, Nafi; Mazaheri, Neda; Maroofian, Reza; Zeighami, Jawaher; Seifi, Tahere; Zamani, Mina; Sedaghat, Alireza; Shariati, Gholam Reza; Galehdari, Hamid
2017-12-01
Ryanodine receptor 1 ( RYR1 ) is an intracellular calcium receptor primarily expressed in skeletal muscle with a role in excitation contraction. Both dominant and recessive mutations in the RYR1 gene cause a range of RYR1 -related myopathies and/or susceptibility to malignant hyperthermia (MH). Recently, an atypical manifestation of ptosis, variably presenting with ophthalmoplegia, facial paralysis, and scoliosis but without significant muscle weakness, has been reported in 9 cases from 4 families with bialleic variants in RYR1 . Two affected children from a consanguineous family with severe congenital ptosis, ophthalmoplegia, scoliosis, and distinctive long faces but without skeletal myopathy were studied. To identify the cause of the hereditary condition, DNA from the proband was subjected to whole exome sequencing (WES). WES revealed a novel homozygous missense variant in RYR1 (c.14066T>A; p.IIe4689Asn), which segregated within the family. Although the phenotype of the affected siblings in this study was similar to previously described cases, the clinical features were more severely expressed. Our findings contribute to the expansion of phenotypes related to RYR1 dysfunction. Additionally, it supports a new RYR1 -related clinical presentation without musculoskeletal involvement. It is important that individuals with RYR1 mutations are considered susceptible to MH, as 70% of the MH cases are caused by mutations in the RYR1 gene.
Equation of motion for the axial gravitational superfield
International Nuclear Information System (INIS)
Ogievetsky, V.; Sokatchev, E.
1980-01-01
Transformation properties of the axial supergravitational field variants are investigated. The equation of motion for the axial gravitational superfield is derived by direct variation of the N = 1 supergravity action. The left-hand side of this equation is a component of the torsion tensor, and the right-hand side is the supercurrent. The question about the cosmological term in supergravity is discussed
Development of vortex model with realistic axial velocity distribution
International Nuclear Information System (INIS)
Ito, Kei; Ezure, Toshiki; Ohshima, Hiroyuki
2014-01-01
A vortex is considered as one of significant phenomena which may cause gas entrainment (GE) and/or vortex cavitation in sodium-cooled fast reactors. In our past studies, the vortex is assumed to be approximated by the well-known Burgers vortex model. However, the Burgers vortex model has a simple but unreal assumption that the axial velocity component is horizontally constant, while in real the free surface vortex has the axial velocity distribution which shows large gradient in radial direction near the vortex center. In this study, a new vortex model with realistic axial velocity distribution is proposed. This model is derived from the steady axisymmetric Navier-Stokes equation as well as the Burgers vortex model, but the realistic axial velocity distribution in radial direction is considered, which is defined to be zero at the vortex center and to approach asymptotically to zero at infinity. As the verification, the new vortex model is applied to the evaluation of a simple vortex experiment, and shows good agreements with the experimental data in terms of the circumferential velocity distribution and the free surface shape. In addition, it is confirmed that the Burgers vortex model fails to calculate accurate velocity distribution with the assumption of uniform axial velocity. However, the calculation accuracy of the Burgers vortex model can be enhanced close to that of the new vortex model in consideration of the effective axial velocity which is calculated as the average value only in the vicinity of the vortex center. (author)
The deep structure of Axial Volcano
West, Michael Edwin
The subsurface structure of Axial Volcano, near the intersection of the Juan de Fuca Ridge and the Cobb-Eickelberg seamount chain in the northeast Pacific, is imaged from an active source seismic experiment. At a depth of 2.25 to 3.5 km beneath Axial lies an 8 km x 12 km region of very low seismic velocities that can only be explained by the presence of magma. In the center of this magma storage chamber at 2--3.5 km below sea floor, the crust is at least 10--20% melt. At depths of 4--5 km there is evidence of additional low concentrations of magma (a few percent) over a larger area. In total, 5--11 km3 of magma are stored in the mid-crust beneath Axial. This is more melt than has been positively identified under any basaltic volcano on Earth. It is also far more than the 0.1--0.2 km3 emplaced during the 1998 eruption. The implied residence time in the magma reservoir of a few hundred to a few thousand years agrees with geochemical trends which suggest prolonged storage and mixing of magmas. The large volume of melt bolsters previous observations that Axial provides much of the material to create crust along its 50 km rift zones. A high velocity ring-shaped feature sits above the magma chamber just outside the caldera walls. This feature is believed to be the result of repeated dike injections from the magma body to the surface during the construction of the volcanic edifice. A rapid change in crustal thickness from 8 to 11 km within 15 km of the caldera implies focused delivery of melt from the mantle. The high flux of magma suggests that melting occurs deeper in the mantle than along the nearby ridge. Melt supply to the volcano is not connected to any plumbing system associated with the adjacent segments of the Juan de Fuca Ridge. This suggests that, despite Axial's proximity to the ridge, the Cobb hot spot currently drives the supply of melt to the volcano.
Anisotropic yield surfaces in bi-axial cyclic plasticity
International Nuclear Information System (INIS)
Rider, R.J.; Harvey, S.J.; Breckell, T.H.
1985-01-01
Some aspects of the behaviour of yield surfaces and work-hardening surfaces occurring in biaxial cyclic plasticity have been studied experimentally and theoretically. The experimental work consisted of subjecting thin-walled tubular steel specimens to cyclic plastic torsion in the presence of sustained axial loads of various magnitudes. The experimental results show that considerable anisotropy is induced when the cyclic shear strains are dominant. Although the true shapes of yield and work-hardening surfaces can be very complex, a mathematical model is presented which includes both anisotropy and Bauschinger effects. The model is able to qualitatively predict the deformation patterns during a cycle of applied plastic shear strain for a range of sustained axial stresses and also indicate the material response to changes in axial stress. (orig.)
Light-front view of the axial anomaly
International Nuclear Information System (INIS)
Ji, C.; Rey, S.
1996-01-01
Motivated by an apparent puzzle of the light-front vacua incompatible with the axial anomaly, we have considered the two-dimensional massless Schwinger model for an arbitrary interpolating angle of Hornbostel close-quote s interpolating quantization surface. By examining spectral deformation of the Dirac sea under an external electric field semiclassically, we have found that the axial anomaly is quantization angle independent. This indicates an intricate nontrivial vacuum structure present even in the light-front limit. copyright 1996 The American Physical Society
Gravitational waves from the axial perturbations of hyperon stars
International Nuclear Information System (INIS)
Wen De-Hua; Yan Jing; Liu Xue-Mei
2012-01-01
The eigen-frequencies of the axial w-mode oscillations of hyperon stars are examined. It is shown that as the appearance of hyperons softens the equation of state of the super-density matter, the frequency of gravitational waves from the axial w-mode of hyperon star becomes smaller than that of a traditional neutron star at the same stellar mass. Moreover, the eigenfrequencies of hyperon stars also have scaling universality. It is shown that the EURO third-generation gravitational-wave detector has the potential to detect the gravitational-wave signal emitted from the axial w-mode oscillations of a hyperon star. (general)
Axial injection in Orsay superconducting cyclotron
International Nuclear Information System (INIS)
Depauw, J.; Kugler, M.F.; Legoff, A.; Potier, J.C.; Richomme, A.; Skowron, R.; Mandrillon, P.; Schapira, J.P.
1983-01-01
The compact superconducting cyclotron currently planned at IPN at Orsay is designed for light ion acceleration together with heavy ion acceleration. From the beginning, for this reason, a central geometry able to receive an inflector (to 90deg C) allowing the axial injection of low energy ion beams given by an outer source. The present study is aimed at showing the technical feasibility of theoretical results obtained on axial injection. First experimental study has been made of spatial repartition in three dimensions of electric potential developed by a central geometry of 3 electrodes. Then, the electric study of an electrostatic mirror has been made [fr
Bessel beam CARS of axially structured samples
Heuke, Sandro; Zheng, Juanjuan; Akimov, Denis; Heintzmann, Rainer; Schmitt, Michael; Popp, Jürgen
2015-06-01
We report about a Bessel beam CARS approach for axial profiling of multi-layer structures. This study presents an experimental implementation for the generation of CARS by Bessel beam excitation using only passive optical elements. Furthermore, an analytical expression is provided describing the generated anti-Stokes field by a homogeneous sample. Based on the concept of coherent transfer functions, the underling resolving power of axially structured geometries is investigated. It is found that through the non-linearity of the CARS process in combination with the folded illumination geometry continuous phase-matching is achieved starting from homogeneous samples up to spatial sample frequencies at twice of the pumping electric field wave. The experimental and analytical findings are modeled by the implementation of the Debye Integral and scalar Green function approach. Finally, the goal of reconstructing an axially layered sample is demonstrated on the basis of the numerically simulated modulus and phase of the anti-Stokes far-field radiation pattern.
Uniform Decay for Solutions of an Axially Moving Viscoelastic Beam
Energy Technology Data Exchange (ETDEWEB)
Kelleche, Abdelkarim, E-mail: kellecheabdelkarim@gmail.com [Université des Sciences et de la Technologie Houari Boumediene, Faculté des Mathématiques (Algeria); Tatar, Nasser-eddine, E-mail: tatarn@Kfupm.edu.sa [King Fahd University of Petroleum and Minerals, Department of Mathematics and Statistics (Saudi Arabia)
2017-06-15
The paper deals with an axially moving viscoelastic structure modeled as an Euler–Bernoulli beam. The aim is to suppress the transversal displacement (transversal vibrations) that occur during the axial motion of the beam. It is assumed that the beam is moving with a constant axial speed and it is subject to a nonlinear force at the right boundary. We prove that when the axial speed of the beam is smaller than a critical value, the dissipation produced by the viscoelastic material is sufficient to suppress the transversal vibrations. It is shown that the rate of decay of the energy depends on the kernel which arise in the viscoelastic term. We consider a general kernel and notice that solutions cannot decay faster than the kernel.
Atlanto-axial Subluxation in rheumatoid arthritis: description of a case
International Nuclear Information System (INIS)
Medina, Yimy F; Martinez V, Jose B; Restrepo, Jose Felix; Rondon H, Federico; Iglesias G, Antonio
2004-01-01
The damage of the spine by rheumatoid arthritis is multiple and a variety of affectations have been described at cervical level, being the anterior atlanto-axial subluxation and vertical subluxation the more common. However the posterior atlanto-axial subluxation has been rarely described. In this paper, we describe the case of a patient with posterior atlanto-axial subluxaction in addition to its infrequent manifestation of alteration of the lower cranial nerves as a manifestation of myelopathy
X linked neonatal centronuclear/myotubular myopathy: evidence for linkage to Xq28 DNA marker loci.
Thomas, N S; Williams, H; Cole, G; Roberts, K; Clarke, A; Liechti-Gallati, S; Braga, S; Gerber, A; Meier, C; Moser, H
1990-05-01
We have studied the inheritance of several polymorphic Xq27/28 DNA marker loci in two three generation families with the X linked neonatal lethal form of centronuclear/myotubular myopathy (XL MTM). We found complete linkage of XLMTM to all four informative Xq28 markers analysed, with GCP/RCP (Z = 3.876, theta = 0.00), with DXS15 (Z = 3.737, theta = 0.00), with DXS52 (Z = 2.709, theta = 0.00), and with F8C (Z = 1.020, theta = 0.00). In the absence of any observable recombination, we are unable to sublocalise the XLMTM locus further within the Xq28 region. This evidence for an Xq28 localisation may allow us to carry out useful genetic counselling within such families.
Analysis of axial compressive loaded beam under random support excitations
Xiao, Wensheng; Wang, Fengde; Liu, Jian
2017-12-01
An analytical procedure to investigate the response spectrum of a uniform Bernoulli-Euler beam with axial compressive load subjected to random support excitations is implemented based on the Mindlin-Goodman method and the mode superposition method in the frequency domain. The random response spectrum of the simply supported beam subjected to white noise excitation and to Pierson-Moskowitz spectrum excitation is investigated, and the characteristics of the response spectrum are further explored. Moreover, the effect of axial compressive load is studied and a method to determine the axial load is proposed. The research results show that the response spectrum mainly consists of the beam's additional displacement response spectrum when the excitation is white noise; however, the quasi-static displacement response spectrum is the main component when the excitation is the Pierson-Moskowitz spectrum. Under white noise excitation, the amplitude of the power spectral density function decreased as the axial compressive load increased, while the frequency band of the vibration response spectrum increased with the increase of axial compressive load.
Challa, Sundaram; Jakati, Saumya; Uppin, Megha S; Kannan, Meena A; Liza, Rajasekhar; Murthy Jagarlapudi, M K
2018-01-01
Bohan and Peter criteria are widely used for the diagnosis of idiopathic inflammatory myopathies (IIMs). Recently, European Neuromuscular Center (ENMC) formulated criteria to identify subgroups of IIMs. To compare the two diagnostic criteria in adult IIMs. This was a retrospective review of case records of histologically confirmed IIMs in adults between January 2014 and May 2015. Both the Bohan and Peter, and ENMC 2004 criteria were applied in the same group of patients to subgroup the IIMs. Muscle biopsy was evaluated in all the four domains: muscle fiber, inflammatory, connective tissue, and vascular, with the basic panel of histological stains. Sporadic inclusion body myositis (s-IBM) was diagnosed using ENMC IBM diagnostic research criteria 2011. During the study period, 69 patients fulfilled the ENMC criteria for IIMs including 16 patients with s-IBM. The subgrouping as per the ENMC criteria (53) was: dermatomyositis (DM) in 30; polymyositis (PM) in 2; immune-mediated necrotizing myopathy (IMNM) in 9; and nonspecific myositis (NM) in 12 patients, whereas subgrouping by the Bohan and Peter criteria was DM in 9 and PM with and without connective tissue disease (CTD) in 26 patients only. There was underdiagnosis of DM, as perifascicular atrophy is not recognized as a diagnostic histological feature, and overdiagnosis of PM with and without CTD due to poor characterization of histological features in PM by the Bohan and Peter criteria. Systematic evaluation of muscle biopsy according to the ENMC criteria with basic panel of histochemical stains improved the diagnostic yield of IIM significantly when compared to the Bohan and Peter criteria.
Escalas, Cécile; Dalichampt, Marie; Dougados, Maxime; Poiraudeau, Serge
2016-03-01
To evaluate the effect of physiotherapy on functional limitation in an observational cohort of early axial spondyloarthritis. prospective population-based cohort study. 708 patients with early axial spondyloarthritis between 2007 and 2010 naive of TNF blockers. early physiotherapy defined by at least eight supervised sessions of physical therapy during the first six months. the primary outcome was functional improvement defined by a relative improvement of at least 20% in BASFI at six months. Secondary outcomes were improvement in BASFI at one and two years and ASAS20 response criteria at six months. a propensity score of having physiotherapy was developed and multivariate analysis using propensity score weighting were used to assess the effect of physiotherapy on outcome. Overall, 166 (24%) patients had physiotherapy during the first six months. After using propensity score weighting, there was no functional improvement on the primary outcome in patients treated with early physical therapy (relative risk [IC95%]: 1.15 [0.91-1.45]). No differences were observed on secondary outcomes (relative risk [IC95%]: 0.94 [0.80-1.11]). It seems there is no functional benefit for patients with early spondyloarthritis to be treated early by physiotherapy in daily practice, even though the efficacy of physiotherapy has been shown in several randomized controlled studies. Copyright © 2015 Société française de rhumatologie. Published by Elsevier SAS. All rights reserved.
Two families with MYH7 distal myopathy associated with cardiomyopathy and core formations.
Naddaf, Elie; Waclawik, Andrew J
2015-03-01
Laing distal myopathy is caused by MYH7 gene mutations. Multiple families have been reported with varying patterns of skeletal and cardiac involvement as well as histopathological findings. We report 2 families with p.Glu1508del mutation with detailed electrophysiological and muscle pathology findings. All patients displayed the classic phenotype with weakness starting in the anterior compartment of the legs with a "hanging great toe." It was followed by finger extensors involvement, relatively sparing the extensor indicis proprius, giving the appearance of a "pointing index" finger. All the affected individuals had a dilated cardiomyopathy and core formations on muscle biopsy. Unexpectedly, neurogenic changes were also observed in some individuals. Both families were initially misdiagnosed with either central core disease or hereditary neuropathy. Recognizing the classic phenotype, screening for cardiac involvement that may be clinically silent, and determining the mode of inheritance help with selecting the appropriate genetic test.
Plasma sheath axial phase dynamics in coaxial device
Energy Technology Data Exchange (ETDEWEB)
Soliman, H.M. (Plasma Physics Dept., NRC, Atomic Energy Authority, Cairo (Egypt)); Masoud, M.M. (Plasma Physics Dept., NRC, Atomic Energy Authority, Cairo (Egypt))
1994-10-01
The study of the plasma sheath dynamics in the axial phase has been carried out in a 3 kJ coaxial system of Mather type for two different inner electrode (IE) lengths, 20 cm and 31.5 cm. For both lengths, measurements showed that the plasma sheath is splitted into two layers at the breech, which is referred to as a shock front and its magnetic piston. It has been found that the two layers of the plasma current sheath rotate around the inner electrode. At the muzzle the back layer reverse its rotation direction due to the magnetic field structure of the system. Results showed that the axial velocity of the first layer is greater than the second one all over the axial phase within the range between 1.4 and 1.7. (orig.).
Plasma sheath axial phase dynamics in coaxial device
International Nuclear Information System (INIS)
Soliman, H.M.; Masoud, M.M.
1994-01-01
The study of the plasma sheath dynamics in the axial phase has been carried out in a 3 kJ coaxial system of Mather type for two different inner electrode (IE) lengths, 20 cm and 31.5 cm. For both lengths, measurements showed that the plasma sheath is splitted into two layers at the breech, which is referred to as a shock front and its magnetic piston. It has been found that the two layers of the plasma current sheath rotate around the inner electrode. At the muzzle the back layer reverse its rotation direction due to the magnetic field structure of the system. Results showed that the axial velocity of the first layer is greater than the second one all over the axial phase within the range between 1.4 and 1.7. (orig.)
Directory of Open Access Journals (Sweden)
Manchikanti L
2012-08-01
Full Text Available Laxmaiah Manchikanti,1,2 Kimberly A Cash,1 Carla D McManus,1 Vidyasagar Pampati,1 Ramsin Benyamin3,41Pain Management Center of Paducah, Paducah, KY; 2University of Louisville, Louisville, KY; 3Millennium Pain Center, Bloomington, IL; 4University of Illinois, Urbana-Champaign, IL, USAAbstract: Among the multiple causes of chronic low back pain, axial and discogenic pain are common. Various modalities of treatments are utilized in managing discogenic and axial low back pain including epidural injections. However, there is a paucity of evidence regarding the effectiveness, indications, and medical necessity of any treatment modality utilized for managing axial or discogenic pain, including epidural injections. In an interventional pain management practice in the US, a randomized, double-blind, active control trial was conducted. The objective was to assess the effectiveness of lumbar interlaminar epidural injections of local anesthetic with or without steroids for managing chronic low back pain of discogenic origin. However, disc herniation, radiculitis, facet joint pain, or sacroiliac joint pain were excluded. Two groups of patients were studied, with 60 patients in each group receiving either local anesthetic only or local anesthetic mixed with non-particulate betamethasone. Primary outcome measures included the pain relief-assessed by numeric rating scale of pain and functional status assessed by the, Oswestry Disability Index, Secondary outcome measurements included employment status, and opioid intake. Significant improvement or success was defined as at least a 50% decrease in pain and disability. Significant improvement was seen in 77% of the patients in Group I and 67% of the patients in Group II. In the successful groups (those with at least 3 weeks of relief with the first two procedures, the improvement was 84% in Group I and 71% in Group II. For those with chronic function-limiting low back pain refractory to conservative management
Saada, Ann; Shaag, Avraham; Elpeleg, Orly
2003-05-01
Decreased mitochondrial thymidine kinase (TK2) activity is associated with mitochondrial DNA (mtDNA) depletion and respiratory chain dysfunction and is manifested by isolated, fatal skeletal myopathy. Other tissues such as liver, brain, heart, and skin remain unaffected throughout the patients' life. In order to elucidate the mechanism of tissue specificity in the disease we have investigated the expression of the mitochondrial deoxynucleotide carrier, the mtDNA content and the activity of TK2 in mitochondria of various tissues. Our results suggest that low basal TK2 activity combined with a high requirement for mitochondrial encoded proteins in muscle predispose this tissue to the devastating effect of TK2 deficiency.
Adult cases of mitochondrial DNA depletion due to TK2 defect: an expanding spectrum.
Béhin, A; Jardel, C; Claeys, K G; Fagart, J; Louha, M; Romero, N B; Laforêt, P; Eymard, B; Lombès, A
2012-02-28
In this study we aim to demonstrate the occurrence of adult forms of TK2 mutations causing progressive mitochondrial myopathy with significant muscle mitochondrial DNA (mtDNA) depletion. Patients' investigations included serum creatine kinase, blood lactate, electromyographic, echocardiographic, and functional respiratory analyses as well as TK2 gene sequencing and TK2 activity measurement. Mitochondrial activities and mtDNA were analyzed in the patients' muscle biopsy. The 3 adult patients with TK2 mutations presented with slowly progressive myopathy compatible with a fairly normal life during decades. Apart from its much slower progression, these patients' phenotype closely resembled that of pediatric cases including early onset, absence of CNS symptoms, generalized muscle weakness predominating on axial and proximal muscles but affecting facial, ocular, and respiratory muscles, typical mitochondrial myopathy with a mosaic pattern of COX-negative and ragged-red fibers, combined mtDNA-dependent respiratory complexes deficiency and mtDNA depletion. In accordance with the disease's relatively slow progression, the residual mtDNA content was higher than that observed in pediatric cases. That difference was not explained by the type of the TK2 mutations or by the residual TK2 activity. TK2 mutations can cause mitochondrial myopathy with a slow progression. Comparison of patients with similar mutations but different disease progression might address potential mechanisms of mtDNA maintenance modulation.
Hong, R.; Li, J. C.; Hajjar, R.; Chakraborty Thakur, S.; Diamond, P. H.; Tynan, G. R.
2018-05-01
Detailed measurements of intrinsic axial flow generation parallel to the magnetic field in the controlled shear decorrelation experiment linear plasma device with no axial momentum input are presented and compared to theory. The results show a causal link from the density gradient to drift-wave turbulence with broken spectral symmetry and development of the axial mean parallel flow. As the density gradient steepens, the axial and azimuthal Reynolds stresses increase and radially sheared azimuthal and axial mean flows develop. A turbulent axial momentum balance analysis shows that the axial Reynolds stress drives the radially sheared axial mean flow. The turbulent drive (Reynolds power) for the azimuthal flow is an order of magnitude greater than that for axial flow, suggesting that the turbulence fluctuation levels are set by azimuthal flow shear regulation. The direct energy exchange between axial and azimuthal mean flows is shown to be insignificant. Therefore, the axial flow is parasitic to the turbulence-zonal flow system and is driven primarily by the axial turbulent stress generated by that system. The non-diffusive, residual part of the axial Reynolds stress is found to be proportional to the density gradient and is formed due to dynamical asymmetry in the drift-wave turbulence.
Manufacture of axially insulated large-area diodes
International Nuclear Information System (INIS)
Ma Weiyi; Zhou Kungang; Wang Youtian; Zhang Dong; Shan Yusheng; Wang Naiyan
1999-01-01
The author describes the design and construction of the axially insulated large-area diodes used in the 'Heaven-1'. The four axially insulated large-area diodes are connected to the 10 ohm pulse transmission lines via the vacuum feed through tubes. The experimental results with the diodes are given. The diodes can steadily work at the voltage of 650 kV, and the diode current density is about 80 A per cm 2 with a pulse width of 220 ns. The electron beams with a total energy of 25 kJ are obtained
Axial nucleon form factors from lattice QCD
International Nuclear Information System (INIS)
Alexandrou, C.; Brinet, M.; Carbonell, J.; Harraud, P. A.; Papinutto, M.; Constantinou, M.; Guichon, P.; Jansen, K.; Korzec, T.
2011-01-01
We present results on the nucleon axial form factors within lattice QCD using two flavors of degenerate twisted mass fermions. Volume effects are examined using simulations at two volumes of spatial length L=2.1 fm and L=2.8 fm. Cut-off effects are investigated using three different values of the lattice spacings, namely a=0.089 fm, a=0.070 fm and a=0.056 fm. The nucleon axial charge is obtained in the continuum limit and chirally extrapolated to the physical pion mass enabling comparison with experiment.
Topological invariants and the dynamics of an axial vector torsion field
International Nuclear Information System (INIS)
Drechsler, W.
1983-01-01
A generalized throry of gravitation is discussed which is based on a Riemann-Cartan space-time, U 4 , with an axial vector torsion field. Besides Einstein's equations determining the metric of the U 4 a system of nonlinear field equations is established coupling an axial vector source current to the axial vector torsion field. The properties of the solutions of these equations are discussed assuming a London-type condition relating the axial current and torsion field. To characterize the solutions use is made of the Euler and Pontrjagin forms and the associated quadratic curvature invariants for the U 4 space-time. It is found that there exists for a Riemann-Cartan space-time a relation between the zeros of the axial vector torsion field and the singularities of the Pontrjagin invariant, which is analogous to the well-known Hopf relation between the zeros of vector fields and the Euler characteristic. (author)
Axial holdup in pulsed perforated-plate column of pulser feeder type, (2)
International Nuclear Information System (INIS)
Ikeda, Hidematsu; Suzuki, Atsuyuki; Kiyose, Ryohei.
1987-01-01
In mathematical models for a pulsed perforated-plate column, the dispersed phase holdup has been considered to be uniform throughout the length of the column, but fairly recently it is treated as being nonuniform. In the previous paper, the axial holdup data were obtained in the dispersed aqueous and the dispersed organic modes. Experimental results showed that the axial holdup data become nonuniform throughout the column. It was also found that both of the plate type and the operation mode affected the axial holdup distribution. The present work is an attempt to formulate the axial holdup by means of a heuristic selforganization method that provides a nonlinear prediction model of complex system, since the holdup data did not directly show so significant trend as to formulate the axial holdup. The Group Method of Data Handling (GMDH) is used for this purpose. The GMDH can be used for selection and synthesis of input variables concerned with the axial holdup for the pulsed perforated-plate column. The axial holdup data have been successfully correlated and the identification models could be useful in discussing mathematical models. (author)
Evaluation of efficiency of axial profiling in WWER-440 fuel assemblies
International Nuclear Information System (INIS)
Ananjev, Yu. A.; Kurakin, K. Yu.; Artemov, V.G.; Ivanov, A.S.
2005-01-01
The present report deals with consideration of fuel enrichment axial profiling in WWER-440 assemblies. The study is performed on improving the effectiveness of fuel utilization using the example of implementing the axial profiling in the assemblies of the second generation. For simulation of fuel loadings the computer code package SAPFIR 9 5 and RC is used that allows for correct consideration of specific features of assemblies design changes. The methodical approach to assessment of effectiveness of implementing the axial profiling is considered with the use of capabilities of the mentioned code package. In conclusion the recommendations are given on using the fuel enrichment axial profiling in WWER-440 assemblies (Authors)
Precautions against axial fan stall in reactor building to Tianwan NPP
International Nuclear Information System (INIS)
Liu Chunlong; Pei Junmin
2011-01-01
The paper introduces the mechanism and harm of rotating stall of axial fans, analyzes the necessity for prevention against axial fan stall in reactor building of Tianwan NPP, introduces the precautions, and then makes an assessment on anti-stall effect of flow separators. It can provide reference for model-selection or reconstruction of similar fans in power stations, and for operation and maintenance of axial fans. (authors)
Contribution of metallic fission product inclusions to axial fuel motion potential
International Nuclear Information System (INIS)
Sasa, P.; Cronenberg, A.; Stevenson, M.
1979-01-01
In the analysis of postulated nuclear reactor accidents, axial fuel motion within the fuel pin prior to cladding failure can have an important mitigating effect. The question of primary importance is whether or not metallic inclusions have the potential to vaporize during an overheating event and thus contribute to fuel motion. To assess this potential, two limiting calculations were made: 1) The inclusion constituent assumed insoluble in one another and 2) The constituents assumed totally miscible in one another. Thermodynamic considerations indicate that the metallic fission products found within inclusions of fuel rods irradiated in a fast neutron spectrum, would form homogeneous solutions. Therefore, it is concluded that the metallic fission products would not enhance fuel swelling during an overheating event. 16 refs
Dynamic control of knee axial deformities
Directory of Open Access Journals (Sweden)
E. E. Malyshev
2013-01-01
Full Text Available The authors have evaluated the clinical examination of the patients with axial malalignments in the knee by the original method and device which was named varovalgometer. The measurements were conducted by tension of the cord through the spina iliaca anterior superior and the middle of the lower pole of patella. The deviation of the center of the ankle estimated by metal ruler which was positioned perpendicular to the lower leg axis on the level of the ankle joint line. The results of comparison of our method and computer navigation in 53 patients during the TKA show no statistically significant varieties but they differ by average 5° of valgus in clinical examination in comparison with mechanical axis which was identified by computer navigation. The dynamic control of axial malalignment can be used in clinical practice for estimation of the results of treatment of pathology with axial deformities in the knee; for the control of reduction and secondary displacement of the fractures around the knee; for assessment of instability; in planning of correctional osteotomies and intraoperative control of deformity correction; for estimation of Q angle in subluxation and recurrent dislocation of patella; in planning of TKA; during the growth of child it allows to assess the progression of deformity.
Analysis of the axial filaments of Treponema hyodysenteriae by SDS-PAGE and immunoblotting.
Kent, K A; Sellwood, R; Lemcke, R M; Burrows, M R; Lysons, R J
1989-06-01
Purified axial filaments from eight serotypes of Treponema hyodysenteriae and two non-pathogenic intestinal spirochaetes were characterized by SDS-PAGE and Western blotting. Axial filaments of all ten strains had similar SDS-PAGE profiles; five major axial filament polypeptides were identified, with molecular masses of 43.8, 38, 34.8, 32.8 and 29.4 kDa. Hyperimmune gnotobiotic pig serum raised against purified axial filaments of strain P18A (serotype 4) cross-reacted with all other serotypes and with the non-pathogens, and convalescent serum taken from a pig with persistent swine dysentery also showed a strong response to the axial filament polypeptides. Hyperimmune gnotobiotic pig serum raised against axial filaments failed to agglutinate viable organisms and did not inhibit growth in vitro. Hence, the axial filaments of T. hyodysenteriae have been identified as major immunodominant antigens, although the role that antibodies to these antigens play in protection has yet to be established.
Investigation of axial power gradients near a control rod tip
Energy Technology Data Exchange (ETDEWEB)
Loberg, John, E-mail: John.Loberg@fysast.uu.se [Uppsala University, Department of Physics and Astronomy, Division of Applied Nuclear Physics, Box 525, SE-75120 Uppsala (Sweden); Osterlund, Michael, E-mail: Michael.Osterlund@fysast.uu.se [Uppsala University, Department of Physics and Astronomy, Division of Applied Nuclear Physics, Box 525, SE-75120 Uppsala (Sweden); Bejmer, Klaes-Hakan, E-mail: Klaes-Hakan.Bejmer@vattenfall.com [Vattenfall Nuclear Fuel AB, Jaemtlandsgatan 99, 162 60 Vaellingby, Stockholm (Sweden); Blomgren, Jan, E-mail: Jan.Blomgren@vattenfall.com [Vattenfall Nuclear Fuel AB, Jaemtlandsgatan 99, 162 60 Vaellingby, Stockholm (Sweden); Kierkegaard, Jesper, E-mail: Jesper.Kierkegaar@vattenfall.com [Vattenfall Nuclear Fuel AB, Jaemtlandsgatan 99, 162 60 Vaellingby, Stockholm (Sweden)
2011-07-15
Highlights: > Pin power gradients near BWR control rod tips have been investigated. > A control rod tip is modeled in MCNP and compared to simplified 2D/3D geometry. > Small nodes increases pin power gradients; standard nodes underestimates gradients. > The MCNP results are validated against axial gamma scan of a controlled fuel pin. - Abstract: Control rod withdrawal in BWRs induces large power steps in the adjacent fuel assemblies. This paper investigates how well a 2D/3D method, e.g., CASMO5/SIMULATE5 computes axial pin power gradients adjacent to an asymmetrical control-rod tip in a BWR. The ability to predict pin power gradients accurately is important for safety considerations whereas large powers steps induced by control rod withdrawal can cause Pellet Cladding Interaction. The computation of axial pin power gradients axially around a control rod tip is a challenging task for any nodal code. On top of that, asymmetrical control rod handles are present in some BWR designs. The lattice code CASMO requires diagonal symmetry of all control rod parts. This introduces an error in computed pin power gradients that has been evaluated by Monte Carlo calculations. The results show that CASMO5/SIMULATE5, despite the asymmetrical control rod handle, is able to predict the axial pin power gradient within 1%/cm for axial nodal sizes of 15-3.68 cm. However, a nodal size of 3.68 cm still causes underestimations of pin power gradients compared with 1 cm nodes. Furthermore, if conventional node sizes are used, {approx}15 cm, pin power gradients can be underestimated by over 50% compared with 1 cm nodes. The detailed axial pin power profiles from MCNP are corroborated by measured gamma scan data on fuel rods irradiated adjacent to control rods.
Bruch´s membrane thickness in relationship to axial length.
Directory of Open Access Journals (Sweden)
Hai Xia Bai
Full Text Available To assess a potential role of Bruch´s membrane (BM in the biomechanics of the eye, we measured its thickness and the density of retinal pigment epithelium (RPE cells in various ocular regions in eyes of varying axial length.Human globes, enucleated because of an ocular tumor or end-stage glaucoma were prepared for histological examination. Using light microscopy, the histological slides were histomorphometrically examined applying a digitized image analysis system.The study included 104 eyes with a mean axial length of 27.9±3.2 mm (range:22.6mm-36.5mm. In eyes without congenital glaucoma, BM was significantly thickest (P<0.001 at the ora serrata, followed by the posterior pole, the midpoint between equator and posterior pole (MBEPP, and finally the equator. BM thickness was not significantly correlated with axial length (ora serrata: P = 0.93; equator:P = 0.31; MBEPP:P = 0.15; posterior pole:P = 0.35. RPE cell density in the pre-equatorial region (P = 0.02; regression coefficient r = -0.24 and in the retro-equatorial region (P = 0.03; r = -0.22 decreased with longer axial length, while RPE cell density at the ora serrata (P = 0.35, the MBEPP (P = 0.06; r = -0.19 and the posterior pole (P = 0.38 was not significantly correlated with axial length. Highly myopic eyes with congenital glaucoma showed a tendency towards lower BM thickness and lower RPE cell density at all locations.BM thickness, in contrast to scleral and choroidal thickness, was independent of axial length in eyes without congenital glaucoma. In association with an axial elongation associated decrease in the RPE cell density in the midperiphery, the findings support the notion of a biomechanical role BM may play in the process of emmetropization/myopization.
Investigation of axial power gradients near a control rod tip
International Nuclear Information System (INIS)
Loberg, John; Osterlund, Michael; Bejmer, Klaes-Hakan; Blomgren, Jan; Kierkegaard, Jesper
2011-01-01
Highlights: → Pin power gradients near BWR control rod tips have been investigated. → A control rod tip is modeled in MCNP and compared to simplified 2D/3D geometry. → Small nodes increases pin power gradients; standard nodes underestimates gradients. → The MCNP results are validated against axial gamma scan of a controlled fuel pin. - Abstract: Control rod withdrawal in BWRs induces large power steps in the adjacent fuel assemblies. This paper investigates how well a 2D/3D method, e.g., CASMO5/SIMULATE5 computes axial pin power gradients adjacent to an asymmetrical control-rod tip in a BWR. The ability to predict pin power gradients accurately is important for safety considerations whereas large powers steps induced by control rod withdrawal can cause Pellet Cladding Interaction. The computation of axial pin power gradients axially around a control rod tip is a challenging task for any nodal code. On top of that, asymmetrical control rod handles are present in some BWR designs. The lattice code CASMO requires diagonal symmetry of all control rod parts. This introduces an error in computed pin power gradients that has been evaluated by Monte Carlo calculations. The results show that CASMO5/SIMULATE5, despite the asymmetrical control rod handle, is able to predict the axial pin power gradient within 1%/cm for axial nodal sizes of 15-3.68 cm. However, a nodal size of 3.68 cm still causes underestimations of pin power gradients compared with 1 cm nodes. Furthermore, if conventional node sizes are used, ∼15 cm, pin power gradients can be underestimated by over 50% compared with 1 cm nodes. The detailed axial pin power profiles from MCNP are corroborated by measured gamma scan data on fuel rods irradiated adjacent to control rods.
Griffin, Jacqueline Reedy; Moraes, Luis; Wick, Macdonald; Lilburn, Michael Snell
2018-02-01
The broiler industry has incurred significant economic losses due to two muscle myopathies, white striping (WS) and wooden breast (WB), affecting the Pectoralis major (P. major) of commercial broilers. The present study documented macroscopic changes occurring with age/growth in the P. major and P. minor muscles of commercial broilers from day 2 through day 46 (n = 27/day). Distinct myopathic aberrations observed in both breast muscles corresponded to the onset of WB. These distinct morphological changes were used as determinants in developing a ranking system, defining the ontogeny of WB as the following four stages: (1) WS, (2) petechial epimysium haemorrhages, (3) intramuscular haemorrhages and (4) ischaemia. A cumulative logit proportional odds model was used to relate the rank probabilities with the following growth parameters: body weight, P. major and P. minor weight/yield/length/width/depth. The best-fit model included P. major length/width/depth, P. minor width, P. major and P. minor yield as predictors for rank. Increasing P. major depth, P. minor width and P. major yield increased the odds of falling into higher ranks (more severe myopathy). Conversely, increasing P. major length, P. major width and P. minor yield increased the odds of falling into smaller ranks (less severe myopathy). This study describes the macroscopic changes associated with WB ontogeny in the development of a ranking system and the contribution of growth parameters in the determination of rank (WB severity). Results suggest that physical measurements inherent to selection for high-yielding broiler genotypes are contributing to the occurrence and severity of WS and WB.
Nuclear chiral axial currents and applications to few-nucleon systems
Energy Technology Data Exchange (ETDEWEB)
Baroni, Alessandro [Old Dominion Univ., Norfolk, VA (United States)
2017-08-01
This Thesis is divided into three main parts. The first part discusses basic aspects of chiral effective field theory and the formalism, based on time ordered perturbation theory, used to to derive the nuclear potentials and currents from the chiral Lagrangians. The second part deals with the actual derivation, up to one loop, of the two-nucleon potential and one- and two-nucleon weak axial charge and current. In both derivations ultraviolet divergences generated by loop corrections are isolated using dimensional regularization. The resulting axial current is finite and conserved in the chiral limit, while the axial charge requires renormalization. A complete set of contact terms for the axial charge up to the relevant order in the power counting is constructed. The third part of this Thesis discusses two applications: (i) the calculation of the Gamow-Teller matrix element of tritium, used to constrain the single low-energy constant entering the axial current; (ii) the calculation of neutrino-deuteron inclusive cross sections at low energies. These results have confirmed previous predictions obtained in phenomenological approaches. These latter studies have played an important role in the analysis and interpretation of experiments at the Sudbury Neutrino Observatory.
Reconstruction of core axial power shapes using the alternating conditional expectation algorithm
International Nuclear Information System (INIS)
Lee, Eun Ki; Kim, Yong Hee; Cha, Kune Ho; Park, Moon Ghu
1999-01-01
We have introduced the alternating conditional expectation (ACE) algorithm in reconstructing 20-node axial core power shapes from five-level in-core detector powers. The core design code, Reactor Operation and Control Simulation (ROCS), calculates 3-dimensional power distributions for various core states, and the reference core-averaged axial power shapes and corresponding simulated detector powers are utilized to synthesize the axial power shape. By using the ACE algorithm, the optimal relationship between a dependent variable, the plane power, and independent variables, five detector powers, is determined without any preprocessing. A total of ∼3490 data sets per each cycle of YongGwang Nuclear (YGN) power plant units 3 and 4 is used for the regression. Continuous analytic function corresponding to each optimal transformation is calculated by simple regression model. The reconstructed axial power shapes of ∼21,200 cases are compared to the original ROCS axial power shapes. Also, to test the validity and accuracy of the new method, its performance is compared with that of the Fourier fitting method (FFM), a typical method of the deterministic approach. For a total of 21,204 data cases, the averages of root mean square (rms) error, axial peak error (ΔF z ), and axial shape index error (ΔASI) of new method are calculated as 0.81%, 0.51% and 0.00204, while those of FFM are 2.29%, 2.37% and 0.00264, respectively. We also evaluated the wide range of axial power profiles from the xenon-oscillation. The results show that the newly developed method is far superior to FFM; average rms and axial peak error are just ∼35 and ∼20% of those of FFM, respectively
Bone mineral changes in primary hyperparathyroidism
International Nuclear Information System (INIS)
Richardson, M.L.; Harborview Medical Center, Seattle, WA; Pozzi-Mucelli, R.S.; Trieste Univ.; Kanter, A.S.; Genant, H.K.; Kolb, F.O.; Ettinger, B.
1986-01-01
We studied 34 patients with primary hyperparathyroidism in order to assess their bone mineral status, to determine its relationship to biochemical parameters (serum calcium and parathyroid hormone) and surgical status, and to determine the relationship between peripheral cortical bone and spinal trabecular bone in this disease. These patients were studied with radiogrammetry of the metacarpals, Norland-Cameron photon absorptiometry of the radius, quantitative computed tomography (QCT) of the spine, industrial radiography of the hands, and conventional radiography of the thoracolumbar spine. We also calculated a spinal fracture index from thoracolumbar spine films. We found that the appendicular measurements correlated well together, but less well with spinal QCT. The spinal fracture index correlated best with QCT (r = 0.55), although significant dispersion was noted. We found that, in general, these hyperparathyroid patients had statistically significant decrements in bone mineral content in both the appendicular and the axial portions of the skeleton. However, the decrement in the appendicular skeleton did not correlate well with that in the axial skeleton. Therefore we conclude that it is necessary to measure both peripheral and central bone mineral content in order to reliably assess the skeletal demineralizing effects of primary hyperparathyroidism in an individual patient. (orig.)
What changed during the axial age: Cognitive styles or reward systems?
Baumard, Nicolas; Hyafil, Alexandre; Boyer, Pascal
2015-01-01
The ‘Axial Age’ (500–300 BCE) refers to the period during which most of the main religious and spiritual traditions emerged in Eurasian societies. Although the Axial Age has recently been the focus of increasing interest,1-5 its existence is still very much in dispute. The main reason for questioning the existence of the Axial Age is that its nature, as well as its spatial and temporal boundaries, remain very much unclear. The standard approach to the Axial Age defines it as a change of cognitive style, from a narrative and analogical style to a more analytical and reflective style, probably due to the increasing use of external memory tools. Our recent research suggests an alternative hypothesis, namely a change in reward orientation, from a short-term materialistic orientation to a long-term spiritual one.6 Here, we briefly discuss these 2 alternative definitions of the Axial Age. PMID:27066164
Axial gravity, massless fermions and trace anomalies
International Nuclear Information System (INIS)
Bonora, L.; Cvitan, M.; Giaccari, S.; Stemberga, T.; Prester, P.D.; Pereira, A.D.; UFF-Univ. Federal Fluminense, Niteroi
2017-01-01
This article deals with two main topics. One is odd parity trace anomalies in Weyl fermion theories in a 4d curved background, the second is the introduction of axial gravity. The motivation for reconsidering the former is to clarify the theoretical background underlying the approach and complete the calculation of the anomaly. The reference is in particular to the difference between Weyl and massless Majorana fermions and to the possible contributions from tadpole and seagull terms in the Feynman diagram approach. A first, basic, result of this paper is that a more thorough treatment, taking account of such additional terms and using dimensional regularization, confirms the earlier result. The introduction of an axial symmetric tensor besides the usual gravitational metric is instrumental to a different derivation of the same result using Dirac fermions, which are coupled not only to the usual metric but also to the additional axial tensor. The action of Majorana and Weyl fermions can be obtained in two different limits of such a general configuration. The results obtained in this way confirm the previously obtained ones. (orig.)
Axial gravity, massless fermions and trace anomalies
Energy Technology Data Exchange (ETDEWEB)
Bonora, L. [International School for Advanced Studies (SISSA), Trieste (Italy); KEK, Tsukuba (Japan). KEK Theory Center; INFN, Sezione di Trieste (Italy); Cvitan, M.; Giaccari, S.; Stemberga, T. [Zagreb Univ. (Croatia). Dept. of Physics; Prester, P.D. [Rijeka Univ. (Croatia). Dept. of Physics; Pereira, A.D. [UERJ-Univ. Estadual do Rio de Janeiro (Brazil). Dept. de Fisica Teorica; UFF-Univ. Federal Fluminense, Niteroi (Brazil). Inst. de Fisica
2017-08-15
This article deals with two main topics. One is odd parity trace anomalies in Weyl fermion theories in a 4d curved background, the second is the introduction of axial gravity. The motivation for reconsidering the former is to clarify the theoretical background underlying the approach and complete the calculation of the anomaly. The reference is in particular to the difference between Weyl and massless Majorana fermions and to the possible contributions from tadpole and seagull terms in the Feynman diagram approach. A first, basic, result of this paper is that a more thorough treatment, taking account of such additional terms and using dimensional regularization, confirms the earlier result. The introduction of an axial symmetric tensor besides the usual gravitational metric is instrumental to a different derivation of the same result using Dirac fermions, which are coupled not only to the usual metric but also to the additional axial tensor. The action of Majorana and Weyl fermions can be obtained in two different limits of such a general configuration. The results obtained in this way confirm the previously obtained ones. (orig.)
On the problem of axial anomaly in supersymmetric gauge theories
International Nuclear Information System (INIS)
Kazakov, D.I.
1984-01-01
The explicit relation is found between the axial current obeying the Adler-Bardeen theorem and the supersymmetric one belonging to a supermultiplet. It is shown that the axial and superconformal anomalies are consistent in all orders of perturbation theory
Metamorphosis of helical magnetorotational instability in the presence axial electric current
Priede, Jānis
2014-01-01
This paper presents numerical linear stability analysis of a cylindrical Taylor-Couette flow of liquid metal carrying axial electric current in a generally helical external magnetic field. Axially symmetric disturbances are considered in the inductionless approximation corresponding to zero magnetic Prandtl number. Axial symmetry allows us to reveal an entirely new electromagnetic instability. First, we show that the electric current passing through the liquid can extend the range of helical ...
Progressive atlanto-axial subluxation in Behcet's disease
Energy Technology Data Exchange (ETDEWEB)
Kim, Sang-hyuk [Chonbuk National University Hospital, Department of Neurosurgery, Jeonju City, Jeonbuk (Korea); Eoh, Whan [Sungkyunkwan University School of Medicine, Samsung Medical Center, Department of Neurosurgery, Seoul (Korea)
2010-03-15
Behcet's disease is a chronic inflammatory condition involving several organs, such as the skin, mucous membranes, eyes, joints, intestines, lungs and central nervous system. It rarely affects the spinal column. We describe a case of progressive atlanto-axial subluxation in a 44-year-old woman with Behcet's disease. The patient started complaining of posterior neck pain 10 years after the diagnosis of her Behcet's disease. Initial radiographs showed no abnormal finding, but follow-up radiographs 6 month later demonstrated atlanto-axial subluxation. To the best of our knowledge, this is the second reported case in the worldwide literature of an atlanto-axial instability in a patient with Behcet's disease. (orig.)
Sanada, Fumihiro; Kim, Junghyun; Czarna, Anna; Chan, Noel Yan-Ki; Signore, Sergio; Ogórek, Barbara; Isobe, Kazuya; Wybieralska, Ewa; Borghetti, Giulia; Pesapane, Ada; Sorrentino, Andrea; Mangano, Emily; Cappetta, Donato; Mangiaracina, Chiara; Ricciardi, Mario; Cimini, Maria; Ifedigbo, Emeka; Perrella, Mark A; Goichberg, Polina; Choi, Augustine M; Kajstura, Jan; Hosoda, Toru; Rota, Marcello; Anversa, Piero; Leri, Annarosa
2014-01-03
Hypoxia favors stem cell quiescence, whereas normoxia is required for stem cell activation, but whether cardiac stem cell (CSC) function is regulated by the hypoxic/normoxic state of the cell is currently unknown. A balance between hypoxic and normoxic CSCs may be present in the young heart, although this homeostatic control may be disrupted with aging. Defects in tissue oxygenation occur in the old myocardium, and this phenomenon may expand the pool of hypoxic CSCs, which are no longer involved in myocyte renewal. Here, we show that the senescent heart is characterized by an increased number of quiescent CSCs with intact telomeres that cannot re-enter the cell cycle and form a differentiated progeny. Conversely, myocyte replacement is controlled only by frequently dividing CSCs with shortened telomeres; these CSCs generate a myocyte population that is chronologically young but phenotypically old. Telomere dysfunction dictates their actual age and mechanical behavior. However, the residual subset of quiescent young CSCs can be stimulated in situ by stem cell factor reversing the aging myopathy. Our findings support the notion that strategies targeting CSC activation and growth interfere with the manifestations of myocardial aging in an animal model. Although caution has to be exercised in the translation of animal studies to human beings, our data strongly suggest that a pool of functionally competent CSCs persists in the senescent heart and that this stem cell compartment can promote myocyte regeneration effectively, partly correcting the aging myopathy.
Development of axial tomography technique for the study of steam explosion
Energy Technology Data Exchange (ETDEWEB)
Lee, Jae Young; Seo, S. W.; You, S. [Handong Golbal Univ., Pohang (Korea, Republic of)
2006-05-15
In this report, axial tomography applying to steam explosion is implemented. When steam explosion experiment is performed, we have seen the difficulty with physical modeling due to the complex phenomena of generated steam, propagation of shock wave and bubble breakup and coalescence. Hence, the uncertainty due to these phenomena is occurred. The fast and global measurement of the steam distribution is imperative to understand the complex phenomena performed during the steam explosion, KAERI have developed the fast and global measuring instrument to monitor such phenomena of axial steam distribution. Generally, X-ray is used as measuring method, but this method is very expensive and has limited measurement area. So we need new method that can substitute X-ray method and in this research, ECT method is replaced. The research is performed dividing within two parts: Software and Hardware. In the software part, the electric field analysis code and algorithm for inverse projection were developed. And, in the hardware part, capacitance measurement circuit is developed to measure up to fF level. Operable axial tomography was analyzed with concept design of axial tomography appropriate to steam explosion accident and analysis code for axial electric field analysis and inverse algorithm were developed, moreover, designing signal analysis system for axial tomography was performed.
Axial sidelobe reduction in single-photon 4Pi microscopy by Toraldo filters
International Nuclear Information System (INIS)
Martinex-Corral, M.; Pons, A.; Caballero, M.T.
2002-01-01
Full text: The 4Pi-confocal fluorescence microscope is a recently developed 3D imaging technique in which two opposing high-NA objectives are used for coherently illuminating and/or detecting the same point of the fluorescent sample. The interference process yields an intensity point spread function (PSF) with an extremely narrow axial core, but with very large axial sidelobes, which compromise the actual improvement in axial resolution. To overcome this problem we propose the use, in the illumination arm of the 4Pi-confocal microscope, of multiple-zones phase filters whose design is based on the Toraldo-design principle. Note that the Toraldo procedure allows to select at will the positions of the zeros of the PSF of an optical system. Then, what we propose here if to design a phase pupil filter such that the position of the first zero of the illumination axial PSF is close to the position of the maximum of the first axial sidelobe of the detection PSF. In the design procedure it is taken into account that: 1. The value of the parameter ε = λ exc /λ det which, in a single-photon fluorescent process, is the responsible for the different scales of the illumination and detection PSFs. 2. The Toraldo procedure was originally designed to control the position of zeros of the transverse PSF. In this case the procedure is adapted to the aim of controlling the position of zeros of the axial PSF. 3. Since 4Pi-confocal microscopes are only useful when built with high-NA objectives, the Toraldo principle is reformulated in terms of the nonparaxial diffraction theory. We show that by using Toraldo filters in the illumination part of a 4Pi-confocal microscope it is possible to obtain up to a 60% reduction of height of the axial sidelobe of the whole-system axial PSF. This fact permits to fully benefit the axial resolution from the strong narrowness of the central peak of the axial PSF, inherent to the 4Pi principle. Copyright (2002) Australian Society for Electron Microscopy
Axial structure of the nucleon
Energy Technology Data Exchange (ETDEWEB)
Veronique Bernard; Latifa Elouadrhiri; Ulf-G Meissner
2002-01-01
We review the current status of experimental and theoretical understanding of the axial nucleon structure at low and moderate energies. Topics considered include (quasi)elastic (anti)neutrino-nucleon scattering, charged pion electroproduction off nucleons and ordinary as well as radiative muon capture on the proton.
Method to Measure Tone of Axial and Proximal Muscle
Gurfinkel, Victor S.; Cacciatore, Timothy W.; Cordo, Paul J.; Horak, Fay B.
2011-01-01
The control of tonic muscular activity remains poorly understood. While abnormal tone is commonly assessed clinically by measuring the passive resistance of relaxed limbs1, no systems are available to study tonic muscle control in a natural, active state of antigravity support. We have developed a device (Twister) to study tonic regulation of axial and proximal muscles during active postural maintenance (i.e. postural tone). Twister rotates axial body regions relative to each other about the vertical axis during stance, so as to twist the neck, trunk or hip regions. This twisting imposes length changes on axial muscles without changing the body's relationship to gravity. Because Twister does not provide postural support, tone must be regulated to counteract gravitational torques. We quantify this tonic regulation by the restive torque to twisting, which reflects the state of all muscles undergoing length changes, as well as by electromyography of relevant muscles. Because tone is characterized by long-lasting low-level muscle activity, tonic control is studied with slow movements that produce "tonic" changes in muscle length, without evoking fast "phasic" responses. Twister can be reconfigured to study various aspects of muscle tone, such as co-contraction, tonic modulation to postural changes, tonic interactions across body segments, as well as perceptual thresholds to slow axial rotation. Twister can also be used to provide a quantitative measurement of the effects of disease on axial and proximal postural tone and assess the efficacy of intervention. PMID:22214974
Modelling larval transport in a axial convergence front
Robins, P.
2010-12-01
Marine larvae exhibit different vertical swimming behaviours, synchronised by factors such as tidal currents and daylight, in order to aid retention near the parent populations and hence promote production, avoid predation, or to stimulate digestion. This paper explores two types of larval migration in an estuarine axial convergent front which is an important circulatory mechanism in many coastal regions where larvae are concentrated. A parallelised, three-dimensional, ocean model was applied to an idealised estuarine channel which was parameterised from observations of an axial convergent front which occurs in the Conwy Estuary, U.K. (Nunes and Simpson, 1985). The model successfully simulates the bilateral cross-sectional recirculation of an axial convergent front, which has been attributed to lateral density gradients established by the interaction of the lateral shear of the longitudinal currents with the axial salinity gradients. On the flood tide, there is surface axial convergence whereas on the ebb tide, there is (weaker) surface divergence. Further simulations with increased/decreased tidal velocities and with stronger/weaker axial salinity gradients are planned so that the effects of a changing climate on the secondary flow can be understood. Three-dimensional Lagrangian Particle Tracking Models (PTMs) have been developed which use the simulated velocity fields to track larvae in the estuarine channel. The PTMs take into account the vertical migrations of two shellfish species that are commonly found in the Conwy Estuary: (i) tidal migration of the common shore crab (Carcinus maenas) and (ii), diel (daily) migration of the Great scallop (Pecten maximus). These migration behaviours are perhaps the most widespread amongst shellfish larvae and have been compared with passive (drifting) particles in order to assess their relative importance in terms of larval transport. Preliminary results suggest that the net along-estuary dispersal over a typical larval
Axial loaded MRI of the lumbar spine
Energy Technology Data Exchange (ETDEWEB)
Saifuddin, A. E-mail: asaifuddin@aol.com; Blease, S.; MacSweeney, E
2003-09-01
Magnetic resonance imaging is established as the technique of choice for assessment of degenerative disorders of the lumbar spine. However, it is routinely performed with the patient supine and the hips and knees flexed. The absence of axial loading and lumbar extension results in a maximization of spinal canal dimensions, which may in some cases, result in failure to demonstrate nerve root compression. Attempts have been made to image the lumbar spine in a more physiological state, either by imaging with flexion-extension, in the erect position or by using axial loading. This article reviews the literature relating to the above techniques.
Cross-flow filtration and axial filtration
International Nuclear Information System (INIS)
Kraus, K.A.
1974-01-01
Two relatively novel alternative solid-liquid-separation techniques of filtration are discussed. In cross-flow filtration, the feed is pumped past the filtering surface. While in axial filtration the filter, mounted on a rotor, is moved with respect to the feed. While large-scale application of the axial filter is still in doubt, it permits with little expenditure of time and money, duplication of many hydrodynamic aspects of cross-flow filtration for fine-particle handling problems. The technique has been applied to municipal wastes, low-level radioactive waste treatment plant, lead removal from industrial wastes, removal of pulp-mill contaminants, textile-mill wastes, and pretreatment of saline waters by lime-soda process in preparation for hyperfiltration. Economics and energy requirements are also discussed
Development of Performance Analysis Program for an Axial Compressor with Meanline Analysis
International Nuclear Information System (INIS)
Park, Jun Young; Park, Moo Ryong; Choi, Bum Suk; Song, Je Wook
2009-01-01
Axial-flow compressor is one of the most important parts of gas turbine units with axial turbine and combustor. Therefore, precise prediction of performance is very important for development of new compressor or modification of existing one. Meanline analysis is a simple, fast and powerful method for performance prediction of axial-flow compressors with different geometries. So, Meanline analysis is frequently used in preliminary design stage and performance analysis for given geometry data. Much correlations for meanline analysis have been developed theoretically and experimentally for estimating various types of losses and flow deviation angle for long time. In present study, meanline analysis program was developed to estimate compressor losses, incidence angles, deviation angles, stall and surge conditions with many correlations. Performance prediction of one stage axial compressors is conducted with this meanline analysis program. The comparison between experimental and numerical results show a good agreement. This meanline analysis program can be used for various types of single stage axial-flow compressors with different geometries, as well as multistage axial-flow compressors
Xenon-induced axial power oscillations in the 400 MW PBMR
International Nuclear Information System (INIS)
Strydom, Gerhard
2008-01-01
The redistribution of the spatial xenon concentration in the 400 MW Pebble Bed Modular Reactor (PBMR) core has a non-linear, time-dependent feedback effect on the spatial power density during several types of operational transient events. Due to the inherent weak coupling that exists between the iodine and xenon formation and destruction rates, as well as the complicating effect of spatial variance in the thermal flux field, reactor cores have been analyzed for a number of decades for the occurrence and severity of xenon-induced axial power oscillations. Of specific importance is the degree of oscillation damping exhibited by the core during transients, which involves axial variations in the local power density. In this paper the TINTE reactor dynamics code is used to assess the stability of the current 400 MW PBMR core design with regard to axial xenon oscillations. The focus is mainly on the determination of the inherent xenon and power oscillation damping properties by utilizing a set of hypothetical control rod insertion transients at various power levels. The oscillation damping properties of two 100%-50%-100% load-follow transients, one of which includes the de-stabilizing axial effects of moving control rods, are also discussed in some detail. The study shows that, although first axial mode oscillations do occur in the 400 MW PBMR core, the inherent damping of these oscillations is high, and that none of the investigated load-follow transients resulted in diverging oscillations. It is also shown that the PBMR core exhibits no radial oscillation components for these xenon-induced axial power oscillations
Bodoki, L; Nagy-Vincze, M; Griger, Z; Betteridge, Z; Szöllősi, L; Jobanputra, R; Dankó, K
2015-01-01
Idiopathic inflammatory myopathies are systemic, chronic autoimmune diseases characterized by symmetrical, proximal muscle weakness. Homogeneous groups present with similar symptoms. The response to therapy and prognosis could be facilitated by myositis-specific autoantibodies, and in this way, give rise to immunoserological classification. The myositis-specific autoantibodies are directed against specific proteins found in the cytoplasm or in the nucleus of the cells. To date, literature suggests the rarity of the co-existence of two myositis-specific autoantibodies. In this study the authors highlight rare associations of myositis-specific autoantibodies. Three hundred and thirty-seven Hungarian patients with polymyositis or dermatomyositis were studied. Their clinical findings were noted retrospectively. Specific blood tests identified six patients with the rare co-existence of myositis-specific autoantibodies, anti-Jo-1 and anti-SRP, anti-Jo-1 and anti-Mi-2, anti-Mi-2 and anti-PL-12, anti-Mi-2 and anti-SRP, and anti-SRP and anti-PL-7, respectively. This case review aims to identify the clinical importance of these rare associations and their place within the immunoserological classification.
A study on multi-axial fatigue model based on structural stress
International Nuclear Information System (INIS)
Kim, Cheol; Kim, Jong Sung; Jin, Tae Eun; Dong, P.
2004-01-01
In nuclear components, cyclic loadings that cause complex states of stress are common. Through a reference review, four sources of the multi-axial fatigue data were collected from LBF, University of Illinois, EPRI, and TWI. All these tests were conducted using tube to flange specimens with a circumferential fillet welds. The loading conditions were mostly bending/ torsion combinations, except that TWI used tension/ torsion combinations. None of fatigue correlation parameters have been demonstrated to be satisfactory in correlating the multi-axial fatigue data outside of their own. In this paper, we proposed the characterizing multi-axial fatigue behavior in terms of the structural stress methods by using some of the well-known multi-axial fatigue data available in the references
Precision axial translator with high stability.
Bösch, M A
1979-08-01
We describe a new type of translator which is inherently stable against torsion and twisting. This concentric translator is also ideally suited for precise axial motion with clearance of the center line.
Axially modulated arch resonator for logic and memory applications
Hafiz, Md Abdullah Al
2018-01-17
We demonstrate reconfigurable logic and random access memory devices based on an axially modulated clamped-guided arch resonator. The device is electrostatically actuated and the motional signal is capacitively sensed, while the resonance frequency is modulated through an axial electrostatic force from the guided side of the microbeam. A multi-physics finite element model is used to verify the effectiveness of the axial modulation. We present two case studies: first, a reconfigurable two-input logic gate based on the linear resonance frequency modulation, and second, a memory element based on the hysteretic frequency response of the resonator working in the nonlinear regime. The energy consumptions of the device for both logic and memory operations are in the range of picojoules, promising for energy efficient alternative computing paradigm.
Investigation on a procedure for optimal axial depth of cut accuracy in micromilling
DEFF Research Database (Denmark)
Bissacco, Giuliano; Hansen, Hans Nørgaard; De Chiffre, Leonardo
2005-01-01
On the basis of a previously developed procedure for control of axial depth of cut in high accuracy micromilling operations, this paper presents an investigation on the estimation of the uncertainty of the set axial depth of cut.......On the basis of a previously developed procedure for control of axial depth of cut in high accuracy micromilling operations, this paper presents an investigation on the estimation of the uncertainty of the set axial depth of cut....
Asymptotic freedom in the axial and Coulomb gauges
International Nuclear Information System (INIS)
Frenkel, J.; Taylor, J.C.
1976-01-01
The sources of the negative contribution to the charge renormalization factor gsup(B)/g-1 in Yang-Mills theories are investigated in the axial and Coulomb gauges. In the axial gauge, a Kaellen dispersion relation exists but the spectral function is not positive definite because of the prescription that is used to integrate the singular polarization vectors. In the Coulomb gauge, the negative contributions are (to the lowest order) isolated in the Coulomb self-energy corrections to the Coulomb field. (Auth.)
Effects of axial coordination on immobilized Mn(salen) catalysts.
Teixeira, Filipe; Mosquera, Ricardo A; Melo, André; Freire, Cristina; Cordeiro, M Natália D S
2014-11-13
The consequences of anchoring Mn(salen) catalysts onto a supporting material using one of the vacant positions of the metal center are tackled by studying several Mn(salen) complexes with different axial ligands attached. This is accomplished using Density Functional Theory at the X3LYP/Triple-ζ level of theory and the Atom In Molecules formalism. The results suggest that both Mn(salen) complexes and their oxo derivatives should lie in a triplet ground state. Also, the choice of the axial ligand bears a moderate effect on the energy involved in the oxidation of the former to oxo-Mn(salen) complexes, as well as in the stability of such complexes toward ligand removal by HCl. AIM analysis further suggests that the salen ligand acts as a "charge reservoir" for the metal center, with strong correlations being obtained between the charge of salen and the electron population donated by the axial ligand to the metal center. Moreover, the results suggest that the Mn atom in Mn(salen) complexes holds different hybridization of its valence orbitals depending on the type of axial ligand present in the system.
Axial magnetic field restriction of plasma sheath in a coaxial discharge
International Nuclear Information System (INIS)
Masoud, M. M.; Soliman, H. M.; Ibrahim, F. A.
1999-01-01
The study deals with the effect of an applied axial magnetic field on the dynamics and parameters of the plasma sheath and the expanded plasma in a coaxial discharge. Experimental investigations were carried out with a 3 kJ coaxial discharge device of a Mather geometry. The discharge takes place in Hydrogen gas with base pressure of 1 torr. The experiments were conducted with a 10 kV bank voltage, which corresponds to 100 kA discharge currents. The investigations have shown that the maximum axial plasma sheath velocity is decreased by 20% when applying the external axial magnetic field along the coaxial electrodes of intensity 2.6 kG. The experimental results of axial magnetic field intensity B z along the coaxial electrodes indicated that the application of external axial magnetic field causes an increases of B z ∼ 40% at a mid-distance between the breech and the muzzle and a decrease by 75% at the muzzle. The experimental results of expanded plasma electron temperature T e and density n e cleared that when the axial magnetic field is applied the maximum T e is decreased by 2.6 and 3 times, while the maximum n e is increased by 2.8 and 2 times for the first and second half cycles respectively. (author)
Efficient Propulsion Structure with an Axial Flux Rotary Converter for HEV Drive Unit
Directory of Open Access Journals (Sweden)
Ales Havel
2011-01-01
Full Text Available This paper describes an efficient axial flux arrangement of the four quadrant rotary converter for hybrid electric vehicles. The design of the axial flux wound stator and both axial flux squirrel cage rotors is based on the arrangement of radial air gap induction motor and permanent magnet synchronous motor. The method of constant magnetic circuit volume is utilized for dimensions conversion, which results into basic dimensions of stator and rotor discs in axial flux conception. This allows the creation of real 3D models in the CAD application. Finally, the finite element simulations of electromagnetic induction in the axial flux stator pack are presented in the concluding part of this paper.
Axial and radial velocities in the creeping flow in a pipe
Directory of Open Access Journals (Sweden)
Zuykov Andrey L'vovich
2014-05-01
Full Text Available The article is devoted to analytical study of transformation fields of axial and radial velocities in uneven steady creeping flow of a Newtonian fluid in the initial portion of the cylindrical channel. It is shown that the velocity field of the flow is two-dimensional and determined by the stream function. The article is a continuation of a series of papers, where normalized analytic functions of radial axial distributions in uneven steady creeping flow in a cylindrical tube with azimuthal vorticity and stream function were obtained. There is Poiseuille profile for the axial velocity in the uniform motion of a fluid at an infinite distance from the entrance of the pipe (at x = ∞, here taken equal to zero radial velocity. There is uniform distribution of the axial velocity in the cross section at the tube inlet at x = 0, at which the axial velocity is constant along the current radius. Due to the axial symmetry of the flow on the axis of the pipe (at r = 0, the radial velocities and the partial derivative of the axial velocity along the radius, corresponding to the condition of the soft function extremum, are equal to zero. The authors stated vanishing of the velocity of the fluid on the walls of the pipe (at r = R , where R - radius of the tube due to its viscous sticking and tightness of the walls. The condition of conservation of volume flow along the tube was also accepted. All the solutions are obtained in the form of the Fourier - Bessel. It is shown that the hydraulic losses at uniform creeping flow of a Newtonian fluid correspond to Poiseuille - Hagen formula.
Axial length elongation in adults with long-standing unilateral traumatic cataract
Directory of Open Access Journals (Sweden)
Jonel Steffen
2016-09-01
Full Text Available Background: Unilateral eye elongation with resultant axial myopia has been reported to occur secondary to visual deprivation from birth or early childhood. Acquired axial length elongation secondary to visual deprivation in adults has rarely been reported. Aim: To report acquired axial myopia in adults with visual deprivation due to long-standing unilateral traumatic cataract. Methods: Eleven consecutive adult patients who presented for cataract surgery with unilateral, long-standing, mature, traumatic cataracts and an interocular axial length difference of more than 1 mm were studied. Patients with a post-operative best corrected visual acuity (BCVA of < 6/12 were excluded to rule out possible pre-existing anisometropic amblyopia. Results: Of the 11 patients with significant interocular axial length difference, 5 patients were excluded on the basis of possible pre-existing amblyopia. The remaining 6 patients had final BCVA of 6/12 or better. The median length of the cataractous eyes was 2.83 mm longer than the fellow eyes (range 1.12 mm – 3.52 mm. The intraocular lens power required for emmetropia was 6.8 dioptres (range 3.5 dioptres – 11.5 dioptres less in the cataractous eyes. A refractive outcome within 1 dioptre of the target refraction was achieved in all patients. The median delay between ocular trauma and cataract surgery was 20 years (range 8–24 years. Conclusion: Significant unilateral axial length elongation may occur in adults with longstanding traumatic cataracts and visual deprivation. A potential correlation may exist between delay to surgery and degree of axial length difference. This rare phenomenon must be considered when determining intraocular lens power to avoid post-operative refractive surprises.
Computational analysis of a multistage axial compressor
Mamidoju, Chaithanya
Turbomachines are used extensively in Aerospace, Power Generation, and Oil & Gas Industries. Efficiency of these machines is often an important factor and has led to the continuous effort to improve the design to achieve better efficiency. The axial flow compressor is a major component in a gas turbine with the turbine's overall performance depending strongly on compressor performance. Traditional analysis of axial compressors involves throughflow calculations, isolated blade passage analysis, Quasi-3D blade-to-blade analysis, single-stage (rotor-stator) analysis, and multi-stage analysis involving larger design cycles. In the current study, the detailed flow through a 15 stage axial compressor is analyzed using a 3-D Navier Stokes CFD solver in a parallel computing environment. Methodology is described for steady state (frozen rotor stator) analysis of one blade passage per component. Various effects such as mesh type and density, boundary conditions, tip clearance and numerical issues such as turbulence model choice, advection model choice, and parallel processing performance are analyzed. A high sensitivity of the predictions to the above was found. Physical explanation to the flow features observed in the computational study are given. The total pressure rise verses mass flow rate was computed.
High-resolution axial MR imaging of tibial stress injuries
Directory of Open Access Journals (Sweden)
Mammoto Takeo
2012-05-01
Full Text Available Abstract Purpose To evaluate the relative involvement of tibial stress injuries using high-resolution axial MR imaging and the correlation with MR and radiographic images. Methods A total of 33 patients with exercise-induced tibial pain were evaluated. All patients underwent radiograph and high-resolution axial MR imaging. Radiographs were taken at initial presentation and 4 weeks later. High-resolution MR axial images were obtained using a microscopy surface coil with 60 × 60 mm field of view on a 1.5T MR unit. All images were evaluated for abnormal signals of the periosteum, cortex and bone marrow. Results Nineteen patients showed no periosteal reaction at initial and follow-up radiographs. MR imaging showed abnormal signals in the periosteal tissue and partially abnormal signals in the bone marrow. In 7 patients, periosteal reaction was not seen at initial radiograph, but was detected at follow-up radiograph. MR imaging showed abnormal signals in the periosteal tissue and entire bone marrow. Abnormal signals in the cortex were found in 6 patients. The remaining 7 showed periosteal reactions at initial radiograph. MR imaging showed abnormal signals in the periosteal tissue in 6 patients. Abnormal signals were seen in the partial and entire bone marrow in 4 and 3 patients, respectively. Conclusions Bone marrow abnormalities in high-resolution axial MR imaging were related to periosteal reactions at follow-up radiograph. Bone marrow abnormalities might predict later periosteal reactions, suggesting shin splints or stress fractures. High-resolution axial MR imaging is useful in early discrimination of tibial stress injuries.