WorldWideScience

Sample records for primary axial myopathy

  1. Axial myopathy

    DEFF Research Database (Denmark)

    Witting, Nanna; Andersen, Linda K; Vissing, John

    2016-01-01

    Classically, myopathies are categorized according to limb or cranial nerve muscle affection, but with the growing use of magnetic resonance imaging it has become evident that many well-known myopathies have significant involvement of the axial musculature. New disease entities with selective axial...

  2. Myopathies

    Science.gov (United States)

    ... find appropri- ate therapists, and to locate and purchase important assistive devices. And today, people with disabilities ... in inheritable myopathies • Anesthesia: People with myopathies can experience a range of adverse reactions to certain anesthetic ...

  3. Myopathy

    Science.gov (United States)

    ... alternating episodes of twitching and stiffness; and stiff-man syndrome: characterized by episodes of rigidity and reflex spasms common muscle cramps and stiffness, and tetany: characterized by prolonged spasms of the arms and legs × Definition The myopathies are neuromuscular disorders in which the ...

  4. [Descending ocular myopathy].

    Science.gov (United States)

    de Freitas, M R; Nascimento, O J

    1975-06-01

    The case of a 23 years old female patient, with primary involvement of the extraocular and faringeal muscles without familiar history is reported. Electromyographic and muscular biopsy studies proved the myogenic nature of the process. A clinical comparison between the ocular myopathy and the descending ocular myopathy is made, the authors thinking that both of them would be variants of the same muscle disease.

  5. DISTAL MYOPATHIES

    Science.gov (United States)

    Dimachkie, Mazen M.; Barohn, Richard J.

    2014-01-01

    Over a century ago, Gowers described two young patients in whom distal muscles weakness involved the hand, foot, sternocleidomastoid, and facial muscles in the other case the shoulder and distal leg musculature. Soon after, , similar distal myopathy cases were reported whereby the absence of sensory symptoms and of pathologic changes in the peripheral nerves and spinal cord at postmortem examination allowed differentiation from Charcot-Marie-Tooth disease. In 1951, Welander described autosomal dominant (AD) distal arm myopathy in a large Scandanavian cohort. Since then the number of well-characterized distal myopathies has continued to grow such that the distal myopathies have formed a clinically and genetically heterogeneous group of disorders. Affected kindred commonly manifest weakness that is limited to foot and toe muscles even in advanced stages of the disease, with variable mild proximal leg, distal arm, neck and laryngeal muscle involvement in selected individuals. An interesting consequence of the molecular characterization of the distal myopathies has been the recognition that mutation in a single gene can lead to more than one clinical disorder. For example, Myoshi myopathy (MM) and limb girdle muscular dystrophy (LGMD) type 2B are allelic disorders due to defects in the gene that encodes dysferlin. The six well described distal myopathy syndromes are shown in Table 1. Table 2 lists advances in our understanding of the myofibrillar myopathy group and Table 3 includes more recently delineated and less common distal myopathies. In the same manner, the first section of this review pertains to the more traditional six distal myopathies followed by discussion of the myofibrillar myopathies. In the third section, we review other clinically and genetically distinctive distal myopathy syndromes usually based upon single or smaller family cohorts. The fourth section considers other neuromuscular disorders that are important to recognize as they display prominent

  6. Fulminant lipid storage myopathy due to multiple acyl-coenzyme a dehydrogenase deficiency.

    Science.gov (United States)

    Whitaker, Charles H; Felice, Kevin J; Silvers, David; Wu, Qian

    2015-08-01

    The lipid storage myopathies, primary carnitine deficiency, neutral lipid storage disease, and multiple acyl coenzyme A dehydrogenase deficiency (MADD), are progressive disorders that cause permanent weakness. These disorders of fatty acid metabolism and intracellular triglyceride degradation cause marked fat deposition and damage to muscle cells. We describe a rapidly progressive myopathy in a previously healthy 33-year-old woman. Over 4 months, she developed a proximal and axial myopathy associated with diffuse myalgia and dysphagia, ultimately leading to respiratory failure and death. Muscle biopsy showed massive accumulation of lipid. Plasma acylcarnitine and urine organic acid analysis was consistent with MADD. This was confirmed by molecular genetic testing, which revealed 2 pathogenic mutations in the ETFDH gene. This report illustrates a late-onset case of MADD and reviews the differential diagnosis and evaluation of patients with proximal myopathy and excessive accumulation of lipid on muscle biopsy. © 2014 Wiley Periodicals, Inc.

  7. Metabolic Myopathies.

    Science.gov (United States)

    Tarnopolsky, Mark A

    2016-12-01

    Metabolic myopathies are genetic disorders that impair intermediary metabolism in skeletal muscle. Impairments in glycolysis/glycogenolysis (glycogen-storage disease), fatty acid transport and oxidation (fatty acid oxidation defects), and the mitochondrial respiratory chain (mitochondrial myopathies) represent the majority of known defects. The purpose of this review is to develop a diagnostic and treatment algorithm for the metabolic myopathies. The metabolic myopathies can present in the neonatal and infant period as part of more systemic involvement with hypotonia, hypoglycemia, and encephalopathy; however, most cases present in childhood or in adulthood with exercise intolerance (often with rhabdomyolysis) and weakness. The glycogen-storage diseases present during brief bouts of high-intensity exercise, whereas fatty acid oxidation defects and mitochondrial myopathies present during a long-duration/low-intensity endurance-type activity or during fasting or another metabolically stressful event (eg, surgery, fever). The clinical examination is often normal between acute events, and evaluation involves exercise testing, blood testing (creatine kinase, acylcarnitine profile, lactate, amino acids), urine organic acids (ketones, dicarboxylic acids, 3-methylglutaconic acid), muscle biopsy (histology, ultrastructure, enzyme testing), MRI/spectroscopy, and targeted or untargeted genetic testing. Accurate and early identification of metabolic myopathies can lead to therapeutic interventions with lifestyle and nutritional modification, cofactor treatment, and rapid treatment of rhabdomyolysis.

  8. Adult-onset nemaline myopathy in a dog presenting with persistent atrial standstill and primary hypothyroidism.

    Science.gov (United States)

    Nakamura, R K; Russell, N J; Shelton, G D

    2012-06-01

    A nine-year-old neutered female mixed breed dog presented for evaluation following a five-day history of lethargy, inappetence, weakness, abdominal distension and generalised muscle atrophy. Persistent vatrial standstill with a junctional rhythm was identified on electrocardiogram. Echocardiogram identified moderate dilation of all cardiac chambers and mild thickening of the mitral and tricuspid valves. Serology was negative for Neospora caninum and Toxoplasma gondii. Permanent pacemaker implantation was performed in addition to endomyocardial and skeletal muscle biopsies. Cryosections from the biceps femoris muscle showed numerous nemaline rod bodies while endomyocardial biopsies were possibly consistent with end-stage myocarditis. Rod bodies have rarely been reported in the veterinary literature. To the authors' knowledge, this is the first report of adult-onset nemaline rod myopathy and hypothyroidism with concurrent cardiac disease in a dog. © 2012 British Small Animal Veterinary Association.

  9. Mitochondrial myopathies.

    Science.gov (United States)

    DiMauro, Salvatore

    2006-11-01

    Our understanding of mitochondrial diseases (defined restrictively as defects of the mitochondrial respiratory chain) is expanding rapidly. In this review, I will give the latest information on disorders affecting predominantly or exclusively skeletal muscle. The most recently described mitochondrial myopathies are due to defects in nuclear DNA, including coenzyme Q10 deficiency and mutations in genes controlling mitochondrial DNA abundance and structure, such as POLG, TK2, and MPV17. Barth syndrome, an X-linked recessive mitochondrial myopathy/cardiopathy, is associated with decreased amount and altered structure of cardiolipin, the main phospholipid of the inner mitochondrial membrane, but a secondary impairment of respiratory chain function is plausible. The role of mutations in protein-coding genes of mitochondrial DNA in causing isolated myopathies has been confirmed. Mutations in tRNA genes of mitochondrial DNA can also cause predominantly myopathic syndromes and--contrary to conventional wisdom--these mutations can be homoplasmic. Defects in the mitochondrial respiratory chain impair energy production and almost invariably involve skeletal muscle, causing exercise intolerance, cramps, recurrent myoglobinuria, or fixed weakness, which often affects extraocular muscles and results in droopy eyelids (ptosis) and progressive external ophthalmoplegia.

  10. [Metabolic myopathies].

    Science.gov (United States)

    Papazian, Óscar; Rivas-Chacón, Rafael

    2013-09-06

    To review the metabolic myopathies manifested only by crisis of myalgias, cramps and rigidity of the muscles with decreased voluntary contractions and normal inter crisis neurologic examination in children and adolescents. These metabolic myopathies are autosomic recessive inherited enzymatic deficiencies of the carbohydrates and lipids metabolisms. The end result is a reduction of intra muscle adenosine triphosphate, mainly through mitochondrial oxidative phosphorylation, with decrease of available energy for muscle contraction. The one secondary to carbohydrates intra muscle metabolism disorders are triggered by high intensity brief (fatty acids metabolism disorders are triggered by low intensity prolonged (> 10 min) exercises. The conditions in the first group in order of decreasing frequency are the deficiencies of myophosforilase (GSD V), muscle phosphofructokinase (GSD VII), phosphoglycerate mutase 1 (GSD X) and beta enolase (GSD XIII). The conditions in the second group in order of decreasing frequency are the deficiencies of carnitine palmitoyl transferase II and very long chain acyl CoA dehydrogenase. The differential characteristics of patients in each group and within each group will allow to make the initial presumptive clinical diagnosis in the majority and then to order only the necessary tests to achieve the final diagnosis. Treatment during the crisis includes hydration, glucose and alkalinization of urine if myoglobin in blood and urine are elevated. Prevention includes avoiding exercise which may induce the crisis and fasting. The prognosis is good with the exception of rare cases of acute renal failure due to hipermyoglobinemia because of severe rabdomyolisis.

  11. Amyloid myopathy: a diagnostic challenge

    Directory of Open Access Journals (Sweden)

    Heli Tuomaala

    2009-08-01

    Full Text Available Amyloid myopathy (AM is a rare manifestation of primary systemic amyloidosis (AL. Like inflammatory myopathies, it presents with proximal muscle weakness and an increased creatine kinase level. We describe a case of AL with severe, rapidly progressive myopathy as the initial symptom. The clinical manifestation and muscle biopsy were suggestive of inclusion body myositis. AM was not suspected until amyloidosis was seen in the gastric mucosal biopsy. The muscle biopsy was then re-examined more specifically, and Congo red staining eventually showed vascular and interstitial amyloid accumulation, which led to a diagnosis of AM. The present case illustrates the fact that the clinical picture of AM can mimic that of inclusion body myositis.

  12. Evidence-based treatment of metabolic myopathy

    Directory of Open Access Journals (Sweden)

    Yan LIN

    2014-05-01

    Full Text Available Objective To evaluate the current treatments and possible adverse reactions of metabolic myopathy, and to develop the best solution for evidence-based treatment.  Methods Taking metabolic myopathy, mitochondrial myopathy, lipid storage myopathy, glycogen storage diseases, endocrine myopathy, drug toxicity myopathy and treatment as search terms, retrieve in databases such as PubMed, Cochrane Library, ClinicalKey database, National Science and Technology Library (NSTL, in order to collect the relevant literature database including clinical guidelines, systematic reviews (SR, randomized controlled trials (RCT, controlled clinical trials, retrospective case analysis and case study. Jadad Scale was used to evaluate the quality of literature.  Results Twenty-eight related articles were selected, including 6 clinical guidelines, 5 systematic reviews, 10 randomized controlled trials and 7 clinical controlled trials. According to Jadad Scale, 23 articles were evaluated as high-quality literature (≥ 4, and the remaining 5 were evaluated as low-quality literature (< 4. Treatment principles of these clinical trials, efficacy of different therapies and drug safety evaluation suggest that: 1 Acid α-glycosidase (GAA enzyme replacement therapy (ERT is the main treatment for glycogen storage diseases, with taking a high-protein diet, exercising before taking a small amount of fructose orally and reducing the patient's physical activity gradually. 2 Carnitine supplementation is used in the treatment of lipid storage myopathy, with carbohydrate and low fat diet provided before exercise or sports. 3 Patients with mitochondrial myopathy can take coenzyme Q10, vitamin B, vitamin K, vitamin C, etc. Proper aerobic exercise combined with strength training is safe, and it can also enhance the exercise tolerance of patients effectively. 4 The first choice to treat the endocrine myopathy is treating primary affection. 5 Myopathies due to drugs and toxins should

  13. Molecular and Genetic Studies of Congenital Myopathies

    Science.gov (United States)

    2018-03-21

    Central Core Disease; Centronuclear Myopathy; Congenital Fiber Type Disproportion; Multiminicore Disease; Myotubular Myopathy; Nemaline Myopathy; Rigid Spine Muscular Dystrophy; Undefined Congenital Myopathy

  14. A rare case report of simultaneous presentation of myopathy, Addison's disease, primary hypoparathyroidism, and Fanconi syndrome in a child diagnosed with Kearns-Sayre syndrome.

    Science.gov (United States)

    Tzoufi, Meropi; Makis, Alexandros; Chaliasos, Nikolaos; Nakou, Iliada; Siomou, Ekaterini; Tsatsoulis, Agathoklis; Zikou, Anastasia; Argyropoulou, Maria; Bonnefont, Jean Paul; Siamopoulou, Antigone

    2013-04-01

    Kearns-Sayre syndrome (KSS) is a rare mitochondrial DNA deletion syndrome defined as the presence of ophthalmoplegia, pigmentary retinopathy, onset less than age 20 years, and one of the following: cardiac conduction defects, cerebellar syndrome, or cerebrospinal fluid protein above 100 mg/dl. KSS may affect many organ systems causing endocrinopathies, encephalomyopathy, sensorineural hearing loss, and renal tubulopathy. Clinical presentation at diagnosis is quite heterogeneous and, usually, few organs are affected with progression to generalized disease early in adulthood. We present the case of a boy with KSS presenting at the age of 5 years with myopathy, Addison's disease, primary hypoparathyroidism, and Fanconi syndrome. The proper replacement treatment along with the administration of mitochondrial metabolism-improving agents had a brief ameliorating effect, but gradual severe multisystemic deterioration was inevitable over the next 5 years. This report highlights the fact that in case of simultaneous presentation of polyendocrinopathies and renal disease early in childhood, KSS should be considered.

  15. Myopathy in acute hypothyroidism

    OpenAIRE

    Ma, JTC; Yu, YL; Kung, AWC

    1987-01-01

    Hypothyroid myopathy has so far been reported in long standing cases of hypothyroidism. We describe two adult patients with myopathy associated with acute transient hypothyroidism. Both presented with severe muscle aches and cramps, stiffness and spasms. Muscle enzymes were markedly elevated and electromyography in one patient showed myopathic features. Histological changes were absent in muscle biopsy, probably because of the short duration of metabolic disturbance. The myopathy subsided pro...

  16. Myopathy in acute hypothyroidism.

    OpenAIRE

    Kung, A. W.; Ma, J. T.; Yu, Y. L.; Wang, C. C.; Woo, E. K.; Lam, K. S.; Huang, C. Y.; Yeung, R. T.

    1987-01-01

    Hypothyroid myopathy has so far been reported in long standing cases of hypothyroidism. We describe two adult patients with myopathy associated with acute transient hypothyroidism. Both presented with severe muscle aches and cramps, stiffness and spasms. Muscle enzymes were markedly elevated and electromyography in one patient showed myopathic features. Histological changes were absent in muscle biopsy, probably because of the short duration of metabolic disturbance. The myopathy subsided pro...

  17. Genetics Home Reference: Miyoshi myopathy

    Science.gov (United States)

    ... links) Centers for Disease Control and Prevention: Muscular Dystrophy Cincinnati Children's Hospital: Molkentin Lab: Mechanisms of Duchenne and Miyoshi Myopathy Disease InfoSearch: Miyoshi myopathy Jain ...

  18. Chronic primary intestinal pseudo-obstruction from visceral myopathy Pseudo-osbtrucción intestinal crónica primaria debida a miopatía visceral

    Directory of Open Access Journals (Sweden)

    M. T. Muñoz-Yagüe

    2006-04-01

    Full Text Available Chronic intestinal pseudo-obstruction is an uncommon syndrome characterized by relapsing episodes suggesting intestinal obstruction during which no mechanical causes are identified to account for symptoms. Etiologic factors may be manifold. Among them a number of neurologic conditions, gastrointestinal smooth muscle myopathies, endocrino-metabolic and autoimmune diseases, and the use of selected drugs stand out. We report a case of chronic intestinal pseudo-obstruction originating in a sporadic, primary intestinal myopathy that corresponds to no type thus far described. A histological study of the intestinal wall showed disrupted muscle bundles and the presence of interstitial edema. Myocytes had severe degenerative changes, and no alterations were seen in submucosal and myenteric plexus neurons. The activity of enzyme complexes in the mitochondrial respiratory chain, and of thymidine phosphorylase was normal. No mitochondrial DNA changes were seen.La pseudo-obstrucción intestinal crónica es un síndrome infrecuente caracterizado por episodios recidivantes, sugestivos de obstrucción intestinal, durante los cuales no se detectan causas mecánicas que justifiquen la sintomatología. Los factores etiológicos pueden ser múltiples. Entre ellos destacan diversas enfermedades neurológicas, miopatías de la musculatura lisa gastrointestinal, enfermedades endocrino-metabólicas y autoinmunes y el uso de determinados fármacos. Presentamos un caso de pseudo-obstrucción intestinal crónica originada por una miopatía intestinal primaria y esporádica que no corresponde a ningún tipo descrito hasta el momento. El estudio histológico de la pared intestinal mostró que los haces musculares estaban desestructurados y que existía edema intersticial. Los miocitos presentaban marcados cambios degenerativos y no existían alteraciones en las neuronas de los plexos submucoso y mientérico. La actividad de los complejos enzimáticos de la cadena

  19. Primary biliary cirrhosis and myopathy: an uncommon association Cirrose biliar primária e miopatia: uma rara associação

    Directory of Open Access Journals (Sweden)

    Bruno Cupertino Migueletto

    1999-10-01

    Full Text Available Primary biliary cirrhosis (PBC is a cholestatic liver disease, which is characterized by a chronic inflammatory destruction of intrahepatic bile ducts. It is a rare disorder whose precise etiology is still to be elucidated. Even though the liver is the principal target of PBC, other organ systems also might be affected. Muscular involvement has rarely been described in this disease, and in the majority of cases, muscular weakness has been interpreted as polymyositis. We report the case of a 48-year-old woman suffering from classic PBC, in association with a myopathy whose histological features are distinct from the cases reported before. We also performed a MEDLINE research for PBC and concomitant muscular diseases.A cirrose biliar primária (CBP é uma doença hepática colestática crônica de etiologia desconhecida e rara. Apesar do principal órgão acometido na CBP ser o fígado, outros órgãos podem também ser afetados. O acometimento muscular raramente tem sido relatado em pacientes com CBP e na maioria destes casos, a fraqueza muscular tem sido interpretada como Polimiosite. Nós relatamos o caso de uma mulher de 48 anos com CBP e miopatia com achados histopatológicos distintos dos casos anteriormente descritos e fizemos uma revisão da literatura sobre o acometimento muscular na CBP.

  20. Mitochondrial disorders in congenital myopathies

    Directory of Open Access Journals (Sweden)

    D. A. Kharlamov

    2014-01-01

    Full Text Available The literature review gives data on the role of mitochondrial disorders in the pathogenesis of congenital myopathies: congenital muscular dystrophies and congenital structural myopathies. It describes changes in congenital muscular dystrophies with type VI collagen, in myodystrophy with giant mitochondria, in congenital central core myopathies, myotubular myopathy, etc. Clinical and experimental findings are presented. Approaches to therapy for energy disorders in congenital myopathies are depicted.

  1. A Novel Axial Foldable Mechanism for a Segmented Primary Mirror of Space Telescope

    Directory of Open Access Journals (Sweden)

    Dignesh Thesiya

    2015-09-01

    Full Text Available Future space missions will have larger telescopes in order to look deeper into space while improvising on spatial resolution. The primary mirrors for these telescopes will be so large that using a monolithic mirror will be nearly impossible because of the difficulties associated with its fabrication, transportation, and installation on a launch vehicle. The feasibility of launching these huge mirrors is limited because of their small launch fairing diameter. The aerodynamic shape of the fairing requires a small diameter, but the height of the launch vehicle, which is available for designers to utilize, is larger than the fairing diameter. This paper presents the development of an axial deployment mechanism based on the screw jack principle. The mechanism was designed and developed, and a prototype was constructed in order to demonstrate a lab model.

  2. Imagenological characterization by Computerized Axial Tomography of the primary intracranial tumors

    International Nuclear Information System (INIS)

    Sosa Rivera, Manuel; Quintas Santana, Maria

    2009-01-01

    A descriptive observational study to 56 patients with imagenological diagnosis of primary intracranial neoplasia attended in the service of imagenology of the Provincial Docent Hospital 'Dr. Antonio Luaces Iraola' was carried out from March 1st 2006 to February 1st 2008, with the aim of characterizing these injuries by Computerized Axial Tomography and establishing an evaluation with the histological diagnosis. A questionnaire with the following variables was applied: sex, presuntive age, clinic, topographical characteristics (location, size, tumoral density, changes with administration of the resistance, calcifications, effect of mass and evaluation of the imagenological diagnosis with the histological diagnosis. Masculine sex and the group of ages of 60 are more predominated. The more frequent clinical manifestations were migraine, convulsions, difficulty to walk and vertigo. The size of the injury that prevailed was of 5, 9 and 2, 1 cm with supratentorial location. The majority of primary intracranial neoplasms were hypodense, and enhancement of the injuries with the administration of the resistance was observed. The mass effect bears a close relation with the location and size of the injury. The imagenological diagnosis fitted in with the histological one, being the gliomas the more frequent histological type

  3. STATINS AND MYOPATHY: MOLECULAR MECHANISMS

    Directory of Open Access Journals (Sweden)

    O. M. Drapkina

    2012-01-01

    Full Text Available The safety of statin therapy is considered. In particular the reasons of a complication such as myopathy are discussed in detail. The molecular mechanisms of statin myopathy , as well as its risk factors are presented. The role of coenzyme Q10 in the myopathy development and coenzyme Q10 application for the prevention of this complication are considered. 

  4. Genuine myotubular myopathy

    International Nuclear Information System (INIS)

    Edstroem, L.; Wroblewski, R.; Mair, W.G.

    1982-01-01

    Two patients, a father and his 14-year-old son, were suffering from a facioperoneal syndrome, and muscle biopsy findings were consistent with a myotubular myopathy. The father exhibited central nuclei in most muscle fibers, but his son had typical changes exclusively in hypotrophic type I fibers. The cytochemical and ultrastructural analysis revealed a spectrum of pathological changes typical of myotubular myopathy. Energy-dispersive electron probe x-ray microanalysis was performed on 6- to 12-microns thick freeze-dried cryosections visualized in the scanning or scanning transmission mode of electron microscopy. We found a high intracellular sodium and chlorine concentration and a low potassium concentration in comparison with control muscles. These changes pointed in the direction similar to results from human fetal muscle. The changes in the intracellular elemental composition may indicate a membrane pump dysfunction, which might be caused by a partial arrest in muscle fiber maturation

  5. Cerebrovascular Accidents In Myopathies

    Directory of Open Access Journals (Sweden)

    Farzad Fatehi

    2017-02-01

    Full Text Available Several types of stroke in myopathies are described: ischemic, metabolic, or cryptogenic. Ischemic stroke may be categorized as cardioembolic, angiopathic, hemodynamic, or thrombophilic. Cardiac involvement in the form of atrial fibrillation/flutter, dilated cardiomyopathy, or non-compaction Cardioembolic could ensue in stroke. Angiopathic stroke occurs provided that there is atherosclerosis or mitochondrial disorders. Thrombophilic stroke may happen in polymyositis or dermatomyositis along with anti-phospholipid syndrome. Metabolic stroke usually manifests as stroke-like episode and is a distinct feature of various mitochondrial disorders, principally MELAS syndrome. The clinical manifestations are as a result of a vasogenic edema, demonstrating as hyperintensity on T2, DWI, and apparent diffusion coefficient mapping. Differentiation between ischemic and metabolic stroke is essential in terms of diagnosis, therapy, and prognosis. In conclusion, ischemic stroke attributable to cardioembolism, arteriopathy, or thrombophilia are occasional events in myopathies, but metabolic stroke is a frequent feature of mitochondrial disorders.

  6. Muscle regeneration in mitochondrial myopathies

    DEFF Research Database (Denmark)

    Krag, T O; Hauerslev, S; Jeppesen, T D

    2013-01-01

    Mitochondrial myopathies cover a diverse group of disorders in which ragged red and COX-negative fibers are common findings on muscle morphology. In contrast, muscle degeneration and regeneration, typically found in muscular dystrophies, are not considered characteristic features of mitochondrial...... myopathies. We investigated regeneration in muscle biopsies from 61 genetically well-defined patients affected by mitochondrial myopathy. Our results show that the perturbed energy metabolism in mitochondrial myopathies causes ongoing muscle regeneration in a majority of patients, and some were even affected...

  7. Spectrum of metabolic myopathies.

    Science.gov (United States)

    Angelini, Corrado

    2015-04-01

    Metabolic myopathies are disorders of utilization of carbohydrates or fat in muscles. The acute nature of energy failure is manifested either by a metabolic crisis with weakness, sometimes associated with respiratory failure, or by myoglobinuria. A typical disorder where permanent weakness occurs is glycogenosis type II (GSDII or Pompe disease) both in infantile and late-onset forms, where respiratory insufficiency is manifested by a large number of cases. In GSDII the pathogenetic mechanism is still poorly understood, and has to be attributed more to structural muscle alterations, possibly in correlation to macro-autophagy, rather than to energetic failure. This review is focused on recent advances about GSDII and its treatment, and the most recent notions about the management and treatment of other metabolic myopathies will be briefly reviewed, including glycogenosis type V (McArdle disease), glycogenosis type III (debrancher enzyme deficiency or Cori disease), CPT-II deficiency, and ETF-dehydrogenase deficiency (also known as riboflavin-responsive multiple acyl-CoA dehydrogenase deficiency or RR-MADD). The discovery of the genetic defect in ETF dehydrogenase confirms the etiology of this syndrome. Other metabolic myopathies with massive lipid storage and weakness are carnitine deficiency, neutral lipid storage-myopathy (NLSD-M), besides RR-MADD. Enzyme replacement therapy is presented with critical consideration and for each of the lipid storage disorders, representative cases and their response to therapy is included. This article is part of a Special Issue entitled: Neuromuscular Diseases: Pathology and Molecular Pathogenesis. Copyright © 2014. Published by Elsevier B.V.

  8. Inherited myopathies and muscular dystrophies

    NARCIS (Netherlands)

    Cardamone, Michael; Darras, Basil T.; Ryan, Monique M.

    The inherited myopathies and muscular dystrophies are a diverse group of muscle diseases presenting with common complaints and physical signs: weakness, motor delay, and respiratory and bulbar dysfunction. The myopathies are caused by genetic defects in the contractile apparatus of muscle, and

  9. CT and the diagnosis of myopathies. Preliminary findings in 42 cases

    Energy Technology Data Exchange (ETDEWEB)

    Calgo, M; Crisi, G; Martinelli, C; Colombo, A; Schoenhuber, R; Gibertoni, M

    1986-01-01

    A total of 42 patients with myopathies underwent CT scans in order to study the relationship between CT images and clinical findings. CT is a valuable diagnostic aid to distinguish primary from neurogenic myopathies, to facilitate directed biopsy and finally to classify the disease according to the degree and extent of the muscular lesion. (orig.).

  10. Supratentorial primary intra-axial tumors in children. MR and CT evaluation

    International Nuclear Information System (INIS)

    Higano, S.; Takahashi, S.; Kurihara, N.; Singh, L.N.; Yamada, S.; Ishii, K.; Matsumoto, K.; Shirane, R.; Katakura, R.

    1997-01-01

    Purpose: To evaluate the MR and CT features of pediatric supratentorial intra-axial tumors with respect to different diagnosis and the role of each investigation modality. Material and Methods: MR and CT findings in 40 children with 12 types of pathologically proven histological tumors were reviewed. Results: The location of tumors might be one clue to differential diagnosis. In our material, cysts (60%), calcifications (45%), and intratumoral hemorrhages (27%) were found in the tumors. Characteristic features noted in some lesions included: peritumoral hemosiderin deposition in cavernous angiomas; intratumoral flow void in a choroid plexus carcinoma and in glioblastomas; and hemicerebral atrophy in germinomas. A comparison between malignant and benign tumors showed perifocal edema and a mass effect to be signifcantly more common in malignant lesions. Homogeneous enhancement suggested a benign tumor and an inhomogeneous pattern represented malignancy, while the lack of obvious enhancement did not always suggest benignity. Intratumoral calcium deposition was a not uncommon finding in malignant tumors. Conclusion: In most cases, the exact diagnosis should be made hy histological examination but it is important for treatment planning that the appropriate depiction of tumor extension and tissue characterization be made by MR and CT. (orig.)

  11. Stepwise approach to myopathy in systemic disease.

    Science.gov (United States)

    Chawla, Jasvinder

    2011-01-01

    Muscle diseases can constitute a large variety of both acquired and hereditary disorders. Myopathies in systemic disease results from several different disease processes including endocrine, inflammatory, paraneoplastic, infectious, drug- and toxin-induced, critical illness myopathy, metabolic, and myopathies with other systemic disorders. Patients with systemic myopathies often present acutely or sub acutely. On the other hand, familial myopathies or dystrophies generally present in a chronic fashion with exceptions of metabolic myopathies where symptoms on occasion can be precipitated acutely. Most of the inflammatory myopathies can have a chance association with malignant lesions; the incidence appears to be specifically increased only in patients with dermatomyositis. In dealing with myopathies associated with systemic illnesses, the focus will be on the acquired causes. Management is beyond the scope of this chapter. Prognosis is based upon the underlying cause and, most of the time, carries a good prognosis. In order to approach a patient with suspected myopathy from systemic disease, a stepwise approach is utilized.

  12. Exercise training in metabolic myopathies

    DEFF Research Database (Denmark)

    Vissing, J

    2016-01-01

    metabolic adaptations, such as increased dependence on glycogen use and a reduced capacity for fatty acid oxidation, which is detrimental in GSDs. Training has not been studied systematically in any FAODs and in just a few GSDs. However, studies on single bouts of exercise in most metabolic myopathies show......Metabolic myopathies encompass muscle glycogenoses (GSD) and disorders of muscle fat oxidation (FAOD). FAODs and GSDs can be divided into two main clinical phenotypes; those with static symptoms related to fixed muscle weakness and atrophy, and those with dynamic, exercise-related symptoms...... that are brought about by a deficient supply of ATP. Together with mitochondrial myopathies, metabolic myopathies are unique among muscle diseases, as the limitation in exercise performance is not solely caused by structural damage of muscle, but also or exclusively related to energy deficiency. ATP consumption...

  13. Genetics Home Reference: nemaline myopathy

    Science.gov (United States)

    ... deformities, abnormal curvature of the spine ( scoliosis ), and joint deformities (contractures). Most people with nemaline myopathy are ... Centre for Rare Diseases Washington University, St. Louis: Neuromuscular Disease Center Patient Support and Advocacy Resources (3 ...

  14. Treatment Opportunities in Patients With Metabolic Myopathies

    DEFF Research Database (Denmark)

    Ørngreen, Mette Cathrine; Vissing, John

    2017-01-01

    the development of new therapeutic options. Enzyme replacement therapy with rGAA has revolutionized treatment of early onset Pompe disease. Supplements of riboflavin, carnitine, and sucrose show promise in patients with respectively riboflavin-responsive multiple acyl-CoA dehydrogenase deficiency, primary...... carnitine deficiency, and McArdle disease. Treatment with citric acid cycle intermediates supply by triheptanoin seems promising in patients with glucogenoses, and studies are ongoing in patients with McArdle disease. Summary Treatment of metabolic myopathies primarily relies on avoiding precipitating...

  15. Endocrine myopathy: Case-based review

    Directory of Open Access Journals (Sweden)

    Babul Reddy Hanmayyagari

    2016-01-01

    Full Text Available Endocrine myopathy means muscle weakness in the presence of an abnormal endocrine state. Most of the endocrine disorders are associated with myopathy and it is usually reversible with correction of the underlying disturbance, though, there is an increasing knowledge of the metabolic effects of hormones, endocrine myopathy is a less recognized and often overlooked entity in clinical practice. Here, we describe this association in three of our patients, then, we discuss systematically about endocrine myopathy.

  16. Resveratrol and Myopathy

    Science.gov (United States)

    Bastin, Jean; Djouadi, Fatima

    2016-01-01

    Resveratrol is a natural polyphenolic compound produced by plants under various stress conditions. Resveratrol has been reported to exhibit antioxidant, anti-inflammatory, and anti-proliferative properties in mammalian cells and animal models, and might therefore exert pleiotropic beneficial effects in different pathophysiological states. More recently, resveratrol has also been shown to potentially target many mitochondrial metabolic pathways, including fatty acid β-oxidation or oxidative phosphorylation, leading to the up-regulation of the energy metabolism via signaling pathways involving PGC-1α, SIRT1, and/or AMP-kinase, which are not yet fully delineated. Some of resveratrol beneficial effects likely arise from its cellular effects in the skeletal muscle, which, surprisingly, has been given relatively little attention, compared to other target tissues. Here, we review the potential for resveratrol to ameliorate or correct mitochondrial metabolic deficiencies responsible for myopathies, due to inherited fatty acid β-oxidation or to respiratory chain defects, for which no treatment exists to date. We also review recent data supporting therapeutic effects of resveratrol in the Duchenne Muscular Dystrophy, a fatal genetic disease affecting the production of muscle dystrophin, associated to a variety of mitochondrial dysfunctions, which likely contribute to disease pathogenesis. PMID:27136581

  17. Lipid storage myopathies.

    Science.gov (United States)

    Bruno, Claudio; Dimauro, Salvatore

    2008-10-01

    The aim of this review is to provide an update on disorders of lipid metabolism affecting skeletal muscle exclusively or predominantly and to summarize recent clinical, genetic, and therapeutic studies in this field. Over the past 5 years, new clinical phenotypes and genetic loci have been described, unusual pathogenic mechanisms have been elucidated, and novel pharmacological approaches have been developed. At least one genetic defect responsible for the myopathic form of CoQ10 deficiency has been identified, causing a disorder that is allelic with the late-onset riboflavine-responsive form of multiple acyl-coenzyme A dehydrogenation deficiency. Novel mechanisms involved in the lipolytic breakdown of cellular lipid depots have been described and have led to the identification of genes and mutations responsible for multisystemic neutral lipid storage disorders, characterized by accumulation of triglyceride in multiple tissues, including muscle. Defects in lipid metabolism can affect either the mitochondrial transport and oxidation of exogenous fatty acid or the catabolism of endogenous triglycerides. These disorders impair energy production and almost invariably involve skeletal muscle, causing progressive myopathy with muscle weakness, or recurrent acute episodes of rhabdomyolysis triggered by exercise, fasting, or infections. Clinical and genetic characterization of these disorders has important implications both for accurate diagnostic approach and for development of therapeutic strategies.

  18. Whole-body muscle MRI to detect myopathies in non-extrapyramidal bent spine syndrome

    International Nuclear Information System (INIS)

    Ohana, Mickael; Durand, Marie-Christine; Marty, Catherine; Lazareth, Jean-Philippe; Maisonobe, Thierry; Mompoint, Dominique; Carlier, Robert-Yves

    2014-01-01

    Bent spine syndrome (BSS), defined as an abnormal forward flexion of the trunk resolving in supine position, is usually related to parkinsonism, but can also be encountered in myopathies. This study evaluates whole-body muscle MRI (WB-mMRI) as a tool for detecting underlying myopathy in non-extrapyramidal BSS. Forty-three patients (90 % women; 53-86 years old) with a non-extrapyramidal BSS were prospectively included. All underwent a 1.5-T WB-mMRI and a nerve conduction study. Muscle biopsy was performed if a myopathy could not be eliminated based on clinical examination and all tests. Systematic MRI interpretation focused on peripheral and axial muscle injury; spinal posture and incidental findings were also reported. WB-mMRI was completed for all patients, with 13 muscle biopsies ultimately needed and myopathy revealed as the final etiological diagnosis in five cases (12 %). All biopsy-proven myopathies were detected by the WB-mMRI. Relevant incidental MRI findings were made in seven patients. This study supports WB-mMRI as a sensitive and feasible tool for detecting myopathy in BSS patients. Associated with electroneuromyography, it can better indicate when a muscle biopsy is needed and guide it when required. Rigorous radiological interpretation is mandatory, so as not to miss incidental findings of clinical consequence. (orig.)

  19. Whole-body muscle MRI to detect myopathies in non-extrapyramidal bent spine syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Ohana, Mickael [Nouvel Hopital Civil - Hopitaux Universitaires de Strasbourg, Service de Radiologie B, Strasbourg (France); Durand, Marie-Christine [AP-HP - Hopital Raymond Poincare, Service de Neurologie, Garches (France); Marty, Catherine; Lazareth, Jean-Philippe [AP-HP - Hopital Raymond Poincare, Service de Rhumatologie, Garches (France); Maisonobe, Thierry [APH-HP - Hopital de la Pitie-Salpetriere, Service de Neuropathologie, Paris (France); Mompoint, Dominique; Carlier, Robert-Yves [AP-HP - Hopital Raymond Poincare, Service de Radiologie, Garches (France)

    2014-08-15

    Bent spine syndrome (BSS), defined as an abnormal forward flexion of the trunk resolving in supine position, is usually related to parkinsonism, but can also be encountered in myopathies. This study evaluates whole-body muscle MRI (WB-mMRI) as a tool for detecting underlying myopathy in non-extrapyramidal BSS. Forty-three patients (90 % women; 53-86 years old) with a non-extrapyramidal BSS were prospectively included. All underwent a 1.5-T WB-mMRI and a nerve conduction study. Muscle biopsy was performed if a myopathy could not be eliminated based on clinical examination and all tests. Systematic MRI interpretation focused on peripheral and axial muscle injury; spinal posture and incidental findings were also reported. WB-mMRI was completed for all patients, with 13 muscle biopsies ultimately needed and myopathy revealed as the final etiological diagnosis in five cases (12 %). All biopsy-proven myopathies were detected by the WB-mMRI. Relevant incidental MRI findings were made in seven patients. This study supports WB-mMRI as a sensitive and feasible tool for detecting myopathy in BSS patients. Associated with electroneuromyography, it can better indicate when a muscle biopsy is needed and guide it when required. Rigorous radiological interpretation is mandatory, so as not to miss incidental findings of clinical consequence. (orig.)

  20. Idiopathic Inflammatory Myopathies: An update

    Directory of Open Access Journals (Sweden)

    Bulent KURT

    2016-06-01

    Full Text Available Idiopathic inflammatory myopathies (IIM are a heterogeneous group of disease with complex clinical features. It has been sub-classified as: (1 Dermatomyositis, (2 Polymyositis, and (3 Inclusion body myositis (IBM. Nowadays, there are some studies in literature suggest necrotizing autoimmune myopathy and immune-mediated necrotizing myopathy should also be added to this group of disease. There is a debate in the diagnosis of IIMs and up until now, about 12 criteria systems have been proposed. Some of the criteria systems have been used widely such as Griggs et al.'s proposal for IBM. Clinical findings, autoantibodies, enzymes, electrophysiological, and muscle biopsy findings are diagnostic tools. Because of diseases' complexity, none of the findings are diagnostic alone. In this study, we discussed the diagnostic criteria of IMMs and described detailed morphological features. [J Interdiscipl Histopathol 2016; 4(2.000: 41-45

  1. GNE Myopathy in Turkish Sisters with a Novel Homozygous Mutation

    Science.gov (United States)

    Diniz, Gulden; Secil, Yaprak; Ceylaner, Serdar; Tokucoglu, Figen; Türe, Sabiha; Celebisoy, Mehmet; İncesu, Tülay Kurt; Akhan, Galip

    2016-01-01

    Background. Hereditary inclusion body myopathy is caused by biallelic defects in the GNE gene located on chromosome 9p13. It generally affects adults older than 20 years of age. Methods and Results. In this study, we present two Turkish sisters with progressive myopathy and describe a novel mutation in the GNE gene. Both sisters had slightly higher levels of creatine kinase (CK) and muscle weakness. The older sister presented at 38 years of age with an inability to climb steps, weakness, and a steppage gait. Her younger sister was 36 years old and had similar symptoms. The first symptoms of the disorder were seen when the sisters were 30 and 34 years old, respectively. The muscle biopsy showed primary myopathic features and presence of rimmed vacuoles. DNA analysis demonstrated the presence of previously unknown homozygous mutations [c.2152 G>A (p.A718T)] in the GNE genes. Conclusion. Based on our literature survey, we believe that ours is the first confirmed case of primary GNE myopathy with a novel missense mutation in Turkey. These patients illustrate that the muscle biopsy is still an important method for the differential diagnosis of vacuolar myopathies in that the detection of inclusions is required for the definitive diagnosis. PMID:27298745

  2. Severe polysaccharide storage myopathy in Belgian and Percheron draught horses.

    Science.gov (United States)

    Valentine, B A; Credille, K M; Lavoie, J P; Fatone, S; Guard, C; Cummings, J F; Cooper, B J

    1997-05-01

    A severe myopathy leading to death or euthanasia was identified in 4 Belgian and 4 Percheron draught horses age 2-21 years. Clinical signs ranged from overt weakness and muscle atrophy in 2 horses age 2 and 3 years, to recumbency with inability to rise in 6 horses age 4-21 years. In 5 horses there was mild to severe increases in muscle enzyme levels. Clinical diagnoses included equine motor neuron disease (2 horses), post anaesthetic myopathy (2 horses), exertional myopathy (2 horses), myopathy due to unknown (one horse), and equine protozoal myelitis (one horse). Characteristic histopathology of muscle from affected horses was the presence of excessive complex polysaccharide and/or glycogen, revealed by periodic acid-Schiff staining in all cases and by electron microscopy in one case. Evaluation of frozen section histochemistry performed on 2 cases indicated that affected fibres were Type 2 glycolytic fibres. Subsarcolemmal and intracytoplasmic vacuoles were most prominent in 3 horses age 2-4 years, and excessive glycogen, with little or no complex polysaccharide, was the primary compound stored in affected muscle in these young horses. Myopathic changes, including fibre size variation, fibre hypertrophy, internal nuclei, and interstitial fat infiltration, were most prominent in 5 horses age 6-21 years, and the accumulation of complex polysaccharide appeared to increase with age. Mild to moderate segmental myofibre necrosis was present in all cases.

  3. Association of Bruch's membrane opening and optic disc morphology to axial length and visual field defects in eyes with primary open-angle glaucoma.

    Science.gov (United States)

    Nakanishi, Hideo; Suda, Kenji; Yoshikawa, Munemitsu; Akagi, Tadamichi; Kameda, Takanori; Ikeda, Hanako Ohashi; Yokota, Satoshi; Kurimoto, Yasuo; Tsujikawa, Akitaka

    2018-03-01

    To examine the morphology of Bruch's membrane opening (BMO), optic disc, and peripapillary atrophy (PPA) by scanning laser ophthalmoscopy (SLO) and spectral-domain optical coherence tomography (SD-OCT), and to determine their association with the axial length and visual field defects. This was a cross-sectional study of 94 eyes of 56 subjects; 77 eyes were diagnosed with primary open-angle glaucoma and 17 eyes as normal. The margins of the optic disc were determined in the SLO images, and that of the BMO in the SD-OCT images. The ovality and area of the BMO and the optic disc were measured. The beta and gamma-PPA areas were also measured. The association of each parameter with the axial length and the mean deviation (MD) of the visual field tests was determined by generalized estimating equations (GEEs). The optic disc ovality was associated with the axial length and the MD (β = -0.47, P = 7.6 × 10 -4 and β = 0.12, P = 0.040). The BMO ovality was not significantly associated with the axial length and the MD. The BMO area was associated with the axial length (β = 0.30, P = 0.029). A larger BMO area was associated with a thinner BMO-based neuroretinal rim width (BMO-MRW) after adjustments for the MD (β = -0.30, P = 2.1 × 10 -4 ). The beta- and gamma-PPA areas were associated with the axial length (β = 0.50, P = 7.4 × 10 -5 and β = 0.62, P = 4.2 × 10 -6 ). The optic disc ovality was associated with both the axial length and MD, whereas BMO ovality was not. Attention should be paid to the influence of the axial length-related enlargement of the BMO.

  4. Immune-mediated statin myopathy.

    Science.gov (United States)

    Loganathan, Priyadarshini; Oddis, Chester V; Aggarwal, Rohit

    2016-01-01

    Statin-induced necrotizing autoimmune myopathy (SINAM) is associated with a unique clinical 5 phenotype of severe proximal muscle weakness during or after exposure to statins in patients with high creatine kinase (CK) levels. Electromyography (EMG) and muscle biopsy reveal features of a necrotizing myopathy and the anti-HMGCR autoantibody is frequently detected. Treatment requires a combination of statin discontinuation as well as immunomodulatory or immunosuppressive therapy. HLA typing (HLADRB1*1101) is strongly associated with anti-10 HMGCR autoantibody positivity in statin-exposed patients. It is well documented that statin triggers autoimmune disease in those with a genetic susceptibility. With the commercial availability of an accurate ELISA test, the natural history of the disease and its phenotypic features are becoming increasingly understood.

  5. Localized scleroderma and regional inflammatory myopathy.

    Science.gov (United States)

    Zivković, Saša A; Freiberg, William; Lacomis, David; Domsic, Robyn T; Medsger, Thomas A

    2014-05-01

    Inflammatory myopathy is rare in localized scleroderma. We report 2 new cases of regional inflammatory myopathy associated with localized scleroderma and review 10 reported cases of localized scleroderma associated with an inflammatory myopathy with regional muscle involvement, more often in the upper extremities. Serum creatine kinase was mildly elevated or normal. Histopathology often showed perimysial inflammation and plasma cell infiltration. These cases demonstrate that inflammatory myopathy should be considered in patients with localized scleroderma and regional muscle weakness, pain or atrophy. Muscle biopsy can confirm the diagnosis of myositis, which if identified, will require anti-inflammatory and/or immunosuppressive therapy. Published by Elsevier B.V.

  6. Myopathy in Addison's disease.

    OpenAIRE

    Mor, F; Green, P; Wysenbeek, A J

    1987-01-01

    Since the first description of primary adrenocortical insufficiency by Thomas Addison in 1855 several large series of patients with Addison's disease have been published. The common signs and symptoms include: weakness, hyperpigmentation, weight loss, gastrointestinal complaints, and hypotension. It is rare for patients with Addison's disease to present with musculoskeletal symptoms including flexion contractures, hyperkalaemic neuromyopathy, Guillain-Barré syndrome, migratory myalgia, sciati...

  7. Miopatia ocular descendente Descending ocular myopathy: a case report

    Directory of Open Access Journals (Sweden)

    Marcos R. G. de Freitas

    1975-06-01

    Full Text Available Os autores apresentam caso de paciente jovem, do sexo feminino, com afecção muscular primária ocular e faríngea sem caráter familial. Foram feitos estudos eletromiográficos e histopatológicos musculares que confirmam o caráter miogênico do processo. É feita comparação entre a miopatia ocular e a miopatia ocular descendente, acreditando os autores que seriam variantesThe case of a 23 years old female patient, with primary involvement of the extraocular and faringeal muscles without familiar history is reported. Electromyographic and muscular biopsy studies proved the myogenic nature of the process. A clinical comparison between the ocular myopathy and the descending ocular myopathy is made, the authors thinking that both of them would be variants of the same muscle disease.

  8. A diagnostic algorithm for metabolic myopathies.

    Science.gov (United States)

    Berardo, Andres; DiMauro, Salvatore; Hirano, Michio

    2010-03-01

    Metabolic myopathies comprise a clinically and etiologically diverse group of disorders caused by defects in cellular energy metabolism, including the breakdown of carbohydrates and fatty acids to generate adenosine triphosphate, predominantly through mitochondrial oxidative phosphorylation. Accordingly, the three main categories of metabolic myopathies are glycogen storage diseases, fatty acid oxidation defects, and mitochondrial disorders due to respiratory chain impairment. The wide clinical spectrum of metabolic myopathies ranges from severe infantile-onset multisystemic diseases to adult-onset isolated myopathies with exertional cramps. Diagnosing these diverse disorders often is challenging because clinical features such as recurrent myoglobinuria and exercise intolerance are common to all three types of metabolic myopathy. Nevertheless, distinct clinical manifestations are important to recognize as they can guide diagnostic testing and lead to the correct diagnosis. This article briefly reviews general clinical aspects of metabolic myopathies and highlights approaches to diagnosing the relatively more frequent subtypes (Fig. 1). Fig. 1 Clinical algorithm for patients with exercise intolerance in whom a metabolic myopathy is suspected. CK-creatine kinase; COX-cytochrome c oxidase; CPT-carnitine palmitoyl transferase; cyt b-cytochrome b; mtDNA-mitochondrial DNA; nDNA-nuclear DNA; PFK-phosphofructokinase; PGAM-phosphoglycerate mutase; PGK-phosphoglycerate kinase; PPL-myophosphorylase; RRF-ragged red fibers; TFP-trifunctional protein deficiency; VLCAD-very long-chain acyl-coenzyme A dehydrogenase.

  9. Genetics Home Reference: idiopathic inflammatory myopathy

    Science.gov (United States)

    ... stumble while walking and find it difficult to grasp items. As in dermatomyositis and polymyositis, swallowing can ... and development? More about Mutations and Health Inheritance Pattern Most cases of idiopathic inflammatory myopathy are sporadic, ...

  10. Tumor-Induced Osteomalacia Caused by Primary Fibroblast Growth Factor 23 Secreting Neoplasm in Axial Skeleton: A Case Report

    Directory of Open Access Journals (Sweden)

    Gunjan Y. Gandhi

    2012-01-01

    Full Text Available We report the case of a 66-year-old woman with tumor-induced osteomalacia (TIO caused by fibroblast growth factor 23 (FGF-23 secreting mesenchymal tumor localized in a lumbar vertebra and review other cases localized to the axial skeleton. She presented with nontraumatic low back pain and spontaneous bilateral femur fractures. Laboratory testing was remarkable for low serum phosphorus, phosphaturia, and significantly elevated serum FGF-23 level. Magnetic resonance imaging (MRI of the lumbar spine showed a focal lesion in the L-4 vertebra which was hypermetabolic on positron emission tomography (PET scan. A computed tomography (CT guided needle biopsy showed a low grade spindle cell neoplasm with positive FGF-23 mRNA expression by reverse transcriptase polymerase chain reaction (RT-PCR, confirming the diagnosis of a phosphaturic mesenchymal tumor mixed connective tissue variant (PMTMCT. The patient elected to have surgery involving anterior resection of L-4 vertebra with subsequent normalization of serum phosphorus. Including the present case, we identified 12 cases of neoplasms localized to spine causing TIO. To our knowledge, this paper represents the first documented case of lumbar vertebra PMT causing TIO. TIO is a rare metabolic bone disorder that carries a favorable prognosis. When a lesion is identifiable, surgical intervention is typically curative.

  11. Understanding mitochondrial myopathies: a review

    Directory of Open Access Journals (Sweden)

    Abhimanyu S. Ahuja

    2018-05-01

    Full Text Available Mitochondria are small, energy-producing structures vital to the energy needs of the body. Genetic mutations cause mitochondria to fail to produce the energy needed by cells and organs which can cause severe disease and death. These genetic mutations are likely to be in the mitochondrial DNA (mtDNA, or possibly in the nuclear DNA (nDNA. The goal of this review is to assess the current understanding of mitochondrial diseases. This review focuses on the pathology, causes, risk factors, symptoms, prevalence data, symptomatic treatments, and new research aimed at possible preventions and/or treatments of mitochondrial diseases. Mitochondrial myopathies are mitochondrial diseases that cause prominent muscular symptoms such as muscle weakness and usually present with a multitude of symptoms and can affect virtually all organ systems. There is no cure for these diseases as of today. Treatment is generally supportive and emphasizes symptom management. Mitochondrial diseases occur infrequently and hence research funding levels tend to be low in comparison with more common diseases. On the positive side, quite a few genetic defects responsible for mitochondrial diseases have been identified, which are in turn being used to investigate potential treatments. Speech therapy, physical therapy, and respiratory therapy have been used in mitochondrial diseases with variable results. These therapies are not curative and at best help with maintaining a patient’s current abilities to move and function.

  12. An integrated diagnosis strategy for congenital myopathies.

    Directory of Open Access Journals (Sweden)

    Johann Böhm

    Full Text Available Congenital myopathies are severe muscle disorders affecting adults as well as children in all populations. The diagnosis of congenital myopathies is constrained by strong clinical and genetic heterogeneity. Moreover, the majority of patients present with unspecific histological features, precluding purposive molecular diagnosis and demonstrating the need for an alternative and more efficient diagnostic approach. We used exome sequencing complemented by histological and ultrastructural analysis of muscle biopsies to identify the causative mutations in eight patients with clinically different skeletal muscle pathologies, ranging from a fatal neonatal myopathy to a mild and slowly progressive myopathy with adult onset. We identified RYR1 (ryanodine receptor mutations in six patients and NEB (nebulin mutations in two patients. We found novel missense and nonsense mutations, unraveled small insertions/deletions and confirmed their impact on splicing and mRNA/protein stability. Histological and ultrastructural findings of the muscle biopsies of the patients validated the exome sequencing results. We provide the evidence that an integrated strategy combining exome sequencing with clinical and histopathological investigations overcomes the limitations of the individual approaches to allow a fast and efficient diagnosis, accelerating the patient's access to a better healthcare and disease management. This is of particular interest for the diagnosis of congenital myopathies, which involve very large genes like RYR1 and NEB as well as genetic and phenotypic heterogeneity.

  13. Systemic calciphylaxis presenting as a painful, proximal myopathy.

    OpenAIRE

    Edelstein, C. L.; Wickham, M. K.; Kirby, P. A.

    1992-01-01

    A renal transplant patient who presented with a painful, proximal myopathy due to systemic calciphylaxis is described. The myopathy preceded the characteristic skin and soft tissue necrosis. Systemic calciphylaxis should be considered in a dialysis or a renal transplant patient presenting with a painful proximal myopathy even in the absence of necrotic skin lesions.

  14. Primary and Reflected Compaction Waves in a Foam Rod Due to an Axial Impact by a Small Mass

    Directory of Open Access Journals (Sweden)

    D. Karagiozova

    Full Text Available AbstractThe propagation of compaction waves in a stationary foam block subjected to an impact by a small mass is studied in order to examine the mechanism of compaction within the primary and reflected stress waves. The analysis is focused on aluminium strain rate insensitive foam that exhibits strain hardening under quasistatic compression. A theoretical approach is applied using a uniaxial model of compaction in which the compacted strains, being functions of the velocity variation, are not predefined but are obtained as a part of the solution. The present approach allows one to obtain the strain histories and strain distributions within the primary compaction wave as well as within the reflected wave, which propagates in a media with non-uniform density increasing monotonically in the direction of loading. FE simulations considering aluminium based foam Cymat with density 411.5 kg/m3 are carried out in order to verify the proposed theoretical model. A comparison between the impact velocity attenuation predicted by the present model and classical Rigid Perfectly-Plastic Locking material model for cellular materials is discussed.

  15. Adult-onset nemaline myopathy presenting as respiratory failure.

    LENUS (Irish Health Repository)

    Kelly, Emer

    2008-11-01

    Nemaline myopathy is a rare congenital myopathy that generally presents in childhood. We report a case of a 44-year-old man who presented with severe hypoxic hypercapnic respiratory failure as the initial manifestation of nemaline myopathy. After starting noninvasive ventilation, his pulmonary function test results improved substantially, and over the 4 years since diagnosis his respiratory function remained stable. There are few reported cases of respiratory failure in patients with adult-onset nemaline myopathy, and the insidious onset in this case is even more unusual. This case highlights the varied presenting features of adult-onset nemaline myopathy and that noninvasive ventilation improves respiratory function.

  16. Myopathies of endocrine disorders: A prospective clinical and biochemical study

    Directory of Open Access Journals (Sweden)

    Vikas Sharma

    2014-01-01

    Full Text Available Introduction: Major categories of endocrine myopathy include those associated with: Adrenal dysfunction (as in Cushing′s disease or steroid myopathy; thyroid dysfunction (as in myxedema coma or thyrotoxic myopathy; vitamin D deficiency; parathyroid dysfunction; and pituitary dysfunction. Steroid myopathy is the most common endocrine myopathy. Objective: To study the etiology, varied presentations, and outcome after therapy of patients with endocrine myopathies. Materials and Methods: Myopathy was evaluated by the standard clinical procedures: Detailed clinical history, manual muscle strength testing, and creatine phosphokinase (CPK. Endocrine disorders were diagnosed as per clinical features and biochemical parameters. The treatment was given to patients as per underlying endocrine disease. Myopathy was assessed before and after treatment. Results: Out of the 37 patients who were diagnosed with endocrine myopathies, thyroid dysfunction was the most common cause (17 cases, followed by vitamin D deficiency in nine, adrenal dysfunction in six, parathyroid dysfunction in three, and pituitary dysfunction in two. Some patients had atypical presentation (repeated falls in one, tongue fasciculations in one, neck weakness in five, one with ptosis and facial weakness, asymmetrical onset in one, and calf hypertrophy in one. The serum creatine kinase (CK concentration did not correlate with muscle weakness. Following the treatment regimen which was specific for a given myopathy, 26 patients recovered fully. Conclusion: We found varied clinical presentations of endocrine myopathies. All the patients with neuromuscular complaints should be investigated for endocrine causes because significant number of them recovers fully with specific treatment.

  17. A study of acute muscle dysfunction with particular reference to dengue myopathy

    Directory of Open Access Journals (Sweden)

    Rajesh Verma

    2017-01-01

    ; dermatomyositis, polymyositis, thyrotoxicosis, systemic lupus erythematosus, and unknown etiology in one each. Only eight patients had abnormal electrophysiology and seven among nine biopsies done were abnormal. At 1 month, 24 (80.0% and 23 (76.7% patients had achieved normal MBI and MRS scores with 28 (93.3 and 27 (90% patients, respectively, at 3 months. Dengue with hypokalemia had less myalgia, more of hyporeflexia, and lower serum CK compared to those without hypokalemia. Conclusion: Dengue infection and hypokalemia due to various causes are the most common causes of acute myopathy and are associated with rapid and complete recovery within 1 month. Shorter duration of illness, higher MRC sum score, better disability status at presentation, lower serum CK correlate with better outcome. Biopsy was decisive in <20% cases; hence, it is not primary investigation in acute myopathy.

  18. Acute steroid myopathy: a highly overlooked entity.

    Science.gov (United States)

    Haran, Michal; Schattner, Ami; Kozak, Natasha; Mate, Andras; Berrebi, Alain; Shvidel, Lev

    2018-02-15

    Myopathy in patients being treated with corticosteroids is known primarily among chronically-treated patients or in critically ill and mechanically-ventilated patients receiving corticosteroids, often in high doses. To highlight the entity of acute, early-onset corticosteroid-treatment-associated myopathy and its characteristics. Reporting our experience with four patients and reviewing all published reports of myopathy developing ≤14 days of initiating corticosteroid-treatment. Acute corticosteroid myopathy (ASM) exists, though the syndrome appears to be rare. It is characterized by unpredictability and heterogeneity, sometimes developing within 1-3 days, after a single dose, which may not be high and administered by varied routes. Proximal limb muscle weakness is the most common form, but distal limb, bulbar and respiratory muscles may be involved. Steroid cessation often leads to improvement/resolution, but irreversibility may occur. A high index of suspicion for the possibility of ASM is necessary, to ensure drug discontinuation and recovery. This is particularly true since the entity is not widely recognized and its symptoms are often erroneously interpreted as due to the patient's underlying disease.

  19. Muscle spindles exhibit core lesions and extensive degeneration of intrafusal fibers in the Ryr1I4895T/wt mouse model of core myopathy

    International Nuclear Information System (INIS)

    Zvaritch, Elena; MacLennan, David H.

    2015-01-01

    Muscle spindles from the hind limb muscles of adult Ryr1 I4895T/wt (IT/+) mice exhibit severe structural abnormalities. Up to 85% of the spindles are separated from skeletal muscle fascicles by a thick layer of connective tissue. Many intrafusal fibers exhibit degeneration, with Z-line streaming, compaction and collapse of myofibrillar bundles, mitochondrial clumping, nuclear shrinkage and pyknosis. The lesions resemble cores observed in the extrafusal myofibers of this animal model and of core myopathy patients. Spindle abnormalities precede those in extrafusal fibers, indicating that they are a primary pathological feature in this murine Ryr1-related core myopathy. Muscle spindle involvement, if confirmed for human core myopathy patients, would provide an explanation for an array of devastating clinical features characteristic of these diseases and provide novel insights into the pathology of RYR1-related myopathies. - Highlights: • Muscle spindles exhibit structural abnormalities in a mouse model of core myopathy. • Myofibrillar collapse and mitochondrial clumping is observed in intrafusal fibers. • Myofibrillar degeneration follows a pattern similar to core formation in extrafusal myofibers. • Muscle spindle abnormalities are a part of the pathological phenotype in the mouse model of core myopathy. • Direct involvement of muscle spindles in the pathology of human RYR1-related myopathies is proposed

  20. Axial tomography

    International Nuclear Information System (INIS)

    Brueckner, K.A.; Lewis, J.H.

    1979-01-01

    The invention relates to axial tomography, sometimes referred to as cross-sectional x-ray. The apparatus described may utilize the conventional x-ray or ultrasonic source and detector and scanning mechanism for producing the plurality of sets of radiation detector output signals. It has the means for storing the detector output signals in analog form with the signals of one set overlying the signals of another set so that signals resulting from radiation through a zone of the object being examined are summed at a corresponding zone in the storage device, typically an electronic storage tube. The summed signals are read from the storage device with a radially inversely proportional reader producing a second signal for storage, again typically in an electronic storage tube. These signals stored in the second storage device are read with Laplacian relation, with the resultant sigal being a video signal that may be connected to a TV monitor for display of the sectional image. In alternative embodiments, optical film systems and electrostatic systems are utilized. (JTA)

  1. Evaluation of ubiquinone concentration and mitochondrial function relative to cerivastatin-induced skeletal myopathy in rats

    International Nuclear Information System (INIS)

    Schaefer, William H.; Lawrence, Jeffery W.; Loughlin, Amy F.; Stoffregen, Dana A.; Mixson, Lori A.; Dean, Dennis C.; Raab, Conrad E.; Yu, Nathan X.; Lankas, George R.; Frederick, Clay B.

    2004-01-01

    with circulating CK levels in treated animals. The results of this study suggest that neither mitochondrial injury, nor a decrease in muscle ubiquinone levels, is the primary cause of skeletal myopathy in cerivastatin-dosed rats

  2. Restrictive extraocular myopathy: A presenting feature of acromegaly

    Directory of Open Access Journals (Sweden)

    Steven Heireman

    2011-01-01

    Full Text Available A 45-year-old man presented with binocular diplopia in primary gaze for 1 year. Orthoptic evaluation showed 10-prism diopter right eye hypotropia and 6-prism diopter right eye esotropia. The elevation and abduction of the right eye were mechanically restricted. This was associated with systemic features suggestive of acromegaly. Magnetic resonance imaging (MRI of the brain demonstrated a pituitary macroadenoma. An elevated serum insulin-like growth factor I level and the failure of growth hormone suppression after an oral glucose load biochemically confirmed the diagnosis of acromegaly. Computed tomography (CT of the orbit demonstrated bilateral symmetrical enlargement of the medial rectus and inferior rectus muscle bellies. All tests regarding Graves-Basedow disease were negative. Although rare, diplopia due to a restrictive extraocular myopathy could be the presenting symptom of acromegaly.

  3. Centronuclear myopathy in a Border collie dog.

    Science.gov (United States)

    Eminaga, S; Cherubini, G B; Shelton, G D

    2012-10-01

    A two-year old, male entire Border collie was presented with a one-year history of exercise-induced collapsing on the pelvic limbs. Physical examination revealed generalised muscle atrophy. Neurological examination supported a generalised neuromuscular disorder. Electromyography revealed spontaneous electrical activity in almost all muscles. Unfixed and formaldehyde-fixed biopsy samples were collected from the triceps brachii, longissimus and vastus lateralis muscles. Histopathological, histochemical and ultrastructural examinations of biopsy specimens were consistent with either centronuclear or myotubular myopathy. The dog clinically improved with supportive treatment with L-carnitine, co-enzyme Q10 and vitamin B compound. To the authors' knowledge, this is the first report of centronuclear/myotubular myopathy in a Border collie. © 2012 British Small Animal Veterinary Association.

  4. Aerobic Training in Patients with Congenital Myopathy

    DEFF Research Database (Denmark)

    Hedermann, Gitte; Vissing, Christoffer Rasmus; Jensen, Karen

    2016-01-01

    INTRODUCTION: Congenital myopathies (CM) often affect contractile proteins of the sarcomere, which could render patients susceptible to exercise-induced muscle damage. We investigated if exercise is safe and beneficial in patients with CM. METHODS: Patients exercised on a stationary bike for 30......: The Regional Committee on Health Research Ethics of the Capital Region of Denmark H-2-2013-066 and ClinicalTrials.gov H2-2013-066....

  5. Bethlem myopathy: An autosomal dominant myopathy with flexion contractures, keloids, and follicular hyperkeratosis.

    Science.gov (United States)

    Saroja, Aralikatte Onkarappa; Naik, Karkal Ravishankar; Nalini, Atcharayam; Gayathri, Narayanappa

    2013-10-01

    Bethlem myopathy and Ullrich congenital muscular dystrophy form a spectrum of collagenopathies caused by genetic mutations encoding for any of the three subunits of collagen VI. Bethlem phenotype is relatively benign and is characterized by proximal dominant myopathy, keloids, contractures, distal hyperextensibility, and follicular hyperkeratosis. Three patients from a single family were diagnosed to have Bethlem myopathy based on European Neuromuscular Centre Bethlem Consortium criteria. Affected father and his both sons had slowly progressive proximal dominant weakness and recurrent falls from the first decade. Both children aged 18 and 20 years were ambulant at presentation. All had flexion contractures, keloids, and follicular hyperkeratosis without muscle hypertrophy. Creatinine kinase was mildly elevated and electromyography revealed myopathic features. Muscle imaging revealed severe involvement of glutei and vasti with "central shadow" in rectus femoris. Muscle biopsy in the father showed dystrophic changes with normal immmunostaining for collagen VI, sarcoglycans, and dysferlin.

  6. Bethlem myopathy: An autosomal dominant myopathy with flexion contractures, keloids, and follicular hyperkeratosis

    Directory of Open Access Journals (Sweden)

    Aralikatte Onkarappa Saroja

    2013-01-01

    Full Text Available Bethlem myopathy and Ullrich congenital muscular dystrophy form a spectrum of collagenopathies caused by genetic mutations encoding for any of the three subunits of collagen VI. Bethlem phenotype is relatively benign and is characterized by proximal dominant myopathy, keloids, contractures, distal hyperextensibility, and follicular hyperkeratosis. Three patients from a single family were diagnosed to have Bethlem myopathy based on European Neuromuscular Centre Bethlem Consortium criteria. Affected father and his both sons had slowly progressive proximal dominant weakness and recurrent falls from the first decade. Both children aged 18 and 20 years were ambulant at presentation. All had flexion contractures, keloids, and follicular hyperkeratosis without muscle hypertrophy. Creatinine kinase was mildly elevated and electromyography revealed myopathic features. Muscle imaging revealed severe involvement of glutei and vasti with "central shadow" in rectus femoris. Muscle biopsy in the father showed dystrophic changes with normal immmunostaining for collagen VI, sarcoglycans, and dysferlin.

  7. Morphology of the mitochondria in heat shock protein 60 deficient fibroblasts from mitochondrial myopathy patients : Effects of stress conditions

    NARCIS (Netherlands)

    Huckriede, A; Heikema, A; Sjollema, K; Briones, P; Agsteribbe, E

    1995-01-01

    We have described two mitochondrial (mt) myopathy patients with reduced activities of various mt enzymes associated with significantly decreased amounts of heat shock protein 60 (hsp60). Experimental evidence suggested that the lack of hsp60 was the primary defect. Since hsp60 is essential for the

  8. The expanding phenotype of mitochondrial myopathy.

    Science.gov (United States)

    DiMauro, Salvatore; Gurgel-Giannetti, Juliana

    2005-10-01

    Our understanding of mitochondrial diseases (defined restrictively as defects in the mitochondrial respiratory chain) continues to progress apace. In this review we provide an update of information regarding disorders that predominantly or exclusively affect skeletal muscle. Most recently described mitochondrial myopathies are due to defects in nuclear DNA, including coenzyme Q10 deficiency, and mutations in genes that control mitochondrial DNA (mtDNA) abundance and structure such as POLG and TK2. Barth syndrome, an X-linked recessive mitochondrial myopathy/cardiopathy, is associated with altered lipid composition of the inner mitochondrial membrane, but a putative secondary impairment of the respiratory chain remains to be documented. Concerning the 'other genome', the role played by mutations in protein encoding genes of mtDNA in causing isolated myopathies has been confirmed. It has also been confirmed that mutations in tRNA genes of mtDNA can cause predominantly myopathic syndromes and - contrary to conventional wisdom - these mutations can be homoplasmic. Defects in the mitochondrial respiratory chain impair energy production and almost invariably involve skeletal muscle, causing exercise intolerance, myalgia, cramps, or fixed weakness, which often affects extraocular muscles and results in droopy eyelids (ptosis) and progressive external ophthalmoplegia.

  9. Muscle MRI in neutral lipid storage disease with myopathy carrying mutation c.187+1G>A.

    Science.gov (United States)

    Xu, Chunxiao; Zhao, Yawen; Liu, Jing; Zhang, Wei; Wang, Zhaoxia; Yuan, Yun

    2015-06-01

    We describe the clinical and muscle MRI changes in 2 siblings with neutral lipid storage disease with myopathy (NLSDM) carrying the mutation c.187+1G>A. Peripheral blood smears, genetic tests, and muscle biopsies were performed. Thigh MRI was performed to observe fatty replacement, muscle edema, and muscle bulk from axial sections. Both siblings had similar fatty infiltration and edema. T1-weighted images of the gluteus maximus, adductor magnus, semitendinosus, and semimembranosus revealed marked and diffuse fatty infiltration. There was asymmetric involvement in biceps femoris and quadriceps. There was extensive fatty infiltration in the quadriceps, except for the rectus femoris. Gracilis and sartorius were relatively spared. Thigh muscle volume was decreased, while the gracilis and sartorius appeared to show compensatory hypertrophy. Compared with previous reports in NLSDM, MRI changes in this myopathy tended to be more severe. Asymmetry and relatively selective fatty infiltration were characteristics. © 2014 Wiley Periodicals, Inc.

  10. Hereditary myopathies with early respiratory insufficiency in adults.

    Science.gov (United States)

    Naddaf, Elie; Milone, Margherita

    2017-11-01

    Hereditary myopathies with early respiratory insufficiency as a predominant feature of the clinical phenotype are uncommon and underestimated in adults. We reviewed the clinical and laboratory data of patients with hereditary myopathies who demonstrated early respiratory insufficiency before the need for ambulatory assistance. Only patients with disease-causing mutations or a specific histopathological diagnosis were included. Patients with cardiomyopathy were excluded. We identified 22 patients; half had isolated respiratory symptoms at onset. The diagnosis of the myopathy was often delayed, resulting in delayed ventilatory support. The most common myopathies were adult-onset Pompe disease, myofibrillar myopathy, multi-minicore disease, and myotonic dystrophy type 1. Single cases of laminopathy, MELAS (mitochondrial encephalomyopathy with lactic acidosis and strokelike events), centronuclear myopathy, and cytoplasmic body myopathy were identified. We highlighted the most common hereditary myopathies associated with early respiratory insufficiency as the predominant clinical feature, and underscored the importance of a timely diagnosis for patient care. Muscle Nerve 56: 881-886, 2017. © 2017 Wiley Periodicals, Inc.

  11. Meeting the challenges in the diagnosis of inflammatory myopathies ...

    African Journals Online (AJOL)

    Conditions that mimic IM include other causes of myopathy such as endocrine disorders, adverse effects of medication, metabolic myopathies and muscle dystrophies. Atypical features suggesting an alternative diagnosis are acute onset, severe pain, assymmetrical involvement, distal weakness and wasting. Appropriate ...

  12. Hypothyroid myopathy. A clinical and pathologaical study.

    Science.gov (United States)

    McKeran, R O; Slavin, G; Ward, P; Paul, E; Mair, W G

    1980-09-01

    Ten patients with varying degrees of hypothroid myopathy were studied clinically and by serial percutaneous needle muscle biopsies before and during treatment with L-thyroxine. The biochemical evidence of hypothyroidism was related to the severity of the myopathic and signs before treatment. The severity of myopathic symptoms before and during treatment correlated with the biochemical evidence of hypothyrodism, a type II fibre atrophy and increased central nuclear counts. Likewise, the clinical evidence of a myopathy before and during treatment was correlated with both a type II fibre atrophy and loss and increased central nuclear counts but was not related to the biochemical parameters of hypothyroidism, except the level of thyroid stimulating hormone. In the muscle, before and during treatment, of the two most severely affected patients, intracellular glycogen inclusions were seen in scattered muscle fibres. On light microscopy and on electronmicroscopy, numerous mitochondria were seen responding to L-thyroxine with accumulations of subsarcolemmal honey-combing. Vesicular abnormalities, an electron dense matrix or occasional crystalline deposits were seen in muscle mitochondria from less severely azffected patients. Severely myopathic muscle contained excessive glycogen, membrane bound glycogen and excess lipid in a mainly perinuclear distribution. Occasional myelin and membranous bodies were seen and satellite cells during the recovery phase. A group of patients with hypothyroid myopathy who are likely to have a delayed recovery of full muscle strength on L-thyroxine may be recognised by the presence of severe proximal muscle weakness and characteristic changes on histochemical and electronmicroscopic examination of muscle. The spectrum of histochemical and electronmicroscopic abnormalities of muscle revealed with increasing degree of hypothyrodism, suggests that a generally reversible acquired glycogen storage and mictochondrial disorder is an important feature

  13. [Cardiac myopathy due to overt hypothyroidism].

    Science.gov (United States)

    Harbeck, B; Berndt, M J; Lehnert, H

    2014-03-01

    A 51-year-old man presented with progressive tiredness, proximal muscle weakness, hair loss and weight gain for months. The patient showed mild pretibial myxedema and dry skin. Laboratory findings revealed strongly elevated cardiac enzymes as well as marked hypothyroidism. The electrocardiogram, echocardiography, abdominal sonography and chest X-ray were unremarkable. Thyroid ultrasound demonstrated features of Hashimoto thyroiditis. The findings supported the diagnosis of an overt hypothyroidism with myxedema and rhabdomyolysis. After starting levothyroxine and volume substitution laboratory parameters and clinical condition slowly normalized. Severe overt hypothyroidism may rarely present primarily as myopathy with myositis and cardiac involvement. © Georg Thieme Verlag KG Stuttgart · New York.

  14. Bethlem myopathy is not allelic to limb-girdle muscular dystrophy type 1A

    Energy Technology Data Exchange (ETDEWEB)

    Speer, M.C.; Yamaoka, L.H.; Stajich, J.; Lewis, K. [and others

    1995-08-28

    The Bethlem myopathy, an autosomal-dominant myopathy, shows a distribution of proximal muscle weakness similar to that observed in dominant limb-girdle muscular dystrophy (LGMD). Yet the Bethlem myopathy differs from most limb-girdle dystrophies in two important regards. First, the Bethlem myopathy presents with joint contractures most commonly observed at the elbows, ankles, and neck. Secondly, disease onset in the Bethlem myopathy is in early childhood, while most dominant LGMDs present with adult onset. 6 refs., 1 fig.

  15. BAG3-related myopathy, polyneuropathy and cardiomyopathy with long QT syndrome.

    Science.gov (United States)

    Kostera-Pruszczyk, Anna; Suszek, Małgorzata; Płoski, Rafał; Franaszczyk, Maria; Potulska-Chromik, Anna; Pruszczyk, Piotr; Sadurska, Elżbieta; Karolczak, Justyna; Kamińska, Anna M; Rędowicz, Maria Jolanta

    2015-12-01

    BAG3 belongs to BAG family of molecular chaperone regulators interacting with HSP70 and anti-apoptotic protein Bcl-2. It is ubiquitously expressed with strong expression in skeletal and cardiac muscle, and is involved in a panoply of cellular processes. Mutations in BAG3 and aberrations in its expression cause fulminant myopathies, presenting with progressive limb and axial muscle weakness, and respiratory insufficiency and neuropathy. Herein, we report a sporadic case of a 15-years old girl with symptoms of myopathy, demyelinating polyneuropathy and asymptomatic long QT syndrome. Genetic testing demonstrated heterozygous mutation Pro209Leu (c.626C > T) in exon 3 of BAG3 gene causing severe myopathy and neuropathy, often associated with restrictive cardiomyopathy. We did not find a mutation in any known LQT syndrome genes. Analysis of muscle biopsy revealed profound disintegration of Z-discs with extensive accumulation of granular debris and large inclusions within fibers. We demonstrated profound alterations in BAG3 distribution as the protein localized to long filamentous structures present across the fibers that were positively stained not only for α-actinin but also for desmin and filamin indicating that those disintegrated Z-disc regions contained also other sarcomeric proteins. The mutation caused a decrease in the content of BAG3 and HSP70, and also of α-actinin desmin, filamin and fast myosin heavy chain, confirming its severe effect on the muscle fiber morphology and thus function. We provide further evidence that BAG3 is associated with Z-disc maintenance, and the Pro209Leu mutation may occur worldwide. We also provide a summary of cases associated with this mutation reported so far.

  16. [Biologic therapy in idiopathic inflammatory myopathy].

    Science.gov (United States)

    Selva-O'Callaghan, Albert; Ramos Casals, Manel; Grau Junyent, Josep M

    2014-09-15

    The aim of this article is to study the evidence-based knowledge related to the use of biological therapies in patients diagnosed with idiopathic inflammatory myopathy (dermatomyositis, polymyositis and inclusion body myositis). In this review the leading published studies related to the use of biological therapy in patients with myositis are analysed; mainly those with high methodological standards, that means randomized and controlled studies. Methodological drawbacks due to the rarity and heterogeneity of these complex diseases are also addressed. Up to now is not possible to ascertain the biologics as a recommended therapy in patients with myositis, at least based in the current evidence-based knowledge, although it can not be neglected as a therapeutic option in some clinical situations, taking into account the scarce of effective treatments in those patients, especially in refractory myositis. Future studies probably will help to better define the role of biological therapies in patients with idiopathic inflammatory myopathy. Copyright © 2013 Elsevier España, S.L.U. All rights reserved.

  17. Flaccid quadriplegia due to thyrotoxic myopathy.

    Science.gov (United States)

    Couillard, Philippe; Wijdicks, Eelco F M

    2014-04-01

    Acute flaccid paralysis is an important clinical problem in neurological critical care. After implementing life-supporting measures, it is imperative to identify the correct diagnosis to provide timely appropriate care. Thyrotoxicosis is a recognized cause of myopathy, but rarely of quadriplegia. Here, we report a case of hyperthyroidism with severe weakness. Case report and video demonstration of clinical examination. We describe a case of a 59-year-old woman with Grave's disease who presented to the hospital with progressive shortness of breath secondary to atrial fibrillation with rapid ventricular response. Following contrast administration, she had a pulseless electrical activity arrest from which she recovered without cognitive sequelae, but with flaccid quadriplegia, facial diplegia, and hypophonia. CK was mildly elevated and electrolytes were essentially normal. Nerve conduction studies and electromyography demonstrated features supporting an acute myopathy without evidence of neuromuscular junction conduction abnormality. Normalization of thyroid hormones resulted in slow, but steady improvement over months after which she regained ambulation. Acute flaccid quadriplegia can result from thyrotoxicosis. With normalization of thyroid function, recovery can be expected.

  18. Atypical presentation of GNE myopathy with asymmetric hand weakness

    Science.gov (United States)

    de Dios, John Karl L.; Shrader, Joseph A.; Joe, Galen O.; McClean, Jeffrey C.; Williams, Kayla; Evers, Robert; Malicdan, May Christine V.; Ciccone, Carla; Mankodi, Ami; Huizing, Marjan; McKew, John C.; Bluemke, David A.; Gahl, William A.; Carrillo-Carrasco, Nuria

    2014-01-01

    GNE myopathy is a rare autosomal recessive muscle disease caused by mutations in GNE, the gene encoding the rate-limiting enzyme in sialic acid biosynthesis. GNE myopathy usually manifests in early adulthood with distal myopathy that progresses slowly and symmetrically, first involving distal muscles of the lower extremities, followed by proximal muscles with relative sparing of the quadriceps. Upper extremities are typically affected later in the disease. We report a patient with GNE myopathy who presented with asymmetric hand weakness. He had considerably decreased left grip strength, atrophy of the left anterior forearm and fibro-fatty tissue replacement of left forearm flexor muscles on T1-weighted magnetic resonance imaging. The patient was an endoscopist and thus the asymmetric hand involvement may be associated with left hand overuse in daily repetitive pinching and gripping movements, highlighting the possible impact of environmental factors on the progression of genetic muscle conditions. PMID:25182749

  19. Genetics Home Reference: early-onset myopathy with fatal cardiomyopathy

    Science.gov (United States)

    ... in childhood, people with EOMFC may also develop joint deformities called contractures that restrict the movement of ... Home Edition for Patients and Caregivers: Dilated Cardiomyopathy Neuromuscular Disease Center, Washington University Orphanet: Early-onset myopathy ...

  20. Statin Induced Myopathy a Patient with Multiple Systemic Diseases

    Directory of Open Access Journals (Sweden)

    Özgül Uçar

    2011-04-01

    Full Text Available Hydroxymethylglutaryl-coenzyme A reductase inhibitors (statins are the most successful class of drugs for the treatment of hypercholesterolaemia and dyslipidaemia. However, the popular profile of statins in terms of efficacy has been maligned by theiradverse effects. Statin induced myopathy, which can be seen at any time during the course of therapy, is a clinically important cause of statin intolerance and discontinuation. When a patient with multiple systemic diseases who use numerous medications represent with myalgia and muscle cramps, statin induced myopathy may not be remembered at first. We present a patient with multiple systemic diseases, alcohol and morphine abuse in whom myopathy developed. After exclusion of other etiologies, we concluded that myopathy was related to statin therapy.

  1. Congenital myopathy is caused by mutation of HACD1

    OpenAIRE

    Muhammad, Emad; Reish, Orit; Ohno, Yusuke; Scheetz, Todd; DeLuca, Adam; Searby, Charles; Regev, Miriam; Benyamini, Lilach; Fellig, Yakov; Kihara, Akio; Sheffield, Val C.; Parvari, Ruti

    2013-01-01

    Congenital myopathies are heterogeneous inherited diseases of muscle characterized by a range of distinctive histologic abnormalities. We have studied a consanguineous family with congenital myopathy. Genome-wide linkage analysis and whole-exome sequencing identified a homozygous non-sense mutation in 3-hydroxyacyl-CoA dehydratase 1 (HACD1) in affected individuals. The mutation results in non-sense mediated decay of the HACD1 mRNA to 31% of control levels in patient muscle and completely abro...

  2. Skeletal muscle repair in a mouse model of nemaline myopathy

    OpenAIRE

    Sanoudou, Despina; Corbett, Mark A.; Han, Mei; Ghoddusi, Majid; Nguyen, Mai-Anh T.; Vlahovich, Nicole; Hardeman, Edna C.; Beggs, Alan H.

    2006-01-01

    Nemaline myopathy (NM), the most common non-dystrophic congenital myopathy, is a variably severe neuromuscular disorder for which no effective treatment is available. Although a number of genes have been identified in which mutations can cause NM, the pathogenetic mechanisms leading to the phenotypes are poorly understood. To address this question, we examined gene expression patterns in an NM mouse model carrying the human Met9Arg mutation of alpha-tropomyosin slow (Tpm3). We assessed five d...

  3. Aerobic Training in Patients with Congenital Myopathy.

    Directory of Open Access Journals (Sweden)

    Gitte Hedermann

    Full Text Available Congenital myopathies (CM often affect contractile proteins of the sarcomere, which could render patients susceptible to exercise-induced muscle damage. We investigated if exercise is safe and beneficial in patients with CM.Patients exercised on a stationary bike for 30 minutes, three times weekly, for 10 weeks at 70% of their maximal oxygen uptake (VO2max. Creatine kinase (CK was monitored as a marker of muscle damage. VO2max, functional tests, and questionnaires evaluated efficacy.Sixteen patients with CM were included in a controlled study. VO2max increased by 14% (range, 6-25%; 95% CI 7-20; p < 0.001 in the seven patients who completed training, and tended to decrease in a non-intervention group (n = 7; change -3.5%; range, -11-3%, p = 0.083. CK levels were normal and remained stable during training. Baseline Fatigue Severity Scale scores were high, 4.9 (SE 1.9, and tended to decrease (to 4.4 (SE 1.7; p = 0.08 with training. Nine patients dropped out of the training program. Fatigue was the major single reason.Ten weeks of endurance training is safe and improves fitness in patients with congenital myopathies. The training did not cause sarcomeric injury, even though sarcomeric function is affected by the genetic abnormalities in most patients with CM. Severe fatigue, which characterizes patients with CM, is a limiting factor for initiating training in CM, but tends to improve in those who train.The Regional Committee on Health Research Ethics of the Capital Region of Denmark H-2-2013-066 and ClinicalTrials.gov H2-2013-066.

  4. Association between statin-associated myopathy and skeletal muscle damage.

    Science.gov (United States)

    Mohaupt, Markus G; Karas, Richard H; Babiychuk, Eduard B; Sanchez-Freire, Verónica; Monastyrskaya, Katia; Iyer, Lakshmanan; Hoppeler, Hans; Breil, Fabio; Draeger, Annette

    2009-07-07

    Many patients taking statins often complain of muscle pain and weakness. The extent to which muscle pain reflects muscle injury is unknown. We obtained biopsy samples from the vastus lateralis muscle of 83 patients. Of the 44 patients with clinically diagnosed statin-associated myopathy, 29 were currently taking a statin, and 15 had discontinued statin therapy before the biopsy (minimal duration of discontinuation 3 weeks). We also included 19 patients who were taking statins and had no myopathy, and 20 patients who had never taken statins and had no myopathy. We classified the muscles as injured if 2% or more of the muscle fibres in a biopsy sample showed damage. Using reverse transcriptase polymerase chain reaction, we evaluated the expression levels of candidate genes potentially related to myocyte injury. Muscle injury was observed in 25 (of 44) patients with myopathy and in 1 patient without myopathy. Only 1 patient with structural injury had a circulating level of creatine phosphokinase that was elevated more than 1950 U/L (10x the upper limit of normal). Expression of ryanodine receptor 3 was significantly upregulated in patients with biopsy evidence of structural damage (1.7, standard error of the mean 0.3). Persistent myopathy in patients taking statins reflects structural muscle damage. A lack of elevated levels of circulating creatine phosphokinase does not rule out structural muscle injury. Upregulation of the expression of ryanodine receptor 3 is suggestive of an intracellular calcium leak.

  5. Genetics Home Reference: hereditary fibrosing poikiloderma with tendon contractures, myopathy, and pulmonary fibrosis

    Science.gov (United States)

    ... Hereditary fibrosing poikiloderma with tendon contractures, myopathy, and pulmonary fibrosis Printable PDF Open All Close All Enable Javascript ... Fibrosing Poikiloderma with Tendon Contractures, Myopathy, and Pulmonary ... Lung, and Blood Institute (NHLBI): Pulmonary Function Tests National ...

  6. Acute liver failure after recommended doses of acetaminophen in patients with myopathies

    NARCIS (Netherlands)

    I. Ceelie (Ilse); L.P. James (Laura); V.M.G.J. Gijsen (Violette); R.A.A. Mathôt (Ron); S. Ito (Shinya); C.D. Tesselaar (Coranne); D. Tibboel (Dick); G. Koren (Gideon); S.N. de Wildt (Saskia)

    2011-01-01

    textabstractObjective: To determine the likelihood that recommended doses of acetaminophen are associated with acute liver failure in patients with myopathies. Design: Retrospective analysis. Setting: Level III pediatric intensive care unit. Patients: Two pediatric patients with myopathies and acute

  7. Acute liver failure after recommended doses of acetaminophen in patients with myopathies

    NARCIS (Netherlands)

    Ceelie, Ilse; James, Laura P.; Gijsen, Violette; Mathot, Ron A. A.; Ito, Shinya; Tesselaar, Coranne D.; Tibboel, Dick; Koren, Gideon; de Wildt, Saskia N.

    2011-01-01

    To determine the likelihood that recommended doses of acetaminophen are associated with acute liver failure in patients with myopathies. Retrospective analysis. Level III pediatric intensive care unit. Two pediatric patients with myopathies and acute liver failure. CLINICAL INVESTIGATIONS: We

  8. Genetics Home Reference: myopathy with deficiency of iron-sulfur cluster assembly enzyme

    Science.gov (United States)

    ... Myopathy with deficiency of iron-sulfur cluster assembly enzyme Printable PDF Open All Close All Enable Javascript ... Myopathy with deficiency of iron-sulfur cluster assembly enzyme is an inherited disorder that primarily affects muscles ...

  9. Genetics Home Reference: inclusion body myopathy with early-onset Paget disease and frontotemporal dementia

    Science.gov (United States)

    ... Share: Email Facebook Twitter Home Health Conditions IBMPFD Inclusion body myopathy with early-onset Paget disease and ... Javascript to view the expand/collapse boxes. Description Inclusion body myopathy with early-onset Paget disease and ...

  10. Compound heterozygous mutations of the TNXB gene cause primary myopathy

    NARCIS (Netherlands)

    Penisson-Besnier, I.; Allamand, V.; Beurrier, P.; Martin, L.; Schalkwijk, J.; Vlijmen-Willems, I. van; Gartioux, C.; Malfait, F.; Syx, D.; Macchi, L.; Marcorelles, P.; Arbeille, B.; Croue, A.; Paepe, A. de; Dubas, F.

    2013-01-01

    Complete deficiency of the extracellular matrix glycoprotein tenascin-X (TNX) leads to recessive forms of Ehlers-Danlos syndrome, clinically characterized by hyperextensible skin, easy bruising and joint hypermobility. Clinical and pathological studies, immunoassay, and molecular analyses were

  11. [Dropped head syndrome as first manifestation of primary hyperparathyroid myopathy].

    Science.gov (United States)

    Ota, Kiyobumi; Koseki, Sayo; Ikegami, Kenji; Onishi, Iichiroh; Tomimitsu, Hiyoryuki; Shintani, Shuzo

    2018-03-28

    75 years old woman presented with 6-month history of progressive dropped head syndrome. Neurological examination revealed moderate weakness of flexor and extensor of neck and mild weakness of proximal appendicular muscles with normal deep tendon reflexes. The needle electromyography showed short duration and low amplitude motor unit potential. No fibrillation potentials or positive sharp waves were seen. Biopsy of deltoid muscle was normal. Laboratory studies showed elevated levels of serum calcium (11.8 mg/dl, upper limit of normal 10.1) and intact parathyroid hormone (104 pg/ml, upper limit of normal 65), and decreased level of serum phosphorus (2.3 mg/dl, lower limit of normal 2.7). Ultrasonography and enhanced computed tomography revealed a parathyroid tumor. The tumor was removed surgically. Pathological examination proved tumor to be parathyroid adenoma. Dropped head and weakness of muscles were dramatically improved within a week after the operation. Although hyperparathyroidism is a rare cause of dropped head syndrome, neurologists must recognize hyperparathyroidism as a treatable cause of dropped head syndrome.

  12. BAG3 myofibrillar myopathy presenting with cardiomyopathy.

    Science.gov (United States)

    Konersman, Chamindra G; Bordini, Brett J; Scharer, Gunter; Lawlor, Michael W; Zangwill, Steven; Southern, James F; Amos, Louella; Geddes, Gabrielle C; Kliegman, Robert; Collins, Michael P

    2015-05-01

    Myofibrillar myopathies (MFMs) are a heterogeneous group of neuromuscular disorders distinguished by the pathological hallmark of myofibrillar dissolution. Most patients present in adulthood, but mutations in several genes including BCL2-associated athanogene 3 (BAG3) cause predominantly childhood-onset disease. BAG3-related MFM is particularly severe, featuring weakness, cardiomyopathy, neuropathy, and early lethality. While prior cases reported either neuromuscular weakness or concurrent weakness and cardiomyopathy at onset, we describe the first case in which cardiomyopathy and cardiac transplantation (age eight) preceded neuromuscular weakness by several years (age 12). The phenotype comprised distal weakness and severe sensorimotor neuropathy. Nerve biopsy was primarily axonal with secondary demyelinating/remyelinating changes without "giant axons." Muscle biopsy showed extensive neuropathic changes that made myopathic changes difficult to interpret. Similar to previous cases, a p.Pro209Leu mutation in exon 3 of BAG3 was found. This case underlines the importance of evaluating for MFMs in patients with combined neuromuscular weakness and cardiomyopathy. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Myofibrillar myopathies: State of the art, present and future challenges.

    Science.gov (United States)

    Béhin, A; Salort-Campana, E; Wahbi, K; Richard, P; Carlier, R-Y; Carlier, P; Laforêt, P; Stojkovic, T; Maisonobe, T; Verschueren, A; Franques, J; Attarian, S; Maues de Paula, A; Figarella-Branger, D; Bécane, H-M; Nelson, I; Duboc, D; Bonne, G; Vicart, P; Udd, B; Romero, N; Pouget, J; Eymard, B

    2015-10-01

    Myofibrillar myopathies (MFM) have been described in the mid-1990s as a group of diseases sharing common histological features, including an abnormal accumulation of intrasarcoplasmic proteins, the presence of vacuoles and a disorganization of the intermyofibrillar network beginning at the Z-disk. The boundaries of this concept are still uncertain, and whereas six genes (DES, CRYAB, LDB3/ZASP, MYOT, FLNC and BAG3) are now classically considered as responsible for MFM, other entities such as FHL1 myopathy or Hereditary Myopathy with Early Respiratory Failure linked to mutations of titin can now as well be included in this group. The diagnosis of MFM is not always easy; as histological lesions can be focal, and muscle biopsy may be disappointing; this has led to a growing importance of muscle imaging, and the selectivity of muscle involvement has now been described in several disorders. Due to the rarity of these myopathies, if some clinical patterns (such as distal myopathy associated with cardiomyopathy due to desmin mutations) are now well known, surprises remain possible and should lead to systematic testing of the known genes in case of a typical histological presentation. In this paper, we aim at reviewing the data acquired on the six main genes listed above as well as presenting the experience from two French reference centres, Paris and Marseilles. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  14. Mitochondrial myopathy presenting as fibromyalgia: a case report

    Directory of Open Access Journals (Sweden)

    Abdullah Mishal

    2012-02-01

    Full Text Available Abstract Introduction To the best of our knowledge, we describe for the first time the case of a woman who met the diagnostic criteria for fibromyalgia, did not respond to therapy for that disorder, and was subsequently diagnosed by biochemical and genetic studies with a mitochondrial myopathy. Treatment of the mitochondrial myopathy resulted in resolution of symptoms. This case demonstrates that mitochondrial myopathy may present in an adult with a symptom complex consistent with fibromyalgia. Case presentation Our patient was a 41-year-old Caucasian woman with symptoms of fatigue, exercise intolerance, headache, and multiple trigger points. Treatment for fibromyalgia with a wide spectrum of medications including non-steroidal anti-inflammatory drugs, antidepressants, gabapentin and pregabalin had no impact on her symptoms. A six-minute walk study demonstrated an elevated lactic acid level (5 mmol/L; normal Conclusions This case demonstrates that adults diagnosed with fibromyalgia may have their symptom complex related to an adult onset mitochondrial myopathy. This is an important finding since treatment of mitochondrial myopathy resulted in resolution of symptoms.

  15. Autosomal dominant distal myopathy: Linkage to chromosome 14

    Energy Technology Data Exchange (ETDEWEB)

    Laing, N.G.; Laing, B.A.; Wilton, S.D.; Dorosz, S.; Mastaglia, F.L.; Kakulas, B.A. [Australian Neuromuscular Research Institute, Perth (Australia); Robbins, P.; Meredith, C.; Honeyman, K.; Kozman, H.

    1995-02-01

    We have studied a family segregating a form of autosomal dominant distal myopathy (MIM 160500) and containing nine living affected individuals. The myopathy in this family is closest in clinical phenotype to that first described by Gowers in 1902. A search for linkage was conducted using microsatellite, VNTR, and RFLP markers. In total, 92 markers on all 22 autosomes were run. Positive linkage was obtained with 14 of 15 markers tested on chromosome 14, with little indication of linkage elsewhere in the genome. Maximum two-point LOD scores of 2.60 at recombination fraction .00 were obtained for the markers MYH7 and D14S64 - the family structure precludes a two-point LOD score {ge} 3. Recombinations with D14S72 and D14S49 indicate that this distal myopathy locus, MPD1, should lie between these markers. A multipoint analysis assuming 100% penetrance and using the markers D14S72, D14S50, MYH7, D14S64, D14S54, and D14S49 gave a LOD score of exactly 3 at MYH7. Analysis at a penetrance of 80% gave a LOD score of 2.8 at this marker. This probable localization of a gene for distal myopathy, MPD1, on chromosome 14 should allow other investigators studying distal myopathy families to test this region for linkage in other types of the disease, to confirm linkage or to demonstrate the likely genetic heterogeneity. 24 refs., 3 figs., 1 tab.

  16. Prevalence and phenotypes of congenital myopathy due to α-actin 1 gene mutations

    DEFF Research Database (Denmark)

    Witting, Nanna; Werlauff, Ulla; Duno, Morten

    2016-01-01

    airway pressure. Limb flexor/extensor muscles and upper and lower extremities were affected equally. Pronounced neck flexor weakness was noted. CONCLUSIONS: Congenital myopathy caused by ACTA1 mutations is fatal in infancy in most cases. This study shows that the prevalence of α-actin myopathy in older...... patients with congenital myopathy is not negligible and that phenotypes can be quite mild....

  17. Is Vitamin D Deficiency a Confounder in Alcoholic Skeletal Muscle Myopathy?

    NARCIS (Netherlands)

    Wijnia, J.W.; Wielders, J.P.M.; Lips, P.T.A.M.; van der Wiel, A.; Mulder, C.L.; Nieuwenhuis, K.G.A.

    2013-01-01

    Background: Excessive intake of alcohol is often associated with low or subnormal levels of vitamin D even in the absence of active liver disease. As vitamin D deficiency is a well-recognized cause of myopathy, alcoholic myopathy might be related to vitamin D deficiency. Chronic alcoholic myopathy

  18. Idiopathic Inflammatory Myopathies; Association with Overlap Myositis and Syndromes: Classification, Clinical Characteristics, and Associated Autoantibodies

    Directory of Open Access Journals (Sweden)

    Pari Basharat

    2016-07-01

    Full Text Available Idiopathic inflammatory myopathies (IIM are traditionally identified as a group of disorders that target skeletal muscle due to autoimmune dysfunction. The IIM can be divided into subtypes based on certain clinical characteristics, and several classification schemes have been proposed. The predominant diagnostic criteria for IIM is the Bohan and Peter criteria, which subdivides IIM into primary polymyositis (PM, primary dermatomyositis (DM, myositis with another connective tissue disease, and myositis associated with cancer. However, this measure has been criticised for several reasons including lack of specific criteria to help distinguish between muscle biopsy findings of PM, DM, and immune-mediated necrotising myopathy, as well as the lack of identification of cases of overlap myositis (OM. Because of this issue, other classification criteria for IIM have been proposed, which include utilising myositis-associated antibodies and myositis-specific antibodies, as well as overlap features such as Raynaud’s phenomenon, polyarthritis, oesophageal abnormalities, interstitial lung disease, small bowel abnormalities such as hypomotility and malabsorption, and renal crises, amongst others. Indeed, the identification of autoantibodies associated with certain clinical phenotypes of myositis, in particular connective tissue disease-myositis overlap, has further helped divide IIM into distinct clinical subsets, which include OM and overlap syndromes (OS. This paper reviews the concepts of OM and OS as they pertain to IIM, including definitions in the literature, clinical characteristics, and overlap autoantibodies.

  19. A Rare Manifestation of Hypothyroid Myopathy: Hoffmann's Syndrome

    Directory of Open Access Journals (Sweden)

    Kang Won Lee

    2015-12-01

    Full Text Available Hypothyroid myopathy is observed frequently and the resolution of the clinical manifestations of myopathy following thyroid hormone replacement is well known. However, a specific subtype of hypothyroid myopathy, Hoffmann's syndrome, characterized by increased muscular mass (pseudohypertrophy, proximal muscle weakness, muscle stiffness and cramps, is rarely reported. Herein, we describe a 34-year-old male who presented with proximal muscle weakness and non-pitting edema of the lower extremities. He initially visited the neurology department where he was suspected of having polymyositis. Additional laboratory evaluation revealed profound autoimmune hypothyroidism and elevated muscle enzymes including creatine kinase. The patient was started on levothyroxine treatment and, subsequently, clinical symptoms and biochemical parameters resolved with the treatment. The present case highlights that hypothyroidism should be considered in the differential diagnosis of musculoskeletal symptoms even in the absence of overt manifestations of hypothyroidism. To our knowledge, this is the first case reported in Korea.

  20. A Case Report of Inflammatory Myopathy and Sideroblastic Anemia

    Directory of Open Access Journals (Sweden)

    F Binesh

    2007-01-01

    Full Text Available Mitochondrial myopathy, lactic acidosis, and siderobastic anemia (MLA SA syndrome is one of the newly reported mitochondrial diseases, seven cases of which have been reported. We report a child with inflammatory myopathy, sideroblastic anemia and lactic acidosis .The patient is a 8.5 year old boy with normal cognitive function suffering from chronic progressive weakness in lower extremities, inability to walk since four months and pallor. In paraclinical evaluation, sideroblastic anemia, mild lactic acidosis and elevated muscle enzymes were seen. Inflammatory myopathy (myositis in muscle biopsy was detected as well .The patient was administered oral prednisolone, folic acid, B6 and underwent regular physiotherapy. He ambulated after four months and resumed education and schooling.

  1. Refractory Hyperlactatemia with Organ Insufficiency in Lipid Storage Myopathy.

    Science.gov (United States)

    Xu, Yuanda; Zhou, Li; Liang, Weibo; He, Weiqun; Liu, Xiaoqing; Liang, Xiuling; Zhong, Nanshan; Li, Yimin

    2015-08-01

    Lipid storage myopathy is a metabolic disorder characterized by abnormal lipid accumulation in muscle fibers and progressive muscle weakness. Here, we report the case of a 17-year-old woman with progressive muscle weakness, refractory hyperlactatemia, and multiple organ insufficiency. Severe pneumonia was the initial diagnosis. After anti-infective treatment, fluid resuscitation, and mechanical ventilation, the patient's symptoms improved but hyperlactatemia and muscle weakness persisted. She was empirically treated with carnitine. Biochemical tests, electromyography, and muscle biopsy confirmed lipid storage myopathy. After 7 weeks of treatment, the patient resumed normal daily life. An empirical treatment with carnitine may be beneficial for patients before an accurate diagnosis of lipid storage myopathy is made.

  2. BWR AXIAL PROFILE

    International Nuclear Information System (INIS)

    Huffer, J.

    2004-01-01

    The purpose of this calculation is to develop axial profiles for estimating the axial variation in burnup of a boiling water reactor (BWR) assembly spent nuclear fuel (SNF) given the average burnup of an assembly. A discharged fuel assembly typically exhibits higher burnup in the center and lower burnup at the ends of the assembly. Criticality safety analyses taking credit for SNF burnup must account for axially varying burnup relative to calculations based on uniformly distributed assembly average burnup due to the under-burned tips. Thus, accounting for axially varying burnup in criticality analyses is also referred to as accounting for the ''end effect'' reactivity. The magnitude of the reactivity change due to ''end effect'' is dependent on the initial assembly enrichment, the assembly average burnup, and the particular axial profile characterizing the burnup distribution. The set of bounding axial profiles should incorporate multiple BWR core designs and provide statistical confidence (95 percent confidence that 95 percent of the population is bound by the profile) that end nodes are conservatively represented. The profiles should also conserve the overall burnup of the fuel assembly. More background on BWR axial profiles is provided in Attachment I

  3. Computerised Axial Tomography (CAT)

    Science.gov (United States)

    1990-06-01

    Ministry of’ Defence, Defence Research Information Centre, UK. Computerised Axial Tomography ( CAT ) Report Secufty C"uMiauion tide Onadtiicadon (U. R, Cor S...DRIC T 8485 COMPUTERISED AXIAL TOMOGRAPHY ( CAT ) F.P. GENTILE, F. SABETTA, V. TRO1* ISS R 78/4.Rome, 1.5 Mlarch 1978 (from Italian) B Distribution(f...dello Radiazioni ISSN 0390--6477 F.P. GENTILE, F. SABETTA. V. TROI Computerised Axial Tomography ( CAT ) March 15, 1978). This paper is a review of

  4. Hoffmann's disease: MR imaging of hypothyroid myopathy

    International Nuclear Information System (INIS)

    Chung, Jeewon; Ahn, Kyung-Sik; Kang, Chang Ho; Hong, Suk-Joo; Kim, Beak Hyun

    2015-01-01

    Hoffmann's syndrome is a hypothyroid myopathy presenting as muscle stiffness and hypertrophy. It is a rare complication of hypothyroidism. MRI features of this syndrome have seldom been described in the literature. We present a case of Hoffmann's syndrome in a 34-year-old man who underwent lower extremity contrast-enhanced MRI. MRI can demonstrate the hypertrophic configuration, T2 hyperintensity, and enhancement of the involved muscles in Hoffmann's syndrome. Along with clinical, laboratory, and electromyography findings, MRI may be helpful in distinguishing between inflammatory myopathy, myonecrosis, subacute muscle denervation, and infectious myositis. (orig.)

  5. Hoffmann's disease: MR imaging of hypothyroid myopathy

    Energy Technology Data Exchange (ETDEWEB)

    Chung, Jeewon; Ahn, Kyung-Sik; Kang, Chang Ho [Korea University Anam Hospital, Korea University College of Medicine, Department of Radiology, Seoul (Korea, Republic of); Hong, Suk-Joo [Korea University Guro Hospital, Korea University College of Medicine, Department of Radiology, Seoul (Korea, Republic of); Kim, Beak Hyun [Korea University Ansan Hospital, Korea University College of Medicine, Department of Radiology, Gyeonggi-do (Korea, Republic of)

    2015-11-15

    Hoffmann's syndrome is a hypothyroid myopathy presenting as muscle stiffness and hypertrophy. It is a rare complication of hypothyroidism. MRI features of this syndrome have seldom been described in the literature. We present a case of Hoffmann's syndrome in a 34-year-old man who underwent lower extremity contrast-enhanced MRI. MRI can demonstrate the hypertrophic configuration, T2 hyperintensity, and enhancement of the involved muscles in Hoffmann's syndrome. Along with clinical, laboratory, and electromyography findings, MRI may be helpful in distinguishing between inflammatory myopathy, myonecrosis, subacute muscle denervation, and infectious myositis. (orig.)

  6. Glucocorticoid-induced myopathy in the intensive care unit

    DEFF Research Database (Denmark)

    Eddelien, Heidi Shil; Hoffmeyer, Henrik Westy; Lund, Eva Charlotte Løbner

    2015-01-01

    Glucocorticoids (GC) are used for intensive care unit (ICU) patients on several indications. We present a patient who was admitted to the ICU due to severe respiratory failure caused by bronchospasm requiring mechanical ventilation and treated with methylprednisolone 240 mg/day in addition...... to antibiotics and bronchiolytics. When the sedation was lifted on day 10, the patient was awake but quadriplegic. Blood samples revealed elevated muscle enzymes, electromyography showed myopathy, and a muscle biopsy was performed. Glucocorticoid-induced myopathy was suspected, GC treatment was tapered...

  7. Mitochondrial Myopathy: A Rare Cause of Early-Onset Vocal Fold Atrophy

    Science.gov (United States)

    Kelly, Elizabeth A.; Bock, Jonathan M.; Peltier, Amanda C.; Oh, Shin J.; Garrett, C. Gaelyn

    2014-01-01

    Objectives We present the second published case of laryngeal involvement in mitochondrial myopathy. Methods A patient with laryngeal involvement of mitochondrial myopathy is presented, together with a literature review. Results A 41-year-old man presented with progressive breathy dysphonia. His brother had mitochondrial myopathy. Biopsy of the biceps muscle demonstrated cytochrome C oxidase–negative ragged blue fibers confirming mitochondrial myopathy. Videostroboscopy showed marked vocal fold atrophy, but subsequent injection laryngoplasty did not significantly improve the patient’s voice, despite improved postoperative glottic closure. Conclusions Mitochondrial myopathy should be considered in the differential diagnosis of severe early-onset vocal fold atrophy. PMID:23577570

  8. Signatures for axial chromodynamics

    International Nuclear Information System (INIS)

    Pati, J.C.

    1978-07-01

    Within the context of basic left-right symmetry and the hypothesis of unification of weak, electromagnetic and strong forces at a mass level approximately equal to 10 4 -10 6 GeV, relatively light ''mass'' axial gluons, confined or liberated, must be postulated. The authors remark that the existence of such ''light'' axial gluons supplementing the familiar vector octet preserves the successes of QCD, both for deep inelastic processes and charmonium physics. Through the characteristic spin-spin force, generated by their exchange, they may even help resolve some of the discrepancies between vector QCD predictions and charmonium physics. The main remark of this note is that if colour is liberated, not only vector but also axial-vector gluons are produced in high-energy e - e + experiments, e.g. at PETRA and PEP, with fairly large cross-section. Distinctive decay modes of such liberated axial gluons are noted

  9. DNAJB6 myopathies: Focused review on an emerging and expanding group of myopathies

    Directory of Open Access Journals (Sweden)

    Alessandra Ruggieri

    2016-09-01

    Full Text Available Mutations in the DNAJB6 gene have been associated with the autosomal dominant limb girdle muscular dystrophy type 1D (LGMD1D, a disorder characterized by abnormal protein aggregates and rimmed vacuoles in muscle fibers. DNAJB6 is a ubiquitously expressed Hsp40 co-chaperone characterized by a J domain that specifies Hsp70 functions in the cellular environment. DNAJB6 is also a potent inhibitor of expanded polyglutamine (polyQ aggregation preventing aggregate toxicity in cells. In DNAJB6-mutated patients this anti-aggregation property is significantly reduced, albeit not completely lost. To elucidate the pathogenetic mechanisms underlying the DNAJB6-related myopathy, animal models have been created showing that, indeed, conditional muscular expression of a DNAJB6 mutant in the mouse causes a LGMD1D myofibrillary muscle tissue phenotype. Both mutations and phenotypes reported until recently were rather homogeneous, being exclusively missense mutations of a few amino acids of the protein G/F domain, and with a phenotype characterized by adult-onset slowly progressive muscular dystrophy predominantly affecting proximal muscles. Lately, several novel mutations and new phenotypes of DNAJB6 have been described. These mutations once more affect the G/F domain of DNAJB6 with missense changes and a splice site mutation; and the phenotypes include childhood onset and distal involvement of muscles, or childhood-onset LGMD1D with loss of ambulation in early adulthood and respiratory involvement. Thus, the spectrum of DNAJB6-related phenotypes is widening. Although our knowledge about the role of DNAJB6 in the pathogenesis of muscle diseases has made great progression, several questions remain unsolved, including why a ubiquitous protein affects only, or predominantly, skeletal muscle; why only the G/F domain is involved; and what is the possible role of the DNAJB6a isoform. Clarification of these issues will provide clues to implement possible therapeutic

  10. Genetics Home Reference: CAV3-related distal myopathy

    Science.gov (United States)

    ... gene causes a peculiar form of distal myopathy. Neurology. 2002 Jan 22;58(2):323-5. Erratum in: Neurology 2002 Mar 12;58(5):839. Itoyoma Y [ ... 3 cause four distinct autosomal dominant muscle diseases. Neurology. 2004 Feb 24;62(4):538-43. Review. ...

  11. Congenital myopathy is caused by mutation of HACD1.

    Science.gov (United States)

    Muhammad, Emad; Reish, Orit; Ohno, Yusuke; Scheetz, Todd; Deluca, Adam; Searby, Charles; Regev, Miriam; Benyamini, Lilach; Fellig, Yakov; Kihara, Akio; Sheffield, Val C; Parvari, Ruti

    2013-12-20

    Congenital myopathies are heterogeneous inherited diseases of muscle characterized by a range of distinctive histologic abnormalities. We have studied a consanguineous family with congenital myopathy. Genome-wide linkage analysis and whole-exome sequencing identified a homozygous non-sense mutation in 3-hydroxyacyl-CoA dehydratase 1 (HACD1) in affected individuals. The mutation results in non-sense mediated decay of the HACD1 mRNA to 31% of control levels in patient muscle and completely abrogates the enzymatic activity of dehydration of 3-hydroxyacyl-CoA, the third step in the elongation of very long-chain fatty acids (VLCFAs). We describe clinical findings correlated with a deleterious mutation in a gene not previously known to be associated with congenital myopathy in humans. We suggest that the mutation in the HACD1 gene causes a reduction in the synthesis of VLCFAs, which are components of membrane lipids and participants in physiological processes, leading to congenital myopathy. These data indicate that HACD1 is necessary for muscle function.

  12. Eosinophilic fasciitis in a child mimicking a myopathy.

    NARCIS (Netherlands)

    Pillen, S.; Engelen, B.G.M. van; Hoogen, F.H.J. van den; Fiselier, T.J.W.; Vossen, P. van der; Drost, G.

    2006-01-01

    A 14-year-old boy was suspected of having a myopathy with joint contractures. He presented with progressive painless joint contractures of his right wrist and fingers, and reduced muscle strength of his right arm, without obvious skin changes. Laboratory investigation showed a normal CK,

  13. Clinical, serologic, and immunogenetic features of familial idiopathic inflammatory myopathy

    NARCIS (Netherlands)

    Rider, L. G.; Gurley, R. C.; Pandey, J. P.; Garcia de la Torre, I.; Kalovidouris, A. E.; O'Hanlon, T. P.; Love, L. A.; Hennekam, R. C.; Baumbach, L. L.; Neville, H. E.; Garcia, C. A.; Klingman, J.; Gibbs, M.; Weisman, M. H.; Targoff, I. N.; Miller, F. W.

    1998-01-01

    OBJECTIVE: To describe the clinical, serologic, and immunogenetic features of familial idiopathic inflammatory myopathy (IIM) and to compare these with the features of sporadic IIM. METHODS: Clinical signs and symptoms, autoantibodies, HLA-DRB1 and DQA1 alleles, and GM/KM phenotypes were compared

  14. REV-ERB and ROR: therapeutic targets for treating myopathies

    Science.gov (United States)

    Welch, Ryan D.; Flaveny, Colin A.

    2017-08-01

    Muscle is primarily known for its mechanical roles in locomotion, maintenance of posture, and regulation of cardiac and respiratory function. There are numerous medical conditions that adversely affect muscle, myopathies that disrupt muscle development, regeneration and protein turnover to detrimental effect. Skeletal muscle is also a vital secretory organ that regulates thermogenesis, inflammatory signaling and directs context specific global metabolic changes in energy substrate preference on a daily basis. Myopathies differ in the causative factors that drive them but share common features including severe reduction in quality of life and significantly increased mortality all due irrefutably to the loss of muscle mass. Thus far clinically viable approaches for preserving muscle proteins and stimulating new muscle growth without unwanted side effects or limited efficacy has been elusive. Over the last few decades, evidence has emerged through in vitro and in vivo studies that suggest the nuclear receptors REV-ERB and ROR might modulate pathways involved in myogenesis and mitochondrial biogenesis. Hinting that REV-ERB and ROR might be targeted to treat myopathies. However there is still a need for substantial investigation into the roles of these nuclear receptors in in vivo rodent models of degenerative muscle diseases and acute injury. Although exciting, REV-ERB and ROR have somewhat confounding roles in muscle physiology and therefore more studies utilizing in vivo models of skeletal muscle myopathies are needed. In this review we highlight the molecular forces driving some of the major degenerative muscular diseases and showcase two promising molecular targets that may have the potential to treat myopathies: ROR and REV-ERB.

  15. Sagging Eye Syndrome or Nemaline Rod Myopathy? Divergence Insufficiency with Levator Dehiscence as an Overlapping Symptom between Two Diagnoses

    Directory of Open Access Journals (Sweden)

    Stephanie S. L. Cheung

    2017-01-01

    Full Text Available A 78-year-old woman complained of gradual, painless onset of horizontal binocular diplopia associated with progressive axial weakness. Physical examination revealed esotropia that was greater at distance than at near vision, bilateral levator dehiscence, and normal abducting saccadic speeds. Given the age of the patient and compatible clinical findings, the diagnosis of Sagging Eye Syndrome (SES was made. However, further work-up with a muscle biopsy suggested Sporadic Late-Onset Nemaline Myopathy (SLONM as the cause of her progressive muscle weakness. Although rare, external ophthalmoplegia has been described in the literature as a presenting symptom in SLONM. To elucidate the pathological mechanism for the patient’s diplopia, an MRI of the orbits was performed, which revealed findings consistent with SES. This case aims to highlight the importance of integrating clinical findings during the diagnostic process and serves as a reminder that diplopia can be a common symptom for an uncommon diagnosis.

  16. Exertional myopathy in a grizzly bear (Ursus arctos) captured by leghold snare.

    Science.gov (United States)

    Cattet, Marc; Stenhouse, Gordon; Bollinger, Trent

    2008-10-01

    We diagnosed exertional myopathy (EM) in a grizzly bear (Ursus arctos) that died approximately 10 days after capture by leghold snare in west-central Alberta, Canada, in June 2003. The diagnosis was based on history, post-capture movement data, gross necropsy, histopathology, and serum enzyme levels. We were unable to determine whether EM was the primary cause of death because autolysis precluded accurate evaluation of all tissues. Nevertheless, comparison of serum aspartate aminotransferase and creatine kinase concentrations and survival between the affected bear and other grizzly bears captured by leghold snare in the same research project suggests EM also occurred in other bears, but that it is not generally a cause of mortality. We propose, however, occurrence of nonfatal EM in grizzly bears after capture by leghold snare has potential implications for use of this capture method, including negative effects on wildlife welfare and research data.

  17. The effect of coenzyme Q10 in statin myopathy.

    Science.gov (United States)

    Zlatohlavek, Lukas; Vrablik, Michal; Grauova, Barbora; Motykova, Eva; Ceska, Richard

    2012-01-01

    Statins significantly reduce CV morbidity and mortality. Unfortunately, one of the side effects of statins is myopathy, for which statins cannot be administered in sufficient doses or administered at all. The aim of this study was to demonstrate the effect of coenzyme Q10 in patients with statin myopathy. Twenty eight patients aged 60.6±10.7 years were monitored (18 women and 10 men) and treated with different types and doses of statin. Muscle weakness and pain was monitored using a scale of one to ten, on which patients expressed the degree of their inconvenience. Examination of muscle problems was performed prior to administration of CQ10 and after 3 and 6 months of dosing. Statistical analysis was performed using Friedman test, Annova and Students t-test. Pain decreased on average by 53.8% (pmuscle weakness by 44.4% (pmuscle pain and sensitivity statistically significantly decreased.

  18. Myopathy in Childhood Muscle-Specific Kinase Myasthenia Gravis.

    Science.gov (United States)

    Kirzinger, Lukas; Khomenko, Andrei; Schulte-Mattler, Wilhelm; Backhaus, Roland; Platen, Sabine; Schalke, Berthold

    2016-12-01

    Adult and pediatric patients suffering from MuSK (muscle-specific kinase) -antibody positive myasthenia gravis exhibit similar features to individuals with acetylcholine receptor (AChR) antibodies, but they differ in several characteristics such as a predominant bulbar, respiratory and neck weakness, a generally worse disease severity and a tendency to develop muscle atrophy. Muscle atrophy is a rare phenomenon that is usually restricted to the facial muscles. We describe a girl with MuSK-antibody positive myasthenia gravis who developed a myopathy with severe generalized muscular weakness, muscle atrophy, and myopathic changes on electromyography. This is the first published example of a generalized myopathic syndrome in myasthenia gravis. We review the relevant literature and discuss the hypothesis of a mitochondrial myopathy as a pathogenic mechanism in MuSK-antibody positive myasthenia gravis. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Sarcoidosis Presenting as Löfgren’s Syndrome with Myopathy

    Directory of Open Access Journals (Sweden)

    Şenol Kobak

    2013-01-01

    Full Text Available A 34-year-old female patient, who had proximal muscle weakness for 8 months, presented with erythema nodosum lesions on the pretibial region in addition to pain, swelling, and movement restriction in both ankles for the last one month. Thoracic CT demonstrated hilar and mediastinal lymphadenopathy. She underwent mediastinoscopic lymph node biopsy; biopsy result was consistent with noncaseating granuloma. Serum angiotensin converting enzyme level and muscle enzymes have been elevated. Muscular MRI and EMG findings were consistent with myositis. Muscle biopsy was done, and myopathy was found. The patient was diagnosed with sarcoidosis, Löfgren's syndrome, and sarcoid myopathy. The patient displayed remarkable clinical and radiological regression after 6-month corticosteroid and MTX therapy.

  20. Analysis of lipid profile in lipid storage myopathy.

    Science.gov (United States)

    Aguennouz, M'hammed; Beccaria, Marco; Purcaro, Giorgia; Oteri, Marianna; Micalizzi, Giuseppe; Musumesci, Olimpia; Ciranni, Annmaria; Di Giorgio, Rosa Maria; Toscano, Antonio; Dugo, Paola; Mondello, Luigi

    2016-09-01

    Lipid dysmetabolism disease is a condition in which lipids are stored abnormally in organs and tissues throughout the body, causing muscle weakness (myopathy). Usually, the diagnosis of this disease and its characterization goes through dosage of Acyl CoA in plasma accompanied with evidence of droplets of intra-fibrils lipids in the patient muscle biopsy. However, to understand the pathophysiological mechanisms of lipid storage diseases, it is useful to identify the nature of lipids deposited in muscle fiber. In this work fatty acids and triglycerides profile of lipid accumulated in the muscle of people suffering from myopathies syndromes was characterized. In particular, the analyses were carried out on the muscle biopsy of people afflicted by lipid storage myopathy, such as multiple acyl-coenzyme A dehydrogenase deficiency, and neutral lipid storage disease with myopathy, and by the intramitochondrial lipid storage dysfunctions, such as deficiencies of carnitine palmitoyltransferase II enzyme. A single step extraction and derivatization procedure was applied to analyze fatty acids from muscle tissues by gas chromatography with a flame ionization detector and with an electronic impact mass spectrometer. Triglycerides, extracted by using n-hexane, were analyzed by high performance liquid chromatography coupled to mass spectrometer equipped with an atmospheric pressure chemical ionization interface. The most representative fatty acids in all samples were: C16:0 in the 13-24% range, C18:1n9 in the 20-52% range, and C18:2n6 in the 10-25% range. These fatty acids were part of the most representative triglycerides in all samples. The data obtained was statistically elaborated performing a principal component analysis. A satisfactory discrimination was obtained among the different diseases. Using component 1 vs component 3 a 43.3% of total variance was explained. Such results suggest the important role that lipid profile characterization can have in supporting a correct

  1. Quantitative nailfold video capillaroscopy in patients with idiopathic inflammatory myopathy

    OpenAIRE

    Mercer, Louise K.; Moore, Tonia L.; Chinoy, Hector; Murray, Andrea K.; Vail, Andy; Cooper, Robert G.; Herrick, Ariane L.

    2010-01-01

    Objectives. To quantify nailfold capillary density and dimensions in patients with idiopathic inflammatory myopathy (IIM) and compare them with those in healthy controls; to look for associations with microvascular disease in IIM; and to determine whether nailfold capillary density and dimensions change over time. Methods. Nailfold video microscopy (×300 magnification) was performed on 24 patients with IIM and 35 healthy controls. Capillary density and dimensions (total width and apical width...

  2. Cardiac involvement in adult and juvenile idiopathic inflammatory myopathies

    DEFF Research Database (Denmark)

    Schwartz, TThomas W; Diederichsen, L. P.; Lundberg, Ingrid E.

    2016-01-01

    Idiopathic inflammatory myopathies (IIM) include the main subgroups polymyositis (PM), dermatomyositis (DM), inclusion body myositis (IBM) and juvenile DM ( JDM). The mentioned subgroups are characterised by inflammation of skeletal muscles leading to muscle weakness and other organs can also...... that statins might worsen muscle symptoms mimicking myositis relapse. On the basis of recent studies, we recommend a low threshold for cardiac workup and follow-up in patients with IIM. © 2016 Published by the BMJ Publishing Group Limited....

  3. Diagnosis and treatment of the idiopathic inflammatory myopathies

    OpenAIRE

    Gazeley, David J.; Cronin, Mary E.

    2011-01-01

    The idiopathic inflammatory myopathies (IIMs) are rare disorders with the unifying feature of proximal muscle weakness. These diseases include polymyositis(PM), dermatomyositis (DM) and inclusion body myositis (IBM) as the most common. The diagnosis is based on the finding of weakness on exam, elevated muscles enzymes, characteristic histopathology of muscle biopsies, electromyography abnormalities and rash in DM. Myositis-specific antibodies have been helpful in defining subsets of patients ...

  4. Association between statin-associated myopathy and skeletal muscle damage.

    OpenAIRE

    Mohaupt Markus G; Karas Richard H; Babiychuk Eduard B; Sanchez-Freire Verónica; Monastyrskaya Katia; Iyer Lakshmanan; Hoppeler Hans; Breil Fabio; Draeger Annette

    2009-01-01

    BACKGROUND Many patients taking statins often complain of muscle pain and weakness. The extent to which muscle pain reflects muscle injury is unknown. METHODS We obtained biopsy samples from the vastus lateralis muscle of 83 patients. Of the 44 patients with clinically diagnosed statin associated myopathy 29 were currently taking a statin and 15 had discontinued statin therapy before the biopsy (minimal duration of discontinuation 3 weeks). We also included 19 patients who were taking stat...

  5. Schistosomiasis and nutritional myopathy in a Brazilian tapir (Tapirus terrestris).

    Science.gov (United States)

    Yamini, B; Schillhorn van Veen, T W

    1988-10-01

    Gross lesions suggestive of severe hepatoenteropathy and myopathy were noted in a 4.5-yr-old Brazilian tapir (Tapirus terrestris) from a zoo in Michigan (USA). The major microscopic lesions were granulomatous hepatitis and hemorrhagic enteritis associated with non-operculated eggs compatible with those of the Schistosomatidae (Digenea). Skeletal muscle and tongue contained foci of severe acute myodegeneration and necrosis. The hepatic vitamin E value of 1.3 ppm dry weight was considered critically low.

  6. Search for Pompe disease among patients with undetermined myopathies.

    Science.gov (United States)

    Lindberg, C; Anderson, B; Engvall, M; Hult, M; Oldfors, A

    2015-07-20

    Pompe disease is a rare treatable glycogen storage disease with in adults - a limb-girdle muscle weakness. Muscle biopsy may fail to show the typical vacuolar myopathy. We asked if we had un-diagnosed patients with Pompe disease in western Sweden. We searched the muscle biopsy registry during the time period 1986 until 2006 including 3665 biopsies and included patients at our Neuromuscular Center with unspecified myopathy or limb-girdle muscular dystrophy. The dry blood spot test was used to identify patients with Pompe disease. A total of 82 patients (46 from the biopsy register and 36 from our center) were seen and dry blood spot test was obtained. No patient with Pompe disease was found. The dry blood spot test was low in three cases (11, 16, and 18% of normal) but a second blood sample showed a normal result based on GAA enzyme activity in lymphocytes in all three patients. In one patient with low normal result of the analysis in lymphocytes a genetic test showed no pathogenic mutations. Further investigation gave a definite diagnose of another myopathy in 12 patients. The prevalence of Pompe disease in western Sweden (3 in 1.27 million or 0.24 per 100.000 inhabitants) is lower than in the Netherlands and New York. Re-evaluation of patients with myopathies but without definite diagnosis is rewarding since 12 of 82 patients in our study had a definite molecular diagnosis after workup. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. Morphologic imaging in muscular dystrophies and inflammatory myopathies

    International Nuclear Information System (INIS)

    Degardin, Adrian; Lacour, Arnaud; Vermersch, Patrick; Morillon, David; Cotten, Anne; Stojkovic, Tanya

    2010-01-01

    To determine if magnetic resonance imaging (MR imaging) is useful in the diagnostic workup of muscular dystrophies and idiopathic inflammatory myopathies for describing the topography of muscle involvement. MR imaging was performed in 31 patients: 8 with dystrophic myotony types 1 (n = 4) or 2 (n = 4); 11 with limb-girdle muscular dystrophy, including dysferlinopathy, calpainopathy, sarcoglycanopathy, and dystrophy associated with fukutin-related protein mutation; 3 with Becker muscular dystrophy; and 9 with idiopathic inflammatory myopathies, including polymyositis, dermatomyositis, and sporadic inclusion body myositis. Analysis of T1 images enabled us to describe the most affected muscles and the muscles usually spared for each muscular disease. In particular, examination of pelvis, thigh, and leg muscles demonstrated significant differences between the muscular diseases. On STIR images, hyperintensities were present in 62% of our patients with muscular dystrophies. A specific pattern of muscular involvement was established for each muscular disease. Hyperintensities observed on STIR images precede fatty degeneration and are not specific for inflammatory myopathies. (orig.)

  8. Morphologic imaging in muscular dystrophies and inflammatory myopathies

    Energy Technology Data Exchange (ETDEWEB)

    Degardin, Adrian; Lacour, Arnaud; Vermersch, Patrick [CHU de Lille, Clinique neurologique, Lille (France); Morillon, David; Cotten, Anne [CHRU de Lille, Service de Radiologie Osteoarticulaire, Hopital Roger Salengro, Lille (France); Stojkovic, Tanya [G-H Pitie-Salpetriere, Institut de Myologie, Paris (France)

    2010-12-15

    To determine if magnetic resonance imaging (MR imaging) is useful in the diagnostic workup of muscular dystrophies and idiopathic inflammatory myopathies for describing the topography of muscle involvement. MR imaging was performed in 31 patients: 8 with dystrophic myotony types 1 (n = 4) or 2 (n = 4); 11 with limb-girdle muscular dystrophy, including dysferlinopathy, calpainopathy, sarcoglycanopathy, and dystrophy associated with fukutin-related protein mutation; 3 with Becker muscular dystrophy; and 9 with idiopathic inflammatory myopathies, including polymyositis, dermatomyositis, and sporadic inclusion body myositis. Analysis of T1 images enabled us to describe the most affected muscles and the muscles usually spared for each muscular disease. In particular, examination of pelvis, thigh, and leg muscles demonstrated significant differences between the muscular diseases. On STIR images, hyperintensities were present in 62% of our patients with muscular dystrophies. A specific pattern of muscular involvement was established for each muscular disease. Hyperintensities observed on STIR images precede fatty degeneration and are not specific for inflammatory myopathies. (orig.)

  9. Zidovudine-induced myopathy: A study in Indian patients.

    Science.gov (United States)

    Sagar, Amitabh; Mohanty, Ambika P; Bahal, Ashish

    2010-07-01

    Literature is replete with studies on zidovudine-induced myopathy after prolonged use (use beyond 270 days on an average). However, all these studies have been done on patients of Caucasian, American and African ethnic origin. No such study has been carried out in Indian patients to our knowledge. To determine the correlation of zidovudine usage with serum creatine phosphokinase (CK) levels, clinical muscular weakness and muscle histology in Indian patients, we studied 147 physically active, Human Immunodeficiency Virus infected men on prolonged zidovudine-based antiretroviral therapy (ART). Cross-sectional study on hospital follow-up patients of HIV infection. All cases on ART who reported to our canter during a period of 18 months were evaluated for symptoms (muscle fatigue, myalgia), objective muscle strength (testing clinically) and serum CK levels, and a select group was evaluated by muscle biopsy. These patients were on zidovudine for 1 to 7 years. None of the patients studied had significant symptoms or objective muscle weakness and only a small fraction (10.8% of cases) had marginally raised serum CK levels. All muscle biopsies were normal on light microscopy. Zidovudine myopathy may be a constraint for use of the drug in the western population; however, it is a well-tolerated drug as regards myopathy in our study on Indian patients.

  10. On renormalization of axial anomaly

    International Nuclear Information System (INIS)

    Efremov, A.V.; Teryaev, O.V.

    1989-01-01

    It is shown that multiplicative renormalization of the axial singlet current results in renormalization of the axial anomaly in all orders of perturbation theory. It is a necessary condition for the Adler - Bardeen theorem being valid. 10 refs.; 2 figs

  11. Axial tomographic scanner

    International Nuclear Information System (INIS)

    1976-01-01

    An axial tomographic system is described comprising axial tomographic means for collecting sets of data corresponding to the transmission or absorption of a number of beams of penetrating radiation through a planar slice of an object. It includes means to locate an object to be analyzed, a source and detector for directing one or more beams of penetrating radiation through the object from the source to the detector, and means to rotate (and optionally translate) the source as well as means to process the collected sets of data. Data collection, data processing, and data display can each be conducted independently of each other. An additional advantage of the system described is that the raw data (i.e., the originally collected data) are not destroyed by the data processing but instead are retained intact for further reference or use, if needed

  12. Neurogenic myopathies and imaging of muscle denervation; Neurogene Myopathien und Bildgebung der Muskeldenervation

    Energy Technology Data Exchange (ETDEWEB)

    Wolf, M. [Universitaetsklinikum Heidelberg, Abteilung fuer Neuroradiologie, Heidelberg (Germany); Wolf, C. [Reha-Zentrum Gernsbach, Neurologie, Gernsbach (Germany); Weber, M.A. [Universitaetsklinikum Heidelberg, Abteilung fuer Diagnostische und Interventionelle Radiologie, Heidelberg (Germany)

    2017-12-15

    Neurogenic myopathies are primary diseases of the nervous system, which secondarily result in denervation of the target musculature. The spectrum of potential causes is manifold ranging from acute traumatic injuries and chronic compression to neurodegenerative, inflammatory, metabolic and neoplastic processes. The medical history, clinical neurological examination, and electrophysiological tests including electromyography and nerve conduction studies are crucial in diagnosing neuropathic myopathies. Electromyography is the gold standard for diagnosing muscle denervation. Additional imaging methods and magnetic resonance imaging (MRI) in particular, are capable of contributing valuable information. The MRI examination of denervated musculature shows edema, an increase in the apparent diffusion coefficient (ADC) and hyperperfusion. Chronic denervation results in fatty degeneration and atrophy of affected muscles, which are also detectable by MRI. Although the MRI findings in muscle denervation are relatively unspecific, they show a high sensitivity, comparable to electromyography. Dedicated MR neurography may often visualize the underlying lesion(s) of the innervating nerve(s). Besides high sensitivity, comparable to electromyography, MRI is capable of evaluating muscles which are inaccessible for needle electromyography. Due to its non-invasive character, MRI is ideal for follow-up examinations. The use of MRI is often a meaningful addition to the diagnostics of neurogenic myopathies. The extent and distribution pattern of muscular alterations often provide information on the localization of the causative nerve damage. A correct diagnosis or at least a narrowing down of possible differential diagnoses can often be achieved using MRI. (orig.) [German] Neurogene Myopathien sind Erkrankungen des Nervensystems, die sekundaer zur Denervierung der Zielmuskulatur fuehren. Das Spektrum potenzieller Ursachen ist vielfaeltig und umfasst akute traumatische Verletzungen

  13. Myopathy and hepatic lipidosis in weaned lambs due to vitamin E deficiency.

    Science.gov (United States)

    Menzies, Paula; Langs, Lisa; Boermans, Herman; Martin, John; McNally, John

    2004-03-01

    A sheep flock experienced losses in weaned lambs from myopathy and hepatic lipidosis. Investigation revealed painful ambulation, illthrift, and unexpected death in lambs with normal selenium levels, deficient vitamin E levels, and elevated muscle and liver enzyme levels. Vitamin E deficiency should be considered when investigating myopathy and illthrift in lambs.

  14. Myopathy and hepatic lipidosis in weaned lambs due to vitamin E deficiency

    OpenAIRE

    Menzies, Paula; Langs, Lisa; Boermans, Herman; Martin, John; McNally, John

    2004-01-01

    A sheep flock experienced losses in weaned lambs from myopathy and hepatic lipidosis. Investigation revealed painful ambulation, illthrift, and unexpected death in lambs with normal selenium levels, deficient vitamin E levels, and elevated muscle and liver enzyme levels. Vitamin E deficiency should be considered when investigating myopathy and illthrift in lambs.

  15. Critical Axial Load

    Directory of Open Access Journals (Sweden)

    Walt Wells

    2008-01-01

    Full Text Available Our objective in this paper is to solve a second order differential equation for a long, simply supported column member subjected to a lateral axial load using Heun's numerical method. We will use the solution to find the critical load at which the column member will fail due to buckling. We will calculate this load using Euler's derived analytical approach for an exact solution, as well as Euler's Numerical Method. We will then compare the three calculated values to see how much they deviate from one another. During the critical load calculation, it will be necessary to calculate the moment of inertia for the column member.

  16. Study protocol for a cluster randomized controlled trial to evaluate a referral strategy for axial spondyloarthritis in young primary care patients with chronic low back pain; an impact study.

    Science.gov (United States)

    van Hoeven, Lonneke; Vergouwe, Yvonne; Koes, Bart W; Hazes, Johanna M W; Weel, Angelique E A M

    2016-07-12

    Axial spondyloarthritis (axSpA) is a disabling inflammatory joint disease with chronic low back pain (CLBP) as leading symptom. Recognizing axSpA in the large amount of CLBP patients is difficult for general practioners (GP). This evaluation aims to assess the effect of a referral strategy for axSpA in young primary care patients with CLBP by comparing the use of the strategy with usual care. The effect is measured at three different levels; by patient reported outcomes (the clinical effect), process and costs evaluation. This study design is a cluster randomized controlled trial with GP as clusters. GPs throughout the Netherlands are invited to participate and randomized to either the intervention or the control group. Patients from participating GPs are invited to participate if they have ever been registered with low back pain, without radiation (ICPC L03) and aged 18-45 years. To be included in the study, patients need to have current low back pain and chronic low back pain (>12 weeks). In the intervention arm a referral strategy for axSpA will be applied in CLBP patients, in the control arm care as usual will be provided for CLBP patients. The referral strategy consists of four easy to use variables. All are questions about the back pain complaints of the patients. Data is prospectively collected in an online database at baseline (T0), 4 months (T1), 12 months (T2) and 24 months (T3). After time point T1 (4 months) patients from the control group will also receive the intervention i.e. the application of a referral strategy for axSpA. The effect of the referral strategy is measured at three different levels, by patient outcomes (e.g. pain scores, quality of life), process measures (e.g. number of axSpA diagnoses by rheumatologists) and by costs (work productivity and health care resources use). Our primary outcome is the Roland Morris Disability Questionnaire after 4 months, secondary outcomes are pain and quality of life. Costs will be assessed before

  17. Study of cognitive sphere in children and adolescents with congenital myopathy (theoretical review

    Directory of Open Access Journals (Sweden)

    V. A. Erokhina

    2013-08-01

    Full Text Available This paper presents an analysis of current approaches to the study of states of higher mental functions in children and adolescents suffering from various forms of hereditary myopathies. The aim of this work is to study the theoretical rationale and the possibility of specific disorders of mental function in children and adolescents with congenital myopathies. To achieve this objective during the study it was necessary to solve the following problems: give a description of the various groups and forms of congenital myopathies, their clinical characteristics; justify the possibility of considering the hereditary myopathies as a factor in the formation of changes in visual-spatial activities and thinking; evaluate the possibility to use complex neuropsychological psycho-diagnostic techniques for investigating the state of the higher mental functions of children with congenital myopathies. The possibility of neuropsychological correction for this category of patients is discussed also.

  18. Muscle structural changes in mitochondrial myopathy relate to genotype

    DEFF Research Database (Denmark)

    Olsen, David B.; Langkilde, Annika Reynberg; Ørngreen, Mette C.

    2003-01-01

    It is well known that morphological changes at the cellular level occur in muscle of patients with mitochondrial myopathy (MM), but changes in muscle structure with fat infiltration and gross variation of muscle fiber size with giant fibers, normally encountered in the muscular dystrophies, have...... typically not been associated with mitochondrial disease. We investigated gross and microscopic muscle morphology in thigh muscles by muscle biopsy and MRI in 16 patients with MM, and compared findings with those obtained in muscular dystrophy patients and healthy subjects. Changes of muscle architecture...

  19. Axial skeletal CT densitometry

    International Nuclear Information System (INIS)

    Lampmann, L.E.H.

    1982-01-01

    Since the discovery of the Roentgen ray a precise and accurate assessment of bone mineral content has been a challenge to many investigators. A number of methods have been developed but no one satisfied. Considering its technical possibilities computed tomography is very promising in determination of bone mineral content (BMC). The new modality enables BMC estimations in the axial skeletal trabecular bone. CT densitometry can be performed on a normal commercially available third generation whole body CT scanner. No dedicated device in a special clinical set-up is necessary. In this study 106 patients, most of them clinically suspected of osteoporosis, were examined. The new method CT densitometry has been evaluated. The results have been correlated to alternative BMC determination methods. (Auth.)

  20. [Insight into the training of patients with idiopathic inflammatory myopathy].

    Science.gov (United States)

    Váncsa, Andrea

    2016-09-01

    Using current recommended treatment, a majority of patients with idiopathic inflammatory myopathy develop muscle impairment and poor health. Beneficial effects of exercise have been reported on muscle performance, aerobic capacity and health in chronic polymyositis and dermatomyositis, as well as in active disease and inclusion body myositis to some extent. Importantly, randomized controlled trials indicate that improved health and decreased clinical disease activity could be mediated through increased aerobic capacity. Recently, reports seeking pathomechanisms of the underlying effects of exercise on skeletal muscle indicate increased aerobic capacity (i.e. increased mitochondrial capacity and capillary density, reduced lactate levels), activation of genes of aerobic phenotype and muscle growth programs and down regulation of genes related to inflammation. Exercise contributes to both systemic and within-muscle adaptations demonstrating that it is fundamental for improving muscle performance and health in patients with idiopathic inflammatory myopathy. There is a need for randomized controlled trials to study the effects of exercise in patients with active disease and inclusion body myositis. Orv. Hetil., 2016, 157(39), 1557-1562.

  1. Statin-associated myopathy: from genetic predisposition to clinical management.

    Science.gov (United States)

    Vrablik, M; Zlatohlavek, L; Stulc, T; Adamkova, V; Prusikova, M; Schwarzova, L; Hubacek, J A; Ceska, R

    2014-01-01

    Statin-associated myopathy (SAM) represents a broad spectrum of disorders from insignificant myalgia to fatal rhabdomyolysis. Its frequency ranges from 1-5 % in clinical trials to 15-20 % in everyday clinical practice. To a large extent, these variations can be explained by the definition used. Thus, we propose a scoring system to classify statin-induced myopathy according to clinical and biochemical criteria as 1) possible, 2) probable or 3) definite. The etiology of this disorder remains poorly understood. Most probably, an underlying genetic cause is necessary for overt SAM to develop. Variants in a few gene groups that encode proteins involved in: i) statin metabolism and distribution (e.g. membrane transporters and enzymes; OATP1B1, ABCA1, MRP, CYP3A4), ii) coenzyme Q10 production (e.g. COQ10A and B), iii) energy metabolism of muscle tissue (e.g. PYGM, GAA, CPT2) and several others have been proposed as candidates which can predispose to SAM. Pharmacological properties of individual statin molecules (e.g. lipophilicity, excretion pathways) and patients´ characteristics influence the likelihood of SAM development. This review summarizes current data as well as our own results.

  2. Novel autosomal dominant TNNT1 mutation causing nemaline myopathy.

    Science.gov (United States)

    Konersman, Chamindra G; Freyermuth, Fernande; Winder, Thomas L; Lawlor, Michael W; Lagier-Tourenne, Clotilde; Patel, Shailendra B

    2017-11-01

    Nemaline myopathy (NEM) is one of the three major forms of congenital myopathy and is characterized by diffuse muscle weakness, hypotonia, respiratory insufficiency, and the presence of nemaline rod structures on muscle biopsy. Mutations in troponin T1 (TNNT1) is 1 of 10 genes known to cause NEM. To date, only homozygous nonsense mutations or compound heterozygous truncating or internal deletion mutations in TNNT1 gene have been identified in NEM. This extended family is of historical importance as some members were reported in the 1960s as initial evidence that NEM is a hereditary disorder. Proband and extended family underwent Sanger sequencing for TNNT1. We performed RT-PCR and immunoblot on muscle to assess TNNT1 RNA expression and protein levels in proband and father. We report a novel heterozygous missense mutation of TNNT1 c.311A>T (p.E104V) that segregated in an autosomal dominant fashion in a large family residing in the United States. Extensive sequencing of the other known genes for NEM failed to identify any other mutant alleles. Muscle biopsies revealed a characteristic pattern of nemaline rods and severe myofiber hypotrophy that was almost entirely restricted to the type 1 fiber population. This novel mutation alters a residue that is highly conserved among vertebrates. This report highlights not only a family with autosomal dominant inheritance of NEM, but that this novel mutation likely acts via a dominant negative mechanism. © 2017 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

  3. Skeletal muscle repair in a mouse model of nemaline myopathy.

    Science.gov (United States)

    Sanoudou, Despina; Corbett, Mark A; Han, Mei; Ghoddusi, Majid; Nguyen, Mai-Anh T; Vlahovich, Nicole; Hardeman, Edna C; Beggs, Alan H

    2006-09-01

    Nemaline myopathy (NM), the most common non-dystrophic congenital myopathy, is a variably severe neuromuscular disorder for which no effective treatment is available. Although a number of genes have been identified in which mutations can cause NM, the pathogenetic mechanisms leading to the phenotypes are poorly understood. To address this question, we examined gene expression patterns in an NM mouse model carrying the human Met9Arg mutation of alpha-tropomyosin slow (Tpm3). We assessed five different skeletal muscles from affected mice, which are representative of muscles with differing fiber-type compositions, different physiological specializations and variable degrees of pathology. Although these same muscles in non-affected mice showed marked variation in patterns of gene expression, with diaphragm being the most dissimilar, the presence of the mutant protein in nemaline muscles resulted in a more similar pattern of gene expression among the muscles. This result suggests a common process or mechanism operating in nemaline muscles independent of the variable degrees of pathology. Transcriptional and protein expression data indicate the presence of a repair process and possibly delayed maturation in nemaline muscles. Markers indicative of satellite cell number, activated satellite cells and immature fibers including M-Cadherin, MyoD, desmin, Pax7 and Myf6 were elevated by western-blot analysis or immunohistochemistry. Evidence suggesting elevated focal repair was observed in nemaline muscle in electron micrographs. This analysis reveals that NM is characterized by a novel repair feature operating in multiple different muscles.

  4. Statin-associated immune-mediated myopathy: biology and clinical implications.

    Science.gov (United States)

    Christopher-Stine, Lisa; Basharat, Pari

    2017-04-01

    In the last 6 years, our understanding of statin-associated myopathy expanded to include not only a toxic myopathy with limited and reversible side-effects but also an autoimmune variety in which statins likely induce an autoimmune myopathy that is both associated with a specific autoantibody and responsive to immunosuppression and immune modulation. This review widens the reader's understanding of statin myopathy to include an autoimmune process. Statin-associated immune-mediated myopathy provides an example of an environmental trigger (statins) directly implicated in an autoimmune disease associated with a genetic predisposition as well as potential risk factors including concomitant diseases and specific statins. Given a median exposure to statins of 38 months, providers should be aware that anti-3-hydroxy-3-methyl-glutaryl-coenzyme A reductase (HMGCR) myopathy may occur even after several years of statin exposure. It is important for the reader to understand the clinical presentation of statin-associated immune-mediated myopathy and the difference in its clinical presentation to that of statins as direct myotoxins. Prompt recognition of such an entity allows the clinician to immediately stop the offending agent if it has not already been discontinued as well as to recognize that statin rechallenge is not a likely option, and that prompt treatment with immunosuppression and/or immunomodulation is usually of enormous benefit to the patient in restoring muscle strength and physical function. VIDEO ABSTRACT.

  5. Myopathy With SQSTM1 and TIA1 Variants: Clinical and Pathological Features

    Directory of Open Access Journals (Sweden)

    Zhiyv Niu

    2018-03-01

    Full Text Available ObjectiveThe aim of this study is to identify the molecular defect of three unrelated individuals with late-onset predominant distal myopathy; to describe the spectrum of phenotype resulting from the contributing role of two variants in genes located on two different chromosomes; and to highlight the underappreciated complex forms of genetic myopathies.Patients and methodsClinical and laboratory data of three unrelated probands with predominantly distal weakness manifesting in the sixth-seventh decade of life, and available affected and unaffected family members were reviewed. Next-generation sequencing panel, whole exome sequencing, and targeted analyses of family members were performed to elucidate the genetic etiology of the myopathy.ResultsGenetic analyses detected two contributing variants located on different chromosomes in three unrelated probands: a heterozygous pathogenic mutation in SQSTM1 (c.1175C>T, p.Pro392Leu and a heterozygous variant in TIA1 (c.1070A>G, p.Asn357Ser. The affected fraternal twin of one proband also carries both variants, while the unaffected family members harbor one or none. Two unrelated probands (family 1, II.3, and family 3, II.1 have a distal myopathy with rimmed vacuoles that manifested with index extensor weakness; the other proband (family 2, I.1 has myofibrillar myopathy manifesting with hypercapnic respiratory insufficiency and distal weakness.ConclusionThe findings indicate that all the affected individuals have a myopathy associated with both variants in SQSTM1 and TIA1, respectively, suggesting that the two variants determine the phenotype and likely functionally interact. We speculate that the TIA1 variant is a modifier of the SQSTM1 mutation. We identify the combination of SQSTM1 and TIA1 variants as a novel genetic defect associated with myofibrillar myopathy and suggest to consider sequencing both genes in the molecular investigation of myopathy with rimmed vacuoles and myofibrillar myopathy

  6. Myopathy With SQSTM1 and TIA1 Variants: Clinical and Pathological Features.

    Science.gov (United States)

    Niu, Zhiyv; Pontifex, Carly Sabine; Berini, Sarah; Hamilton, Leslie E; Naddaf, Elie; Wieben, Eric; Aleff, Ross A; Martens, Kristina; Gruber, Angela; Engel, Andrew G; Pfeffer, Gerald; Milone, Margherita

    2018-01-01

    The aim of this study is to identify the molecular defect of three unrelated individuals with late-onset predominant distal myopathy; to describe the spectrum of phenotype resulting from the contributing role of two variants in genes located on two different chromosomes; and to highlight the underappreciated complex forms of genetic myopathies. Clinical and laboratory data of three unrelated probands with predominantly distal weakness manifesting in the sixth-seventh decade of life, and available affected and unaffected family members were reviewed. Next-generation sequencing panel, whole exome sequencing, and targeted analyses of family members were performed to elucidate the genetic etiology of the myopathy. Genetic analyses detected two contributing variants located on different chromosomes in three unrelated probands: a heterozygous pathogenic mutation in SQSTM1 (c.1175C>T, p.Pro392Leu) and a heterozygous variant in TIA1 (c.1070A>G, p.Asn357Ser). The affected fraternal twin of one proband also carries both variants, while the unaffected family members harbor one or none. Two unrelated probands (family 1, II.3, and family 3, II.1) have a distal myopathy with rimmed vacuoles that manifested with index extensor weakness; the other proband (family 2, I.1) has myofibrillar myopathy manifesting with hypercapnic respiratory insufficiency and distal weakness. The findings indicate that all the affected individuals have a myopathy associated with both variants in SQSTM1 and TIA1 , respectively, suggesting that the two variants determine the phenotype and likely functionally interact. We speculate that the TIA1 variant is a modifier of the SQSTM1 mutation. We identify the combination of SQSTM1 and TIA1 variants as a novel genetic defect associated with myofibrillar myopathy and suggest to consider sequencing both genes in the molecular investigation of myopathy with rimmed vacuoles and myofibrillar myopathy although additional studies are needed to investigate the

  7. Fibrous Myopathy as a Complication of Repeated Intramuscular Injections for Chronic Headache

    Directory of Open Access Journals (Sweden)

    R Burnham

    2006-01-01

    Full Text Available Two cases of fibrous myopathy associated with repeated, long-term intramuscular injections for treatment of chronic temporomandibular joint pain and chronic headache, respectively, are described. Both patients developed severe, function-limiting contractures in upper and lower extremity muscles used as injection sites. In one of the cases, the contractures were painful. Electrophysiological testing, magnetic resonance imaging and muscle biopsy results were all consistent with myopathy and replacement of skeletal muscle with noncontractile fibrous tissue. These cases are presented to increase awareness of fibrous myopathy and to promote surveillance for this serious potential complication of long-term intramuscular injections in chronic headache and other pain patients.

  8. Dissipative Axial Inflation

    CERN Document Server

    Notari, Alessio

    2016-12-22

    We analyze in detail the background cosmological evolution of a scalar field coupled to a massless abelian gauge field through an axial term $\\frac{\\phi}{f_\\gamma} F \\tilde{F}$, such as in the case of an axion. Gauge fields in this case are known to experience tachyonic growth and therefore can backreact on the background as an effective dissipation into radiation energy density $\\rho_R$, which which can lead to inflation without the need of a flat potential. We analyze the system, for momenta $k$ smaller than the cutoff $f_\\gamma$, including numerically the backreaction. We consider the evolution from a given static initial condition and explicitly show that, if $f_\\gamma$ is smaller than the field excursion $\\phi_0$ by about a factor of at least ${\\cal O} (20)$, there is a friction effect which turns on before that the field can fall down and which can then lead to a very long stage of inflation with a generic potential. In addition we find superimposed oscillations, which would get imprinted on any kind of...

  9. The myositis autoantibody phenotypes of the juvenile idiopathic inflammatory myopathies.

    Science.gov (United States)

    Rider, Lisa G; Shah, Mona; Mamyrova, Gulnara; Huber, Adam M; Rice, Madeline Murguia; Targoff, Ira N; Miller, Frederick W

    2013-07-01

    The juvenile idiopathic inflammatory myopathies (JIIM) are systemic autoimmune diseases characterized by skeletal muscle weakness, characteristic rashes, and other systemic features. In follow-up to our study defining the major clinical subgroup phenotypes of JIIM, we compared demographics, clinical features, laboratory measures, and outcomes among myositis-specific autoantibody (MSA) subgroups, as well as with published data on adult idiopathic inflammatory myopathy patients enrolled in a separate natural history study. In the present study, of 430 patients enrolled in a nationwide registry study who had serum tested for myositis autoantibodies, 374 had either a single specific MSA (n = 253) or no identified MSA (n = 121) and were the subject of the present report. Following univariate analysis, we used random forest classification and exact logistic regression modeling to compare autoantibody subgroups. Anti-p155/140 autoantibodies were the most frequent subgroup, present in 32% of patients with juvenile dermatomyositis (JDM) or overlap myositis with JDM, followed by anti-MJ autoantibodies, which were seen in 20% of JIIM patients, primarily in JDM. Other MSAs, including anti-synthetase, anti-signal recognition particle (SRP), and anti-Mi-2, were present in only 10% of JIIM patients. Features that characterized the anti-p155/140 autoantibody subgroup included Gottron papules, malar rash, "shawl-sign" rash, photosensitivity, cuticular overgrowth, lowest creatine kinase (CK) levels, and a predominantly chronic illness course. The features that differed for patients with anti-MJ antibodies included muscle cramps, dysphonia, intermediate CK levels, a high frequency of hospitalization, and a monocyclic disease course. Patients with anti-synthetase antibodies had higher frequencies of interstitial lung disease, arthralgia, and "mechanic's hands," and had an older age at diagnosis. The anti-SRP group, which had exclusively juvenile polymyositis, was characterized by high

  10. Oculopharyngeal Weakness, Hypophrenia, Deafness, and Impaired Vision: A Novel Autosomal Dominant Myopathy with Rimmed Vacuoles

    Directory of Open Access Journals (Sweden)

    Ting Chen

    2016-01-01

    Conclusions: We reported a novel autosomal dominant myopathy with rimmed vacuoles characterized by dysarthria, dysphagia, external ophthalmoplegia, limb weakness, hypophrenia, deafness, and impaired vision, but the causative gene has not been found and needs further study.

  11. Nuclear actin aggregation is a hallmark of anti-synthetase syndrome-induced dysimmune myopathy

    NARCIS (Netherlands)

    Stenzel, Werner; Preuße, Corinna; Allenbach, Yves; Pehl, Debora; Junckerstorff, Reimar; Heppner, Frank L.; Nolte, Kay; Aronica, Eleonora; Kana, Veronika; Rushing, Elisabeth; Schneider, Udo; Claeys, Kristl G.; Benveniste, Olivier; Weis, Joachim; Goebel, Hans H.

    2015-01-01

    To analyze antisynthetase syndrome-associated myositis by modern myopathologic methods and to define its place in the spectrum of idiopathic inflammatory myopathies (IIMs). Skeletal muscle biopsies from antisynthetase syndrome-associated myositis and other IIMs from different institutions worldwide

  12. Diagnostic value of MHC class I staining in idiopathic inflammatory myopathies.

    NARCIS (Netherlands)

    Pas, J. van der; Hengstman, G.J.D.; Laak, H.J. ter; Borm, G.F.; Engelen, B.G.M. van

    2004-01-01

    BACKGROUND: Identification of mononuclear cellular infiltrates in skeletal muscle tissue is the histological cornerstone of the diagnosis of idiopathic inflammatory myopathy (IIM). However, these infiltrates are not always present. OBJECTIVE: To determine whether MHC class I antigen expression on

  13. Organophosphate-induced intermediate syndrome: aetiology and relationships with myopathy.

    Science.gov (United States)

    Karalliedde, Lakshman; Baker, David; Marrs, Timothy C

    2006-01-01

    -15 days and even up to 21 days. Weaning from ventilatory care is best carried out in stages, with provision of continuous positive airway pressure prior to complete weaning. Continuous and close monitoring of respiratory function (arterial oxygen saturation, partial pressure of oxygen in arterial blood, partial pressure of carbon dioxide in arterial blood) and acid-base status are an absolute necessity. Prophylactic antibiotics are usually not required unless there has been evidence of aspiration of material into the lungs. Close monitoring of fluid and electrolyte balance is mandatory in view of the profuse offensive diarrhoea that most patients develop. Maintenance of nutrition, physiotherapy, prevention of bed sores and other routine measures to minimise discomfort during ventilatory care are necessary. Recovery from the intermediate syndrome is normally complete and without any sequelae. The usefulness of oximes during the IMS remains uncertain. In animal experiments, very early administration of oximes has prevented the occurrence of myopathy. There are reports from developed countries where administration of oximes at recommended doses and within 2 hours of ingestion of OP insecticide did not prevent the onset of the IMS. Controlled randomised clinical studies are necessary to evaluate the efficacy of oximes in combating the IMS. Electrophysiological studies following OP poisoning have revealed three characteristic phenomena: (i) repetitive firing following a single stimulus; (ii) gradual reduction in twitch height or compound muscle action potential followed by an increase with repetitive stimulation (the 'decrement-increment response'); and (iii) continued reduction in twitch height or compound muscle action potential with repetitive simulation ('decrementing response'). Of these, the decrementing response is the most frequent finding during the IMS, whilst repetitive firing is observed during the acute cholinergic syndrome. The distribution of the weakness in

  14. Acylcarnitines profile best predicts survival in horses with atypical myopathy.

    Directory of Open Access Journals (Sweden)

    François Boemer

    Full Text Available Equine atypical myopathy (AM is caused by hypoglycin A intoxication and is characterized by a high fatality rate. Predictive estimation of survival in AM horses is necessary to prevent unnecessary suffering of animals that are unlikely to survive and to focus supportive therapy on horses with a possible favourable prognosis of survival. We hypothesized that outcome may be predicted early in the course of disease based on the assumption that the acylcarnitine profile reflects the derangement of muscle energetics. We developed a statistical model to prognosticate the risk of death of diseased animals and found that estimation of outcome may be drawn from three acylcarnitines (C2, C10:2 and C18 -carnitines with a high sensitivity and specificity. The calculation of the prognosis of survival makes it possible to distinguish the horses that will survive from those that will die despite severe signs of acute rhabdomyolysis in both groups.

  15. Acylcarnitines profile best predicts survival in horses with atypical myopathy

    Science.gov (United States)

    Detilleux, Johann; Cello, Christophe; Amory, Hélène; Marcillaud-Pitel, Christel; Richard, Eric; van Galen, Gaby; van Loon, Gunther; Lefère, Laurence; Votion, Dominique-Marie

    2017-01-01

    Equine atypical myopathy (AM) is caused by hypoglycin A intoxication and is characterized by a high fatality rate. Predictive estimation of survival in AM horses is necessary to prevent unnecessary suffering of animals that are unlikely to survive and to focus supportive therapy on horses with a possible favourable prognosis of survival. We hypothesized that outcome may be predicted early in the course of disease based on the assumption that the acylcarnitine profile reflects the derangement of muscle energetics. We developed a statistical model to prognosticate the risk of death of diseased animals and found that estimation of outcome may be drawn from three acylcarnitines (C2, C10:2 and C18 -carnitines) with a high sensitivity and specificity. The calculation of the prognosis of survival makes it possible to distinguish the horses that will survive from those that will die despite severe signs of acute rhabdomyolysis in both groups. PMID:28846683

  16. A case of congenital myopathy masquerading as paroxysmal dyskinesia

    Directory of Open Access Journals (Sweden)

    Harsh Patel

    2014-01-01

    Full Text Available Gastroesophageal reflux (GER disease is a significant comorbidity of neuromuscular disorders. It may present as paroxysmal dyskinesia, an entity known as Sandifer syndrome. A 6-week-old neonate presented with very frequent paroxysms of generalized stiffening and opisthotonic posture since day 22 of life. These were initially diagnosed as seizures and he was started on multiple antiepileptics which did not show any response. After a normal video electroencephalogram (VEEG was documented, possibility of dyskinesia was kept. However, when he did not respond to symptomatic therapy, Sandifer syndrome was thought of and GER scan was done, which revealed severe GER. After his symptoms got reduced to some extent, a detailed clinical examination revealed abnormal facies with flaccid quadriparesis. Muscle biopsy confirmed the diagnosis of a specific congenital myopathy. On antireflux measures, those episodic paroxysms reduced to some extent. Partial response to therapy in GER should prompt search for an underlying secondary etiology.

  17. Characterization of Multiflux Axial Compressors

    International Nuclear Information System (INIS)

    Brasnarof, Daniel; Kyung Kyu-Hyung; Rivarola, Martin; Gonzalez Jose; Florido, Pablo; Orellano, Pablo; Bergallo, Juan

    2003-01-01

    In the present work the results of analytical models of performance are compared with experimental data acquired in the multi flux axial compressor test facility, built in The Pilcaniyeu Technological Complex for the SIGMA project.We describe the experimental circuit and the data of the dispersion inside the axial compressor obtained using a tracer gas through one of the annular inlets.The attained results can be used to validate the design code for the multi flux axial compressors and SIGMA industrial plant

  18. Axial gap rotating electrical machine

    Science.gov (United States)

    None

    2016-02-23

    Direct drive rotating electrical machines with axial air gaps are disclosed. In these machines, a rotor ring and stator ring define an axial air gap between them. Sets of gap-maintaining rolling supports bear between the rotor ring and the stator ring at their peripheries to maintain the axial air gap. Also disclosed are wind turbines using these generators, and structures and methods for mounting direct drive rotating electrical generators to the hubs of wind turbines. In particular, the rotor ring of the generator may be carried directly by the hub of a wind turbine to rotate relative to a shaft without being mounted directly to the shaft.

  19. Study of axial magnetic effect

    Energy Technology Data Exchange (ETDEWEB)

    Braguta, Victor [IHEP, Protvino, Moscow region, 142284 Russia ITEP, B. Cheremushkinskaya street 25, Moscow, 117218 (Russian Federation); School of Biomedicine, Far Eastern Federal University, Ajax 10 Building 25, Russian island, Vladivostok, 690922 (Russian Federation); Chernodub, M. N. [CNRS, Laboratoire de Mathématiques et Physique Théorique, Université François-Rabelais Tours, Fédération Denis Poisson, Parc de Grandmont, 37200 Tours, France Department of Physics and Astronomy, University of Gent, Krijgslaan 281, S9, B-9000 Gent (Belgium); School of Biomedicine, Far Eastern Federal University, Ajax 10 Building 25, Russian island, Vladivostok, 690922 (Russian Federation); Goy, V. A. [School of Natural Sciences, Far Eastern Federal University, Sukhanova street 8, Vladivostok, 690950 (Russian Federation); Landsteiner, K. [Instituto de Física Teórica UAM/CSIC, C/ Nicolás Cabrera 13-15, Universidad Autónoma de Madrid, Cantoblanco, 28049 Madrid (Spain); Molochkov, A. V. [School of Biomedicine, Far Eastern Federal University, Ajax 10 Building 25, Russian island, Vladivostok, 690922 (Russian Federation); Ulybyshev, M. [ITEP, B. Cheremushkinskaya street 25, Moscow, 117218 Russia Institute for Theoretical Problems of Microphysics, Moscow State University, Moscow, 119899 (Russian Federation)

    2016-01-22

    The Axial Magnetic Effect manifests itself as an equilibrium energy flow of massless fermions induced by the axial (chiral) magnetic field. Here we study the Axial Magnetic Effect in the quenched SU(2) lattice gauge theory with massless overlap fermions at finite temperature. We numerically observe that in the low-temperature hadron phase the effect is absent due to the quark confinement. In the high-temperature deconfinement phase the energy flow is an increasing function of the temperature which reaches the predicted asymptotic T{sup 2} behavior at high temperatures. We find, however, that energy flow is about one order of magnitude lower compared to a theoretical prediction.

  20. The genetic basis of pectoralis major myopathies in modern broiler chicken lines

    OpenAIRE

    Bailey, Richard A.; Watson, Kellie A.; Bilgili, S. F.; Avendano, Santiago

    2015-01-01

    This is the first report providing estimates of the genetic basis of breast muscle myopathies (BMM) and their relationship with growth and yield in broiler chickens. In addition, this paper addresses the hypothesis that genetic selection for increase breast yield has contributed to the onset of BMM. Data were analyzed from ongoing recording of BMM within the Aviagen breeding program. This study focused on three BMM: deep pectoral myopathy (DPM; binary trait), white striping (WS; 4 categories)...

  1. Hereditary vacuolar internal anal sphincter myopathy causing proctalgia fugax and constipation: a new case contribution.

    Science.gov (United States)

    de la Portilla, Fernando; Borrero, Juan José; Rafel, Enrique

    2005-03-01

    Hereditary anal sphincter myopathy is rare. We present a family with one affected member with proctalgia fugax, constipation and internal anal sphincter hypertrophy. Ultrastructural findings show vacuolization of smooth muscle cells without the characteristic polyglucosan inclusion. Further relief of symptoms was obtained using an oral calcium antagonist. Based on clinical presentation, endosonography and morphological findings, we consider our case is a histological variant of the vacuolar myopathy originally described.

  2. Statin induced myopathy presenting as mechanical musculoskeletal pain observed in two chiropractic patients

    OpenAIRE

    Rodine, Robert J; Tibbles, Anthony C; Kim, Peter SY; Alikhan, Neetan

    2010-01-01

    Lipid lowering drugs, such as statins, are commonly used to treat approximately 10 million Canadians affected by hypercholesterolemia. The most commonly experienced side-effect of statin medication is muscle pain. Statin induced myopathy consists of a spectrum of myopathic disorders ranging from mild myalgia to fatal rhabdomyolysis. The following is a presentation of 2 cases of statin induced myopathy in patients presenting in a chiropractic setting. In addition, discussion will surround the ...

  3. Dietary intervention rescues myopathy associated with neurofibromatosis type 1.

    Science.gov (United States)

    Summers, Matthew A; Rupasinghe, Thusitha; Vasiljevski, Emily R; Evesson, Frances J; Mikulec, Kathy; Peacock, Lauren; Quinlan, Kate GR; Cooper, Sandra T; Roessner, Ute; Stevenson, David A; Little, David G; Schindeler, Aaron

    2018-02-15

    Neurofibromatosis type 1 (NF1) is an autosomal dominant genetic disorder with complex symptomology. In addition to a predisposition to tumors, children with NF1 can present with reduced muscle mass, global muscle weakness, and impaired motor skills, which can have a significant impact on quality of life. Genetic mouse models have shown a lipid storage disease phenotype may underlie muscle weakness in NF1. Herein we confirm that biopsy specimens from six individuals with NF1 similarly manifest features of a lipid storage myopathy, with marked accumulation of intramyocellular lipid, fibrosis, and mononuclear cell infiltrates. Intramyocellular lipid was also correlated with reductions in neurofibromin protein expression by western analysis. An RNASeq profile of Nf1null muscle from a muscle-specific Nf1 knockout mouse (Nf1MyoD-/-) revealed alterations in genes associated with glucose regulation and cell signaling. Comparison by lipid mass spectrometry demonstrated that Nf1null muscle specimens were enriched for long chain fatty acid (LCFA) containing neutral lipids, such as cholesterol esters and triacylglycerides, suggesting fundamentally impaired LCFA metabolism. The subsequent generation of a limb-specific Nf1 knockout mouse (Nf1Prx1-/-) recapitulated all observed features of human NF1 myopathy, including lipid storage, fibrosis, and muscle weakness. Collectively, these insights led to the evaluation of a dietary intervention of reduced LCFAs, and enrichment of medium-chain fatty acids (MCFAs) with L-carnitine. Following 8-weeks of dietary treatment, Nf1Prx1-/- mice showed a 45% increase in maximal grip strength, and a 71% reduction in intramyocellular lipid staining compared with littermates fed standard chow. These data link NF1 deficiency to fundamental shifts in muscle metabolism, and provide strong proof of principal that a dietary intervention can ameliorate symptoms. © The Author(s) 2017. Published by Oxford University Press. All rights reserved. For

  4. SCLERAL AND CHOROIDAL THICKNESS IN SECONDARY HIGH AXIAL MYOPIA.

    Science.gov (United States)

    Shen, Ling; You, Qi Sheng; Xu, Xiaolin; Gao, Fei; Zhang, Zhibao; Li, Bin; Jonas, Jost B

    2016-08-01

    To assess differences in scleral and choroidal thickness between eyes with secondary high axial myopia caused by congenital glaucoma, eyes with primary high axial myopia, and nonhighly myopic eyes. The study consisted of 301 Chinese individuals with a mean age of 23.9 ± 22.6 years and mean axial length of 24.8 ± 4.2 mm. It included the "secondary highly myopic group" (SHMG) because of congenital glaucoma (n = 20 eyes; axial length >26.0 mm), the "primary highly myopic group" (PHMG) (n = 73; axial length >26.0 mm), and the remaining nonhighly myopic group (NHMG). The secondary highly myopic group versus the primary highly myopic group had significantly thinner sclera in the pars plana region (343 ± 71 μm versus 398 ± 83 μm; P = 0.006), whereas scleral thickness in other regions did not differ significantly between both highly myopic groups and was significantly thinner in both highly myopic groups than in the NHMG. Mean total scleral volume did not differ significantly (P > 0.20) between any group (SHMG: 659 ± 106 μm; PHMG: 667 ± 128 μm; NHMG: 626 ± 135 μm). Choroidal thickness was significantly thinner in both highly myopic groups than in the NHMG, with no significant differences between both highly myopic groups. Choroidal volume did not differ significantly (P > 0.40) between any of the groups (SHMG: 43 ± 12 μm; PHMG: 43 ± 13 μm; NHMG: 46 ± 17 μm). In secondary high axial myopia, the sclera gets thinner anterior and posterior to the equator; whereas in primary high axial myopia, scleral thinning is predominantly found posterior to the equator. Because volume of sclera and choroid did not differ between any group, scleral and choroidal thinning in myopia may be due to a rearrangement of tissue and not due to the new formation of tissue.

  5. White striping and woody breast myopathies in the modern poultry industry: a review.

    Science.gov (United States)

    Kuttappan, V A; Hargis, B M; Owens, C M

    2016-11-01

    Myopathies are gaining the attention of poultry meat producers globally. White Striping (WS) is a condition characterized by the occurrence of white striations parallel to muscle fibers on breast, thigh, and tender muscles of broilers, while Woody Breast (WB) imparts tougher consistency to raw breast fillets. Histologically, both conditions have been characterized with myodegeneration and necrosis, fibrosis, lipidosis, and regenerative changes. The occurrence of these modern myopathies has been associated with increased growth rate in birds. The severity of the myopathies can adversely affect consumer acceptance of raw cut up parts and/or quality of further processed poultry meat products, resulting in huge economic loss to the industry. Even though gross and/or histologic characteristics of modern myopathies are similar to some of the known conditions, such as hereditary muscular dystrophy, nutritional myopathy, toxic myopathies, and marbling, WS and WB could have a different etiology. As a result, there is a need for future studies to identify markers for WS and WB in live birds and genetic, nutritional, and/or management strategies to alleviate the condition. © 2016 Poultry Science Association Inc.

  6. Mutation Spectrum of GNE Myopathy in the Indian Sub-Continent.

    Science.gov (United States)

    Bhattacharya, Sudha; Khadilkar, Satish V; Nalini, Atchayaram; Ganapathy, Aparna; Mannan, Ashraf U; Majumder, Partha P; Bhattacharya, Alok

    GNE myopathy is an adult onset recessive genetic disorder that affects distal muscles sparing the quadriceps. GNE gene mutations have been identified in GNE myopathy patients all over the world. Homozygosity is a common feature in GNE myopathy patients worldwide. The major objective of this study was to investigate the mutation spectrum of GNE myopathy in India in relation to the population diversity in the country. We have collated GNE mutation data of Indian GNE myopathy patients from published literature and from recently identified patients. We also used data of people of Indian subcontinent from 1000 genomes database, South Asian Genome database and Strand Life Science database to determine frequency of GNE mutations in the general population. A total of 67 GNE myopathy patients were studied, of whom 21% were homozygous for GNE variants, while the rest were compound heterozygous. Thirty-five different mutations in the GNE gene were recorded, of which 5 have not been reported earlier. The most frequent mutation was p.Val727Met (65%) found mainly in the heterozygous form. Another mutation, p.Ile618Thr was also common (16%) but was found mainly in patients from Rajasthan, while p.Val727Met was more widely distributed. The latter was also seen at a high frequency in general population of Indian subcontinent in all the databases. It was also present in Thailand but was absent in general population elsewhere in the world. p.Val727Met is likely to be a founder mutation of Indian subcontinent.

  7. Axial Dispersion during Hanford Saltcake Washing

    International Nuclear Information System (INIS)

    Josephson, Gary B.; Geeting, John GH; Lessor, Delbert L.; Barton, William B.

    2006-01-01

    Clean up of Hanford salt cake wastes begins with dissolution retrieval of the sodium rich salts that make up the dominant majority of mass in the tanks. Water moving through the porous salt cake dissolves the soluble components and also displaces the soluble radionuclides (e.g. 137Cs and 99TcO4- ). The separation that occurs from this displacement, known as Selective dissolution, is an important component in Hanford?s pretreatment of low activity wastes for subsequent Supplemental treatment. This paper describes lab scale testing conducted to evaluate Selective dissolution of cesium from non-radioactive Hanford tank 241-S-112 salt cake simulant containing the primary chemicals found the actual tank. An modified axial dispersion model with increasing axial dispersion was developed to predict cesium removal. The model recognizes that water dissolves the salt cake during washing, which causes an increase in the axial dispersion during the wash. This model was subsequently compared with on-line cesium measurements from the retrieval of tank 241-S-112. The model had remarkably good agreement with both the lab scale and full scale data

  8. Dissipative axial inflation

    Energy Technology Data Exchange (ETDEWEB)

    Notari, Alessio [Departament de Física Fondamental i Institut de Ciències del Cosmos, Universitat de Barcelona, Martí i Franquès 1, Barcelona, 08028 Spain (Spain); Tywoniuk, Konrad, E-mail: notari@ffn.ub.es, E-mail: konrad.tywoniuk@cern.ch [Theoretical Physics Department, CERN, Geneva (Switzerland)

    2016-12-01

    We analyze in detail the background cosmological evolution of a scalar field coupled to a massless abelian gauge field through an axial term φ/ f {sub γ} F ∼ F , such as in the case of an axion. Gauge fields in this case are known to experience tachyonic growth and therefore can backreact on the background as an effective dissipation into radiation energy density ρ{sub R}, which can lead to inflation without the need of a flat potential. We analyze the system, for momenta k smaller than the cutoff f {sub γ}, including the backreaction numerically. We consider the evolution from a given static initial condition and explicitly show that, if f {sub γ} is smaller than the field excursion φ{sub 0} by about a factor of at least O (20), there is a friction effect which turns on before the field can fall down and which can then lead to a very long stage of inflation with a generic potential. In addition we find superimposed oscillations, which would get imprinted on any kind of perturbations, scalars and tensors. Such oscillations have a period of 4–5 efolds and an amplitude which is typically less than a few percent and decreases linearly with f {sub γ}. We also stress that the curvature perturbation on uniform density slices should be sensitive to slow-roll parameters related to ρ{sub R} rather than φ-dot {sup 2}/2 and we discuss the existence of friction terms acting on the perturbations, although we postpone a calculation of the power spectrum and of non-gaussianity to future work and we simply define and compute suitable slow roll parameters. Finally we stress that this scenario may be realized in the axion case, if the coupling 1/ f {sub γ} to U(1) (photons) is much larger than the coupling 1/ f {sub G} to non-abelian gauge fields (gluons), since the latter sets the range of the potential and therefore the maximal allowed φ{sub 0∼} f {sub G}.

  9. Three-dimensional magnetotelluric axial anisotropic forward modeling and inversion

    Science.gov (United States)

    Cao, Hui; Wang, Kunpeng; Wang, Tao; Hua, Boguang

    2018-06-01

    Magnetotelluric (MT) data has been widely used to image underground electrical structural. However, when the significant axial resistivity anisotropy presents, how this influences three-dimensional MT data has not been resolved clearly yet. We here propose a scheme for three-dimensional modeling of MT data in presence of axial anisotropic resistivity, where the electromagnetic fields are decomposed into primary and secondary components. A 3D staggered-grid finite difference method is then used to resolve the resulting 3D governing equations. Numerical tests have completed to validate the correctness and accuracy of the present algorithm. A limited-memory Broyden-Fletcher-Goldfarb-Shanno method is then utilized to realize the 3D MT axial anisotropic inversion. The testing results show that, compared to the results of isotropic resistivity inversion, taking account the axial anisotropy can much improve the inverted results.

  10. Experimental study on the influence of the rotating cylinder and circling pistons on churning losses in axial piston pumps

    OpenAIRE

    Zhang, Junhui; Li, Ying; Xu, Bing; Pan, Min; Lv, Fei

    2017-01-01

    Pressure and performance requirements of axial piston pumps and the proportion of churning losses in axial piston pumps increase significantly with increasing speed. To investigate the primary distribution of churning losses in axial piston pumps at various ranges of speed, a test rig was set up in which other friction losses can be eliminated, thus making it possible to investigate the net churning losses in an axial piston pump. The influence of the rotating cylinder block and pistons on ch...

  11. Diagnostic criteria for idiopathic inflammatory myopathies. Problems of their optimization

    Directory of Open Access Journals (Sweden)

    O. A. Antelava

    2014-01-01

    Full Text Available The paper deals with the problems of optimizing the diagnostic criteria for idiopathic inflammatory myopathies (IIM, a group of heterogeneous rare autoimmune diseases characterized by inflammatory lesion in the skeletal muscles. The representatives of this group are traditionally considered to be polymyositis (PM, dermatomyositis (DM, and inclusion-body myositis. The authors detail the history of classification criteria for IIM from those proposed by T.A. Medsger et al. (1970 relying on its clinical picture, laboratory data and instrumental findings, as well as the criteria (including the first introduced exclusion ones elaborated by A. Bohan and J.B. Peter in 1975, which remain fundamental in both clinical practice and researches. The basis for the clinical and serological criteria proposed by Y. Troyanov et al. (2005 for IIM is the identification of myositis-overlap syndromes. The classificational (subtype identification and therapeutic value of the criteria based on clinical and serological characteristics was supported by the Hungarian investigators A. Vancsa et al. (2010 who investigated the relationship between the clinical and therapeutic characteristics of IIM and positivity for myositis-specific and myositis-associated antibodies. The criteria developed by M.C. Dalakas (1991, 2003 are based on the specific immunopathological features of a histological pattern, which allow the differentiation of DM, PM, and inclusion-body myositis from other myopathic syndromes. The 2004 European Neuromuscular Center (ENMC criteria first identify necrotizing autoimmune myopathy and nonspecific myositis as individual subtypes. The serological classification of IIM, which is based onthe assessment of autoantibodies that play an important role in the pathogenesis of the disease, is of indubitable interest. There is an obvious need for the correct and timely diagnosis of both IIM as a whole and its subtypes in particular, which is complicated by

  12. Quantitative nailfold video capillaroscopy in patients with idiopathic inflammatory myopathy.

    Science.gov (United States)

    Mercer, Louise K; Moore, Tonia L; Chinoy, Hector; Murray, Andrea K; Vail, Andy; Cooper, Robert G; Herrick, Ariane L

    2010-09-01

    To quantify nailfold capillary density and dimensions in patients with idiopathic inflammatory myopathy (IIM) and compare them with those in healthy controls; to look for associations with microvascular disease in IIM; and to determine whether nailfold capillary density and dimensions change over time. Nailfold video microscopy (x300 magnification) was performed on 24 patients with IIM and 35 healthy controls. Capillary density and dimensions (total width and apical width) were quantified. Patients were clinically assessed and disease activity recorded using the Myositis Disease Activity Assessment Tool. Disease severity and physical function were assessed using the myositis damage index and Stanford HAQ, respectively. Findings were analysed using linear and logistic regression, adjusted for age and sex. In a subgroup of 16 patients with IIM and 27 controls, the process was repeated 6-12 months later and the results were analysed using Student's t-test. Capillary density was lower and dimensions were higher in patients with IIM compared with healthy controls (P nailfold capillaroscopy, suggesting that nailfold capillaroscopy may be useful as an outcome measure of microvascular disease in studies of IIM.

  13. Muscle sonography in six patients with hereditary inclusion body myopathy

    International Nuclear Information System (INIS)

    Adler, Ronald S.; Garolfalo, Giovanna; Paget, Stephen; Kagen, Lawrence

    2008-01-01

    To evaluate the morphological changes of muscle with sonography in six patients affected by hereditary inclusion body myopathy (HIBM). We studied a group of six Persian Jews diagnosed with HIBM. All were homozygous for the GNE mutation M712T. Ultrasonographic examinations of the quadriceps femoris and hamstring muscle groups were performed. A follow-up ultrasound examination was performed, after an interval of 3 years, in four of these patients. Muscles were assessed subjectively as to echogenicity, determined by gray-scale assessment, and loss of normal muscle morphology. Power Doppler sonography (PDS) was used to assess vascularity. A sonographic finding of central atrophy and peripheral sparing resulting in a target-like appearance was noted in the hamstring compartment of all six patients. The quadriceps compartment also showed involvement of the rectus femoris of all patients, which, in some cases, was the only muscle involved in the quadriceps. Vascularity was markedly reduced in the affected areas, with blood flow demonstrated in the peripherally spared areas. The severity of atrophy increased with disease duration. In this case series, we describe a new sonographic finding as well as document progression of HIBM disease, which has generally been described as quadriceps sparing. The myopathic target lesion, as well as isolated rectus femoris atrophy, may provide a useful adjunct to disease diagnosis. (orig.)

  14. Myopathy in CRPS-I: disuse or neurogenic?

    Science.gov (United States)

    Hulsman, Natalie M; Geertzen, Jan H B; Dijkstra, Pieter U; van den Dungen, Jan J A M; den Dunnen, Wilfred F A

    2009-08-01

    The diagnosis Complex Regional Pain Syndrome type I (CRPS-I) is based on clinical symptoms, including motor symptoms. Histological changes in muscle tissue may be present in the chronic phase of CRPS-I. Aim of this study was to analyze skeletal muscle tissue from amputated limbs of patients with CRPS-I, in order to gain more insight in factors that may play a role in changes in muscles in CRPS-I. These changes may be helpful in clarifying the pathophysiology of CRPS-I. Fourteen patients with therapy resistant and longstanding CRPS-I, underwent an amputation of the affected limb. In all patients histological analysis showed extensive changes in muscle tissue, such as fatty degeneration, fibre atrophy and nuclear clumping, which was not related to duration of CRPS-I prior to amputation. In all muscles affected, both type 1 and type 2 fibre atrophy was found, without selective type 2 fibre atrophy. In four patients, type grouping was observed, indicating a sequence of denervation and reinnervation of muscle tissue. In two patients even large group atrophy was present, suggesting new denervation after reinnervation. Comparison between subgroups in arms and legs showed no difference in the number of changes in muscle tissue. Intrinsic and extrinsic muscles were affected equally. Our findings show that in the chronic phase of CRPS-I extensive changes can be seen in muscle tissue, not related to duration of CRPS-I symptoms. Signs of neurogenic myopathy were present in five patients.

  15. OCULAR ASPECTS OF HYPERTHYROIDISM WITH SPECIAL REFERENCE TO OCULAR MYOPATHY

    Directory of Open Access Journals (Sweden)

    Mallika O. U

    2017-04-01

    Full Text Available BACKGROUND Hyperthyroidism can result in ocular manifestations even before systemic signs and symptoms develop. It is seen more in females and severe forms are more common in males. Early detection of ocular involvement can prevent vision threatening complications and troublesome discomforts affecting quality of vision. This clinical study highlights the importance of detailed ocular examination in hyperthyroidism. MATERIALS AND METHODS Fifty consecutive patients with ocular signs of hyperthyroidism were evaluated and followed up for an average period of 1 year. Detailed ocular examination included exophthalmometric measurements, ocular movements and Worth four-dot test. T3, T4, TSH, CT scan and antimicrosomal antibodies and antithyroglobulin antibodies were done along with routine investigations. Study Design- Prospective cohort study. RESULTS Statistical analysis did not reveal any correlation between the level of serum T3 and severity of ocular findings. Majority of the cases were euthyroid with moderate ocular myopathy having multiple muscle involvement. Inferior rectus was affected most. CONCLUSION The ocular signs of hyperthyroidism in the present study seem to be mild. The severe eye changes like corneal involvement and optic nerve changes were less common.

  16. [Statin associated myopathy in clinical practice. Results of DAMA study].

    Science.gov (United States)

    Millán, Jesús; Pedro-Botet, Juan; Climent, Elisenda; Millán, Joaquín; Rius, Joan

    Muscle symptoms, with or without elevation of creatin kinase are one of the main adverse effects of statin therapy, a fact that sometimes limits their use. The aim of this study was to evaluate the clinical characteristics of patients treated with statins who have complained muscle symptoms and to identify possible predictive factors. A cross-sectional one-visit, non-interventional, national multicenter study including patients of both sexes over 18 years of age referred for past or present muscle symptoms associated with statin therapy was conducted. 3,845 patients were recruited from a one-day record from 2,001 physicians. Myalgia was present in 78.2% of patients included in the study, myositis in 19.3%, and rhabdomyolysis in 2.5%. Patients reported muscle pain in 77.5% of statin-treated individuals, general weakness 42.7%, and cramps 28.1%. Kidney failure, intense physical exercise, alcohol consumption (>30g/d in men and 20g/d in women) and abdominal obesity were the clinical situations associated with statin myopathy. Myalgia followed by myositis are the most frequent statin-related side effects. It should be recommended control environmental factors such as intense exercise and alcohol intake as well as abdominal obesity and renal function of the patient treated with statins. Copyright © 2016 Sociedad Española de Arteriosclerosis. Publicado por Elsevier España, S.L.U. All rights reserved.

  17. Mutation update and genotype-phenotype correlations of novel and previously described mutations in TPM2 and TPM3 causing congenital myopathies

    NARCIS (Netherlands)

    Marttila, Minttu; Lehtokari, Vilma-Lotta; Marston, Steven; Nyman, Tuula A.; Barnerias, Christine; Beggs, Alan H.; Bertini, Enrico; Ceyhan-Birsoy, Ozge; Cintas, Pascal; Gerard, Marion; Gilbert-Dussardier, Brigitte; Hogue, Jacob S.; Longman, Cheryl; Eymard, Bruno; Frydman, Moshe; Kang, Peter B.; Klinge, Lars; Kolski, Hanna; Lochmüller, Hans; Magy, Laurent; Manel, Véronique; Mayer, Michèle; Mercuri, Eugenio; North, Kathryn N.; Peudenier-Robert, Sylviane; Pihko, Helena; Probst, Frank J.; Reisin, Ricardo; Stewart, Willie; Taratuto, Ana Lia; de Visser, Marianne; Wilichowski, Ekkehard; Winer, John; Nowak, Kristen; Laing, Nigel G.; Winder, Tom L.; Monnier, Nicole; Clarke, Nigel F.; Pelin, Katarina; Grönholm, Mikaela; Wallgren-Pettersson, Carina

    2014-01-01

    Mutations affecting skeletal muscle isoforms of the tropomyosin genes may cause nemaline myopathy, cap myopathy, core-rod myopathy, congenital fiber-type disproportion, distal arthrogryposes, and Escobar syndrome. We correlate the clinical picture of these diseases with novel (19) and previously

  18. Progressive Structural Defects in Canine Centronuclear Myopathy Indicate a Role for HACD1 in Maintaining Skeletal Muscle Membrane Systems.

    Science.gov (United States)

    Walmsley, Gemma L; Blot, Stéphane; Venner, Kerrie; Sewry, Caroline; Laporte, Jocelyn; Blondelle, Jordan; Barthélémy, Inès; Maurer, Marie; Blanchard-Gutton, Nicolas; Pilot-Storck, Fanny; Tiret, Laurent; Piercy, Richard J

    2017-02-01

    Mutations in HACD1/PTPLA cause recessive congenital myopathies in humans and dogs. Hydroxyacyl-coA dehydratases are required for elongation of very long chain fatty acids, and HACD1 has a role in early myogenesis, but the functions of this striated muscle-specific enzyme in more differentiated skeletal muscle remain unknown. Canine HACD1 deficiency is histopathologically classified as a centronuclear myopathy (CNM). We investigated the hypothesis that muscle from HACD1-deficient dogs has membrane abnormalities in common with CNMs with different genetic causes. We found progressive changes in tubuloreticular and sarcolemmal membranes and mislocalized triads and mitochondria in skeletal muscle from animals deficient in HACD1. Furthermore, comparable membranous abnormalities in cultured HACD1-deficient myotubes provide additional evidence that these defects are a primary consequence of altered HACD1 expression. Our novel findings, including T-tubule dilatation and disorganization, associated with defects in this additional CNM-associated gene provide a definitive pathophysiologic link with these disorders, confirm that dogs deficient in HACD1 are relevant models, and strengthen the evidence for a unifying pathogenesis in CNMs via defective membrane trafficking and excitation-contraction coupling in muscle. These results build on previous work by determining further functional roles of HACD1 in muscle and provide new insight into the pathology and pathogenetic mechanisms of HACD1 CNM. Consequently, alterations in membrane properties associated with HACD1 mutations should be investigated in humans with related phenotypes. Copyright © 2017 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  19. Differential effect of the rs4149056 variant in SLCO1B1 on myopathy associated with simvastatin and atorvastatin

    NARCIS (Netherlands)

    Brunham, L. R.; Lansberg, P. J.; Zhang, L.; Miao, F.; Carter, C.; Hovingh, G. K.; Visscher, H.; Jukema, J. W.; Stalenhoef, A. F.; Ross, C. J. D.; Carleton, B. C.; Kastelein, J. J. P.; Hayden, M. R.

    2012-01-01

    Statins reduce cardiovascular morbidity and mortality in appropriately selected patients. However, statin-associated myopathy is a significant risk associated with these agents. Recently, variation in the SLCO1B1 gene was reported to predict simvastatin-associated myopathy. The aim of this study was

  20. A note on axial symmetries

    International Nuclear Information System (INIS)

    Beetle, Christopher; Wilder, Shawn

    2015-01-01

    This note describes how to characterize and normalize an axial Killing field on a general Riemannian geometry or four-dimensional Lorentzian geometry. No global assumptions are necessary, such as that the orbits of the Killing field all have period 2π. Rather, any Killing field that vanishes at at least one point necessarily has the expected global properties. (note)

  1. Axial structure of the nucleon

    Energy Technology Data Exchange (ETDEWEB)

    Veronique Bernard; Latifa Elouadrhiri; Ulf-G Meissner

    2002-01-01

    We review the current status of experimental and theoretical understanding of the axial nucleon structure at low and moderate energies. Topics considered include (quasi)elastic (anti)neutrino-nucleon scattering, charged pion electroproduction off nucleons and ordinary as well as radiative muon capture on the proton.

  2. Technological quality, mineral profile, and sensory attributes of broiler chicken breasts affected by White Striping and Wooden Breast myopathies.

    Science.gov (United States)

    Tasoniero, G; Cullere, M; Cecchinato, M; Puolanne, E; Dalle Zotte, A

    2016-11-01

    The aim of the research was to study the impact of white striping and wooden breast myopathies on the technological quality, mineral, and sensory profile of poultry meat. With this purpose, a total of 138 breasts were selected for a control group with normal breasts (N), a group of breasts characterised by white striping (WS) myopathy, and a group of breasts having both white striping and wooden breast myopathies (WSWB). Data revealed that the simultaneous presence of the two myopathies, with respect to the WS lesion individually considered, had a further detrimental effect on pH (6.04 vs. 5.96; P white striping and wooden breast myopathies. © 2016 Poultry Science Association Inc.

  3. Lipid storage myopathy with clinical markers of Marfan syndrome: A rare association

    Directory of Open Access Journals (Sweden)

    Subasree Ramakrishnan

    2012-01-01

    Full Text Available Disorders of lipid metabolism can cause variable clinical presentations, often involving skeletal muscle, alone or together with other tissues. A 19-year-old boy presented with a 2-year history of muscle pain, cramps, exercise intolerance and progressive weakness of proximal lower limbs. Examination revealed skeletal markers of Marfan syndrome in the form of increased arm span compared with height, Kyphoscoliois, moderate pectus excavatum, high arched palate and wrist sign. He also had mild neck flexor weakness and proximal lower limb weakness with areflexia. Pathologic findings revealed lipid-laden fine vacuoles in the muscle fibers. Possibility of carnitine deficiency myopathy was considered and the patient was started on carnitine and Co Q. The patient made remarkable clinical improvement over the next 2 months. This case is reported for rarity of the association of clinical markers of Marfan syndrome and lipid storage myopathy and sparse literature on lipid storage myopathy in the Indian context.

  4. Muscle imaging in patients with tubular aggregate myopathy caused by mutations in STIM1

    DEFF Research Database (Denmark)

    Tasca, Giorgio; D'Amico, Adele; Monforte, Mauro

    2015-01-01

    Tubular aggregate myopathy is a genetically heterogeneous disease characterized by tubular aggregates as the hallmark on muscle biopsy. Mutations in STIM1 have recently been identified as one genetic cause in a number of tubular aggregate myopathy cases. To characterize the pattern of muscle...... involvement in this disease, upper and lower girdles and lower limbs were imaged in five patients with mutations in STIM1, and the scans were compared with two patients with tubular aggregate myopathy not caused by mutations in STIM1. A common pattern of involvement was found in STIM1-mutated patients...... of thigh and posterior leg with sparing of gracilis, tibialis anterior and, to a lesser extent, short head of biceps femoris. Mutations in STIM1 are associated with a homogeneous involvement on imaging despite variable clinical features. Muscle imaging can be useful in identifying STIM1-mutated patients...

  5. A novel mutation in PNPLA2 leading to neutral lipid storage disease with myopathy.

    Science.gov (United States)

    Ash, Daniel B; Papadimitriou, Dimitra; Hays, Arthur P; Dimauro, Salvatore; Hirano, Michio

    2012-09-01

    Mutations in PNPLA2, a gene encoding adipose triglyceride lipase, lead to neutral lipid storage disease with myopathy. To report the clinical and molecular features of a case of neutral lipid storage disease with myopathy resulting from a novel mutation in PNPLA2. Case report. University hospital. A 65-year-old man with progressive muscle weakness and high serum creatine kinase levels. Direct sequencing of the PNPLA2 gene. Identification of a novel homozygous mutation in the patient's PNPLA2 gene confirmed the suspected diagnosis of neutral lipid storage disease with myopathy. Screening of the PNPLA2 gene should be considered for patients presenting with high levels of creatine kinase, progressive muscle weakness, and systemic lipid accumulation. The presence of Jordans anomaly can be a strong diagnostic clue.

  6. Myopathy in hyperthyroidism as a consequence of rapid reduction of thyroid hormone: A case report.

    Science.gov (United States)

    Li, Qianrui; Liu, Yuping; Zhang, Qianying; Tian, Haoming; Li, Jianwei; Li, Sheyu

    2017-07-01

    Myalgia and elevated creatine kinase (CK) are occasionally observed during the treatment of hyperthyroid patients. Relative hypothyroidism resulted from rapid thyroid hormone reduction had been promoted as a plausible cause of these myopathic changes, however rarely reported. We hereby presented a 20-year-old female with Grave's disease, who developed myopathy and elevated CK during rapid correction of thyroid hormone. Relative hypothyroidism-induced myopathy. Antithyroid drug (ATD) dosage was reduced without levothyroxine replacement. The muscular symptoms were recovered with CK level returned to normal after adoption of the euthyroid status. Differentiation of relative hypothyroidism from other causes of myopathy, especially with the effect of ATD, is important for clinical practice, although difficult in many cases.

  7. Role of Autophagy in Glycogen Breakdown and Its Relevance to Chloroquine Myopathy

    Science.gov (United States)

    Zirin, Jonathan; Nieuwenhuis, Joppe; Perrimon, Norbert

    2013-01-01

    Several myopathies are associated with defects in autophagic and lysosomal degradation of glycogen, but it remains unclear how glycogen is targeted to the lysosome and what significance this process has for muscle cells. We have established a Drosophila melanogaster model to study glycogen autophagy in skeletal muscles, using chloroquine (CQ) to simulate a vacuolar myopathy that is completely dependent on the core autophagy genes. We show that autophagy is required for the most efficient degradation of glycogen in response to starvation. Furthermore, we show that CQ-induced myopathy can be improved by reduction of either autophagy or glycogen synthesis, the latter possibly due to a direct role of Glycogen Synthase in regulating autophagy through its interaction with Atg8. PMID:24265594

  8. Myopathy in hyperthyroidism as a consequence of rapid reduction of thyroid hormone

    Science.gov (United States)

    Li, Qianrui; Liu, Yuping; Zhang, Qianying; Tian, Haoming; Li, Jianwei; Li, Sheyu

    2017-01-01

    Abstract Rationale: Myalgia and elevated creatine kinase (CK) are occasionally observed during the treatment of hyperthyroid patients. Relative hypothyroidism resulted from rapid thyroid hormone reduction had been promoted as a plausible cause of these myopathic changes, however rarely reported. Patient concerns: We hereby presented a 20-year-old female with Grave's disease, who developed myopathy and elevated CK during rapid correction of thyroid hormone. Diagnoses: Relative hypothyroidism-induced myopathy. Interventions: Antithyroid drug (ATD) dosage was reduced without levothyroxine replacement. Outcomes: The muscular symptoms were recovered with CK level returned to normal after adoption of the euthyroid status. Lessons: Differentiation of relative hypothyroidism from other causes of myopathy, especially with the effect of ATD, is important for clinical practice, although difficult in many cases. PMID:28746208

  9. Identification of methylenecyclopropyl acetic acid in serum of European horses with atypical myopathy.

    Science.gov (United States)

    Votion, D-M; van Galen, G; Sweetman, L; Boemer, F; de Tullio, P; Dopagne, C; Lefère, L; Mouithys-Mickalad, A; Patarin, F; Rouxhet, S; van Loon, G; Serteyn, D; Sponseller, B T; Valberg, S J

    2014-03-01

    It is hypothesised that European atypical myopathy (AM) has a similar basis as seasonal pasture myopathy in North America, which is now known to be caused by ingestion of hypoglycin A contained in seeds from the tree Acer negundo. Serum from horses with seasonal pasture myopathy contained the conjugated toxic metabolite of hypoglycin A, methylenecyclopropyl acetic acid (MCPA). Retrospective study on archived samples. 1) To determine whether MCPA-carnitine was present in serum of European horses confirmed to have AM; 2) to determine whether Acer negundo or related Acer species were present on AM pastures in Europe. Concentrations of MCPA-carnitine were analysed in banked serum samples of 17 AM horses from Europe and 3 diseased controls (tetanus, neoplasia and exertional rhabdomyolysis) using tandem mass spectrometry. Atypical myopathy was diagnosed by characteristic serum acylcarnitine profiles. Pastures of 12 AM farms were visited by experienced botanists and plant species were documented. Methylenecyclopropyl acetic acid-carnitine at high concentrations (20.39 ± 17.24 nmol/l; range 0.95-57.63 nmol/l; reference: <0.01 nmol/l) was identified in serum of AM but not disease controls (0.00 ± 0.00 nmol/l). Acer pseudoplatanus but not Acer negundo was present on all AM farms. Atypical myopathy in Europe, like seasonal pasture myopathy in North America, is highly associated with the toxic metabolite of hypoglycin A, MCPA-carnitine. This finding coupled with the presence of a tree of which seeds are known to also contain hypoglycin A indicates that ingestion of Acer pseudoplatanus is the probable cause of AM. This finding has major implications for the prevention of AM. © 2013 EVJ Ltd.

  10. Lipid myopathy associated with renal tubular acidosis and spastic diplegia in two brothers.

    Science.gov (United States)

    Tung, Y C; Tsau, Y K; Chu, L W; Young, C; Shen, Y Z

    2001-07-01

    Lipid myopathy is a group of disorders involving mitochondrial fatty acid oxidation. We describe two brothers, 3 years 8 months old and 2 years 9 months old, respectively, with progressive spastic diplegia, developmental delay, failure to thrive, and chronic metabolic acidosis who had lipid myopathy and renal tubular acidosis. Brain magnetic resonance imaging revealed demyelinating changes in the periventricular white matter, which was compatible with spastic diplegia. These symptoms may be related to errors in fatty acid metabolism. Cerebral palsy had been misdiagnosed in both of these patients at another hospital. Therefore, for patients with late-onset and progressive spastic diplegia, detailed investigations for underlying diseases are warranted.

  11. Collagen XII myopathy with rectus femoris atrophy and collagen XII retention in fibroblasts

    DEFF Research Database (Denmark)

    Witting, Nanna; Krag, Thomas; Werlauff, Ulla

    2018-01-01

    INTRODUCTION: Mutation in the collagen XII gene (COL12A1) was recently reported to induce Bethlem myopathy. We describe a family affected by collagen XII-related myopathy in 3 generations. METHODS: Systematic interview, clinical examination, skin biopsies, and MRI of muscle were used. RESULTS...... affection and abnormal collagen XII retention in fibroblasts. MRI disclosed a selective wasting of the rectus femoris muscle. DISCUSSION: COL12A1 mutations should be considered in patients with a mild Bethlem phenotype who present with selective wasting of the rectus femoris, absence of the outside......-in phenomenon on MRI, and abnormal collagen XII retention in fibroblasts. Muscle Nerve, 2018....

  12. Phenotypes, genotypes, and prevalence of congenital myopathies older than 5 years in Denmark

    DEFF Research Database (Denmark)

    Witting, Nanna; Werlauff, Ulla; Duno, Morten

    2017-01-01

    .3% NEB mutations. Less than 5% had mutations in ACTA1, TPM2/3, MTM1, TTN, SEPN1, or SC4NA. A genetic cause was established in 83% with specific histology (cores/rods/centronuclear myopathy) vs 29% with unspecific histology. The detailed clinical examination found gene-dependent discrepancies...... in the pattern of muscle affection and walking ability. Although walking ability was delayed in patients with ACTA1, TPM2/3, and RYR1 mutations, it was within normal limits in patients with NEB and DNM2 mutations. CONCLUSIONS: We found that overall, genetic and histologic prevalence of congenital myopathy...

  13. Treatment of critical illness polyneuropathy and/or myopathy - a systematic review

    DEFF Research Database (Denmark)

    Ydemann, Mogens; Eddelien, Heidi Shil; Lauritsen, Anne Øberg

    2012-01-01

    The objective was to search the literature with a view to providing a general description of critical illness myopathy/polyneuropathy (CIM/CIP), including its genesis and prevention. Furthermore, it was our aim to determine whether new treatments have occurred in the past five years.......The objective was to search the literature with a view to providing a general description of critical illness myopathy/polyneuropathy (CIM/CIP), including its genesis and prevention. Furthermore, it was our aim to determine whether new treatments have occurred in the past five years....

  14. Autophagy, inflammation and innate immunity in inflammatory myopathies.

    Directory of Open Access Journals (Sweden)

    Cristina Cappelletti

    Full Text Available Autophagy has a large range of physiological functions and its dysregulation contributes to several human disorders, including autoinflammatory/autoimmune diseases such as inflammatory myopathies (IIMs. In order to better understand the pathogenetic mechanisms of these muscular disorders, we sought to define the role of autophagic processes and their relation with the innate immune system in the three main subtypes of IIM, specifically sporadic inclusion body myositis (sIBM, polymyositis (PM, dermatomyositis (DM and juvenile dermatomyositis (JDM. We found that although the mRNA transcript levels of the autophagy-related genes BECN1, ATG5 and FBXO32 were similar in IIM and controls, autophagy activation in all IIM subgroups was suggested by immunoblotting results and confirmed by immunofluorescence. TLR4 and TLR3, two potent inducers of autophagy, were highly increased in IIM, with TLR4 transcripts significantly more expressed in PM and DM than in JDM, sIBM and controls, and TLR3 transcripts highly up-regulated in all IIM subgroups compared to controls. Co-localization between autophagic marker, LC3, and TLR4 and TLR3 was observed not only in sIBM but also in PM, DM and JDM muscle tissues. Furthermore, a highly association with the autophagic processes was observed in all IIM subgroups also for some TLR4 ligands, endogenous and bacterial HSP60, other than the high-mobility group box 1 (HMGB1. These findings indicate that autophagic processes are active not only in sIBM but also in PM, DM and JDM, probably in response to an exogenous or endogenous 'danger signal'. However, autophagic activation and regulation, and also interaction with the innate immune system, differ in each type of IIM. Better understanding of these differences may lead to new therapies for the different IIM types.

  15. Axial magnetic field produced by axially and radially magnetized permanent rings

    International Nuclear Information System (INIS)

    Peng, Q.L.; McMurry, S.M.; Coey, J.M.D.

    2004-01-01

    Axial magnetic fields produced by axially and radially magnetized permanent magnet rings were studied. First, the axial magnetic field produced by a current loop is introduced, from which the axial field generated by an infinitely thin solenoid and by an infinitely thin current disk can be derived. Then the axial fields produced by axially and by radially magnetized permanent magnet rings can be obtained. An analytic formula for the axial fields produced by two axially magnetized rings is given. A permanent magnet with a high axial gradient field is fabricated, the measured results agree with the theoretical calculation very well. As an example, the axial periodic field produced by an arrangement of alternating axially and radially magnetized rings has been discussed

  16. View of the Axial Field Spectrometer

    CERN Multimedia

    1980-01-01

    The Axial Field Spectrometer, with the vertical uranium/scintillator calorimeter and the central drift chamber retracted for service. One coil of the Open Axial Field Magnet is just visible to the right.

  17. Axial-Centrifugal Compressor Program

    Science.gov (United States)

    1975-10-01

    Assembly . .. . .... ..... 33 5 Tie Bolt...... .. .. .. .. . *.. .. .. .. .. .. ... 34 6 Axial Compressor Rotor Assembly Runouts . . .. . 34 7 CCV Blow...1.796 Impeller Slip Factor ’Ce2/U 2 ) .91 Impeller Wheel Speed ft/sec 1992.2 Impellet ’.ip Radius in. 3.780 Blade Tip Metal Angle- deg 0 Numbec of Blades...test item to the next Phase V component test. The test vehicle final balance levels and rotor runouts were normal at teardown, and no rubsI were

  18. Absence of anti-HMG-CoA reductase autoantibodies in severe self-limited statin-related myopathy.

    Science.gov (United States)

    Floyd, James S; Brody, Jennifer A; Tiniakou, Eleni; Psaty, Bruce M; Mammen, Andrew

    2016-06-01

    Patients with self-limited statin-related myopathy improve spontaneously when statins are stopped. In contrast, patients with statin-associated autoimmune myopathy have autoantibodies recognizing 3-hydroxy-3-methyl-glutaryl-coenzyme A reductase (HMGCR) and usually require immunosuppressive therapy to control their disease. On initial presentation, it can sometimes be difficult to distinguish between these 2 diseases, as both present with muscle pain, weakness, and elevated serum creatine kinase (CK) levels. The goal of this study was to determine whether patients with severe self-limited statin-related myopathy also make anti-HMGCR autoantibodies. We screened 101 subjects with severe self-limited cerivastatin-related myopathy for anti-HMGCR autoantibodies. No patient with severe self-limited cerivastatin-related myopathy had anti-HMGCR autoantibodies. Anti-HMGCR autoantibody testing can be used to help differentiate whether a patient has self-limited myopathy due to cerivastatin or autoimmune statin-associated myopathy; these findings may apply to other statins as well. Muscle Nerve 54: 142-144, 2016. © 2016 Wiley Periodicals, Inc.

  19. The heart in Becker muscular dystrophy, facioscapulohumeral dystrophy, and Bethlem myopathy

    NARCIS (Netherlands)

    de Visser, M.; de Voogt, W. G.; la Rivière, G. V.

    1992-01-01

    We report a study, assessing involvement of the heart in 33 familial cases of Becker muscular dystrophy (BMD), 31 familiar cases of facioscapulohumeral (FSH) dystrophy, and 27 familial cases of Bethlem myopathy. In the patients with BMD, correlations of myocardial involvement with age and extent of

  20. Management of cases suffering from atypical myopathy: interpretations of descriptive, epidemiological and pathophysiological findings

    DEFF Research Database (Denmark)

    van Galen Verwilghen, Gaby; Votion, D.-M.

    2013-01-01

    Atypical myopathy is highly fatal, but about a quarter of affected horses survive. This highlights the need for provision of supportive treatment for these cases. This review is a practical guideline for equine practitioners and includes suggestions for close monitoring of involved organ systems ...

  1. Acquired multiple Acyl-CoA dehydrogenase deficiency in 10 horses with atypical myopathy

    NARCIS (Netherlands)

    Westermann, C. M.; Dorland, L.; Votion, D. M.; de Sain-van der Velden, M. G. M.; Wijnberg, I. D.; Wanders, R. J. A.; Spliet, W. G. M.; Testerink, N.; Berger, R.; Ruiter, J. P. N.; van der Kolk, J. H.

    2008-01-01

    The aim of the current study was to assess lipid metabolism in horses with atypical myopathy. Urine samples from 10 cases were subjected to analysis of organic acids, glycine conjugates, and acylcarnitines revealing increased mean excretion of lactic acid, ethylmalonic acid, 2-methylsuccinic acid,

  2. [External progressive ophthalmoplegia secondary to mitochondrial myopathy. Report of a case and review of the literature].

    Science.gov (United States)

    Calderón-Garcidueñas, A L; Pérez-Loria, O; Alberto-Sagástegui, J; Farías-García, R

    2000-01-01

    Progressive limitation of occular motility, accompanied by ptosis but usually without diplopia, occurs in many pathologic states, including mitochondrial diseases. A case with chronic progressive external ophthalmoplegia with onset during childhood, associated with proximal myopathy and dysphasia is presented. The muscle biopsy showed a myopathic pattern and abnormal subsarcolemmal mitochondrial deposits. Muscle biopsy for important in the correct diagnosis of this entity.

  3. Congenital myotonic myopathy in the miniature schnauzer: an autosomal recessive trait.

    Science.gov (United States)

    Vite, C H; Melniczek, J; Patterson, D; Giger, U

    1999-01-01

    Myotonia is a clinical sign characterized by a delay in skeletal muscle relaxation following electrical or mechanical stimulation. A series of related miniature schnauzer dogs with congenital myotonic myopathy were studied. A composite pedigree of six affected litters and the results of a planned breeding between two affected animals are consistent with an autosomal recessive mode of inheritance.

  4. Suspected myofibrillar myopathy in Arabian horses with a history of exertional rhabdomyolysis.

    Science.gov (United States)

    Valberg, S J; McKenzie, E C; Eyrich, L V; Shivers, J; Barnes, N E; Finno, C J

    2016-09-01

    Although exertional rhabdomyolysis (ER) is common in Arabian horses, there are no dedicated studies describing histopathological characteristics of muscle from Arabian horses with ER. To prospectively identify distinctive histopathological features of muscle from Arabian endurance horses with a history of ER (pro-ER) and to retrospectively determine their prevalence in archived samples from Arabian horses with exertional myopathies (retro-ER). Prospective and retrospective histopathological description. Middle gluteal muscle biopsies obtained from Arabian controls (n = 14), pro-ER (n = 13) as well as archived retro-ER (n = 25) muscle samples previously classified with type 2 polysaccharide storage myopathy (15/25), recurrent exertional rhabdomyolysis (7/25) and no pathology (3/25) were scored for histopathology and immunohistochemical staining of cytoskeletal proteins. Glutaraldehyde-fixed samples (2 pro-ER, one control) were processed for electron microscopy. Pro-ER and retro-ER groups were compared with controls using Mann-Whitney U and Fisher's exact tests. Centrally located myonuclei in mature myofibres were found in significantly more (Prhabdomyolysis, ectopic accumulation of cytoskeletal proteins and Z-disc degeneration bear a strong resemblance to a myofibrillar myopathy. While many of these horses were previously diagnosed with type 2 polysaccharide storage myopathy, pools of glycogen forming within disrupted myofibrils appeared to give the false appearance of a glycogen storage disorder. © 2015 EVJ Ltd.

  5. Atypical myopathy in Denmark confirmed with the aTRAQ assay

    DEFF Research Database (Denmark)

    Høffer, Sofie Esbjørn; Votion, Dominique-Marie; Anderberg, Marie

    2016-01-01

    Atypical myopathy is a severe form of rhabdomyolysis that occurs in grazing horses. Over the past decades, the disease has been emerging in Europe. The disease is widespread in Europe and has been suspected in Denmark since 2000, yet no cases have been confirmed. The objective of this study...

  6. Evaluating the Atrial Myopathy Underlying Atrial Fibrillation: Identifying the Arrhythmogenic and Thrombogenic Substrate

    Science.gov (United States)

    Goldberger, Jeffrey J.; Arora, Rishi; Green, David; Greenland, Philip; Lee, Daniel C.; Lloyd-Jones, Donald M.; Markl, Michael; Ng, Jason; Shah, Sanjiv J.

    2015-01-01

    Atrial disease or myopathy forms the substrate for atrial fibrillation (AF) and underlies the potential for atrial thrombus formation and subsequent stroke. Current diagnostic approaches in patients with AF focus on identifying clinical predictors with evaluation of left atrial size by echocardiography serving as the sole measure specifically evaluating the atrium. Although the atrial substrate underlying AF is likely developing for years prior to the onset of AF, there is no current evaluation to identify the pre-clinical atrial myopathy. Atrial fibrosis is one component of the atrial substrate that has garnered recent attention based on newer MRI techniques that have been applied to visualize atrial fibrosis in humans with prognostic implications regarding success of treatment. Advanced ECG signal processing, echocardiographic techniques, and MRI imaging of fibrosis and flow provide up-to-date approaches to evaluate the atrial myopathy underlying AF. While thromboembolic risk is currently defined by clinical scores, their predictive value is mediocre. Evaluation of stasis via imaging and biomarkers associated with thrombogenesis may provide enhanced approaches to assess risk for stroke in patients with AF. Better delineation of the atrial myopathy that serves as the substrate for AF and thromboembolic complications might improve treatment outcomes. Furthermore, better delineation of the pathophysiologic mechanisms underlying the development of the atrial substrate for AF, particularly in its earlier stages, could help identify blood and imaging biomarkers that could be useful to assess risk for developing new onset AF and suggest specific pathways that could be targeted for prevention. PMID:26216085

  7. Effects of ubiquinone (coenzyme Q10) on myopathy in statin users.

    NARCIS (Netherlands)

    Schaars, C.F.; Stalenhoef, A.F.H.

    2008-01-01

    PURPOSE OF REVIEW: Statins are associated with muscle complaints, including myositis. The mechanism through which statin use causes muscle toxicity is unknown. One of the theories is that statin therapy reduces coenzyme Q10 levels in muscle mitochondria, which leads to muscle injury and myopathy.

  8. Whole-body MRI in adult inflammatory myopathies: Do we need imaging of the trunk?

    International Nuclear Information System (INIS)

    Filli, Lukas; Manoliu, Andrei; Andreisek, Gustav; Guggenberger, Roman; Maurer, Britta

    2015-01-01

    To evaluate whether imaging of the trunk could be omitted in patients with inflammatory myopathies without losing diagnostic accuracy using a restricted whole-body magnetic resonance imaging (rWB-MRI) protocol. After approval by the institutional review board, this study was performed in 63 patients (male/female, 13/50; median age, 52 years; range, 20-81 years) with new-onset myopathic symptoms (group 1, n = 41) or previously diagnosed inflammatory myopathy (group 2, n = 22). After performing whole-body MRI (WB-MRI) at 3.0 Tesla, myositis and fatty atrophy were evaluated in different muscles by two independent radiologists. The intra-class correlation coefficient (ICC) was calculated to evaluate inter-observer reliability. Acquisition time was 56:01 minutes for WB-MRI and 37:37 minutes (32.8 % shorter) for rWB-MRI. In group 1, 14 patients were diagnosed with inflammatory myopathy based on muscle biopsy. rWB-MRI and WB-MRI showed equal sensitivity (42.9 %) and specificity (100 %) for myositis, and showed equal sensitivity (71.4 %) and similar specificity (63.0 % and 48.1 %, respectively) for fatty atrophy. No myositis was found in the body trunk in any patient. Inter-observer reliability was between substantial and perfect (ICC, 0.77-1.00). rWB-MRI showed diagnostic accuracy similar to WB-MRI for inflammatory myopathy at markedly reduced overall acquisition time. (orig.)

  9. Whole-body MRI in adult inflammatory myopathies: Do we need imaging of the trunk?

    Energy Technology Data Exchange (ETDEWEB)

    Filli, Lukas; Manoliu, Andrei; Andreisek, Gustav; Guggenberger, Roman [University Hospital Zurich, University of Zurich, Institute of Diagnostic and Interventional Radiology, Zurich (Switzerland); Maurer, Britta [University Hospital Zurich, University of Zurich, Division of Rheumatology, Zurich (Switzerland)

    2015-12-15

    To evaluate whether imaging of the trunk could be omitted in patients with inflammatory myopathies without losing diagnostic accuracy using a restricted whole-body magnetic resonance imaging (rWB-MRI) protocol. After approval by the institutional review board, this study was performed in 63 patients (male/female, 13/50; median age, 52 years; range, 20-81 years) with new-onset myopathic symptoms (group 1, n = 41) or previously diagnosed inflammatory myopathy (group 2, n = 22). After performing whole-body MRI (WB-MRI) at 3.0 Tesla, myositis and fatty atrophy were evaluated in different muscles by two independent radiologists. The intra-class correlation coefficient (ICC) was calculated to evaluate inter-observer reliability. Acquisition time was 56:01 minutes for WB-MRI and 37:37 minutes (32.8 % shorter) for rWB-MRI. In group 1, 14 patients were diagnosed with inflammatory myopathy based on muscle biopsy. rWB-MRI and WB-MRI showed equal sensitivity (42.9 %) and specificity (100 %) for myositis, and showed equal sensitivity (71.4 %) and similar specificity (63.0 % and 48.1 %, respectively) for fatty atrophy. No myositis was found in the body trunk in any patient. Inter-observer reliability was between substantial and perfect (ICC, 0.77-1.00). rWB-MRI showed diagnostic accuracy similar to WB-MRI for inflammatory myopathy at markedly reduced overall acquisition time. (orig.)

  10. RYR1-related myopathies: a wide spectrum of phenotypes throughout life

    NARCIS (Netherlands)

    Snoeck, M.; Engelen, B.G.M. van; Kusters, B.; Lammens, M.M.; Meijer, R.; Molenaar, J.P.F.; Raaphorst, J.; Verschuuren-Bemelmans, C.C.; Straathof, C.S.; Sie, L.T.L.; Coo, I.F.M. de; Pol, W.L. van der; Visser, M de; Scheffer, H.; Treves, S.; Jungbluth, H.; Voermans, N.C.; Kamsteeg, E.J.

    2015-01-01

    BACKGROUND AND PURPOSE: Although several recent studies have implicated RYR1 mutations as a common cause of various myopathies and the malignant hyperthermia susceptibility (MHS) trait, many of these studies have been limited to certain age groups, confined geographical regions or specific

  11. Management of cases suffering from atypical myopathy: interpretations of descriptive, epidemiological and pathophysiological findings

    DEFF Research Database (Denmark)

    van Galen Verwilghen, Gaby; Votion, D.-M.

    2013-01-01

    Atypical myopathy is highly fatal, but about a quarter of affected horses survive. This highlights the need for provision of supportive treatment for these patients. This review is a practical guideline for equine practitioners and includes suggestions for close monitoring of involved organ systems...

  12. Leiomodin-3-deficient mice display nemaline myopathy with fast-myofiber atrophy

    Directory of Open Access Journals (Sweden)

    Lei Tian

    2015-06-01

    Full Text Available Nemaline myopathy (NM is one of the most common forms of congenital myopathy, and affects either fast myofibers, slow myofibers, or both. However, an animal model for congenital myopathy with fast-myofiber-specific atrophy is not available. Furthermore, mutations in the leiomodin-3 (LMOD3 gene have recently been identified in a group of individuals with NM. However, it is not clear how loss of LMOD3 leads to NM. Here, we report a mouse mutant in which the piggyBac (PB transposon is inserted into the Lmod3 gene and disrupts its expression. Lmod3PB/PB mice show severe muscle weakness and postnatal growth retardation. Electron microscopy and immunofluorescence studies of the mutant skeletal muscles revealed the presence of nemaline bodies, a hallmark of NM, and disorganized sarcomeric structures. Interestingly, Lmod3 deficiency caused muscle atrophy specific to the fast fibers. Together, our results show that Lmod3 is required in the fast fibers for sarcomere integrity, and this study offers the first NM mouse model with muscle atrophy that is specific to fast fibers. This model could be a valuable resource for interrogating myopathy pathogenesis and developing therapeutics for NM as well as other pathophysiological conditions with preferential atrophy of fast fibers, including cancer cachexia and sarcopenia.

  13. Hypoglycin A in maple trees in the Netherlands and the risk of equine atypical myopathy

    NARCIS (Netherlands)

    Westermann, C.M.; van Leeuwen, Robbert; Mol, Hans

    2016-01-01

    The Acer (maple) genus of trees comprises over 120 species worldwide. Some of these contain the plant-toxin hypoglycin-A which has been proven to be a cause of the highly fatal condition called atypical myopathy (AM) in horses and ponies. In an earlier study of maple-tree samples (leaves and seeds)

  14. Autosomal dominant distal myopathy due to a novel ACTA1 mutation.

    Science.gov (United States)

    Liewluck, Teerin; Sorenson, Eric J; Walkiewicz, Magdalena A; Rumilla, Kandelaria M; Milone, Margherita

    2017-08-01

    Mutations in skeletal muscle α-actin 1-encoding gene (ACTA1) cause autosomal dominant or recessive myopathies with marked clinical and pathological heterogeneity. Patients typically develop generalized or limb-girdle pattern of weakness, but recently a family with scapuloperoneal myopathy was reported. We describe a father and 2 children with childhood-to-juvenile onset distal myopathy, carrying a novel dominant ACTA1 variant, c.757G>C (p.Gly253Arg). Father had delayed motor development and developed significant proximal weakness later in life; he was initially misdiagnosed as having spinal muscular atrophy based on electromyographic findings. His children had predominant anterior distal leg and finger extensor involvement. Nemaline rods were abundant on the daughter's biopsy, absent on the father's initial biopsy, and extremely rare on the father's subsequent biopsy a decade later. The father's second biopsy also showed myofibrillar pathology and rare fibers with actin filament aggregates. The present family expands the spectrum of actinopathy to include a distal myopathy. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Fatigue in patients with spinal muscular atrophy type II and congenital myopathies

    DEFF Research Database (Denmark)

    Werlauff, Ulla; Højberg, A; Firla-Holme, R

    2014-01-01

    PURPOSE: The aim of this study was to evaluate whether the fatigue severity scale (FSS) is an appropriate instrument to assess fatigue in patients with spinal muscular atrophy type II (SMA II) and congenital myopathies (CM). METHODS: FSS and visual analog scale (VAS) were administered to 33 SMA II...

  16. Triacylglycerol infusion improves exercise endurance in patients with mitochondrial myopathy due to complex I deficiency

    NARCIS (Netherlands)

    Roef, MJ; de Meer, K; Reijngoud, DJ; Straver, HWHC; de Barse, M; Kalhan, SC; Berger, R

    Background: A high-fat diet has been recommended for the treatment of patients with mitochondrial myopathy due to complex I (NADH dehydrogenase) deficiency (CID). Objective: This study evaluated the effects of intravenous infusion of isoenergetic amounts of triacylglycerol or glucose on substrate

  17. Ileocolonic transfer of solid chyme in small intestinal neuropathies and myopathies

    Energy Technology Data Exchange (ETDEWEB)

    Greydanus, M.P.; Camilleri, M.; Colemont, L.J.; Phillips, S.F.; Brown, M.L.; Thomforde, G.M. (Mayo Clinic and Foundation, Rochester, MN (USA))

    1990-07-01

    The aims of this study were to assess gastric emptying, small bowel transit and colonic filling in patients with motility disorders, with particular attention to the patterns of colonic filling. Gastrointestinal transit was assessed using a previously validated radiolabeled mixed meal. Fourteen patients with clinical and manometric features of chronic intestinal pseudoobstruction classified as intestinal neuropathy and 6 as intestinal myopathy, were studied. The results were compared with those from 10 healthy controls studied similarly. Gastric emptying and small bowel transit of solids were significantly slower in both groups of patients than in healthy controls (P less than 0.05). In health, the ileocolonic transit of solid chyme was characterized by intermittent bolus transfers. The mean size of boluses transferred to the colon (expressed as a percentage of ingested radiolabel) was significantly less (P less than 0.05) in patients with intestinal myopathy (10% +/- 4% (SEM)) than in healthy controls (25% +/- 4%) or in patients with intestinal neuropathy (25% +/- 4%). The intervals between bolus transfer of solids (plateaus in the colonic filling curve) were longer (P less than 0.05) in myopathies (212 +/- 89 minutes) than in health (45 +/- 7 minutes) or neuropathies (53 +/- 11 minutes). Thus, gastric emptying and small bowel transit were delayed in small bowel neuropathies and myopathies. Bolus filling of the colon was less frequent and less effective in patients with myopathic intestinal pseudoobstruction, whereas bolus transfer was preserved in patients with neuropathic intestinal pseudoobstruction.

  18. The Impact of Exercise on Statin-Associated Skeletal Muscle Myopathy

    Science.gov (United States)

    Chung, Hae R.; Vakil, Mayand; Munroe, Michael; Parikh, Alay; Meador, Benjamin M.; Wu, Pei T.; Jeong, Jin H.; Woods, Jeffrey A.; Wilund, Kenneth R.; Boppart, Marni D.

    2016-01-01

    HMG-CoA reductase inhibitors (statins) are the most effective pharmacological means of reducing cardiovascular disease risk. The most common side effect of statin use is skeletal muscle myopathy, which may be exacerbated by exercise. Hypercholesterolemia and training status are factors that are rarely considered in the progression of myopathy. The purpose of this study was to determine the extent to which acute and chronic exercise can influence statin-induced myopathy in hypercholesterolemic (ApoE-/-) mice. Mice either received daily injections of saline or simvastatin (20 mg/kg) while: 1) remaining sedentary (Sed), 2) engaging in daily exercise for two weeks (novel, Nov), or 3) engaging in daily exercise for two weeks after a brief period of training (accustomed, Acct) (2x3 design, n = 60). Cholesterol, activity, strength, and indices of myofiber damage and atrophy were assessed. Running wheel activity declined in both exercise groups receiving statins (statin x time interaction, pstatin treatment (statin main effect, pstatin x exercise interaction, pstatin treatment. Exercise (Acct and Nov) increased atrogin-1 mRNA in combination with statin treatment, yet enhanced fiber damage or atrophy was not observed. The results from this study suggest that exercise (Nov, Acct) does not exacerbate statin-induced myopathy in ApoE-/- mice, yet statin treatment reduces activity in a manner that prevents muscle from mounting a beneficial adaptive response to training. PMID:27936249

  19. Statin-Associated Autoimmune Myopathy: A Systematic Review of 100 Cases.

    Science.gov (United States)

    Nazir, Salik; Lohani, Saroj; Tachamo, Niranjan; Poudel, Dilliram; Donato, Anthony

    2017-04-01

    Statins are a group of drugs that reduce the levels of triglycerides and cholesterol in blood by inhibiting HMG-CoA reductase, an enzyme involved in rate limiting step in cholesterol synthesis. About 2-20% patients on statins develop toxic myopathies, which usually resolve on discontinuation of statin. More recently, an immune-mediated necrotizing myopathy has been found to be associated with statin use which in most cases requires treatment with immunosuppressants. To perform a systematic review on published case reports and case series of statin-associated autoimmune myopathy. A comprehensive search of PUBMED, EMBASE, Cochrane library and ClinicalTrials.gov databases was performed for relevant articles from inception until March 19, 2016 to identify cases of statin-associated necrotizing myopathy and characterize their symptoms, evaluation and response to treatment. A total of 16 articles describing 100 patients with statin-associated autoimmune myopathy were identified. The mean age of presentation was 64.72 years, and 54.44% were males. The main presenting clinical feature was proximal muscle weakness, which was symmetric in 83.33% of patients. The mean creatine kinase (CK) was 6853 IU/l. Anti-HMG-CoA reductase antibody was positive in all cases tested (n = 57/57, 100%). In patients with no anti-HMG-CoA antibody results, diagnosis was established by findings of necrotizing myopathy on biopsy. Among the 83 cases where muscle biopsy information was available, 81.48% had necrosis, while 18.51% had combination of necrosis and inflammation. Most (83.82%) patients received two or more immunosuppressants to induce remission. Ninety-one percent had resolution of symptoms after treatment. Statin-associated necrotizing myopathy is a symmetric proximal muscle weakness associated with extreme elevations of CK. It is common in males and can occur after months of statin use. It is associated with necrosis on muscle biopsy and the presence of anti-HMG-CoA reductase antibodies

  20. Evidence for marsh mallow (Malva parviflora) toxicosis causing myocardial disease and myopathy in four horses.

    Science.gov (United States)

    Bauquier, J; Stent, A; Gibney, J; Jerrett, I; White, J; Tennent-Brown, B; Pearce, A; Pitt, J

    2017-05-01

    Investigation of toxicosis caused by Malva parviflora was required after 4 horses from the same farm developed severe muscle fasciculations, tachycardia, sweating and periods of recumbency leading to death or euthanasia after ingesting the plant. To describe historical, clinical, clinicopathological and pathological findings of 4 horses with suspected M. parviflora toxicosis. The role of cyclopropene fatty acids (found in M. parviflora) and mechanism for toxicosis are proposed. Case series. Historical, physical examination, clinicopathological and pathological findings are reported. Due to similarities with atypical myopathy or seasonal pasture myopathy acyl carnitine profiles were performed on sera from 2 cases and equine controls. Presence of cyclopropene fatty acids was also examined in sera of 2 cases. M. parviflora had been heavily grazed by the horses with little other feed available. Horse 1 deteriorated rapidly and was subjected to euthanasia. Horse 2 was referred to hospital where severe myocardial disease and generalised myopathy was determined; this horse was subjected to euthanasia 36 h after admission. Horse 3 died rapidly and Horse 4 was subjected to euthanasia at onset of clinical signs. Post-mortem examinations performed on 3 horses revealed acute, multifocal cardiac and skeletal myonecrosis. Myocyte glycogen accumulation was absent when examined in Horse 2. Acyl carnitine profiles revealed increased C14-C18 acyl carnitine concentrations in cases relative to controls. Cyclopropene fatty acids were detected in sera of cases but not controls. These findings suggest aetiology different to that of atypical myopathy or seasonal pasture myopathy. We hypothesise that cyclopropene fatty acids in M. parviflora interfere with fatty acid β-oxidation in horses in negative energy balance, causing the clinical signs and abnormal acyl carnitine profiles. These equine cases suggest a pathophysiological course that closely mimics the human genetic condition very

  1. ColVI myopathies: where do we stand, where do we go?

    Directory of Open Access Journals (Sweden)

    Allamand Valérie

    2011-09-01

    Full Text Available Abstract Collagen VI myopathies, caused by mutations in the genes encoding collagen type VI (ColVI, represent a clinical continuum with Ullrich congenital muscular dystrophy (UCMD and Bethlem myopathy (BM at each end of the spectrum, and less well-defined intermediate phenotypes in between. ColVI myopathies also share common features with other disorders associated with prominent muscle contractures, making differential diagnosis difficult. This group of disorders, under-recognized for a long time, has aroused much interest over the past decade, with important advances made in understanding its molecular pathogenesis. Indeed, numerous mutations have now been reported in the COL6A1, COL6A2 and COL6A3 genes, a large proportion of which are de novo and exert dominant-negative effects. Genotype-phenotype correlations have also started to emerge, which reflect the various pathogenic mechanisms at play in these disorders: dominant de novo exon splicing that enables the synthesis and secretion of mutant tetramers and homozygous nonsense mutations that lead to premature termination of translation and complete loss of function are associated with early-onset, severe phenotypes. In this review, we present the current state of diagnosis and research in the field of ColVI myopathies. The past decade has provided significant advances, with the identification of altered cellular functions in animal models of ColVI myopathies and in patient samples. In particular, mitochondrial dysfunction and a defect in the autophagic clearance system of skeletal muscle have recently been reported, thereby opening potential therapeutic avenues.

  2. Cardiovascular magnetic resonance imaging (CMR) reveals characteristic pattern of myocardial damage in patients with mitochondrial myopathy.

    Science.gov (United States)

    Yilmaz, Ali; Gdynia, Hans-Jürgen; Ponfick, Matthias; Rösch, Sabine; Lindner, Alfred; Ludolph, Albert C; Sechtem, Udo

    2012-04-01

    Mitochondrial myopathy comprises various clinical subforms of neuromuscular disorders that are characterised by impaired mitochondrial energy metabolism due to dysfunction of the mitochondrial respiratory chain. No comprehensive and targeted cardiovascular magnetic resonance (CMR) studies have been performed so far in patients with mitochondrial disorders. The present study aimed at characterising cardiac disease manifestations in patients with mitochondrial myopathy and elucidating the in vivo cardiac damage pattern of patients with different subforms of mitochondrial disease by CMR studies. In a prospective study, 37 patients with mitochondrial myopathy underwent comprehensive neurological and cardiac evaluations including physical examination, resting ECG and CMR. The CMR studies comprised cine-CMR, T2-weighted "edema" imaging and T1-weighted late-gadolinium-enhancement (LGE) imaging. Various patterns and degrees of skeletal myopathy were present in the participants of this study, whereas clinical symptoms such as chest pain symptoms (in eight (22%) patients) and various degrees of dyspnea (in 16 (43%) patients) were less frequent. Pathological ECG findings were documented in eight (22%) patients. T2-weighted "edema" imaging was positive in one (3%) patient with MELAS (mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes) only. LGE imaging demonstrated the presence of non-ischemic LGE in 12 (32%) patients: 10 out of 24 (42%) patients with CPEO (chronic progressive external ophthalmoplegia) or KSS (Kearns-Sayre syndrome) and 2 of 3 (67%) patients with MELAS were LGE positive. All 10 LGE-positive patients with CPEO or KSS demonstrated a potentially typical pattern of diffuse intramural LGE in the left-ventricular (LV) inferolateral segments. Cardiac involvement is a frequent finding in patients with mitochondrial myopathy. A potentially characteristic pattern of diffuse intramural LGE in the LV inferolateral segments was identified in

  3. Elucidation of the mechanism of atorvastatin-induced myopathy in a rat model.

    Science.gov (United States)

    El-Ganainy, Samar O; El-Mallah, Ahmed; Abdallah, Dina; Khattab, Mahmoud M; Mohy El-Din, Mahmoud M; El-Khatib, Aiman S

    2016-06-01

    Myopathy is among the well documented and the most disturbing adverse effects of statins. The underlying mechanism is still unknown. Mitochondrial dysfunction related to coenzyme Q10 decline is one of the proposed theories. The present study aimed to investigate the mechanism of atorvastatin-induced myopathy in rats. In addition, the mechanism of the coenzyme Q10 protection was investigated with special focus of mitochondrial alterations. Sprague-Dawely rats were treated orally either with atorvastatin (100mg/kg) or atorvastatin and coenzyme Q10 (100mg/kg). Myopathy was assessed by measuring serum creatine kinase (CK) and myoglobin levels together with examination of necrosis in type IIB fiber muscles. Mitochondrial dysfunction was evaluated by measuring muscle lactate/pyruvate ratio, ATP level, pAkt as well as mitochondrial ultrastructure examination. Atorvastatin treatment resulted in a rise in both CK (2X) and myoglobin (6X) level with graded degrees of muscle necrosis. Biochemical determinations showed prominent increase in lactate/pyruvate ratio and a decline in both ATP (>80%) and pAkt (>50%) levels. Ultrastructure examination showed mitochondrial swelling with disrupted organelle membrane. Co-treatment with coenzyme Q10 induced reduction in muscle necrosis as well as in CK and myoglobin levels. In addition, coenzyme Q10 improved all mitochondrial dysfunction parameters including mitochondrial swelling and disruption. These results presented a model for atorvastatin-induced myopathy in rats and proved that mitochondrial dysfunction is the main contributor in statin-myopathy pathophysiology. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  4. Electron angular distribution axial channeling

    International Nuclear Information System (INIS)

    Khokonov, A.Kh.; Khokonov, M.Kh.

    1989-01-01

    Angular distributions of ultra-relativistic electrons are calculated in the assumption about presence of statistical equilibrium. Analysis is based on numerical solution of Fokker-Planck type kinetic equation. It is shown that in contrast to case of amorphous medium, the multiple scattering at axial channeling of negative particles results in self-focusing of the initial beam particles and due to it number of electrons moving at an angles to the chain, which are smaller, than critical angle of channeling, may increase by several times as compared to the initial one

  5. Axially alignable nuclear fuel pellets

    International Nuclear Information System (INIS)

    Johansson, E.B.; Klahn, D.H.; Marlowe, M.O.

    1978-01-01

    An axially alignable nuclear fuel pellet of the type stacked in end-to-end relationship within a tubular cladding is described. Fuel cladding failures can occur at pellet interface locations due to mechanical interaction between misaligned fuel pellets and the cladding. Mechanical interaction between the cladding and the fuel pellets loads the cladding and causes increased cladding stresses. Nuclear fuel pellets are provided with an end structure that increases plastic deformation of the pellets at the interface between pellets so that lower alignment forces are required to straighten axially misaligned pellets. Plastic deformation of the pellet ends results in less interactions beween the cladding and the fuel pellets and significantly lowers cladding stresses. The geometry of pellets constructed according to the invention also reduces alignment forces required to straighten fuel pellets that are tilted within the cladding. Plastic deformation of the pellets at the pellet interfaces is increased by providing pellets with at least one end face having a centrally-disposed raised area of convex shape so that the mean temperature and shear stress of the contact area is higher than that of prior art pellets

  6. PWR AXIAL BURNUP PROFILE ANALYSIS

    International Nuclear Information System (INIS)

    J.M. Acaglione

    2003-01-01

    The purpose of this activity is to develop a representative ''limiting'' axial burnup profile for pressurized water reactors (PWRs), which would encompass the isotopic axial variations caused by different assembly irradiation histories, and produce conservative isotopics with respect to criticality. The effect that the low burnup regions near the ends of spent fuel have on system reactivity is termed the ''end-effect''. This calculation will quantify the end-effects associated with Pressurized Water Reactor (PWR) fuel assemblies emplaced in a hypothetical 21 PWR waste package. The scope of this calculation covers an initial enrichment range of 3.0 through 5.0 wt% U-235 and a burnup range of 10 through 50 GWd/MTU. This activity supports the validation of the process for ensuring conservative generation of spent fuel isotopics with respect to criticality safety applications, and the use of burnup credit for commercial spent nuclear fuel. The intended use of these results will be in the development of PWR waste package loading curves, and applications involving burnup credit. Limitations of this evaluation are that the limiting profiles are only confirmed for use with the B andW 15 x 15 fuel assembly design. However, this assembly design is considered bounding of all other typical commercial PWR fuel assembly designs. This calculation is subject to the Quality Assurance Requirements and Description (QARD) because this activity supports investigations of items or barriers on the Q-list (YMP 2001)

  7. Exact axially symmetric galactic dynamos

    Science.gov (United States)

    Henriksen, R. N.; Woodfinden, A.; Irwin, J. A.

    2018-05-01

    We give a selection of exact dynamos in axial symmetry on a galactic scale. These include some steady examples, at least one of which is wholly analytic in terms of simple functions and has been discussed elsewhere. Most solutions are found in terms of special functions, such as associated Lagrange or hypergeometric functions. They may be considered exact in the sense that they are known to any desired accuracy in principle. The new aspect developed here is to present scale-invariant solutions with zero resistivity that are self-similar in time. The time dependence is either a power law or an exponential factor, but since the geometry of the solution is self-similar in time we do not need to fix a time to study it. Several examples are discussed. Our results demonstrate (without the need to invoke any other mechanisms) X-shaped magnetic fields and (axially symmetric) magnetic spiral arms (both of which are well observed and documented) and predict reversing rotation measures in galaxy haloes (now observed in the CHANG-ES sample) as well as the fact that planar magnetic spirals are lifted into the galactic halo.

  8. Muscle-fiber conduction velocity and electromyography as diagnostic tools in patients with suspected inflammatory myopathy: a prospective study.

    NARCIS (Netherlands)

    Blijham, P.J.; Hengstman, G.J.D.; Laak, H.J. ter; Engelen, B.G.M. van; Zwarts, M.J.

    2004-01-01

    Combinations of different techniques can increase the diagnostic yield from neurophysiological examination of muscle. In 25 patients with suspected inflammatory myopathy, we prospectively performed needle electromyography (EMG) and measured muscle-fiber conduction velocity (MFCV) in a single muscle,

  9. Opposed-phase MR imaging of lipid storage myopathy in a case of Chanarin-Dorfman disease

    International Nuclear Information System (INIS)

    Gaeta, Michele; Celona, Antonio; Racchiusa, Sergio; Mazziotti, Silvio; Minutoli, Fabio; Toscano, Antonio; Musumeci, Olimpia

    2008-01-01

    Chanarin-Dorfman disease (CDD) is a rare genetic disorder characterized by ichthyosis, myopathy, central nervous system disturbances, and intracellular lipid storage in muscle fibers, hepatocytes, and granulocytes. We describe skeletal muscle magnetic resonance imaging findings in a case of CDD, outlining the potential role of GE T1-weighted opposed-phase sequence (chemical shift imaging) in the evaluation of lipid storage myopathies. (orig.)

  10. Opposed-phase MR imaging of lipid storage myopathy in a case of Chanarin-Dorfman disease

    Energy Technology Data Exchange (ETDEWEB)

    Gaeta, Michele; Celona, Antonio; Racchiusa, Sergio; Mazziotti, Silvio [University of Messina, Department of Radiological Sciences, Messina (Italy); Minutoli, Fabio [University of Messina, Department of Radiological Sciences, Messina (Italy); A.O.U. ' ' Policlinico G. Martino' ' , Dipartimento di Scienze Radiologiche, Messina (Italy); Toscano, Antonio; Musumeci, Olimpia [University of Messina, Department of Neurosciences, Psychiatry and Anaesthesiology, Messina (Italy)

    2008-11-15

    Chanarin-Dorfman disease (CDD) is a rare genetic disorder characterized by ichthyosis, myopathy, central nervous system disturbances, and intracellular lipid storage in muscle fibers, hepatocytes, and granulocytes. We describe skeletal muscle magnetic resonance imaging findings in a case of CDD, outlining the potential role of GE T1-weighted opposed-phase sequence (chemical shift imaging) in the evaluation of lipid storage myopathies. (orig.)

  11. Acute quadriplegia caused by necrotizing myopathy in a renal transplant recipient with severe pneumonia: acute onset and complete recovery.

    Science.gov (United States)

    Tu, Guo-Wei; Song, Jie-Qiong; Ting, Simon Kang Seng; Ju, Min-Jie; He, Hong-Yu; Dong, Ji-Hong; Luo, Zhe

    2015-02-03

    Critical illness polyneuropathy and myopathy are multifaceted complications that follow severe illnesses involving the sensorimotor axons and proximal skeletal muscles. These syndromes have rarely been reported among renal transplant recipients. In this paper, we report a case of acute quadriplegia caused by necrotizing myopathy in a renal transplant recipient with severe pneumonia. The muscle strength in the patient's extremities improved gradually after four weeks of comprehensive treatment, and his daily life activities were normal a year after being discharged.

  12. Axial vector mass spectrum and mixing angles

    International Nuclear Information System (INIS)

    Caffarelli, R.V.; Kang, K.

    1976-01-01

    Spectral sum rules of the axial-vector current and axial-vector current-pseudoscalar field are used to study the axial-vector mass spectrum and mixing angles, as well as the decay constants and mixing angles of the pseudoscalar mesons. In general, the result is quite persuasive for the existence of the Jsup(PC) = 1 ++ multiplet in which one has a canonical D-E mixing. (Auth.)

  13. Electric machines with axial magnetic flux

    Science.gov (United States)

    Nuca, I.; Ambros, T.; Burduniuc, M.; Deaconu, S. I.; Turcanu, A.

    2018-01-01

    The paper contains information on the performance of axial machines compared to cylindrical ones. At the same time, various constructive schemes of synchronous electromechanical converters with permanent magnets and asynchronous with short-circuited rotor are presented. In the developed constructions, the aim is to maximize the usage of the material of the stator windings. The design elements of the axial machine magnetic system are presented. The FEMM application depicted the array of the magnetic field of an axial machine.

  14. Centrifugal and axial compressor control

    CERN Document Server

    McMillan, Gregory K

    2009-01-01

    Control engineers, mechanical engineers and mechanical technicians will learn how to select the proper control systems for axial and centrifugal compressors for proper throughput and surge control, with a particular emphasis on surge control. Readers will learn to understand the importance of transmitter speed, digital controller sample time, and control valve stroking time in helping to prevent surge. Engineers and technicians will find this book to be a highly valuable guide on compressor control schemes and the importance of mitigating costly and sometimes catastrophic surge problems. It can be used as a self-tutorial guide or in the classroom with the book's helpful end-of-chapter questions and exercises and sections for keeping notes.

  15. Axial channeling in electron diffraction

    International Nuclear Information System (INIS)

    Ichimiya, A.; Lehmpfuhl, G.

    1978-01-01

    Kossel patterns from Silicon and Niobium were obtained with a convergent electron beam. An intensity maximum in the direction of the zone axes [001] and [111] of Nb was interpreted as axial channeling. The intensity distribution in Kossel patterns was calculated by means of the Bloch wave picture of the dynamical theory of electron diffraction. Particularly zone axis patterns were calculated for different substance-energy combinations and they were compared with experimental observations. The intensity distribution in the calculated Kossel patterns was very sensitive to the model of absorption and it was found that a treatment of the absorption close to the model of Humphreys and Hirsch [Phil. Mag. 18, 115 (1968)] gave the best agreement with the experimental observations. Furthermore it is shown which Bloch waves are important for the intensity distribution in the Kossel patterns, how they are absorbed and how they change with energy. (orig.) [de

  16. Axial channeling of uttrarelativistic electrons

    Energy Technology Data Exchange (ETDEWEB)

    Telegin, V.I.; Khokonov, M.Kh. (Moskovskij Gosudarstvennyj Univ. (USSR). Nauchno-Issledovatel' skij Inst. Yadernoj Fiziki)

    1982-07-01

    The dynamics of motion of ultrarelativistic electrons under axial channeling conditions is investigated. The analysis is based on the solution of the kinetic equation obtained recently by Beloshitsky and Kumakhov. The particle dechanneling function is investigated as depending on the type of a crystal, particle energy and angle of entrance into the single crystal. It is found that for most of the beam the major diffusion mechanism is scattering by electrons. It is shown that an optimal depth range exists for which the fraction of channeled particles sharply increases at the expense of the quasi-channeled particles. In a number of cases the dechanneling length for crystals with high atomic numbers may be greater than that of light elements.

  17. Axial channeling of uttrarelativistic electrons

    International Nuclear Information System (INIS)

    Telegin, V.I.; Khokonov, M.Kh.

    1982-01-01

    The dynamics of motion of ultrarelativistic electrons under axial channeling conditions is investigated. The analysis is based on the solution of the kinetic equation obtained recently by Beloshitsky and Kumakhov. The particle dechanneling function is investigated as depending on the type of a crystal, particle energy and angle of entrance into the single crystal. It is found that for most of the beam the major diffusion mechanism is scattering by electrons. It is shown that an optimal depth range exists for which the fraction of channeled particles sharply increases at the expense of the quasi-channeled particles. In a number of cases the dechanneling length for crystals with high atomic numbers may be greater than that of light elements

  18. Bone Disease in Axial Spondyloarthritis.

    Science.gov (United States)

    Van Mechelen, Margot; Gulino, Giulia Rossana; de Vlam, Kurt; Lories, Rik

    2018-05-01

    Axial spondyloarthritis is a chronic inflammatory skeletal disorder with an important burden of disease, affecting the spine and sacroiliac joints and typically presenting in young adults. Ankylosing spondylitis, diagnosed by the presence of structural changes to the skeleton, is the prototype of this disease group. Bone disease in axial spondyloarthritis is a complex phenomenon with the coexistence of bone loss and new bone formation, both contributing to the morbidity of the disease, in addition to pain caused by inflammation. The skeletal structural changes respectively lead to increased fracture risk and to permanent disability caused by ankylosis of the sacroiliac joints and the spine. The mechanism of this new bone formation leading to ankylosis is insufficiently known. The process appears to originate from entheses, specialized structures that provide a transition zone in which tendon and ligaments insert into the underlying bone. Growth factor signaling pathways such as bone morphogenetic proteins, Wnts, and Hedgehogs have been identified as molecular drivers of new bone formation, but the relationship between inflammation and activation of these pathways remains debated. Long-standing control of inflammation appears necessary to avoid ankylosis. Recent evidence and concepts suggest an important role for biomechanical factors in both the onset and progression of the disease. With regard to new bone formation, these processes can be understood as ectopic repair responses secondary to inflammation-induced bone loss and instability. In this review, we discuss the clinical implications of the skeletal changes as well as the underlying molecular mechanisms, the relation between inflammation and new bone formation, and the potential role of biomechanical stress.

  19. Resolution of axial shear strain elastography

    International Nuclear Information System (INIS)

    Thitaikumar, Arun; Righetti, Raffaella; Krouskop, Thomas A; Ophir, Jonathan

    2006-01-01

    The technique of mapping the local axial component of the shear strain due to quasi-static axial compression is defined as axial shear strain elastography. In this paper, the spatial resolution of axial shear strain elastography is investigated through simulations, using an elastically stiff cylindrical lesion embedded in a homogeneously softer background. Resolution was defined as the smallest size of the inclusion for which the strain value at the inclusion/background interface was greater than the average of the axial shear strain values at the interface and inside the inclusion. The resolution was measured from the axial shear strain profile oriented at 45 0 to the axis of beam propagation, due to the absence of axial shear strain along the normal directions. The effects of the ultrasound system parameters such as bandwidth, beamwidth and transducer element pitch along with signal processing parameters such as correlation window length (W) and axial shift (ΔW) on the estimated resolution were investigated. The results show that the resolution (at 45 0 orientation) is determined by the bandwidth and the beamwidth. However, the upper bound on the resolution is limited by the larger of the beamwidth and the window length, which is scaled inversely to the bandwidth. The results also show that the resolution is proportional to the pitch and not significantly affected by the axial window shift

  20. Origin of axial current in scyllac

    International Nuclear Information System (INIS)

    Sugisaki, K.

    1975-12-01

    The origin of the axial current observed in Scyllac (a high beta stellarator experiment) is discussed. A shaped coil and/or helical winding produce rotational transform which links magnetic lines of force to the plasma column and the axial current is induced electromagnetically. This phenomenon is inherent in a pulsed high-beta stellarator. The rotational transform produced by the induced axial current is much smaller than that associated with the l = 1, 0 equilibrium fields. The effect of the axial current on the equilibrium and stability of the plasma column is thus small. It is also shown that the magnetic field shear near a plasma surface is very strong

  1. Radial and axial compression of pure electron

    International Nuclear Information System (INIS)

    Park, Y.; Soga, Y.; Mihara, Y.; Takeda, M.; Kamada, K.

    2013-01-01

    Experimental studies are carried out on compression of the density distribution of a pure electron plasma confined in a Malmberg-Penning Trap in Kanazawa University. More than six times increase of the on-axis density is observed under application of an external rotating electric field that couples to low-order Trivelpiece-Gould modes. Axial compression of the density distribution with the axial length of a factor of two is achieved by controlling the confining potential at both ends of the plasma. Substantial increase of the axial kinetic energy is observed during the axial compression. (author)

  2. A defect in the thymidine kinase 2 gene causing isolated mitochondrial myopathy without mtDNA depletion.

    Science.gov (United States)

    Leshinsky-Silver, E; Michelson, M; Cohen, S; Ginsberg, M; Sadeh, M; Barash, V; Lerman-Sagie, T; Lev, D

    2008-07-01

    Isolated mitochondrial myopathies (IMM) are either due to primary defects in mtDNA, in nuclear genes that control mtDNA abundance and structure such as thymidine kinase 2 (TK2), or due to CoQ deficiency. Defects in the TK2 gene have been found to be associated with mtDNA depletion attributed to a depleted mitochondrial dNTP pool in non-dividing cells. We report an unusual case of IMM, homozygous for the H90N mutation in the TK2 gene but unlike other cases with the same mutation, does not demonstrate mtDNA depletion. The patient's clinical course is relatively mild and a muscle biopsy showed ragged red muscle fibers with a mild decrease in complexes I and an increase in complexes IV and II activities. This report extends the phenotypic expression of TK2 defects and suggests that all patients who present with an IMM even with normal quantities of mtDNA should be screened for TK2 mutations.

  3. Role of Exercise Therapy in Prevention of Decline in Aging Muscle Function: Glucocorticoid Myopathy and Unloading

    Directory of Open Access Journals (Sweden)

    Teet Seene

    2012-01-01

    Full Text Available Changes in skeletal muscle quantity and quality lead to disability in the aging population. Physiological changes in aging skeletal muscle are associated with a decline in mass, strength, and inability to maintain balance. Glucocorticoids, which are in wide exploitation in various clinical scenarios, lead to the loss of the myofibrillar apparatus, changes in the extracellular matrix, and a decrease in muscle strength and motor activity, particularly in the elderly. Exercise therapy has shown to be a useful tool for the prevention of different diseases, including glucocorticoid myopathy and muscle unloading in the elderly. The purpose of the paper is to discuss the possibilities of using exercise therapy in the prevention of glucocorticoid caused myopathy and unloading in the elderly and to describe relationships between the muscle contractile apparatus and the extracellular matrix in different types of aging muscles.

  4. Free radicals in alcoholic myopathy: indices of damage and preventive studies.

    Science.gov (United States)

    Preedy, Victor R; Adachi, Junko; Asano, Migiwa; Koll, Michael; Mantle, David; Niemela, Onni; Parkkila, Seppo; Paice, Alistair G; Peters, Timothy; Rajendram, Rajkumar; Seitz, Helmut; Ueno, Yasuhiro; Worrall, Simon

    2002-04-15

    Chronic alcoholic myopathy affects up to two-thirds of all alcohol misusers and is characterized by selective atrophy of Type II (glycolytic, fast-twitch, anaerobic) fibers. In contrast, the Type I fibers (oxidative, slow-twitch, aerobic) are relatively protected. Alcohol increases the concentration of cholesterol hydroperoxides and malondialdehyde-protein adducts, though protein-carbonyl concentration levels do not appear to be overtly increased and may actually decrease in some studies. In alcoholics, plasma concentrations of alpha-tocopherol may be reduced in myopathic patients. However, alpha-tocopherol supplementation has failed to prevent either the loss of skeletal muscle protein or the reductions in protein synthesis in alcohol-dosed animals. The evidence for increased oxidative stress in alcohol-exposed skeletal muscle is thus inconsistent. Further work into the role of ROS in alcoholic myopathy is clearly warranted.

  5. Fatal hepatic hemorrhage by peliosis hepatis in X-linked myotubular myopathy: a case report.

    Science.gov (United States)

    Motoki, T; Fukuda, M; Nakano, T; Matsukage, S; Fukui, A; Akiyoshi, S; Hayashi, Y K; Ishii, E; Nishino, I

    2013-11-01

    We report a 5-year-old boy with X-linked myotubular myopathy complicated by peliosis hepatis. At birth, he was affected with marked generalized muscle hypotonia and weakness, which required permanent ventilatory support, and was bedridden for life. He died of acute fatal hepatic hemorrhage after using a mechanical in-exsufflator. Peliosis hepatis, defined as multiple, variable-sized, cystic blood-filled spaces through the liver parenchyma, was confirmed by autopsy. To avoid fatal hepatic hemorrhage by peliosis hepatis, routine hepatic function tests and abdominal imaging tests should be performed for patients with X-linked myotubular myopathy, especially at the time of using artificial respiration. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Neutral lipid-storage disease with myopathy and extended phenotype with novel PNPLA2 mutation.

    Science.gov (United States)

    Massa, Roberto; Pozzessere, Simone; Rastelli, Emanuele; Serra, Laura; Terracciano, Chiara; Gibellini, Manuela; Bozzali, Marco; Arca, Marcello

    2016-04-01

    Neutral lipid-storage disease with myopathy is caused by mutations in PNPLA2, which produce skeletal and cardiac myopathy. We report a man with multiorgan neutral lipid storage and unusual multisystem clinical involvement, including cognitive impairment. Quantitative brain MRI with voxel-based morphometry and extended neuropsychological assessment were performed. In parallel, the coding sequences and intron/exon boundaries of the PNPLA2 gene were screened by direct sequencing. Neuropsychological assessment revealed global cognitive impairment, and brain MRI showed reduced gray matter volume in the temporal lobes. Molecular characterization revealed a novel homozygous mutation in exon 5 of PNPLA2 (c.714C>A), resulting in a premature stop codon (p.Cys238*). Some PNPLA2 mutations, such as the one described here, may present with an extended phenotype, including brain involvement. In these cases, complete neuropsychological testing, combined with quantitative brain MRI, may help to characterize and quantify cognitive impairment. © 2016 Wiley Periodicals, Inc.

  7. Homozygous LIPE Mutation in Siblings with Multiple Symmetric Lipomatosis, Partial Lipodystrophy, and Myopathy

    OpenAIRE

    Zolotov, Sagit; Xing, Chao; Mahamid, Riad; Shalata, Adel; Sheikh-Ahmad, Mohammed; Garg, Abhimanyu

    2016-01-01

    Despite considerable progress in identifying causal genes for lipodystrophy syndromes, the molecular basis of some peculiar adipose tissue disorders remains obscure. In an Israeli–Arab pedigree with a novel autosomal recessive, multiple symmetric lipomatosis (MSL), partial lipodystrophy and myopathy, we conducted exome sequencing of two affected siblings to identify the disease-causingmutation. The 41-year-old female proband and her 36-year-old brother reported marked accumulation of subcutan...

  8. Cardiac abnormalities assessed by non-invasive techniques in patients with newly diagnosed idiopathic inflammatory myopathies

    DEFF Research Database (Denmark)

    Diederichsen, Louise Pyndt; Simonsen, Jane Angel; Diederichsen, Axel Cosmus Pyndt

    2015-01-01

    inflammatory myopathies (IIM) by means of non-invasive techniques. METHODS: Fourteen patients with IIM (8 polymyositis, 4 dermatomyositis, 2 cancer-associated dermatomyositis) and 14 gender- and age- matched healthy control subjects were investigated. Participant assessments included a cardiac questionnaire...... in 8 (57%) of the patients compared to none of the controls (pgroup (p=0.01). Two patients had systolic dysfunction, and one diastolic dysfunction...

  9. Case Report: Elevated CPK, an indicator of idiopathic inflammatory myopathy? [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Hina N. Khan

    2016-02-01

    Full Text Available Polymyositis is a rare disease with incidence rates at about 1 per 100,000 people annually. In this case report we will review a case of proximal muscle weakness with an elevated creatine phosphokinase that was initially misdiagnosed twice as rhabdomyolysis. Therefore, emphasizing that idiopathic inflammatory myopathy is a potential cause of myasthenia that must be considered in the differential. The case will also describe the current treatment and treatment response in polymyositis.

  10. Toxic myopathy in a dog associated with the presence of monensin in dry food.

    Science.gov (United States)

    Wilson, J S

    1980-01-01

    This report describes a case of toxic myopathy in a two year old sheltie dog with clinical signs of profound weakness, myoglobinuria, and muscle enzyme elevations. The clinical signs were likely related to the accidental inclusion of monensin sodium in the dog's food. This food was prepared by a small feed milling company that also prepares cattle and chicken rations. A change of dog food resulted in remission of the clinical signs.

  11. Toxic Myopathy in a Dog Associated with the Presence of Monensin in Dry Food

    OpenAIRE

    Wilson, J. S.

    1980-01-01

    This report describes a case of toxic myopathy in a two year old sheltie dog with clinical signs of profound weakness, myoglobinuria, and muscle enzyme elevations. The clinical signs were likely related to the accidental inclusion of monensin sodium in the dog's food. This food was prepared by a small feed milling company that also prepares cattle and chicken rations. A change of dog food resulted in remission of the clinical signs.

  12. Whole-body MRI for full assessment and characterization of diffuse inflammatory myopathy

    Directory of Open Access Journals (Sweden)

    Saleh Saleh Elessawy

    2016-09-01

    Full Text Available Background Conventional magnetic resonance imaging (MRI is a highly valuable tool for full assessment of the extent of bilateral symmetrical diffuse inflammatory myopathy, owing to its high sensitivity in the detection of edema which correlates with, and sometimes precedes, clinical findings. Purpose To evaluate the use of whole-body (WB-MRI in characterization and full assessment of the extent and distribution of diffuse inflammatory myopathy. Material and Methods A prospective study on 15 patients presenting with clinical evidence of inflammatory myopathy. It included 4 boys/men and 11 girls/women (age range, 6–44 years; mean age, 25.5 years. 1.5 T WB-MRI was performed and the distribution and extent of disease severity was assessed according to muscle edema on STIR images. Results Four cases of dermatomyositis showed lower limb disease predilection with edema in gluteal, thigh, and calf muscles. The same finding was seen in one case with recurrent polymyositis and three cases with overlap myositis with systemic lupus erythematosus (SLE. Bilateral upper and lower limb myositis was demonstrated in three cases of polymyositis and one case of overlap myositis with scleroderma. Bilateral edema involving all scanned muscle groups was detected in three cases of polymyositis with paraneoplastic syndrome, SLE, and severe active dermatomyositis (including the neck muscles. Conclusion WB-MRI is the diagnostic modality of choice for cases of inflammatory myopathy. It accurately detects the most severely affected muscles candidate for biopsy and provides a reliable baseline study for follow-up of disease progression as well as response to treatment.

  13. Apparent diffusion coefficient (ADC) does not correlate with different serological parameters in myositis and myopathy.

    Science.gov (United States)

    Meyer, Hans-Jonas; Ziemann, Oliver; Kornhuber, Malte; Emmer, Alexander; Quäschling, Ulf; Schob, Stefan; Surov, Alexey

    2018-06-01

    Background Magnetic resonance imaging (MRI) is widely used in several muscle disorders. Diffusion-weighted imaging (DWI) is an imaging modality, which can reflect microstructural tissue composition. The apparent diffusion coefficient (ADC) is used to quantify the random motion of water molecules in tissue. Purpose To investigate ADC values in patients with myositis and non-inflammatory myopathy and to analyze possible associations between ADC and laboratory parameters in these patients. Material and Methods Overall, 17 patients with several myositis entities, eight patients with non-inflammatory myopathies, and nine patients without muscle disorder as a control group were included in the study (mean age = 55.3 ± 14.3 years). The diagnosis was confirmed by histopathology in every case. DWI was obtained in a 1.5-T scanner using two b-values: 0 and 1000 s/mm 2 . In all patients, the blood sample was acquired within three days to the MRI. The following serological parameters were estimated: C-reactive protein, lactate dehydrogenase, alanine aminotransferase, aspartate aminotransferase, creatine kinase, and myoglobine. Results The estimated mean ADC value for the myositis group was 1.89 ± 0.37 × 10 -3  mm 2 /s and for the non-inflammatory myopathy group was 1.79 ± 0.33 × 10 -3  mm 2 /s, respectively. The mean ADC values (1.15 ± 0.37 × 10 -3  mm 2 /s) were significantly higher to unaffected muscles (vs. myositis P = 0.0002 and vs. myopathy P = 0.0021). There were no significant correlations between serological parameters and ADC values. Conclusion Affected muscles showed statistically significantly higher ADC values than normal muscles. No linear correlations between ADC and serological parameters were identified.

  14. Nuclear actin aggregation is a hallmark of anti-synthetase syndrome-induced dysimmune myopathy

    OpenAIRE

    Stenzel, W; Preusse, C; Allenbach, Y; Pehl, D; Junckerstorff, R; Heppner, F L; Nolte, K; Aronica, E; Kana, V; Rushing, E; Schneider, U; Claeys, K G; Benveniste, O; Weis, J; Goebel, H H

    2015-01-01

    Objective: To analyze antisynthetase syndrome–associated myositis by modern myopathologic methods and to define its place in the spectrum of idiopathic inflammatory myopathies (IIMs). Methods: Skeletal muscle biopsies from antisynthetase syndrome–associated myositis and other IIMs from different institutions worldwide were analyzed by histopathology, quantitative PCR, and electron microscopy. Results: Myonuclear actin filament inclusions were identified as a unique morphologic hallmark of a...

  15. Mutation-specific effects on thin filament length in thin filament myopathy.

    Science.gov (United States)

    Winter, Josine M de; Joureau, Barbara; Lee, Eun-Jeong; Kiss, Balázs; Yuen, Michaela; Gupta, Vandana A; Pappas, Christopher T; Gregorio, Carol C; Stienen, Ger J M; Edvardson, Simon; Wallgren-Pettersson, Carina; Lehtokari, Vilma-Lotta; Pelin, Katarina; Malfatti, Edoardo; Romero, Norma B; Engelen, Baziel G van; Voermans, Nicol C; Donkervoort, Sandra; Bönnemann, C G; Clarke, Nigel F; Beggs, Alan H; Granzier, Henk; Ottenheijm, Coen A C

    2016-06-01

    Thin filament myopathies are among the most common nondystrophic congenital muscular disorders, and are caused by mutations in genes encoding proteins that are associated with the skeletal muscle thin filament. Mechanisms underlying muscle weakness are poorly understood, but might involve the length of the thin filament, an important determinant of force generation. We investigated the sarcomere length-dependence of force, a functional assay that provides insights into the contractile strength of muscle fibers as well as the length of the thin filaments, in muscle fibers from 51 patients with thin filament myopathy caused by mutations in NEB, ACTA1, TPM2, TPM3, TNNT1, KBTBD13, KLHL40, and KLHL41. Lower force generation was observed in muscle fibers from patients of all genotypes. In a subset of patients who harbor mutations in NEB and ACTA1, the lower force was associated with downward shifted force-sarcomere length relations, indicative of shorter thin filaments. Confocal microscopy confirmed shorter thin filaments in muscle fibers of these patients. A conditional Neb knockout mouse model, which recapitulates thin filament myopathy, revealed a compensatory mechanism; the lower force generation that was associated with shorter thin filaments was compensated for by increasing the number of sarcomeres in series. This allowed muscle fibers to operate at a shorter sarcomere length and maintain optimal thin-thick filament overlap. These findings might provide a novel direction for the development of therapeutic strategies for thin filament myopathy patients with shortened thin filament lengths. Ann Neurol 2016;79:959-969. © 2016 American Neurological Association.

  16. Unfolded protein response and activated degradative pathways regulation in GNE myopathy.

    Directory of Open Access Journals (Sweden)

    Honghao Li

    Full Text Available Although intracellular beta amyloid (Aβ accumulation is known as an early upstream event in the degenerative course of UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase (GNE myopathy, the process by which Aβdeposits initiate various degradative pathways, and their relationship have not been fully clarified. We studied the possible secondary responses after amyloid beta precursor protein (AβPP deposition including unfolded protein response (UPR, ubiquitin proteasome system (UPS activation and its correlation with autophagy system. Eight GNE myopathy patients and five individuals with normal muscle morphology were included in this study. We performed immunofluorescence and immunoblotting to investigate the expression of AβPP, phosphorylated tau (p-tau and endoplasmic reticulum molecular chaperones. Proteasome activities were measured by cleavage of fluorogenic substrates. The expression of proteasome subunits and linkers between proteasomal and autophagy systems were also evaluated by immunoblotting and relative quantitative real-time RT-PCR. Four molecular chaperones, glucose-regulated protein 94 (GRP94, glucose-regulated protein 78 (GRP78, calreticulin and calnexin and valosin containing protein (VCP were highly expressed in GNE myopathy. 20S proteasome subunits, three main proteasome proteolytic activities, and the factors linking UPS and autophagy system were also increased. Our study suggests that AβPP deposition results in endoplasmic reticulum stress (ERS and highly expressed VCP deliver unfolded proteins from endoplasmic reticulum to proteosomal system which is activated in endoplasmic reticulum associated degradation (ERAD in GNE myopathy. Excessive ubiquitinated unfolded proteins are exported by proteins that connect UPS and autophagy to autophagy system, which is activated as an alternative pathway for degradation.

  17. Computed tomography and angiography in MELAS (mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes)

    International Nuclear Information System (INIS)

    Hasuo, K.; Tamura, S.; Yasumori, K.; Uchino, A.; Masuda, K.; Goda, S.; Ishimoto, S.; Kamikaseda, K.; Wakuta, Y.; Kishi, M.

    1987-01-01

    Among mitochondrial encephalomyopathies, MELAS (mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes, Pavlakis et al., 1983) is recognized as a distinct syndrome characterized by generalized convulsions and recurrrent stroke-like episodes. The neuroradiological findings of three patients with MELAS are reported here. Retrospective review shows that MELAS should be included in the differential diagnosis of infarct-like lesions of the cerebrum. (orig.)

  18. Myopathy in hyperthyroidism as a consequence of rapid reduction of thyroid hormone

    OpenAIRE

    Li, Qianrui; Liu, Yuping; Zhang, Qianying; Tian, Haoming; Li, Jianwei; Li, Sheyu

    2017-01-01

    Abstract Rationale: Myalgia and elevated creatine kinase (CK) are occasionally observed during the treatment of hyperthyroid patients. Relative hypothyroidism resulted from rapid thyroid hormone reduction had been promoted as a plausible cause of these myopathic changes, however rarely reported. Patient concerns: We hereby presented a 20-year-old female with Grave's disease, who developed myopathy and elevated CK during rapid correction of thyroid hormone. Diagnoses: Relative hypothyroidism-i...

  19. The Nucleon Axial Form Factor and Staggered Lattice QCD

    Energy Technology Data Exchange (ETDEWEB)

    Meyer, Aaron Scott [Chicago U.

    2017-01-01

    The study of neutrino oscillation physics is a major research goal of the worldwide particle physics program over the upcoming decade. Many new experiments are being built to study the properties of neutrinos and to answer questions about the phenomenon of neutrino oscillation. These experiments need precise theoretical cross sections in order to access fundamental neutrino properties. Neutrino oscillation experiments often use large atomic nuclei as scattering targets, which are challenging for theorists to model. Nuclear models rely on free-nucleon amplitudes as inputs. These amplitudes are constrained by scattering experiments with large nuclear targets that rely on the very same nuclear models. The work in this dissertation is the rst step of a new initiative to isolate and compute elementary amplitudes with theoretical calculations to support the neutrino oscillation experimental program. Here, the eort focuses on computing the axial form factor, which is the largest contributor of systematic error in the primary signal measurement process for neutrino oscillation studies, quasielastic scattering. Two approaches are taken. First, neutrino scattering data on a deuterium target are reanalyzed with a model-independent parametrization of the axial form factor to quantify the present uncertainty in the free-nucleon amplitudes. The uncertainties on the free-nucleon cross section are found to be underestimated by about an order of magnitude compared to the ubiquitous dipole model parametrization. The second approach uses lattice QCD to perform a rst-principles computation of the nucleon axial form factor. The Highly Improved Staggered Quark (HISQ) action is employed for both valence and sea quarks. The results presented in this dissertation are computed at physical pion mass for one lattice spacing. This work presents a computation of the axial form factor at zero momentum transfer, and forms the basis for a computation of the axial form factor momentum dependence

  20. Radiological features of Paget disease of bone associated with VCP myopathy

    Energy Technology Data Exchange (ETDEWEB)

    Farpour, Farzin [University of California, Department of Radiology, VA Long Beach Health Care, Irvine, CA (United States); Queens Hospital Center, Mount Sinai School of Medicine, New York, NY (United States); Tehranzadeh, Jamshid [University of California, Department of Radiology, VA Long Beach Health Care, Irvine, CA (United States); Donkervoort, Sandra; Vanjara, Pari [University of California, Division of Genetics and Metabolism, Department of Pediatrics, Irvine, CA (United States); Smith, Charles [University of Kentucky, Department of Neurology and Sanders-Brown Center on Aging, Lexington, KY (United States); Martin, Barbara [University of Kentucky, Lexington, KY (United States); Osann, Kathryn [University of California, Department of Medicine, Division of Hematology/Oncology, Irvine, CA (United States); Kimonis, Virginia E. [University of California, Division of Genetics and Metabolism, Department of Pediatrics, Irvine, CA (United States); UC Irvine Medical Center, Division of Genetics and Metabolism, Orange, CA (United States)

    2012-03-15

    Mutations in the Valosin-containing protein (VCP) gene cause a unique disorder characterized by classic Paget disease of bone (PDB), inclusion body myopathy, and frontotemporal dementia (IBMPFD). Our objective was to analyze the radiographic features of PDB associated with VCP mutations since there is a dearth of literature on the PDB component of VCP disease. Radiographic bone surveys were examined in 23 individuals with VCP mutation and compared with their unaffected relatives. Laboratory testing relevant for VCP disease was performed in all individuals. Of the 17 affected individuals with clinical manifestations of VCP disease, 16 of whom had myopathy, radiographic analysis revealed classic PDB in 11 individuals (65%). The mean age of diagnosis for myopathy was 43.8 years and for PDB was 38.1 years of age. Radiological evidence of PDB was seen in one individual (16%) amongst six clinically asymptomatic VCP mutation carriers. Alkaline phosphatase was a useful marker for diagnosing PDB in VCP disease. Radiographic findings of classic PDB are seen in 52% of individuals carrying VCP mutations at a significantly younger age than conventional PDB. Screening for PDB is warranted in at-risk individuals because of the benefit of early treatment with the new powerful bisphosphonates that hold the potential for prevention of disease. (orig.)

  1. Insulin resistance and increased muscle cytokine levels in patients with mitochondrial myopathy.

    Science.gov (United States)

    Rue, Nana; Vissing, John; Galbo, Henrik

    2014-10-01

    Mitochondrial dysfunction has been proposed to cause insulin resistance and that might stimulate cytokine production. The objective of the study was to elucidate the association between mitochondrial myopathy, insulin sensitivity, and cytokine levels in muscle. This was an experimental, controlled study in outpatients. Eight overnight-fasted patients (P) with various inherited mitochondrial myopathies and eight healthy subjects (C) matched for sex, age, weight, height, and physical activity participated in the study. The intervention included a 120-minute hyperinsulinemic, euglycemic clamp. Another morning, microdialysis of both vastus lateralis muscles for 4 hours, including one-legged, knee extension exercise for 30 minutes, was performed. Glucose infusion rate during 90-120 minutes of insulin infusion was measured. Cytokine concentrations in dialysate were also measured. Muscle strength, percentage fat mass, and creatine kinase in plasma did not differ between groups. The maximal oxygen uptake was 21 ± 3 (SE) (P) and 36 ± 3(C) mL/kg·min (2P fatty acids and glycerol at 120 minutes were higher in P vs C (2P myopathies, insulin sensitivity of muscle, adipose tissue, and pancreatic A cells is reduced, supporting that mitochondrial function influences insulin action. Furthermore, a local, low-grade inflammation of potential clinical importance exists in the muscle of these patients.

  2. Rapid diagnosis of hypoglycin A intoxication in atypical myopathy of horses.

    Science.gov (United States)

    Sander, Johannes; Cavalleri, Jessika-M V; Terhardt, Michael; Bochnia, Mandy; Zeyner, Annette; Zuraw, Aleksandra; Sander, Stefanie; Peter, Michael; Janzen, Nils

    2016-03-01

    Hypoglycin A (2-amino-3-(2-methylidenecyclopropyl)propanoic acid) is the plant toxin shown to cause atypical myopathy in horses. It is converted in vivo to methylenecyclopropyl acetic acid, which is transformed to a coenzyme A ester that subsequently blocks beta oxidation of fatty acids. Methylenecyclopropyl acetic acid is also conjugated with carnitine and glycine. Acute atypical myopathy may be diagnosed by quantifying the conjugates of methylenecyclopropyl acetic acid plus a selection of acyl conjugates in urine and serum. We describe a new mass spectrometric method for sample volumes of acid in urine, the coefficients of variation for intraday quantification were 2.9% and 3.0%, respectively. The respective values for interday were 9.3% and 8.0%. Methylenecyclopropyl acetyl carnitine was detected as high as 1.18 µmol/L in serum (median: 0.46 µmol/L) and 1.98 mmol/mol creatinine in urine (median: 0.79 mmol/mol creatinine) of diseased horses, while the glycine derivative accumulated up to 1.97 mmol/mol creatinine in urine but was undetectable in most serum samples. In serum samples from horses with atypical myopathy, the intraday coefficients of variation for C4-C8 carnitines and glycines were ≤4.5%. Measured concentrations exceeded those in healthy horses by ~10 to 1,400 times. © 2015 The Author(s).

  3. The genetic basis of pectoralis major myopathies in modern broiler chicken lines.

    Science.gov (United States)

    Bailey, Richard A; Watson, Kellie A; Bilgili, S F; Avendano, Santiago

    2015-12-01

    This is the first report providing estimates of the genetic basis of breast muscle myopathies (BMM) and their relationship with growth and yield in broiler chickens. In addition, this paper addresses the hypothesis that genetic selection for increase breast yield has contributed to the onset of BMM. Data were analyzed from ongoing recording of BMM within the Aviagen breeding program. This study focused on three BMM: deep pectoral myopathy (DPM; binary trait), white striping (WS; 4 categories) and wooden breast (WB; 3 categories). Data from two purebred commercial broiler lines (A and B) were utilized providing greater than 40,000 meat quality records per line. The difference in selection history between these two lines has resulted in contrasting breast yield (BY): 29% for Line A and 21% for Line B. Data were analyzed to estimate genetic parameters using a multivariate animal model including six traits: body weight (BW), processing body weight (PW), BY, DPM, WB, and WS, in addition to the appropriate fixed effects and permanent environmental effect of the dam. Results indicate similar patterns of heritability and genetic correlations for the two lines. Heritabilities (h2) of BW, PW and BY ranged from 0.271-0.418; for DPM and WB h2white striping of breast muscle and more than 90% of the variance of the incidence of wooden breast and deep pectoral myopathy in broiler chickens. © The Author 2015. Published by Oxford University Press on behalf of Poultry Science Association.

  4. [Rhabdomyolysis - may it be a metabolic myopathy? Case report and diagnostic algorithm].

    Science.gov (United States)

    Sebők, Ágnes; Pál, Endre; Molnár, Gergő Attila; Wittmann, István; Berenténé Bene, Judit; Melegh, Béla; Komoly, Sámuel; Hidvégi, Tibor; Balogh, Lídia; Szabó, Attila; Zsidegh, Petra

    2017-11-01

    We report the case of a 46-year-old female patient with recurrent rhabdomyolysis. In the background of her metabolic myopathy an inherited metabolic disorder of the fatty acid oxidation, very long-chain acyl-coenzyme A-dehydrogenase deficiency was diagnosed. The diagnosis was based on abnormal acyl-carnitine- and urine organic-acid profile in addition to low residual enzyme activity, and was confirmed by genetic testing. After introduction of dietotherapy metabolic crisis necessitating hospital admission has not occurred neither have fixed myopathic changes developed. We present here the differential diagnosis of rhabdomyolysis and exertional muscle complaints, with the metabolic myopathies in focus. The main features of fatty acid oxidation disorders are highlighted, acute and chronic managements of very long-chain acyl-coenzyme A-dehydrogenase deficiency are discussed. Metabolic myopathies respond well to treatment, so good quality of life can be achieved. However, especially in fatty acid oxidation disorders, a metabolic crisis may develop quickly and can be fatal, albeit rarely. Some of these disorders can be identified by newborn screening, but occasionally the symptoms may manifest only in adulthood. With the presentation of this case we would like to point out that in the differential diagnosis of recurrent rhabdomyolysis inherited metabolic disorders should be considered regardless of the patient's age. Orv Hetil. 2017; 158(46): 1873-1882.

  5. Exertional Myopathy in a Juvenile Green Sea Turtle (Chelonia mydas Entangled in a Large Mesh Gillnet

    Directory of Open Access Journals (Sweden)

    Brianne E. Phillips

    2015-01-01

    Full Text Available A juvenile female green sea turtle (Chelonia mydas was found entangled in a large mesh gillnet in Pamlico Sound, NC, and was weak upon presentation for treatment. Blood gas analysis revealed severe metabolic acidosis and hyperlactatemia. Plasma biochemistry analysis showed elevated aspartate aminotransferase and creatine kinase, marked hypercalcemia, hyperphosphatemia, and hyperkalemia. Death occurred within 24 hours of presentation despite treatment with intravenous and subcutaneous fluids and sodium bicarbonate. Necropsy revealed multifocal to diffuse pallor of the superficial and deep pectoral muscles. Mild, multifocal, and acute myofiber necrosis was identified by histopathological examination. While histological changes in the examined muscle were modest, the acid-base, mineral, and electrolyte abnormalities were sufficiently severe to contribute to this animal’s mortality. Exertional myopathy in reptiles has not been well characterized. Sea turtle mortality resulting from forced submergence has been attributed to blood gas derangements and seawater aspiration; however, exertional myopathy may also be an important contributing factor. If possible, sea turtles subjected to incidental capture and entanglement that exhibit weakness or dull mentation should be clinically evaluated prior to release to minimize the risk of delayed mortality. Treatment with appropriate fluid therapy and supportive care may mitigate the effects of exertional myopathy in some cases.

  6. Genetic factors affecting statin concentrations and subsequent myopathy: a HuGENet systematic review

    Science.gov (United States)

    Canestaro, William J.; Austin, Melissa A.; Thummel, Kenneth E.

    2015-01-01

    Statins, 3-hydroxy-3-methyl-glutaryl-coenzyme A reductase inhibitors, have proven efficacy in both lowering low-density-lipoprotein levels and preventing major coronary events, making them one of the most commonly prescribed drugs in the United States. Statins exhibit a class-wide side effect of muscle toxicity and weakness, which has led regulators to impose both dosage limitations and a recall. This review focuses on the best-characterized genetic factors associated with increased statin muscle concentrations, including the genes encoding cytochrome P450 enzymes (CYP2D6, CYP3A4, and CYP3A5), a mitochondrial enzyme (GATM), an influx transporter (SLCO1B1), and efflux transporters (ABCB1 and ABCG2). A systematic literature review was conducted to identify relevant research evaluating the significance of genetic variants predictive of altered statin concentrations and subsequent statin-related myopathy. Studies eligible for inclusion must have incorporated genotype information and must have associated it with some measure of myopathy, either creatine kinase levels or self-reported muscle aches and pains. After an initial review, focus was placed on seven genes that were adequately characterized to provide a substantive review: CYP2D6, CYP3A4, CYP3A5, GATM, SLCO1B1, ABCB1, and ABCG2. All statins were included in this review. Among the genetic factors evaluated, statin-related myopathy appears to be most strongly associated with variants in SLCO1B1. PMID:24810685

  7. Tc-99m ECD brain SPECT in MELAS syndrome and mitochondrial myopathy: comparison with MR findings

    International Nuclear Information System (INIS)

    Park, Sang Joon; Ryu, Young Hoon; Jeon, Tae Joo; Kim, Jai Keun; Nam, Ji Eun; Yoon, Pyeong Ho; Yoon, Choon Sik; Lee, Jong Doo

    1998-01-01

    We evaluated brain perfusion SPECT findings of MELAS syndrome and mitochondrial myopathy in correlation with MR imaging in search of specific imaging features. Subjects were five patients (four females and one male; age range, 1 to 25 year) who presented with repeated stroke like episodes, seizures or developmental delay or asymptomatic but had elevated lactic acid in CSF and serum. Conventional non-contrast MR imaging and Tc-99m-ethyl cysteinate dimer (ECD) brain perfusion SPECT were performed and imaging features were analyzed. MRI demonstrated increased T2 signal intensities in the affected areas of gray and white matters mainly in the parietal (4/5) and occipital lobes (4/5) and in the basal ganglia (1/5), which were not restricted to a specific vascular territory. SPECT demonstrated decreased perfusion in the corresponding regions of MRI lesions. In addition, there were perfusion defects in parietal (1 patient), temporal (2), and frontal (1) lobes and basal ganglia (1) and thalami (2). In a patient with mitochondrial myopathy who had normal MRI, decreased perfusion was noted in left parietal area and bilateral thalami. Tc-99m ECD SPECT imaging in patients with MELAS syndrome and mitochondrial myopathy showed hypoperfusion of parieto-occipital cortex, basal ganglia, thalamus and temporal cortex, which were not restricted to a specific vascular territory. There were no specific imaging features on SPECT. The significance of abnormal perfusion on SPECT without corresponding MR abnormalities needs to be evaluated further in larger number of patients

  8. [Value of MRI in the treatment of Grave's disease orbital myopathy].

    Science.gov (United States)

    Oğuz, V; Yolar, M; Yetik, H; Cakirer, D; Uysal, O; Pazarli, H

    2001-10-01

    In order to evaluate the predictability of the results in the treatment of myopathy in cases with the clinical signs of muscle involvement, 177 extraocular muscles of 27 cases whose oedematous status was detected by MRI and who were given antiinflammatory treatment according to the data of this method, were studied. The nature of involvement was detected in respect with the signal intensity and thickness of each rectus muscle prior to the treatment and at the end of the sixth month following a three months' application of combined treatment of steroids and irradiation of 2000 rads. When the initial and final results were compared, the signal intensities of four involved recti showed significant decrease at the end of the treatment, as they were evaluated separately or together. Besides the thicknesses of these groups of involved recti which were evaluated separately showed significant decrease. The evaluation of the signal intensities by MRI is a way that enables noninvasive detection of the edema and prediction of the anti-inflammatory treatment's results of dysthyroid myopathy. Therefore a systematic follow up by MRI is recommended for the treatment choice in dysthyroid myopathy.

  9. Stochastic quantization for the axial model

    International Nuclear Information System (INIS)

    Farina, C.; Montani, H.; Albuquerque, L.C.

    1991-01-01

    We use bosonization ideas to solve the axial model in the stochastic quantization framework. We obtain the fermion propagator of the theory decoupling directly the Langevin equation, instead of the Fokker-Planck equation. In the Appendix we calculate explicitly the anomalous divergence of the axial-vector current by using a regularization that does not break the Markovian character of the stochastic process

  10. Health and imaging outcomes in axial spondyloarthritis

    NARCIS (Netherlands)

    Machado, P.M.

    2016-01-01

    This thesis focuses on the assessment and monitoring of health and imaging outcomes in axial spondyloarthritis (SpA) and the relationship between these outcomes. Four major contributions to the understanding and management of axial SpA were made: 1) the improvement and facilitation of the assessment

  11. Actin Nemaline Myopathy Mouse Reproduces Disease, Suggests Other Actin Disease Phenotypes and Provides Cautionary Note on Muscle Transgene Expression

    Science.gov (United States)

    Ravenscroft, Gianina; Jackaman, Connie; Sewry, Caroline A.; McNamara, Elyshia; Squire, Sarah E.; Potter, Allyson C.; Papadimitriou, John; Griffiths, Lisa M.; Bakker, Anthony J.; Davies, Kay E.; Laing, Nigel G.; Nowak, Kristen J.

    2011-01-01

    Mutations in the skeletal muscle α-actin gene (ACTA1) cause congenital myopathies including nemaline myopathy, actin aggregate myopathy and rod-core disease. The majority of patients with ACTA1 mutations have severe hypotonia and do not survive beyond the age of one. A transgenic mouse model was generated expressing an autosomal dominant mutant (D286G) of ACTA1 (identified in a severe nemaline myopathy patient) fused with EGFP. Nemaline bodies were observed in multiple skeletal muscles, with serial sections showing these correlated to aggregates of the mutant skeletal muscle α-actin-EGFP. Isolated extensor digitorum longus and soleus muscles were significantly weaker than wild-type (WT) muscle at 4 weeks of age, coinciding with the peak in structural lesions. These 4 week-old mice were ∼30% less active on voluntary running wheels than WT mice. The α-actin-EGFP protein clearly demonstrated that the transgene was expressed equally in all myosin heavy chain (MHC) fibre types during the early postnatal period, but subsequently became largely confined to MHCIIB fibres. Ringbinden fibres, internal nuclei and myofibrillar myopathy pathologies, not typical features in nemaline myopathy or patients with ACTA1 mutations, were frequently observed. Ringbinden were found in fast fibre predominant muscles of adult mice and were exclusively MHCIIB-positive fibres. Thus, this mouse model presents a reliable model for the investigation of the pathobiology of nemaline body formation and muscle weakness and for evaluation of potential therapeutic interventions. The occurrence of core-like regions, internal nuclei and ringbinden will allow analysis of the mechanisms underlying these lesions. The occurrence of ringbinden and features of myofibrillar myopathy in this mouse model of ACTA1 disease suggests that patients with these pathologies and no genetic explanation should be screened for ACTA1 mutations. PMID:22174871

  12. Axial anomalies of Lifshitz fermions

    CERN Document Server

    Bakas, Ioannis

    2011-01-01

    We compute the axial anomaly of a Lifshitz fermion theory with anisotropic scaling z=3 which is minimally coupled to geometry in 3+1 space-time dimensions. We find that the result is identical to the relativistic case using path integral methods. An independent verification is provided by showing with spectral methods that the eta-invariant of the Dirac and Lifshitz fermion operators in three dimensions are equal. Thus, by the integrated form of the anomaly, the index of the Dirac operator still accounts for the possible breakdown of chiral symmetry in non-relativistic theories of gravity. We apply this framework to the recently constructed gravitational instanton backgrounds of Horava-Lifshitz theory and find that the index is non-zero provided that the space-time foliation admits leaves with harmonic spinors. Using Hitchin's construction of harmonic spinors on Berger spheres, we obtain explicit results for the index of the fermion operator on all such gravitational instanton backgrounds with SU(2)xU(1) isom...

  13. Referral patterns, diagnosis, and disease management of patients with axial spondyloarthritis: results of an international survey.

    Science.gov (United States)

    van der Heijde, Désirée; Sieper, Joachim; Elewaut, Dirk; Deodhar, Atul; Pangan, Aileen L; Dorr, Alexander P

    2014-12-01

    Recognition, diagnosis, and management of axial spondyloarthritis (axial SpA) continue to advance. The objectives of this study were to compare referrals, diagnosis, and management of axial SpA in Western Europe (WE), North America (US and Canada), and the rest of world (RoW) in academic and community rheumatology practices and to identify areas for further education. Rheumatologists responded online to the MAXIMA (Management of Axial SpA International and Multicentric Approaches) survey. Questions pertained to referral, diagnosis, and management of axial SpA. Rheumatologists (N = 809) from 56 countries completed the survey about patients with chronic back pain (≥3 months) starting before age 45 years. Responses from academic and community practice rheumatologists were generally similar. Most referrals were from primary care providers. Symptom duration of 3 years or more at referral was reported more frequently by WE and RoW than US respondents. More WE and RoW than US rheumatologists referred to the Assessment of SpondyloArthritis International Society criteria for axial SpA in clinical practice. Rheumatologists reported prescribing disease-modifying antirheumatic drugs for the management of axial SpA. Sulfasalazine was frequently prescribed across regions; methotrexate was more commonly prescribed by US rheumatologists compared with other regions. Referral patterns, diagnosis, and disease management for axial SpA were similar among WE, North America, and RoW rheumatologists and in academic/community practices, although more WE and RoW rheumatologists referred to Assessment of SpondyloArthritis International Society criteria in clinical practice. Disease-modifying antirheumatic drugs were commonly prescribed for axial SpA patients, although it was unclear whether these were prescribed for axial or peripheral symptoms.

  14. Effects of reduced dietary energy and amino acid density on Pectoralis major myopathies in broiler chickens at 36 and 49 days of age1.

    Science.gov (United States)

    Meloche, K J; Fancher, B I; Emmerson, D A; Bilgili, S F; Dozier, W A

    2018-05-01

    Two experiments (Exp) were conducted to determine if reductions in the incidence and severity of wooden breast (WB) and white striping (WS) may be obtained by reducing dietary nutrient density. In each Exp, Yield Plus × Ross 708 male broiler chicks were placed into 63 pens (22 birds/pen). All birds received an identical prestarter diet until 7 d of age, after which time each pen was randomly assigned to 1 of the following 7 dietary treatments (TRT) for the starter (8 to 14 d), grower (15 to 24 d), finisher 1 (Exp 1: 26 to 35 d; Exp 2: 26 to 42 d), and withdrawal (Exp 2: 43 to 48 d) phases: 1) 100% of primary breeder recommendations for digestible amino acid and metabolizable energy density throughout Exp; 2) 95% of TRT 1 until 14 d of age, then as TRT 1; 3) 95% of TRT 1 until 24 d of age, then as TRT 1; 4) 95% of TRT 1 throughout Exp; 5) 90% of TRT 1 until 14 d of age, then as TRT 1; 6) 90% of TRT 1 until 24 d of age, then as TRT 1; 7) 90% of TRT 1 throughout Exp. At 36 d (Exp 1) and 49 d (Exp 2), 18 birds per pen were processed and evaluated for WS and WB. In Exp 1, reduced dietary density in the starter phase (TRT 2 and TRT 5) resulted in increased (P ≤ 0.05) incidences of severe WB (32.9% and 34.7%) relative to TRT 1 (18.2%). In Exp 2, broilers assigned to TRT 7 had reduced (P 36.5%; WS: 64.5%). In both Exp, plasma creatine kinase and lactate dehydrogenase increased (P ≤ 0.05) with increasing scores for WB and WS. Reducing dietary nutrient density from 8 to 14 d may exacerbate fillet myopathies in broilers reared to 35 d of age. Although reducing dietary energy and amino acid density to 90% of recommendations from 1 to 48 d reduced the severity of myopathies, these reductions occurred with compromises in live performance. Altogether, these results indicated that concurrent manipulation of dietary amino acid and energy density is not a viable practical solution for breast myopathies.

  15. Modernity: A new axial (era culture?

    Directory of Open Access Journals (Sweden)

    Wolfgang Schluchter

    2017-10-01

    Full Text Available The proposition of an axial age, lasting roughly from 800 to 200 B.C. and occurring in major civilizations (China, India, Near East independent of each other, first introduced by Alfred Weber and Karl Jaspers, then further developed by Robert Bellah and S. N. Eisenstadt among others, implied from the outset the question whether there has been a second axial age, leading to modernity, and if so, whether this second axial age consists in a secularization of the achievements of the first axial age. In this article it is argued that the notion of a second axial age is meaningful, but that the emergence of modernity can›t be accounted for in terms of secularization of the achievements of the first axial age. Rather, a new axial principle was institutionalized which separates the modern from the premodern world. This new principle is spelled out with reference to Hans Blumenberg, Charles Taylor and especially Max Weber. The emphasis is on the dialectics of disenchantment and the place of religion in a secular age

  16. Diagnosis of myocardial involvement in patients with systemic myopathies with 15-(p-[I-123]iodophenyl) pentadecanoic acid (IPPA) SPECT

    Energy Technology Data Exchange (ETDEWEB)

    Kropp, J.; Briele, B.; Smekal, A.V.; Hotze, A.L.; Biersack, H.J.; Koehler, U.; Zierz, St. [Bonn Univ. (Germany); Knapp, F.F. [Oak Ridge National Lab., TN (United States)

    1992-03-01

    Involvement of the myocardium in non-infectious myopathies presents in most cases as systolic dysfunction or a disturbed cardiac rhythm. We are interested in exploring how often cardiac involvement can be evaluated with various diagnostic techniques in patients with proven myopathy. We investigated 41 patients with myopathies of various etiology, including mitochondrial and congenital myopathies, Curshmann-Steinert disease, muscular dystrophy, and others. Myopathy was proven by muscular biopsy usually from the bicep. Fatty acid imaging was performed with 15-(p-[I-123]iodophenyl)pentadecanoic acid (IP-PA) and sequential SPECT-scintigraphy with a 180 deg. rotation starting at the 45 deg. RAO position. 190 MBq were injected at the maximal stage of a submaximal exercise. Filtered backprojection and reorientation of the slices were achieved by standard techniques. The quantitative comparison of the oblique slices (bulls-eye technique) of the SPECT-studies revealed turnover-rates as a qualitative measure of {beta}-oxidation. Serum levels of lactate (L), pyruvate (P), glucose (G) and triglycerides (TG) were measured at rest and stress. Ventricular function was investigated by radionuclide ventriculography (MUGA) at rest and under stress with Tc-99m labeled red blood cells. In addition, ECG, 24 hour-ECG, and echocardiography were also performed with standard techniques.

  17. Diagnosis of myocardial involvement in patients with systemic myopathies with 15-(p-(I-123)iodophenyl) pentadecanoic acid (IPPA) SPECT

    Energy Technology Data Exchange (ETDEWEB)

    Kropp, J.; Briele, B.; Smekal, A.V.; Hotze, A.L.; Biersack, H.J.; Koehler, U.; Zierz, St. (Bonn Univ. (Germany)); Knapp, F.F. (Oak Ridge National Lab., TN (United States))

    1992-01-01

    Involvement of the myocardium in non-infectious myopathies presents in most cases as systolic dysfunction or a disturbed cardiac rhythm. We are interested in exploring how often cardiac involvement can be evaluated with various diagnostic techniques in patients with proven myopathy. We investigated 41 patients with myopathies of various etiology, including mitochondrial and congenital myopathies, Curshmann-Steinert disease, muscular dystrophy, and others. Myopathy was proven by muscular biopsy usually from the bicep. Fatty acid imaging was performed with 15-(p-(I-123)iodophenyl)pentadecanoic acid (IP-PA) and sequential SPECT-scintigraphy with a 180 deg. rotation starting at the 45 deg. RAO position. 190 MBq were injected at the maximal stage of a submaximal exercise. Filtered backprojection and reorientation of the slices were achieved by standard techniques. The quantitative comparison of the oblique slices (bulls-eye technique) of the SPECT-studies revealed turnover-rates as a qualitative measure of {beta}-oxidation. Serum levels of lactate (L), pyruvate (P), glucose (G) and triglycerides (TG) were measured at rest and stress. Ventricular function was investigated by radionuclide ventriculography (MUGA) at rest and under stress with Tc-99m labeled red blood cells. In addition, ECG, 24 hour-ECG, and echocardiography were also performed with standard techniques.

  18. Diagnosis of myocardial involvement in patients with systemic myopathies with 15-(p-[I-123]iodophenyl) pentadecanoic acid (IPPA) SPECT

    International Nuclear Information System (INIS)

    Kropp, J.; Briele, B.; Smekal, A.V.; Hotze, A.L.; Biersack, H.J.; Koehler, U.; Zierz, St.; Knapp, F.F.

    1992-01-01

    Involvement of the myocardium in non-infectious myopathies presents in most cases as systolic dysfunction or a disturbed cardiac rhythm. We are interested in exploring how often cardiac involvement can be evaluated with various diagnostic techniques in patients with proven myopathy. We investigated 41 patients with myopathies of various etiology, including mitochondrial and congenital myopathies, Curshmann-Steinert disease, muscular dystrophy, and others. Myopathy was proven by muscular biopsy usually from the bicep. Fatty acid imaging was performed with 15-(p-[I-123]iodophenyl)pentadecanoic acid (IP-PA) and sequential SPECT-scintigraphy with a 180 deg. rotation starting at the 45 deg. RAO position. 190 MBq were injected at the maximal stage of a submaximal exercise. Filtered backprojection and reorientation of the slices were achieved by standard techniques. The quantitative comparison of the oblique slices (bulls-eye technique) of the SPECT-studies revealed turnover-rates as a qualitative measure of β-oxidation. Serum levels of lactate (L), pyruvate (P), glucose (G) and triglycerides (TG) were measured at rest and stress. Ventricular function was investigated by radionuclide ventriculography (MUGA) at rest and under stress with Tc-99m labeled red blood cells. In addition, ECG, 24 hour-ECG, and echocardiography were also performed with standard techniques

  19. Statin myopathy: the fly in the ointment for the prevention of cardiovascular disease in the 21st century?

    Science.gov (United States)

    Keen, Helen I; Krishnarajah, Janakan; Bates, Timothy R; Watts, Gerald F

    2014-09-01

    Cardiovascular disease (CVD) remains the leading cause of death in industrialized nations. Despite clear evidence of CVD risk reduction with HMG-CoA reductase inhibitors (statins), the side effects of these medications, particularly myopathy, limit their effectiveness. Studies into the mechanisms, aetiology and management of statin myopathy are limited by lack of an internationally agreed clinical definition and tools for assessing outcomes. Currently there is a paucity of evidence to guide the management of patients affected by statin myopathy; with the exception of dose reduction, there is little evidence that other strategies can improve statin tolerance, and even less evidence to suggest these alternate dosing strategies reduce cardiovascular risk. This review will cover current definitions, clinical presentations, risk factors, pathogenesis and management. PubMed was searched (English language, to 2014) for key articles pertaining to statin myopathy. This review then briefly describes our experience of managing this condition in a tertiary lipid disorders clinic, in the setting of limited guiding evidence. Knowledge gaps in the field of statin myopathy are identified and future research directions are suggested. We urge the need for international attention to address this important, but largely neglected clinical problem, that if unresolved will remain an impediment to the effective prevention and treatment of CVD.

  20. Development of submersible axial pump for wastewater

    Energy Technology Data Exchange (ETDEWEB)

    Yun, Jeong Eui [Kangwon Nat' l Univ., Chuncheon (Korea, Republic of)

    2013-02-15

    This study was performed to develop a high efficiency submersible axial pump for concentration wastewater treatment. To do this, we simulated the effect of some parameters such as the axial twist angle of a blade({beta}), the radial twist angle of a blade({alpha}) and the length of a blade ({iota}) on pump efficiency using commercial code, ANSYS CFX and BladeGen. The results showed that the axial twist angle of a blade({beta}) was the most sensible parameter on the pump efficiency. And the pump efficiency had a maximum at {beta}=20.deg, {alpha}=110.deg and {iota}=240mm.

  1. sizing of wind powered axial flux permanent magnet alternator using

    African Journals Online (AJOL)

    user

    2016-10-04

    Oct 4, 2016 ... Keywords: Wind-Power, Axial flux, Axial Flux Permanent Machines (AFPM), Axial Flux Permanent Magnet ... energy for power generation, a high constraint is the .... arrangements as Single-Rotor Single-Stator Structure.

  2. Axial power monitoring uncertainty in the Savannah River Reactors

    International Nuclear Information System (INIS)

    Losey, D.C.; Revolinski, S.M.

    1990-01-01

    The results of this analysis quantified the uncertainty associated with monitoring the Axial Power Shape (APS) in the Savannah River Reactors. Thermocouples at each assembly flow exit map the radial power distribution and are the primary means of monitoring power in these reactors. The remaining uncertainty in power monitoring is associated with the relative axial power distribution. The APS is monitored by seven sensors that respond to power on each of nine vertical Axial Power Monitor (APM) rods. Computation of the APS uncertainty, for the reactor power limits analysis, started with a large database of APM rod measurements spanning several years of reactor operation. A computer algorithm was used to randomly select a sample of APSs which were input to a code. This code modeled the thermal-hydraulic performance of a single fuel assembly during a design basis Loss-of Coolant Accident. The assembly power limit at Onset of Significant Voiding was computed for each APS. The output was a distribution of expected assembly power limits that was adjusted to account for the biases caused by instrumentation error and by measuring 7 points rather than a continuous APS. Statistical analysis of the final assembly power limit distribution showed that reducing reactor power by approximately 3% was sufficient to account for APS variation. This data confirmed expectations that the assembly exit thermocouples provide all information needed for monitoring core power. The computational analysis results also quantified the contribution to power limits of the various uncertainties such as instrumentation error

  3. VERY SLOW SPEED AXIAL MOTION RELUCTANCE MOTOR

    African Journals Online (AJOL)

    Dr Obe

    1984-09-01

    Sep 1, 1984 ... VERY SLOW SPEED AXIAL MOTION RELUCTANCE MOTOR by. L. A. Agu ... order as that of the screw-thread motor can be obtained. LIST OF .... The n stator have equal non- magnetic spacers .... induction motor. An.

  4. Precision axial translator with high stability.

    Science.gov (United States)

    Bösch, M A

    1979-08-01

    We describe a new type of translator which is inherently stable against torsion and twisting. This concentric translator is also ideally suited for precise axial motion with clearance of the center line.

  5. Axial force measurement for esophageal function testing

    DEFF Research Database (Denmark)

    Gravesen, Flemming Holbæk; Funch-Jensen, Peter; Gregersen, Hans

    2009-01-01

    force (force in radial direction) whereas the bolus moves along the length of esophagus in a distal direction. Force measurements in the longitudinal (axial) direction provide a more direct measure of esophageal transport function. The technique used to record axial force has developed from external...... force transducers over in-vivo strain gauges of various sizes to electrical impedance based measurements. The amplitude and duration of the axial force has been shown to be as reliable as manometry. Normal, as well as abnormal, manometric recordings occur with normal bolus transit, which have been...... documented using imaging modalities such as radiography and scintigraphy. This inconsistency using manometry has also been documented by axial force recordings. This underlines the lack of information when diagnostics are based on manometry alone. Increasing the volume of a bag mounted on a probe...

  6. Theorem on axially symmetric gravitational vacuum configurations

    Energy Technology Data Exchange (ETDEWEB)

    Papadopoulos, A; Le Denmat, G [Paris-6 Univ., 75 (France). Inst. Henri Poincare

    1977-01-24

    A theorem is proved which asserts the non-existence of axially symmetric gravitational vacuum configurations with non-stationary rotation only. The eventual consequences in black-hole physics are suggested.

  7. Skeletal muscle-specific HMG-CoA reductase knockout mice exhibit rhabdomyolysis: A model for statin-induced myopathy.

    Science.gov (United States)

    Osaki, Yoshinori; Nakagawa, Yoshimi; Miyahara, Shoko; Iwasaki, Hitoshi; Ishii, Akiko; Matsuzaka, Takashi; Kobayashi, Kazuto; Yatoh, Shigeru; Takahashi, Akimitsu; Yahagi, Naoya; Suzuki, Hiroaki; Sone, Hirohito; Ohashi, Ken; Ishibashi, Shun; Yamada, Nobuhiro; Shimano, Hitoshi

    2015-10-23

    HMG-CoA reductase (HMGCR) catalyzes the conversion of HMG-CoA to mevalonic acid (MVA); this is the rate-limiting enzyme of the mevalonate pathway that synthesizes cholesterol. Statins, HMGCR inhibitors, are widely used as cholesterol-reducing drugs. However, statin-induced myopathy is the most adverse side effect of statins. To eludicate the mechanisms underlying statin the myotoxicity and HMGCR function in the skeletal muscle, we developed the skeletal muscle-specific HMGCR knockout mice. Knockout mice exhibited postnatal myopathy with elevated serum creatine kinase levels and necrosis. Myopathy in knockout mice was completely rescued by the oral administration of MVA. These results suggest that skeletal muscle toxicity caused by statins is dependent on the deficiencies of HMGCR enzyme activity and downstream metabolites of the mevalonate pathway in skeletal muscles rather than the liver or other organs. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Buoyant Helical Twin-Axial Wire Antenna

    Science.gov (United States)

    2016-11-15

    February 2017 The below identified patent application is available for licensing. Requests for information should be addressed to...300169 1 of 9 BUOYANT HELICAL TWIN-AXIAL WIRE ANTENNA CROSS REFERENCE TO OTHER PATENT APPLICATIONS [0001] This application is a divisional...application and claims the benefit of the filing date of United States Patent Application No. 14/280,889; filed on May 19, 2014; and entitled “Twin-Axial

  9. Nonperturbative Aspects of Axial Vector Vertex

    Institute of Scientific and Technical Information of China (English)

    ZONG Hong-Shi; CHEN Xiang-Song; WANG Fan; CHANG Chao-Hsi; ZHAO En-Guang

    2002-01-01

    It is shown how the axial vector current of current quarks is related to that of constituent quarks within the framework of the global color symmetry model.Gluon dressing of the axial vector vertex and the quark self-energy functions are described by the inhomogeneous Bethe-Salpeter equation in the ladder approximation and the Schwinger Dyson equation in the rainbow approximation,respectively.

  10. High temperature co-axial winding transformers

    Science.gov (United States)

    Divan, Deepakraj M.; Novotny, Donald W.

    1993-01-01

    The analysis and design of co-axial winding transformers is presented. The design equations are derived and the different design approaches are discussed. One of the most important features of co-axial winding transformers is the fact that the leakage inductance is well controlled and can be made low. This is not the case in conventional winding transformers. In addition, the power density of co-axial winding transformers is higher than conventional ones. Hence, using co-axial winding transformers in a certain converter topology improves the power density of the converter. The design methodology used in meeting the proposed specifications of the co-axial winding transformer specifications are presented and discussed. The final transformer design was constructed in the lab. Co-axial winding transformers proved to be a good choice for high power density and high frequency applications. They have a more predictable performance compared with conventional transformers. In addition, the leakage inductance of the transformer can be controlled easily to suit a specific application. For space applications, one major concern is the extraction of heat from power apparatus to prevent excessive heating and hence damaging of these units. Because of the vacuum environment, the only way to extract heat is by using a cold plate. One advantage of co-axial winding transformers is that the surface area available to extract heat from is very large compared to conventional transformers. This stems from the unique structure of the co-axial transformer where the whole core surface area is exposed and can be utilized for cooling effectively. This is a crucial issue here since most of the losses are core losses.

  11. Dechanneling function for relativistic axially channeled electrons

    International Nuclear Information System (INIS)

    Muralev, V.A.; Telegin, V.I.

    1981-01-01

    Behaviour of the x(t) dechanneling function depending on the depth is theoretically studied. Theoretical consideration of x(t) for axial channeled relativistic electrons in anisotropic medium results in two-dimensional kinetic equation with mixed derivatives of the parabolic type. The kinetic equation in the approximation of the continuous Lindchard model for relativistic axial channeled electrons is numerically solved. The depth dependence of the x(t) dechanneling function is obtained [ru

  12. Axial forces in centrifugal compressor couplings

    Science.gov (United States)

    Ivanov, A. N.; Ivanov, N. M.; Yun, V. K.

    2017-08-01

    The article presents the results of the theoretical and experimental investigation of axial forces arising in the toothed and plate couplings of centrifugal compressor shaft lines. Additional loads on the thrust bearing are considered that can develop in the toothed couplings as a result of coupled rotors misalignment. Design relationships to evaluate the level of axial forces and recommendations for their reduction in the operating conditions are given.

  13. Singlet axial constant from QCD sum rules

    International Nuclear Information System (INIS)

    Belitskij, A.V.; Teryaev, O.V.

    1995-01-01

    We analyze the singlet axial form factor of the proton for small momentum transferred in the framework of QCD sum rules using the interpolating nucleon current which explicitly accounts for the gluonic degrees of freedom. As the result we come to the quantitative prediction of the singlet axial constant. It is shown that the bilocal power corrections play the most important role in the analysis. 21 refs., 3 figs

  14. Computer axial tomography in geosciences

    International Nuclear Information System (INIS)

    Duliu, Octavian G.

    2002-01-01

    Computer Axial Tomography (CAT) is one of the most adequate non-invasive techniques for the investigation of the internal structure of a large category of objects. Initially designed for medical investigations, this technique, based on the attenuation of X- or gamma-ray (and in some cases neutrons), generates digital images which map the numerical values of the linear attenuation coefficient of a section or of the entire volume of the investigated sample. Shortly after its application in medicine, CAT has been successfully used in archaeology, life sciences, and geosciences as well as for the industrial materials non-destructive testing. Depending on the energy of the utilized radiation as well as on the effective atomic number of the sample, CAT can provide with a spatial resolution of 0.01 - 0.5 mm, quantitative as well as qualitative information concerning local density, porosity or chemical composition of the sample. At present two types of axial Computer Tomographs (CT) are in use. One category, consisting of medical as well as industrial CT is equipped with X-ray tubes while the other uses isotopic gamma-ray sources. CT provided with intense X-ray sources (equivalent to 12-15 kCi or 450-550 TBq) has the advantage of an extremely short running time (a few seconds and even less) but presents some disadvantages known as beam hardening and absorption edge effects. These effects, intrinsically related to the polychromatic nature of the X-rays generated by classical tubes, need special mathematical or physical corrections. A polychromatic X-ray beam can be made almost monochromatic by means of crystal diffraction or by using adequate multicomponent filters, but these devices are costly and considerably diminish the output of X-ray generators. In the case of CT of the second type, monochromatic gamma-rays generated by radioisotopic sources, such as 169 Yb (50.4 keV), 241 Am (59 keV), 192 Ir (310.5 and 469.1 keV ) or 137 Cs (662.7 keV), are used in combination with

  15. Evaluation of inflammatory biomarkers associated with oxidative stress and histological assessment of magnetic therapy on experimental myopathy in rats.

    Science.gov (United States)

    Vignola, María Belén; Dávila, Soledad; Cremonezzi, David; Simes, Juan C; Palma, José A; Campana, Vilma R

    2012-12-01

    The effect of pulsed electromagnetic field (PEMF) therapy, also called magnetic therapy, upon inflammatory biomarkers associated with oxidative stress plasma fibrinogen, nitric oxide (NO), L-citrulline, carbonyl groups, and superoxide dismutase (SOD) was evaluated through histological assessment, in rats with experimental myopathy. The groups studied were: (A) control (intact rats that received PEMF sham exposures); (B) rats with myopathy and sacrificed 24 h later; (C) rats with myopathy; (D) rats with myopathy and treated with PEMF; and (E) intact rats treated with PEMF. Groups A, C, D, and E were sacrificed 8 days later. Myopathy was induced by injecting 50 μl of 1% carrageenan λ (type IV) once sub-plantar. Treatment was carried out with PEMF emitting equipment with two flat solenoid disks for 8 consecutive days in groups D and E, at 20 mT and 50 Hz for 30 min/day/rat. The biomarkers were determined by spectrophotometry. The muscles (5/8) were stained with Hematoxylin-Eosin and examined by optic microscopy. Quantitative variables were statistically analyzed by the Fisher test, and categorical applying Pearson's Chi Squared test at p < 0.05 for all cases. In Groups B and C, the biomarkers were significantly increased compared to A, D, and E groups: fibrinogen (p < 0.001); NO, L-citrulline and carbonyl groups (p < 0.05); SOD (p < 0.01) as well as the percentage of area with inflammatory infiltration (p < 0.001). PEMF caused decreased levels of fibrinogen, L-citrulline, NO, SOD, and carbonyl groups and significant muscle recovery in rats with experimental myopathies.

  16. Subclinical myopathy in patients with colorectal cancer: clinical-pathological characterization and search for tissue markers

    Directory of Open Access Journals (Sweden)

    Massimo Vecchiato

    2012-03-01

    Full Text Available Skeletal muscle in patients with cancer undergoes many morphological changes due to immuno-inflammatory factors of tumor origin or treatment.T he latest event of these changes is cancer cachexia. Aim of the study is to identify myopathic features in skeletal muscle biopsies from weight stable patients with colorectal cancer and without cachexia or asthenia / weakness, that could possibly provide new diagnostic and prognostic cancer biomarkers. Morphometric analyses and immunohistochemical studies were performed on intraoperative muscle biopsies from patients with colorectal cancer and from weight stable patients undergoing surgery for benign non-inflammatory conditions. A rectus abdominis biopsy was taken in all patients and controls.A correlation between histopathologic findings and clinical characteristics, circulating inflammatory biomarkers and markers of muscle necrosis,surgery data and cancer phenotype were investigated.. Forty four patients (21male/23 female and 17 controls (6 male/11 female (p=NS were studied. In cancer patients’biopsies we observed asubclinical myopathy characterized by an abnormal distribution of myonuclei, which are localized inside the myofiber rather than at the periphery, and by the presence of regenerating muscle fibers. The percentage of myofibers with internalized nuclei is significantly higher in patients (median= 9%, IQR= 3.7-18.8 than in controls (median= 2.7%, IQR= 1.7-3.2 ( p=0.0002. In patients we observed an inverse correlation between the number of centronucleated fibers and the presence of node metastasis (N+(ρ=-0.64 (p=0.002. Patients affected with colorectal cancer display early sign of a myopathy, characterized by centronucleated and regenerating myofibers. This myopathy appears to be associated with an early stage of neoplasia and it could be an adaptive response of muscle to cancer. We hope a future application of these findings as a possible early diagnostic and prognostic biomarker of

  17. Acquired multiple Acyl-CoA dehydrogenase deficiency in 10 horses with atypical myopathy.

    Science.gov (United States)

    Westermann, C M; Dorland, L; Votion, D M; de Sain-van der Velden, M G M; Wijnberg, I D; Wanders, R J A; Spliet, W G M; Testerink, N; Berger, R; Ruiter, J P N; van der Kolk, J H

    2008-05-01

    The aim of the current study was to assess lipid metabolism in horses with atypical myopathy. Urine samples from 10 cases were subjected to analysis of organic acids, glycine conjugates, and acylcarnitines revealing increased mean excretion of lactic acid, ethylmalonic acid, 2-methylsuccinic acid, butyrylglycine, (iso)valerylglycine, hexanoylglycine, free carnitine, C2-, C3-, C4-, C5-, C6-, C8-, C8:1-, C10:1-, and C10:2-carnitine as compared with 15 control horses (12 healthy and three with acute myopathy due to other causes). Analysis of plasma revealed similar results for these predominantly short-chain acylcarnitines. Furthermore, measurement of dehydrogenase activities in lateral vastus muscle from one horse with atypical myopathy indeed showed deficiencies of short-chain acyl-CoA dehydrogenase (0.66 as compared with 2.27 and 2.48 in two controls), medium-chain acyl-CoA dehydrogenase (0.36 as compared with 4.31 and 4.82 in two controls) and isovaleryl-CoA dehydrogenase (0.74 as compared with 1.43 and 1.61 nmol min(-1) mg(-1) in two controls). A deficiency of several mitochondrial dehydrogenases that utilize flavin adenine dinucleotide as cofactor including the acyl-CoA dehydrogenases of fatty acid beta-oxidation, and enzymes that degrade the CoA-esters of glutaric acid, isovaleric acid, 2-methylbutyric acid, isobutyric acid, and sarcosine was suspected in 10 out of 10 cases as the possible etiology for a highly fatal and prevalent toxic equine muscle disease similar to the combined metabolic derangements seen in human multiple acyl-CoA dehydrogenase deficiency also known as glutaric acidemia type II.

  18. Autism in the Son of a Woman with Mitochondrial Myopathy and Dysautonomia: A Case Report.

    Science.gov (United States)

    Brown, Bradley D; Rais, Theodore

    2015-01-01

    The relationship between autism spectrum disorders and mitochondrial dysfunction, including mitochondrial myopathies and other mitochondrial diseases, is an area of ongoing research. All autism spectrum disorders are known to be heritable, via genetic and/or epigenetic mechanisms, but specific modes of inheritance are not well characterized. Nevertheless, autism spectrum disorders have been linked to many specific genes associated with mitochondrial function, especially to genes involved in mitochondrial tRNA and the electron transport chain, both particularly vulnerable to point mutations, and clinical research also supports a relationship between the two pathologies. Although only a small minority of patients with autism have a mitochondrial disease, many patients with mitochondrial myopathies have autism spectrum disorder symptoms, and these symptoms may be the presenting symptoms, which presents a diagnostic challenge for clinicians. The authors report the case of a 15-year-old boy with a history of autism spectrum disorder and neurocardiogenic syncope, admitted to the inpatient unit for self-injury, whose young mother, age 35, was discovered to suffer from mitochondrial myopathy, dysautonomia, neurocardiogenic syncope, Ehler-Danlos syndrome, and other uncommon multisystem pathologies likely related to mitochondrial dysfunction. This case illustrates the need for a high index of suspicion for mitochondrial disease in patients with autism, as they have two orders of magnitude greater risk for such diseases than the general population. The literature shows that mitochondrial disease is underdiagnosed in autism spectrum disorder patients and should not be viewed as a "zebra" (i.e., an obscure diagnosis that is made when a more common explanation is more likely).

  19. Craniopharyngioma presenting with severe hyponatremia, hyponatremia-induced myopathy, and panhypopituitarism: a case report.

    Science.gov (United States)

    Dilrukshi, M D S A; Sandakumari, G V N; Abeysundara, P K; Chang, T

    2017-02-05

    Craniopharyngiomas are rare intracranial tumors commonly presenting with neurological symptoms. Reports of severe hyponatremia as a presenting manifestation of a craniopharyngioma and hyponatremia-induced myopathy are rare. We report the case of a patient with craniopharyngioma presenting with severe hyponatremia, panhypopituitarism, and hyponatremia-induced myopathy. A 52-year-old Sri Lankan man presented with anorexia, nausea, fatigue, generalized muscle weakness, and cramps for 1 week. The onset of his illness had been preceded by vomiting and diarrhea for 1 day which he attributed to food poisoning. On examination, he had an apathetic disposition with a generalized "sallow complexion." He was not dehydrated. Apart from reduced muscle power (4/5) and hyporeflexia, the neurological examination was normal. His serum sodium was 102 mmol/l; potassium 4.1 mmol/l; chloride 63 mmol/l; plasma osmolality 272 mosm/KgH 2 O; urine osmolality 642 mosm/KgH 2 O; and urine sodium 79 mmol/l. His creatine phosphokinase was 12,400 U/l, lactate dehydrogenase 628 U/l, aspartate aminotransferase 360 U/l, and alanine aminotransferase 64 U/l. His hormone profile revealed panhypopituitarism. An electromyogram showed nonspecific abnormalities while a muscle biopsy did not show any pathology. Magnetic resonance imaging of his brain demonstrated a well-defined craniopharyngioma with suprasellar extension. His pituitary gland was compressed and the pituitary stalk was displaced by the tumor. He had marked improvement in muscle power and rapid reduction of serum creatine phosphokinase levels paralleling the correction of severe hyponatremia, even before the initiation of hormone replacement. This case illustrates the rare presentation of severe hyponatremia and hyponatremia-induced myopathy in patients with craniopharyngioma, awareness of which would facilitate early appropriate investigations and treatment.

  20. Equine atypical myopathy caused by hypoglycin A intoxication associated with ingestion of sycamore maple tree seeds.

    Science.gov (United States)

    Żuraw, A; Dietert, K; Kühnel, S; Sander, J; Klopfleisch, R

    2016-07-01

    Evidence suggest there is a link between equine atypical myopathy (EAM) and ingestion of sycamore maple tree seeds. To further evaluate the hypothesis that the ingestion of hypoglycin A (HGA) containing sycamore maple tree seeds causes acquired multiple acyl-CoA dehydrogenase deficiency and might be associated with the clinical and pathological signs of EAM. Case report. Necropsy and histopathology, using hematoxylin and eosin and Sudan III stains, were performed on a 2.5-year-old mare that died following the development of clinical signs of progressive muscle stiffness and recumbency. Prior to death, the animal ingested sycamore maple tree seeds (Acer pseudoplatanus). Detection of metabolites in blood and urine obtained post mortem was performed by rapid ultra-performance liquid chromatography-tandem mass spectrometry. Data from this case were compared with 3 geldings with no clinical history of myopathy. Macroscopic examination revealed fragments of maple tree seeds in the stomach and severe myopathy of several muscle groups including Mm. intercostales, deltoidei and trapezii. Histologically, the affected muscles showed severe, acute rhabdomyolysis with extensive accumulation of finely dispersed fat droplets in the cytoplasm of degenerated skeletal muscle cells not present in controls. Urine and serum concentrations of several acyl carnitines and acyl glycines were increased, and both contained metabolites of HGA, a toxic amino acid present in sycamore maple tree seeds. The study supports the hypothesis that ingestion of HGA-containing maple tree seeds may cause EAM due to acquired multiple acyl-CoA dehydrogenase deficiency. © 2015 EVJ Ltd.

  1. Toxic myopathies: muscle biopsy features Miopatia tóxica: biópsia muscular

    Directory of Open Access Journals (Sweden)

    Rosana Herminia Scola

    2007-03-01

    Full Text Available Several drugs and toxic substances can cause muscular abnormalities and are frequent causes of acquired myopathies. We present a series of 32 patients, predominance of young adult patients, diagnosed with toxic myopathy. The most common substances inducing myopathy were corticosteroids (56.2% followed by the propoxyphene, neuroleptics, zidovudine and drug-induced hypokalemia. The investigation showed normal serum creatine kinase levels in 65.4%, myopathic pattern of the needle electromyography in 40% and the more frequent histological diagnosis of the muscle biopsy was type 2 fiber atrophy (59.3%. Clinical features, etiology, course of the disease, serum levels of muscular enzymes, electromyographic features and, especially, muscle biopsy features are discussed.Diversos medicamentos e substâncias tóxicas podem causar alterações musculares e são causas freqüentes de miopatia adquirida. Apresentamos uma série de 32 pacientes, predomínio de pacientes adulto jovens, com miopatia tóxica. As substâncias mais relacionadas com a miopatia foram os corticosteróides (56,2% seguidos pelo propoxifeno, neurolépticos, zidovudina e drogas indutoras de hipocalemia. A investigação mostrou níveis normais de creatino quinase sérica em 65,4%, eletromiografia de agulha com padrão miopático em 40% e o mais freqüente diagnóstico histológico da biópsia muscular foi atrofia de fibras do tipo 2 (59,3%. As manifestações clínicas, etiologia, tempo de evolução, nível sérico das enzimas musculares, alterações da eletroneuromiografia e, especialmente, da biópsia muscular são discutidos.

  2. A Case of Myopathy, Encephalopathy, Lactic Acidosis and Stroke-Like Episodes (MELAS) Syndrome with Intracardiac Thrombus [corrected].

    Science.gov (United States)

    Joo, Jung-Chul; Seol, Myung Do; Yoon, Jin Won; Lee, Young Soo; Kim, Dong-Keun; Choi, Yong Hoon; Ahn, Hyo Seong; Cho, Wook Hyun

    2013-03-01

    Myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS) is a multisystem clinical syndrome manifested by mitochondrial myopathy, encephalopathy, lactic acidosis and recurrent stroke-like episodes. A 27-year-old female with MELAS syndrome presented with cerebral infarction. Echocardiography revealed a thrombus attached to the apex of the hypertrophied left ventricle, with decreased systolic function. The embolism of the intracardiac thrombus might have been the cause of stroke. There should be more consideration given to the increased possibility of intracardiac thrombus formation when a MELAS patient with cardiac involvement is encountered.

  3. Hyperquenched hyaloclastites from Axial Seamount

    Science.gov (United States)

    Zezin, D.; Helo, C.; Richard, D.; Clague, D. A.; Dingwell, D. B.; Stix, J.

    2009-12-01

    We determined apparent cooling rates for basaltic hyaloclastites from Axial caldera, Juan de Fuca Ridge. Samples originate from different stratigraphic layers within the unconsolidated volcaniclastic sequences, on flanks of the volcanic edifice. Water depth is ~1400 m below sea level. The hyaloclastite glass fragments comprise two principal morphologies: (1) angular fragments, and (2) thin glassy melt films interpreted as bubble walls, called deep-sea limu o Pele. A natural cooling rate was estimated for each sample of ~50 carefully selected glass shards. The heat capacity was first measured with a differential scanning calorimeter in two heating scans with heating rates of 20 K/min, and a matching cooling rate between those scans. The fictive temperatures Tf were then determined from both heating cycles, and the natural cooling rate derived by the non-Arrhenian relationship between Tf and cooling rate. All samples display hyperquenched states, manifested in a strong exothermic energy release during the initial heating cycle before reaching the glass transition. Cooling rates range from 10 6.73 K/s to 10 3.94 K/s for the limu, and 10 4.92 K/s to 10 2.34 K/s for the angular fragments. Almost all samples of limu shards show elevated cooling rates compared to their angular counterparts of comparable grain mass. In addition, the exothermic part of the enthalpy curves reveal two superimposed relaxation domains, the main broad exothermal peak, ranging from ~350 K to the onset of the glass transition, and a small subordinate peak/shoulder occurring between 550 K and 700 K. The magnitude of the latter varies from clearly identifiable to nearly absent, and tends to be more pronounced in curves obtained from angular fragments. The main exothermal peak is related to the frozen-in structure of the glass and consequently to its thermal history when passing through the glass transition. The subordinate peak may represent strain rate-induced and tensile stress accumulation

  4. X linked neonatal centronuclear/myotubular myopathy: evidence for linkage to Xq28 DNA marker loci.

    OpenAIRE

    Thomas, N S; Williams, H; Cole, G; Roberts, K; Clarke, A; Liechti-Gallati, S; Braga, S; Gerber, A; Meier, C; Moser, H

    1990-01-01

    We have studied the inheritance of several polymorphic Xq27/28 DNA marker loci in two three generation families with the X linked neonatal lethal form of centronuclear/myotubular myopathy (XL MTM). We found complete linkage of XLMTM to all four informative Xq28 markers analysed, with GCP/RCP (Z = 3.876, theta = 0.00), with DXS15 (Z = 3.737, theta = 0.00), with DXS52 (Z = 2.709, theta = 0.00), and with F8C (Z = 1.020, theta = 0.00). In the absence of any observable recombination, we are unable...

  5. Serum and tissue markers of myopathy in patients with colorectal cancer

    Directory of Open Access Journals (Sweden)

    Nicoletta Adami

    2012-09-01

    Full Text Available Skeletal muscles in patients with cancer undergo many changes due to immuno-inflammatory factors of tumor origin, or to chemotherapy and irradiation. Aim of the present study is to identify serological biomarkers and early myopathic features in skeletal muscle biopsies from weight stable patients bearing colorectal cancer at the onset of disease. Morphometric analyses by histochemistry and immunohistochemistry were performed on intraoperative muscle biopsies from patients with early colorectal cancer and from weight stable patients undergoing surgery for benign non-inflammatory conditions. Serological analyses for testing markers of inflammation (C Reactive Protein, CRP, muscle enzymes, (Creatin Kinase, CK, soluble isoforms of adhesion molecules (Neural Cell Adhesion Molecule, NCAM, and a marker of protein turnover (prealbumin, a typical indicator of caloric and protein malnutrition were also performed. Fifty oncologic patients (28 male/22 female and 25 non oncologic patients (18 male/7 female (p=N.S. were studied. In muscles from cancer patients we observed a subclinical myopathy characterized by an abnormal distribution of myonuclei. The percentage of myofibers with internalized nuclei was significantly higher in oncologic (median= 13.1%, IQR= 6.0-20.3 than in non oncologic patients (median= 3%, IQR= 2.5-6.1 (p<0.0001. The frequency of these internally nucleated myofibers is even higher in a subgroup of oncologic patients taking myotoxic drugs. In cancer patients, we observed an inverse correlation between the number of internally nucleated fibers and the presence of node metastasis (N+ (ρ=-0.30 (p=0.03. Moreover, in patients with colorectal cancer, low serum levels of preoperative prealbumin (median= 167,7 mg/L, normal range 200-400 mg/L, were detected. The link between the observed early myopathy and long-term cachexia is supported also by the altered expression of sarcolemma associated proteins, in particular laminin and dystrophin

  6. Miopatia por corpos esferóides: relato de caso Spheroid body myopathy: case report

    Directory of Open Access Journals (Sweden)

    Rosana Hermínia Scola

    2005-06-01

    Full Text Available A miopatia por corpos esferóides é doença rara, classificada no grupo das miopatias congênitas relacionadas aos distúrbios da desmina; apresenta, em geral, origem autossômica dominante e com início dos sintomas na fase adulta. Relatamos o caso de menina de sete anos, com diparesia facial, hipotrofia e hipotonia muscular generalizadas, arreflexia profunda generalizada, força muscular proximal nos membros superiores e inferiores e distal dos membros superiores grau 3 e distal nos membros inferiores grau 1. A eletromiografia de agulha evidenciou recrutamento aumentado e potenciais de unidade motora de curta duração e baixa amplitude, caracterizando um padrão miopático. A biópsia muscular revelou padrão misto para miopatia e desinervação e presença de corpos esferóides intracitoplasmáticos compatíveis com a miopatia por corpos esferóides. No presente caso, a paciente apresentou precocemente o início dos sintomas e não há relatos de casos semelhantes na família.Spheroid body myopathy is a rare illness classified in the group of the congenital myopathies as a desmin-related neuromuscular disorder, presenting dominant autosomical origin with the beginning of the symptoms in the adult phase. We report on a seven years old girl with facial paresia, generalized muscular hypotrophy and hypotony, generalized deep areflexia, proximal upper and lower limbs muscular strengh and distal upper limbs grade 3 and distal lower limbs grade 1. Needle electromyography evidenced increased conscription and potentials of motor unit of short duration and low amplitude, characterizing a myopathic standard. The muscle biopsy disclosed mixed standard to myopathy, denervation and inclusion bodies that are consistent to spheroid body myopathy. In this case, the patient presented, in advance, early beginning of the symptoms and there are no similar cases in the family.

  7. Severe insulin-resistant diabetes mellitus in patients with congenital muscle fiber type disproportion myopathy

    DEFF Research Database (Denmark)

    Vestergaard, H; Klein, H H; Hansen, T

    1995-01-01

    Congenital muscle fiber type disproportion myopathy (CFTDM) is a chronic, nonprogressive muscle disorder characterized by universal muscle hypotrophy and growth retardation. Histomorphometric examination of muscle shows a preponderance of smaller than normal type 1 fibers and overall fiber size....... Insulin receptor function and glycogen synthase (GS) activity and expression were examined in biopsies of vastus lateralis muscle. Despite a 45-90-fold increase in both fasting and postprandial serum insulin levels, both CFTDM patients had diabetes mellitus. Clamp studies revealed that the oldest boy had...

  8. Aerobic training in patients with anoctamin 5 myopathy and hyperckemia

    DEFF Research Database (Denmark)

    Vissing, Christoffer R; Preisler, Nicolai; Husu, Edith

    2014-01-01

    INTRODUCTION: Anoctamin 5 deficiency has recently been defined to cause limb-girdle muscular dystrophy type 2L (LGMD2L) with pronounced hyperCKemia. No treatment interventions have been made so far in this condition. METHODS: In 6 patients with LGMD2L, we studied the effect of home-based, pulse......-watch monitored, moderate-intensity exercise on a cycle ergometer for 30 minutes, 3 times weekly, for 10 weeks. Plasma creatine kinase (CK) was assessed before, during, and after the program as a marker of muscle damage. Primary outcome measures were maximum oxygen uptake (VO(2max)) and time in the 5-repetitions......-sit-to-stand test (FRSTST). RESULTS: Training resulted in improvements in VO(2max) (27 ± 7%; P = 0.0001) and FRSTST time (35 ± 12%; P = 0.007). Improvements in physiologic and functional muscle testing were accompanied by stable CK levels and no reports of adverse effects. CONCLUSIONS: These findings suggest...

  9. Vector and axial constants of the baryon decuplet

    International Nuclear Information System (INIS)

    Belyaev, V.M.; Blok, B.Y.; Kogan, Y.I.

    1985-01-01

    On the basis of the QCD sum rules for the polarization operator in external axial and vector fields we determine the vector and axial transition constants in the 3/2 + baryon decuplet. We show that the renormalization of the axial constant is due to the interaction of the external axial field with the quark condensate

  10. Δ(1232) Axial Charge and Form Factors from Lattice QCD

    International Nuclear Information System (INIS)

    Alexandrou, Constantia; Gregory, Eric B.; Korzec, Tomasz; Koutsou, Giannis; Negele, John W.; Sato, Toru; Tsapalis, Antonios

    2011-01-01

    We present the first calculation on the Δ axial vector and pseudoscalar form factors using lattice QCD. Two Goldberger-Treiman relations are derived and examined. A combined chiral fit is performed to the nucleon axial charge, N to Δ axial transition coupling constant and Δ axial charge.

  11. Using axial magnetized permanent rings to build axial gradient magnetic field

    International Nuclear Information System (INIS)

    Peng Quanling

    2003-01-01

    Axial field produced by an axially magnetized permanent ring was studied. For two permanent magnet rings, if they are magnetized in the same direction, a nearly uniform axial field can be produced; if they are magnetized in opposite direction, an axial gradient field can be produced in the region between the two permanent rings, with the field strength changing from -B 0 to B 0 . A high gradient axial magnetic field has been built by using two axially magnetized permanent rings, the measured field results agree with the PANDIRA calculation very well. It is desirable that the field gradient can be varied to match various requirements. A method to produce the variable gradient field is presented. Axial gradient field can also be used as a beam focusing facility for linear accelerator if axial periodic field can be produced. Its magnetic field is similar to that of a solenoid, in which, large stray field will leak to the outside environment. A method for shielding the outside stray field is discussed

  12. Optimization of residual heat removal pump axial thrust and axial bearing

    International Nuclear Information System (INIS)

    Schubert, F.

    1996-01-01

    The residual heat removal (RHR) pumps of German 1300 megawatt pressurized-water reactor (PWR) power plants are of the single stage end suction type with volute casing or with diffuser and forged circular casing. Due to the service conditions the pumps have to cover the full capacity range as well as a big variation in suction static pressure. This results in a big difference in the axial thrust that has to be borne by the axial bearing. Because these pumps are designed to operate without auxiliary systems (things that do not exist can not fail), they are equipped with antifriction bearings and sump oil lubrication. To minimize the heat production within the bearing casing, a number of PWR plants have pumps with combined axial/radial bearings of the ball type. Due to the fact that the maximum axial thrust caused by static pressure and hydrodynamic forces on the impeller is too big to be borne by that type of axial bearing, the impellers were designed to produce a hydrodynamic axial force that counteracts the static axial force. Thus, the resulting axial thrust may change direction when the static pressure varies

  13. Optimization of residual heat removal pump axial thrust and axial bearing

    Energy Technology Data Exchange (ETDEWEB)

    Schubert, F.

    1996-12-01

    The residual heat removal (RHR) pumps of German 1300 megawatt pressurized-water reactor (PWR) power plants are of the single stage end suction type with volute casing or with diffuser and forged circular casing. Due to the service conditions the pumps have to cover the full capacity range as well as a big variation in suction static pressure. This results in a big difference in the axial thrust that has to be borne by the axial bearing. Because these pumps are designed to operate without auxiliary systems (things that do not exist can not fail), they are equipped with antifriction bearings and sump oil lubrication. To minimize the heat production within the bearing casing, a number of PWR plants have pumps with combined axial/radial bearings of the ball type. Due to the fact that the maximum axial thrust caused by static pressure and hydrodynamic forces on the impeller is too big to be borne by that type of axial bearing, the impellers were designed to produce a hydrodynamic axial force that counteracts the static axial force. Thus, the resulting axial thrust may change direction when the static pressure varies.

  14. The Effect of the Wooden Breast Myopathy on Sarcomere Structure and Organization.

    Science.gov (United States)

    Velleman, Sandra G; Clark, Daniel L; Tonniges, Jeffrey R

    2018-03-01

    The wooden breast (WB) has been classically identified by the phenotypic presence of a wood-like pectoralis major (p. major) muscle. The WB-affected p. major muscle is characterized by necrotic muscle fibers and the replacement of muscle with connective tissue, water, and fat. The objective of the current study was to determine the effect of the WB myopathy on sarcomere organization by transmission electron microscopy. Sarcomere structure and organization were examined in two broiler lines with a high incidence of WB (Lines A and B) and another broiler line without WB (Line C). Affected muscle had an increase in smaller myofibers with diameters of 20 μm or less. Sarcomere organization decreased with fiber diameter in both Lines A and B. The structure and organization of sarcomeres in Line C were similar to WB-unaffected muscle in Lines A and B. Taken together, these data demonstrate that the WB myopathy detrimentally affects sarcomere organization in a broiler line-specific manner. Disorganization of sarcomere structure will affect the function of the p. major muscle as well as meat quality.

  15. A Nonsense Variant in the ACADVL Gene in German Hunting Terriers with Exercise Induced Metabolic Myopathy

    Directory of Open Access Journals (Sweden)

    Vincent Lepori

    2018-05-01

    Full Text Available Several enzymes are involved in fatty acid oxidation, which is a key process in mitochondrial energy production. Inherited defects affecting any step of fatty acid oxidation can result in clinical disease. We present here an extended family of German Hunting Terriers with 10 dogs affected by clinical signs of exercise induced weakness, muscle pain, and suspected rhabdomyolysis. The combination of clinical signs, muscle histopathology and acylcarnitine analysis with an elevated tetradecenoylcarnitine (C14:1 peak suggested a possible diagnosis of acyl-CoA dehydrogenase very long chain deficiency (ACADVLD. Whole genome sequence analysis of one affected dog and 191 controls revealed a nonsense variant in the ACADVL gene encoding acyl-CoA dehydrogenase very long chain, c.1728C>A or p.(Tyr576*. The variant showed perfect association with the phenotype in the 10 affected and more than 500 control dogs of various breeds. Pathogenic variants in the ACADVL gene have been reported in humans with similar myopathic phenotypes. We therefore considered the detected variant to be the most likely candidate causative variant for the observed exercise induced myopathy. To our knowledge, this is the first description of this disease in dogs, which we propose to name exercise induced metabolic myopathy (EIMM, and the identification of the first canine pathogenic ACADVL variant. Our findings provide a large animal model for a known human disease and will enable genetic testing to avoid the unintentional breeding of affected offspring.

  16. Homozygous LIPE mutation in siblings with multiple symmetric lipomatosis, partial lipodystrophy, and myopathy.

    Science.gov (United States)

    Zolotov, Sagit; Xing, Chao; Mahamid, Riad; Shalata, Adel; Sheikh-Ahmad, Mohammed; Garg, Abhimanyu

    2017-01-01

    Despite considerable progress in identifying causal genes for lipodystrophy syndromes, the molecular basis of some peculiar adipose tissue disorders remains obscure. In an Israeli-Arab pedigree with a novel autosomal recessive, multiple symmetric lipomatosis (MSL), partial lipodystrophy and myopathy, we conducted exome sequencing of two affected siblings to identify the disease-causing mutation. The 41-year-old female proband and her 36-year-old brother reported marked accumulation of subcutaneous fat in the face, neck, axillae, and trunk but loss of subcutaneous fat from the lower extremities and progressive distal symmetric myopathy during adulthood. They had increased serum creatine kinase levels, hypertriglyceridemia and low levels of high-density lipoprotein cholesterol. Exome sequencing identified a novel homozygous NC_000019.9:g.42906092C>A variant on chromosome 19, leading to a NM_005357.3:c.3103G>T nucleotide change in coding DNA and corresponding p.(Glu1035*) protein change in hormone sensitive lipase (LIPE) gene as the disease-causing variant. Sanger sequencing further confirmed the segregation of the mutation in the family. Hormone sensitive lipase is the predominant regulator of lipolysis from adipocytes, releasing free fatty acids from stored triglycerides. The homozygous null LIPE mutation could result in marked inhibition of lipolysis from some adipose tissue depots and thus may induce an extremely rare phenotype of MSL and partial lipodystrophy in adulthood associated with complications of insulin resistance, such as diabetes, hypertriglyceridemia and hepatic steatosis. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  17. Inflammatory myopathies in childhood: correlation between nailfold capillaroscopy findings and clinical and laboratory data.

    Science.gov (United States)

    Nascif, Ana K S; Terreri, Maria T R A; Len, Cláudio A; Andrade, Luis E C; Hilário, Maria O E

    2006-01-01

    Nailfold capillaroscopy is an important tool for the diagnosis and follow-up of patients with rheumatic diseases, in particular dermatomyositis and scleroderma. A relationship has been observed in adults between improved capillaroscopic findings and reduced disease activity. Our aim was to correlate disease activity (clinical and laboratory data) and nailfold capillaroscopy findings in 18 patients with inflammatory myopathies. This prospective study included 13 juvenile dermatomyositis patients (Bohan and Peter criteria) (mean age of 8.8 years) and five patients with overlap syndrome (mean age of 15.7 years). We evaluated disease activity (skin abnormalities and muscle weakness, muscle enzymes and acute phase reactants) and its correlation with nailfold capillaroscopy findings (dilatation of isolated loops, dropout of surrounding vessels and giant capillary loops). We used a microscope with special light and magnification of 10 to 16X. Eighteen patients underwent a total of 26 capillaroscopic examinations, seven of them on two or more occasions (13 were performed during the active disease phase and 13 during remission). Twelve of the 13 examinations performed during the active phase exhibited scleroderma pattern and 8 of the 13 examinations performed during remission were normal. Therefore, in 20 of the 26 examinations clinical and laboratory data and nailfold capillaroscopy findings correlated (p = 0.01). Nailfold capillaroscopy is a non-invasive examination that offers satisfactory correlation with disease activity and could be a useful tool for the diagnosis and follow-up of inflammatory myopathies.

  18. Hypothyroid myopathy: A peculiar clinical presentation of thyroid failure. Review of the literature.

    Science.gov (United States)

    Sindoni, Alessandro; Rodolico, Carmelo; Pappalardo, Maria Angela; Portaro, Simona; Benvenga, Salvatore

    2016-12-01

    Abnormalities in thyroid function are common endocrine disorders that affect 5-10 % of the general population, with hypothyroidism occurring more frequently than hyperthyroidism. Clinical symptoms and signs are often nonspecific, particularly in hypothyroidism. Muscular symptoms (stiffness, myalgias, cramps, easy fatigability) are mentioned by the majority of patients with frank hypothyroidism. Often underestimated is the fact that muscle symptoms may represent the predominant or the only clinical manifestation of hypothyroidism, raising the issue of a differential diagnosis with other causes of myopathy, which sometimes can be difficult. Elevated serum creatine kinase, which not necessarily correlates with the severity of the myopathic symptoms, is certainly suggestive of muscle impairment, though it does not explain the cause. Rare muscular manifestations, associated with hypothyroidism, are rhabdomyolysis, acute compartment syndrome, Hoffman's syndrome and Kocher-Debré-Sémélaigne syndrome. Though the pathogenesis of hypothyroid myopathy is not entirely known, proposed mechanisms include altered glycogenolytic and oxidative metabolism, altered expression of contractile proteins, and neuro-mediated damage. Correlation studies of haplotype, muscle gene expression and protein characterization, could help understanding the pathophysiological mechanisms of this myopathic presentation of hypothyroidism.

  19. MYOPATHY AS A SIDE EFFECT OF STATIN THERAPY: MECHANISMS OF DEVELOPMENT AND PROSPECTS FOR TREATMENT

    Directory of Open Access Journals (Sweden)

    O. M. Drapkina

    2015-01-01

    Full Text Available Statins are lipid-lowering drugs with proven efficacy that reduce cardiovascular risk and are well tolerated by most patients. Myopathy as a side effect of statin therapy is one of the most common reasons for their withdrawal. Its severity can range from asymptomatic increase of serum CPK to life-threatening rhabdomyolysis. Therefore it is necessary to remember about the possibility of its occurrence.The exact molecular mechanisms of muscle damage by statins are still unknown. Various hypotheses are suggested in this respect: fatty acid oxidation disorders, mitochondrial dysfunction, increased protein degradation in myocytes due to changes in atrogin-1 and ubiquitin activity, activation of autoimmune processes, intracellular depletion of essential metabolites, destabilization of cell membranes, impaired expression of genes involved in apoptosis and protein degradation. The theory that the reduction of intramuscular CoQ10 level is the cause of myopathy prevails. Additional intake of CoQ10 seems promising, but is not evidence-based.

  20. Anaesthetic management of a paediatric patient with congenital fibre type disproportion myopathy.

    Science.gov (United States)

    Buisán, F; de la Varga, O; Flores, M; Sánchez-Ruano, J

    2018-04-23

    Congenital fibre type disproportion (CFTD) is a rare type of myopathy that is characterised by muscle weakness and hypotonia during childhood. Clinical features include motor delay, feeding difficulties, limb weakness, joint contractures, and scoliosis. A report is presented of the anaesthetic management of a 3-year-old girl with CFTD myopathy associated with a mutation of the TPM3 gene, scheduled for adenotonsillectomy because of obstructive sleep apnoea hypopnoea syndrome (OSAHS). The main concerns were the possible susceptibility to malignant hyperthermia, the risk of anaesthesia-induced rhabdomyolysis, a greater sensitivity to non-depolarising muscle relaxants, and the presence of OSAHS. Total intravenous anaesthesia with propofol and the use of rocuronium/sugammadex appear to be safe options. Given the high risk of respiratory compromise and other complications, patients should be closely monitored in the post-operative period. Copyright © 2018 Sociedad Española de Anestesiología, Reanimación y Terapéutica del Dolor. Publicado por Elsevier España, S.L.U. All rights reserved.

  1. A Nonsense Variant in the ACADVL Gene in German Hunting Terriers with Exercise Induced Metabolic Myopathy.

    Science.gov (United States)

    Lepori, Vincent; Mühlhause, Franziska; Sewell, Adrian C; Jagannathan, Vidhya; Janzen, Nils; Rosati, Marco; Alves de Sousa, Filipe Miguel Maximiano; Tschopp, Aurélie; Schüpbach, Gertraud; Matiasek, Kaspar; Tipold, Andrea; Leeb, Tosso; Kornberg, Marion

    2018-05-04

    Several enzymes are involved in fatty acid oxidation, which is a key process in mitochondrial energy production. Inherited defects affecting any step of fatty acid oxidation can result in clinical disease. We present here an extended family of German Hunting Terriers with 10 dogs affected by clinical signs of exercise induced weakness, muscle pain, and suspected rhabdomyolysis. The combination of clinical signs, muscle histopathology and acylcarnitine analysis with an elevated tetradecenoylcarnitine (C14:1) peak suggested a possible diagnosis of acyl-CoA dehydrogenase very long chain deficiency (ACADVLD). Whole genome sequence analysis of one affected dog and 191 controls revealed a nonsense variant in the ACADVL gene encoding acyl-CoA dehydrogenase very long chain, c.1728C>A or p.(Tyr576*). The variant showed perfect association with the phenotype in the 10 affected and more than 500 control dogs of various breeds. Pathogenic variants in the ACADVL gene have been reported in humans with similar myopathic phenotypes. We therefore considered the detected variant to be the most likely candidate causative variant for the observed exercise induced myopathy. To our knowledge, this is the first description of this disease in dogs, which we propose to name exercise induced metabolic myopathy (EIMM), and the identification of the first canine pathogenic ACADVL variant. Our findings provide a large animal model for a known human disease and will enable genetic testing to avoid the unintentional breeding of affected offspring. Copyright © 2018 Lepori et al.

  2. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  3. Uremic myopathy: Is oxidative stress implicated in muscle dysfunction in uremia?

    Directory of Open Access Journals (Sweden)

    Antonia eKaltsatou

    2015-03-01

    Full Text Available Renal failure is accompanied by progressive muscle weakness and premature fatigue, in part linked to hypokinesis and in part to uremic toxicity. These changes are associated with various detrimental biochemical and morphological alterations. All of these pathological parameters are collectively termed ureamic myopathy. Various interventions while helpful can’t fully remedy the pathological phenotype. Complex mechanisms that stimulate muscle dysfunction in uremia have been proposed, and oxidative stress could be implicated. Skeletal muscles continuously produce reactive oxygen species (ROS and reactive nitrogen species (RNS at rest and more so during contraction. The aim of this mini review is to provide an update on recent advances in our understanding of how ROS and RNS generation might contribute to muscle dysfunction in uremia. Thus a systematic review was conducted searching PubMed and Scopus by using the Cochrane and PRISMA guidelines. While few studies met our criteria their findings are discussed making reference to other available literature data. Oxidative stress can direct muscle cells into a catabolic state and chronic exposure to it leads to wasting. Moreover, redox disturbances can significantly affect force production per se. We conclude that oxidative stress can be in part responsible for some aspects of uremic myopathy. Further research is needed to discern clear mechanisms and to help efforts to counteract muscle weakness and exercise intolerance in uremic patients.

  4. Elevated risk of venous thromboembolic events in patients with inflammatory myopathies

    Directory of Open Access Journals (Sweden)

    Nowak M

    2016-06-01

    Full Text Available Michał Nowak, Katarzyna Królak-Nowak, Aleksandra Sobolewska-Włodarczyk, Jakub Fichna, Marcin Włodarczyk Department of Biochemistry, Faculty of Medicine, Medical University of Lodz, Lodz, Poland Abstract: Venous thromboembolism (VTE is a multifactorial disease manifesting as either deep vein thrombosis or pulmonary embolism. Its prevalence makes VTE a significant issue for both the individual – as a negative factor influencing the quality of life and prognosis – and the society due to economic burden. VTE is the third most common vascular disorder in Western countries, after myocardial infarction and stroke, making it a major cause of in-hospital mortality, responsible for 5%–10% of hospital deaths. Despite many studies conducted, only 50%–60% provoking factors have been identified, while the remaining 40%–50% have been classified as idiopathic or unprovoked. Chronic inflammatory disorders, with their underlying prothrombotic state, reveal an increased risk of VTE (six to eight times compared with the general population. Among the inflammatory disorders, we can identify inflammatory myopathies – a group of rare, chronic diseases featuring weakness and inflammation of muscles with periods of exacerbation and remission; their main classes are polymyositis and dermatomyositis. The objective of this review is to emphasize the need of VTE prophylaxis in individuals with inflammatory myopathies in order to reduce morbidity and mortality rates among those patients and improve their quality of life and prognosis. Keywords: deep vein thrombosis, pulmonary embolism, inflammation, polymyositis, dermatomyositis, prothrombotic state

  5. Hereditary internal anal sphincter myopathy causing proctalgia fugax and constipation. A newly identified condition.

    Science.gov (United States)

    Kamm, M A; Hoyle, C H; Burleigh, D E; Law, P J; Swash, M; Martin, J E; Nicholls, R J; Northover, J M

    1991-03-01

    A newly identified myopathy of the internal anal sphincter is described. In the affected family, at least one member from each of five generations had severe proctalgia fugax; onset was usually in the third to fifth decades of life. Three members of the family have been studied in detail. Each had severe pain intermittently during the day and hourly during the night. Constipation was an associated symptom, in particular difficulty with rectal evacuation. Clinically the internal anal sphincter was thickened and of decreased compliance. The maximum anal canal pressure was usually increased with marked ultraslow wave activity. Anal endosonography confirmed a grossly thickened internal anal sphincter. Two patients were treated by internal anal sphincter strip myectomy; one showed marked improvement and one was relieved of the constipation but had only slight improvement of the pain. The hypertrophied muscle in two of the patients showed unique myopathic changes, consisting of vacuolar changes with periodic acid-Schiff-positive polyglycosan bodies in the smooth muscle fibers and increased endomysial fibrosis. In vitro organ-bath studies showed insensitivity of the muscle to noradrenaline, isoprenaline, carbachol, dimethylpiperazinium, and electrical-field stimulation. Immunohistochemical studies for substance P, calcitonin gene-related peptide, galanin, neuropeptide Y, and vasoactive intestinal peptide showed staining in a similar distribution to that in control tissue. A specific autosomal-dominant inherited myopathy of the internal anal sphincter that causes anal pain and constipation has been identified and characterized.

  6. MYOPATHY AS A SIDE EFFECT OF STATIN THERAPY: MECHANISMS OF DEVELOPMENT AND PROSPECTS FOR TREATMENT

    Directory of Open Access Journals (Sweden)

    O. M. Drapkina

    2015-09-01

    Full Text Available Statins are lipid-lowering drugs with proven efficacy that reduce cardiovascular risk and are well tolerated by most patients. Myopathy as a side effect of statin therapy is one of the most common reasons for their withdrawal. Its severity can range from asymptomatic increase of serum CPK to life-threatening rhabdomyolysis. Therefore it is necessary to remember about the possibility of its occurrence.The exact molecular mechanisms of muscle damage by statins are still unknown. Various hypotheses are suggested in this respect: fatty acid oxidation disorders, mitochondrial dysfunction, increased protein degradation in myocytes due to changes in atrogin-1 and ubiquitin activity, activation of autoimmune processes, intracellular depletion of essential metabolites, destabilization of cell membranes, impaired expression of genes involved in apoptosis and protein degradation. The theory that the reduction of intramuscular CoQ10 level is the cause of myopathy prevails. Additional intake of CoQ10 seems promising, but is not evidence-based.

  7. Gene expression profiling in equine polysaccharide storage myopathy revealed inflammation, glycogenesis inhibition, hypoxia and mitochondrial dysfunctions

    Directory of Open Access Journals (Sweden)

    Benech Philippe

    2009-08-01

    Full Text Available Abstract Background Several cases of myopathies have been observed in the horse Norman Cob breed. Muscle histology examinations revealed that some families suffer from a polysaccharide storage myopathy (PSSM. It is assumed that a gene expression signature related to PSSM should be observed at the transcriptional level because the glycogen storage disease could also be linked to other dysfunctions in gene regulation. Thus, the functional genomic approach could be conducted in order to provide new knowledge about the metabolic disorders related to PSSM. We propose exploring the PSSM muscle fiber metabolic disorders by measuring gene expression in relationship with the histological phenotype. Results Genotypying analysis of GYS1 mutation revealed 2 homozygous (AA and 5 heterozygous (GA PSSM horses. In the PSSM muscles, histological data revealed PAS positive amylase resistant abnormal polysaccharides, inflammation, necrosis, and lipomatosis and active regeneration of fibers. Ultrastructural evaluation revealed a decrease of mitochondrial number and structural disorders. Extensive accumulation of an abnormal polysaccharide displaced and partially replaced mitochondria and myofibrils. The severity of the disease was higher in the two homozygous PSSM horses. Gene expression analysis revealed 129 genes significantly modulated (p Conclusion The main disorders observed in PSSM muscles could be related to mitochondrial dysfunctions, glycogenesis inhibition and the chronic hypoxia of the PSSM muscles.

  8. Nutritional status evaluation in patients affected by bethlem myopathy and ullrich congenital muscular dystrophy.

    Science.gov (United States)

    Toni, Silvia; Morandi, Riccardo; Busacchi, Marcello; Tardini, Lucia; Merlini, Luciano; Battistini, Nino Carlo; Pellegrini, Massimo

    2014-01-01

    Collagen VI mutations lead to disabling myopathies like Bethlem myopathy (BM) and Ullrich congenital muscular dystrophy (UCMD). We have investigated the nutritional and metabolic status of one UCMD and seven BM patients (five female, three male, mean age 31 ± 9 years) in order to find a potential metabolic target for nutritional intervention. For this study, we used standard anthropometric tools, such as BMI evaluation and body circumference measurements. All results were compared to dual-energy X-ray absorptiometry (DXA), considered the "gold standard" method. Energy intake of each patient was evaluated through longitudinal methods (7-day food diary) while resting energy expenditure (REE) was predicted using specific equations and measured by indirect calorimetry. Clinical evaluation included general and nutritional blood and urine laboratory analyses and quantitative muscle strength measurement by hand-held dynamometry. BM and UCMD patients showed an altered body composition, characterized by low free fat mass (FFM) and high fat mass (FM), allowing us to classify them as sarcopenic, and all but one as sarcopenic-obese. Another main result was the negative correlation between REE/FFM ratio (basal energy expenditure per kilograms of fat-free mass) and the severity of the disease, as defined by the muscle megascore (correlation coefficient -0.955, P-value nutritional intervention in these patients.

  9. Treatment options for mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) syndrome.

    Science.gov (United States)

    Santa, Kristin M

    2010-11-01

    Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) syndrome is a rare neurodegenerative disease caused by the decreased ability of cells to produce sufficient energy in the form of adenosine 5'-triphosphate. Although it is one of the most common maternally inherited mitochondrial disorders, its exact incidence is unknown. Caused most frequently by an A-to-G point mutation at the 3243 position in the mitochondrial DNA, MELAS syndrome has a broad range of clinical manifestations and a highly variable course. The classic neurologic characteristics include encephalopathy, seizures, and stroke-like episodes. In addition to its neurologic manifestations, MELAS syndrome exhibits multisystem effects including cardiac conduction defects, diabetes mellitus, short stature, myopathy, and gastrointestinal disturbances. Unfortunately, no consensus guidelines outlining standard drug regimens exist for this syndrome. Many of the accepted therapies used in treating MELAS syndrome have been identified through a small number of clinical trials or isolated case reports. Currently, the drugs most often used include antioxidants and various vitamins aimed at minimizing the demands on the mitochondria and supporting and maximizing their function. Some of the most frequently prescribed agents include coenzyme Q(10), l-arginine, B vitamins, and levocarnitine. Although articles describing MELAS syndrome are available, few specifically target education for clinical pharmacists. This article will provide pharmacists with a practical resource to enhance their understanding of MELAS syndrome in order to provide safe and effective pharmaceutical care.

  10. Effects of aerobic training on exercise-related oxidative stress in mitochondrial myopathies.

    Science.gov (United States)

    Siciliano, Gabriele; Simoncini, Costanza; Lo Gerfo, Annalisa; Orsucci, Daniele; Ricci, Giulia; Mancuso, Michelangelo

    2012-12-01

    In mitochondrial myopathies with respiratory chain deficiency impairment of energy cell production may lead to in excess reactive oxygen species generation with consequent oxidative stress and cell damage. Aerobic training has been showed to increase muscle performance in patients with mitochondrial myopathies. Aim of this study has been to evaluate, in 7 patients (6 F e 1M, mean age 44.9 ± 12.1 years) affected by mitochondrial disease, concomitantly to lactate exercise curve, the occurrence of oxidative stress, as indicated by circulating levels of lipoperoxides, in rest condition and as effect of exercise, and also, to verify if an aerobic training program is able to modify, in these patients, ox-redox balance efficiency. At rest and before training blood level of lipoperoxides was 382.4 ± 37.8 AU, compared to controls (318.7 ± 63.8; Pstress degree according to the adopted scale. During incremental exercise blood level of lipoperoxides did not increase, but maintained significantly higher compared to controls. After an aerobic training of 10 weeks the blood level of lipoperoxides decreased by 13.7% at rest (Pexercise test (P=0.06). These data indicate that, in mitochondrial patients, oxidative stress occurs and that an aerobic training is useful in partially reverting this condition. Copyright © 2012 Elsevier B.V. All rights reserved.

  11. Improving the lattice axial vector current

    International Nuclear Information System (INIS)

    Horsley, R.; Perlt, H.; Schiller, A.; Zanotti, J.M.

    2015-11-01

    For Wilson and clover fermions traditional formulations of the axial vector current do not respect the continuum Ward identity which relates the divergence of that current to the pseudoscalar density. Here we propose to use a point-split or one-link axial vector current whose divergence exactly satisfies a lattice Ward identity, involving the pseudoscalar density and a number of irrelevant operators. We check in one-loop lattice perturbation theory with SLiNC fermion and gauge plaquette action that this is indeed the case including order O(a) effects. Including these operators the axial Ward identity remains renormalisation invariant. First preliminary results of a nonperturbative check of the Ward identity are also presented.

  12. Diagnostic value of axial CT scan

    International Nuclear Information System (INIS)

    Kiuchi, Sousuke

    1983-01-01

    Axial CT scan was used to investigate the radiological details of the temporal bone of 33 patients with chronic otitis media, secondary cholesteatoma, sensorineural hearing loss, Meniere disease, vertigo, facial spasm, and neoplasma. The axial scans showed anatomic details of the temporal bone, and at the same time clearly demonstrated the extent of the soft-tissue masses in the middle ears, as well as the destructions of the ossicles. Bone changes of the anterior walls of the epitympanum and external auditory meatus were more clearly demonstrated than by coronary CT scan. However, the axial scan had the disadvantages in demonstrating the stapes, crista transversa, and the mastoid portion of the facial canal. (author)

  13. EULAR/ACR classification criteria for adult and juvenile idiopathic inflammatory myopathies and their major subgroups: a methodology report

    NARCIS (Netherlands)

    Bottai, Matteo; Tjärnlund, Anna; Santoni, Giola; Werth, Victoria P.; Pilkington, Clarissa; de Visser, Marianne; Alfredsson, Lars; Amato, Anthony A.; Barohn, Richard J.; Liang, Matthew H.; Singh, Jasvinder A.; Aggarwal, Rohit; Arnardottir, Snjolaug; Chinoy, Hector; Cooper, Robert G.; Danko, Katalin; Dimachkie, Mazen M.; Feldman, Brian M.; García-de la Torre, Ignacio; Gordon, Patrick; Hayashi, Taichi; Katz, James D.; Kohsaka, Hitoshi; Lachenbruch, Peter A.; Lang, Bianca A.; Li, Yuhui; Oddis, Chester V.; Olesinka, Marzena; Reed, Ann M.; Rutkowska-Sak, Lidia; Sanner, Helga; Selva-O'Callaghan, Albert; Wook Song, Yeong; Vencovsky, Jiri; Ytterberg, Steven R.; Miller, Frederick W.; Rider, Lisa G.; Lundberg, Ingrid E.; Amoruso, Maria; Andersson, Helena; Bayat, Nastaran; Bhansing, Kavish J.; Bucher, Sara; Champbell, Richard; Charles-Schoeman, Christina; Chaudhry, Vinay; Christopher-Stine, Lisa; Chung, Lorinda; Cronin, Mary; Curry, Theresa; Dahlbom, Kathe; Distler, Oliver; Efthimiou, Petros; van Engelen, Baziel G. M.; Faiq, Abdullah; Farhadi, Payam Noroozi; Fiorentino, David; Hengstman, Gerald; Hoogendijk, Jessica; Huber, Adam; Kataoka, Hiroshi; Katsumata, Yasuhiro; Kim, Susan; Kong-Rosario, Michelle; Kontzias, Apostolos; Krol, Petra; Kurita, Takashi; Li, Zhan-Guo; Lindvall, Björn; Linklater, Helen; Maillard, Sue; Mamyrova, Gulnara; Mantegazza, Renato; Marder, Galina S.; Nagahashi Marie, Suely Kazue; Mathiesen, Pernille; Mavragani, Clio P.; McHugh, Neil J.; Michaels, Mimi; Mohammed, Reem; Morgan, Gabrielle; Moser, David W.; Moutsopoulos, Haralampos M.

    2017-01-01

    To describe the methodology used to develop new classification criteria for adult and juvenile idiopathic inflammatory myopathies (IIMs) and their major subgroups. An international, multidisciplinary group of myositis experts produced a set of 93 potentially relevant variables to be tested for

  14. Implications of compound heterozygous insulin receptor mutations in congenital muscle fibre type disproportion myopathy for the receptor kinase activation

    DEFF Research Database (Denmark)

    Klein, H H; Müller, R; Vestergaard, H

    1999-01-01

    We studied insulin receptor kinase activation in two brothers with congenital muscle fibre type disproportion myopathy and compound heterozygous mutations of the insulin receptor gene, their parents, and their unaffected brother. In the father who has a heterozygote Arg1174-->Gln mutation, in sit...

  15. Characterization of DLK1+ cells emerging during skeletal muscle remodeling in response to myositis, myopathies, and acute injury

    DEFF Research Database (Denmark)

    Andersen, Ditte C; Petersson, Stine J; Jørgensen, Louise H

    2009-01-01

    , DLK1 was upregulated in all human myopathies analyzed, including Duchenne- and Becker muscular dystrophies. Substantial numbers of DLK1(+) satellite cells were observed in normal neonatal and Duchenne muscle, and furthermore, myogenic DLK1(+) cells were identified during muscle regeneration in animal...

  16. Characterization of sarcoplasmic reticulum Ca(2+) ATPase pumps in muscle of patients with myotonic dystrophy and with hypothyroid myopathy.

    Science.gov (United States)

    Guglielmi, V; Oosterhof, A; Voermans, N C; Cardani, R; Molenaar, J P; van Kuppevelt, T H; Meola, G; van Engelen, B G; Tomelleri, G; Vattemi, G

    2016-06-01

    Sarcoplasmic/endoplasmic reticulum Ca(2+) ATPase (SERCA) pumps play the major role in lowering cytoplasmic calcium concentration in skeletal muscle by catalyzing the ATP-dependent transport of Ca(2+) from the cytosol to the lumen of the sarcoplasmic reticulum (SR). Although SERCA abnormalities have been hypothesized to contribute to the dysregulation of intracellular Ca(2+) homeostasis and signaling in muscle of patients with myotonic dystrophy (DM) and hypothyroid myopathy, the characterization of SERCA pumps remains elusive and their impairment is still unclear. We assessed the activity of SR Ca(2+)-ATPase, expression levels and fiber distribution of SERCA1 and SERCA2, and oligomerization of SERCA1 protein in muscle of patients with DM type 1 and 2, and with hypothyroid myopathy. Our data provide evidence that SR Ca(2+) ATPase activity, protein levels and muscle fiber distribution of total SERCA1 and SERCA2, and SERCA1 oligomerization pattern are similar in patients with both DM1 and DM2, hypothyroid myopathy and in control subjects. We prove that SERCA1b, the neonatal isoform of SERCA1, is expressed at protein level in muscle of patients with DM2 and, in lower amount, of patients with DM1. Our present study demonstrates that SERCA function is not altered in muscle of patients with DM and with hypothyroid myopathy. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Loss-of-function mutations in SCN4A> cause severe foetal hypokinesia or 'classical' congenital myopathy

    DEFF Research Database (Denmark)

    Zaharieva, Irina T; Thor, Michael G; Oates, Emily C

    2016-01-01

    Congenital myopathies are a clinically and genetically heterogeneous group of muscle disorders characterized by congenital or early-onset hypotonia and muscle weakness, and specific pathological features on muscle biopsy. The phenotype ranges from foetal akinesia resulting in in utero or neonatal...

  18. Lactate disposal via gluconeogenesis is increased during exercise in patients with mitochondrial myopathy due to complex I deficiency

    NARCIS (Netherlands)

    Roef, MJ; Kalhan, SC; Reijngoud, DJ; De Meer, K; Berger, Ruud

    This study evaluated lactate disposal via gluconeogenesis as well as effects of FFA availability on gluconeogenesis via pyruvate (GNG(PYR)) in patients with mitochondrial myopathy due to complex I deficiency (CID). The rates of GNG(PYR) were measured in three CID patients and six healthy controls at

  19. Hereditary internal anal sphincter myopathy causing proctalgia fugax and constipation: further clinical and histological characterization in a patient.

    Science.gov (United States)

    König, P; Ambrose, N S; Scott, N

    2000-01-01

    Hereditary internal anal sphincter myopathy is a very rare condition, only three families have so far been described in the literature. In this case report further clinical and histological findings of one affected member of one of the above families are presented.

  20. Hypoglycin A Concentrations in Maple Tree Species in the Netherlands and the Occurrence of Atypical Myopathy in Horses

    NARCIS (Netherlands)

    Westermann, C.M.; Van Leeuwen, Robbert; Van Raamsdonk, L.W.D.; Mol, H.G.J.

    BACKGROUND: Atypical myopathy (AM) in horses is caused by the plant toxin hypoglycin A, which in Europe typically is found in the sycamore maple tree (Acer pseudoplatanus). Owners are concerned about whether their horses are in danger if they graze near maple trees. HYPOTHESIS/OBJECTIVES: To measure

  1. Hypoglycin A Concentrations in Maple Tree Species in the Netherlands and the Occurrence of Atypical Myopathy in Horses

    NARCIS (Netherlands)

    Westermann, C.M.; Leeuwen, van R.; Raamsdonk, van L.W.D.; Mol, H.G.J.

    2016-01-01

    Background: Atypical myopathy (AM) in horses is caused by the plant toxin hypoglycin A, which in Europe typically is found in the sycamore maple tree (Acer pseudoplatanus). Owners are concerned about whether their horses are in danger if they graze near maple trees. Hypothesis/Objectives: To

  2. Mutation spectrum in the large GTPase dynamin 2, and genotype-phenotype correlation in autosomal dominant centronuclear myopathy

    DEFF Research Database (Denmark)

    Böhm, Johann; Biancalana, Valérie; Dechene, Elizabeth T

    2012-01-01

    Centronuclear myopathy (CNM) is a genetically heterogeneous disorder associated with general skeletal muscle weakness, type I fiber predominance and atrophy, and abnormally centralized nuclei. Autosomal dominant CNM is due to mutations in the large GTPase dynamin 2 (DNM2), a mechanochemical enzym...

  3. Dietary nitrate does not reduce oxygen cost of exercise or improve muscle mitochondrial function in patients with mitochondrial myopathy

    NARCIS (Netherlands)

    Nabben, M.; Schmitz, J.P.J.; Ciapaite, J.; le Clercq, C.M.P.; van Riel, N.A.; Haak, H.R.; Nicolay, K.; de Coo, I.F.M.; Smeets, H.; Praet, S.F.; van Loon, L.J.; Prompers, J.J.

    2017-01-01

    Muscle weakness and exercise intol erance negatively affect the quality of life of patients with mitochondrial myopathy. Short-term dietary nitrate supplementation has been shown to improve exercise performance and reduce oxygen cost of exercise in healthy humans and trained athletes. We

  4. Axial Vircator for Electronic Warfare Applications

    Directory of Open Access Journals (Sweden)

    L. Drazan

    2009-12-01

    Full Text Available This paper deals with a high power microwave generator with virtual cathode – vircator in axial release for electronic warfare applications. The classification of directed energy weapons microwave (DEWM is introduced together with basic block diagrams of a particular class of DEWM. In the paper, methods for designing vircator pulsed power supply, axial vircator structure, measurement methods and experimental results are presented. The vircator in electromagnetic ammunition is powered by magneto-cumulative generator and in weapons for defense of objects (WDO, it is powered by Marx generator. The possible applications of a vircator in the DEWM area are discussed.

  5. Axial loaded MRI of the lumbar spine

    Energy Technology Data Exchange (ETDEWEB)

    Saifuddin, A. E-mail: asaifuddin@aol.com; Blease, S.; MacSweeney, E

    2003-09-01

    Magnetic resonance imaging is established as the technique of choice for assessment of degenerative disorders of the lumbar spine. However, it is routinely performed with the patient supine and the hips and knees flexed. The absence of axial loading and lumbar extension results in a maximization of spinal canal dimensions, which may in some cases, result in failure to demonstrate nerve root compression. Attempts have been made to image the lumbar spine in a more physiological state, either by imaging with flexion-extension, in the erect position or by using axial loading. This article reviews the literature relating to the above techniques.

  6. Axial nucleon form factors from lattice QCD

    International Nuclear Information System (INIS)

    Alexandrou, C.; Brinet, M.; Carbonell, J.; Harraud, P. A.; Papinutto, M.; Constantinou, M.; Guichon, P.; Jansen, K.; Korzec, T.

    2011-01-01

    We present results on the nucleon axial form factors within lattice QCD using two flavors of degenerate twisted mass fermions. Volume effects are examined using simulations at two volumes of spatial length L=2.1 fm and L=2.8 fm. Cut-off effects are investigated using three different values of the lattice spacings, namely a=0.089 fm, a=0.070 fm and a=0.056 fm. The nucleon axial charge is obtained in the continuum limit and chirally extrapolated to the physical pion mass enabling comparison with experiment.

  7. The Axially Symmetric One-Monopole

    International Nuclear Information System (INIS)

    Wong, K.-M.; Teh, Rosy

    2009-01-01

    We present new classical generalized one-monopole solution of the SU(2) Yang-Mills-Higgs theory with the Higgs field in the adjoint representation. We show that this solution with θ-winding number m = 1 and φ-winding number n = 1 is an axially symmetric generalization of the 't Hooft-Polyakov one-monopole. We construct this axially symmetric one-monopole solution by generalizing the large distance asymptotic solutions of the 't Hooft-Polyakov one-monopole to the Jacobi elliptic functions and solving the second order equations of motion numerically when the Higgs potential is vanishing. This solution is a non-BPS solution.

  8. Axial injection in Orsay superconducting cyclotron

    International Nuclear Information System (INIS)

    Depauw, J.; Kugler, M.F.; Legoff, A.; Potier, J.C.; Richomme, A.; Skowron, R.; Mandrillon, P.; Schapira, J.P.

    1983-01-01

    The compact superconducting cyclotron currently planned at IPN at Orsay is designed for light ion acceleration together with heavy ion acceleration. From the beginning, for this reason, a central geometry able to receive an inflector (to 90deg C) allowing the axial injection of low energy ion beams given by an outer source. The present study is aimed at showing the technical feasibility of theoretical results obtained on axial injection. First experimental study has been made of spatial repartition in three dimensions of electric potential developed by a central geometry of 3 electrodes. Then, the electric study of an electrostatic mirror has been made [fr

  9. «FLARES» IN AXIAL SPONDYLOARTHRITIS

    Directory of Open Access Journals (Sweden)

    Sh. F. Erdes

    2016-01-01

    Full Text Available The clear definition of the concept of «flare in axial spondyloarthritis» is of paramount importance for clinical trials and routine practice in particular. It will be able to unify the characteristics of outcomes over a particular period of time on the one hand and to standardize therapeutic approaches on the other. On 4 February 2016, the journal Annals of Rheumatic Diseases published the on-line paper «Preliminary definitions of 'flare' in axial spondyloarthritis, based on pain, BASDAI and ASDAS-CRP: an ASAS initiative» by L. Gossec et al., which was devoted to this topic.

  10. Novel duplication mutation in the patatin domain of adipose triglyceride lipase (PNPLA2) in neutral lipid storage disease with severe myopathy.

    Science.gov (United States)

    Akiyama, Masashi; Sakai, Kaori; Ogawa, Masaya; McMillan, James R; Sawamura, Daisuke; Shimizu, Hiroshi

    2007-12-01

    Recently, mutations in PNPLA2 encoding adipose triglyceride lipase (ATGL) were reported to underlie a neutral lipid storage disease (NLSD) subgroup characterized by mild myopathy and the absence of ichthyosis. In the present study a novel homozygous PNPLA2 mutation c.475_478dupCTCC (p.Gln160ProfsX19) in the patatin domain, the ATGL active site, was detected in a woman with NLSD and severe myopathy. The present results suggest that a premature truncation mutation in the patatin domain causes NLSD with severe myopathy.

  11. BPHZL-subtraction scheme and axial gauges

    Energy Technology Data Exchange (ETDEWEB)

    Kreuzer, M.; Rebhan, A.; Schweda, M.; Piguet, O.

    1986-03-27

    The application of the BPHZL subtraction scheme to Yang-Mills theories in axial gauges is presented. In the auxillary mass formulation we show the validity of the convergence theorems for subtracted momentum space integrals, and we give the integral formulae necessary for one-loop calculations. (orig.).

  12. Accessory caudal axial and pelvic ribs

    International Nuclear Information System (INIS)

    Bohutova, J.; Kolar, J.; Vitovec, J.; Vyhnanek, L.

    1980-01-01

    Accessory caudal ribs are reported as an extremely curious anomaly in five patients. Once the fracture of this rib was a source of pains after injury. The different shapes of the ribs are documented in this clinical survey which is the most extensive in the present literature. Anomalous ribs arise due to inappropriate segmentation during the embryonal development of the axial skeleton. (orig.) [de

  13. Aryabha~ and Axial Rotation of Earth

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 11; Issue 4. Aryabhata and Axial Rotation of Earth - Naksatra Dina (the Sidereal Day). Amartya Kumar Dutta. General Article Volume 11 Issue 4 April 2006 pp 56-74. Fulltext. Click here to view fulltext PDF. Permanent link:

  14. Aryabhala and Axial Rotation of Earth

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 11; Issue 3. Aryabhata and Axial Rotation of Earth - Khagola (The Celestial Sphere). Amartya Kumar Dutta. General Article Volume 11 Issue 3 March 2006 pp 51-68. Fulltext. Click here to view fulltext PDF. Permanent link:

  15. Helical axial injection concept for cyclotrons

    Energy Technology Data Exchange (ETDEWEB)

    Hudson, E.D.

    1981-01-01

    A concept for an external beam injection system using a helical beam path centered on the cyclotron axis is described. This system could be used to couple two accelerator stages, with or without intermediate stripping, in cases where conventional axial injection or radial injection are not practical.

  16. Helical axial injection concept for cyclotrons

    International Nuclear Information System (INIS)

    Hudson, E.D.

    1981-01-01

    A concept for an external beam injection system using a helical beam path centered on the cyclotron axis is described. This system could be used to couple two accelerator stages, with or without intermediate stripping, in cases where conventional axial injection or radial injection are not practical

  17. The axial polarizability of nucleons and nuclei

    International Nuclear Information System (INIS)

    Ericson, M.; Figureau, A.

    1981-02-01

    The part of the static nuclear axial polarizability arising from the nucleonic excitations is derived from the low energy expansion of the πN amplitude. It is shown that the contribution of the Δ intermediate state, though dominant, does not saturate the nucleonic response. A similar effect, though more pronounced, is known to occur for the magnetic susceptibility

  18. Optimisation of efficiency of axial fans

    NARCIS (Netherlands)

    Kruyt, Nicolaas P.; Pennings, P.C.; Faasen, R.

    2014-01-01

    A three-stage research project has been executed to develop ducted axial-fans with increased efficiency. In the first stage a design method has been developed in which various conflicting design criteria can be incorporated. Based on this design method, an optimised design has been determined

  19. Axial crystals macroscopic symmetry and tensor properties

    Czech Academy of Sciences Publication Activity Database

    Janovec, Václav

    2017-01-01

    Roč. 90, č. 1 (2017), s. 1-10 ISSN 0141-1594 Institutional support: RVO:68378271 Keywords : axial * polar * pseudopolar * chiral * enantiomorphism * optical activity Subject RIV: BM - Solid Matter Physics ; Magnetism OBOR OECD: Condensed matter physics (including formerly solid state physics, supercond.) Impact factor: 1.060, year: 2016

  20. Elevated Cardiac Troponin T in Patients With Skeletal Myopathies.

    Science.gov (United States)

    Schmid, Johannes; Liesinger, Laura; Birner-Gruenberger, Ruth; Stojakovic, Tatjana; Scharnagl, Hubert; Dieplinger, Benjamin; Asslaber, Martin; Radl, Roman; Beer, Meinrad; Polacin, Malgorzata; Mair, Johannes; Szolar, Dieter; Berghold, Andrea; Quasthoff, Stefan; Binder, Josepha S; Rainer, Peter P

    2018-04-10

    Cardiac troponins are often elevated in patients with skeletal muscle disease who have no evidence of cardiac disease. The goal of this study was to characterize cardiac troponin concentrations in patients with myopathies and derive insights regarding the source of elevated troponin T measurements. Cardiac troponin T (cTnT) and cardiac troponin I (cTnI) concentrations were determined by using high sensitivity assays in 74 patients with hereditary and acquired skeletal myopathies. Patients underwent comprehensive cardiac evaluation, including 12-lead electrocardiogram, 24-h electrocardiogram, cardiac magnetic resonance imaging, and coronary artery computed tomography. cTnT and cTnI protein expression was determined in skeletal muscle samples of 9 patients and in control tissues derived from autopsy using antibodies that are used in commercial assays. Relevant Western blot bands were subjected to liquid chromatography tandem mass spectrometry for protein identification. Levels of cTnT (median: 24 ng/l; interquartile range: 11 to 54 ng/l) were elevated (>14 ng/l) in 68.9% of patients; cTnI was elevated (>26 ng/l) in 4.1% of patients. Serum cTnT levels significantly correlated with creatine kinase and myoglobin (r = 0.679 and 0.786, respectively; both p < 0.001). Based on cTnT serial testing, 30.1% would have fulfilled current rule-in criteria for myocardial infarction. Noncoronary cardiac disease was present in 23%. Using cTnT antibodies, positive bands were found in both diseased and healthy skeletal muscle at molecular weights approximately 5 kDa below cTnT. Liquid chromatography tandem mass spectrometry identified the presence of skeletal troponin T isoforms in these bands. Measured cTnT concentrations were chronically elevated in the majority of patients with skeletal myopathies, whereas cTnI elevation was rare. Our data indicate that cross-reaction of the cTnT immunoassay with skeletal muscle troponin isoforms was the likely cause. Copyright © 2018 The

  1. A Comprehensive Overview on Myositis-Specific Antibodies: New and Old Biomarkers in Idiopathic Inflammatory Myopathy

    Science.gov (United States)

    Satoh, Minoru; Tanaka, Shin; Ceribelli, Angela; Calise, S. John; Chan, Edward K. L.

    2018-01-01

    Autoantibodies specific for idiopathic inflammatory myopathy (myositis-specific autoantibodies (MSAs)) are clinically useful biomarkers to help the diagnosis of polymyositis/dermatomyositis (PM/DM). Many of these are also associated with a unique clinical subset of PM/DM, making them useful in predicting and monitoring certain clinical manifestations. Classic MSAs known for over 30 years include antibodies to Jo-1 (histidyl transfer RNA (tRNA) synthetase) and other aminoacyl tRNA synthetases (ARS), anti-Mi-2, and anti-signal recognition particle (SRP). Anti-Jo-1 is the first autoantibodies to ARS detected in 15–25 % of patients. In addition to anti-Jo-1, antibodies to seven other aminoacyl tRNA synthetases (ARS) have been reported with prevalence, usually 1–5 % or lower. Patients with any antiARS antibodies are associated with anti-synthetase syndrome characterized by myositis, interstitial lung disease (ILD), arthritis, Raynaud’s phenomenon, and others. Several recent studies suggested heterogeneity in clinical features among different anti-ARS antibody-positive patients and anti-ARS may also be found in idiopathic ILD without myositis. Anti-Mi-2 is a classic marker for DM and associated with good response to steroid treatment and good prognosis. Anti-SRP is specific for PM and associated with treatment-resistant myopathy histologically characterized as necrotizing myopathy. In addition to classic MSAs, several new autoantibodies with strong clinical significance have been described in DM. Antibodies to transcription intermediary factor 1γ/α (TIF1γ/α, p155/140) are frequently found in DM associated with malignancy while anti-melanoma differentiation-associated gene 5 (MDA5; CADM140) are associated with clinically amyopathic DM (CADM) complicated by rapidly progressive ILD. Also, anti-MJ/nuclear matrix protein 2 (NXP-2) and anti-small ubiquitin-like modifier-1 (SUMO-1) activating enzyme (SAE) are recognized as new DM-specific autoantibodies. Addition of

  2. [Hot spot mutation screening of RYR1 gene in diagnosis of congenital myopathies].

    Science.gov (United States)

    Chang, Xing-zhi; Jin, Yi-wen; Wang, Jing-min; Yuan, Yun; Xiong, Hui; Wang, Shuang; Qin, Jiong

    2014-10-18

    To detect hot spot mutation of RYR1 gene in 15 cases of congenital myopathy with different subtypes, and to discuss the value of RYR1 gene hot spot mutation detection in the diagnosis of the disease. Clinical data were collected in all the patients, including clinical manifestations and signs, serum creatine kinase, electromyography. Fourteen of the patients accepted the muscle biopsy. Hot spot mutation in the C-terminal of RYR1 gene (extron 96-106) had been detected in all the 15 patients. All the patients presented with motor development delay, and they could walk at the age of 1 to 3.5 years,but were always easy to fall and could not run or jump. There were no progressive deteriorations. Physical examination showed different degrees of muscle weakness and hypotonia.High arched palates were noted in 3 patients. The serum levels of creatine kinase were mildly elevated in 3 cases, and normal in 12 cases. Electromyography showed "myogenic" features in 11 patients, being normal in the other 4 patients. Muscle biopsy pathologic diagnosis was the central core disease in 3 patients, the central nuclei in 2 patients, the congenital fiber type disproportion in 2 patients, the nameline myopathy in 3 patient, the multiminicore disease in 1 patient, and nonspecific minimal changes in the other 3 patients; one patient was diagnosed with central core disease according to positive family history and gene mutation. In the family case (Patient 2) of central core disease, the c.14678G>A (p.Arg4893Gln) mutation in 102 extron of RYR1 was identified in three members of the family, which had been reported to be a pathogenic mutation. The c.14596A>G(p.Lys4866Gln) mutation in 101 extron was found in one patient with central core disease(Patient 1), and the c.14719G>A(p.Gly4907Ser) mutation in 102 extron was found in another case of the central core disease(Patient 3).The same novel mutation was verified in one of the patients' (Patient 3) asymptomatic father. Congenital myopathies in

  3. Are Peripheral Blood Mononuclear Cells Derived from Patients with Certain Myopathies Suitable for Personalized Drug Screening?

    Directory of Open Access Journals (Sweden)

    Andriy V. Shatillo

    2014-12-01

    Full Text Available Background: Limb girdle muscular dystrophies (LGMDs and several other disorders which share their specific phenotype are rare, predominantly hereditary conditions with no curative treatment. Differential diagnosis of these myopathies is quite challenging and expensive in many cases. Therefore, a significant proportion of patients remains undiagnosed and untreated for a long time. At the same time there is a huge amount of drugs and supplements potentially able to modify the course of some of these muscular dystrophies. That is why a simple empirical approach able to define a patient’s reaction to a specific compound seems rational. Because most common basic pathogenetic mechanisms for these quite different disorders increase the vulnerability of muscle cells (or decrease ability for reparation during mechanical stress, we propose a simple, noninvasive and inexpensive approach for individualized drug screening based on the drug’s influence on the mechanical vulnerability of peripheral blood mononuclear cells (PBMC. Methods: PBMC derived from 8 patients with Duchenne muscular dystrophy (DMD, 2 patients with LGMD2A, 1 patient with LGMD2B, 1 with MERRF syndrome, 1 with facioscapulohumeral muscular dystrophy (FSHD and 13 matched control subjects were irradiated by ultrasound in the presence of several compounds (lisinopril, vitamin D3, prednisolon, tocopherol, topiramate, glutargin, α-lipoic acid, essentiale, and physiological solution. Then viability indexes of the samples were detected by citotoxic assays based on vital dye (neutral red and resazurin metabolism. Results: In cytotoxicity tests with active transport of neutral red into PBMC derived from DMD patients, the cells showed signs of destruction at 1.06±0.52 minutes of ultrasounding compared to 1.75±0.6 minutes in control. PBMCs from patients with other myopathies have either normal or decreased resistance to ultrasound. The addition of tocopherol significantly changes the PBMC

  4. Validation and clinical significance of the childhood myositis assessment scale for assessment of muscle function in the juvenile idiopathic inflammatory myopathies

    NARCIS (Netherlands)

    Huber, AM; Feldman, BM; Rennebohm, RM; Hicks, JE; Lindsley, CB; Perez, MD; Zemel, LS; Wallace, CA; Ballinger, SH; Passo, MH; Reed, AM; Summers, RM; Katona, IM; Miller, FW; Lachenbruch, PA; Rider, LG; White, P.H.

    Objective. To examine the measurement characteristics of the Childhood Myositis Assessment Scale (CMAS) in children with juvenile idiopathic inflammatory myopathy (juvenile IIM), and to obtain preliminary data on the clinical significance of CMAS scores. Methods. One hundred eight children with

  5. Rimmed vacuoles in Becker muscular dystrophy have similar features with inclusion myopathies.

    Science.gov (United States)

    Momma, Kazunari; Noguchi, Satoru; Malicdan, May Christine V; Hayashi, Yukiko K; Minami, Narihiro; Kamakura, Keiko; Nonaka, Ikuya; Nishino, Ichizo

    2012-01-01

    Rimmed vacuoles in myofibers are thought to be due to the accumulation of autophagic vacuoles, and can be characteristic in certain myopathies with protein inclusions in myofibers. In this study, we performed a detailed clinical, molecular, and pathological characterization of Becker muscular dystrophy patients who have rimmed vacuoles in muscles. Among 65 Becker muscular dystrophy patients, we identified 12 patients who have rimmed vacuoles and 11 patients who have deletions in exons 45-48 in DMD gene. All patients having rimmed vacuoles showed milder clinical features compared to those without rimmed vacuoles. Interestingly, the rimmed vacuoles in Becker muscular dystrophy muscles seem to represent autophagic vacuoles and are also associated with polyubiquitinated protein aggregates. These findings support the notion that rimmed vacuoles can appear in Becker muscular dystrophy, and may be related to the chronic changes in muscle pathology induced by certain mutations in the DMD gene.

  6. Rimmed vacuoles in Becker muscular dystrophy have similar features with inclusion myopathies.

    Directory of Open Access Journals (Sweden)

    Kazunari Momma

    Full Text Available Rimmed vacuoles in myofibers are thought to be due to the accumulation of autophagic vacuoles, and can be characteristic in certain myopathies with protein inclusions in myofibers. In this study, we performed a detailed clinical, molecular, and pathological characterization of Becker muscular dystrophy patients who have rimmed vacuoles in muscles. Among 65 Becker muscular dystrophy patients, we identified 12 patients who have rimmed vacuoles and 11 patients who have deletions in exons 45-48 in DMD gene. All patients having rimmed vacuoles showed milder clinical features compared to those without rimmed vacuoles. Interestingly, the rimmed vacuoles in Becker muscular dystrophy muscles seem to represent autophagic vacuoles and are also associated with polyubiquitinated protein aggregates. These findings support the notion that rimmed vacuoles can appear in Becker muscular dystrophy, and may be related to the chronic changes in muscle pathology induced by certain mutations in the DMD gene.

  7. Insulin Resistance and Increased Muscle Cytokine Levels in Patients With Mitochondrial Myopathy

    DEFF Research Database (Denmark)

    Rue, Nana; Vissing, John; Galbo, Henrik

    2014-01-01

    CONTEXT: Mitochondrial dysfunction has been proposed to cause insulin resistance and that might stimulate cytokine production. OBJECTIVE: The objective of the study was to elucidate the association between mitochondrial myopathy, insulin sensitivity, and cytokine levels in muscle. DESIGN......: The intervention included a 120-minute hyperinsulinemic, euglycemic clamp. Another morning, microdialysis of both vastus lateralis muscles for 4 hours, including one-legged, knee extension exercise for 30 minutes, was performed. MAIN OUTCOME MEASURES: Glucose infusion rate during 90-120 minutes of insulin infusion...... was measured. Cytokine concentrations in dialysate were also measured. RESULTS: Muscle strength, percentage fat mass, and creatine kinase in plasma did not differ between groups. The maximal oxygen uptake was 21 ± 3 (SE) (P) and 36 ± 3(C) mL/kg·min (2P insulin, C-peptide, and glucagon were higher...

  8. X-linked Myotubular Myopathy with a Novel MTM1 Mutation in a Taiwanese Child

    Directory of Open Access Journals (Sweden)

    Chia-Ying Chang

    2008-12-01

    Full Text Available We report a male, preterm newborn infant with X-linked myotubular myopathy, the most severe type of the disease. He presented at birth with generalized hypotonia, difficulty in swallowing, and respiratory distress with frequent episodes of atelectasis. The infant had a long thin face, generalized hypotonia, and arachnodactyly. Diagnosis was based on fetal history, muscle histopathology, electron microscopy and a genetic study. A base pair change was detected in exon 11 of the MTM1 gene: c.1160C > A, which caused an amino acid change, p.S387Y. The father's gene was normal but the mother had the same mutation as her son and was thus a carrier.

  9. Myopathy Associated with Acute Hypothyroidism following Radioiodine Therapy for Graves Disease in an Adolescent

    Directory of Open Access Journals (Sweden)

    Rivkees ScottA

    2010-08-01

    Full Text Available We describe acute myopathy following I-131 treatment for hyperthyroidism due to Graves Disease (GD in an adolescent. A 15 year-old diagnosed with GD required treatment with radioactive iodine (I-131 therapy. Six weeks post I-131, he developed generalized muscle cramps. The CK was 19.800 U/L, the total thyroxine was 2.3 mcg/dL (29.6 nmol/L SI and the estimated free thyroxine (EFT was 0.5 ng/dL (6.4 pmol/L SI. The ALT was 112 U/L and AST was 364 U/L (normal

  10. Two families with MYH7 distal myopathy associated with cardiomyopathy and core formations.

    Science.gov (United States)

    Naddaf, Elie; Waclawik, Andrew J

    2015-03-01

    Laing distal myopathy is caused by MYH7 gene mutations. Multiple families have been reported with varying patterns of skeletal and cardiac involvement as well as histopathological findings. We report 2 families with p.Glu1508del mutation with detailed electrophysiological and muscle pathology findings. All patients displayed the classic phenotype with weakness starting in the anterior compartment of the legs with a "hanging great toe." It was followed by finger extensors involvement, relatively sparing the extensor indicis proprius, giving the appearance of a "pointing index" finger. All the affected individuals had a dilated cardiomyopathy and core formations on muscle biopsy. Unexpectedly, neurogenic changes were also observed in some individuals. Both families were initially misdiagnosed with either central core disease or hereditary neuropathy. Recognizing the classic phenotype, screening for cardiac involvement that may be clinically silent, and determining the mode of inheritance help with selecting the appropriate genetic test.

  11. X linked neonatal centronuclear/myotubular myopathy: evidence for linkage to Xq28 DNA marker loci.

    Science.gov (United States)

    Thomas, N S; Williams, H; Cole, G; Roberts, K; Clarke, A; Liechti-Gallati, S; Braga, S; Gerber, A; Meier, C; Moser, H

    1990-05-01

    We have studied the inheritance of several polymorphic Xq27/28 DNA marker loci in two three generation families with the X linked neonatal lethal form of centronuclear/myotubular myopathy (XL MTM). We found complete linkage of XLMTM to all four informative Xq28 markers analysed, with GCP/RCP (Z = 3.876, theta = 0.00), with DXS15 (Z = 3.737, theta = 0.00), with DXS52 (Z = 2.709, theta = 0.00), and with F8C (Z = 1.020, theta = 0.00). In the absence of any observable recombination, we are unable to sublocalise the XLMTM locus further within the Xq28 region. This evidence for an Xq28 localisation may allow us to carry out useful genetic counselling within such families.

  12. When should MELAS (Mitochondrial myopathy, Encephalopathy, Lactic Acidosis, and Stroke-like episodes) be the diagnosis?

    Science.gov (United States)

    Lorenzoni, Paulo José; Werneck, Lineu Cesar; Kay, Cláudia Suemi Kamoi; Silvado, Carlos Eduardo Soares; Scola, Rosana Herminia

    2015-11-01

    Mitochondrial myopathy, Encephalopathy, Lactic Acidosis, and Stroke-like episodes (MELAS) is a rare mitochondrial disorder. Diagnostic criteria for MELAS include typical manifestations of the disease: stroke-like episodes, encephalopathy, evidence of mitochondrial dysfunction (laboratorial or histological) and known mitochondrial DNA gene mutations. Clinical features of MELAS are not necessarily uniform in the early stages of the disease, and correlations between clinical manifestations and physiopathology have not been fully elucidated. It is estimated that point mutations in the tRNALeu(UUR) gene of the DNAmt, mainly A3243G, are responsible for more of 80% of MELAS cases. Morphological changes seen upon muscle biopsy in MELAS include a substantive proportion of ragged red fibers (RRF) and the presence of vessels with a strong reaction for succinate dehydrogenase. In this review, we discuss mainly diagnostic criterion, clinical and laboratory manifestations, brain images, histology and molecular findings as well as some differential diagnoses and current treatments.

  13. Role of Myofibrillar Protein Catabolism in Development of Glucocorticoid Myopathy: Aging and Functional Activity Aspects

    Directory of Open Access Journals (Sweden)

    Teet Seene

    2016-05-01

    Full Text Available Muscle weakness in corticosteroid myopathy is mainly the result of the destruction and atrophy of the myofibrillar compartment of fast-twitch muscle fibers. Decrease of titin and myosin, and the ratio of nebulin and MyHC in myopathic muscle, shows that these changes of contractile and elastic proteins are the result of increased catabolism of the abovementioned proteins in skeletal muscle. Slow regeneration of skeletal muscle is in good correlation with a decreased number of satellite cells under the basal lamina of muscle fibers. Aging causes a reduction of AMP-activated protein kinase (AMPK activity as the result of the reduced function of the mitochondrial compartment. AMPK activity increases as a result of increased functional activity. Resistance exercise causes anabolic and anticatabolic effects in skeletal muscle: muscle fibers experience hypertrophy while higher myofibrillar proteins turn over. These changes are leading to the qualitative remodeling of muscle fibers. As a result of these changes, possible maximal muscle strength is increasing. Endurance exercise improves capillary blood supply, increases mitochondrial biogenesis and muscle oxidative capacity, and causes a faster turnover rate of sarcoplasmic proteins as well as qualitative remodeling of type I and IIA muscle fibers. The combination of resistance and endurance exercise may be the fastest way to prevent or decelerate muscle atrophy due to the anabolic and anticatabolic effects of exercise combined with an increase in oxidative capacity. The aim of the present short review is to assess the role of myofibrillar protein catabolism in the development of glucocorticoid-caused myopathy from aging and physical activity aspects.

  14. Masseter muscle myofibrillar protein synthesis and degradation in an experimental critical illness myopathy model.

    Directory of Open Access Journals (Sweden)

    Hazem Akkad

    Full Text Available Critical illness myopathy (CIM is a debilitating common consequence of modern intensive care, characterized by severe muscle wasting, weakness and a decreased myosin/actin (M/A ratio. Limb/trunk muscles are primarily affected by this myopathy while cranial nerve innervated muscles are spared or less affected, but the mechanisms underlying these muscle-specific differences remain unknown. In this time-resolved study, the cranial nerve innervated masseter muscle was studied in a unique experimental rat intensive care unit (ICU model, where animals were exposed to sedation, neuromuscular blockade (NMB, mechanical ventilation, and immobilization for durations varying between 6 h and 14d. Gel electrophoresis, immunoblotting, RT-PCR and morphological staining techniques were used to analyze M/A ratios, myofiber size, synthesis and degradation of myofibrillar proteins, and levels of heat shock proteins (HSPs. Results obtained in the masseter muscle were compared with previous observations in experimental and clinical studies of limb muscles. Significant muscle-specific differences were observed, i.e., in the masseter, the decline in M/A ratio and muscle fiber size was small and delayed. Furthermore, transcriptional regulation of myosin and actin synthesis was maintained, and Akt phosphorylation was only briefly reduced. In studied degradation pathways, only mRNA, but not protein levels of MuRF1, atrogin-1 and the autophagy marker LC3b were activated by the ICU condition. The matrix metalloproteinase MMP-2 was inhibited and protective HSPs were up-regulated early. These results confirm that the cranial nerve innervated masticatory muscles is less affected by the ICU-stress response than limb muscles, in accordance with clinical observation in ICU patients with CIM, supporting the model' credibility as a valid CIM model.

  15. Mutations in the satellite cell gene MEGF10 cause a recessive congenital myopathy with minicores.

    Science.gov (United States)

    Boyden, Steven E; Mahoney, Lane J; Kawahara, Genri; Myers, Jennifer A; Mitsuhashi, Satomi; Estrella, Elicia A; Duncan, Anna R; Dey, Friederike; DeChene, Elizabeth T; Blasko-Goehringer, Jessica M; Bönnemann, Carsten G; Darras, Basil T; Mendell, Jerry R; Lidov, Hart G W; Nishino, Ichizo; Beggs, Alan H; Kunkel, Louis M; Kang, Peter B

    2012-05-01

    We ascertained a nuclear family in which three of four siblings were affected with an unclassified autosomal recessive myopathy characterized by severe weakness, respiratory impairment, scoliosis, joint contractures, and an unusual combination of dystrophic and myopathic features on muscle biopsy. Whole genome sequence from one affected subject was filtered using linkage data and variant databases. A single gene, MEGF10, contained nonsynonymous mutations that co-segregated with the phenotype. Affected subjects were compound heterozygous for missense mutations c.976T > C (p.C326R) and c.2320T > C (p.C774R). Screening the MEGF10 open reading frame in 190 patients with genetically unexplained myopathies revealed a heterozygous mutation, c.211C > T (p.R71W), in one additional subject with a similar clinical and histological presentation as the discovery family. All three mutations were absent from at least 645 genotyped unaffected control subjects. MEGF10 contains 17 atypical epidermal growth factor-like domains, each of which contains eight cysteine residues that likely form disulfide bonds. Both the p.C326R and p.C774R mutations alter one of these residues, which are completely conserved in vertebrates. Previous work showed that murine Megf10 is required for preserving the undifferentiated, proliferative potential of satellite cells, myogenic precursors that regenerate skeletal muscle in response to injury or disease. Here, knockdown of megf10 in zebrafish by four different morpholinos resulted in abnormal phenotypes including unhatched eggs, curved tails, impaired motility, and disorganized muscle tissue, corroborating the pathogenicity of the human mutations. Our data establish the importance of MEGF10 in human skeletal muscle and suggest satellite cell dysfunction as a novel myopathic mechanism.

  16. Mutations in the collagen XII gene define a new form of extracellular matrix-related myopathy.

    Science.gov (United States)

    Hicks, Debbie; Farsani, Golara Torabi; Laval, Steven; Collins, James; Sarkozy, Anna; Martoni, Elena; Shah, Ashoke; Zou, Yaqun; Koch, Manuel; Bönnemann, Carsten G; Roberts, Mark; Lochmüller, Hanns; Bushby, Kate; Straub, Volker

    2014-05-01

    Bethlem myopathy (BM) [MIM 158810] is a slowly progressive muscle disease characterized by contractures and proximal weakness, which can be caused by mutations in one of the collagen VI genes (COL6A1, COL6A2 and COL6A3). However, there may be additional causal genes to identify as in ∼50% of BM cases no mutations in the COL6 genes are identified. In a cohort of -24 patients with a BM-like phenotype, we first sequenced 12 candidate genes based on their function, including genes for known binding partners of collagen VI, and those enzymes involved in its correct post-translational modification, assembly and secretion. Proceeding to whole-exome sequencing (WES), we identified mutations in the COL12A1 gene, a member of the FACIT collagens (fibril-associated collagens with interrupted triple helices) in five individuals from two families. Both families showed dominant inheritance with a clinical phenotype resembling classical BM. Family 1 had a single-base substitution that led to the replacement of one glycine residue in the triple-helical domain, breaking the Gly-X-Y repeating pattern, and Family 2 had a missense mutation, which created a mutant protein with an unpaired cysteine residue. Abnormality at the protein level was confirmed in both families by the intracellular retention of collagen XII in patient dermal fibroblasts. The mutation in Family 2 leads to the up-regulation of genes associated with the unfolded protein response (UPR) pathway and swollen, dysmorphic rough-ER. We conclude that the spectrum of causative genes in extracellular matrix (ECM)-related myopathies be extended to include COL12A1.

  17. Metabolic Myopathies

    Science.gov (United States)

    ... OII) Timed Up & Go (TUG) Western Ontario & McMaster Universities Osteoarthritis Index (WOMAC) Young Investigators Resources for Doctoral Students/Post-Doctoral Fellows Evidence-Based Practice for Academic Researchers Responsible Data Management in Research Career Planning Treatments Patient ...

  18. Mitochondrial Myopathy

    Science.gov (United States)

    ... these disorders and to find ways to effectively treat, prevent, or potentially cure them. Information from the National Library of Medicine’s MedlinePlus ... neuromuscular diseases caused by damage to the mitochondria—small, energy-producing structures that serve as the cells' "power plants." Nerve cells in the brain and muscles ...

  19. Inflammatory Myopathies

    Science.gov (United States)

    ... National Institutes of Health, the leading supporter of biomedical research in the world. The NINDS, along with other ... Testimony Legislative Updates Impact NINDS Contributions to Approved Therapies ... Director, Division of Intramural Research

  20. Mitochondrial Myopathy

    Science.gov (United States)

    ... Institutes of Health (NIH), the leading supporter of biomedical research in the world. In conjunction with other NIH ... Testimony Legislative Updates Impact NINDS Contributions to Approved Therapies ... Director, Division of Intramural Research

  1. Mitochondrial Myopathies

    Science.gov (United States)

    ... noting “soft signs” in unaffected relatives. These include deaf- ness, short stature, migraine headaches and PEO. Muscle ... mitochondrial defects and provide valuable information for family planning. Perhaps most important, knowing the genetic defects that ...

  2. Thyrotoxic Myopathy

    Science.gov (United States)

    ... potassium levels (known as periodic paralysis). View Full Definition Treatment Treatment involves restoring normal levels of thyroid hormone and may include thyroid drugs, radioactive iodine, and sometimes partial or complete surgical ...

  3. Evaluation of the inner wall axial cracks of steam generator tubes by eddy current test

    International Nuclear Information System (INIS)

    Hur, Do Haeng; Choi, Myung Sik; Lee, Doek Hyun; Han, Jung Ho

    2001-01-01

    For the enhancement of ECT reliability on the primary water stress corrosion cracks of nuclear steam generator tubes, it is important to comprehend the signal characteristics on crack morphology and to select an appropriate probe type. In this paper, the sizing accuracy and the detectability for the inner wall axial cracks of tubes were quantitatively evaluated using the electric discharge machined notches and the corrosion cracks which were developed on the operating steam generator tubes. The difference of eddy current signal characteristics between pancake and axial coil were also investigated. The results obtained from this study provide a useful information for more precise evaluation on the inner wall axial cracks of steam generator tubes.

  4. Evaluation of Eddy Current Signals from the Inner Wall Axial Cracks of Steam Generator Tubes

    International Nuclear Information System (INIS)

    Choi, Myung Sik; Hur, Do Haeng; Lee, Doek Hyun; Han, Jung Ho; Park, Jung Am

    2001-01-01

    For the enhancement of ECT reliability on the primary water stress corrosion cracks of nuclear steam generator tubes, of which the occurrence is on the increase, it is important to comprehend the signal characteristics on crack morphology and to select an appropriate probe type. In this paper, the sizing accuracy and the detectability for the inner wall axial cracks of tubes were quantitatively evaluated using the following specimens: the electric discharge machined notches and the corrosion cracks which were developed on the operating steam generator tubes. The difference of eddy current signal characteristics between pancake and axial coil were also Investigated. The results obtained from this study provide a useful information for more precise evaluation on the inner wall axial tracks oi steam generator tubes

  5. Constitutive relations describing creep deformation for multi-axial time-dependent stress states

    Science.gov (United States)

    McCartney, L. N.

    1981-02-01

    A THEORY of primary and secondary creep deformation in metals is presented, which is based upon the concept of tensor internal state variables and the principles of continuum mechanics and thermodynamics. The theory is able to account for both multi-axial and time-dependent stress and strain states. The wellknown concepts of elastic, anelastic and plastic strains follow naturally from the theory. Homogeneous stress states are considered in detail and a simplified theory is derived by linearizing with respect to the internal state variables. It is demonstrated that the model can be developed in such a way that multi-axial constant-stress creep data can be presented as a single relationship between an equivalent stress and an equivalent strain. It is shown how the theory may be used to describe the multi-axial deformation of metals which are subjected to constant stress states. The multi-axial strain response to a general cyclic stress state is calculated. For uni-axial stress states, square-wave loading and a thermal fatigue stress cycle are analysed.

  6. Numerical investigations on axial and radial blade rubs in turbo-machinery

    Science.gov (United States)

    Abdelrhman, Ahmed M.; Tang, Eric Sang Sung; Salman Leong, M.; Al-Qrimli, Haidar F.; Rajamohan, G.

    2017-07-01

    In the recent years, the clearance between the rotor blades and stator/casing had been getting smaller and smaller prior improving the aerodynamic efficiency of the turbomachines as demand in the engineering field. Due to the clearance reduction between the blade tip and the rotor casing and between rotor blades and stator blades, axial and radial blade rubbing could be occurred, especially at high speed resulting into complex nonlinear vibrations. The primary aim of this study is to address the blade axial rubbing phenomenon using numerical analysis of rotor system. A comparison between rubbing caused impacts of axial and radial blade rubbing and rubbing forces are also aims of this study. Tow rotor models (rotor-stator and rotor casing models) has been designed and sketched using SOILDSWORKS software. ANSYS software has been used for the simulation and the numerical analysis. The rubbing conditions were simulated at speed range of 1000rpm, 1500rpm and 2000rpm. Analysis results for axial blade rubbing showed the appearance of blade passing frequency and its multiple frequencies (lx, 2x 3x etc.) and these frequencies will more excited with increasing the rotational speed. Also, it has been observed that when the rotating speed increased, the rubbing force and the harmonics frequencies in x, y and z-direction become higher and severe. The comparison study showed that axial blade rub is more dangerous and would generate a higher vibration impacts and higher blade rubbing force than radial blade rub.

  7. Deformation and collapse of zircaloy fuel rod cladding into plenum axial gaps

    International Nuclear Information System (INIS)

    Pfennigwerth, P.L.; Gorscak, D.A.; Selsley, I.A.

    1983-01-01

    To minimize support structure, blanket and reflector fuel rods of the thoria urania-fueled Light Water Breeder Reactor (LWBR) were designed with non-freestanding Zircaloy-4 cladding. An analytical model was developed to predict deformation of unirradiated cladding into axial gaps of fuel rod plenum regions where it is unsupported. This model uses the ACCEPT finite element computer program to calculate elastic-plastic deformation of cladding due to external pressure. The finite element is 20-node, triquadratic, isoparametric, and 3-dimensional. Its curved surface permits accurate modeling of the tube geometry, including geometric nonuniformities such as circumferential wall thickness variation and initial tube out-of-roundness. Progressive increases in axial gap length due to cladding elongation and fuel stack shrinkage are modeled, as are deformations of fuel pellets and stainless steel support sleeves which bound plenum axial gaps in LWBR type blanket fuel rods. Zircaloy-4 primary and secondary thermal creep representations were developed from uniaxial creep testing of fuel rod tubing. Creep response to multi-axial loading is modeled with a variation of Hill's formulation for anisotropic materials. Coefficients accounting for anisotropic thermal creep in Zircaloy-4 tubes were developed from creep testing of externally pressurized tubes having fixed axial gaps in the range 2.5 cm to 5.7 cm and radial clearances over simulated fuel pellets ranging from zero to 0.089 mm. (orig./RW)

  8. Review of Axial Burnup Distribution Considerations for Burnup Credit Calculations

    International Nuclear Information System (INIS)

    Wagner, J.C.; DeHart, M.D.

    2000-01-01

    This report attempts to summarize and consolidate the existing knowledge on axial burnup distribution issues that are important to burnup credit criticality safety calculations. Recently released Nuclear Regulatory Commission (NRC) staff guidance permits limited burnup credit, and thus, has prompted resolution of the axial burnup distribution issue. The reactivity difference between the neutron multiplication factor (keff) calculated with explicit representation of the axial burnup distribution and keff calculated assuming a uniform axial burnup is referred to as the ''end effect.'' This end effect is shown to be dependent on many factors, including the axial-burnup profile, total accumulated burnup, cooling time, initial enrichment, assembly design, and the isotopics considered (i.e., actinide-only or actinides plus fission products). Axial modeling studies, efforts related to the development of axial-profile databases, and the determination of bounding axial profiles are also discussed. Finally, areas that could benefit from further efforts are identified

  9. On the problem of axial anomaly in supersymmetric gauge theories

    International Nuclear Information System (INIS)

    Kazakov, D.I.

    1984-01-01

    The explicit relation is found between the axial current obeying the Adler-Bardeen theorem and the supersymmetric one belonging to a supermultiplet. It is shown that the axial and superconformal anomalies are consistent in all orders of perturbation theory

  10. Gearbox Instrumentation for the Investigation of Bearing Axial Cracking

    Energy Technology Data Exchange (ETDEWEB)

    Keller, Jonathan A [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Lambert, Scott R [National Renewable Energy Laboratory (NREL), Golden, CO (United States)

    2018-03-27

    Failures in gearbox bearings have been the primary source of reliability issues for wind turbine drivetrains, leading to costly downtime and unplanned maintenance. The most common failure mode is attributed to so-called axial cracks or white-etching cracks, which primarily affect the intermediate and high-speed-stage bearings. The high-speed-shaft and bearing loads and sliding will be measured with a specially instrumented gearbox installed in a 1.5-megawatt turbine at the National Wind Technology Center in an upcoming test campaign. Additional instrumentation will also measure the tribological environment of these bearings, including bearing temperatures, lubricant temperature and water content, air temperature and humidity, and stray electrical current across the bearings. This paper fully describes the instrumentation package and summarizes initial results.

  11. Cross-flow filtration and axial filtration

    International Nuclear Information System (INIS)

    Kraus, K.A.

    1974-01-01

    Two relatively novel alternative solid-liquid-separation techniques of filtration are discussed. In cross-flow filtration, the feed is pumped past the filtering surface. While in axial filtration the filter, mounted on a rotor, is moved with respect to the feed. While large-scale application of the axial filter is still in doubt, it permits with little expenditure of time and money, duplication of many hydrodynamic aspects of cross-flow filtration for fine-particle handling problems. The technique has been applied to municipal wastes, low-level radioactive waste treatment plant, lead removal from industrial wastes, removal of pulp-mill contaminants, textile-mill wastes, and pretreatment of saline waters by lime-soda process in preparation for hyperfiltration. Economics and energy requirements are also discussed

  12. Computerized axial tomography in traumatic cervical lesions

    International Nuclear Information System (INIS)

    Koyama, Tsunemaro

    1982-01-01

    Although plain computerized axial tomography cannot routinely demonstrate the spinal cord, it does provide excellent visualization of the bony outline of the spinal canal and vertebral column. So it should be reasonable to use this technique in cases of cervical traumatic disorders. In this paper we presented 10 cases of cervical traumatic lesions; 3 atlanto-axial dislocation, 2 cervical canal stenosis, 3 OPLL, 1 intramedullary hematoma and 1 C 2 -neurinoma. In some patients neurologic deficits were induced by cervical trauma. Bony lesions appeared more adequately deliniated than intraspinal lesions, however, in some cases intramedullary changes could also be demonstrated. The use of metrizamide with high resolution CT-scanner could improve the usefullness of this technique. (author)

  13. Ventajas de los motores de flujo axial

    Directory of Open Access Journals (Sweden)

    Alberto M Basanta Otero

    2011-03-01

    Full Text Available Es importante conocer sobre una familia de motores que a diferencia de los convencionales o tradicionales no presentanun flujo rotatorio radial, denominados motores de flujo axial. Dichos motores presentan altos valores de par motriz abajas velocidades, una alta eficiencia y alta densidad de potencia. Este trabajo constituye un breve análisis dealgunos motores de la referencia bibliográfica.  Is important to know about a family of motors that at difference whit the traditional, don't have a rotator radial flux,called, axial flux motors. These motors have high torque for low speed, high efficiency and high power density. Thiswork is a brief analysis of several motors of the bibliographic references.

  14. [Axial lumbar interbody fusion: prospective monocentric study].

    Science.gov (United States)

    Stulík, J; Adámek, S; Barna, M; Kaspříková, N; Polanecký, O; Kryl, J

    2014-01-01

    The aim of this prospective study was to evaluate clinical and radiographic results in the patients who underwent L5-S1 fixation using the technique of percutaneous lumbar interbody fusion (AxiaLIF). The study comprised 23 patients, 11 women and 12 men, who ranged from age of 21 to 63 years, with an average of 48.2 years. In all patients surgical posterior stabilisation involving the L5-S1 segment had previously been done. The initial indications for surgery were L5-S1 spondylolisthesis in 20 and L5-S1 spondylosis and stenosis in three patients. The AxiaLIF technique for L5-S1 fixation was indicated in overweight patients and in those after repeated abdominal or retroperitoneal surgery. A suitable position and shape of the sacrum or lumbosacral junction was another criterion. The patients were evaluated between 26 and 56 months (average, 40.4 months) after primary surgery and, on the basis of CT and radiographic findings, bone union and lumbosacral junction stability were assessed. The clinical outcome was investigated using the ODI and VAS systems and the results were statistically analysed by the Wilcoxon test for paired samples with statistical significance set at a level of 0.05. The average VAS value was 6.6 before surgery and, after surgery, 5.2 at three months, 4.2 at six months, 3.1 at one year, 2.9 at two years and 2.1 at three years (n=18). At two post-operative years, improvement in the VAS value by 56.1% was recorded. The average pre-operative ODI value was 25.1; the post-operative values were 17.0 at six months, 12.3 at one year, 10.6 at two years and 8.2 at three years (n=18). At two years after surgery the ODI value improved by 57.8%. To the question concerning their willingness to undergo, with acquired experience, surgery for the same diagnosis, 21 patients (91.3%) gave an affirmative answer. Neither screw breakage nor neurovascular damage or rectal injury was found. CT scans showed complete interbody bone fusion in 22 of the 23 patients (95

  15. Internal and external axial corner flows

    Science.gov (United States)

    Kutler, P.; Shankar, V.; Anderson, D. A.; Sorenson, R. L.

    1975-01-01

    The inviscid, internal, and external axial corner flows generated by two intersecting wedges traveling supersonically are obtained by use of a second-order shock-capturing, finite-difference approach. The governing equations are solved iteratively in conical coordinates to yield the complicated wave structure of the internal corner and the simple peripheral shock of the external corner. The numerical results for the internal flows compare favorably with existing experimental data.

  16. Axial flux permanent magnet brushless machines

    CERN Document Server

    Gieras, Jacek F; Kamper, Maarten J

    2008-01-01

    Axial Flux Permanent Magnet (AFPM) brushless machines are modern electrical machines with a lot of advantages over their conventional counterparts. They are being increasingly used in consumer electronics, public life, instrumentation and automation system, clinical engineering, industrial electromechanical drives, automobile manufacturing industry, electric and hybrid electric vehicles, marine vessels and toys. They are also used in more electric aircrafts and many other applications on larger scale. New applications have also emerged in distributed generation systems (wind turbine generators

  17. Axial gravity, massless fermions and trace anomalies

    Energy Technology Data Exchange (ETDEWEB)

    Bonora, L. [International School for Advanced Studies (SISSA), Trieste (Italy); KEK, Tsukuba (Japan). KEK Theory Center; INFN, Sezione di Trieste (Italy); Cvitan, M.; Giaccari, S.; Stemberga, T. [Zagreb Univ. (Croatia). Dept. of Physics; Prester, P.D. [Rijeka Univ. (Croatia). Dept. of Physics; Pereira, A.D. [UERJ-Univ. Estadual do Rio de Janeiro (Brazil). Dept. de Fisica Teorica; UFF-Univ. Federal Fluminense, Niteroi (Brazil). Inst. de Fisica

    2017-08-15

    This article deals with two main topics. One is odd parity trace anomalies in Weyl fermion theories in a 4d curved background, the second is the introduction of axial gravity. The motivation for reconsidering the former is to clarify the theoretical background underlying the approach and complete the calculation of the anomaly. The reference is in particular to the difference between Weyl and massless Majorana fermions and to the possible contributions from tadpole and seagull terms in the Feynman diagram approach. A first, basic, result of this paper is that a more thorough treatment, taking account of such additional terms and using dimensional regularization, confirms the earlier result. The introduction of an axial symmetric tensor besides the usual gravitational metric is instrumental to a different derivation of the same result using Dirac fermions, which are coupled not only to the usual metric but also to the additional axial tensor. The action of Majorana and Weyl fermions can be obtained in two different limits of such a general configuration. The results obtained in this way confirm the previously obtained ones. (orig.)

  18. Axial gravity, massless fermions and trace anomalies

    International Nuclear Information System (INIS)

    Bonora, L.; Cvitan, M.; Giaccari, S.; Stemberga, T.; Prester, P.D.; Pereira, A.D.; UFF-Univ. Federal Fluminense, Niteroi

    2017-01-01

    This article deals with two main topics. One is odd parity trace anomalies in Weyl fermion theories in a 4d curved background, the second is the introduction of axial gravity. The motivation for reconsidering the former is to clarify the theoretical background underlying the approach and complete the calculation of the anomaly. The reference is in particular to the difference between Weyl and massless Majorana fermions and to the possible contributions from tadpole and seagull terms in the Feynman diagram approach. A first, basic, result of this paper is that a more thorough treatment, taking account of such additional terms and using dimensional regularization, confirms the earlier result. The introduction of an axial symmetric tensor besides the usual gravitational metric is instrumental to a different derivation of the same result using Dirac fermions, which are coupled not only to the usual metric but also to the additional axial tensor. The action of Majorana and Weyl fermions can be obtained in two different limits of such a general configuration. The results obtained in this way confirm the previously obtained ones. (orig.)

  19. Golimumab for the treatment of axial spondyloarthritis.

    Science.gov (United States)

    Palazzi, Carlo; D'angelo, Salvatore; Gilio, Michele; Leccese, Pietro; Padula, Angela; Olivieri, Ignazio

    2017-01-01

    Anti-TNF drugs have represented an epochal revolution in the treatment of rheumatoid arthritis and spondyloarthritis. In the field of axial spondyloarthritis, golimumab, a fully human monoclonal anti-TNFα administered subcutaneously every 4 weeks, has shown significant efficacy and good safety in patients with ankylosing spondylitis. More recently, it was also indicated as an effective treatment for patients suffering from non-radiographic axial spondyloarthitits. Areas covered: A systematic literature search was completed, using the largest electronic databases (Medline, Embase and Cochrane), with the aim to review all data concerning the administration of golimumab in patients suffering from axial spondyloartritis. Expert opinion: In the 16-week GO-AHEAD study, golimumab was effective in patients with non-radiographic spondyloarthritis with high levels of CRP and/or positive MRI findings, but not in subjects with both negative CRP and MRI. This finding allows for the addressing the of anti-TNF treatment more specifically. Preliminary data concerning an open-label extension of the GO-AHEAD study outlined the high retention-rate of the drug at 52 weeks. The production of antibodies against golimumab is rare and it seems to exert scarce influence on the drug performances. In conclusion, golimumab appears as a very useful and well tolerated anti-TNF agent.

  20. Computational analysis of a multistage axial compressor

    Science.gov (United States)

    Mamidoju, Chaithanya

    Turbomachines are used extensively in Aerospace, Power Generation, and Oil & Gas Industries. Efficiency of these machines is often an important factor and has led to the continuous effort to improve the design to achieve better efficiency. The axial flow compressor is a major component in a gas turbine with the turbine's overall performance depending strongly on compressor performance. Traditional analysis of axial compressors involves throughflow calculations, isolated blade passage analysis, Quasi-3D blade-to-blade analysis, single-stage (rotor-stator) analysis, and multi-stage analysis involving larger design cycles. In the current study, the detailed flow through a 15 stage axial compressor is analyzed using a 3-D Navier Stokes CFD solver in a parallel computing environment. Methodology is described for steady state (frozen rotor stator) analysis of one blade passage per component. Various effects such as mesh type and density, boundary conditions, tip clearance and numerical issues such as turbulence model choice, advection model choice, and parallel processing performance are analyzed. A high sensitivity of the predictions to the above was found. Physical explanation to the flow features observed in the computational study are given. The total pressure rise verses mass flow rate was computed.

  1. Bessel beam CARS of axially structured samples

    Science.gov (United States)

    Heuke, Sandro; Zheng, Juanjuan; Akimov, Denis; Heintzmann, Rainer; Schmitt, Michael; Popp, Jürgen

    2015-06-01

    We report about a Bessel beam CARS approach for axial profiling of multi-layer structures. This study presents an experimental implementation for the generation of CARS by Bessel beam excitation using only passive optical elements. Furthermore, an analytical expression is provided describing the generated anti-Stokes field by a homogeneous sample. Based on the concept of coherent transfer functions, the underling resolving power of axially structured geometries is investigated. It is found that through the non-linearity of the CARS process in combination with the folded illumination geometry continuous phase-matching is achieved starting from homogeneous samples up to spatial sample frequencies at twice of the pumping electric field wave. The experimental and analytical findings are modeled by the implementation of the Debye Integral and scalar Green function approach. Finally, the goal of reconstructing an axially layered sample is demonstrated on the basis of the numerically simulated modulus and phase of the anti-Stokes far-field radiation pattern.

  2. Dynamic control of knee axial deformities

    Directory of Open Access Journals (Sweden)

    E. E. Malyshev

    2013-01-01

    Full Text Available The authors have evaluated the clinical examination of the patients with axial malalignments in the knee by the original method and device which was named varovalgometer. The measurements were conducted by tension of the cord through the spina iliaca anterior superior and the middle of the lower pole of patella. The deviation of the center of the ankle estimated by metal ruler which was positioned perpendicular to the lower leg axis on the level of the ankle joint line. The results of comparison of our method and computer navigation in 53 patients during the TKA show no statistically significant varieties but they differ by average 5° of valgus in clinical examination in comparison with mechanical axis which was identified by computer navigation. The dynamic control of axial malalignment can be used in clinical practice for estimation of the results of treatment of pathology with axial deformities in the knee; for the control of reduction and secondary displacement of the fractures around the knee; for assessment of instability; in planning of correctional osteotomies and intraoperative control of deformity correction; for estimation of Q angle in subluxation and recurrent dislocation of patella; in planning of TKA; during the growth of child it allows to assess the progression of deformity.

  3. Comparative morphology of the axial complex and interdependence of internal organ systems in sea urchins (Echinodermata: Echinoidea).

    Science.gov (United States)

    Ziegler, Alexander; Faber, Cornelius; Bartolomaeus, Thomas

    2009-06-09

    The axial complex of echinoderms (Echinodermata) is composed of various primary and secondary body cavities that interact with each other. In sea urchins (Echinoidea), structural differences of the axial complex in "regular" and irregular species have been observed, but the reasons underlying these differences are not fully understood. In addition, a better knowledge of axial complex diversity could not only be useful for phylogenetic inferences, but improve also an understanding of the function of this enigmatic structure. We therefore analyzed numerous species of almost all sea urchin orders by magnetic resonance imaging, dissection, histology, and transmission electron microscopy and compared the results with findings from published studies spanning almost two centuries. These combined analyses demonstrate that the axial complex is present in all sea urchin orders and has remained structurally conserved for a long time, at least in the "regular" species. Within the Irregularia, a considerable morphological variation of the axial complex can be observed with gradual changes in topography, size, and internal architecture. These modifications are related to the growing size of the gastric caecum as well as to the rearrangement of the morphology of the digestive tract as a whole. The structurally most divergent axial complex can be observed in the highly derived Atelostomata in which the reorganization of the digestive tract is most pronounced. Our findings demonstrate a structural interdependence of various internal organs, including digestive tract, mesenteries, and the axial complex.

  4. Axial anomaly at finite temperature and finite density

    International Nuclear Information System (INIS)

    Qian Zhixin; Su Rukeng; Yu, P.K.N.

    1994-01-01

    The U(1) axial anomaly in a hot fermion medium is investigated by using the real time Green's function method. After calculating the lowest order triangle diagrams, we find that finite temperature as well as finite fermion density does not affect the axial anomaly. The higher order corrections for the axial anomaly are discussed. (orig.)

  5. Mutation in TWINKLE in a Large Iranian Family with Progressive External Ophthalmoplegia, Myopathy, Dysphagia and Dysphonia, and Behavior Change.

    Science.gov (United States)

    Tafakhori, Abbas; Yu Jin Ng, Alvin; Tohari, Sumanty; Venkatesh, Byrappa; Lee, Hane; Eskin, Ascia; Nelson, Stanley F; Bonnard, Carine; Reversade, Bruno; Kariminejad, Ariana

    2016-02-01

    TWINKLE (c10orf2) gene is responsible for autosomal dominant progressive external ophthalmoplegia (PEO). In rare cases, additional features such as muscle weakness, peripheral neuropathy, ataxia, cardiomyopathy, dysphagia, dysphonia, cataracts, depression, dementia, parkinsonism, and hearing loss have been reported in association with heterozygous mutations of the TWINKLE gene. We have studied a large Iranian family with myopathy, dysphonia, dysphagia, and behavior change in addition to PEO in affected members. We identified a missense mutation c.1121G > A in the c10orf2 gene in all affected members. Early death is a novel feature seen in affected members of this family that has not been reported to date. The association of PEO, myopathy, dysphonia, dysphagia, behavior change and early death has not been previously reported in the literature or other patients with this mutation.

  6. Internal anal sphincter myopathy causing proctalgia fugax and constipation: further clinical and radiological characterization in a patient.

    Science.gov (United States)

    Guy, R J; Kamm, M A; Martin, J E

    1997-02-01

    We report a case of a distinctive familial internal anal sphincter myopathy with unique histological and radiological features. A 67-year-old woman presented with a 20-year history of proctalgia fugax and outlet obstruction; other family members were similarly affected. Computed tomograpy and magnetic resonance imaging demonstrated a grossly hypertrophied internal anal sphincter. Strip myectomy of the sphincter was carried out with improvement in evacuation but little relief of proctalgia. Further relief of symptoms was obtained using oral and transdermal nitrates and a calcium antagonist. Histological examination of the excised muscle revealed hypertrophy and an abnormal arrangement of fibres in whorls; many fibres contained vacuoles with inclusion bodies positive for periodic acid-Schiff. This description of a specific anal sphincter myopathy illustrates the potential importance of histopathological studies of smooth muscle in functional disorders of the gut.

  7. Specific binding of Ulex europaeus agglutinin I lectin to sarcolemma of distal myopathy with rimmed vacuole formation.

    Science.gov (United States)

    Yatabe, K; Kawai, M

    1997-08-01

    Ulex europaeus agglutinin I (UEA I) binding was studied in 83 patients with various neuromuscular disorders. UEA I labelled endomysial capillaries and endothelial cells of perimysial blood vessels in all the examined muscles. There was no UEA I binding to muscle fibres except for all (9) cases of distal myopathy with rimmed vacuole formation (DMRV), 1 of 5 cases of inclusion body myositis and 1 of 36 cases of inflammatory myopathies. The UEA I binding was completely eliminated by preincubation of UEA I solution with L-fucose. Using electron microscopy, the UEA I binding was localized to sarcolemma and intrasarco-plasmic membranous organelles other than mitochondria. Myosatellite cells were not labelled. These findings revealed the existence of fucosylated proteins or lipids in a subset of skeletal muscles suffering from DMRV. Biochemical identification of the fucosylated substance and further detailed study on subcellular localization of UEA I binding may yield important clues to the unknown pathogenesis of DMRV.

  8. Stac3 is a component of the excitation-contraction coupling machinery and mutated in Native American myopathy

    Science.gov (United States)

    Horstick, Eric J.; Linsley, Jeremy W.; Dowling, James J.; Hauser, Michael A.; McDonald, Kristin K.; Ashley-Koch, Allison; Saint-Amant, Louis; Satish, Akhila; Cui, Wilson W.; Zhou, Weibin; Sprague, Shawn M.; Stamm, Demetra S.; Powell, Cynthia M.; Speer, Marcy C.; Franzini-Armstrong, Clara; Hirata, Hiromi; Kuwada, John Y.

    2013-01-01

    Excitation-contraction coupling, the process that regulates contractions by skeletal muscles, transduces changes in membrane voltage by activating release of Ca2+ from internal stores to initiate muscle contraction. Defects in EC coupling are associated with muscle diseases. Here we identify Stac3 as a novel component of the EC coupling machinery. Using a zebrafish genetic screen, we generate a locomotor mutation that is mapped to stac3. We provide electrophysiological, Ca2+ imaging, immunocytochemical and biochemical evidence that Stac3 participates in excitation-contraction coupling in muscles. Furthermore, we reveal that a mutation in human STAC3 as the genetic basis of the debilitating Native American myopathy (NAM). Analysis of NAM stac3 in zebrafish shows that the NAM mutation decreases excitation-contraction coupling. These findings enhance our understanding of both excitation-contraction coupling and the pathology of myopathies. PMID:23736855

  9. The deep structure of Axial Volcano

    Science.gov (United States)

    West, Michael Edwin

    The subsurface structure of Axial Volcano, near the intersection of the Juan de Fuca Ridge and the Cobb-Eickelberg seamount chain in the northeast Pacific, is imaged from an active source seismic experiment. At a depth of 2.25 to 3.5 km beneath Axial lies an 8 km x 12 km region of very low seismic velocities that can only be explained by the presence of magma. In the center of this magma storage chamber at 2--3.5 km below sea floor, the crust is at least 10--20% melt. At depths of 4--5 km there is evidence of additional low concentrations of magma (a few percent) over a larger area. In total, 5--11 km3 of magma are stored in the mid-crust beneath Axial. This is more melt than has been positively identified under any basaltic volcano on Earth. It is also far more than the 0.1--0.2 km3 emplaced during the 1998 eruption. The implied residence time in the magma reservoir of a few hundred to a few thousand years agrees with geochemical trends which suggest prolonged storage and mixing of magmas. The large volume of melt bolsters previous observations that Axial provides much of the material to create crust along its 50 km rift zones. A high velocity ring-shaped feature sits above the magma chamber just outside the caldera walls. This feature is believed to be the result of repeated dike injections from the magma body to the surface during the construction of the volcanic edifice. A rapid change in crustal thickness from 8 to 11 km within 15 km of the caldera implies focused delivery of melt from the mantle. The high flux of magma suggests that melting occurs deeper in the mantle than along the nearby ridge. Melt supply to the volcano is not connected to any plumbing system associated with the adjacent segments of the Juan de Fuca Ridge. This suggests that, despite Axial's proximity to the ridge, the Cobb hot spot currently drives the supply of melt to the volcano.

  10. The ratchet–shakedown diagram for a thin pressurised pipe subject to additional axial load and cyclic secondary global bending

    International Nuclear Information System (INIS)

    Bradford, R.A.W.; Tipping, D.J.

    2015-01-01

    The ratchet and shakedown boundaries are derived analytically for a thin cylinder composed of elastic-perfectly plastic Tresca material subject to constant internal pressure with capped ends, plus an additional constant axial load, F, and a cycling secondary global bending load. The analytic solution is in good agreement with solutions found using the linear matching method. When F is tensile, ratcheting can occur for sufficiently large cyclic bending loads in which the pipe gets longer and thinner but its diameter remains the same. When F is compressive, ratcheting can occur in which the pipe diameter increases and the pipe gets shorter, but its wall thickness remains the same. When subject to internal pressure and cyclic bending alone (F = 0), no ratcheting is possible, even for arbitrarily large bending loads, despite the presence of the axial pressure load. The reason is that the case with a primary axial membrane stress exactly equal to half the primary hoop membrane stress is equipoised between tensile and compressive axial ratcheting, and hence does not ratchet at all. This remarkable result appears to have escaped previous attention. - Highlights: • A thin cylinder is subject to pressure and cyclic global bending and additional axial load. • Ratchet and shakedown boundaries are derived analytically and using LMM. • Good agreement is found. • No ratcheting occurs for zero additional axial load.

  11. A new strategy of axial power distribution control based on three axial offsets concept

    International Nuclear Information System (INIS)

    Shimazu, Yoichiro

    2009-01-01

    We have proposed a very simple control procedure for axial xenon oscillation control based on a characteristic trajectory. The trajectory is drawn by three offsets of power distributions, namely, AOp, AOi and AOx. They are defined as the offset of axial power distribution, the offset of the power distribution under which the current iodine distribution is obtained as the equilibrium and that for xenon distribution, respectively. When these offsets are plotted on X-Y plane for (AOp-AOx, AOi-AOx) the trajectory draws a quite characteristic ellipse (or an elliptic spiral). On the other hands, Constant Axial Offset Control (CAOC) procedure is adopted as axial power distribution control strategy during both base load and load following operations in domestic PWRs. In the previous paper, we have presented an innovative procedure of axial power distribution control during load following in PWRs based on this trajectory such that the AOp-AOx is to be controlled to zero when the value deviates the pre-determined limiting values. In this paper we propose a modified control strategy to get more stability of axial power distributions. In this strategy, we control the trajectory to be close to the major axis of the ellipse when the power distribution reaches the limiting values. In other words, the plot is not controlled only to reduce AOp-AOx but also AOi-AOx is taken into account at the same time. It is known that when the plot is controlled to the major axis, it means that the point gives the peak position of axial xenon oscillation. Therefore xenon oscillation will not increase its amplitude any more. Thus more stable axial power distribution control is attained. This kind of design concept is quite important especially for the future PWRs with elongated fuel length and longer core life. Because in a longer effective core and also the longer core life, it has been known that the stability of axial xenon oscillation becomes more unstable. In this paper, some simulation

  12. Mild trifunctional protein deficiency is associated with progressive neuropathy and myopathy and suggests a novel genotype-phenotype correlation.

    OpenAIRE

    Ibdah, J A; Tein, I; Dionisi-Vici, C; Bennett, M J; IJlst, L; Gibson, B; Wanders, R J; Strauss, A W

    1998-01-01

    Human mitochondrial trifunctional protein (TFP) is a heterooctamer of four alpha- and four beta-subunits that catalyzes three steps in the beta-oxidation spiral of long-chain fatty acids. TFP deficiency causes a Reye-like syndrome, cardiomyopathy, or sudden, unexpected death. We delineated the molecular basis for TFP deficiency in two patients with a unique phenotype characterized by chronic progressive polyneuropathy and myopathy without hepatic or cardiac involvement. Single-stranded confor...

  13. Performance, meat quality, and pectoral myopathies of broilers fed either corn or sorghum based diets supplemented with guanidinoacetic acid.

    Science.gov (United States)

    Córdova-Noboa, H A; Oviedo-Rondón, E O; Sarsour, A H; Barnes, J; Ferzola, P; Rademacher-Heilshorn, M; Braun, U

    2018-04-13

    One experiment was conducted to evaluate the effects of guanidinoacetic acid (GAA) supplementation in broilers fed corn or sorghum-based diets on live performance, carcass and cut up yields, meat quality, and pectoral myopathies. The treatments consisted of corn or sorghum-based diets with or without the addition of GAA (600 g/ton). A total of 800 one-d-old male Ross 708 broiler chicks were randomly placed in 40 floor pens with 10 replicates (20 birds per pen) per each of the four treatments. At hatch, 14, 35, and 50 d, BW and feed intake were recorded. BW gain and FCR were calculated at the end of each phase. Four broilers per pen were selected and slaughtered at 51d and 55d of age to determine carcass and cut up yields, meat quality and myopathies (spaghetti muscle, white striping, and wooden breast) severity in the Pectoralis major. Data were analyzed as a randomized complete block design in a 2 × 2 factorial arrangement with grain type and GAA supplementation as main effects. At 50 d, diets containing GAA improved (P broilers fed corn diets with GAA had higher breast meat yield (P 0.05) by GAA supplementation at any slaughter ages. However, GAA decreased (P broilers supplemented with GAA had double (P broilers fed non-supplemented diets, therefore reducing the severity of this myopathy. In conclusion, GAA supplementation improved broiler live performance in broilers raised up to 50 d independently of grain source, increased breast meat yield in corn-based diets and reduced the severity of wooden breast myopathy.

  14. Mutation in the novel nuclear-encoded mitochondrial protein CHCHD10 in a family with autosomal dominant mitochondrial myopathy.

    Science.gov (United States)

    Ajroud-Driss, Senda; Fecto, Faisal; Ajroud, Kaouther; Lalani, Irfan; Calvo, Sarah E; Mootha, Vamsi K; Deng, Han-Xiang; Siddique, Nailah; Tahmoush, Albert J; Heiman-Patterson, Terry D; Siddique, Teepu

    2015-01-01

    Mitochondrial myopathies belong to a larger group of systemic diseases caused by morphological or biochemical abnormalities of mitochondria. Mitochondrial disorders can be caused by mutations in either the mitochondrial or nuclear genome. Only 5% of all mitochondrial disorders are autosomal dominant. We analyzed DNA from members of the previously reported Puerto Rican kindred with an autosomal dominant mitochondrial myopathy (Heimann-Patterson et al. 1997). Linkage analysis suggested a putative locus on the pericentric region of the long arm of chromosome 22 (22q11). Using the tools of integrative genomics, we established chromosome 22 open reading frame 16 (C22orf16) (later designated as CHCHD10) as the only high-scoring mitochondrial candidate gene in our minimal candidate region. Sequence analysis revealed a double-missense mutation (R15S and G58R) in cis in CHCHD10 which encodes a coiled coil-helix-coiled coil-helix protein of unknown function. These two mutations completely co-segregated with the disease phenotype and were absent in 1,481 Caucasian and 80 Hispanic (including 32 Puerto Rican) controls. Expression profiling showed that CHCHD10 is enriched in skeletal muscle. Mitochondrial localization of the CHCHD10 protein was confirmed using immunofluorescence in cells expressing either wild-type or mutant CHCHD10. We found that the expression of the G58R, but not the R15S, mutation induced mitochondrial fragmentation. Our findings identify a novel gene causing mitochondrial myopathy, thereby expanding the spectrum of mitochondrial myopathies caused by nuclear genes. Our findings also suggest a role for CHCHD10 in the morphologic remodeling of the mitochondria.

  15. Intrinsic carpal ligaments on MR and multidetector CT arthrography: comparison of axial and axial oblique planes

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Ryan K.L.; Griffith, James F.; Ng, Alex W.H.; Law, Eric K.C. [The Chinese University of Hong Kong, Department of Imaging and Interventional Radiology, Prince Of Wales Hospital, Hong Kong (China); Tse, W.L.; Wong, Clara W.Y.; Ho, P.C. [The Chinese University of Hong Kong, Department of Orthopedics and Traumatology, Prince Of Wales Hospital, Hong Kong (China)

    2017-03-15

    To compare axial and oblique axial planes on MR arthrography (MRA) and multidetector CT arthrography (CTA) to evaluate dorsal and volar parts of scapholunate (SLIL) and lunotriquetral interosseous (LTIL) ligaments. Nine cadaveric wrists of five male subjects were studied. The visibility of dorsal and volar parts of the SLIL and LTIL was graded semi-quantitatively (good, intermediate, poor) on MRA and CTA. The presence of a ligament tear was determined on arthrosocopy and sensitivity, specificity and accuracy of tear detection were calculated. Oblique axial imaging was particularly useful for delineating dorsal and volar parts of the LTIL on MRA with overall 'good' visibility increased from 11 % to 78 %. The accuracy of MRA and CTA in revealing SLIL and LTIL tear was higher using the oblique axial plane. The overall accuracy for detecting SLIL tear on CTA improved from 94 % to 100 % and from 89 % to 94 % on MRA; the overall accuracy of detecting LTIL tear on CTA improved from 89 % to 100 % and from 72 % to 89 % on MRA Oblique axial imaging during CT and MR arthrography improves detection of tears in the dorsal and volar parts of both SLIL and LTIL. (orig.)

  16. [Fenofibrate--induced myopathy in a patient with undiagnosed hypothyroidism--case report and a review of the literature].

    Science.gov (United States)

    Lukjanowicz, Małgorzata; Trzcińska-Butkiewicz, Beata; Brzosko, Marek

    2006-01-01

    Hypothyroidism is one of the common causes of the secondary hypercholesterolemia. The prevalence of hypothyroidism in the general population is estimated to be as high as about 1.5%. Frequency of the hypothyroidism in patients with hyperlipidemia is high, and can be observed in 4.2-10% in different populations. Most commonly, there is no need to treat the hypothyroid patients with the hypolipidemic drugs. Substitution treatment with the thyroid hormones usually results in either normalization or significant decreasing of the lipid levels. Hypothyroidism with symptoms of involvement of skeletal muscles is referred as to hypothyroid myopathy in English literature, and can be present in 30-80% patients with deficiency of the thyroid hormones. Hypothyroidism is a risk factor of developing of toxic injury of muscles, what is thought to be related to hypolipidemic drug intake. We report a case of a patient with undiagnosed hypothyroidism with muscle involvement manifestation, who was treated with fenofibrate due to accidentally diagnosed hypercholesterolemia. Hypolipidemic management resulted in rapid exacerbation of previously moderate myopathy. High concentrations of muscle enzymes and moderate increasing of creatinine concentration were detected. Improvement was observed after discontinuation of fenofibrate administration, but muscle symptoms and elevation of muscle enzymes and creatinine persisted. After administration of levothyroxin, muscle weakness and laboratory abnormalities were observed no longer. After several months of follow-up we believe that treatment with fenofibrate in our patient was complicated with muscle tissue damage and exacerbated symptoms of myopathy originally related to decompensated hypothyroidism.

  17. Elasto-optics in double-coated optical fibers induced by axial strain and hydrostatic pressure.

    Science.gov (United States)

    Yang, Yu-Ching; Lee, Haw-Long; Chou, Huann-Ming

    2002-04-01

    Stresses, microbending loss, and refractive-index changes induced simultaneously by axial strain and hydrostatic pressure in double-coated optical fibers are analyzed. The lateral pressure and normal stresses in the optical fiber, primary coating, and secondary coating are derived. Also presented are the microbending loss and refractive-index changes in the glass fiber. The normal stresses are affected by axial strain, hydrostatic pressure, material properties, and thickness of the primary and secondary coatings. It is found that microbending loss decreases with increasing thickness, the Young's modulus, and the Poisson's ratio of the secondary coating but increases with the increasing Young's modulus and Poisson's ratio of the primary coating. Similarly, changes in refractive index in the glass fiber decrease with the increasing Young's modulus and Poisson's ratio of the secondary coating but increase with the increasing Young's modulus and Poisson's ratio of the primary coating. Therefore, to minimize microbending loss induced simultaneously by axial strain and hydrostatic pressure in the glass fiber, the polymeric coatings should be suitably selected. An optimal design procedure is also indicated.

  18. Axial flow heat exchanger devices and methods for heat transfer using axial flow devices

    Science.gov (United States)

    Koplow, Jeffrey P.

    2016-02-16

    Systems and methods described herein are directed to rotary heat exchangers configured to transfer heat to a heat transfer medium flowing in substantially axial direction within the heat exchangers. Exemplary heat exchangers include a heat conducting structure which is configured to be in thermal contact with a thermal load or a thermal sink, and a heat transfer structure rotatably coupled to the heat conducting structure to form a gap region between the heat conducting structure and the heat transfer structure, the heat transfer structure being configured to rotate during operation of the device. In example devices heat may be transferred across the gap region from a heated axial flow of the heat transfer medium to a cool stationary heat conducting structure, or from a heated stationary conducting structure to a cool axial flow of the heat transfer medium.

  19. Inverse axial mounting stiffness design for lithographic projection lenses.

    Science.gov (United States)

    Wen-quan, Yuan; Hong-bo, Shang; Wei, Zhang

    2014-09-01

    In order to balance axial mounting stiffness of lithographic projection lenses and the image quality under dynamic working conditions, an easy inverse axial mounting stiffness design method is developed in this article. Imaging quality deterioration at the wafer under different axial vibration levels is analyzed. The desired image quality can be determined according to practical requirements, and axial vibrational tolerance of each lens is solved with the damped least-squares method. Based on adaptive interval adjustment, a binary search algorithm, and the finite element method, the axial mounting stiffness of each lens can be traveled in a large interval, and converges to a moderate numerical solution which makes the axial vibrational amplitude of the lens converge to its axial vibrational tolerance. Model simulation is carried out to validate the effectiveness of the method.

  20. Axial sesamoiditis in the horse: A review

    Directory of Open Access Journals (Sweden)

    Christelle Le Roux

    2018-03-01

    Full Text Available Axial sesamoiditis or osteitis of the proximal sesamoid bones (PSBs in the horse is described as a rare condition. The cause remains unknown and speculative, with vascular, infectious, and traumatic aetiologies implicated. It is specifically associated with injury of the palmar or plantar ligament (PL, also known as the intersesamoidean ligament. Imaging findings are generally rewarding and radiological changes are typical, if not pathognomonic, for the condition. Lesions consist of bone lysis at the apical to mid-body axial margins of the PSBs, with variable degrees of joint effusion. Radiographic technique warrants careful attention to make a diagnosis, and exposure factors may need to be adjusted. Perineural, intra-articular and intra-thecal anaesthesia does not seem to provide consistent improvement of lameness in these cases, with literature reporting inconsistent findings. Ultrasonographic findings include digital flexor sheath effusion, loss of the normal fibre structure of the PL at its attachment to the PSBs, abnormal echogenicity or change in thickness of the PL, and irregular hyperechoic cortical margins of the axial margins of the PSBs. Scintigraphy, computed tomography and magnetic resonance imaging, although not necessary to make a diagnosis, may add valuable information regarding the location and extent of lesions. The prognosis remains guarded to poor for return to athletic function. The focus of this paper is a comprehensive review of the proposed aetiopathogenesis of the condition, the prognosis, and a summary of the literature findings with focus on the notable diagnostic imaging features, including radiography, ultrasonography, scintigraphy, computed tomography and magnetic resonance imaging.

  1. Axial Tomography from Digitized Real Time Radiography

    Science.gov (United States)

    Zolnay, A. S.; McDonald, W. M.; Doupont, P. A.; McKinney, R. L.; Lee, M. M.

    1985-01-18

    Axial tomography from digitized real time radiographs provides a useful tool for industrial radiography and tomography. The components of this system are: x-ray source, image intensifier, video camera, video line extractor and digitizer, data storage and reconstruction computers. With this system it is possible to view a two dimensional x-ray image in real time at each angle of rotation and select the tomography plane of interest by choosing which video line to digitize. The digitization of a video line requires less than a second making data acquisition relatively short. Further improvements on this system are planned and initial results are reported.

  2. Disordered axial movement in Parkinson's disease.

    OpenAIRE

    Steiger, M J; Thompson, P D; Marsden, C D

    1996-01-01

    Axial motor impairments are a common cause of disability in patients with Parkinson's disease, become more prominent with longer disease duration, and have been said to be less responsive to levodopa replacement therapy. The ability to turn in bed while lying supine before and after dopaminergic stimulation was studied in a group of 36 patients with Parkinson's disease; 23 were in Hoehn and Yahr stages 3-5 when "off", and 13 were in stages 1-2. Turning was also compared with postural stabilit...

  3. Digital enhancement of computerized axial tomograms

    Science.gov (United States)

    Roberts, E., Jr.

    1978-01-01

    A systematic evaluation has been conducted of certain digital image enhancement techniques performed in image space. Three types of images have been used, computer generated phantoms, tomograms of a synthetic phantom, and axial tomograms of human anatomy containing images of lesions, artificially introduced into the tomograms. Several types of smoothing, sharpening, and histogram modification have been explored. It has been concluded that the most useful enhancement techniques are a selective smoothing of singular picture elements, combined with contrast manipulation. The most useful tool in applying these techniques is the gray-scale histogram.

  4. Nemaline myopathy and heart failure: role of ivabradine; a case report.

    Science.gov (United States)

    Sarullo, Filippo M; Vitale, Giuseppe; Di Franco, Antonino; Sarullo, Silvia; Salerno, Ylenia; Vassallo, Laura; Baviera, Emanuela Petrona; Marazia, Stefania; Mandalà, Giorgio; Lanza, Gaetano A

    2015-01-19

    Nemaline myopathy (NM) is a rare congenital myopathy characterized by muscle weakness, hypotonia and the presence in muscle fibers of inclusions known as nemaline bodies and a wide spectrum of clinical phenotypes, ranging from severe forms with neonatal onset to asymptomatic forms. The adult-onset form is heterogeneous in terms of clinical presentation and disease progression. Cardiac involvement occurs in the minority of cases and little is known about medical management in this subgroup of NM patients. We report a rare case of heart failure (HF) in a patient with adult-onset NM in whom ivabradine proved to be able to dramatically improve the clinical picture. We report a case of a 37-year-old man with adult-onset NM, presenting with weakness and hypotonia of the proximal limb muscles and shoulder girdle, severely limiting daily activities. He developed progressive HF over a period of 6 months while attending a rehabilitation program, with reduced left ventricular ejection fraction (LVEF = 20%), manifested by dyspnea and signs of systemic congestion. The patient was started HF therapy with enalapril, carvedilol, spironolactone and loop diuretics. Target HF doses of these drugs (including carvedilol) were not reached because of symptomatic hypotension causing a high resting heart rate (HR) ≥70 beats per minute (bpm). Further deterioration of the clinical picture occurred with several life-threatening arrhythmic episodes requiring external defibrillation. An implantable cardioverter defibrillator (ICD) was then implanted. Persistent high resting HR was successfully treated with ivabradine with HR lowering from 90 bpm to 55 bpm at 1 month follow up, LVEF rising to 50% at 3 month follow up and to 54% at 2,5 year follow up. To date no more hospitalizations for heart failure occurred. A single hospitalization due to aspiration pneumonia required insertion of a tracheostomy tube to protect airways from further aspiration. At present, the patient is attending

  5. Factors related to axial length elongation and myopia progression in orthokeratology practice.

    Directory of Open Access Journals (Sweden)

    Bingjie Wang

    Full Text Available To investigate which baseline factors are predictive for axial length growth over an average period of 2.5 years in a group of children wearing orthokeratology (OK contact lenses.In this retrospective study, the clinical records of 249 new OK wearers between January 2012 and December 2013 from the contact lens clinic at the Eye and ENT Hospital of Fudan University were reviewed. The primary outcome measure was axial length change from baseline to the time of review (July-August 2015. Independent variables included baseline measures of age at initiation of OK wear, gender, refractive error (spherical equivalent, astigmatism, average keratometry, corneal toricity, central corneal thickness, white-to-white corneal diameter, pupil size, corneal topography eccentricity value (e-value, intraocular pressure (IOP and total time in follow-up (months total. The contributions of all independent variables on axial length change at the time of review were assessed using univariate and multivariable regression analyses.Univariate analyses of the right eyes of 249 OK patients showed that smaller increases in axial length were associated with older age at the onset of OK lens wear, greater baseline spherical equivalent myopic refractive error, less time in follow-up and a smaller e-value. Multivariable analyses of the significant right eye variables showed that the factors associated with smaller axial length growth were older age at the onset of OK lens wear (p<0.0001, greater baseline spherical equivalent myopic refractive error (p = 0.0046 and less time in follow-up (p<0.0001.The baseline factors demonstrating the greatest correlation with reduced axial length elongation during OK lens wear in myopic children included greater baseline spherical equivalent myopic refractive error and older age at the onset of OK lens wear.

  6. Axial tomography in live cell laser microscopy

    Science.gov (United States)

    Richter, Verena; Bruns, Sarah; Bruns, Thomas; Weber, Petra; Wagner, Michael; Cremer, Christoph; Schneckenburger, Herbert

    2017-09-01

    Single cell microscopy in a three-dimensional (3-D) environment is reported. Cells are grown in an agarose culture gel, located within microcapillaries and observed from different sides after adaptation of an innovative device for sample rotation. Thus, z-stacks can be recorded by confocal microscopy in different directions and used for illustration in 3-D. This gives additional information, since cells or organelles that appear superimposed in one direction, may be well resolved in another one. The method is tested and validated with single cells expressing a membrane or a mitochondrially associated green fluorescent protein, or cells accumulating fluorescent quantum dots. In addition, axial tomography supports measurements of cellular uptake and distribution of the anticancer drug doxorubicin in the nucleus (2 to 6 h after incubation) or the cytoplasm (24 h). This paper discusses that upon cell rotation an enhanced optical resolution in lateral direction compared to axial direction can be utilized to obtain an improved effective 3-D resolution, which represents an important step toward super-resolution microscopy of living cells.

  7. Axial vessel widening in arborescent monocots.

    Science.gov (United States)

    Petit, Giai; DeClerck, Fabrice A J; Carrer, Marco; Anfodillo, Tommaso

    2014-02-01

    Dicotyledons have evolved a strategy to compensate for the increase in hydraulic resistance to water transport with height growth by widening xylem conduits downwards. In monocots, the accumulation of hydraulic resistance with height should be similar, but the absence of secondary growth represents a strong limitation for the maintenance of xylem hydraulic efficiency during ontogeny. The hydraulic architecture of monocots has been studied but it is unclear how monocots arrange their axial vascular structure during ontogeny to compensate for increases in height. We measured the vessel lumina and estimated the hydraulic diameter (Dh) at different heights along the stem of two arborescent monocots, Bactris gasipaes (Kunth) and Guadua angustifolia (Kunth). For the former, we also estimated the variation in Dh along the leaf rachis. Hydraulic diameter increased basally from the stem apex to the base with a scaling exponent (b) in the range of those reported for dicot trees (b = 0.22 in B. gasipaes; b = 0.31 and 0.23 in G. angustifolia). In B. gasipaes, vessels decrease in Dh from the stem's centre towards the periphery, an opposite pattern compared with dicot trees. Along the leaf rachis, a pattern of increasing Dh basally was also found (b = 0.13). The hydraulic design of the monocots studied revealed an axial pattern of xylem conduits similar to those evolved by dicots to compensate and minimize the negative effect of root-to-leaf length on hydrodynamic resistance to water flow.

  8. Anion-π Catalysts with Axial Chirality.

    Science.gov (United States)

    Wang, Chao; Matile, Stefan

    2017-09-04

    The idea of anion-π catalysis is to stabilize anionic transition states by anion-π interactions on aromatic surfaces. For asymmetric anion-π catalysis, π-acidic surfaces have been surrounded with stereogenic centers. This manuscript introduces the first anion-π catalysts that operate with axial chirality. Bifunctional catalysts with tertiary amine bases next to π-acidic naphthalenediimide planes are equipped with a bulky aromatic substituent in the imide position to produce separable atropisomers. The addition of malonic acid half thioesters to enolate acceptors is used for evaluation. In the presence of a chiral axis, the selective acceleration of the disfavored but relevant enolate addition was much better than with point chirality, and enantioselectivity could be observed for the first time for this reaction with small-molecule anion-π catalysts. Enantioselectivity increased with the π acidity of the π surface, whereas the addition of stereogenic centers around the aromatic plane did not cause further improvements. These results identify axial chirality of the active aromatic plane generated by atropisomerism as an attractive strategy for asymmetric anion-π catalysis. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Medullary sponge kidney on axial computed tomography

    International Nuclear Information System (INIS)

    Ginalski, J.-M.; Schnyder, Pierre; Portmann, Luc; Jaeger, Philippe

    1991-01-01

    To evaluate features of medullary sponge kidney (MSK) on computed tomography (CT), 4-mm-thick axial slices without intravenous contrast material were 1st made in 13 patients through 24 kidneys which showed images of MSK on excretory urograms. On CT, papillary calcifications were found in 11 kidneys. In 5 of these, the calcifications were not detectable on plain films. Some hyperdense papillae (attenuation value 55-70 Hounsfield units) without calcification were found in 4 other kidneys. 9 kidneys appeared normal. 10 of the 14 kidneys were reexamined by a 2nd series of 4-mm-thick axial slices, 5 min after intravenous injection of 50 ml of Urografin. Images suggesting possible ectasia of precaliceal tubules were found in only 4 kidneys. These images appear much less obvious and characteristic on CT than on excretory urogram and do nothing more than suggest the possibility of MSK. In conclusion, the sensitivity of CT in the detection of MSK is markedly lower than that of excretory urography. In the most florid cases of the disease, CT can only show images suggesting the possibility of MSK. On the other hand, CT appears much more sensitive than plain films and tomograms of excretory in the detection of papillary calcifications, the most frequent complication of MSK. (author). 13 refs.; 3 figs

  10. Canonical quantization of the generalized axial gauge

    International Nuclear Information System (INIS)

    Haller, K.

    1990-01-01

    The incompatibility of the constraint A 3 =0 with canonical commutation rules is discussed. A canonical formulation is given of QED and QCD in the axial gauge with n 1 =n 2 =0, n 3 =α and n 0 =β, where α and β are arbitrary real numbers. A Hilbert space is established for the perturbative theory, and a propagator is derived by obtaining an expression for the interaction picture gauge fields, and evaluating the vacuum expectation value of its time-ordered products in the perturbative vacuum. The propagator is expressed in terms of the parameter γ=α/β and is shown to reproduce the light cone gauge propagator when γ=1, and the temporal gauge propagator when γ=0, accommodating various prescriptions for the spurious propagator pole, including the Mandelstam-Leibbrandt and principal value prescriptions. When γ→∞, the generalized axial gauge propagator leads to an expression for the propagator in the A 3 =0 gauge, though in that case the order in which the integration over k 0 is performed, and the limit γ→∞ is taken, affects the resulting expression. Another Hilbert space is established, in which the constraints that include all interactions are implemented in a time independent fashion. It is pointed out that this Hilbert space, and the Hilbert space of the perturbative theory are unitarily equivalent in QED, but that they cannot be unitarily equivalent in QCD. Implications of this fact for the nonperturbative states of QCD are discussed. (orig.)

  11. The Modelling of Axially Translating Flexible Beams

    Science.gov (United States)

    Theodore, R. J.; Arakeri, J. H.; Ghosal, A.

    1996-04-01

    The axially translating flexible beam with a prismatic joint can be modelled by using the Euler-Bernoulli beam equation together with the convective terms. In general, the method of separation of variables cannot be applied to solve this partial differential equation. In this paper, a non-dimensional form of the Euler Bernoulli beam equation is presented, obtained by using the concept of group velocity, and also the conditions under which separation of variables and assumed modes method can be used. The use of clamped-mass boundary conditions leads to a time-dependent frequency equation for the translating flexible beam. A novel method is presented for solving this time dependent frequency equation by using a differential form of the frequency equation. The assume mode/Lagrangian formulation of dynamics is employed to derive closed form equations of motion. It is shown by using Lyapunov's first method that the dynamic responses of flexural modal variables become unstable during retraction of the flexible beam, which the dynamic response during extension of the beam is stable. Numerical simulation results are presented for the uniform axial motion induced transverse vibration for a typical flexible beam.

  12. Multi-axial response of idealized cermets

    International Nuclear Information System (INIS)

    Pickering, E.G.; Bele, E.; Deshpande, V.S.

    2016-01-01

    The yield response of two idealized cermets comprising mono and bi-disperse steel spheres in a Sn/Pb solder matrix has been investigated for a range of axisymmetric stress states. Proportional stress path experiments are reported, from which are extracted the initial yield surfaces and their evolution with increasing plastic strain. The initial yield strength is nearly independent of the hydrostatic pressure but the strain hardening rate increases with stress triaxiality up to a critical value. For higher triaxialities, the responses are independent of hydrostatic pressure. Multi-axial measurements along with X-ray tomography were used to demonstrate that the deformation of these idealized cermets occurs by two competing mechanisms: (i) a granular flow mechanism that operates at low levels of triaxiality, where volumetric dilation occurs under compressive stress states, and (ii) a plastically incompressible mechanism that operates at high stress triaxialities. A phenomenological viscoplastic constitutive model that incorporates both deformation mechanisms is presented. While such multi-axial measurements are difficult for commercial cermets with yield strengths on the order of a few GPa, the form of their constitutive relation is expected to be similar to that of the idealized cermets presented here.

  13. Flex Sensor Based Biofeedback Monitoring for Post-Stroke Fingers Myopathy Patients

    Science.gov (United States)

    Garda, Y. R.; Caesarendra, W.; Tjahjowidodo, T.; Turnip, A.; Wahyudati, S.; Nurhasanah, L.; Sutopo, D.

    2018-04-01

    Hands are one of the crucial parts of the human body in carrying out daily activities. Accidents on the hands decreasing in motor skills of the hand so that therapy is necessary to restore motor function of the hand. In addition to accidents, hand disabilities can be caused by certain diseases, e.g. stroke. Stroke is a partial destruction of the brain. It occurs if the arteries that drain blood to the brain are blocked, or if torn or leak. The purpose of this study to make biofeedback monitoring equipment for post-stroke hands myopathy patients. Biofeedback is an alternative method of treatment that involves measuring body functions measured subjects such as skin temperature, sweat activity, blood pressure, heart rate and hand paralysis due to stroke. In this study, the sensor used for biofeedback monitoring tool is flex sensor. Flex sensor is a passive resistive device that changes its resistance as the sensor is bent. Flex sensor converts the magnitude of the bend into electrical resistance, the greater the bend the greater the resistance value. The monitoring used in this biofeedback monitoring tool uses Graphical User Interface (GUI) in C# programming language. The motivation of the study is to monitor and record the progressive improvement of the hand therapy. Patients who experienced post-stroke can see the therapy progress quantitatively.

  14. Neutral lipid storage disease with myopathy: A whole-body nuclear MRI and metabolic study

    International Nuclear Information System (INIS)

    Laforet, Pascal; Stojkovic, Tanya; Wahbi, Karim; Eymard, Bruno; Bassez, Guillaume; Carlier, Pierre G.; Clement, Karine; Petit, Francois M.; Carlier, Robert-Yves

    2013-01-01

    Neutral lipid storage disease with myopathy (NLSDM) is caused by a mutation in the gene encoding adipose triglyceride lipase (ATGL), and is characterized by the presence of numerous triglyceride-containing cytoplasmic droplets in type I muscle fibers. Major clinical manifestations concern the heart and skeletal muscle, and some patients also present diabetes mellitus. We report the clinical, metabolic, and whole-body nuclear magnetic resonance imaging findings of three patients with NLSDM. Muscle MRI study was consistent with previous descriptions, and allowed to show a common pattern of fatty replacement. Muscle changes predominated in the paravertebral muscles, both compartments of legs, and posterior compartment of the thighs. A more variable distribution of muscle involvement was observed on upper limbs, with marked asymmetry in one patient, and alterations predominating on supra and infra spinatus, biceps brachialis and anterior compartment of arms. Cardiac NMR studies revealed anomalies despite normal echocardiography in two patients. Endocrine studies showed low leptin and adiponectine levels, a moderate increase in insulin levels at fasting state, and even greater increase after oral glucose tolerance test in one patient. Two patients had elevated triglycerides and low cholesterol-HDL. Based on these analyses, regular control of cardio-metabolic risks appear mandatory in the clinical follow-up of these subjects. (authors)

  15. Myotubular myopathy and the neuromuscular junction: a novel therapeutic approach from mouse models

    Directory of Open Access Journals (Sweden)

    James J. Dowling

    2012-11-01

    Myotubular myopathy (MTM is a severe congenital muscle disease characterized by profound weakness, early respiratory failure and premature lethality. MTM is defined by muscle biopsy findings that include centralized nuclei and disorganization of perinuclear organelles. No treatments currently exist for MTM. We hypothesized that aberrant neuromuscular junction (NMJ transmission is an important and potentially treatable aspect of the disease pathogenesis. We tested this hypothesis in two murine models of MTM. In both models we uncovered evidence of a disorder of NMJ transmission: fatigable weakness, improved strength with neostigmine, and electrodecrement with repetitive nerve stimulation. Histopathological analysis revealed abnormalities in the organization, appearance and size of individual NMJs, abnormalities that correlated with changes in acetylcholine receptor gene expression and subcellular localization. We additionally determined the ability of pyridostigmine, an acetylcholinesterase inhibitor, to ameliorate aspects of the behavioral phenotype related to NMJ dysfunction. Pyridostigmine treatment resulted in significant improvement in fatigable weakness and treadmill endurance. In all, these results describe a newly identified pathological abnormality in MTM, and uncover a potential disease-modifying therapy for this devastating disorder.

  16. Role of TGF-β signaling in inherited and acquired myopathies

    Directory of Open Access Journals (Sweden)

    Burks Tyesha N

    2011-05-01

    Full Text Available Abstract The transforming growth factor-beta (TGF-β superfamily consists of a variety of cytokines expressed in many different cell types including skeletal muscle. Members of this superfamily that are of particular importance in skeletal muscle are TGF-β1, mitogen-activated protein kinases (MAPKs, and myostatin. These signaling molecules play important roles in skeletal muscle homeostasis and in a variety of inherited and acquired neuromuscular disorders. Expression of these molecules is linked to normal processes in skeletal muscle such as growth, differentiation, regeneration, and stress response. However, chronic elevation of TGF-β1, MAPKs, and myostatin is linked to various features of muscle pathology, including impaired regeneration and atrophy. In this review, we focus on the aberrant signaling of TGF-β in various disorders such as Marfan syndrome, muscular dystrophies, sarcopenia, and critical illness myopathy. We also discuss how the inhibition of several members of the TGF-β signaling pathway has been implicated in ameliorating disease phenotypes, opening up novel therapeutic avenues for a large group of neuromuscular disorders.

  17. Impaired Insulin/IGF Signaling in Experimental Alcohol-Related Myopathy

    Directory of Open Access Journals (Sweden)

    Elizabeth Silbermann

    2012-08-01

    Full Text Available Alcohol-related myopathy (Alc-M is highly prevalent among heavy drinkers, although its pathogenesis is not well understood. We hypothesize that Alc-M is mediated by combined effects of insulin/IGF resistance and oxidative stress, similar to the effects of ethanol on liver and brain. We tested this hypothesis using an established model in which adult rats were pair-fed for 8 weeks with isocaloric diets containing 0% (N = 8 or 35.5% (N = 13 ethanol by caloric content. Gastrocnemius muscles were examined by histology, morphometrics, qRT-PCR analysis, and ELISAs. Chronic ethanol feeding reduced myofiber size and mRNA expression of IGF-1 polypeptide, insulin, IGF-1, and IGF-2 receptors, IRS-1, and IRS-2. Multiplex ELISAs demonstrated ethanol-associated inhibition of insulin, IRS-1, Akt, and p70S6K signaling, and increased activation of GSK-3β. In addition, ethanol-exposed muscles had increased 4-hydroxy-2-nonenal immunoreactivity, reflecting lipid peroxidation, and reduced levels of mitochondrial Complex IV, Complex V, and acetylcholinesterase. These results demonstrate that experimental Alc-M is associated with inhibition of insulin/IGF/IRS and downstream signaling that mediates metabolism and cell survival, similar to findings in alcoholic liver and brain degeneration. Moreover, the increased oxidative stress, which could be mediated by mitochondrial dysfunction, may have led to inhibition of acetylcholinesterase, which itself is sufficient to cause myofiber atrophy and degeneration.

  18. Vitamin D Receptor Gene Polymorphisms and Haplotypes in Hungarian Patients with Idiopathic Inflammatory Myopathy

    Directory of Open Access Journals (Sweden)

    Levente Bodoki

    2015-01-01

    Full Text Available Idiopathic inflammatory myopathies are autoimmune diseases characterized by symmetrical proximal muscle weakness. Our aim was to identify a correlation between VDR polymorphisms or haplotypes and myositis. We studied VDR-BsmI, VDR-ApaI, VDR-TaqI, and VDR-FokI polymorphisms and haplotypes in 89 Hungarian poly-/dermatomyositis patients (69 females and 93 controls (52 females. We did not obtain any significant differences for VDR-FokI, BsmI, ApaI, and TaqI genotypes and allele frequencies between patients with myositis and healthy individuals. There was no association of VDR polymorphisms with clinical manifestations and laboratory profiles in myositis patients. Men with myositis had a significantly different distribution of BB, Bb, and bb genotypes than female patients, control male individuals, and the entire control group. Distribution of TT, Tt, and tt genotypes was significantly different in males than in females in patient group. According to four-marker haplotype prevalence, frequencies of sixteen possible haplotypes showed significant differences between patient and control groups. The three most frequent haplotypes in patients were the fbAt, FBaT, and fbAT. Our findings may reveal that there is a significant association: Bb and Tt genotypes can be associated with myositis in the Hungarian population we studied. We underline the importance of our result in the estimated prevalence of four-marker haplotypes.

  19. Clinical significance of magnetic resonance imaging of skeletal muscles in idiopathic inflammatory myopathies of adults

    Energy Technology Data Exchange (ETDEWEB)

    Nishikai, Masahiko; Akiya, Kumiko [National Tokyo Medical Center (Japan)

    2000-12-01

    The purpose of this study was to evaluate the clinical significance of magnetic resonance imaging (MRI) of skeletal muscles in Japanese patients with idiopathic inflammatory myopathies (IIM). MRI was performed in 23 adult patients with IIM, including 10 with polymyositis, 12 with dermatomyositis, and 1 with focal myositis. Seven (73%) of 11 patients with active IIM and 2 (17%) of 12 patients with inactive IIM showed hyperintensity of T2-weighted images and normal intensity of T1-weighted images, indicating 'edema-like abnormalities' (MRI findings for active myositis). Muscle lipomatosis and fibrosis were demonstrated in four patients and 1 patient, respectively. Considerable selectivity of muscles in developing inflammatory disorders was found. In quadriceps muscles, for example, vastus muscles seemed to be more often affected in DM patients, whereas adductors were more often affected in PM patients. Serial examination of muscle MRIs was carried out in 4 patients and the findings paralleled the disease activities. The muscle MRI findings did not necessarily correlate with other findings, such as the presence of muscle weakness, elevated serum creatine kinase levels, myogenic electromyogram, or muscle biopsy findings. The muscle MRI was considered to be an additional useful tool for the diagnosis, evaluation of disease activity, and planning treatment of IIM. (author)

  20. Rare myositis-specific autoantibody associations among Hungarian patients with idiopathic inflammatory myopathy.

    Science.gov (United States)

    Bodoki, L; Nagy-Vincze, M; Griger, Z; Betteridge, Z; Szöllősi, L; Jobanputra, R; Dankó, K

    2015-01-01

    Idiopathic inflammatory myopathies are systemic, chronic autoimmune diseases characterized by symmetrical, proximal muscle weakness. Homogeneous groups present with similar symptoms. The response to therapy and prognosis could be facilitated by myositis-specific autoantibodies, and in this way, give rise to immunoserological classification. The myositis-specific autoantibodies are directed against specific proteins found in the cytoplasm or in the nucleus of the cells. To date, literature suggests the rarity of the co-existence of two myositis-specific autoantibodies. In this study the authors highlight rare associations of myositis-specific autoantibodies. Three hundred and thirty-seven Hungarian patients with polymyositis or dermatomyositis were studied. Their clinical findings were noted retrospectively. Specific blood tests identified six patients with the rare co-existence of myositis-specific autoantibodies, anti-Jo-1 and anti-SRP, anti-Jo-1 and anti-Mi-2, anti-Mi-2 and anti-PL-12, anti-Mi-2 and anti-SRP, and anti-SRP and anti-PL-7, respectively. This case review aims to identify the clinical importance of these rare associations and their place within the immunoserological classification.

  1. Clinical significance of magnetic resonance imaging of skeletal muscles in idiopathic inflammatory myopathies of adults

    International Nuclear Information System (INIS)

    Nishikai, Masahiko; Akiya, Kumiko

    2000-01-01

    The purpose of this study was to evaluate the clinical significance of magnetic resonance imaging (MRI) of skeletal muscles in Japanese patients with idiopathic inflammatory myopathies (IIM). MRI was performed in 23 adult patients with IIM, including 10 with polymyositis, 12 with dermatomyositis, and 1 with focal myositis. Seven (73%) of 11 patients with active IIM and 2 (17%) of 12 patients with inactive IIM showed hyperintensity of T2-weighted images and normal intensity of T1-weighted images, indicating 'edema-like abnormalities' (MRI findings for active myositis). Muscle lipomatosis and fibrosis were demonstrated in four patients and 1 patient, respectively. Considerable selectivity of muscles in developing inflammatory disorders was found. In quadriceps muscles, for example, vastus muscles seemed to be more often affected in DM patients, whereas adductors were more often affected in PM patients. Serial examination of muscle MRIs was carried out in 4 patients and the findings paralleled the disease activities. The muscle MRI findings did not necessarily correlate with other findings, such as the presence of muscle weakness, elevated serum creatine kinase levels, myogenic electromyogram, or muscle biopsy findings. The muscle MRI was considered to be an additional useful tool for the diagnosis, evaluation of disease activity, and planning treatment of IIM. (author)

  2. Neutral lipid storage disease with myopathy: A whole-body nuclear MRI and metabolic study

    Energy Technology Data Exchange (ETDEWEB)

    Laforet, Pascal; Stojkovic, Tanya; Wahbi, Karim; Eymard, Bruno [AP-HP, Centre de Reference de pathologie neuromusculaire Paris-Est, Groupe Hospitalier Pitie-Salpetriere, Assistance Publique-Hopitaux de Paris, Paris, (France); Bassez, Guillaume [AP-HP, Centre de Reference de Pathologie Neuromusculaire Paris-Ouest, CHU Henri Mondor, Creteil, (France); Carlier, Pierre G. [CEA, I2BM, MIRCen, IdM NMR Laboratory, T-75651 Paris, (France); Clement, Karine [AP-HP, Institute of Cardiometabolism and Nutrition, ICAN, Pitie-Salpetriere Hospital, University Pierre et Marie-Curie Paris6, Paris, INSERM, U872 team 7, Paris, (France); Petit, Francois M. [AP-HP, Molecular Genetics and Metabolic Diseases Laboratory, Antoine Beclere Hospital, Clamart, (France); Carlier, Robert-Yves [AP-HP, Departement d' imagerie Medicale et Centre d' innovation Technologique, CHU Raymond-Poincare, Garches, (France)

    2013-07-01

    Neutral lipid storage disease with myopathy (NLSDM) is caused by a mutation in the gene encoding adipose triglyceride lipase (ATGL), and is characterized by the presence of numerous triglyceride-containing cytoplasmic droplets in type I muscle fibers. Major clinical manifestations concern the heart and skeletal muscle, and some patients also present diabetes mellitus. We report the clinical, metabolic, and whole-body nuclear magnetic resonance imaging findings of three patients with NLSDM. Muscle MRI study was consistent with previous descriptions, and allowed to show a common pattern of fatty replacement. Muscle changes predominated in the paravertebral muscles, both compartments of legs, and posterior compartment of the thighs. A more variable distribution of muscle involvement was observed on upper limbs, with marked asymmetry in one patient, and alterations predominating on supra and infra spinatus, biceps brachialis and anterior compartment of arms. Cardiac NMR studies revealed anomalies despite normal echocardiography in two patients. Endocrine studies showed low leptin and adiponectine levels, a moderate increase in insulin levels at fasting state, and even greater increase after oral glucose tolerance test in one patient. Two patients had elevated triglycerides and low cholesterol-HDL. Based on these analyses, regular control of cardio-metabolic risks appear mandatory in the clinical follow-up of these subjects. (authors)

  3. Hemolysis, myopathy, and cardiac disease associated with hereditary phosphofructokinase deficiency in two Whippets

    Science.gov (United States)

    Gerber, Karen; Harvey, John W.; D'Agorne, Sara; Wood, Jonathan; Giger, Urs

    2009-01-01

    Two male castrated Whippet littermates were presented at 1 year of age for pallor, tachycardia, systolic heart murmur, dark yellow to orange feces, intermittent lethargy, pigmenturia, and muscle shivering or cramping after exercise. Persistent macrocytic hypochromic anemia with marked reticulocytosis and metarubricytosis was found when CBC results were compared with reference values for Whippets. Increased serum creatine kinase activity and hyperkalemia also were sometimes present over the 4-year period of evaluation. Progressively increasing serum concentrations of N-terminal prohormone brain natriuretic peptide suggested cardiac disease. Erythrocytes from the whippets were less osmotically fragile but more alkaline fragile than those from control dogs. Erythrocyte phosphofructokinase (PFK) activities and 2,3-diphosphoglycerate concentrations were decreased. Restriction enzyme-based DNA test screening and DNA sequencing revealed the same mutation in the muscle-PFK gene of the Whippets as seen in English Springer Spaniel dogs with PFK deficiency. This is the first report of PFK deficiency in Whippet dogs. In addition to causing hemolysis and exertional myopathy, heart disease may be a prominent clinical component of PFK deficiency in this breed and has not been previously recognized in PFK-deficient English Springer Spaniels. PMID:19228357

  4. Two desmin gene mutations associated with myofibrillar myopathies in Polish families.

    Directory of Open Access Journals (Sweden)

    Jakub Piotr Fichna

    Full Text Available Desmin is a muscle-specific intermediate filament protein which forms a network connecting the sarcomere, T tubules, sarcolemma, nuclear membrane, mitochondria and other organelles. Mutations in the gene coding for desmin (DES cause skeletal myopathies often combined with cardiomyopathy, or isolated cardiomyopathies. The molecular pathomechanisms of the disease remain ambiguous. Here, we describe and comprehensively characterize two DES mutations found in Polish patients with a clinical diagnosis of desminopathy. The study group comprised 16 individuals representing three families. Two mutations were identified: a novel missense mutation (Q348P and a small deletion of nine nucleotides (A357_E359del, previously described by us in the Polish population. A common ancestry of all the families bearing the A357_E359del mutation was confirmed. Both mutations were predicted to be pathogenic using a bioinformatics approach, including molecular dynamics simulations which helped to rationalize abnormal behavior at molecular level. To test the impact of the mutations on DES expression and the intracellular distribution of desmin muscle biopsies were investigated. Elevated desmin levels as well as its atypical localization in muscle fibers were observed. Additional staining for M-cadherin, α-actinin, and myosin heavy chains confirmed severe disruption of myofibrill organization. The abnormalities were more prominent in the Q348P muscle, where both small atrophic fibers as well large fibers with centrally localized nuclei were observed. We propose that the mutations affect desmin structure and cause its aberrant folding and subsequent aggregation, triggering disruption of myofibrils organization.

  5. Mitochondrial myopathy, encephalopathy, lactate acidosis with stroke-like episodes syndrome (MELAS: A case report

    Directory of Open Access Journals (Sweden)

    Petrović Igor N.

    2012-01-01

    Full Text Available Introduction. Mitochondrial encephalopathy, lactacidosis and stroke-like episodes (MELAS represent a multisystemic dysfunction due to various mutations in mitochondrial DNA. Here we report a patient with genetically confirmed MELAS. Case Outline. A patient is presented whose clinical features involved short stature, easy tendency to fatigue, recurrent seizures, progressive cognitive decline, myopathy, sensorineural deafness, diabetes mellitus as well as stroke-like episodes. The major clinical feature of migraine type headache was not present. Neuroimaging studies revealed signs of ischemic infarctions localized in the posterior regions of the brain cortex. Electron microscopy of the skeletal muscle biopsy showed subsarcolemmal accumulation of a large number of mitochondria with paracristal inclusions in the skeletal muscle cells. The diagnosis of MELAS was definitively confirmed by the detection of a specific point mutation A to G at nucleotide position 3243 of mitochondrial DNA. Conclusion. When a relatively young patient without common risk factors for ischemic stroke presents with signs of occipitally localized brain infarctions accompanied with multisystemic dysfunction, MELAS syndrome, it is necessary to conduct investigations in order to diagnose the disease.

  6. Diabetic Myopathy: Impact of Diabetes Mellitus on Skeletal Muscle Progenitor Cells

    Directory of Open Access Journals (Sweden)

    Donna M D'Souza

    2013-12-01

    Full Text Available Diabetes mellitus is defined as a group of metabolic diseases that are associated with the presence of a hyperglycemic state due to impairments in insulin function. While the development of each form of diabetes (Type 1 or Type 2 drastically differs, resultant pathologies often overlap. In each diabetic condition a failure to maintain healthy muscle is often observed, and is termed diabetic myopathy. This significant, but often overlooked, complication is believed to contribute to the progression of additional diabetic pathologies due to the vital importance of skeletal muscle for our physical and metabolic well-being. While studies have investigated the link between changes to skeletal muscle metabolic health following diabetes mellitus onset (particularly Type 2 diabetes mellitus, few have examined the negative impact of diabetes mellitus on the growth and reparative capacities of skeletal muscle that often coincides with disease development. Importantly, evidence is accumulating that the muscle progenitor cell population (particularly the muscle satellite cell population is also negatively affected by the diabetic environment, and as such, likely contributes to the declining skeletal muscle health observed in diabetes mellitus. In this review, we summarize the current knowledge surrounding the influence of diabetes mellitus on skeletal muscle growth and repair, with a particular emphasis on the impact of diabetes mellitus on the progenitor cell population of skeletal muscle.

  7. MiR-320a as a Potential Novel Circulating Biomarker of Arrhythmogenic CardioMyopathy.

    Science.gov (United States)

    Sommariva, Elena; D'Alessandra, Yuri; Farina, Floriana Maria; Casella, Michela; Cattaneo, Fabio; Catto, Valentina; Chiesa, Mattia; Stadiotti, Ilaria; Brambilla, Silvia; Dello Russo, Antonio; Carbucicchio, Corrado; Vettor, Giulia; Riggio, Daniela; Sandri, Maria Teresa; Barbuti, Andrea; Vernillo, Gianluca; Muratori, Manuela; Dal Ferro, Matteo; Sinagra, Gianfranco; Moimas, Silvia; Giacca, Mauro; Colombo, Gualtiero Ivanoe; Pompilio, Giulio; Tondo, Claudio

    2017-07-06

    Diagnosis of Arrhythmogenic CardioMyopathy (ACM) is challenging and often late after disease onset. No circulating biomarkers are available to date. Given their involvement in several cardiovascular diseases, plasma microRNAs warranted investigation as potential non-invasive diagnostic tools in ACM. We sought to identify circulating microRNAs differentially expressed in ACM with respect to Healthy Controls (HC) and Idiopathic Ventricular Tachycardia patients (IVT), often in differential diagnosis. ACM and HC subjects were screened for plasmatic expression of 377 microRNAs and validation was performed in 36 ACM, 53 HC, 21 IVT. Variable importance in data partition was estimated through Random Forest analysis and accuracy by Receiver Operating Curves. Plasmatic miR-320a showed 0.53 ± 0.04 fold expression difference in ACM vs. HC (p ACM (n = 13) and HC (n = 17) with athletic lifestyle, a ACM precipitating factor. Importantly, ACM patients miR-320a showed 0.78 ± 0.05 fold expression change vs. IVT (p = 0.03). When compared to non-invasive ACM diagnostic parameters, miR-320a ranked highly in discriminating ACM vs. IVT and it increased their accuracy. Finally, miR-320a expression did not correlate with ACM severity. Our data suggest that miR-320a may be considered a novel potential biomarker of ACM, specifically useful in ACM vs. IVT differentiation.

  8. Ascending paresis as presentation of an unusual association between necrotizing autoimmune myopathy and systemic lupus erythematosus.

    Science.gov (United States)

    García-Reynoso, Marco Julio; Veramendi-Espinoza, Liz Eliana; Ruiz-Garcia, Henry Jeison

    2014-01-01

    A 45 year-old man went to the emergency room due to disease duration of 15 days of insidious onset and progressive course. It began with symmetrical weakness and pain in feet and ankles that extends upward to the knees. Later, this progressed to paraparesis with Creatine phosphokinase levels of 44,270 U/L and respiratory failure that required mechanical ventilation. Electromyography and muscle biopsy of quadriceps were made. The patient responded to corticotherapy in pulses and supporting management. The presentation of ascending paresis suggested the diagnosis of Guillain-Barré syndrome. However, the degree of muscle involvement with rhabdomyolysis explains the neurological damage by itself. The biopsy revealed pathological criteria for necrotizing autoimmune myopathy (NAM), as well as other clinical and laboratory evidence. Patient disease continued and reached criteria for systemic lupus erythematosus (SLE). To our best knowledge, this is the first report of the NAM and SLE association. Copyright © 2012 Elsevier España, S.L. All rights reserved.

  9. Neuropatia na miopatia miotubular ou centronuclear Neuropathy in myotubular or centronuclear myopathy

    Directory of Open Access Journals (Sweden)

    Roberto E. P. Sica

    1975-06-01

    Full Text Available Un estudio electrofisiológico detallado fué hecho en los músculos extensor corto de los dedos, de la eminencia tenar, de la eminencia hipotenar y soleo en un paciente con el diagnóstico de miopatía miotubular o centronuclear. El hallazgo principal fué una notoria reducción en el número de unidades motoras activas en todos los músculos investigados, en tanto que las unidades remanentes mostraron tamaño conservado. Las observaciones hechas se han interpretado como favoreciéndo la génesis neurógena en el desarrollo de este proceso.A detailed electrophysiological study has been made of the extensor digitorum brevis, thenar, hypothenar and soleus muscles in one patient with myotubular or centronuclear myopathy. The main finding was a noticeable reduction in the population of active motor units in all the investigated muscles. The remainer units showed normal sizes. The experimental observations have been interpreted in terms of a neuropathic process.

  10. The spectrum of myopathies in the city of São Paulo

    Directory of Open Access Journals (Sweden)

    José A. Levy

    1976-12-01

    Full Text Available A review of all myopathic patients treated at the Neurologic Clinic of the Medical School of the University of São Paulo during the past 15 years is reported. A total of 466 cases were examined and distributed as follows: 56% of progressive muscular dystrophy; 31% of myasthenia gravis; 6% of polymyositis; 4% of myotonic dystrophy; and the remainder of several different diseases (central core disease, Kearns-syndrome, myotonia congenita, adynamia episodica hereditaria, diabetic myopathy and Eaton-Lambert syndrome. Enzymatic dosages, electromyography, muscle biopsy, electrocardiography and genetic counselling are also reported.Os autores fazem uma revisão de todos os casos de miopatias tratados na Clínica Neurológica da F.M.U.S.P. durante os últimos 15 anos. Foram examinados 466 casos, assim distribuídos: 56% de distrofia muscular progressiva; 31% de miastenia grave; 6% de polimiosite; 4% de distrofia miotônica e, o restante, de várias outras moléstias (Central core disease, síndrome de Kearns, miotonia congênita, adinamia episódica hereditária, miopatia diabética e síndrome de Eaton-Lambert. São relatadas também as dosagens enzimáticas, eletromiografia, biópsia muscular, eletrocardiografia e aconselhamento genético.

  11. Mechanisms of Hyperhomocysteinemia Induced Skeletal Muscle Myopathy after Ischemia in the CBS−/+ Mouse Model

    Directory of Open Access Journals (Sweden)

    Sudhakar Veeranki

    2015-01-01

    Full Text Available Although hyperhomocysteinemia (HHcy elicits lower than normal body weights and skeletal muscle weakness, the mechanisms remain unclear. Despite the fact that HHcy-mediated enhancement in ROS and consequent damage to regulators of different cellular processes is relatively well established in other organs, the nature of such events is unknown in skeletal muscles. Previously, we reported that HHcy attenuation of PGC-1α and HIF-1α levels enhanced the likelihood of muscle atrophy and declined function after ischemia. In the current study, we examined muscle levels of homocysteine (Hcy metabolizing enzymes, anti-oxidant capacity and focused on protein modifications that might compromise PGC-1α function during ischemic angiogenesis. Although skeletal muscles express the key enzyme (MTHFR that participates in re-methylation of Hcy into methionine, lack of trans-sulfuration enzymes (CBS and CSE make skeletal muscles more susceptible to the HHcy-induced myopathy. Our study indicates that elevated Hcy levels in the CBS−/+ mouse skeletal muscles caused diminished anti-oxidant capacity and contributed to enhanced total protein as well as PGC-1α specific nitrotyrosylation after ischemia. Furthermore, in the presence of NO donor SNP, either homocysteine (Hcy or its cyclized version, Hcy thiolactone, not only increased PGC-1α specific protein nitrotyrosylation but also reduced its association with PPARγ in C2C12 cells. Altogether these results suggest that HHcy exerts its myopathic effects via reduction of the PGC-1/PPARγ axis after ischemia.

  12. Two Desmin Gene Mutations Associated with Myofibrillar Myopathies in Polish Families

    Science.gov (United States)

    Berdynski, Mariusz; Sikorska, Agata; Filipek, Slawomir; Redowicz, Maria Jolanta; Kaminska, Anna; Zekanowski, Cezary

    2014-01-01

    Desmin is a muscle-specific intermediate filament protein which forms a network connecting the sarcomere, T tubules, sarcolemma, nuclear membrane, mitochondria and other organelles. Mutations in the gene coding for desmin (DES) cause skeletal myopathies often combined with cardiomyopathy, or isolated cardiomyopathies. The molecular pathomechanisms of the disease remain ambiguous. Here, we describe and comprehensively characterize two DES mutations found in Polish patients with a clinical diagnosis of desminopathy. The study group comprised 16 individuals representing three families. Two mutations were identified: a novel missense mutation (Q348P) and a small deletion of nine nucleotides (A357_E359del), previously described by us in the Polish population. A common ancestry of all the families bearing the A357_E359del mutation was confirmed. Both mutations were predicted to be pathogenic using a bioinformatics approach, including molecular dynamics simulations which helped to rationalize abnormal behavior at molecular level. To test the impact of the mutations on DES expression and the intracellular distribution of desmin muscle biopsies were investigated. Elevated desmin levels as well as its atypical localization in muscle fibers were observed. Additional staining for M-cadherin, α-actinin, and myosin heavy chains confirmed severe disruption of myofibrill organization. The abnormalities were more prominent in the Q348P muscle, where both small atrophic fibers as well large fibers with centrally localized nuclei were observed. We propose that the mutations affect desmin structure and cause its aberrant folding and subsequent aggregation, triggering disruption of myofibrils organization. PMID:25541946

  13. Comparison of femoropopliteal artery stents under axial and radial compression, axial tension, bending, and torsion deformations.

    Science.gov (United States)

    Maleckis, Kaspars; Deegan, Paul; Poulson, William; Sievers, Cole; Desyatova, Anastasia; MacTaggart, Jason; Kamenskiy, Alexey

    2017-11-01

    High failure rates of Peripheral Arterial Disease (PAD) stenting appear to be associated with the inability of certain stent designs to accommodate severe biomechanical environment of the femoropopliteal artery (FPA) that bends, twists, and axially compresses during limb flexion. Twelve Nitinol stents (Absolute Pro, Supera, Lifestent, Innova, Zilver, Smart Control, Smart Flex, EverFlex, Viabahn, Tigris, Misago, and Complete SE) were quasi-statically tested under bench-top axial and radial compression, axial tension, bending, and torsional deformations. Stents were compared in terms of force-strain behavior, stiffness, and geometrical shape under each deformation mode. Tigris was the least stiff stent under axial compression (6.6N/m axial stiffness) and bending (0.1N/m) deformations, while Smart Control was the stiffest (575.3N/m and 105.4N/m, respectively). Under radial compression Complete SE was the stiffest (892.8N/m), while Smart Control had the lowest radial stiffness (211.0N/m). Viabahn and Supera had the lowest and highest torsional stiffness (2.2μNm/° and 959.2μNm/°), respectively. None of the 12 PAD stents demonstrated superior characteristics under all deformation modes and many experienced global buckling and diameter pinching. Though it is yet to be determined which of these deformation modes might have greater clinical impact, results of the current analysis may help guide development of new stents with improved mechanical characteristics. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. A novel Ile1455Thr variant in the skeletal muscle sodium channel alpha-subunit in a patient with a severe adult-onset proximal myopathy with electrical myotonia and a patient with mild paramyotonia phenotype

    NARCIS (Netherlands)

    Bednarz, M.; Stunnenberg, B.C.; Kusters, B.; Kamsteeg, E.J.; Saris, C.G.J.; Groome, J.; Winston, V.; Meola, G.; Jurkat-Rott, K.; Voermans, N.C.

    2017-01-01

    In sodium channelopathies, a severe fixed myopathy caused by a dominant mutation is rare. We describe two unrelated patients with a novel variant, p.Ile1455Thr, with phenotypes of paramyotonia in one case and fixed proximal myopathy with latent myotonia in another. In-vitro whole cell patch-clamp

  15. Chiral filter, axial charges and Gamow-Teller strengths

    International Nuclear Information System (INIS)

    Rho, M.

    1983-09-01

    The different ways that nuclear matter responds to the weak axial-vector current are interpreted in terms of modification of the ''vacuum'' in baryon-rich environments. The notion of ''chiral filter'' is introduced. Use of a ward identity is suggested. The Gamow-Teller quenching and the enhanced axial charge in O + O - transitions follow from this. I also discuss briefly possible relevance of the nucleon as a topological soliton configuration to the global property of nuclear axial response functions

  16. Geometric inequalities for axially symmetric black holes

    International Nuclear Information System (INIS)

    Dain, Sergio

    2012-01-01

    A geometric inequality in general relativity relates quantities that have both a physical interpretation and a geometrical definition. It is well known that the parameters that characterize the Kerr-Newman black hole satisfy several important geometric inequalities. Remarkably enough, some of these inequalities also hold for dynamical black holes. This kind of inequalities play an important role in the characterization of the gravitational collapse; they are closely related with the cosmic censorship conjecture. Axially symmetric black holes are the natural candidates to study these inequalities because the quasi-local angular momentum is well defined for them. We review recent results in this subject and we also describe the main ideas behind the proofs. Finally, a list of relevant open problems is presented. (topical review)

  17. Collimated trans-axial tomographic scintillation camera

    International Nuclear Information System (INIS)

    1980-01-01

    The objects of this invention are first to reduce the time required to obtain statistically significant data in trans-axial tomographic radioisotope scanning using a scintillation camera. Secondly, to provide a scintillation camera system to increase the rate of acceptance of radioactive events to contribute to the positional information obtainable from a known radiation source without sacrificing spatial resolution. Thirdly to reduce the scanning time without loss of image clarity. The system described comprises a scintillation camera detector, means for moving this in orbit about a cranial-caudal axis relative to a patient and a collimator having septa defining apertures such that gamma rays perpendicular to the axis are admitted with high spatial resolution, parallel to the axis with low resolution. The septa may be made of strips of lead. Detailed descriptions are given. (U.K.)

  18. Collimated trans-axial tomographic scintillation camera

    International Nuclear Information System (INIS)

    1980-01-01

    The principal problem in trans-axial tomographic radioisotope scanning is the length of time required to obtain meaningful data. Patient movement and radioisotope migration during the scanning period can cause distortion of the image. The object of this invention is to reduce the scanning time without degrading the images obtained. A system is described in which a scintillation camera detector is moved to an orbit about the cranial-caudal axis relative to the patient. A collimator is used in which lead septa are arranged so as to admit gamma rays travelling perpendicular to this axis with high spatial resolution and those travelling in the direction of the axis with low spatial resolution, thus increasing the rate of acceptance of radioactive events to contribute to the positional information obtainable without sacrificing spatial resolution. (author)

  19. Axial tomographic system for radiation diagnoses

    International Nuclear Information System (INIS)

    Crowther, T.J.

    1977-01-01

    The axial tomographic scanner consists of a source of hard radiation passing a fan shaped beam through a plane layer of the body under examination, a detector, and driving systems for the sequential displacement and rotation of the radiation source and the detector. The diagnosis is made by means of a data processing system offering extensive time overlap capability of the individual system functions. The data sets from transmission or absorption are processed in three independent subsystems, i.e., the scanning system, the processing system and the display system. The systems are made up of well-known modules, e.g., Nova 1200 or Eclipse 5200. Hence, as a result of the independent design of the data system, raw data will not be lost in case of faults in some subsystem. (DG) [de

  20. Axial grazing collisions with insulator surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Gravielle, M.S. [Instituto de Astronomia y Fisica del Espacio (IAFE), Consejo Nacional de Investigaciones Cientificas y Tecnicas, Casilla de Correo 67, Sucursal 28, 1428 Buenos Aires (Argentina) and Departamento de Fisica, FCEN, Universidad de Buenos Aires (Argentina)]. E-mail: msilvia@iafe.uba.ar; Miraglia, J.E. [Instituto de Astronomia y Fisica del Espacio (IAFE), Consejo Nacional de Investigaciones Cientificas y Tecnicas, Casilla de Correo 67, Sucursal 28, 1428 Buenos Aires (Argentina); Departamento de Fisica, FCEN, Universidad de Buenos Aires (Argentina)

    2007-05-15

    Electron capture and emission processes from insulator surfaces produced by grazing impact of fast ions are investigated under axial incidence conditions. For crystal surfaces we develop a model based on distorted wave methods, which allows us to express the coherent transition amplitude along the projectile path as a sum of atomic amplitudes, each one associated with a different lattice site. The method is applied to 100 keV protons colliding with LiF surfaces. For electron transitions from a given initial crystal state, the probabilities display strong interference effects as a function of the crystal orientation. But the interference patterns disappear when these partial probabilities are added to derive the total probability from the surface band.

  1. Axial grazing collisions with insulator surfaces

    International Nuclear Information System (INIS)

    Gravielle, M.S.; Miraglia, J.E.

    2007-01-01

    Electron capture and emission processes from insulator surfaces produced by grazing impact of fast ions are investigated under axial incidence conditions. For crystal surfaces we develop a model based on distorted wave methods, which allows us to express the coherent transition amplitude along the projectile path as a sum of atomic amplitudes, each one associated with a different lattice site. The method is applied to 100 keV protons colliding with LiF surfaces. For electron transitions from a given initial crystal state, the probabilities display strong interference effects as a function of the crystal orientation. But the interference patterns disappear when these partial probabilities are added to derive the total probability from the surface band

  2. Axial nonimaging characteristics of imaging lenses: discussion.

    Science.gov (United States)

    Siew, Ronian

    2016-05-01

    At observation planes away from the image plane, an imaging lens is a nonimaging optic. We examine the variation of axial irradiance with distance in image space and highlight the following little-known observation for discussion: On a per-unit-area basis, the position of the highest concentration in image space is generally not at the focal plane. This characteristic is contrary to common experience, and it offers an additional degree of freedom for the design of detection systems. Additionally, it would also apply to lenses with negative refractive index. The position of peak concentration and its irradiance is dependent upon the location and irradiance of the image. As such, this discussion also includes a close examination of expressions for image irradiance and explains how they are related to irradiance calculations beyond the image plane. This study is restricted to rotationally symmetric refractive imaging systems with incoherent extended Lambertian sources.

  3. Aerodynamic Modelling and Optimization of Axial Fans

    DEFF Research Database (Denmark)

    Sørensen, Dan Nørtoft

    A numerically efficient mathematical model for the aerodynamics oflow speed axial fans of the arbitrary vortex flow type has been developed.The model is based on a blade-element principle, whereby therotor is divided into a number of annular streamtubes.For each of these streamtubes relations......-Raphson method, andsolutions converged to machine accuracy are found at small computing costs.The model has been validated against published measurementson various fan configurations,comprising two rotor-only fan stages, a counter-rotatingfan unit and a stator-rotor-stator stage.Comparisons of local...... and integrated propertiesshow that the computed results agree well with the measurements.Integrating a rotor-only version of the aerodynamic modelwith an algorithm for numerical designoptimization, enables the finding of an optimum fan rotor.The angular velocity of the rotor, the hub radius and the spanwise...

  4. Image reconstruction. Application to transverse axial tomography

    International Nuclear Information System (INIS)

    Aubry, Florent.

    1977-09-01

    A method of computerized tridimensional image reconstruction from their projection, especially in the computerized transverse axial tomography is suggested. First, the different techniques actually developped and presented in the literature are analyzed. Then, the equipment used is briefly described. The reconstruction algorithm developped is presented. This algorithm is based on the convolution method, well adapted to the real conditions of exploitation. It is an extension of SHEPP and LOGAN's algorithm. A correction of the self absorption and of the detector's response is proposed. Finally, the first results obtained which are satisfactory are given. The simplicity of the method which does not need a too long computation time makes possible the implementation of the algorithm on a mini-computer [fr

  5. Composite Axial Flow Propulsor for Small Aircraft

    Directory of Open Access Journals (Sweden)

    R. Poul

    2005-01-01

    Full Text Available This work focuses on the design of an axial flow ducted fan driven by a reciprocating engine. The solution minimizes the turbulization of the flow around the aircraft. The fan has a rotor - stator configuration. Due to the need for low weight of the fan, a carbon/epoxy composite material was chosen for the blades and the driving shaft.The fan is designed for optimal isentropic efficiency and free vortex flow. A stress analysis of the rotor blade was performed using the Finite Element  Method. The skin of the blade is calculated as a laminate and the foam core as a solid. A static and dynamic analysis were made. The RTM technology is compared with other technologies and is described in detail. 

  6. Comparison of axial lengths in occludable angle and angle-closure glaucoma-The Bhaktapur Glaucoma Study

    NARCIS (Netherlands)

    Thapa, S.S.; Paudyal, I.; Khanal, S.; Paudel, N.; van Rens, G.H.M.B.

    2011-01-01

    Purpose. To compare the anterior chamber depth (ACD) and axial length of eyes in a population-based sample among normal, occludable angle, and primary angle-closure glaucoma (PACG) groups. Methods. Totally, 3979 subjects from a population-based glaucoma prevalence study underwent complete ocular

  7. Estimation of ocular volume from axial length.

    Science.gov (United States)

    Nagra, Manbir; Gilmartin, Bernard; Logan, Nicola S

    2014-12-01

    To determine which biometric parameters provide optimum predictive power for ocular volume. Sixty-seven adult subjects were scanned with a Siemens 3-T MRI scanner. Mean spherical error (MSE) (D) was measured with a Shin-Nippon autorefractor and a Zeiss IOLMaster used to measure (mm) axial length (AL), anterior chamber depth (ACD) and corneal radius (CR). Total ocular volume (TOV) was calculated from T2-weighted MRIs (voxel size 1.0 mm(3)) using an automatic voxel counting and shading algorithm. Each MR slice was subsequently edited manually in the axial, sagittal and coronal plane, the latter enabling location of the posterior pole of the crystalline lens and partitioning of TOV into anterior (AV) and posterior volume (PV) regions. Mean values (±SD) for MSE (D), AL (mm), ACD (mm) and CR (mm) were -2.62±3.83, 24.51±1.47, 3.55±0.34 and 7.75±0.28, respectively. Mean values (±SD) for TOV, AV and PV (mm(3)) were 8168.21±1141.86, 1099.40±139.24 and 7068.82±1134.05, respectively. TOV showed significant correlation with MSE, AL, PV (all p<0.001), CR (p=0.043) and ACD (p=0.024). Bar CR, the correlations were shown to be wholly attributable to variation in PV. Multiple linear regression indicated that the combination of AL and CR provided optimum R(2) values of 79.4% for TOV. Clinically useful estimations of ocular volume can be obtained from measurement of AL and CR. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  8. Aerodynamic modelling and optimization of axial fans

    Energy Technology Data Exchange (ETDEWEB)

    Noertoft Soerensen, Dan

    1998-01-01

    A numerically efficient mathematical model for the aerodynamics of low speed axial fans of the arbitrary vortex flow type has been developed. The model is based on a blade-element principle, whereby the rotor is divided into a number of annular stream tubes. For each of these stream tubes relations for velocity, pressure and radial position are derived from the conservation laws for mass, tangential momentum and energy. The equations are solved using the Newton-Raphson methods, and solutions converged to machine accuracy are found at small computing costs. The model has been validated against published measurements on various fan configurations, comprising two rotor-only fan stages, a counter-rotating fan unit and a stator-rotor stator stage. Comparisons of local and integrated properties show that the computed results agree well with the measurements. Optimizations have been performed to maximize the mean value of fan efficiency in a design interval of flow rates, thus designing a fan which operates well over a range of different flow conditions. The optimization scheme was used to investigate the dependence of maximum efficiency on 1: the number of blades, 2: the width of the design interval and 3: the hub radius. The degree of freedom in the choice of design variable and constraints, combined with the design interval concept, provides a valuable design-tool for axial fans. To further investigate the use of design optimization, a model for the vortex shedding noise from the trailing edge of the blades has been incorporated into the optimization scheme. The noise emission from the blades was minimized in a flow rate design point. Optimizations were performed to investigate the dependence of the noise on 1: the number of blades, 2: a constraint imposed on efficiency and 3: the hub radius. The investigations showed, that a significant reduction of noise could be achieved, at the expense of a small reduction in fan efficiency. (EG) 66 refs.

  9. Axially symmetric Lorentzian wormholes in general relativity

    International Nuclear Information System (INIS)

    Schein, F.

    1997-11-01

    The field equations of Einstein's theory of general relativity, being local, do not fix the global structure of space-time. They admit topologically non-trivial solutions, including spatially closed universes and the amazing possibility of shortcuts for travel between distant regions in space and time - so-called Lorentzian wormholes. The aim of this thesis is to (mathematically) construct space-times which contain traversal wormholes connecting arbitrary distant regions of an asymptotically flat or asymptotically de Sitter universe. Since the wormhole mouths appear as two separate masses in the exterior space, space-time can at best be axially symmetric. We eliminate the non-staticity caused by the gravitational attraction of the mouths by anchoring them by strings held at infinity or, alternatively, by electric repulsion. The space-times are obtained by surgically grafting together well-known solutions of Einstein's equations along timelike hypersurfaces. This surgery naturally concentrates a non-zero stress-energy tensor on the boundary between the two space-times which can be investigated by using the standard thin shell formalism. It turns out that, when using charged black holes, the provided constructions are possible without violation of any of the energy conditions. In general, observers living in the axially symmetric, asymptotically flat (respectively asymptotically de Sitter) region axe able to send causal signals through the topologically non-trivial region. However, the wormhole space-times contain closed timelike curves. Because of this explicit violation of global hyperbolicity these models do not serve as counterexamples to known topological censorship theorems. (author)

  10. Energy Dissipation in Sandwich Structures During Axial Compression

    DEFF Research Database (Denmark)

    Urban, Jesper

    2002-01-01

    The purpose of this paper is to investigate the energy dissipation in sandwich structures during axial crushing. Axial crushing tests on six sandwich elements are described. The sandwich elements consist of a polyurethane core and E-glass/Polyester skin. The elements compare to full-scale structu......The purpose of this paper is to investigate the energy dissipation in sandwich structures during axial crushing. Axial crushing tests on six sandwich elements are described. The sandwich elements consist of a polyurethane core and E-glass/Polyester skin. The elements compare to full...

  11. Improved axial position detection in optical tweezers measurements

    DEFF Research Database (Denmark)

    Dreyer, Jakob Kisbye; Berg-Sørensen, Kirstine; Oddershede, Lene

    2004-01-01

    We investigate the axial position detection of a trapped microsphere in an optical trap by using a quadrant photodiode. By replacing the photodiode with a CCD camera, we obtain detailed information on the light scattered by the microsphere. The correlation of the interference pattern with the axial...... position displays complex behavior with regions of positive and negative interference. By analyzing the scattered light intensity as a function of the axial position of the trapped sphere, we propose a simple method to increase the sensitivity and control the linear range of axial position detection....

  12. Two novel MYH7 proline substitutions cause Laing Distal Myopathy-like phenotypes with variable expressivity and neck extensor contracture.

    Science.gov (United States)

    Feinstein-Linial, Miora; Buvoli, Massimo; Buvoli, Ada; Sadeh, Menachem; Dabby, Ron; Straussberg, Rachel; Shelef, Ilan; Dayan, Daniel; Leinwand, Leslie Anne; Birk, Ohad S

    2016-08-12

    Human skeletal muscles express three major myosin heavy chain (MyHC) isoforms: MyHCIIx (MYH1) in fast type 2B muscle fibers, MyHCIIa (MYH2) in fast type 2A fibers and MyHCI/β-cardiac MyHC (MYH7) in slow type I skeletal fibers and cardiac ventricles. In line with its expression pattern, MYH7 mutations have been reported in association with hypertrophic or dilated cardiomyopathy, skeletal myopathies or a combination of both. We analyzed the clinical and molecular phenotype of two unrelated families of Jewish Moroccan ancestry that presented with apparently autosomal dominant inheritance of progressive Laing-like distal myopathy with non-specific myopathic changes, but uncommon marked contractures and wasting of the neck extensors. Clinical phenotyping, whole exome sequencing and restriction analysis, generation of mutants followed by cell culture transfection and imaging. Using whole exome sequencing we identified in both families two novel heterozygous proline substitutions located in exon 31 of MYH7 within its rod domain: c.4309G>C (p.Ala1437Pro) and c.4301G>C (p.Arg1434Pro). Here we show that the phenotype caused by these mutations includes marked cervical muscle contracture, and report that the severity of the phenotype varies significantly, to the extent of non-penetrance in one of the families. Finally, we provide evidence that both proline substitutions impair myosin self-assembly in non-muscle cells transfected with β-myosin constructs carrying the mutations, but do not prevent incorporation of the mutant molecules into the sarcomere. This study expands our clinical and molecular knowledge of MYH7 rod mutations causing skeletal myopathies, and underscores the importance of discussing disease penetrance during genetic counseling.

  13. Dual-detection confocal fluorescence microscopy: fluorescence axial imaging without axial scanning.

    Science.gov (United States)

    Lee, Dong-Ryoung; Kim, Young-Duk; Gweon, Dae-Gab; Yoo, Hongki

    2013-07-29

    We propose a new method for high-speed, three-dimensional (3-D) fluorescence imaging, which we refer to as dual-detection confocal fluorescence microscopy (DDCFM). In contrast to conventional beam-scanning confocal fluorescence microscopy, where the focal spot must be scanned either optically or mechanically over a sample volume to reconstruct a 3-D image, DDCFM can obtain the depth of a fluorescent emitter without depth scanning. DDCFM comprises two photodetectors, each with a pinhole of different size, in the confocal detection system. Axial information on fluorescent emitters can be measured by the axial response curve through the ratio of intensity signals. DDCFM can rapidly acquire a 3-D fluorescent image from a single two-dimensional scan with less phototoxicity and photobleaching than confocal fluorescence microscopy because no mechanical depth scans are needed. We demonstrated the feasibility of the proposed method by phantom studies.

  14. Characteristic cardiac phenotypes are detected by cardiovascular magnetic resonance in patients with different clinical phenotypes and genotypes of mitochondrial myopathy.

    Science.gov (United States)

    Florian, Anca; Ludwig, Anna; Stubbe-Dräger, Bianca; Boentert, Matthias; Young, Peter; Waltenberger, Johannes; Rösch, Sabine; Sechtem, Udo; Yilmaz, Ali

    2015-05-22

    Mitochondrial myopathies (MM) are a heterogeneous group of inherited conditions resulting from a primary defect in the mitochondrial respiratory chain with consecutively impaired cellular energy metabolism. Small sized studies using mainly electrocardiography (ECG) and echocardiography have revealed cardiac abnormalities ranging from conduction abnormalities and arrhythmias to hypertrophic or dilated cardiomyopathy in these patients. Recently, characteristic patterns of cardiac involvement were documented by cardiovascular magnetic resonance (CMR) in patients with chronic progressive external ophthalmoplegia (CPEO)/Kearns-Sayre syndrome (KSS) and with mitochondrial encephalopathy with lactic acidosis and stroke-like episodes (MELAS). The present study aimed to characterize the prevalence and pattern of cardiac abnormalities and to test the additional diagnostic value of CMR in this patient population. The hypothesis that different neuromuscular MM syndromes present with different cardiac disease phenotypes was evaluated. Sixty-four MM patients (50 ± 15 years, 44% male) and 25 matched controls (52 ± 14 years, 36% male) prospectively underwent cardiac evaluations including CMR (comprising cine- and late-gadolinium-enhancement (LGE) imaging). Based on the neuromuscular phenotype and genotype, the patients were grouped: (a) CPEO/KSS (N = 33); (b) MELAS/-like (N = 11); c) myoclonic epilepsy with ragged-red fibers (MERRF) (N = 3) and d) other non-specific MM forms (N = 17). Among the 64 MM patients, 34 (53%) had at least one abnormal CMR finding: 18 (28%) demonstrated an impaired left ventricular ejection-fraction (LV-EF patients showed significantly higher maximal wall thickness (10 ± 3 vs. 8 ± 2 mm, p = 0.005) and concentricity (LV mass to end-diastolic volume: 0.84 ± 0.27 vs. 0.67 ± 0.11, p patients showed the highest frequency of cardiac disease (in 10/11 (91%)), a mostly concentric LV hypertrophy (6/9; 67%) with or

  15. mtDNA depletion myopathy: elucidation of the tissue specificity in the mitochondrial thymidine kinase (TK2) deficiency.

    Science.gov (United States)

    Saada, Ann; Shaag, Avraham; Elpeleg, Orly

    2003-05-01

    Decreased mitochondrial thymidine kinase (TK2) activity is associated with mitochondrial DNA (mtDNA) depletion and respiratory chain dysfunction and is manifested by isolated, fatal skeletal myopathy. Other tissues such as liver, brain, heart, and skin remain unaffected throughout the patients' life. In order to elucidate the mechanism of tissue specificity in the disease we have investigated the expression of the mitochondrial deoxynucleotide carrier, the mtDNA content and the activity of TK2 in mitochondria of various tissues. Our results suggest that low basal TK2 activity combined with a high requirement for mitochondrial encoded proteins in muscle predispose this tissue to the devastating effect of TK2 deficiency.

  16. Gyrate atrophy of choroid and retina with myopia, cataract and systemic proximal myopathy: A rare case report from rural India

    Directory of Open Access Journals (Sweden)

    Surekha Bangal

    2012-12-01

    Full Text Available AbstractGyrate atrophy is a rare metabolic disease with autosomal recessive inheritance pattern characterised by hyperornithinemia and typical ocular findings. This report presents a 17-year-old intellectually challenged girl consulting for a progressive fall of visual acuity with night blindness. Fundus examination showed patches of chorioretinal atrophy with typical scalloped borders and peri vascular pigmentation in the equatorial region. Fundus fluroscein angiography revealed characteristic staining pattern. Other ocular associations included myopia and posterior sub capsular cataract. Progressive systemic proximal myopathy was one of the associated features. Dietary supplementation of vitamin B6 was advised.

  17. Rapid development of anterotibial compartment syndrome and rhabdomyolysis in a patient with primary hypothyroidism and adrenal insufficiency.

    Science.gov (United States)

    Muir, Paul; Choe, Michelle S; Croxson, Michael S

    2012-06-01

    Anterior compartment syndrome (ACS) and rhabdomyolysis are rare complications of hypothyroid myopathy. We report the case of a young man with rapid onset of ACS who presented with simultaneous primary hypothyroidism and adrenal insufficiency associated with acute renal failure, hyponatremia, and hyperkalemia. A 22-year-old man presenting with a one-month history of tiredness, hyperpigmentation, and cramps in his calves was found to have severe bilateral foot drop. Investigations revealed severe primary hypothyroidism and adrenal insufficiency, renal failure, and evidence of rhabdomyolysis with myoglobinuria. Abnormal biochemical findings included serum sodium of 110 mM, serum potassium of 6.9 mM, and serum creatine kinase (CK) of >25,000 IU/L. Magnetic resonance imaging (MRI) of his legs showed changes of myonecrosis confined to anterior tibial muscles typical of ACS. After treatment with intravenous fluids, potassium-lowering therapies, thyroxine, and hydrocortisone, his renal and metabolic function returned to normal, but irreversible bilateral foot drop persisted. A young man with primary hypothyroidism, adrenal insufficiency, hyponatremia, and hyperkalemia presented with severe myopathy, such that muscle necrosis, apparently confined to the anterior tibial compartment on MRI, led to rhabdomyolysis, acute renal failure, and irreversible bilateral peroneal nerve damage. It is possible that other patients with primary hypothyroidism and marked elevations of CK without widespread myopathy or rhabdomyolysis may demonstrate evidence of differential muscle effects in the anterior compartment when assessed by MRI, but that this patient also had adrenal insufficiency raises the possibility that this was a contributing factor. Severe thyroid myopathy and rhabdomyolysis may be associated with anatomic susceptibility to ACS, particularly in the presence of concomitant adrenal insufficiency. MRI examination reveals a distinctive appearance of myonecrosis confined to

  18. Novel Variants in Individuals with RYR1-Related Congenital Myopathies: Genetic, Laboratory, and Clinical Findings

    Directory of Open Access Journals (Sweden)

    Joshua J. Todd

    2018-03-01

    Full Text Available The ryanodine receptor 1-related congenital myopathies (RYR1-RM comprise a spectrum of slow, rare neuromuscular diseases. Affected individuals present with a mild-to-severe symptomatology ranging from proximal muscle weakness, hypotonia and joint contractures to scoliosis, ophthalmoplegia, and respiratory involvement. Although there is currently no FDA-approved treatment for RYR1-RM, our group recently conducted the first clinical trial in this patient population (NCT02362425. This study aimed to characterize novel RYR1 variants with regard to genetic, laboratory, muscle magnetic resonance imaging (MRI, and clinical findings. Genetic and histopathology reports were obtained from participant’s medical records. Alamut Visual Software was used to determine if participant’s variants had been previously reported and to assess predicted pathogenicity. Physical exams, pulmonary function tests, T1-weighted muscle MRI scans, and blood measures were completed during the abovementioned clinical trial. Six novel variants (two de novo, three dominant, and one recessive were identified in individuals with RYR1-RM. Consistent with established RYR1-RM histopathology, cores were observed in all biopsies, except Case 6 who exhibited fiber-type disproportion. Muscle atrophy and impaired mobility with Trendelenburg gait were the most common clinical symptoms and were identified in all cases. Muscle MRI revealed substantial inter-individual variation in fatty infiltration corroborating the heterogeneity of the disease. Two individuals with dominant RYR1 variants exhibited respiratory insufficiency: a clinical symptom more commonly associated with recessive RYR1-RM cases. This study demonstrates that a genetics-led approach is suitable for the diagnosis of suspected RYR1-RM which can be corroborated through histopathology, muscle MRI and clinical examination.

  19. The occurrence of deep pectoral myopathy in broilers and associated changes in breast meat quality.

    Science.gov (United States)

    Yalcin, S; Ozkan, S; Acar, M Comert; Meral, O

    2018-02-01

    1. Two experiments were conducted to determine the effect of slaughter weight on the incidence and intensity of deep pectoral myopathy (DPM) of M. pectoralis minor (p. minor muscle) in commercial conditions in Turkey and to evaluate the impact of DPM on meat quality traits of pectoralis major (p. major) muscle in broilers. 2. In Experiment 1, a total of 116 250 carcasses from 59 Ross-308 broiler flocks, classified according to slaughter weight as 2.0-2.2, 2.2-2.4, 2.4-2.6 and >2.6 kg, were evaluated for occurrence of DPM. In Experiment 2, p. major samples from unaffected broilers and each DPM stage were evaluated for meat quality, oxidant and antioxidant properties, nutritional value and fatty acid profile. DPM was characterised as 1: muscles with coagulative necrosis, 2: muscles with fibrous tissue texture and pink to plumb and 3: muscles with green necrotic area. 3. The average incidence of DPM was found to be 0.73% in Experiment 1 and independent of slaughter weight. 4. In Experiment 2, p. major muscle of broilers with DPM 1 and 2 had higher pH values with higher redness and drip loss. All DPM stages resulted in an increase in lipid content and malondialdehyde activity and lowered ash content of p. major muscle compared with unaffected birds. DPM 2 increased superoxide dismutase and glutathione peroxidase activities in M. p. major. The p. major of broilers with DPM had lower content of C18:2 conjugated linoleic and C20:3n-6 fatty acids than those of unaffected broilers. Lower Δ6 desaturase and thiosterase activities and 18:2n-6 to 18:3n-3 ratio were observed for all DPM stages compared to unaffected. 5. It was concluded that these changes obtained in p. major muscle of broilers with DPM might indicate biochemical characteristics of muscle degenerations.

  20. Biomechanics, diagnosis, and treatment outcome in inflammatory myopathy presenting as oropharyngeal dysphagia

    Science.gov (United States)

    Williams, R B; Grehan, M J; Hersch, M; Andre, J; Cook, I J

    2003-01-01

    Aims: In patients with inflammatory myopathy and dysphagia, our aims were to determine: (1) the diagnostic utility of clinical and laboratory indicators; (2) the biomechanical properties of the pharyngo-oesophageal segment; (3) the usefulness of pharyngeal videomanometry in distinguishing neuropathic from myopathic dysphagia; and (4) clinical outcome. Methods: Clinical, laboratory, and videomanometric assessment was performed in 13 patients with myositis and dysphagia, in 17 disease controls with dysphagia (due to proven CNS disease), and in 22 healthy age matched controls. The diagnostic accuracy of creatine kinase (CPK), erythrocyte sedimentation rate, antinuclear antibody, and electromyography (EMG) were compared with the gold standard muscle biopsy. The biomechanical properties of the pharyngo-oesophageal segment were assessed by videomanometry. Results: Mean time from dysphagia onset to the diagnosis of myositis was 55 months (range 1–180). One third had no extrapharyngeal muscle weakness; 25% had normal CPK, and EMG was unhelpful in 28%. Compared with neurogenic controls, myositis patients had more prevalent cricopharyngeal restrictive disorders (69% v 14%; p=0.0003), reduced upper oesophageal sphincter (UOS) opening (p=0.01), and elevated hypopharyngeal intrabolus pressures (p=0.001). Videomanometric features favouring a myopathic over a neuropathic aetiology were: preserved pharyngeal swallow response, complete UOS relaxation, and normal swallow coordination. The 12 month mortality was 31%. Conclusions: The notable lack of supportive clinical signs and significant false negative rates for laboratory tests contribute to the marked delay in diagnosis. The myopathic process is strongly associated with restricted sphincter opening suggesting that cricopharyngeal disruption is a useful adjunct to immunosuppressive therapy. The condition has a poor prognosis. PMID:12631653

  1. Intravenous immune globulin in hereditary inclusion body myopathy: a pilot study

    Directory of Open Access Journals (Sweden)

    Dorward Heidi

    2007-01-01

    Full Text Available Abstract Background Hereditary Inclusion Body Myopathy (HIBM is an autosomal recessive, adult onset, non-inflammatory neuromuscular disorder with no effective treatment. The causative gene, GNE, codes for UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase, which catalyzes the first two reactions in the synthesis of sialic acid. Reduced sialylation of muscle glycoproteins, such as α-dystroglycan and neural cell adhesion molecule (NCAM, has been reported in HIBM. Methods We treated 4 HIBM patients with intravenous immune globulin (IVIG, in order to provide sialic acid, because IgG contains 8 μmol of sialic acid/g. IVIG was infused as a loading dose of 1 g/kg on two consecutive days followed by 3 doses of 400 mg/kg at weekly intervals. Results For all four patients, mean quadriceps strength improved from 19.0 kg at baseline to 23.2 kg (+22% directly after IVIG loading to 25.6 kg (+35% at the end of the study. Mean shoulder strength improved from 4.1 kg at baseline to 5.9 kg (+44% directly after IVIG loading to 6.0 kg (+46% at the end of the study. The composite improvement for 8 other muscle groups was 5% after the initial loading and 19% by the end of the study. Esophageal motility and lingual strength improved in the patients with abnormal barium swallows. Objective measures of functional improvement gave variable results, but the patients experienced improvements in daily activities that they considered clinically significant. Immunohistochemical staining and immunoblotting of muscle biopsies for α-dystroglycan and NCAM did not provide consistent evidence for increased sialylation after IVIG treatment. Side effects were limited to transient headaches and vomiting. Conclusion The mild benefits in muscle strength experienced by HIBM patients after IVIG treatment may be related to the provision of sialic acid supplied by IVIG. Other sources of sialic acid are being explored as treatment options for HIBM.

  2. Relationship between work rate and oxygen uptake in mitochondrial myopathy during ramp-incremental exercise

    Directory of Open Access Journals (Sweden)

    A.C. Gimenes

    2011-04-01

    Full Text Available We determined the response characteristics and functional correlates of the dynamic relationship between the rate (Δ of oxygen consumption ( O2 and the applied power output (work rate = WR during ramp-incremental exercise in patients with mitochondrial myopathy (MM. Fourteen patients (7 males, age 35.4 ± 10.8 years with biopsy-proven MM and 10 sedentary controls (6 males, age 29.0 ± 7.8 years took a ramp-incremental cycle ergometer test for the determination of the O2 on-exercise mean response time (MRT and the gas exchange threshold (GET. The ΔO2/ΔWR slope was calculated up to GET (S1, above GET (S2 and over the entire linear portion of the response (S T. Knee muscle endurance was measured by isokinetic dynamometry. As expected, peak O2 and muscle performance were lower in patients than controls (P O2/ΔWR than controls, especially the S2 component (6.8 ± 1.5 vs 10.3 ± 0.6 mL·min-1·W-1, respectively; P O2/ΔWR (S T and muscle endurance, MRT-O2, GET and peak O2 in MM patients (P O2/ΔWR below 8 mL·min-1·W-1 had severely reduced peak O2 values (O2 had lower ΔO2/ΔWR (P O2/ΔWR is typically reduced in patients with MM, being related to increased functional impairment and higher cardiopulmonary stress.

  3. Clinical characteristics and favorable long-term outcomes for patients with idiopathic inflammatory myopathies: a retrospective single center study in China

    Directory of Open Access Journals (Sweden)

    Shu Xiao

    2011-11-01

    Full Text Available Abstract Background Little is known about the clinical features and true survival risk factors in Chinese Han population. We conducted the current study to investigate the clinical features, long-term outcome and true potential indicators associated with mortality of idiopathic inflammatory myopathies (IIM in China. Methods We restrospectvely investigated 188 patients diagnosed with IIM at our hospital from January 1986 to April 2009. The primary outcome was determined with mortality. The secondary outcomes for survival patients were organ damage and disease activity, health status, and disability, which were assessed with Myositis Damage Index, Myositis Disease Activity Assessment Visual Analogue Scales, Health Assessment Questionnaire Disability Index, and the Modified Rankin Scale, respectively. Potential prognostic factors for mortality were analyzed with the multivariate Cox regression model. Results Mean age at disease onset was 43.8 ± 15.8 years and male to female ratio was 1:2.1 in this cohort. The 1-, 5-, 10-, 15- and 20-year survival rates were 93.6%, 88.7%, 81%, 73.6% and 65.6%. The independent predicators for mortality were age at disease onset [hazard ratio (HR:1.05, 95% CI 1.02 - 1.08], presence of cancer (HR:3.68, 95%CI 1.39 - 9.74, and elevated IgA level at diagnosis (HR:2.80, 95% CI 1.16-6.74. At the end of the follow-up, 29 patients manifested drug withdrawal within an average 4.1 years (range 0.5-15.2 year, most patients (85.9% had no disease activity and 130 patients (83.4% had no disability. Conclusions The long-term outcomes of IIM patients in our cohort have improved dramatically. Those patients most likely to survive had a high chance of reaching stable disease status, and obtained long-term or possibly permanent remission to a large extent.

  4. Efficient primary and parametric resonance excitation of bistable resonators

    KAUST Repository

    Ramini, Abdallah; Alcheikh, Nouha; Ilyas, Saad; Younis, Mohammad I.

    2016-01-01

    efficient and requires less power for primary resonance excitation. Moreover, unlike the classical method where the structure is vulnerable to the dynamic pull-in instability, the axial excitation technique can provide large amplitude motion while protecting

  5. Bifunctional organocatalysts for the asymmetric synthesis of axially chiral benzamides

    Directory of Open Access Journals (Sweden)

    Ryota Miyaji

    2017-08-01

    Full Text Available Bifunctional organocatalysts bearing amino and urea functional groups in a chiral molecular skeleton were applied to the enantioselective synthesis of axially chiral benzamides via aromatic electrophilic bromination. The results demonstrate the versatility of bifunctional organocatalysts for the enantioselective construction of axially chiral compounds. Moderate to good enantioselectivities were afforded with a range of benzamide substrates. Mechanistic investigations were also carried out.

  6. Test Setup for Axially Loaded Piles in Sand

    DEFF Research Database (Denmark)

    Thomassen, Kristina

    The test setup for testing axially static and cyclic loaded piles in sand is described in the following. The purpose for the tests is to examine the tensile capacity of axially loaded piles in dense fully saturated sand. The pile dimensions are chosen to resemble full scale dimension of piles used...... in offshore pile foundations today....

  7. Characterisation of plasmas produced by the "Torche a Injection Axiale"

    NARCIS (Netherlands)

    Jonkers, J.; Selen, L.J.M.; Mullen, van der J.J.A.M.; Regt, de J.M.; Timmermans, E.A.H.; Schram, D.C.

    1996-01-01

    Summary form only given. The Torche a Injection Axiale (TIA), i.e. torch with axial gas injection, was developed by the group of Moisan in 1993. We report on the investigations on two different kind of plasmas created by the TIA: one with helium and the other with argon as main gas. Using absolute

  8. Equation of motion for the axial gravitational superfield

    International Nuclear Information System (INIS)

    Ogievetsky, V.; Sokatchev, E.

    1980-01-01

    Transformation properties of the axial supergravitational field variants are investigated. The equation of motion for the axial gravitational superfield is derived by direct variation of the N = 1 supergravity action. The left-hand side of this equation is a component of the torsion tensor, and the right-hand side is the supercurrent. The question about the cosmological term in supergravity is discussed

  9. Original paper Cytokine profiles in axial spondyloarthritis

    Directory of Open Access Journals (Sweden)

    Marta Madej

    2015-04-01

    Full Text Available Objectives: Current studies concentrate on the cytokine network and its role in the pathogenesis of spondyloarthritis (SpA. In this study, we analyzed whether the serum cytokine profile (interleukins: IL-10, IL-11, IL-12, IL-15, IL-17, IL-23 and IL-33 correlates with demographic data, clinical manifestations, disease activity and treatment outcome in a group of patients with axial spondyloarthritis. Material and methods: Forty-nine patients with an established diagnosis of axial spondyloarthritis (aSpA and 19 healthy volunteers as controls were enrolled in the study. Clinical evaluation included patient’s medical history, 44 joint count, back pain intensity and global disease activity in the preceding week (VAS, the duration of morning stiffness and blood tests. Disease activity was assessed using BASDAI and ASDAS-CRP. Serum concentration of IL-10, IL-11, IL-12, IL-15, IL-17, IL-23 and IL-33 was determined. Results : In patients with aSpA, elevated serum concentration of IL-10, IL-15, IL-17 and IL-23 was detected. In the aSpA group we detected higher values of serum concentration of IL-23 and IL-33 in the subgroup with anterior uveitis (83.1 ±184.0 pg/ml vs. 14.0 ±17.1 pg/ml, p < 0.0001 and 45.5 ±71.9 pg/ml vs. 18.4 ±14.3 pg/ml, p < 0.0001, respectively. Additionally, in the subgroup with peripheral arthritis, elevation of serum concentration of IL-12 (249.3 ±246.9 pg/ml vs. 99.9 ±105.9 pg/ml, p = 0.0001 was detected. Patients with preradiological SpA had higher serum concentration of IL-17 than patients with established diagnosis of AS (6.37 ±8.50 pg/ml vs. 2.04 ±2.98 pg/ml, p = 0.0295. No differences in serum concentration of analyzed cytokines were found between the subgroup with low to moderate disease activity and the subgroup with high to very high disease activity. Conclusions : We report that in aSpA patients, compared to controls, elevated serum concentrations of IL-10, IL-15, IL-17 and IL-23 were observed. Some cytokines may

  10. The Klinger hot gas double axial valve

    International Nuclear Information System (INIS)

    Kruschik, J.; Hiltgen, H.

    1984-01-01

    The Klinger hot gas valve is a medium controlled double axial valve with advanced design features and safety function. It was first proposed by Klinger early in 1976 for the PNP-Project as a containment shut-off for hot helium (918 deg. C and 42 bar), because a market research has shown that such a valve is not state of present techniques. In the first stage of development a feasibility study had to be made by detailed design, calculation and by basic experiments for key components in close collaboration with Interatom/GHT. This was the basis for further design, calculation, construction and experimental work for such a valve prototype within the new development contract. The stage of knowledge to that time revealed the following key priority development areas: Finite element stress analysis for the highly stressed high temperature main components; development of an insulation layout; Detailed experimental tests of functionally important structural components or units of the valve, partly at Klingers (gasstatic bearings, flexible metallic sealing element, aerodynamic and thermohydraulic tests), partly at Interatom (actuator unit and also gasstatic bearings), partly at HRB in Juelich (flexible metallic sealing system, aerodynamic and thermohydraulic tests); Design of a test valve for experimental work in the KVK (test circuit at Interatom) for evaluation of temperature distribution and reliability of operation; Design of a prototype and extensive testing in the KVK

  11. Small axial compressor technology, volume 1

    Science.gov (United States)

    Holman, F. F.; Kidwell, J. R.; Ware, T. C.

    1976-01-01

    A scaled single-stage, highly-loaded, axial-flow transonic compressor was tested at speeds from 70 to 110% design equivalent speed to evaluate the effects of scaling compromises and the individual and combined effects of rotor tip running clearance and rotor shroud casing treatment on the overall and blade element performance. At design speed and 1% tip clearance the stage demonstrated an efficiency of 83.2% at 96.4% design flow and a pressure ratio of 1.865. Casing treatment increased design speed surge margin 2.0 points to 12.8%. Overall performance was essentially unchanged. An increase in rotor running clearance to 2.2%, with smooth casing, reduced design speed peak efficiency 5.7 points, flow by 7.4%, pressure ratio to 1.740, and surge margin to 5.4%. Reinstalling casing treatment regained 3.5 points in design speed peak efficiency, 4.7% flow, increased pressure ratio to 1.800 and surge margin to 8.7%.

  12. Giant Cell Tumors of the Axial Skeleton

    Directory of Open Access Journals (Sweden)

    Maurice Balke

    2012-01-01

    Full Text Available Background. We report on 19 cases of giant cell tumor of bone (GCT affecting the spine or sacrum and evaluate the outcome of different treatment modalities. Methods. Nineteen patients with GCT of the spine (=6 or sacrum (=13 have been included in this study. The mean followup was 51.6 months. Ten sacral GCT were treated by intralesional procedures of which 4 also received embolization, and 3 with irradiation only. All spinal GCT were surgically treated. Results. Two (15.4% patients with sacral and 4 (66.7% with spinal tumors had a local recurrence, two of the letter developed pulmonary metastases. One local recurrence of the spine was successfully treated by serial arterial embolization, a procedure previously described only for sacral tumors. At last followup, 9 patients had no evidence of disease, 8 had stable disease, 1 had progressive disease, 1 died due to disease. Six patients had neurological deficits. Conclusions. GCT of the axial skeleton have a high local recurrence rate. Neurological deficits are common. En-bloc spondylectomy combined with embolization is the treatment of choice. In case of inoperability, serial arterial embolization seems to be an alternative not only for sacral but also for spinal tumors.

  13. Axial channeling of boron ions into silicon

    International Nuclear Information System (INIS)

    La Ferla, A.; Galvagno, G.; Raineri, V.; Setola, R.; Rimini, E.; Carnera, A.; Gasparotto, A.

    1992-01-01

    Channeling boron implants were performed into (100) and (110) silicon substrates in the energy range 80-700 keV. The dose ranged between 3.5x10 11 and 1x10 15 atoms/cm 2 . The axial channeling concentration profiles of implanted B + were compared with that obtained for incidence along the random direction of the crystal and with that obtained by implantation in amorphous silicon. The electrical and chemical boron distributions were obtained by spreading resistance and secondary ion mass spectrometry measurements, respectively. The inelastic stopping power, S c , was extracted from the experimental maximum ranges for the [100] and [110] axis. The energy dependence of the electronic stopping power is given by S e = KE p with p [100] = 0.469±0.010 and p [110] = 0.554±0.004. Simulations obtained by the MARLOWE code, using the Oen-Robinson impact parameter dependent formula, for the electronic energy loss reproduce quite well the experimental depth profiles. (orig.)

  14. Axial sheath dynamics in a plasma focus

    International Nuclear Information System (INIS)

    Soliman, H.M.; El-Khalafawy, T.A.; Masoud, M.M.

    1990-01-01

    This paper presents the result of investigation with a 10 kJ Mather type plasma focus. It is operated in hydrogen gas at ambient pressure of 0.15--1 torr and charging voltage of 8--11 kV. Radial distribution of the current sheath density with axial distance has been estimated. Plasma rotation in the expansion chamber in the absence of external magnetic field has been detected. A plasma flare from the plasma focus region propagating in the radial direction has been observed. Streak photography shows two plasma streams flowing simultaneously out of the muzzle. The mean energy of the electron beam ejected from the pinch region of the focused plasma, was measured by retarding field analyzer to be 0.32 keV. The electron temperature of the plasma focus at peak compression was determined by measuring the X-ray intensity as a function of absorber thickness at a distance of 62 cm from the focus. The electron temperature has been found to 3 keV

  15. Relation between axial length and ocular parameters

    Directory of Open Access Journals (Sweden)

    Xue-Qiu Yang

    2013-09-01

    Full Text Available AIM: To investigatethe relation between axial length(AL, age and ocular parameters.METHODS: A total of 360 subjects(360 eyeswith emmetropia or myopia were recruited. Refraction, center corneal thickness(CCT, AL, intraocular pressure(IOPwere measured by automatic-refractor, Pachymeter, A-mode ultrasound and non-contact tonometer, respectively. Corneal curvature(CC, anterior chamber depth(ACDand white-to-white distance(WWDwere measured by Orbscan II. Three dimensional frequency domain coherent optical tomography(3D-OCTwas used to examine the retinal nerve fiber layer thickness(RNFLT. The Pearson correlation coefficient(rand multiple regression analysis were performed to evaluate the relationship between AL, age and ocular parameters.RESULTS: The average AL was 24.15±1.26mm. With elongation of the AL, spherical equivalent(SE(r=-0.742,Pr=-0.395, Pr=-0.374, Pr=0.411, Pr=0.099, P=0.060and WWD(r=0.061, P=0.252. There was also a significant correlation between AL and age(P=0.001, SE(PPPCONCLUSION: In longer eyes, there is a tendency toward myopia, a flatter cornea, a deeper ACD and a thinner RNFLT. Age is an influencing factor for the AL as well.

  16. Analysis of SONACO axial cooling experiments

    International Nuclear Information System (INIS)

    Sigg, B.; Dury, T.V.; Hudina, M.

    1994-01-01

    The SONACO test rig contained a sodium-cooled, electrically heated 37-pin bundle. On this rig, a series of forced, mixed and natural convection experiments have been performed with the aim of contributing to the understanding of thermal-hydraulic phenomena and providing data for code validation for a subassembly at decay heat power level with low flow or stagnant coolant. The test section and especially the heater pins were equipped with an extensive number of chromel-alumel thermocouples. In addition, special permanent-magnet probes were used for measuring local velocities. In this paper we give a survey of results from axial cooling experiments, where heat was removed by natural convection to a cooling coil situated in the coolant channel (plenum) above the bundle. The experimental conditions led to turbulent convection with a slowly varying, large scale flow pattern. It is shown that a power tilt in the bundle reduces these fluctuations but does not eliminate them. For the uniformly heated bundle, aglebraic expressions for the average turbulent heat flux as well as for temperature and velocity fluctuations are derived from a second-moments model and compared with experimental data. Furthermore, heat transfer in the plenum and the consequences of the SONACO experiments for the coolability of reactor fuel elements under loss-of-flow conditions are discussed. ((orig.))

  17. Nucleon axial coupling from Lattice QCD

    Science.gov (United States)

    Cheng Chang, Chia; Nicholson, Amy; Rinaldi, Enrico; Berkowitz, Evan; Garron, Nicolas; Brantley, David; Monge-Camacho, Henry; Monahan, Chris; Bouchard, Chris; Clark, M. A.; Joó, Bálint; Kurth, Thorsten; Orginos, Kostas; Vranas, Pavlos; Walker-Loud, André

    2018-03-01

    We present state-of-the-art results from a lattice QCD calculation of the nucleon axial coupling, gA, using Möbius Domain-Wall fermions solved on the dynamical Nf = 2 + 1 + 1 HISQ ensembles after they are smeared using the gradient-flow algorithm. Relevant three-point correlation functions are calculated using a method inspired by the Feynman-Hellmann theorem, and demonstrate significant improvement in signal for fixed stochastic samples. The calculation is performed at five pion masses of mπ {400, 350, 310, 220, 130} MeV, three lattice spacings of a {0.15, 0.12, 0.09} fm, and we do a dedicated volume study with mπL {3.22, 4.29, 5.36}. Control over all relevant sources of systematic uncertainty are demonstrated and quantified. We achieve a preliminary value of gA = 1.285(17), with a relative uncertainty of 1.33%.

  18. Multimode interaction in axially excited cylindrical shells

    Directory of Open Access Journals (Sweden)

    Silva F. M. A.

    2014-01-01

    Full Text Available Cylindrical shells exhibit a dense frequency spectrum, especially near the lowest frequency range. In addition, due to the circumferential symmetry, frequencies occur in pairs. So, in the vicinity of the lowest natural frequencies, several equal or nearly equal frequencies may occur, leading to a complex dynamic behavior. So, the aim of the present work is to investigate the dynamic behavior and stability of cylindrical shells under axial forcing with multiple equal or nearly equal natural frequencies. The shell is modelled using the Donnell nonlinear shallow shell theory and the discretized equations of motion are obtained by applying the Galerkin method. For this, a modal solution that takes into account the modal interaction among the relevant modes and the influence of their companion modes (modes with rotational symmetry, which satisfies the boundary and continuity conditions of the shell, is derived. Special attention is given to the 1:1:1:1 internal resonance (four interacting modes. Solving numerically the governing equations of motion and using several tools of nonlinear dynamics, a detailed parametric analysis is conducted to clarify the influence of the internal resonances on the bifurcations, stability boundaries, nonlinear vibration modes and basins of attraction of the structure.

  19. NASA Glenn's Single-Stage Axial Compressor Facility Upgraded

    Science.gov (United States)

    Brokopp, Richard A.

    2004-01-01

    NASA Glenn Research Center's Single-Stage Axial Compressor Facility was upgraded in fiscal year 2003 to expand and improve its research capabilities for testing high-speed fans and compressors. The old 3000-hp drive motor and gearbox were removed and replaced with a refurbished 7000-hp drive motor and gearbox, with a maximum output speed of 21,240 rpm. The higher horsepower rating permits testing of fans and compressors with higher pressure ratio or higher flow. A new inline torquemeter was installed to provide an alternate measurement of fan and compressor efficiency, along with the standard pressure and temperature measurements. A refurbished compressor bearing housing was also installed with bidirectional rotation capability, so that a variety of existing hardware could be tested. Four new lubrication modules with backup capability were installed for the motor, gearbox, torquemeter, and compressor bearing housing, so that in case the primary pump fails, the backup will prevent damage to the rotating hardware. The combustion air supply line for the facility inlet air system was activated to provide dry air for repeatable inlet conditions. New flow conditioning hardware was installed in the facility inlet plenum tank, which greatly reduced the inlet turbulence. The new inlet can also be easily modified to accommodate 20- or 22-in.-diameter fans and compressors, so a variety of existing hardware from other facilities (such as Glenn's 9- by 15-Foot Low-Speed Wind Tunnel) can be tested in the Single-Stage Axial Compressor Facility. An exhaust line was also installed to provide bleed capability to remove the inlet boundary layer. To improve the operation and control of the facility, a new programmable logic controller (PLC) was installed to upgrade from hardwired relay logic to software logic. The PLC also enabled the usage of human-machine interface software to allow for easier operation of the facility and easier reconfiguration of the facility controls when

  20. Experimental studies on the accumulation of /sup 99m/Tc-MDP in the bupivacaine hydrochloride induced myopathy

    Energy Technology Data Exchange (ETDEWEB)

    Sone, Shinsuke

    1989-02-01

    It has recently been demonstrated that several /sup 99m/Tc-labeled phosphate compounds accumulate in skeletal muscle in patients with myopathies including Duchenne muscular dystrophy (DMD). However, the mechanism by which these compounds accumulate in skeletal muscles is unknown. In order to analyze the mechanisms of tracer-localization in skeletal muscles of myopathies, the uptake of /sup 99m/Tc-methylendiphosphonate (/sup 99m/Tc-MDP) by muscles examined in rats treated by intramuscular injection of a local anesthetic, bupivacaine. At the same time, the histological and biochemical changes of the injured muscles were studied, and findings obtained were correlated with the procedure of /sup 99m/Tc-MDP uptake. Intramuscular injection of bupivacaine resulted in markedly increased uptake of /sup 99m/Tc-MDP in the injected muscle at 12 and 24 hours after injection. The plasma creatine phosphokinase (CK) concentration increased 2-3 folds during the period from 3 to 24 hours after bupivacaine injection. Four days following injection, the CK isozyme MB activity in muscle increased. Twenty hours after injection of bupivacaine, changes such as hypercontraction and disruptin of myofibrils, Z-band lysis, and swelling of mitochondria occurred. Four days after the injection, myoblasts and myotubes were found in the damaged areas of the muscle. These results show that the increased muscle uptake of /sup 99m/Tc-MDP reflects the early degenerative changes of skeletal muscle.