Combination therapies for the treatment of HER2-positive breast cancer: current and future prospects.

Science.gov (United States)

Brandão, Mariana; Pondé, Noam F; Poggio, Francesca; Kotecki, Nuria; Salis, Mauren; Lambertini, Matteo; de Azambuja, Evandro

2018-05-24

HER2-positive disease is an aggressive subtype of breast cancer that has been revolutionized by anti-HER2 directed therapies. Multiple drugs have been developed and are currently in clinical use, including trastuzumab, lapatinib, pertuzumab, T-DM1, and neratinib, alone or combined in 'dual HER2-blockade' regimens. Areas covered: A comprehensive literature review was performed regarding the current state and the future of combination regimens containing anti-HER2 agents, focusing on their efficacy, toxicity, and cost-effectiveness. Expert commentary: The combination of trastuzumab/pertuzumab is approved in all disease settings, while trastuzumab/neratinib is approved in the adjuvant setting and trastuzumab/lapatinib in metastatic disease. Meanwhile, as breast cancer biology and resistance mechanisms become clearer, combinations with drugs like PI3K/Akt/mTOR inhibitors, CDK4/6 inhibitors, anti-PD(L)1 antibodies, endocrine therapy, and new anti-HER2 agents (panHER and HER2 tyrosine kinase inhibitors, bispecific antibodies, anti-HER3 antibodies, and antibody-drug conjugates) are being extensively tested in clinical trials. More specific strategies for the 'triple-positive' (estrogen receptor-positive/HER2-positive) disease are also being explored. However, there is an urgent need for the development of predictive biomarkers for a better tailoring of anti-HER2 directed therapy. This is the only way to further improve clinical outcomes and quality of life and to decrease costs and toxicities of unnecessary treatments.

Chaos game representation (CGR)-walk model for DNA sequences

International Nuclear Information System (INIS)

Jie, Gao; Zhen-Yuan, Xu

2009-01-01

Chaos game representation (CGR) is an iterative mapping technique that processes sequences of units, such as nucleotides in a DNA sequence or amino acids in a protein, in order to determine the coordinates of their positions in a continuous space. This distribution of positions has two features: one is unique, and the other is source sequence that can be recovered from the coordinates so that the distance between positions may serve as a measure of similarity between the corresponding sequences. A CGR-walk model is proposed based on CGR coordinates for the DNA sequences. The CGR coordinates are converted into a time series, and a long-memory ARFIMA (p, d, q) model, where ARFIMA stands for autoregressive fractionally integrated moving average, is introduced into the DNA sequence analysis. This model is applied to simulating real CGR-walk sequence data of ten genomic sequences. Remarkably long-range correlations are uncovered in the data, and the results from these models are reasonably fitted with those from the ARFIMA (p, d, q) model. (cross-disciplinary physics and related areas of science and technology)

A tale of three next generation sequencing platforms: comparison of Ion Torrent, Pacific Biosciences and Illumina MiSeq sequencers

Directory of Open Access Journals (Sweden)

Quail Michael A

2012-07-01

Full Text Available Abstract Background Next generation sequencing (NGS technology has revolutionized genomic and genetic research. The pace of change in this area is rapid with three major new sequencing platforms having been released in 2011: Ion Torrent’s PGM, Pacific Biosciences’ RS and the Illumina MiSeq. Here we compare the results obtained with those platforms to the performance of the Illumina HiSeq, the current market leader. In order to compare these platforms, and get sufficient coverage depth to allow meaningful analysis, we have sequenced a set of 4 microbial genomes with mean GC content ranging from 19.3 to 67.7%. Together, these represent a comprehensive range of genome content. Here we report our analysis of that sequence data in terms of coverage distribution, bias, GC distribution, variant detection and accuracy. Results Sequence generated by Ion Torrent, MiSeq and Pacific Biosciences technologies displays near perfect coverage behaviour on GC-rich, neutral and moderately AT-rich genomes, but a profound bias was observed upon sequencing the extremely AT-rich genome of Plasmodium falciparum on the PGM, resulting in no coverage for approximately 30% of the genome. We analysed the ability to call variants from each platform and found that we could call slightly more variants from Ion Torrent data compared to MiSeq data, but at the expense of a higher false positive rate. Variant calling from Pacific Biosciences data was possible but higher coverage depth was required. Context specific errors were observed in both PGM and MiSeq data, but not in that from the Pacific Biosciences platform. Conclusions All three fast turnaround sequencers evaluated here were able to generate usable sequence. However there are key differences between the quality of that data and the applications it will support.

New strategy for eliminating zero-sequence circulating current between parallel operating three-level NPC voltage source inverters

DEFF Research Database (Denmark)

Li, Kai; Dong, Zhenhua; Wang, Xiaodong

2018-01-01

A novel strategy based on a zero common mode voltage pulse-width modulation (ZCMV-PWM) technique and zero-sequence circulating current (ZSCC) feedback control is proposed in this study to eliminate ZSCCs between three-level neutral point clamped (NPC) voltage source inverters, with common AC and DC......, the ZCMV-PWM method is presented to reduce CMVs, and a simple electric circuit is adopted to control ZSCCs and neutral point potential. Finally, simulation and experiment are conducted to illustrate effectiveness of the proposed strategy. Results show that ZSCCs between paralleled inverters can...

Sequence periodicity in nucleosomal DNA and intrinsic curvature.

Science.gov (United States)

Nair, T Murlidharan

2010-05-17

Most eukaryotic DNA contained in the nucleus is packaged by wrapping DNA around histone octamers. Histones are ubiquitous and bind most regions of chromosomal DNA. In order to achieve smooth wrapping of the DNA around the histone octamer, the DNA duplex should be able to deform and should possess intrinsic curvature. The deformability of DNA is a result of the non-parallelness of base pair stacks. The stacking interaction between base pairs is sequence dependent. The higher the stacking energy the more rigid the DNA helix, thus it is natural to expect that sequences that are involved in wrapping around the histone octamer should be unstacked and possess intrinsic curvature. Intrinsic curvature has been shown to be dictated by the periodic recurrence of certain dinucleotides. Several genome-wide studies directed towards mapping of nucleosome positions have revealed periodicity associated with certain stretches of sequences. In the current study, these sequences have been analyzed with a view to understand their sequence-dependent structures. Higher order DNA structures and the distribution of molecular bend loci associated with 146 base nucleosome core DNA sequence from C. elegans and chicken have been analyzed using the theoretical model for DNA curvature. The curvature dispersion calculated by cyclically permuting the sequences revealed that the molecular bend loci were delocalized throughout the nucleosome core region and had varying degrees of intrinsic curvature. The higher order structures associated with nucleosomes of C.elegans and chicken calculated from the sequences revealed heterogeneity with respect to the deviation of the DNA axis. The results points to the possibility of context dependent curvature of varying degrees to be associated with nucleosomal DNA.

SU-E-J-231: Comparison of Delineation Variability of Soft Tissue Volume and Position in Head-And-Neck Between Two T1-Weighted Pulse Sequences Using An MR-Simulator with Immobilization

Energy Technology Data Exchange (ETDEWEB)

Wong, O; Lo, G; Yuan, J; Law, M; Ding, A; Cheng, K; Chan, K; Cheung, K; Yu, S [Hong Kong Sanatorium & Hospital, Hong Kong (Hong Kong)

2015-06-15

Purpose: There is growing interests in applying MR-simulator(MR-sim) in radiotherapy but MR images subject to hardware, patient and pulse sequence dependent geometric distortion that may potentially influence target definition. This study aimed to evaluate the influence on head-and-neck tissue delineation, in terms of positional and volumetric variability, of two T1-weighted(T1w) MR sequences on a 1.5T MR-sim Methods: Four healthy volunteers were scanned (4 scans for each on different days) using both spin-echo (3DCUBE, TR/TE=500/14ms, TA=183s) and gradient-echo sequences (3DFSPGR, TE/TR=7/4ms, TA=173s) with identical coverage, voxel-size(0.8×0.8×1.0mm3), receiver-bandwidth(62.5kHz/pix) and geometric correction on a 1.5T MR-sim immobilized with personalized thermoplastic cast and head-rest. Under this setting, similar T1w contrast and signal-to-noise ratio were obtained, and factors other than sequence that might bias image distortion and tissue delineation were minimized. VOIs of parotid gland(PGR, PGL), pituitary gland(PIT) and eyeballs(EyeL, EyeR) were carefully drawn, and inter-scan coefficient-of-variation(CV) of VOI centroid position and volume were calculated for each subject. Mean and standard deviation(SD) of the CVs for four subjects were compared between sequences using Wilcoxon ranksum test. Results: The mean positional(<4%) and volumetric(<7%) CVs varied between tissues, majorly dependent on tissue inherent properties like volume, location, mobility and deformability. Smaller mean volumetric CV was found in 3DCUBE, probably due to its less proneness to tissue susceptibility, but only PGL showed significant difference(P<0.05). Positional CVs had no significant differences for all VOIs(P>0.05) between sequences, suggesting volumetric variation might be more sensitive to sequence-dependent delineation difference. Conclusion: Although 3DCUBE is considered less prone to tissue susceptibility-induced artifact and distortion, our preliminary data showed

Whole Genome Sequencing Increases Molecular Diagnostic Yield Compared with Current Diagnostic Testing for Inherited Retinal Disease.

Science.gov (United States)

Ellingford, Jamie M; Barton, Stephanie; Bhaskar, Sanjeev; Williams, Simon G; Sergouniotis, Panagiotis I; O'Sullivan, James; Lamb, Janine A; Perveen, Rahat; Hall, Georgina; Newman, William G; Bishop, Paul N; Roberts, Stephen A; Leach, Rick; Tearle, Rick; Bayliss, Stuart; Ramsden, Simon C; Nemeth, Andrea H; Black, Graeme C M

2016-05-01

To compare the efficacy of whole genome sequencing (WGS) with targeted next-generation sequencing (NGS) in the diagnosis of inherited retinal disease (IRD). Case series. A total of 562 patients diagnosed with IRD. We performed a direct comparative analysis of current molecular diagnostics with WGS. We retrospectively reviewed the findings from a diagnostic NGS DNA test for 562 patients with IRD. A subset of 46 of 562 patients (encompassing potential clinical outcomes of diagnostic analysis) also underwent WGS, and we compared mutation detection rates and molecular diagnostic yields. In addition, we compared the sensitivity and specificity of the 2 techniques to identify known single nucleotide variants (SNVs) using 6 control samples with publically available genotype data. Diagnostic yield of genomic testing. Across known disease-causing genes, targeted NGS and WGS achieved similar levels of sensitivity and specificity for SNV detection. However, WGS also identified 14 clinically relevant genetic variants through WGS that had not been identified by NGS diagnostic testing for the 46 individuals with IRD. These variants included large deletions and variants in noncoding regions of the genome. Identification of these variants confirmed a molecular diagnosis of IRD for 11 of the 33 individuals referred for WGS who had not obtained a molecular diagnosis through targeted NGS testing. Weighted estimates, accounting for population structure, suggest that WGS methods could result in an overall 29% (95% confidence interval, 15-45) uplift in diagnostic yield. We show that WGS methods can detect disease-causing genetic variants missed by current NGS diagnostic methodologies for IRD and thereby demonstrate the clinical utility and additional value of WGS. Copyright © 2016 American Academy of Ophthalmology. Published by Elsevier Inc. All rights reserved.

Polymorphism Sequence - JSNP | LSDB Archive [Life Science Database Archive metadata

Lifescience Database Archive (English)

Full Text Available List Contact us JSNP Polymorphism Sequence Data detail Data name Polymorphism Sequence DOI 10.18908/lsdba.nb...dc00114-001 Description of data contents Information on polymorphisms (SNPs and insertions/deletions) and th...se Name database name JSNP_SNP: single nucleotide polymorphism JSNP_InsDel_IND: insertion/deletion JSNP_InsD...ved allele observed 3' Flanking Sequence 3' flanking sequence Offset in Flanking Sequence position of the polymorphism...uence Accession No. accession No. of the sequence for polymorphism screening Offset in Record position of the polymorphism

Controlling charge current through a DNA based molecular transistor

Energy Technology Data Exchange (ETDEWEB)

Behnia, S., E-mail: s.behnia@sci.uut.ac.ir; Fathizadeh, S.; Ziaei, J.

2017-01-05

Molecular electronics is complementary to silicon-based electronics and may induce electronic functions which are difficult to obtain with conventional technology. We have considered a DNA based molecular transistor and study its transport properties. The appropriate DNA sequence as a central chain in molecular transistor and the functional interval for applied voltages is obtained. I–V characteristic diagram shows the rectifier behavior as well as the negative differential resistance phenomenon of DNA transistor. We have observed the nearly periodic behavior in the current flowing through DNA. It is reported that there is a critical gate voltage for each applied bias which above it, the electrical current is always positive. - Highlights: • Modeling a DNA based molecular transistor and studying its transport properties. • Choosing the appropriate DNA sequence using the quantum chaos tools. • Choosing the functional interval for voltages via the inverse participation ratio tool. • Detecting the rectifier and negative differential resistance behavior of DNA.

Balanced Current Control Strategy for Current Source Rectifier Stage of Indirect Matrix Converter under Unbalanced Grid Voltage Conditions

Directory of Open Access Journals (Sweden)

Yeongsu Bak

2016-12-01

Full Text Available This paper proposes a balanced current control strategy for the current source rectifier (CSR stage of an indirect matrix converter (IMC under unbalanced grid voltage conditions. If the three-phase grid connected to the voltage source inverter (VSI of the IMC has unbalanced voltage conditions, it affects the currents of the CSR stage and VSI stage, and the currents are distorted. Above all, the distorted currents of the CSR stage cause instability in the overall system, which can affect the life span of the system. Therefore, in this paper, a control strategy for balanced currents in the CSR stage is proposed. To achieve balanced currents in the CSR stage, the VSI stage should receive DC power without ripple components from the CSR stage. This is implemented by controlling the currents in the VSI stage. Therefore, the proposed control strategy decouples the positive and negative phase-sequence components existing in the unbalanced voltages and currents of the VSI stage. Using the proposed control strategy under unbalanced grid voltage conditions, the stability and life span of the overall system can be improved. The effectiveness of the proposed control strategy is verified by simulation and experimental results.

A workflow for peptide-based proteomics in a poorly sequenced plant: A case study on the plasma membrane proteome of banana

DEFF Research Database (Denmark)

Vertommen, A.; Laurell Blom Møller, Anders; Cordewener, J. H. G.

2011-01-01

for membrane proteomics. However, their application in non-model plants demands special precautions to prevent false positive identification of proteins.In the current paper, a workflow for membrane proteomics in banana, a poorly sequenced plant, is proposed. The main steps of this workflow are (i......) optimization of the peptide separation, (ii) performing de novo sequencing to allow a sequence homology search and (iii) visualization of identified peptide–protein associations using Cytoscape to remove redundancy and wrongly assigned peptides, based on species-specific information. By applying this workflow...

Fractal MapReduce decomposition of sequence alignment

Directory of Open Access Journals (Sweden)

Almeida Jonas S

2012-05-01

Full Text Available Abstract Background The dramatic fall in the cost of genomic sequencing, and the increasing convenience of distributed cloud computing resources, positions the MapReduce coding pattern as a cornerstone of scalable bioinformatics algorithm development. In some cases an algorithm will find a natural distribution via use of map functions to process vectorized components, followed by a reduce of aggregate intermediate results. However, for some data analysis procedures such as sequence analysis, a more fundamental reformulation may be required. Results In this report we describe a solution to sequence comparison that can be thoroughly decomposed into multiple rounds of map and reduce operations. The route taken makes use of iterated maps, a fractal analysis technique, that has been found to provide a "alignment-free" solution to sequence analysis and comparison. That is, a solution that does not require dynamic programming, relying on a numeric Chaos Game Representation (CGR data structure. This claim is demonstrated in this report by calculating the length of the longest similar segment by inspecting only the USM coordinates of two analogous units: with no resort to dynamic programming. Conclusions The procedure described is an attempt at extreme decomposition and parallelization of sequence alignment in anticipation of a volume of genomic sequence data that cannot be met by current algorithmic frameworks. The solution found is delivered with a browser-based application (webApp, highlighting the browser's emergence as an environment for high performance distributed computing. Availability Public distribution of accompanying software library with open source and version control at http://usm.github.com. Also available as a webApp through Google Chrome's WebStore http://chrome.google.com/webstore: search with "usm".

Minimotif Miner 3.0: database expansion and significantly improved reduction of false-positive predictions from consensus sequences.

Science.gov (United States)

Mi, Tian; Merlin, Jerlin Camilus; Deverasetty, Sandeep; Gryk, Michael R; Bill, Travis J; Brooks, Andrew W; Lee, Logan Y; Rathnayake, Viraj; Ross, Christian A; Sargeant, David P; Strong, Christy L; Watts, Paula; Rajasekaran, Sanguthevar; Schiller, Martin R

2012-01-01

Minimotif Miner (MnM available at http://minimotifminer.org or http://mnm.engr.uconn.edu) is an online database for identifying new minimotifs in protein queries. Minimotifs are short contiguous peptide sequences that have a known function in at least one protein. Here we report the third release of the MnM database which has now grown 60-fold to approximately 300,000 minimotifs. Since short minimotifs are by their nature not very complex we also summarize a new set of false-positive filters and linear regression scoring that vastly enhance minimotif prediction accuracy on a test data set. This online database can be used to predict new functions in proteins and causes of disease.

Coval: improving alignment quality and variant calling accuracy for next-generation sequencing data.

Directory of Open Access Journals (Sweden)

Shunichi Kosugi

Full Text Available Accurate identification of DNA polymorphisms using next-generation sequencing technology is challenging because of a high rate of sequencing error and incorrect mapping of reads to reference genomes. Currently available short read aligners and DNA variant callers suffer from these problems. We developed the Coval software to improve the quality of short read alignments. Coval is designed to minimize the incidence of spurious alignment of short reads, by filtering mismatched reads that remained in alignments after local realignment and error correction of mismatched reads. The error correction is executed based on the base quality and allele frequency at the non-reference positions for an individual or pooled sample. We demonstrated the utility of Coval by applying it to simulated genomes and experimentally obtained short-read data of rice, nematode, and mouse. Moreover, we found an unexpectedly large number of incorrectly mapped reads in 'targeted' alignments, where the whole genome sequencing reads had been aligned to a local genomic segment, and showed that Coval effectively eliminated such spurious alignments. We conclude that Coval significantly improves the quality of short-read sequence alignments, thereby increasing the calling accuracy of currently available tools for SNP and indel identification. Coval is available at http://sourceforge.net/projects/coval105/.

Yeast genome sequencing:

DEFF Research Database (Denmark)

Piskur, Jure; Langkjær, Rikke Breinhold

2004-01-01

For decades, unicellular yeasts have been general models to help understand the eukaryotic cell and also our own biology. Recently, over a dozen yeast genomes have been sequenced, providing the basis to resolve several complex biological questions. Analysis of the novel sequence data has shown...... of closely related species helps in gene annotation and to answer how many genes there really are within the genomes. Analysis of non-coding regions among closely related species has provided an example of how to determine novel gene regulatory sequences, which were previously difficult to analyse because...... they are short and degenerate and occupy different positions. Comparative genomics helps to understand the origin of yeasts and points out crucial molecular events in yeast evolutionary history, such as whole-genome duplication and horizontal gene transfer(s). In addition, the accumulating sequence data provide...

Unified Deep Learning Architecture for Modeling Biology Sequence.

Science.gov (United States)

Wu, Hongjie; Cao, Chengyuan; Xia, Xiaoyan; Lu, Qiang

2017-10-09

Prediction of the spatial structure or function of biological macromolecules based on their sequence remains an important challenge in bioinformatics. When modeling biological sequences using traditional sequencing models, characteristics, such as long-range interactions between basic units, the complicated and variable output of labeled structures, and the variable length of biological sequences, usually lead to different solutions on a case-by-case basis. This study proposed the use of bidirectional recurrent neural networks based on long short-term memory or a gated recurrent unit to capture long-range interactions by designing the optional reshape operator to adapt to the diversity of the output labels and implementing a training algorithm to support the training of sequence models capable of processing variable-length sequences. Additionally, the merge and pooling operators enhanced the ability to capture short-range interactions between basic units of biological sequences. The proposed deep-learning model and its training algorithm might be capable of solving currently known biological sequence-modeling problems through the use of a unified framework. We validated our model on one of the most difficult biological sequence-modeling problems currently known, with our results indicating the ability of the model to obtain predictions of protein residue interactions that exceeded the accuracy of current popular approaches by 10% based on multiple benchmarks.

POWRS: position-sensitive motif discovery.

Directory of Open Access Journals (Sweden)

Ian W Davis

Full Text Available Transcription factors and the short, often degenerate DNA sequences they recognize are central regulators of gene expression, but their regulatory code is challenging to dissect experimentally. Thus, computational approaches have long been used to identify putative regulatory elements from the patterns in promoter sequences. Here we present a new algorithm "POWRS" (POsition-sensitive WoRd Set for identifying regulatory sequence motifs, specifically developed to address two common shortcomings of existing algorithms. First, POWRS uses the position-specific enrichment of regulatory elements near transcription start sites to significantly increase sensitivity, while providing new information about the preferred localization of those elements. Second, POWRS forgoes position weight matrices for a discrete motif representation that appears more resistant to over-generalization. We apply this algorithm to discover sequences related to constitutive, high-level gene expression in the model plant Arabidopsis thaliana, and then experimentally validate the importance of those elements by systematically mutating two endogenous promoters and measuring the effect on gene expression levels. This provides a foundation for future efforts to rationally engineer gene expression in plants, a problem of great importance in developing biotech crop varieties.BSD-licensed Python code at http://grassrootsbio.com/papers/powrs/.

Weighted A-statistical convergence for sequences of positive linear operators.

Science.gov (United States)

Mohiuddine, S A; Alotaibi, Abdullah; Hazarika, Bipan

2014-01-01

We introduce the notion of weighted A-statistical convergence of a sequence, where A represents the nonnegative regular matrix. We also prove the Korovkin approximation theorem by using the notion of weighted A-statistical convergence. Further, we give a rate of weighted A-statistical convergence and apply the classical Bernstein polynomial to construct an illustrative example in support of our result.

Stratigraphic position, origin and characteristics of manganese mineralization horizons in the Late Cretaceous volcano-sedimentary sequence, south-southwest of Sabzevar

Directory of Open Access Journals (Sweden)

Sajjad Maghfouri

2014-10-01

Full Text Available Introduction The Mn mineralization occurs in the northeastern segment of the Sabzevar zone (SZ, north of the Central Iranian Microcontinent (CIM. This Zone (SZ is located between the CIM fragmentation in the south and the Kopeh dagh sedimentary sequence in the north. The ore deposits of the northeastern segment of the Sabzevar zone can be divided into three groups, each with different metal association and spatial distribution and each related to a major geodynamic event. The first mineralization with associated Ordovician host rock is characterized by Taknar polymetallic (Fe-rich massive sulfide deposit. The Cretaceous mineralization consists of Cr deposits associated with serpentinized peridotites, Cyprus type VMS, Mn deposit in pillow lava, volcano-sedimentary hosted Besshi type VMS and Mn deposit. Paleogene mineralization in eastern segment of the Sabzevar zone began with porphyry deposits, Cu Red Bed mineralization occurs in the Paleogene sandy red marl. Materials and methods A field study and sampling was performed during the autumn of 2012. To assess the geochemical characteristics of 48 systematic samples (least fractured and altered of ore-bearing layers and host rocks were collected from the deposit for polished thin section examination. In order to correctly characterize their chemical compositions, 15 least-altered and fractured samples were chosen for major elements analysis. Results The Late Cretaceous volcano-sedimentary sequence in south-southwest of Sabzevar hosts numerous manganese mineralization. The sequence based on the stratigraphic position, age and composition of the rocks, can be divided into two lower and upper parts. The lower part or K2tv unit mainly formed from marine sediments interbedded with volcanic rocks. The sedimentary rocks of this part include silicified tuff, chert, shale and sandstone, and the volcanic rocks involve pyroclastic rocks of various composition, rhyolite, dacite and andesitic lava. The upper

The nucleotide sequences of two leghemoglobin genes from soybean

DEFF Research Database (Denmark)

Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O

1982-01-01

We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

A new amplifier for improving piezoelectric actuator linearity based on current switching in precision positioning

International Nuclear Information System (INIS)

Ru, Changhai; Chen, Liguo; Shao, Bing; Rong, Weibin; Sun, Lining

2008-01-01

Piezoelectric actuators have traditionally been driven by voltage amplifiers. When driven at large voltages these actuators exhibit a significant amount of distortion, known as hysteresis, which may reduce the stability robustness of the system in feedback control applications. Piezoelectric transducers are known to exhibit less hysteresis when driven with current or charge rather than voltage. Despite this advantage, such methods have found little practical application due to the poor low frequency response of present current and charge driver designs. In this paper, a new piezoelectric amplifier based on current switching is presented which can reduce hysteresis. Special circuits and a hybrid control algorithm realize quick and precise positioning. Experimental results demonstrate that the amplifier can be used for dynamic and static applications and low frequency bandwidths can also be achieved

Evaluation of positive Rift Valley fever virus formalin-fixed paraffin embedded samples as a source of sequence data for retrospective phylogenetic analysis.

Science.gov (United States)

Mubemba, B; Thompson, P N; Odendaal, L; Coetzee, P; Venter, E H

2017-05-01

Rift Valley fever (RVF), caused by an arthropod borne Phlebovirus in the family Bunyaviridae, is a haemorrhagic disease that affects ruminants and humans. Due to the zoonotic nature of the virus, a biosafety level 3 laboratory is required for isolation of the virus. Fresh and frozen samples are the preferred sample type for isolation and acquisition of sequence data. However, these samples are scarce in addition to posing a health risk to laboratory personnel. Archived formalin-fixed, paraffin-embedded (FFPE) tissue samples are safe and readily available, however FFPE derived RNA is in most cases degraded and cross-linked in peptide bonds and it is unknown whether the sample type would be suitable as reference material for retrospective phylogenetic studies. A RT-PCR assay targeting a 490 nt portion of the structural G N glycoprotein encoding gene of the RVFV M-segment was applied to total RNA extracted from archived RVFV positive FFPE samples. Several attempts to obtain target amplicons were unsuccessful. FFPE samples were then analysed using next generation sequencing (NGS), i.e. Truseq ® (Illumina) and sequenced on the Miseq ® genome analyser (Illumina). Using reference mapping, gapped virus sequence data of varying degrees of shallow depth was aligned to a reference sequence. However, the NGS did not yield long enough contigs that consistently covered the same genome regions in all samples to allow phylogenetic analysis. Copyright © 2017 Elsevier B.V. All rights reserved.

Use of tuf as a target for sequence-based identification of Gram-positive cocci of the genus Enterococcus, Streptococcus, coagulase-negative Staphylococcus, and Lactococcus

Directory of Open Access Journals (Sweden)

Li Xuerui

2012-11-01

Full Text Available Abstract Background Accurate identification of isolates belonging to genus Enterococcus, Streptococcus, coagulase-negative Staphylococcus, and Lactococcus at the species level is necessary to provide a better understanding of their pathogenic potential, to aid in making clinical decisions, and to conduct epidemiologic investigations,especially when large blind samples must be analyzed. It is useful to simultaneously identify species in different genera using a single primer pair. Methods We developed a primer pair based on the tuf gene (encoding elongation factor sequence to identify 56 Gram-positive cocci isolates. Results The target sequences were amplified from all 56 samples. The sequencing results and the phylogenetic tree derived from the partial tuf gene sequences identified the isolates as three enterococcal species, two lactococcal species, two staphylococcal species, and six streptococcal species, as well as eight isolates that were novel species of the genus Streptococcus. Partial gene sequence analysis of the sodA, dnaK, and 16S RNA genes confirmed the results obtained by tuf gene sequencing. Conclusion Based on the uniform amplification of the tuf gene from all samples and the ability to identify all isolates at both the genus and species levels, we conclude that the primer pair developed in this research provides a powerful tool for identifying these organisms in clinical laboratories where large blind samples are used.

BmTx3, a scorpion toxin with two putative functional faces separately active on A-type K+ and HERG currents.

OpenAIRE

Huys, Isabelle; Xu, Chen-Qi; Wang, Cheng-Zhong; Vacher, Hélène; Martin-Eauclaire, Marie-France; Chi, Cheng-Wu; Tytgat, Jan

2004-01-01

A novel HERG channel blocker was isolated from the venom of the scorpion Buthus martensi Karsch, sequenced and characterized at the pharmacological level after chemical synthesis. According to the determined amino acid sequence, the cDNA and genomic genes were then cloned. The genomic gene consists of two exons interrupted by an intron of 65 bp at position -6 upstream from the mature toxin. The protein sequence of this toxin was completely identical with that of a known A-type K+ current bloc...

Weighted A-Statistical Convergence for Sequences of Positive Linear Operators

Directory of Open Access Journals (Sweden)

S. A. Mohiuddine

2014-01-01

Full Text Available We introduce the notion of weighted A-statistical convergence of a sequence, where A represents the nonnegative regular matrix. We also prove the Korovkin approximation theorem by using the notion of weighted A-statistical convergence. Further, we give a rate of weighted A-statistical convergence and apply the classical Bernstein polynomial to construct an illustrative example in support of our result.

Value of a dixon-based MR/PET attenuation correction sequence for the localization and evaluation of PET-positive lesions

International Nuclear Information System (INIS)

Eiber, Matthias; Holzapfel, Konstantin; Rummeny, Ernst J.; Martinez-Moeller, Axel; Souvatzoglou, Michael; Ziegler, Sibylle; Schwaiger, Markus; Nekolla, Stephan G.; Beer, Ambros J.; Pickhard, Anja; Loeffelbein, Dennys; Santi, Ivan

2011-01-01

In this study, the potential contribution of Dixon-based MR imaging with a rapid low-resolution breath-hold sequence, which is a technique used for MR-based attenuation correction (AC) for MR/positron emission tomography (PET), was evaluated for anatomical correlation of PET-positive lesions on a 3T clinical scanner compared to low-dose CT. This technique is also used in a recently installed fully integrated whole-body MR/PET system. Thirty-five patients routinely scheduled for oncological staging underwent 18 F-fluorodeoxyglucose (FDG) PET/CT and a 2-point Dixon 3-D volumetric interpolated breath-hold examination (VIBE) T1-weighted MR sequence on the same day. Two PET data sets reconstructed using attenuation maps from low-dose CT (PET AC C T ) or simulated MR-based segmentation (PET AC M R ) were evaluated for focal PET-positive lesions. The certainty for the correlation with anatomical structures was judged in the low-dose CT and Dixon-based MRI on a 4-point scale (0-3). In addition, the standardized uptake values (SUVs) for PET AC C T and PET AC M R were compared. Statistically, no significant difference could be found concerning anatomical localization for all 81 PET-positive lesions in low-dose CT compared to Dixon-based MR (mean 2.51 ± 0.85 and 2.37 ± 0.87, respectively; p = 0.1909). CT tended to be superior for small lymph nodes, bone metastases and pulmonary nodules, while Dixon-based MR proved advantageous for soft tissue pathologies like head/neck tumours and liver metastases. For the PET AC C T - and PET AC M R -based SUVs (mean 6.36 ± 4.47 and 6.31 ± 4.52, respectively) a nearly complete concordance with a highly significant correlation was found (r = 0.9975, p < 0.0001). Dixon-based MR imaging for MR AC allows for anatomical allocation of PET-positive lesions similar to low-dose CT in conventional PET/CT. Thus, this approach appears to be useful for future MR/PET for body regions not fully covered by diagnostic MRI due to potential time

The detailed characteristics of positive corona current pulses in the line-to-plane electrodes

Science.gov (United States)

Xuebao, LI; Dayong, LI; Qian, ZHANG; Yinfei, LI; Xiang, CUI; Tiebing, LU

2018-05-01

The corona current pulses generated by corona discharge are the sources of the radio interference from transmission lines and the detailed characteristics of the corona current pulses from conductor should be investigated in order to reveal their generation mechanism. In this paper, the line-to-plane electrodes are designed to measure and analyze the characteristics of corona current pulses from positive corona discharges. The influences of inter-electrode gap and line diameters on the detail characteristics of corona current pulses, such as pulse amplitude, rise time, duration time and repetition frequency, are carefully analyzed. The obtained results show that the pulse amplitude and the repetition frequency increase with the diameter of line electrode when the electric fields on the surface of line electrodes are same. With the increase of inter-electrode gap, the pulse amplitude and the repetition frequency first decrease and then turn to be stable, while the rise time first increases and finally turns to be stable. The distributions of electric field and space charges under the line electrodes are calculated, and the influences of inter-electrode gap and line electrode diameter on the experimental results are qualitatively explained.

Proline: the distribution, frequency, positioning, and common functional roles of proline and polyproline sequences in the human proteome.

Directory of Open Access Journals (Sweden)

Alexander A Morgan

Full Text Available Proline is an anomalous amino acid. Its nitrogen atom is covalently locked within a ring, thus it is the only proteinogenic amino acid with a constrained phi angle. Sequences of three consecutive prolines can fold into polyproline helices, structures that join alpha helices and beta pleats as architectural motifs in protein configuration. Triproline helices are participants in protein-protein signaling interactions. Longer spans of repeat prolines also occur, containing as many as 27 consecutive proline residues. Little is known about the frequency, positioning, and functional significance of these proline sequences. Therefore we have undertaken a systematic bioinformatics study of proline residues in proteins. We analyzed the distribution and frequency of 687,434 proline residues among 18,666 human proteins, identifying single residues, dimers, trimers, and longer repeats. Proline accounts for 6.3% of the 10,882,808 protein amino acids. Of all proline residues, 4.4% are in trimers or longer spans. We detected patterns that influence function based on proline location, spacing, and concentration. We propose a classification based on proline-rich, polyproline-rich, and proline-poor status. Whereas singlet proline residues are often found in proteins that display recurring architectural patterns, trimers or longer proline sequences tend be associated with the absence of repetitive structural motifs. Spans of 6 or more are associated with DNA/RNA processing, actin, and developmental processes. We also suggest a role for proline in Kruppel-type zinc finger protein control of DNA expression, and in the nucleation and translocation of actin by the formin complex.

"First generation" automated DNA sequencing technology.

Science.gov (United States)

Slatko, Barton E; Kieleczawa, Jan; Ju, Jingyue; Gardner, Andrew F; Hendrickson, Cynthia L; Ausubel, Frederick M

2011-10-01

Beginning in the 1980s, automation of DNA sequencing has greatly increased throughput, reduced costs, and enabled large projects to be completed more easily. The development of automation technology paralleled the development of other aspects of DNA sequencing: better enzymes and chemistry, separation and imaging technology, sequencing protocols, robotics, and computational advancements (including base-calling algorithms with quality scores, database developments, and sequence analysis programs). Despite the emergence of high-throughput sequencing platforms, automated Sanger sequencing technology remains useful for many applications. This unit provides background and a description of the "First-Generation" automated DNA sequencing technology. It also includes protocols for using the current Applied Biosystems (ABI) automated DNA sequencing machines. © 2011 by John Wiley & Sons, Inc.

An intuitive graphical webserver for multiple-choice protein sequence search.

Science.gov (United States)

Banky, Daniel; Szalkai, Balazs; Grolmusz, Vince

2014-04-10

Every day tens of thousands of sequence searches and sequence alignment queries are submitted to webservers. The capitalized word "BLAST" becomes a verb, describing the act of performing sequence search and alignment. However, if one needs to search for sequences that contain, for example, two hydrophobic and three polar residues at five given positions, the query formation on the most frequently used webservers will be difficult. Some servers support the formation of queries with regular expressions, but most of the users are unfamiliar with their syntax. Here we present an intuitive, easily applicable webserver, the Protein Sequence Analysis server, that allows the formation of multiple choice queries by simply drawing the residues to their positions; if more than one residue are drawn to the same position, then they will be nicely stacked on the user interface, indicating the multiple choice at the given position. This computer-game-like interface is natural and intuitive, and the coloring of the residues makes possible to form queries requiring not just certain amino acids in the given positions, but also small nonpolar, negatively charged, hydrophobic, positively charged, or polar ones. The webserver is available at http://psa.pitgroup.org. Copyright © 2014 Elsevier B.V. All rights reserved.

Management of High-Throughput DNA Sequencing Projects: Alpheus.

Science.gov (United States)

Miller, Neil A; Kingsmore, Stephen F; Farmer, Andrew; Langley, Raymond J; Mudge, Joann; Crow, John A; Gonzalez, Alvaro J; Schilkey, Faye D; Kim, Ryan J; van Velkinburgh, Jennifer; May, Gregory D; Black, C Forrest; Myers, M Kathy; Utsey, John P; Frost, Nicholas S; Sugarbaker, David J; Bueno, Raphael; Gullans, Stephen R; Baxter, Susan M; Day, Steve W; Retzel, Ernest F

2008-12-26

High-throughput DNA sequencing has enabled systems biology to begin to address areas in health, agricultural and basic biological research. Concomitant with the opportunities is an absolute necessity to manage significant volumes of high-dimensional and inter-related data and analysis. Alpheus is an analysis pipeline, database and visualization software for use with massively parallel DNA sequencing technologies that feature multi-gigabase throughput characterized by relatively short reads, such as Illumina-Solexa (sequencing-by-synthesis), Roche-454 (pyrosequencing) and Applied Biosystem's SOLiD (sequencing-by-ligation). Alpheus enables alignment to reference sequence(s), detection of variants and enumeration of sequence abundance, including expression levels in transcriptome sequence. Alpheus is able to detect several types of variants, including non-synonymous and synonymous single nucleotide polymorphisms (SNPs), insertions/deletions (indels), premature stop codons, and splice isoforms. Variant detection is aided by the ability to filter variant calls based on consistency, expected allele frequency, sequence quality, coverage, and variant type in order to minimize false positives while maximizing the identification of true positives. Alpheus also enables comparisons of genes with variants between cases and controls or bulk segregant pools. Sequence-based differential expression comparisons can be developed, with data export to SAS JMP Genomics for statistical analysis.

Genomic sequencing in clinical trials

OpenAIRE

Mestan, Karen K; Ilkhanoff, Leonard; Mouli, Samdeep; Lin, Simon

2011-01-01

Abstract Human genome sequencing is the process by which the exact order of nucleic acid base pairs in the 24 human chromosomes is determined. Since the completion of the Human Genome Project in 2003, genomic sequencing is rapidly becoming a major part of our translational research efforts to understand and improve human health and disease. This article reviews the current and future directions of clinical research with respect to genomic sequencing, a technology that is just beginning to fin...

Dynamics of domain coverage of the protein sequence universe

Science.gov (United States)

2012-01-01

Background The currently known protein sequence space consists of millions of sequences in public databases and is rapidly expanding. Assigning sequences to families leads to a better understanding of protein function and the nature of the protein universe. However, a large portion of the current protein space remains unassigned and is referred to as its “dark matter”. Results Here we suggest that true size of “dark matter” is much larger than stated by current definitions. We propose an approach to reducing the size of “dark matter” by identifying and subtracting regions in protein sequences that are not likely to contain any domain. Conclusions Recent improvements in computational domain modeling result in a decrease, albeit slowly, in the relative size of “dark matter”; however, its absolute size increases substantially with the growth of sequence data. PMID:23157439

Dynamics of domain coverage of the protein sequence universe

Directory of Open Access Journals (Sweden)

Rekapalli Bhanu

2012-11-01

Full Text Available Abstract Background The currently known protein sequence space consists of millions of sequences in public databases and is rapidly expanding. Assigning sequences to families leads to a better understanding of protein function and the nature of the protein universe. However, a large portion of the current protein space remains unassigned and is referred to as its “dark matter”. Results Here we suggest that true size of “dark matter” is much larger than stated by current definitions. We propose an approach to reducing the size of “dark matter” by identifying and subtracting regions in protein sequences that are not likely to contain any domain. Conclusions Recent improvements in computational domain modeling result in a decrease, albeit slowly, in the relative size of “dark matter”; however, its absolute size increases substantially with the growth of sequence data.

Current status of low power/shutdown PSA and accident sequence analysis for loss of RHR during mid-loop operation

International Nuclear Information System (INIS)

Park, Chang Kyu; Choi, Young; Kim, Tae Woon; Jin, Young Ho

1994-07-01

Probabilistic safety assessment (PSA) has been applied to only full-power operation of nuclear power plant (NPP), but some events which were recently occurred could reach severe plant damage state. Thus, various countries around the world have focused their interests on the evaluation for low power/shutdown (LP/S) operation. This report covers the main stream of LP/S PSA methodology, current status of LP/S PSA practices and results, and accident sequence analysis for loss of RHR during mid-loop operation. Therefore this report would be helpful for us to practice LP/S PSA for YGN 5,6 NPP which will be built in the near future. Also the results of accident sequence analysis show that operator's mis-diagnosis and failure of recovery action would initiate core damage during LP/S operation. In summary, overall environmental improvements (equipments, procedures, Tech Spec, etc, ...) and operating support system will be very useful to reduce risk during LP/S operation. (Author) 5 figs., 9 tabs

Dependence of ion beam current on position of mobile plate tuner in multi-frequencies microwaves electron cyclotron resonance ion source

International Nuclear Information System (INIS)

Kurisu, Yosuke; Kiriyama, Ryutaro; Takenaka, Tomoya; Nozaki, Dai; Sato, Fuminobu; Kato, Yushi; Iida, Toshiyuki

2012-01-01

We are constructing a tandem-type electron cyclotron resonance ion source (ECRIS). The first stage of this can supply 2.45 GHz and 11-13 GHz microwaves to plasma chamber individually and simultaneously. We optimize the beam current I FC by the mobile plate tuner. The I FC is affected by the position of the mobile plate tuner in the chamber as like a circular cavity resonator. We aim to clarify the relation between the I FC and the ion saturation current in the ECRIS against the position of the mobile plate tuner. We obtained the result that the variation of the plasma density contributes largely to the variation of the I FC when we change the position of the mobile plate tuner.

Insights into the sequence parameters for halophilic adaptation.

Science.gov (United States)

Nath, Abhigyan

2016-03-01

The sequence parameters for halophilic adaptation are still not fully understood. To understand the molecular basis of protein hypersaline adaptation, a detailed analysis is carried out, and investigated the likely association of protein sequence attributes to halophilic adaptation. A two-stage strategy is implemented, where in the first stage a supervised machine learning classifier is build, giving an overall accuracy of 86 % on stratified tenfold cross validation and 90 % on blind testing set, which are better than the previously reported results. The second stage consists of statistical analysis of sequence features and possible extraction of halophilic molecular signatures. The results of this study showed that, halophilic proteins are characterized by lower average charge, lower K content, and lower S content. A statistically significant preference/avoidance list of sequence parameters is also reported giving insights into the molecular basis of halophilic adaptation. D, Q, E, H, P, T, V are significantly preferred while N, C, I, K, M, F, S are significantly avoided. Among amino acid physicochemical groups, small, polar, charged, acidic and hydrophilic groups are preferred over other groups. The halophilic proteins also showed a preference for higher average flexibility, higher average polarity and avoidance for higher average positive charge, average bulkiness and average hydrophobicity. Some interesting trends observed in dipeptide counts are also reported. Further a systematic statistical comparison is undertaken for gaining insights into the sequence feature distribution in different residue structural states. The current analysis may facilitate the understanding of the mechanism of halophilic adaptation clearer, which can be further used for rational design of halophilic proteins.

Positive integer solutions of certain diophantine equations

Indian Academy of Sciences (India)

BIJAN KUMAR PATEL

2018-03-19

Mar 19, 2018 ... integer solutions. They also found all the positive integer solutions of the given equations in terms of Fibonacci and Lucas numbers. Another interesting number sequence which is closely related to the sequence of. Fibonacci numbers is the sequence of balancing numbers. In 1999, Behera et al. [1] intro-.

Multilocus Sequence Analysis and rpoB Sequencing of Mycobacterium abscessus (Sensu Lato) Strains▿

Science.gov (United States)

Macheras, Edouard; Roux, Anne-Laure; Bastian, Sylvaine; Leão, Sylvia Cardoso; Palaci, Moises; Sivadon-Tardy, Valérie; Gutierrez, Cristina; Richter, Elvira; Rüsch-Gerdes, Sabine; Pfyffer, Gaby; Bodmer, Thomas; Cambau, Emmanuelle; Gaillard, Jean-Louis; Heym, Beate

2011-01-01

Mycobacterium abscessus, Mycobacterium bolletii, and Mycobacterium massiliense (Mycobacterium abscessus sensu lato) are closely related species that currently are identified by the sequencing of the rpoB gene. However, recent studies show that rpoB sequencing alone is insufficient to discriminate between these species, and some authors have questioned their current taxonomic classification. We studied here a large collection of M. abscessus (sensu lato) strains by partial rpoB sequencing (752 bp) and multilocus sequence analysis (MLSA). The final MLSA scheme developed was based on the partial sequences of eight housekeeping genes: argH, cya, glpK, gnd, murC, pgm, pta, and purH. The strains studied included the three type strains (M. abscessus CIP 104536T, M. massiliense CIP 108297T, and M. bolletii CIP 108541T) and 120 isolates recovered between 1997 and 2007 in France, Germany, Switzerland, and Brazil. The rpoB phylogenetic tree confirmed the existence of three main clusters, each comprising the type strain of one species. However, divergence values between the M. massiliense and M. bolletii clusters all were below 3% and between the M. abscessus and M. massiliense clusters were from 2.66 to 3.59%. The tree produced using the concatenated MLSA gene sequences (4,071 bp) also showed three main clusters, each comprising the type strain of one species. The M. abscessus cluster had a bootstrap value of 100% and was mostly compact. Bootstrap values for the M. massiliense and M. bolletii branches were much lower (71 and 61%, respectively), with the M. massiliense cluster having a fuzzy aspect. Mean (range) divergence values were 2.17% (1.13 to 2.58%) between the M. abscessus and M. massiliense clusters, 2.37% (1.5 to 2.85%) between the M. abscessus and M. bolletii clusters, and 2.28% (0.86 to 2.68%) between the M. massiliense and M. bolletii clusters. Adding the rpoB sequence to the MLSA-concatenated sequence (total sequence, 4,823 bp) had little effect on the clustering

Multilocus sequence analysis and rpoB sequencing of Mycobacterium abscessus (sensu lato) strains.

Science.gov (United States)

Macheras, Edouard; Roux, Anne-Laure; Bastian, Sylvaine; Leão, Sylvia Cardoso; Palaci, Moises; Sivadon-Tardy, Valérie; Gutierrez, Cristina; Richter, Elvira; Rüsch-Gerdes, Sabine; Pfyffer, Gaby; Bodmer, Thomas; Cambau, Emmanuelle; Gaillard, Jean-Louis; Heym, Beate

2011-02-01

Mycobacterium abscessus, Mycobacterium bolletii, and Mycobacterium massiliense (Mycobacterium abscessus sensu lato) are closely related species that currently are identified by the sequencing of the rpoB gene. However, recent studies show that rpoB sequencing alone is insufficient to discriminate between these species, and some authors have questioned their current taxonomic classification. We studied here a large collection of M. abscessus (sensu lato) strains by partial rpoB sequencing (752 bp) and multilocus sequence analysis (MLSA). The final MLSA scheme developed was based on the partial sequences of eight housekeeping genes: argH, cya, glpK, gnd, murC, pgm, pta, and purH. The strains studied included the three type strains (M. abscessus CIP 104536(T), M. massiliense CIP 108297(T), and M. bolletii CIP 108541(T)) and 120 isolates recovered between 1997 and 2007 in France, Germany, Switzerland, and Brazil. The rpoB phylogenetic tree confirmed the existence of three main clusters, each comprising the type strain of one species. However, divergence values between the M. massiliense and M. bolletii clusters all were below 3% and between the M. abscessus and M. massiliense clusters were from 2.66 to 3.59%. The tree produced using the concatenated MLSA gene sequences (4,071 bp) also showed three main clusters, each comprising the type strain of one species. The M. abscessus cluster had a bootstrap value of 100% and was mostly compact. Bootstrap values for the M. massiliense and M. bolletii branches were much lower (71 and 61%, respectively), with the M. massiliense cluster having a fuzzy aspect. Mean (range) divergence values were 2.17% (1.13 to 2.58%) between the M. abscessus and M. massiliense clusters, 2.37% (1.5 to 2.85%) between the M. abscessus and M. bolletii clusters, and 2.28% (0.86 to 2.68%) between the M. massiliense and M. bolletii clusters. Adding the rpoB sequence to the MLSA-concatenated sequence (total sequence, 4,823 bp) had little effect on the

Inferring Variation in Copy Number Using High Throughput Sequencing Data in R.

Science.gov (United States)

Knaus, Brian J; Grünwald, Niklaus J

2018-01-01

Inference of copy number variation presents a technical challenge because variant callers typically require the copy number of a genome or genomic region to be known a priori . Here we present a method to infer copy number that uses variant call format (VCF) data as input and is implemented in the R package vcfR . This method is based on the relative frequency of each allele (in both genic and non-genic regions) sequenced at heterozygous positions throughout a genome. These heterozygous positions are summarized by using arbitrarily sized windows of heterozygous positions, binning the allele frequencies, and selecting the bin with the greatest abundance of positions. This provides a non-parametric summary of the frequency that alleles were sequenced at. The method is applicable to organisms that have reference genomes that consist of full chromosomes or sub-chromosomal contigs. In contrast to other software designed to detect copy number variation, our method does not rely on an assumption of base ploidy, but instead infers it. We validated these approaches with the model system of Saccharomyces cerevisiae and applied it to the oomycete Phytophthora infestans , both known to vary in copy number. This functionality has been incorporated into the current release of the R package vcfR to provide modular and flexible methods to investigate copy number variation in genomic projects.

Draft genome sequence of Therminicola potens strain JR

Energy Technology Data Exchange (ETDEWEB)

Byrne-Bailey, K.G.; Wrighton, K.C.; Melnyk, R.A.; Agbo, P.; Hazen, T.C.; Coates, J.D.

2010-07-01

'Thermincola potens' strain JR is one of the first Gram-positive dissimilatory metal-reducing bacteria (DMRB) for which there is a complete genome sequence. Consistent with the physiology of this organism, preliminary annotation revealed an abundance of multiheme c-type cytochromes that are putatively associated with the periplasm and cell surface in a Gram-positive bacterium. Here we report the complete genome sequence of strain JR.

HLA typing: Conventional techniques v.next-generation sequencing

African Journals Online (AJOL)

The existing techniques have contributed significantly to our current knowledge of allelic diversity. At present, sequence-based typing (SBT) methods, in particular next-generation sequencing. (NGS), provide the highest possible resolution. NGS platforms were initially only used for genomic sequencing, but also showed.

Next-generation sequencing

DEFF Research Database (Denmark)

Rieneck, Klaus; Bak, Mads; Jønson, Lars

2013-01-01

, Illumina); several millions of PCR sequences were analyzed. RESULTS: The results demonstrated the feasibility of diagnosing the fetal KEL1 or KEL2 blood group from cell-free DNA purified from maternal plasma. CONCLUSION: This method requires only one primer pair, and the large amount of sequence...... information obtained allows well for statistical analysis of the data. This general approach can be integrated into current laboratory practice and has numerous applications. Besides DNA-based predictions of blood group phenotypes, platelet phenotypes, or sickle cell anemia, and the determination of zygosity...

Beyond DNA Sequencing in Space: Current and Future Omics Capabilities of the Biomolecule Sequencer Payload

Science.gov (United States)

Wallace, Sarah

2017-01-01

Why do we need a DNA sequencer to support the human exploration of space? (A) Operational environmental monitoring; (1) Identification of contaminating microbes, (2) Infectious disease diagnosis, (3) Reduce down mass (sample return for environmental monitoring, crew health, etc.). (B) Research; (1) Human, (2) Animal, (3) Microbes/Cell lines, (4) Plant. (C) Med Ops; (1) Response to countermeasures, (2) Radiation, (3) Real-time analysis can influence medical intervention. (C) Support astrobiology science investigations; (1) Technology superiorly suited to in situ nucleic acid-based life detection, (2) Functional testing for integration into robotics for extraplanetary exploration mission.

Sequence walkers: a graphical method to display how binding proteins interact with DNA or RNA sequences | Center for Cancer Research

Science.gov (United States)

A graphical method is presented for displaying how binding proteins and other macromolecules interact with individual bases of nucleotide sequences. Characters representing the sequence are either oriented normally and placed above a line indicating favorable contact, or upside-down and placed below the line indicating unfavorable contact. The positive or negative height of each letter shows the contribution of that base to the average sequence conservation of the binding site, as represented by a sequence logo.

How Many Protein Sequences Fold to a Given Structure? A Coevolutionary Analysis.

Science.gov (United States)

Tian, Pengfei; Best, Robert B

2017-10-17

Quantifying the relationship between protein sequence and structure is key to understanding the protein universe. A fundamental measure of this relationship is the total number of amino acid sequences that can fold to a target protein structure, known as the "sequence capacity," which has been suggested as a proxy for how designable a given protein fold is. Although sequence capacity has been extensively studied using lattice models and theory, numerical estimates for real protein structures are currently lacking. In this work, we have quantitatively estimated the sequence capacity of 10 proteins with a variety of different structures using a statistical model based on residue-residue co-evolution to capture the variation of sequences from the same protein family. Remarkably, we find that even for the smallest protein folds, such as the WW domain, the number of foldable sequences is extremely large, exceeding the Avogadro constant. In agreement with earlier theoretical work, the calculated sequence capacity is positively correlated with the size of the protein, or better, the density of contacts. This allows the absolute sequence capacity of a given protein to be approximately predicted from its structure. On the other hand, the relative sequence capacity, i.e., normalized by the total number of possible sequences, is an extremely tiny number and is strongly anti-correlated with the protein length. Thus, although there may be more foldable sequences for larger proteins, it will be much harder to find them. Lastly, we have correlated the evolutionary age of proteins in the CATH database with their sequence capacity as predicted by our model. The results suggest a trade-off between the opposing requirements of high designability and the likelihood of a novel fold emerging by chance. Published by Elsevier Inc.

How psychological and behavioral team states change during positive and negative momentum.

Science.gov (United States)

Den Hartigh, Ruud J R; Gernigon, Christophe; Van Yperen, Nico W; Marin, Ludovic; Van Geert, Paul L C

2014-01-01

In business and sports, teams often experience periods of positive and negative momentum while pursuing their goals. However, researchers have not yet been able to provide insights into how psychological and behavioral states actually change during positive and negative team momentum. In the current study we aimed to provide these insights by introducing an experimental dynamical research design. Rowing pairs had to compete against a virtual opponent on rowing ergometers, while a screen in front of the team broadcasted the ongoing race. The race was manipulated so that the team's rowing avatar gradually progressed (positive momentum) or regressed (negative momentum) in relation to the victory. The participants responded verbally to collective efficacy and task cohesion items appearing on the screen each minute. In addition, effort exertion and interpersonal coordination were continuously measured. Our results showed negative psychological changes (perceptions of collective efficacy and task cohesion) during negative team momentum, which were stronger than the positive changes during positive team momentum. Moreover, teams' exerted efforts rapidly decreased during negative momentum, whereas positive momentum accompanied a more variable and adaptive sequence of effort exertion. Finally, the interpersonal coordination was worse during negative momentum than during positive momentum. These results provide the first empirical insights into actual team momentum dynamics, and demonstrate how a dynamical research approach significantly contributes to current knowledge on psychological and behavioral processes.

Optimization of sequence alignment for simple sequence repeat regions

Directory of Open Access Journals (Sweden)

Ogbonnaya Francis C

2011-07-01

Full Text Available Abstract Background Microsatellites, or simple sequence repeats (SSRs, are tandemly repeated DNA sequences, including tandem copies of specific sequences no longer than six bases, that are distributed in the genome. SSR has been used as a molecular marker because it is easy to detect and is used in a range of applications, including genetic diversity, genome mapping, and marker assisted selection. It is also very mutable because of slipping in the DNA polymerase during DNA replication. This unique mutation increases the insertion/deletion (INDELs mutation frequency to a high ratio - more than other types of molecular markers such as single nucleotide polymorphism (SNPs. SNPs are more frequent than INDELs. Therefore, all designed algorithms for sequence alignment fit the vast majority of the genomic sequence without considering microsatellite regions, as unique sequences that require special consideration. The old algorithm is limited in its application because there are many overlaps between different repeat units which result in false evolutionary relationships. Findings To overcome the limitation of the aligning algorithm when dealing with SSR loci, a new algorithm was developed using PERL script with a Tk graphical interface. This program is based on aligning sequences after determining the repeated units first, and the last SSR nucleotides positions. This results in a shifting process according to the inserted repeated unit type. When studying the phylogenic relations before and after applying the new algorithm, many differences in the trees were obtained by increasing the SSR length and complexity. However, less distance between different linage had been observed after applying the new algorithm. Conclusions The new algorithm produces better estimates for aligning SSR loci because it reflects more reliable evolutionary relations between different linages. It reduces overlapping during SSR alignment, which results in a more realistic

Quantitative phenotyping via deep barcode sequencing.

Science.gov (United States)

Smith, Andrew M; Heisler, Lawrence E; Mellor, Joseph; Kaper, Fiona; Thompson, Michael J; Chee, Mark; Roth, Frederick P; Giaever, Guri; Nislow, Corey

2009-10-01

Next-generation DNA sequencing technologies have revolutionized diverse genomics applications, including de novo genome sequencing, SNP detection, chromatin immunoprecipitation, and transcriptome analysis. Here we apply deep sequencing to genome-scale fitness profiling to evaluate yeast strain collections in parallel. This method, Barcode analysis by Sequencing, or "Bar-seq," outperforms the current benchmark barcode microarray assay in terms of both dynamic range and throughput. When applied to a complex chemogenomic assay, Bar-seq quantitatively identifies drug targets, with performance superior to the benchmark microarray assay. We also show that Bar-seq is well-suited for a multiplex format. We completely re-sequenced and re-annotated the yeast deletion collection using deep sequencing, found that approximately 20% of the barcodes and common priming sequences varied from expectation, and used this revised list of barcode sequences to improve data quality. Together, this new assay and analysis routine provide a deep-sequencing-based toolkit for identifying gene-environment interactions on a genome-wide scale.

Evaluation of exome variants using the Ion Proton Platform to sequence error-prone regions.

Science.gov (United States)

Seo, Heewon; Park, Yoomi; Min, Byung Joo; Seo, Myung Eui; Kim, Ju Han

2017-01-01

The Ion Proton sequencer from Thermo Fisher accurately determines sequence variants from target regions with a rapid turnaround time at a low cost. However, misleading variant-calling errors can occur. We performed a systematic evaluation and manual curation of read-level alignments for the 675 ultrarare variants reported by the Ion Proton sequencer from 27 whole-exome sequencing data but that are not present in either the 1000 Genomes Project and the Exome Aggregation Consortium. We classified positive variant calls into 393 highly likely false positives, 126 likely false positives, and 156 likely true positives, which comprised 58.2%, 18.7%, and 23.1% of the variants, respectively. We identified four distinct error patterns of variant calling that may be bioinformatically corrected when using different strategies: simplicity region, SNV cluster, peripheral sequence read, and base inversion. Local de novo assembly successfully corrected 201 (38.7%) of the 519 highly likely or likely false positives. We also demonstrate that the two sequencing kits from Thermo Fisher (the Ion PI Sequencing 200 kit V3 and the Ion PI Hi-Q kit) exhibit different error profiles across different error types. A refined calling algorithm with better polymerase may improve the performance of the Ion Proton sequencing platform.

Evaluation of exome variants using the Ion Proton Platform to sequence error-prone regions.

Directory of Open Access Journals (Sweden)

Heewon Seo

Full Text Available The Ion Proton sequencer from Thermo Fisher accurately determines sequence variants from target regions with a rapid turnaround time at a low cost. However, misleading variant-calling errors can occur. We performed a systematic evaluation and manual curation of read-level alignments for the 675 ultrarare variants reported by the Ion Proton sequencer from 27 whole-exome sequencing data but that are not present in either the 1000 Genomes Project and the Exome Aggregation Consortium. We classified positive variant calls into 393 highly likely false positives, 126 likely false positives, and 156 likely true positives, which comprised 58.2%, 18.7%, and 23.1% of the variants, respectively. We identified four distinct error patterns of variant calling that may be bioinformatically corrected when using different strategies: simplicity region, SNV cluster, peripheral sequence read, and base inversion. Local de novo assembly successfully corrected 201 (38.7% of the 519 highly likely or likely false positives. We also demonstrate that the two sequencing kits from Thermo Fisher (the Ion PI Sequencing 200 kit V3 and the Ion PI Hi-Q kit exhibit different error profiles across different error types. A refined calling algorithm with better polymerase may improve the performance of the Ion Proton sequencing platform.

Transforming clinical microbiology with bacterial genome sequencing.

Science.gov (United States)

Didelot, Xavier; Bowden, Rory; Wilson, Daniel J; Peto, Tim E A; Crook, Derrick W

2012-09-01

Whole-genome sequencing of bacteria has recently emerged as a cost-effective and convenient approach for addressing many microbiological questions. Here, we review the current status of clinical microbiology and how it has already begun to be transformed by using next-generation sequencing. We focus on three essential tasks: identifying the species of an isolate, testing its properties, such as resistance to antibiotics and virulence, and monitoring the emergence and spread of bacterial pathogens. We predict that the application of next-generation sequencing will soon be sufficiently fast, accurate and cheap to be used in routine clinical microbiology practice, where it could replace many complex current techniques with a single, more efficient workflow.

PIMS sequencing extension: a laboratory information management system for DNA sequencing facilities

Directory of Open Access Journals (Sweden)

Baldwin Stephen A

2011-03-01

Full Text Available Abstract Background Facilities that provide a service for DNA sequencing typically support large numbers of users and experiment types. The cost of services is often reduced by the use of liquid handling robots but the efficiency of such facilities is hampered because the software for such robots does not usually integrate well with the systems that run the sequencing machines. Accordingly, there is a need for software systems capable of integrating different robotic systems and managing sample information for DNA sequencing services. In this paper, we describe an extension to the Protein Information Management System (PIMS that is designed for DNA sequencing facilities. The new version of PIMS has a user-friendly web interface and integrates all aspects of the sequencing process, including sample submission, handling and tracking, together with capture and management of the data. Results The PIMS sequencing extension has been in production since July 2009 at the University of Leeds DNA Sequencing Facility. It has completely replaced manual data handling and simplified the tasks of data management and user communication. Samples from 45 groups have been processed with an average throughput of 10000 samples per month. The current version of the PIMS sequencing extension works with Applied Biosystems 3130XL 96-well plate sequencer and MWG 4204 or Aviso Theonyx liquid handling robots, but is readily adaptable for use with other combinations of robots. Conclusions PIMS has been extended to provide a user-friendly and integrated data management solution for DNA sequencing facilities that is accessed through a normal web browser and allows simultaneous access by multiple users as well as facility managers. The system integrates sequencing and liquid handling robots, manages the data flow, and provides remote access to the sequencing results. The software is freely available, for academic users, from http://www.pims-lims.org/.

PIMS sequencing extension: a laboratory information management system for DNA sequencing facilities.

Science.gov (United States)

Troshin, Peter V; Postis, Vincent Lg; Ashworth, Denise; Baldwin, Stephen A; McPherson, Michael J; Barton, Geoffrey J

2011-03-07

Facilities that provide a service for DNA sequencing typically support large numbers of users and experiment types. The cost of services is often reduced by the use of liquid handling robots but the efficiency of such facilities is hampered because the software for such robots does not usually integrate well with the systems that run the sequencing machines. Accordingly, there is a need for software systems capable of integrating different robotic systems and managing sample information for DNA sequencing services. In this paper, we describe an extension to the Protein Information Management System (PIMS) that is designed for DNA sequencing facilities. The new version of PIMS has a user-friendly web interface and integrates all aspects of the sequencing process, including sample submission, handling and tracking, together with capture and management of the data. The PIMS sequencing extension has been in production since July 2009 at the University of Leeds DNA Sequencing Facility. It has completely replaced manual data handling and simplified the tasks of data management and user communication. Samples from 45 groups have been processed with an average throughput of 10000 samples per month. The current version of the PIMS sequencing extension works with Applied Biosystems 3130XL 96-well plate sequencer and MWG 4204 or Aviso Theonyx liquid handling robots, but is readily adaptable for use with other combinations of robots. PIMS has been extended to provide a user-friendly and integrated data management solution for DNA sequencing facilities that is accessed through a normal web browser and allows simultaneous access by multiple users as well as facility managers. The system integrates sequencing and liquid handling robots, manages the data flow, and provides remote access to the sequencing results. The software is freely available, for academic users, from http://www.pims-lims.org/.

Winnowing DNA for rare sequences: highly specific sequence and methylation based enrichment.

Directory of Open Access Journals (Sweden)

Jason D Thompson

Full Text Available Rare mutations in cell populations are known to be hallmarks of many diseases and cancers. Similarly, differential DNA methylation patterns arise in rare cell populations with diagnostic potential such as fetal cells circulating in maternal blood. Unfortunately, the frequency of alleles with diagnostic potential, relative to wild-type background sequence, is often well below the frequency of errors in currently available methods for sequence analysis, including very high throughput DNA sequencing. We demonstrate a DNA preparation and purification method that through non-linear electrophoretic separation in media containing oligonucleotide probes, achieves 10,000 fold enrichment of target DNA with single nucleotide specificity, and 100 fold enrichment of unmodified methylated DNA differing from the background by the methylation of a single cytosine residue.

Winnowing DNA for rare sequences: highly specific sequence and methylation based enrichment.

Science.gov (United States)

Thompson, Jason D; Shibahara, Gosuke; Rajan, Sweta; Pel, Joel; Marziali, Andre

2012-01-01

Rare mutations in cell populations are known to be hallmarks of many diseases and cancers. Similarly, differential DNA methylation patterns arise in rare cell populations with diagnostic potential such as fetal cells circulating in maternal blood. Unfortunately, the frequency of alleles with diagnostic potential, relative to wild-type background sequence, is often well below the frequency of errors in currently available methods for sequence analysis, including very high throughput DNA sequencing. We demonstrate a DNA preparation and purification method that through non-linear electrophoretic separation in media containing oligonucleotide probes, achieves 10,000 fold enrichment of target DNA with single nucleotide specificity, and 100 fold enrichment of unmodified methylated DNA differing from the background by the methylation of a single cytosine residue.

Third-Generation Sequencing and Analysis of Four Complete Pig Liver Esterase Gene Sequences in Clones Identified by Screening BAC Library.

Science.gov (United States)

Zhou, Qiongqiong; Sun, Wenjuan; Liu, Xiyan; Wang, Xiliang; Xiao, Yuncai; Bi, Dingren; Yin, Jingdong; Shi, Deshi

2016-01-01

Pig liver carboxylesterase (PLE) gene sequences in GenBank are incomplete, which has led to difficulties in studying the genetic structure and regulation mechanisms of gene expression of PLE family genes. The aim of this study was to obtain and analysis of complete gene sequences of PLE family by screening from a Rongchang pig BAC library and third-generation PacBio gene sequencing. After a number of existing incomplete PLE isoform gene sequences were analysed, primers were designed based on conserved regions in PLE exons, and the whole pig genome used as a template for Polymerase chain reaction (PCR) amplification. Specific primers were then selected based on the PCR amplification results. A three-step PCR screening method was used to identify PLE-positive clones by screening a Rongchang pig BAC library and PacBio third-generation sequencing was performed. BLAST comparisons and other bioinformatics methods were applied for sequence analysis. Five PLE-positive BAC clones, designated BAC-10, BAC-70, BAC-75, BAC-119 and BAC-206, were identified. Sequence analysis yielded the complete sequences of four PLE genes, PLE1, PLE-B9, PLE-C4, and PLE-G2. Complete PLE gene sequences were defined as those containing regulatory sequences, exons, and introns. It was found that, not only did the PLE exon sequences of the four genes show a high degree of homology, but also that the intron sequences were highly similar. Additionally, the regulatory region of the genes contained two 720bps reverse complement sequences that may have an important function in the regulation of PLE gene expression. This is the first report to confirm the complete sequences of four PLE genes. In addition, the study demonstrates that each PLE isoform is encoded by a single gene and that the various genes exhibit a high degree of sequence homology, suggesting that the PLE family evolved from a single ancestral gene. Obtaining the complete sequences of these PLE genes provides the necessary foundation for

Bioengineering of Tobacco Mosaic Virus to Create a Non-Infectious Positive Control for Ebola Diagnostic Assays

Science.gov (United States)

Lam, Patricia; Gulati, Neetu M.; Stewart, Phoebe L.; Keri, Ruth A.; Steinmetz, Nicole F.

2016-03-01

The 2014 Ebola epidemic is the largest to date. There is no cure or treatment for this deadly disease; therefore there is an urgent need to develop new diagnostics to accurately detect Ebola. Current RT-PCR assays lack sensitive and reliable positive controls. To address this critical need, we devised a bio-inspired positive control for use in RT-PCR diagnostics: we encapsulated scrambled Ebola RNA sequences inside of tobacco mosaic virus to create a biomimicry that is non-infectious, but stable, and could therefore serve as a positive control in Ebola diagnostic assays. Here, we report the bioengineering and validation of this probe.

Development of a Nomogram Model Predicting Current Bone Scan Positivity in Patients Treated with Androgen-Deprivation Therapy for Prostate Cancer

Science.gov (United States)

Gotto, Geoffrey T.; Yu, Changhong; Bernstein, Melanie; Eastham, James A.; Kattan, Michael W.

2014-01-01

Purpose: To develop a nomogram predictive of current bone scan positivity in patients receiving androgen-deprivation therapy (ADT) for advanced prostate cancer; to augment clinical judgment and highlight patients in need of additional imaging investigations. Materials and methods: A retrospective chart review of bone scan records (conventional 99mTc-scintigraphy) of 1,293 patients who received ADT at the Memorial Sloan-Kettering Cancer Center from 2000 to 2011. Multivariable logistic regression analysis was used to identify variables suitable for inclusion in the nomogram. The probability of current bone scan positivity was determined using these variables and the predictive accuracy of the nomogram was quantified by concordance index. Results: In total, 2,681 bone scan records were analyzed and 636 patients had a positive result. Overall, the median pre-scan prostate-specific antigen (PSA) level was 2.4 ng/ml; median PSA doubling time (PSADT) was 5.8 months. At the time of a positive scan, median PSA level was 8.2 ng/ml; 53% of patients had PSA <10 ng/ml; median PSADT was 4.0 months. Five variables were included in the nomogram: number of previous negative bone scans after initiating ADT, PSA level, Gleason grade sum, and history of radical prostatectomy and radiotherapy. A concordance index value of 0.721 was calculated for the nomogram. This was a retrospective study based on limited data in patients treated in a large cancer center who underwent conventional 99mTc bone scans, which themselves have inherent limitations. Conclusion: This is the first nomogram to predict current bone scan positivity in ADT-treated prostate cancer patients, providing high predictive accuracy. PMID:25386410

Development of a nomogram model predicting current bone scan positivity in patients treated with androgen-deprivation therapy for prostate cancer

Directory of Open Access Journals (Sweden)

Michael eKattan

2014-10-01

Full Text Available Purpose: To develop a nomogram predictive of current bone scan positivity in patients receiving androgen-deprivation therapy (ADT for advanced prostate cancer; to augment clinical judgment and highlight patients in need of additional imaging investigations.Materials and Methods: A retrospective chart review of bone scan records (conventional 99mTc-scintigraphy of 1,293 patients who received ADT at the Memorial Sloan-Kettering Cancer Center from 2000 to 2011. Multivariable logistic regression analysis was used to identify variables suitable for inclusion in the nomogram. The probability of current bone scan positivity was determined using these variables and the predictive accuracy of the nomogram was quantified by concordance index.Results: In total, 2,681 bone scan records were analyzed and 636 patients had a positive result. Overall, the median pre-scan prostate-specific antigen (PSA level was 2.4 ng/ml; median PSA doubling time (PSADT was 5.8 months. At the time of a positive scan, median PSA level was 8.2 ng/ml; 53% of patients had PSA <10 ng/ml; median PSADT was 4.0 months. Five variables were included in the nomogram: number of previous negative bone scans after initiating ADT, PSA level, Gleason grade sum, and history of radical prostatectomy and radiotherapy. A concordance index value of 0.721 was calculated for the nomogram. This was a retrospective study based on limited data in patients treated in a large cancer centre who underwent conventional 99mTc bone scans, which themselves have inherent limitations. Conclusions: This is the first nomogram to predict current bone scan positivity in ADT-treated prostate cancer patients, providing high predictive accuracy.

Complete sequencing of the bla(NDM-1)-positive IncA/C plasmid from Escherichia coli ST38 isolate suggests a possible origin from plant pathogens.

Science.gov (United States)

Sekizuka, Tsuyoshi; Matsui, Mari; Yamane, Kunikazu; Takeuchi, Fumihiko; Ohnishi, Makoto; Hishinuma, Akira; Arakawa, Yoshichika; Kuroda, Makoto

2011-01-01

The complete sequence of the plasmid pNDM-1_Dok01 carrying New Delhi metallo-β-lactamase (NDM-1) was determined by whole genome shotgun sequencing using Escherichia coli strain NDM-1_Dok01 (multilocus sequence typing type: ST38) and the transconjugant E. coli DH10B. The plasmid is an IncA/C incompatibility type composed of 225 predicted coding sequences in 195.5 kb and partially shares a sequence with bla(CMY-2)-positive IncA/C plasmids such as E. coli AR060302 pAR060302 (166.5 kb) and Salmonella enterica serovar Newport pSN254 (176.4 kb). The bla(NDM-1) gene in pNDM-1_Dok01 is terminally flanked by two IS903 elements that are distinct from those of the other characterized NDM-1 plasmids, suggesting that the bla(NDM-1) gene has been broadly transposed, together with various mobile elements, as a cassette gene. The chaperonin groES and groEL genes were identified in the bla(NDM-1)-related composite transposon, and phylogenetic analysis and guanine-cytosine content (GC) percentage showed similarities to the homologs of plant pathogens such as Pseudoxanthomonas and Xanthomonas spp., implying that plant pathogens are the potential source of the bla(NDM-1) gene. The complete sequence of pNDM-1_Dok01 suggests that the bla(NDM-1) gene was acquired by a novel composite transposon on an extensively disseminated IncA/C plasmid and transferred to the E. coli ST38 isolate.

Molecular design of sequence specific DNA alkylating agents.

Science.gov (United States)

Minoshima, Masafumi; Bando, Toshikazu; Shinohara, Ken-ichi; Sugiyama, Hiroshi

2009-01-01

Sequence-specific DNA alkylating agents have great interest for novel approach to cancer chemotherapy. We designed the conjugates between pyrrole (Py)-imidazole (Im) polyamides and DNA alkylating chlorambucil moiety possessing at different positions. The sequence-specific DNA alkylation by conjugates was investigated by using high-resolution denaturing polyacrylamide gel electrophoresis (PAGE). The results showed that polyamide chlorambucil conjugates alkylate DNA at flanking adenines in recognition sequences of Py-Im polyamides, however, the reactivities and alkylation sites were influenced by the positions of conjugation. In addition, we synthesized conjugate between Py-Im polyamide and another alkylating agent, 1-(chloromethyl)-5-hydroxy-1,2-dihydro-3H-benz[e]indole (seco-CBI). DNA alkylation reactivies by both alkylating polyamides were almost comparable. In contrast, cytotoxicities against cell lines differed greatly. These comparative studies would promote development of appropriate sequence-specific DNA alkylating polyamides against specific cancer cells.

Overlapping positive and negative regulatory domains of the human β-interferon gene

International Nuclear Information System (INIS)

Goodbourn, S.; Maniatis, T.

1988-01-01

Virus of poly(I) x poly(C) induction of human β-interferon gene expression requires a 40-base-pair DNA sequence designated the interferon gene regulatory element (IRE). Previous studies have shown that the IRE contains both positive and negative regulatory DNA sequences. To localize these sequences and study their interactions, the authors have examined the effects of a large number of single-base mutations within the IRE on β-interferon gene regulation. They find that the IRE consists of two genetically separable positive regulatory domains and an overlapping negative control sequence. They propose that the β-interferon gene is switched off in uninduced cells by a repressor that blocks the interaction between one of the two positive regulatory sequences and a specific transcription factor. Induction would then lead to inactivation or displacement of the repressor and binding of transcription factors to both positive regulatory domains

Identification and characterization of the multidrug resistance gene cfr in a Panton-Valentine leukocidin-positive sequence type 8 methicillin-resistant Staphylococcus aureus IVa (USA300) isolate.

LENUS (Irish Health Repository)

Shore, Anna C

2010-12-01

The staphylococcal cfr gene mediates resistance to phenicols, lincosamides, oxazolidinones, pleuromutilins, and streptogramin A, a phenotype that has been termed PhLOPS(A). The cfr gene has mainly been associated with coagulase-negative staphylococcal isolates from animals, and only a few cfr-positive methicillin-resistant Staphylococcus aureus (MRSA) isolates have been described so far. This study reports the first description of a cfr-positive MRSA isolate (M05\\/0060) belonging to the pandemic Panton-Valentine leukocidin (PVL)-positive sequence type 8 MRSA IVa\\/USA300 (ST8-MRSA-IVa\\/USA300) clone. The cfr gene was detected in M05\\/0060 using a DNA microarray which was used to screen PVL-positive MRSA isolates for the presence of virulence genes, typing markers, and antimicrobial resistance genes. Antimicrobial susceptibility testing revealed that M05\\/0060 exhibited the cfr-associated resistance phenotype. Molecular analysis identified the presence of cfr and a second phenicol resistance gene, fexA, on a novel 45-kb conjugative plasmid, which was designated pSCFS7. Within pSCFS7, a DNA segment consisting of cfr, a truncated copy of insertion sequence IS21-558, and a region with homology to the DNA invertase gene bin3 of transposon Tn552 from Bacillus mycoides was integrated into the transposase gene tnpB of the fexA-carrying transposon Tn558. The emergence of a multidrug-resistant cfr-positive variant of ST8-MRSA-IVa\\/USA300 is alarming and requires ongoing surveillance. Moreover, the identification of a novel conjugative plasmid carrying the cfr gene indicates the ability of cfr to spread to other MRSA strains.

Successful treatment of multifocal pedal infection in a feline immunodeficiency virus-positive cat with multiple Bowenoid in situ carcinomas containing papillomaviral DNA sequences

OpenAIRE

Allan E Kessell; Derek McNair; John S Munday; Richard Savory; Catriona Halliday; Richard Malik

2017-01-01

Case summary A 16-year-old, castrated male, feline immunodeficiency virus (FIV)-positive, domestic shorthair cat developed multiple skin lesions. Most of these were Bowenoid carcinoma in situ and contained DNA sequences consistent with Felis catus papillomavirus type 2. Two additional lesions that developed in the skin and subcutaneous tissues between the digital and carpal pads on the left forelimb and right hindlimb were shown by cytology, histology and culture to be caused by Prototheca wi...

[Whole Genome Sequencing of Human mtDNA Based on Ion Torrent PGM™ Platform].

Science.gov (United States)

Cao, Y; Zou, K N; Huang, J P; Ma, K; Ping, Y

2017-08-01

To analyze and detect the whole genome sequence of human mitochondrial DNA （mtDNA） by Ion Torrent PGM™ platform and to study the differences of mtDNA sequence in different tissues. Samples were collected from 6 unrelated individuals by forensic postmortem examination, including chest blood, hair, costicartilage, nail, skeletal muscle and oral epithelium. Amplification of whole genome sequence of mtDNA was performed by 4 pairs of primer. Libraries were constructed with Ion Shear™ Plus Reagents kit and Ion Plus Fragment Library kit. Whole genome sequencing of mtDNA was performed using Ion Torrent PGM™ platform. Sanger sequencing was used to determine the heteroplasmy positions and the mutation positions on HVⅠ region. The whole genome sequence of mtDNA from all samples were amplified successfully. Six unrelated individuals belonged to 6 different haplotypes. Different tissues in one individual had heteroplasmy difference. The heteroplasmy positions and the mutation positions on HVⅠ region were verified by Sanger sequencing. After a consistency check by the Kappa method, it was found that the results of mtDNA sequence had a high consistency in different tissues. The testing method used in present study for sequencing the whole genome sequence of human mtDNA can detect the heteroplasmy difference in different tissues, which have good consistency. The results provide guidance for the further applications of mtDNA in forensic science. Copyright© by the Editorial Department of Journal of Forensic Medicine

Prediction of nucleosome positioning based on transcription factor binding sites.

Directory of Open Access Journals (Sweden)

Xianfu Yi

Full Text Available BACKGROUND: The DNA of all eukaryotic organisms is packaged into nucleosomes, the basic repeating units of chromatin. The nucleosome consists of a histone octamer around which a DNA core is wrapped and the linker histone H1, which is associated with linker DNA. By altering the accessibility of DNA sequences, the nucleosome has profound effects on all DNA-dependent processes. Understanding the factors that influence nucleosome positioning is of great importance for the study of genomic control mechanisms. Transcription factors (TFs have been suggested to play a role in nucleosome positioning in vivo. PRINCIPAL FINDINGS: Here, the minimum redundancy maximum relevance (mRMR feature selection algorithm, the nearest neighbor algorithm (NNA, and the incremental feature selection (IFS method were used to identify the most important TFs that either favor or inhibit nucleosome positioning by analyzing the numbers of transcription factor binding sites (TFBSs in 53,021 nucleosomal DNA sequences and 50,299 linker DNA sequences. A total of nine important families of TFs were extracted from 35 families, and the overall prediction accuracy was 87.4% as evaluated by the jackknife cross-validation test. CONCLUSIONS: Our results are consistent with the notion that TFs are more likely to bind linker DNA sequences than the sequences in the nucleosomes. In addition, our results imply that there may be some TFs that are important for nucleosome positioning but that play an insignificant role in discriminating nucleosome-forming DNA sequences from nucleosome-inhibiting DNA sequences. The hypothesis that TFs play a role in nucleosome positioning is, thus, confirmed by the results of this study.

PEPTIDE SOLUBILITY, STRUCTURE AND CHARGE POSITION EFFECT ON ADSORPTION BY ALUMINIUM HYDROXIDE

Directory of Open Access Journals (Sweden)

Mary Trujillo

2008-04-01

Full Text Available Solubility, structure and position of charges in a peptide antigen sequence can be mentioned as being amongst the basic features of adsorption. In order to study their effect on adsorption, seven analogue series were synthesized from a MSP-1 peptide sequence by systematically replacing each one of the positions in the peptide sequence by aspartic acid, glutamic acid, serine, alanine, asparagine, glutamine or lysine. Such modifications in analogue peptide sequences showed a non-regular tendency regarding solubility and adsorption data. Aspartic acid and Glutamic acid analogue series showed great improvements in adsorption, especially in peptides where Lysine in position 6 and Arginine in position 13 were replaced. Solubility of position 5 analogue was greater than the position 6 analogue in Aspartic acid series; however, the position 6 analogue showed best adsorption results whilst the Aspartic acid in position 5 analogue showed no adsorption in the same conditions. Nuclear Magnetic Resonance structural analysis revealed differences in the -helical structureextension between these analogues. The Aspartic acid in position 6, located in the polar side of the helix, may allow this analogueto fit better onto the adsorption regions suggesting that the local electrostatic charge is responsible for this behavior.

The Biomolecule Sequencer Project: Nanopore Sequencing as a Dual-Use Tool for Crew Health and Astrobiology Investigations

Science.gov (United States)

John, K. K.; Botkin, D. S.; Burton, A. S.; Castro-Wallace, S. L.; Chaput, J. D.; Dworkin, J. P.; Lehman, N.; Lupisella, M. L.; Mason, C. E.; Smith, D. J.;

Analysing breast tissue composition with MRI using currently available short, simple sequences

International Nuclear Information System (INIS)

Chau, A.C.M.; Hua, J.; Taylor, D.B.

2016-01-01

Aim: To determine the most robust commonly available magnetic resonance imaging (MRI) sequence to quantify breast tissue composition at 1.5 T. Materials and methods: Two-dimensional (2D) T1-weighted, Dixon fat, Dixon water and SPAIR images were obtained from five participants and a breast phantom using a 1.5 T Siemens Aera MRI system. Manual segmentation of the breasts was performed, and an in-house computer program was used to generate signal intensity histograms. Relative trough depth and relative peak separation were used to determine the robustness of the images for quantifying the two breast tissues. Total breast volumes and percentage breast densities calculated using the four sequences were compared. Results: Dixon fat histograms had consistently low relative trough depth and relative peak separation compared to those obtained using other sequences. There was no significant difference in total breast volumes and percentage breast densities of the participants or breast phantom using Dixon fat and 2D T1-weighted histograms. Dixon water and SPAIR histograms were not suitable for quantifying breast tissue composition. Conclusion: Dixon fat images are the most robust for the quantification of breast tissue composition using a signal intensity histogram. - Highlights: • Signal intensity histogram analysis can determine robustness of images for quantification of breast tissue composition. • Dixon fat images are the most robust. • The characteristics of the signal intensity histograms from Dixon water and SPAIR images make quantification unsuitable.

Detection and characterization of Pasteuria 16S rRNA gene sequences from nematodes and soils.

Science.gov (United States)

Duan, Y P; Castro, H F; Hewlett, T E; White, J H; Ogram, A V

2003-01-01

Various bacterial species in the genus Pasteuria have great potential as biocontrol agents against plant-parasitic nematodes, although study of this important genus is hampered by the current inability to cultivate Pasteuria species outside their host. To aid in the study of this genus, an extensive 16S rRNA gene sequence phylogeny was constructed and this information was used to develop cultivation-independent methods for detection of Pasteuria in soils and nematodes. Thirty new clones of Pasteuria 16S rRNA genes were obtained directly from nematodes and soil samples. These were sequenced and used to construct an extensive phylogeny of this genus. These sequences were divided into two deeply branching clades within the low-G + C, Gram-positive division; some sequences appear to represent novel species within the genus Pasteuria. In addition, a surprising degree of 16S rRNA gene sequence diversity was observed within what had previously been designated a single strain of Pasteuria penetrans (P-20). PCR primers specific to Pasteuria 16S rRNA for detection of Pasteuria in soils were also designed and evaluated. Detection limits for soil DNA were 100-10,000 Pasteuria endospores (g soil)(-1).

ϕ-statistically quasi Cauchy sequences

Directory of Open Access Journals (Sweden)

Bipan Hazarika

2016-04-01

Full Text Available Let P denote the space whose elements are finite sets of distinct positive integers. Given any element σ of P, we denote by p(σ the sequence {pn(σ} such that pn(σ=1 for n ∈ σ and pn(σ=0 otherwise. Further Ps={σ∈P:∑n=1∞pn(σ≤s}, i.e. Ps is the set of those σ whose support has cardinality at most s. Let (ϕn be a non-decreasing sequence of positive integers such that nϕn+1≤(n+1ϕn for all n∈N and the class of all sequences (ϕn is denoted by Φ. Let E⊆N. The number δϕ(E=lims→∞1ϕs|{k∈σ,σ∈Ps:k∈E}| is said to be the ϕ-density of E. A sequence (xn of points in R is ϕ-statistically convergent (or Sϕ-convergent to a real number ℓ for every ε > 0 if the set {n∈N:|xn−ℓ|≥ɛ} has ϕ-density zero. We introduce ϕ-statistically ward continuity of a real function. A real function is ϕ-statistically ward continuous if it preserves ϕ-statistically quasi Cauchy sequences where a sequence (xn is called to be ϕ-statistically quasi Cauchy (or Sϕ-quasi Cauchy when (Δxn=(xn+1−xn is ϕ-statistically convergent to 0. i.e. a sequence (xn of points in R is called ϕ-statistically quasi Cauchy (or Sϕ-quasi Cauchy for every ε > 0 if {n∈N:|xn+1−xn|≥ɛ} has ϕ-density zero. Also we introduce the concept of ϕ-statistically ward compactness and obtain results related to ϕ-statistically ward continuity, ϕ-statistically ward compactness, statistically ward continuity, ward continuity, ward compactness, ordinary compactness, uniform continuity, ordinary continuity, δ-ward continuity, and slowly oscillating continuity.

The Use of Next Generation Sequencing and Junction Sequence Analysis Bioinformatics to Achieve Molecular Characterization of Crops Improved Through Modern Biotechnology

Directory of Open Access Journals (Sweden)

David Kovalic

2012-11-01

Full Text Available The assessment of genetically modified (GM crops for regulatory approval currently requires a detailed molecular characterization of the DNA sequence and integrity of the transgene locus. In addition, molecular characterization is a critical component of event selection and advancement during product development. Typically, molecular characterization has relied on Southern blot analysis to establish locus and copy number along with targeted sequencing of polymerase chain reaction products spanning any inserted DNA to complete the characterization process. Here we describe the use of next generation (NexGen sequencing and junction sequence analysis bioinformatics in a new method for achieving full molecular characterization of a GM event without the need for Southern blot analysis. In this study, we examine a typical GM soybean [ (L. Merr.] line and demonstrate that this new method provides molecular characterization equivalent to the current Southern blot-based method. We also examine an event containing in vivo DNA rearrangement of multiple transfer DNA inserts to demonstrate that the new method is effective at identifying complex cases. Next generation sequencing and bioinformatics offers certain advantages over current approaches, most notably the simplicity, efficiency, and consistency of the method, and provides a viable alternative for efficiently and robustly achieving molecular characterization of GM crops.

Detection of viral sequence fragments of HIV-1 subfamilies yet unknown

Directory of Open Access Journals (Sweden)

Stanke Mario

2011-04-01

Full Text Available Abstract Background Methods of determining whether or not any particular HIV-1 sequence stems - completely or in part - from some unknown HIV-1 subtype are important for the design of vaccines and molecular detection systems, as well as for epidemiological monitoring. Nevertheless, a single algorithm only, the Branching Index (BI, has been developed for this task so far. Moving along the genome of a query sequence in a sliding window, the BI computes a ratio quantifying how closely the query sequence clusters with a subtype clade. In its current version, however, the BI does not provide predicted boundaries of unknown fragments. Results We have developed Unknown Subtype Finder (USF, an algorithm based on a probabilistic model, which automatically determines which parts of an input sequence originate from a subtype yet unknown. The underlying model is based on a simple profile hidden Markov model (pHMM for each known subtype and an additional pHMM for an unknown subtype. The emission probabilities of the latter are estimated using the emission frequencies of the known subtypes by means of a (position-wise probabilistic model for the emergence of new subtypes. We have applied USF to SIV and HIV-1 sequences formerly classified as having emerged from an unknown subtype. Moreover, we have evaluated its performance on artificial HIV-1 recombinants and non-recombinant HIV-1 sequences. The results have been compared with the corresponding results of the BI. Conclusions Our results demonstrate that USF is suitable for detecting segments in HIV-1 sequences stemming from yet unknown subtypes. Comparing USF with the BI shows that our algorithm performs as good as the BI or better.

Model morphing and sequence assignment after molecular replacement.

Science.gov (United States)

Terwilliger, Thomas C; Read, Randy J; Adams, Paul D; Brunger, Axel T; Afonine, Pavel V; Hung, Li-Wei

2013-11-01

A procedure termed `morphing' for improving a model after it has been placed in the crystallographic cell by molecular replacement has recently been developed. Morphing consists of applying a smooth deformation to a model to make it match an electron-density map more closely. Morphing does not change the identities of the residues in the chain, only their coordinates. Consequently, if the true structure differs from the working model by containing different residues, these differences cannot be corrected by morphing. Here, a procedure that helps to address this limitation is described. The goal of the procedure is to obtain a relatively complete model that has accurate main-chain atomic positions and residues that are correctly assigned to the sequence. Residues in a morphed model that do not match the electron-density map are removed. Each segment of the resulting trimmed morphed model is then assigned to the sequence of the molecule using information about the connectivity of the chains from the working model and from connections that can be identified from the electron-density map. The procedure was tested by application to a recently determined structure at a resolution of 3.2 Å and was found to increase the number of correctly identified residues in this structure from the 88 obtained using phenix.resolve sequence assignment alone (Terwilliger, 2003) to 247 of a possible 359. Additionally, the procedure was tested by application to a series of templates with sequence identities to a target structure ranging between 7 and 36%. The mean fraction of correctly identified residues in these cases was increased from 33% using phenix.resolve sequence assignment to 47% using the current procedure. The procedure is simple to apply and is available in the Phenix software package.

Accurate identification of RNA editing sites from primitive sequence with deep neural networks.

Science.gov (United States)

Ouyang, Zhangyi; Liu, Feng; Zhao, Chenghui; Ren, Chao; An, Gaole; Mei, Chuan; Bo, Xiaochen; Shu, Wenjie

2018-04-16

RNA editing is a post-transcriptional RNA sequence alteration. Current methods have identified editing sites and facilitated research but require sufficient genomic annotations and prior-knowledge-based filtering steps, resulting in a cumbersome, time-consuming identification process. Moreover, these methods have limited generalizability and applicability in species with insufficient genomic annotations or in conditions of limited prior knowledge. We developed DeepRed, a deep learning-based method that identifies RNA editing from primitive RNA sequences without prior-knowledge-based filtering steps or genomic annotations. DeepRed achieved 98.1% and 97.9% area under the curve (AUC) in training and test sets, respectively. We further validated DeepRed using experimentally verified U87 cell RNA-seq data, achieving 97.9% positive predictive value (PPV). We demonstrated that DeepRed offers better prediction accuracy and computational efficiency than current methods with large-scale, mass RNA-seq data. We used DeepRed to assess the impact of multiple factors on editing identification with RNA-seq data from the Association of Biomolecular Resource Facilities and Sequencing Quality Control projects. We explored developmental RNA editing pattern changes during human early embryogenesis and evolutionary patterns in Drosophila species and the primate lineage using DeepRed. Our work illustrates DeepRed's state-of-the-art performance; it may decipher the hidden principles behind RNA editing, making editing detection convenient and effective.

The clinical application of genome-wide sequencing for monogenic diseases in Canada: Position Statement of the Canadian College of Medical Geneticists

Science.gov (United States)

Boycott, Kym; Hartley, Taila; Adam, Shelin; Bernier, Francois; Chong, Karen; Fernandez, Bridget A; Friedman, Jan M; Geraghty, Michael T; Hume, Stacey; Knoppers, Bartha M; Laberge, Anne-Marie; Majewski, Jacek; Mendoza-Londono, Roberto; Meyn, M Stephen; Michaud, Jacques L; Nelson, Tanya N; Richer, Julie; Sadikovic, Bekim; Skidmore, David L; Stockley, Tracy; Taylor, Sherry; van Karnebeek, Clara; Zawati, Ma'n H; Lauzon, Julie; Armour, Christine M

2015-01-01

Purpose and scope The aim of this Position Statement is to provide recommendations for Canadian medical geneticists, clinical laboratory geneticists, genetic counsellors and other physicians regarding the use of genome-wide sequencing of germline DNA in the context of clinical genetic diagnosis. This statement has been developed to facilitate the clinical translation and development of best practices for clinical genome-wide sequencing for genetic diagnosis of monogenic diseases in Canada; it does not address the clinical application of this technology in other fields such as molecular investigation of cancer or for population screening of healthy individuals. Methods of statement development Two multidisciplinary groups consisting of medical geneticists, clinical laboratory geneticists, genetic counsellors, ethicists, lawyers and genetic researchers were assembled to review existing literature and guidelines on genome-wide sequencing for clinical genetic diagnosis in the context of monogenic diseases, and to make recommendations relevant to the Canadian context. The statement was circulated for comment to the Canadian College of Medical Geneticists (CCMG) membership-at-large and, following incorporation of feedback, approved by the CCMG Board of Directors. The CCMG is a Canadian organisation responsible for certifying medical geneticists and clinical laboratory geneticists, and for establishing professional and ethical standards for clinical genetics services in Canada. Results and conclusions Recommendations include (1) clinical genome-wide sequencing is an appropriate approach in the diagnostic assessment of a patient for whom there is suspicion of a significant monogenic disease that is associated with a high degree of genetic heterogeneity, or where specific genetic tests have failed to provide a diagnosis; (2) until the benefits of reporting incidental findings are established, we do not endorse the intentional clinical analysis of disease-associated genes

The clinical application of genome-wide sequencing for monogenic diseases in Canada: Position Statement of the Canadian College of Medical Geneticists.

Science.gov (United States)

Boycott, Kym; Hartley, Taila; Adam, Shelin; Bernier, Francois; Chong, Karen; Fernandez, Bridget A; Friedman, Jan M; Geraghty, Michael T; Hume, Stacey; Knoppers, Bartha M; Laberge, Anne-Marie; Majewski, Jacek; Mendoza-Londono, Roberto; Meyn, M Stephen; Michaud, Jacques L; Nelson, Tanya N; Richer, Julie; Sadikovic, Bekim; Skidmore, David L; Stockley, Tracy; Taylor, Sherry; van Karnebeek, Clara; Zawati, Ma'n H; Lauzon, Julie; Armour, Christine M

2015-07-01

The aim of this Position Statement is to provide recommendations for Canadian medical geneticists, clinical laboratory geneticists, genetic counsellors and other physicians regarding the use of genome-wide sequencing of germline DNA in the context of clinical genetic diagnosis. This statement has been developed to facilitate the clinical translation and development of best practices for clinical genome-wide sequencing for genetic diagnosis of monogenic diseases in Canada; it does not address the clinical application of this technology in other fields such as molecular investigation of cancer or for population screening of healthy individuals. Two multidisciplinary groups consisting of medical geneticists, clinical laboratory geneticists, genetic counsellors, ethicists, lawyers and genetic researchers were assembled to review existing literature and guidelines on genome-wide sequencing for clinical genetic diagnosis in the context of monogenic diseases, and to make recommendations relevant to the Canadian context. The statement was circulated for comment to the Canadian College of Medical Geneticists (CCMG) membership-at-large and, following incorporation of feedback, approved by the CCMG Board of Directors. The CCMG is a Canadian organisation responsible for certifying medical geneticists and clinical laboratory geneticists, and for establishing professional and ethical standards for clinical genetics services in Canada. Recommendations include (1) clinical genome-wide sequencing is an appropriate approach in the diagnostic assessment of a patient for whom there is suspicion of a significant monogenic disease that is associated with a high degree of genetic heterogeneity, or where specific genetic tests have failed to provide a diagnosis; (2) until the benefits of reporting incidental findings are established, we do not endorse the intentional clinical analysis of disease-associated genes other than those linked to the primary indication; and (3) clinicians should

The Sequencing of Basic Chemistry Topics by Physical Science Teachers

Science.gov (United States)

Sibanda, Doras; Hobden, Paul

2016-01-01

The purpose of this study was to find out teachers' preferred teaching sequence for basic chemistry topics in Physical Science in South Africa, to obtain their reasons underpinning their preferred sequence, and to compare these sequences with the prescribed sequences in the current curriculum. The study was located within a pragmatic paradigm and…

Development of a highly sensitive current and position monitor with HTS squids and an HTS magnetic shield

International Nuclear Information System (INIS)

Watanabe, T.; Ikeda, T.; Kase, M.; Yano, Y.; Watanabe, S.; Sasaki, Y.; Kawaguchi, T.

2005-01-01

A highly sensitive current and position monitor with HTS (High-Temperature Superconducting) SQUIDs (Superconducting QUantum Interference Device) and an HTS magnetic shield for the measurement of the intensity of faint beams, such as a radioisotope beam, has been developed for the RIKEN RI beam factory project. The HTS magnetic shield and the HTS current sensor including the HTS SQUID are cooled by a low-vibration pulse-tube refrigerator. Both the HTS magnetic shield and the HTS current sensor were fabricated by dip-coating a thin Bi 2 -Sr 2 -Ca 2 -Cu 3 -O x (Bi-2223) layer on 99.9% MgO ceramic substrates. The HTS technology enables us to develop a system equipped with a downsized and highly sensitive current monitor. Recently, a prototype system was completed and installed in the beam transport line of the RIKEN Ring Cyclotron to measure the DC-current of high-energy heavy-ion beams. As a result, we succeeded in measuring the intensity of the 600 nA 40 Ar 17+ beam (95 MeV/u). We describe the present status of the monitor system and the results of the beam measurements. (author)

Microscopic models for bridging electrostatics and currents

Science.gov (United States)

Borghi, L.; DeAmbrosis, A.; Mascheretti, P.

2007-03-01

A teaching sequence based on the use of microscopic models to link electrostatic phenomena with direct currents is presented. The sequence, devised for high school students, was designed after initial work carried out with student teachers attending a school of specialization for teaching physics at high school, at the University of Pavia. The results obtained with them are briefly presented, because they directed our steps for the development of the teaching sequence. For both the design of the experiments and their interpretation, we drew inspiration from the original works of Alessandro Volta; in addition, a structural model based on the particular role of electrons as elementary charges both in electrostatic phenomena and in currents was proposed. The teaching sequence starts from experiments on charging objects by rubbing and by induction, and engages students in constructing microscopic models to interpret their observations. By using these models and by closely examining the ideas of tension and capacitance, the students acknowledge that a charging (or discharging) process is due to the motion of electrons that, albeit for short time intervals, represent a current. Finally, they are made to see that the same happens in transients of direct current circuits.

Enhanced Power Quality and Minimized Peak Current Control in An Inverter based Microgrid under Unbalanced Grid Faults

DEFF Research Database (Denmark)

Liu, Wenzhao; Guo, Xiaoqiang; Sulligoi, Giorgio

2016-01-01

The microgrid inverter experiences the power oscillations and current harmonics in case of the unbalanced grid voltage faults. However, there is a trade-off between power oscillations and current harmonics should be considered in three phase three wire inverter systems during the conventional fault...... ride through control. In order to solve this problem, a novel control strategy is proposed to enhance the output current quality while mitigating the active and reactive output power oscillations. Moreover, a simple current-limited control strategy can be achieved without the necessity of the voltage....../current positive/negative sequence extraction. Finally, the simulation tests of the conventional and proposed control solutions are carried out. The results verify the effectiveness of the proposed strategy....

High-Throughput Next-Generation Sequencing of Polioviruses

Science.gov (United States)

Montmayeur, Anna M.; Schmidt, Alexander; Zhao, Kun; Magaña, Laura; Iber, Jane; Castro, Christina J.; Chen, Qi; Henderson, Elizabeth; Ramos, Edward; Shaw, Jing; Tatusov, Roman L.; Dybdahl-Sissoko, Naomi; Endegue-Zanga, Marie Claire; Adeniji, Johnson A.; Oberste, M. Steven; Burns, Cara C.

2016-01-01

ABSTRACT The poliovirus (PV) is currently targeted for worldwide eradication and containment. Sanger-based sequencing of the viral protein 1 (VP1) capsid region is currently the standard method for PV surveillance. However, the whole-genome sequence is sometimes needed for higher resolution global surveillance. In this study, we optimized whole-genome sequencing protocols for poliovirus isolates and FTA cards using next-generation sequencing (NGS), aiming for high sequence coverage, efficiency, and throughput. We found that DNase treatment of poliovirus RNA followed by random reverse transcription (RT), amplification, and the use of the Nextera XT DNA library preparation kit produced significantly better results than other preparations. The average viral reads per total reads, a measurement of efficiency, was as high as 84.2% ± 15.6%. PV genomes covering >99 to 100% of the reference length were obtained and validated with Sanger sequencing. A total of 52 PV genomes were generated, multiplexing as many as 64 samples in a single Illumina MiSeq run. This high-throughput, sequence-independent NGS approach facilitated the detection of a diverse range of PVs, especially for those in vaccine-derived polioviruses (VDPV), circulating VDPV, or immunodeficiency-related VDPV. In contrast to results from previous studies on other viruses, our results showed that filtration and nuclease treatment did not discernibly increase the sequencing efficiency of PV isolates. However, DNase treatment after nucleic acid extraction to remove host DNA significantly improved the sequencing results. This NGS method has been successfully implemented to generate PV genomes for molecular epidemiology of the most recent PV isolates. Additionally, the ability to obtain full PV genomes from FTA cards will aid in facilitating global poliovirus surveillance. PMID:27927929

Pairwise local structural alignment of RNA sequences with sequence similarity less than 40%

DEFF Research Database (Denmark)

Havgaard, Jakob Hull; Lyngsø, Rune B.; Stormo, Gary D.

2005-01-01

detect two genes with low sequence similarity, where the genes are part of a larger genomic region. Results: Here we present such an approach for pairwise local alignment which is based on FILDALIGN and the Sankoff algorithm for simultaneous structural alignment of multiple sequences. We include...... the ability to conduct mutual scans of two sequences of arbitrary length while searching for common local structural motifs of some maximum length. This drastically reduces the complexity of the algorithm. The scoring scheme includes structural parameters corresponding to those available for free energy....... The structure prediction performance for a family is typically around 0.7 using Matthews correlation coefficient. In case (2), the algorithm is successful at locating RNA families with an average sensitivity of 0.8 and a positive predictive value of 0.9 using a BLAST-like hit selection scheme. Availability...

Current and planned use of the Navstar Global Positioning System by NASA

Science.gov (United States)

Theiss, Harold L.

1993-01-01

NASA was quick to realize the potential that the Global Positioning System (GPS) had to offer for its many diverse vehicles, experiments and platforms. Soon after the first Block 1 GPS satellites were launched, NASA began to use the tremendous capabilities that they had to offer. Even with a partial GPS constellation in place, important results have been obtained about the shape, orientation and rotation of the earth and calibration of the ionosphere and troposphere. These calibrations enhance geophysical science and facilitate the navigation of interplanetary spacecraft. Some very important results have been obtained in the continuing NASA program for aircraft terminal area operations. Currently, a large amount of activity is being concentrated on real time kinematic carrier phase tracking which has the potential to revolutionize aircraft navigation. This year marks the launch of the first GPS receiver equipped earth-orbiting NASA spacecraft: the Extreme Ultraviolet Explorer and the Ocean Topography Experiment (TOPEX/Poseidon). This paper describes a cross section of GPS-based research at NASA.

Rapid Polymer Sequencer

Science.gov (United States)

Stolc, Viktor (Inventor); Brock, Matthew W (Inventor)

2013-01-01

Method and system for rapid and accurate determination of each of a sequence of unknown polymer components, such as nucleic acid components. A self-assembling monolayer of a selected substance is optionally provided on an interior surface of a pipette tip, and the interior surface is immersed in a selected liquid. A selected electrical field is impressed in a longitudinal direction, or in a transverse direction, in the tip region, a polymer sequence is passed through the tip region, and a change in an electrical current signal is measured as each polymer component passes through the tip region. Each of the measured changes in electrical current signals is compared with a database of reference electrical change signals, with each reference signal corresponding to an identified polymer component, to identify the unknown polymer component with a reference polymer component. The nanopore preferably has a pore inner diameter of no more than about 40 nm and is prepared by heating and pulling a very small section of a glass tubing.

Genome sequence of Desulfitobacterium hafniense DCB-2, a Gram-positive anaerobe capable of dehalogenation and metal reduction

Directory of Open Access Journals (Sweden)

Kim Sang-Hoon

2012-02-01

Full Text Available Abstract Background The genome of the Gram-positive, metal-reducing, dehalorespiring Desulfitobacterium hafniense DCB-2 was sequenced in order to gain insights into its metabolic capacities, adaptive physiology, and regulatory machineries, and to compare with that of Desulfitobacterium hafniense Y51, the phylogenetically closest strain among the species with a sequenced genome. Results The genome of Desulfitobacterium hafniense DCB-2 is composed of a 5,279,134-bp circular chromosome with 5,042 predicted genes. Genome content and parallel physiological studies support the cell's ability to fix N2 and CO2, form spores and biofilms, reduce metals, and use a variety of electron acceptors in respiration, including halogenated organic compounds. The genome contained seven reductive dehalogenase genes and four nitrogenase gene homologs but lacked the Nar respiratory nitrate reductase system. The D. hafniense DCB-2 genome contained genes for 43 RNA polymerase sigma factors including 27 sigma-24 subunits, 59 two-component signal transduction systems, and about 730 transporter proteins. In addition, it contained genes for 53 molybdopterin-binding oxidoreductases, 19 flavoprotein paralogs of the fumarate reductase, and many other FAD/FMN-binding oxidoreductases, proving the cell's versatility in both adaptive and reductive capacities. Together with the ability to form spores, the presence of the CO2-fixing Wood-Ljungdahl pathway and the genes associated with oxygen tolerance add flexibility to the cell's options for survival under stress. Conclusions D. hafniense DCB-2's genome contains genes consistent with its abilities for dehalogenation, metal reduction, N2 and CO2 fixation, anaerobic respiration, oxygen tolerance, spore formation, and biofilm formation which make this organism a potential candidate for bioremediation at contaminated sites.

Nucleotide sequence analysis of the recA gene and discrimination of the three isolates of urease-positive thermophilic Campylobacter (UPTC) isolated from seagulls (Larus spp.) in Northern Ireland.

Science.gov (United States)

Matsuda, M; Tai, K; Moore, J E; Millar, B C; Murayama, O

2004-01-01

Nucleotide sequencing after TA cloning of the amplicon of the almost-full length recA gene from three strains of UPTC (A1, A2, and A3) isolated from seagulls in Northern Ireland, the phenotypical and genotypical characteristics of which have been demonstrated to be indistinguishable, clarified nucleotide differences at three nucleotide positions among the three strains. In conclusion, the nucleotide sequences of the recA gene were found to discriminate among the three strains of UPTC, A1, A2, and A3, which are indistinguishable phenotypically and genotypically. Thus, the present study strongly suggests that nucleotide sequence data of the amplicon of a suitable gene or region could aid in discriminating among isolates of the UPTC group, which are indistinguishable phenotypically and genotypically. Copyright 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Unveiling Mycoplasma hyopneumoniae Promoters: Sequence Definition and Genomic Distribution

Science.gov (United States)

Weber, Shana de Souto; Sant'Anna, Fernando Hayashi; Schrank, Irene Silveira

2012-01-01

Several Mycoplasma species have had their genome completely sequenced, including four strains of the swine pathogen Mycoplasma hyopneumoniae. Nevertheless, little is known about the nucleotide sequences that control transcriptional initiation in these microorganisms. Therefore, with the objective of investigating the promoter sequences of M. hyopneumoniae, 23 transcriptional start sites (TSSs) of distinct genes were mapped. A pattern that resembles the σ70 promoter −10 element was found upstream of the TSSs. However, no −35 element was distinguished. Instead, an AT-rich periodic signal was identified. About half of the experimentally defined promoters contained the motif 5′-TRTGn-3′, which was identical to the −16 element usually found in Gram-positive bacteria. The defined promoters were utilized to build position-specific scoring matrices in order to scan putative promoters upstream of all coding sequences (CDSs) in the M. hyopneumoniae genome. Two hundred and one signals were found associated with 169 CDSs. Most of these sequences were located within 100 nucleotides of the start codons. This study has shown that the number of promoter-like sequences in the M. hyopneumoniae genome is more frequent than expected by chance, indicating that most of the sequences detected are probably biologically functional. PMID:22334569

Single-base resolution and long-coverage sequencing based on single-molecule nanomanipulation

International Nuclear Information System (INIS)

An Hongjie; Huang Jiehuan; Lue Ming; Li Xueling; Lue Junhong; Li Haikuo; Zhang Yi; Li Minqian; Hu Jun

2007-01-01

We show new approaches towards a novel single-molecule sequencing strategy which consists of high-resolution positioning isolation of overlapping DNA fragments with atomic force microscopy (AFM), subsequent single-molecule PCR amplification and conventional Sanger sequencing. In this study, a DNA labelling technique was used to guarantee the accuracy in positioning the target DNA. Single-molecule multiplex PCR was carried out to test the contamination. The results showed that the two overlapping DNA fragments isolated by AFM could be successfully sequenced with high quality and perfect contiguity, indicating that single-base resolution and long-coverage sequencing have been achieved simultaneously

Model morphing and sequence assignment after molecular replacement

Energy Technology Data Exchange (ETDEWEB)

Terwilliger, Thomas C., E-mail: terwilliger@lanl.gov [Los Alamos National Laboratory, Mail Stop M888, Los Alamos, NM 87545 (United States); Read, Randy J. [University of Cambridge, Cambridge Institute for Medical Research, Cambridge CB2 0XY (United Kingdom); Adams, Paul D. [Lawrence Berkeley National Laboratory, One Cyclotron Road, Bldg 64R0121, Berkeley, CA 94720 (United States); Brunger, Axel T. [Stanford University, 318 Campus Drive West, Stanford, CA 94305 (United States); Afonine, Pavel V. [Lawrence Berkeley National Laboratory, One Cyclotron Road, Bldg 64R0121, Berkeley, CA 94720 (United States); Hung, Li-Wei [Los Alamos National Laboratory, Mail Stop M888, Los Alamos, NM 87545 (United States)

2013-11-01

A procedure for model building is described that combines morphing a model to match a density map, trimming the morphed model and aligning the model to a sequence. A procedure termed ‘morphing’ for improving a model after it has been placed in the crystallographic cell by molecular replacement has recently been developed. Morphing consists of applying a smooth deformation to a model to make it match an electron-density map more closely. Morphing does not change the identities of the residues in the chain, only their coordinates. Consequently, if the true structure differs from the working model by containing different residues, these differences cannot be corrected by morphing. Here, a procedure that helps to address this limitation is described. The goal of the procedure is to obtain a relatively complete model that has accurate main-chain atomic positions and residues that are correctly assigned to the sequence. Residues in a morphed model that do not match the electron-density map are removed. Each segment of the resulting trimmed morphed model is then assigned to the sequence of the molecule using information about the connectivity of the chains from the working model and from connections that can be identified from the electron-density map. The procedure was tested by application to a recently determined structure at a resolution of 3.2 Å and was found to increase the number of correctly identified residues in this structure from the 88 obtained using phenix.resolve sequence assignment alone (Terwilliger, 2003 ▶) to 247 of a possible 359. Additionally, the procedure was tested by application to a series of templates with sequence identities to a target structure ranging between 7 and 36%. The mean fraction of correctly identified residues in these cases was increased from 33% using phenix.resolve sequence assignment to 47% using the current procedure. The procedure is simple to apply and is available in the Phenix software package.

Model morphing and sequence assignment after molecular replacement

International Nuclear Information System (INIS)

Terwilliger, Thomas C.; Read, Randy J.; Adams, Paul D.; Brunger, Axel T.; Afonine, Pavel V.; Hung, Li-Wei

2013-01-01

A procedure for model building is described that combines morphing a model to match a density map, trimming the morphed model and aligning the model to a sequence. A procedure termed ‘morphing’ for improving a model after it has been placed in the crystallographic cell by molecular replacement has recently been developed. Morphing consists of applying a smooth deformation to a model to make it match an electron-density map more closely. Morphing does not change the identities of the residues in the chain, only their coordinates. Consequently, if the true structure differs from the working model by containing different residues, these differences cannot be corrected by morphing. Here, a procedure that helps to address this limitation is described. The goal of the procedure is to obtain a relatively complete model that has accurate main-chain atomic positions and residues that are correctly assigned to the sequence. Residues in a morphed model that do not match the electron-density map are removed. Each segment of the resulting trimmed morphed model is then assigned to the sequence of the molecule using information about the connectivity of the chains from the working model and from connections that can be identified from the electron-density map. The procedure was tested by application to a recently determined structure at a resolution of 3.2 Å and was found to increase the number of correctly identified residues in this structure from the 88 obtained using phenix.resolve sequence assignment alone (Terwilliger, 2003 ▶) to 247 of a possible 359. Additionally, the procedure was tested by application to a series of templates with sequence identities to a target structure ranging between 7 and 36%. The mean fraction of correctly identified residues in these cases was increased from 33% using phenix.resolve sequence assignment to 47% using the current procedure. The procedure is simple to apply and is available in the Phenix software package

Generation of pseudo-random sequences for spread spectrum systems

Science.gov (United States)

Moser, R.; Stover, J.

1985-05-01

The characteristics of pseudo random radio signal sequences (PRS) are explored. The randomness of the PSR is a matter of artificially altering the sequence of binary digits broadcast. Autocorrelations of the two sequences shifted in time, if high, determine if the signals are the same and thus allow for position identification. Cross-correlation can also be calculated between sequences. Correlations closest to zero are obtained with large volume of prime numbers in the sequences. Techniques for selecting optimal and maximal lengths for the sequences are reviewed. If the correlations are near zero in the sequences, then signal channels can accommodate multiple users. Finally, Gold codes are discussed as a technique for maximizing the code lengths.

Structural Correlates of Skilled Performance on a Motor Sequence Task

Directory of Open Access Journals (Sweden)

Christopher J Steele

2012-10-01

Full Text Available The brain regions functionally engaged in motor sequence performance are well established, but the structural characteristics of these regions and the fibre pathways involved have been less well studied. In addition, relatively few studies have combined multiple magnetic resonance imaging (MRI and behavioural performance measures in the same sample. Therefore, the current study used diffusion tensor imaging, probabilistic tractography, and voxel-based morphometry to determine the structural correlates of skilled motor performance. Further, we compared these findings with fMRI results in the same sample. We correlated final performance and rate of improvement measures on a temporal motor sequence task with skeletonised fractional anisotropy (FA and whole brain grey matter (GM volume. Final synchronisation performance was negatively correlated with FA in white matter underlying bilateral sensorimotor cortex – an effect that was mediated by a positive correlation with radial diffusivity. Multi-fibre tractography indicated that this region contained crossing fibres from the corticospinal tract and superior longitudinal fasciculus (SLF. The identified SLF pathway linked parietal and auditory cortical regions that have been shown to be functionally engaged in this task. Thus, we hypothesise that enhanced synchronisation performance on this task may be related to greater fibre integrity of the SLF. Rate of improvement on synchronisation was positively correlated with GM volume in cerebellar lobules HVI and V – regions that showed training-related decreases in activity in the same sample. Taken together, our results link individual differences in brain structure and function to motor sequence performance on the same task. Further, our study illustrates the utility of using multiple MR measures and analysis techniques to specify the interpretation of structural findings.

Minimization of Dead-Periods in MRI Pulse Sequences for Imaging Oblique Planes

Science.gov (United States)

Atalar, Ergin; McVeigh, Elliot R.

2007-01-01

With the advent of breath-hold MR cardiac imaging techniques, the minimization of TR and TE for oblique planes has become a critical issue. The slew rates and maximum currents of gradient amplifiers limit the minimum possible TR and TE by adding dead-periods to the pulse sequences. We propose a method of designing gradient waveforms that will be applied to the amplifiers instead of the slice, readout, and phase encoding waveforms. Because this method ensures that the gradient amplifiers will always switch at their maximum slew rate, it results in the minimum possible dead-period for given imaging parameters and scan plane position. A GRASS pulse sequence has been designed and ultra-short TR and TE values have been obtained with standard gradient amplifiers and coils. For some oblique slices, we have achieved shorter TR and TE values than those for nonoblique slices. PMID:7869900

Complete Genome Sequence of Ikoma Lyssavirus

OpenAIRE

Marston, Denise A.; Ellis, Richard J.; Horton, Daniel L.; Kuzmin, Ivan V.; Wise, Emma L.; McElhinney, Lorraine M.; Banyard, Ashley C.; Ngeleja, Chanasa; Keyyu, Julius; Cleaveland, Sarah; Lembo, Tiziana; Rupprecht, Charles E.; Fooks, Anthony R.

2012-01-01

Lyssaviruses (family Rhabdoviridae) constitute one of the most important groups of viral zoonoses globally. All lyssaviruses cause the disease rabies, an acute progressive encephalitis for which, once symptoms occur, there is no effective cure. Currently available vaccines are highly protective against the predominantly circulating lyssavirus species. Using next-generation sequencing technologies, we have obtained the whole-genome sequence for a novel lyssavirus, Ikoma lyssavirus (IKOV), isol...

Identification of optimum sequencing depth especially for de novo genome assembly of small genomes using next generation sequencing data.

Science.gov (United States)

Desai, Aarti; Marwah, Veer Singh; Yadav, Akshay; Jha, Vineet; Dhaygude, Kishor; Bangar, Ujwala; Kulkarni, Vivek; Jere, Abhay

2013-01-01

Next Generation Sequencing (NGS) is a disruptive technology that has found widespread acceptance in the life sciences research community. The high throughput and low cost of sequencing has encouraged researchers to undertake ambitious genomic projects, especially in de novo genome sequencing. Currently, NGS systems generate sequence data as short reads and de novo genome assembly using these short reads is computationally very intensive. Due to lower cost of sequencing and higher throughput, NGS systems now provide the ability to sequence genomes at high depth. However, currently no report is available highlighting the impact of high sequence depth on genome assembly using real data sets and multiple assembly algorithms. Recently, some studies have evaluated the impact of sequence coverage, error rate and average read length on genome assembly using multiple assembly algorithms, however, these evaluations were performed using simulated datasets. One limitation of using simulated datasets is that variables such as error rates, read length and coverage which are known to impact genome assembly are carefully controlled. Hence, this study was undertaken to identify the minimum depth of sequencing required for de novo assembly for different sized genomes using graph based assembly algorithms and real datasets. Illumina reads for E.coli (4.6 MB) S.kudriavzevii (11.18 MB) and C.elegans (100 MB) were assembled using SOAPdenovo, Velvet, ABySS, Meraculous and IDBA-UD. Our analysis shows that 50X is the optimum read depth for assembling these genomes using all assemblers except Meraculous which requires 100X read depth. Moreover, our analysis shows that de novo assembly from 50X read data requires only 6-40 GB RAM depending on the genome size and assembly algorithm used. We believe that this information can be extremely valuable for researchers in designing experiments and multiplexing which will enable optimum utilization of sequencing as well as analysis resources.

Mutation of miRNA target sequences during human evolution

DEFF Research Database (Denmark)

Gardner, Paul P; Vinther, Jeppe

2008-01-01

It has long-been hypothesized that changes in non-protein-coding genes and the regulatory sequences controlling expression could undergo positive selection. Here we identify 402 putative microRNA (miRNA) target sequences that have been mutated specifically in the human lineage and show that genes...... containing such deletions are more highly expressed than their mouse orthologs. Our findings indicate that some miRNA target mutations are fixed by positive selection and might have been involved in the evolution of human-specific traits....

The mitochondrial genome sequence of the Tasmanian tiger (Thylacinus cynocephalus)

DEFF Research Database (Denmark)

Miller, Webb; Drautz, Daniela I; Janecka, Jan E

2009-01-01

We report the first two complete mitochondrial genome sequences of the thylacine (Thylacinus cynocephalus), or so-called Tasmanian tiger, extinct since 1936. The thylacine's phylogenetic position within australidelphian marsupials has long been debated, and here we provide strong support for the ......We report the first two complete mitochondrial genome sequences of the thylacine (Thylacinus cynocephalus), or so-called Tasmanian tiger, extinct since 1936. The thylacine's phylogenetic position within australidelphian marsupials has long been debated, and here we provide strong support...... for the thylacine's basal position in Dasyuromorphia, aided by mitochondrial genome sequence that we generated from the extant numbat (Myrmecobius fasciatus). Surprisingly, both of our thylacine sequences differ by 11%-15% from putative thylacine mitochondrial genes in GenBank, with one of our samples originating...... at a very low genetic diversity shortly before extinction. Despite the samples' heavy contamination with bacterial and human DNA and their temperate storage history, we estimate that as much as one-third of the total DNA in each sample is from the thylacine. The microbial content of the two thylacine...

Seq2Logo: a method for construction and visualization of amino acid binding motifs and sequence profiles including sequence weighting, pseudo counts and two-sided representation of amino acid enrichment and depletion

DEFF Research Database (Denmark)

Thomsen, Martin Christen Frølund; Nielsen, Morten

2012-01-01

Seq2Logo is a web-based sequence logo generator. Sequence logos are a graphical representation of the information content stored in a multiple sequence alignment (MSA) and provide a compact and highly intuitive representation of the position-specific amino acid composition of binding motifs, active...... related to amino acid enrichment and depletion. Besides allowing input in the format of peptides and MSA, Seq2Logo accepts input as Blast sequence profiles, providing easy access for non-expert end-users to characterize and identify functionally conserved/variable amino acids in any given protein...... sites, etc. in biological sequences. Accurate generation of sequence logos is often compromised by sequence redundancy and low number of observations. Moreover, most methods available for sequence logo generation focus on displaying the position-specific enrichment of amino acids, discarding the equally...

Improved detection of CXCR4-using HIV by V3 genotyping: application of population-based and "deep" sequencing to plasma RNA and proviral DNA.

Science.gov (United States)

Swenson, Luke C; Moores, Andrew; Low, Andrew J; Thielen, Alexander; Dong, Winnie; Woods, Conan; Jensen, Mark A; Wynhoven, Brian; Chan, Dennison; Glascock, Christopher; Harrigan, P Richard

2010-08-01

Tropism testing should rule out CXCR4-using HIV before treatment with CCR5 antagonists. Currently, the recombinant phenotypic Trofile assay (Monogram) is most widely utilized; however, genotypic tests may represent alternative methods. Independent triplicate amplifications of the HIV gp120 V3 region were made from either plasma HIV RNA or proviral DNA. These underwent standard, population-based sequencing with an ABI3730 (RNA n = 63; DNA n = 40), or "deep" sequencing with a Roche/454 Genome Sequencer-FLX (RNA n = 12; DNA n = 12). Position-specific scoring matrices (PSSMX4/R5) (-6.96 cutoff) and geno2pheno[coreceptor] (5% false-positive rate) inferred tropism from V3 sequence. These methods were then independently validated with a separate, blinded dataset (n = 278) of screening samples from the maraviroc MOTIVATE trials. Standard sequencing of HIV RNA with PSSM yielded 69% sensitivity and 91% specificity, relative to Trofile. The validation dataset gave 75% sensitivity and 83% specificity. Proviral DNA plus PSSM gave 77% sensitivity and 71% specificity. "Deep" sequencing of HIV RNA detected >2% inferred-CXCR4-using virus in 8/8 samples called non-R5 by Trofile, and <2% in 4/4 samples called R5. Triplicate analyses of V3 standard sequence data detect greater proportions of CXCR4-using samples than previously achieved. Sequencing proviral DNA and "deep" V3 sequencing may also be useful tools for assessing tropism.

Linear quadratic Gaussian controller design for plasma current, position and shape control system in ITER

International Nuclear Information System (INIS)

Belyakov, V.; Kavin, A.; Rumyantsev, E.; Kharitonov, V.; Misenov, B.; Ovsyannikov, A.; Ovsyannikov, D.; Veremei, E.; Zhabko, A.; Mitrishkin, Y.

1999-01-01

This paper is focused on the linear quadratic Gaussian (LQG) controller synthesis methodology for the ITER plasma current, position and shape control system as well as power derivative management system. It has been shown that some poloidal field (PF) coils have less influence on reference plasma-wall gaps control during plasma disturbances and hence they have been used to reduce total control power derivative by means of the additional non-linear feedback. The design has been done on the basis of linear models. Simulation was provided for non-linear model and results are presented and discussed. (orig.)

Nanopore Sequencing as a Rapidly Deployable Ebola Outbreak Tool.

Science.gov (United States)

Hoenen, Thomas; Groseth, Allison; Rosenke, Kyle; Fischer, Robert J; Hoenen, Andreas; Judson, Seth D; Martellaro, Cynthia; Falzarano, Darryl; Marzi, Andrea; Squires, R Burke; Wollenberg, Kurt R; de Wit, Emmie; Prescott, Joseph; Safronetz, David; van Doremalen, Neeltje; Bushmaker, Trenton; Feldmann, Friederike; McNally, Kristin; Bolay, Fatorma K; Fields, Barry; Sealy, Tara; Rayfield, Mark; Nichol, Stuart T; Zoon, Kathryn C; Massaquoi, Moses; Munster, Vincent J; Feldmann, Heinz

2016-02-01

Rapid sequencing of RNA/DNA from pathogen samples obtained during disease outbreaks provides critical scientific and public health information. However, challenges exist for exporting samples to laboratories or establishing conventional sequencers in remote outbreak regions. We successfully used a novel, pocket-sized nanopore sequencer at a field diagnostic laboratory in Liberia during the current Ebola virus outbreak.

Bias in phylogenetic reconstruction of vertebrate rhodopsin sequences.

Science.gov (United States)

Chang, B S; Campbell, D L

2000-08-01

Two spurious nodes were found in phylogenetic analyses of vertebrate rhodopsin sequences in comparison with well-established vertebrate relationships. These spurious reconstructions were well supported in bootstrap analyses and occurred independently of the method of phylogenetic analysis used (parsimony, distance, or likelihood). Use of this data set of vertebrate rhodopsin sequences allowed us to exploit established vertebrate relationships, as well as the considerable amount known about the molecular evolution of this gene, in order to identify important factors contributing to the spurious reconstructions. Simulation studies using parametric bootstrapping indicate that it is unlikely that the spurious nodes in the parsimony analyses are due to long branches or other topological effects. Rather, they appear to be due to base compositional bias at third positions, codon bias, and convergent evolution at nucleotide positions encoding the hydrophobic residues isoleucine, leucine, and valine. LogDet distance methods, as well as maximum-likelihood methods which allow for nonstationary changes in base composition, reduce but do not entirely eliminate support for the spurious resolutions. Inclusion of five additional rhodopsin sequences in the phylogenetic analyses largely corrected one of the spurious reconstructions while leaving the other unaffected. The additional sequences not only were more proximal to the corrected node, but were also found to have intermediate levels of base composition and codon bias as compared with neighboring sequences on the tree. This study shows that the spurious reconstructions can be corrected either by excluding third positions, as well as those encoding the amino acids Ile, Val, and Leu (which may not be ideal, as these sites can contain useful phylogenetic signal for other parts of the tree), or by the addition of sequences that reduce problems associated with convergent evolution.

Effects of sequence on DNA wrapping around histones

Science.gov (United States)

Ortiz, Vanessa

2011-03-01

A central question in biophysics is whether the sequence of a DNA strand affects its mechanical properties. In epigenetics, these are thought to influence nucleosome positioning and gene expression. Theoretical and experimental attempts to answer this question have been hindered by an inability to directly resolve DNA structure and dynamics at the base-pair level. In our previous studies we used a detailed model of DNA to measure the effects of sequence on the stability of naked DNA under bending. Sequence was shown to influence DNA's ability to form kinks, which arise when certain motifs slide past others to form non-native contacts. Here, we have now included histone-DNA interactions to see if the results obtained for naked DNA are transferable to the problem of nucleosome positioning. Different DNA sequences interacting with the histone protein complex are studied, and their equilibrium and mechanical properties are compared among themselves and with the naked case. NLM training grant to the Computation and Informatics in Biology and Medicine Training Program (NLM T15LM007359).

An evaluation of Comparative Genome Sequencing (CGS by comparing two previously-sequenced bacterial genomes

Directory of Open Access Journals (Sweden)

Herring Christopher D

2007-08-01

Full Text Available Abstract Background With the development of new technology, it has recently become practical to resequence the genome of a bacterium after experimental manipulation. It is critical though to know the accuracy of the technique used, and to establish confidence that all of the mutations were detected. Results In order to evaluate the accuracy of genome resequencing using the microarray-based Comparative Genome Sequencing service provided by Nimblegen Systems Inc., we resequenced the E. coli strain W3110 Kohara using MG1655 as a reference, both of which have been completely sequenced using traditional sequencing methods. CGS detected 7 of 8 small sequence differences, one large deletion, and 9 of 12 IS element insertions present in W3110, but did not detect a large chromosomal inversion. In addition, we confirmed that CGS also detected 2 SNPs, one deletion and 7 IS element insertions that are not present in the genome sequence, which we attribute to changes that occurred after the creation of the W3110 lambda clone library. The false positive rate for SNPs was one per 244 Kb of genome sequence. Conclusion CGS is an effective way to detect multiple mutations present in one bacterium relative to another, and while highly cost-effective, is prone to certain errors. Mutations occurring in repeated sequences or in sequences with a high degree of secondary structure may go undetected. It is also critical to follow up on regions of interest in which SNPs were not called because they often indicate deletions or IS element insertions.

Colorimetric and dynamic light scattering detection of DNA sequences by using positively charged gold nanospheres: a comparative study with gold nanorods

Science.gov (United States)

Pylaev, T. E.; Khanadeev, V. A.; Khlebtsov, B. N.; Dykman, L. A.; Bogatyrev, V. A.; Khlebtsov, N. G.

2011-07-01

We introduce a new genosensing approach employing CTAB (cetyltrimethylammonium bromide)-coated positively charged colloidal gold nanoparticles (GNPs) to detect target DNA sequences by using absorption spectroscopy and dynamic light scattering. The approach is compared with a previously reported method employing unmodified CTAB-coated gold nanorods (GNRs). Both approaches are based on the observation that whereas the addition of probe and target ssDNA to CTAB-coated particles results in particle aggregation, no aggregation is observed after addition of probe and nontarget DNA sequences. Our goal was to compare the feasibility and sensitivity of both methods. A 21-mer ssDNA from the human immunodeficiency virus type 1 HIV-1 U5 long terminal repeat (LTR) sequence and a 23-mer ssDNA from the Bacillus anthracis cryptic protein and protective antigen precursor (pagA) genes were used as ssDNA models. In the case of GNRs, unexpectedly, the colorimetric test failed with perfect cigar-like particles but could be performed with dumbbell and dog-bone rods. By contrast, our approach with cationic CTAB-coated GNPs is easy to implement and possesses excellent feasibility with retention of comparable sensitivity—a 0.1 nM concentration of target cDNA can be detected with the naked eye and 10 pM by dynamic light scattering (DLS) measurements. The specificity of our method is illustrated by successful DLS detection of one-three base mismatches in cDNA sequences for both DNA models. These results suggest that the cationic GNPs and DLS can be used for genosensing under optimal DNA hybridization conditions without any chemical modifications of the particle surface with ssDNA molecules and signal amplification. Finally, we discuss a more than two-three-order difference in the reported estimations of the detection sensitivity of colorimetric methods (0.1 to 10-100 pM) to show that the existing aggregation models are inconsistent with the detection limits of about 0.1-1 pM DNA and that

NeSSM: a Next-generation Sequencing Simulator for Metagenomics.

Directory of Open Access Journals (Sweden)

Ben Jia

Full Text Available BACKGROUND: Metagenomics can reveal the vast majority of microbes that have been missed by traditional cultivation-based methods. Due to its extremely wide range of application areas, fast metagenome sequencing simulation systems with high fidelity are in great demand to facilitate the development and comparison of metagenomics analysis tools. RESULTS: We present here a customizable metagenome simulation system: NeSSM (Next-generation Sequencing Simulator for Metagenomics. Combining complete genomes currently available, a community composition table, and sequencing parameters, it can simulate metagenome sequencing better than existing systems. Sequencing error models based on the explicit distribution of errors at each base and sequencing coverage bias are incorporated in the simulation. In order to improve the fidelity of simulation, tools are provided by NeSSM to estimate the sequencing error models, sequencing coverage bias and the community composition directly from existing metagenome sequencing data. Currently, NeSSM supports single-end and pair-end sequencing for both 454 and Illumina platforms. In addition, a GPU (graphics processing units version of NeSSM is also developed to accelerate the simulation. By comparing the simulated sequencing data from NeSSM with experimental metagenome sequencing data, we have demonstrated that NeSSM performs better in many aspects than existing popular metagenome simulators, such as MetaSim, GemSIM and Grinder. The GPU version of NeSSM is more than one-order of magnitude faster than MetaSim. CONCLUSIONS: NeSSM is a fast simulation system for high-throughput metagenome sequencing. It can be helpful to develop tools and evaluate strategies for metagenomics analysis and it's freely available for academic users at http://cbb.sjtu.edu.cn/~ccwei/pub/software/NeSSM.php.

A pneumatic device for rapid loading of DNA sequencing gels.

Science.gov (United States)

Panussis, D A; Cook, M W; Rifkin, L L; Snider, J E; Strong, J T; McGrane, R M; Wilson, R K; Mardis, E R

1998-05-01

This work describes the design and construction of a device that facilitates the loading of DNA samples onto polyacrylamide gels for detection in the Perkin Elmer/Applied Biosystems (PE/ABI) 373 and 377 DNA sequencing instruments. The device is mounted onto the existing gel cassettes and makes the process of loading high-density gels less cumbersome while the associated time and errors are reduced. The principle of operation includes the simultaneous transfer of the entire batch of samples, in which a spring-loaded air cylinder generates positive pressure and flexible silica capillaries transfer the samples. A retractable capillary array carrier allows the delivery ends of the capillaries to be held up clear of the gel during loader attachment on the gel plates, while enabling their insertion in the gel wells once the device is securely mounted. Gel-loading devices capable of simultaneously transferring 72 samples onto the PE/ABI 373 and 377 are currently being used in our production sequencing groups while a 96-sample transfer prototype undergoes testing.

Analysis of high-throughput sequencing and annotation strategies for phage genomes.

Directory of Open Access Journals (Sweden)

Matthew R Henn

Full Text Available BACKGROUND: Bacterial viruses (phages play a critical role in shaping microbial populations as they influence both host mortality and horizontal gene transfer. As such, they have a significant impact on local and global ecosystem function and human health. Despite their importance, little is known about the genomic diversity harbored in phages, as methods to capture complete phage genomes have been hampered by the lack of knowledge about the target genomes, and difficulties in generating sufficient quantities of genomic DNA for sequencing. Of the approximately 550 phage genomes currently available in the public domain, fewer than 5% are marine phage. METHODOLOGY/PRINCIPAL FINDINGS: To advance the study of phage biology through comparative genomic approaches we used marine cyanophage as a model system. We compared DNA preparation methodologies (DNA extraction directly from either phage lysates or CsCl purified phage particles, and sequencing strategies that utilize either Sanger sequencing of a linker amplification shotgun library (LASL or of a whole genome shotgun library (WGSL, or 454 pyrosequencing methods. We demonstrate that genomic DNA sample preparation directly from a phage lysate, combined with 454 pyrosequencing, is best suited for phage genome sequencing at scale, as this method is capable of capturing complete continuous genomes with high accuracy. In addition, we describe an automated annotation informatics pipeline that delivers high-quality annotation and yields few false positives and negatives in ORF calling. CONCLUSIONS/SIGNIFICANCE: These DNA preparation, sequencing and annotation strategies enable a high-throughput approach to the burgeoning field of phage genomics.

An extended sequence specificity for UV-induced DNA damage.

Science.gov (United States)

Chung, Long H; Murray, Vincent

2018-01-01

The sequence specificity of UV-induced DNA damage was determined with a higher precision and accuracy than previously reported. UV light induces two major damage adducts: cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). Employing capillary electrophoresis with laser-induced fluorescence and taking advantages of the distinct properties of the CPDs and 6-4PPs, we studied the sequence specificity of UV-induced DNA damage in a purified DNA sequence using two approaches: end-labelling and a polymerase stop/linear amplification assay. A mitochondrial DNA sequence that contained a random nucleotide composition was employed as the target DNA sequence. With previous methodology, the UV sequence specificity was determined at a dinucleotide or trinucleotide level; however, in this paper, we have extended the UV sequence specificity to a hexanucleotide level. With the end-labelling technique (for 6-4PPs), the consensus sequence was found to be 5'-GCTC*AC (where C* is the breakage site); while with the linear amplification procedure, it was 5'-TCTT*AC. With end-labelling, the dinucleotide frequency of occurrence was highest for 5'-TC*, 5'-TT* and 5'-CC*; whereas it was 5'-TT* for linear amplification. The influence of neighbouring nucleotides on the degree of UV-induced DNA damage was also examined. The core sequences consisted of pyrimidine nucleotides 5'-CTC* and 5'-CTT* while an A at position "1" and C at position "2" enhanced UV-induced DNA damage. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

Genetic signature of strong recent positive selection at interleukin-32 gene in goat

Directory of Open Access Journals (Sweden)

Akhtar Rasool Asif

2017-07-01

Full Text Available Objective Identification of the candidate genes that play key roles in phenotypic variations can provide new information about evolution and positive selection. Interleukin (IL-32 is involved in many biological processes, however, its role for the immune response against various diseases in mammals is poorly understood. Therefore, the current investigation was performed for the better understanding of the molecular evolution and the positive selection of single nucleotide polymorphisms in IL-32 gene. Methods By using fixation index (FST based method, IL-32 (9375 gene was found to be outlier and under significant positive selection with the provisional combined allocation of mean heterozygosity and FST. Using nucleotide sequences of 11 mammalian species from National Center for Biotechnology Information database, the evolutionary selection of IL-32 gene was determined using Maximum likelihood model method, through four models (M1a, M2a, M7, and M8 in Codeml program of phylogenetic analysis by maximum liklihood. Results IL-32 is detected under positive selection using the FST simulations method. The phylogenetic tree revealed that goat IL-32 was in close resemblance with sheep IL-32. The coding nucleotide sequences were compared among 11 species and it was found that the goat IL-32 gene shared identity with sheep (96.54%, bison (91.97%, camel (58.39%, cat (56.59%, buffalo (56.50%, human (56.13%, dog (50.97%, horse (54.04%, and rabbit (53.41% respectively. Conclusion This study provides evidence for IL-32 gene as under significant positive selection in goat.

Safety Assessment of Advanced Imaging Sequences I: Measurements

DEFF Research Database (Denmark)

Jensen, Jørgen Arendt; Rasmussen, Morten Fischer; Pihl, Michael Johannes

2016-01-01

intensity measurement program. The approach can measure and store data for a full imaging sequence in 3.8 to 8.2 s per spatial position. Based on Ispta, MI, and probe surface temperature, the method gives the ability to determine whether a sequence is within US FDA limits, or alternatively indicate how......A method for rapid measurement of intensities (Ispta), mechanical index (MI), and probe surface temperature for any ultrasound scanning sequence is presented. It uses the scanner’s sampling capability to give an accurate measurement of the whole imaging sequence for all emissions to yield the true...... measurement system (Onda Corporation, Sunnyvale, CA, USA). Four different sequences have been measured: a fixed focus emission, a duplex sequence containing B-mode and flow emissions, a vector flow sequence with B-mode and flow emissions in 17 directions, and finally a synthetic aperture (SA) duplex flow...

Application of next generation sequencing in clinical microbiology and infection prevention

NARCIS (Netherlands)

Deurenberg, Ruud H.; Bathoorn, Erik; Chlebowicz, Monika A.; Couto, Natacha; Ferdous, Mithila; Garcia-Cobos, Silvia; Kooistra-Smid, Anna M. D.; Raangs, Erwin C.; Rosema, Sigrid; Veloo, Alida C. M.; Zhou, Kai; Friedrich, Alexander W.; Rossen, John W. A.

2017-01-01

Current molecular diagnostics of human pathogens provide limited information that is often not sufficient for outbreak and transmission investigation. Next generation sequencing (NGS) determines the DNA sequence of a complete bacterial genome in a single sequence run, and from these data,

Comparative analysis of idiom selection and sequencing 5 in Estonian basic school EFL coursebooks

Directory of Open Access Journals (Sweden)

Rita Anita Forssten

2017-05-01

Full Text Available The article investigates the selection and sequencing of the idioms encountered in two locally-produced and international coursebook series currently employed in Estonian basic schools. It is hypothesized that there exists a positive correlation between idioms’ difficulty and coursebooks’ language proficiency level. The hypothesis is tested through a statistical analysis of the idioms found which are categorized in terms of their analysability into three categories where category 1 includes analysable semi-literal idioms, category 2 comprises analysable semi-transparent idioms, and category 3 encompasses non-analysable opaque idioms, and then analysed through an online language corpus (British National Corpus. The results of the study reveal that the coursebook authors under discussion have disregarded idioms’ frequency as a criterion for selection or sequencing, whereas the factor utilized to some extent is the degree of analysability.

DeepSimulator: a deep simulator for Nanopore sequencing

KAUST Repository

Li, Yu

2017-12-23

Motivation: Oxford Nanopore sequencing is a rapidly developed sequencing technology in recent years. To keep pace with the explosion of the downstream data analytical tools, a versatile Nanopore sequencing simulator is needed to complement the experimental data as well as to benchmark those newly developed tools. However, all the currently available simulators are based on simple statistics of the produced reads, which have difficulty in capturing the complex nature of the Nanopore sequencing procedure, the main task of which is the generation of raw electrical current signals. Results: Here we propose a deep learning based simulator, DeepSimulator, to mimic the entire pipeline of Nanopore sequencing. Starting from a given reference genome or assembled contigs, we simulate the electrical current signals by a context-dependent deep learning model, followed by a base-calling procedure to yield simulated reads. This workflow mimics the sequencing procedure more naturally. The thorough experiments performed across four species show that the signals generated by our context-dependent model are more similar to the experimentally obtained signals than the ones generated by the official context-independent pore model. In terms of the simulated reads, we provide a parameter interface to users so that they can obtain the reads with different accuracies ranging from 83% to 97%. The reads generated by the default parameter have almost the same properties as the real data. Two case studies demonstrate the application of DeepSimulator to benefit the development of tools in de novo assembly and in low coverage SNP detection. Availability: The software can be accessed freely at: https://github.com/lykaust15/DeepSimulator.

A universal protocol to generate consensus level genome sequences for foot-and-mouth disease virus and other positive-sense polyadenylated RNA viruses using the Illumina MiSeq.

Science.gov (United States)

Logan, Grace; Freimanis, Graham L; King, David J; Valdazo-González, Begoña; Bachanek-Bankowska, Katarzyna; Sanderson, Nicholas D; Knowles, Nick J; King, Donald P; Cottam, Eleanor M

2014-09-30

Next-Generation Sequencing (NGS) is revolutionizing molecular epidemiology by providing new approaches to undertake whole genome sequencing (WGS) in diagnostic settings for a variety of human and veterinary pathogens. Previous sequencing protocols have been subject to biases such as those encountered during PCR amplification and cell culture, or are restricted by the need for large quantities of starting material. We describe here a simple and robust methodology for the generation of whole genome sequences on the Illumina MiSeq. This protocol is specific for foot-and-mouth disease virus (FMDV) or other polyadenylated RNA viruses and circumvents both the use of PCR and the requirement for large amounts of initial template. The protocol was successfully validated using five FMDV positive clinical samples from the 2001 epidemic in the United Kingdom, as well as a panel of representative viruses from all seven serotypes. In addition, this protocol was successfully used to recover 94% of an FMDV genome that had previously been identified as cell culture negative. Genome sequences from three other non-FMDV polyadenylated RNA viruses (EMCV, ERAV, VESV) were also obtained with minor protocol amendments. We calculated that a minimum coverage depth of 22 reads was required to produce an accurate consensus sequence for FMDV O. This was achieved in 5 FMDV/O/UKG isolates and the type O FMDV from the serotype panel with the exception of the 5' genomic termini and area immediately flanking the poly(C) region. We have developed a universal WGS method for FMDV and other polyadenylated RNA viruses. This method works successfully from a limited quantity of starting material and eliminates the requirement for genome-specific PCR amplification. This protocol has the potential to generate consensus-level sequences within a routine high-throughput diagnostic environment.

Cloning and sequencing of the gene for human β-casein

International Nuclear Information System (INIS)

Loennerdal, B.; Bergstroem, S.; Andersson, Y.; Hialmarsson, K.; Sundgyist, A.; Hernell, O.

1990-01-01

Human β-casein is a major protein in human milk. This protein is part of the casein micelle and has been suggested to have several physiological functions in the newborn. Since there is limited information on βcasein and the factors that affect its concentration in human milk, the authors have isolated and sequenced the gene for this protein. A human mammary gland cDNA library (Clontech) in gt 11 was screened by plaque hy-hybridization using a 42-mer synthetic 32 p-labelled oligo-nucleotide. Positive clones were identified and isolated, DNA was prepared and the gene isolated by cleavage with EcoR1. Following subcloning (PUC18), restriction mapping and Southern blotting, DNA for sequencing was prepared. The gene was sequenced by the dideoxy method. Human β-casein has 212 amino acids and the amino acid sequence deducted from the nucleotide sequence is to 91% identical to the published sequence for human β-casein show a high degree of conservation at the leader peptide and the highly phosphorylated sequences, but also deletions and divergence at several positions. These results provide insight into the structure of the human β-casein gene and will facilitate studies on factors affecting its expression

Amazonian phylogeography: mtDNA sequence variation in arboreal echimyid rodents (Caviomorpha).

Science.gov (United States)

da Silva, M N; Patton, J L

1993-09-01

Patterns of evolutionary relationships among haplotype clades of sequences of the mitochondrial cytochrome b DNA gene are examined for five genera of arboreal rodents of the Caviomorph family Echimyidae from the Amazon Basin. Data are available for 798 bp of sequence from a total of 24 separate localities in Peru, Venezuela, Bolivia, and Brazil for Mesomys, Isothrix, Makalata, Dactylomys, and Echimys. Sequence divergence, corrected for multiple hits, is extensive, ranging from less than 1% for comparisons within populations of over 20% among geographic units within genera. Both the degree of differentiation and the geographic patterning of the variation suggest that more than one species composes the Amazonian distribution of the currently recognized Mesomys hispidus, Isothrix bistriata, Makalata didelphoides, and Dactylomys dactylinus. There is general concordance in the geographic range of haplotype clades for each of these taxa, and the overall level of differentiation within them is largely equivalent. These observations suggest that a common vicariant history underlies the respective diversification of each genus. However, estimated times of divergence based on the rate of third position transversion substitutions for the major clades within each genus typically range above 1 million years. Thus, allopatric isolation precipitating divergence must have been considerably earlier than the late Pleistocene forest fragmentation events commonly invoked for Amazonian biota.

An overview of current developments in position-sensitive hybrid photon detectors and photo-multiplier tubes

CERN Document Server

Gys, Thierry

1999-01-01

Current developments in position-sensitive hybrid photon detectors and photo-multiplier tubes have stimulated increased interest from a variety of fields such as astronomy, biomedical imaging and high- energy physics. These devices are sensitive to single photons over a photon energy spectrum defined by the transmission of the optical entrance window and the photo-cathode type. Their spatial resolution ranges from a few millimeters for pad hybrid photon detectors and multi-anode photo-multiplier tubes down to a few tens of microns for pixel hybrid photon detectors and electron-bombarded charge-coupled devices. Basic technological and design aspects are assessed in this paper. (21 refs).

Determining Switched Reluctance Motor Current Waveforms Exploiting the Transformation from the Time to the Position Domain

Directory of Open Access Journals (Sweden)

Jakub Bernat

2017-06-01

Full Text Available This paper addresses the issue of estimating current waveforms in a switched reluctance motor required to achieve a desired electromagnetic torque. The methodology employed exploits the recently-developed method based on the transformation from the time to the position domain. This transformation takes account of nonlinearities caused by a doubly-salient structure. Owing to this new modelling technique it is possible to solve optimization problems with reference torque, constrained voltage, and parameter sensitivity accounted for. The proposed methodology is verified against published solutions and illustrated through simulations and experiments.

TOUR CONSTRUCTION HEURISTICS FOR AN ORDER SEQUENCING PROBLEM

Directory of Open Access Journals (Sweden)

De Villiers, A. P.

2012-11-01

Full Text Available An order picking system that requires pickers to move in a clockwise direction around a picking line with fixed locations is considered. The problem is divided into three tiers. The tier in which orders must be sequenced is addressed. Eight tour construction heuristics are developed and implemented for an order picking system operating in unidirectional picking lines. Two classes of tour construction heuristics the tour construction starting position ( and the tour construction ending position ( are developed to sequence orders in a picking line. All algorithms are tested and compared using real life data sets. The best solution quality was obtained by a heuristic with adaptations.

WebPrInSeS: automated full-length clone sequence identification and verification using high-throughput sequencing data.

Science.gov (United States)

Massouras, Andreas; Decouttere, Frederik; Hens, Korneel; Deplancke, Bart

2010-07-01

High-throughput sequencing (HTS) is revolutionizing our ability to obtain cheap, fast and reliable sequence information. Many experimental approaches are expected to benefit from the incorporation of such sequencing features in their pipeline. Consequently, software tools that facilitate such an incorporation should be of great interest. In this context, we developed WebPrInSeS, a web server tool allowing automated full-length clone sequence identification and verification using HTS data. WebPrInSeS encompasses two separate software applications. The first is WebPrInSeS-C which performs automated sequence verification of user-defined open-reading frame (ORF) clone libraries. The second is WebPrInSeS-E, which identifies positive hits in cDNA or ORF-based library screening experiments such as yeast one- or two-hybrid assays. Both tools perform de novo assembly using HTS data from any of the three major sequencing platforms. Thus, WebPrInSeS provides a highly integrated, cost-effective and efficient way to sequence-verify or identify clones of interest. WebPrInSeS is available at http://webprinses.epfl.ch/ and is open to all users.

Chromatin accessibility data sets show bias due to sequence specificity of the DNase I enzyme.

Directory of Open Access Journals (Sweden)

Hashem Koohy

Full Text Available DNase I is an enzyme which cuts duplex DNA at a rate that depends strongly upon its chromatin environment. In combination with high-throughput sequencing (HTS technology, it can be used to infer genome-wide landscapes of open chromatin regions. Using this technology, systematic identification of hundreds of thousands of DNase I hypersensitive sites (DHS per cell type has been possible, and this in turn has helped to precisely delineate genomic regulatory compartments. However, to date there has been relatively little investigation into possible biases affecting this data.We report a significant degree of sequence preference spanning sites cut by DNase I in a number of published data sets. The two major protocols in current use each show a different pattern, but for a given protocol the pattern of sequence specificity seems to be quite consistent. The patterns are substantially different from biases seen in other types of HTS data sets, and in some cases the most constrained position lies outside the sequenced fragment, implying that this constraint must relate to the digestion process rather than events occurring during library preparation or sequencing.DNase I is a sequence-specific enzyme, with a specificity that may depend on experimental conditions. This sequence specificity is not taken into account by existing pipelines for identifying open chromatin regions. Care must be taken when interpreting DNase I results, especially when looking at the precise locations of the reads. Future studies may be able to improve the sensitivity and precision of chromatin state measurement by compensating for sequence bias.

The Evolution of Bony Vertebrate Enhancers at Odds with Their Coding Sequence Landscape.

Science.gov (United States)

Yousaf, Aisha; Sohail Raza, Muhammad; Ali Abbasi, Amir

2015-08-06

Enhancers lie at the heart of transcriptional and developmental gene regulation. Therefore, changes in enhancer sequences usually disrupt the target gene expression and result in disease phenotypes. Despite the well-established role of enhancers in development and disease, evolutionary sequence studies are lacking. The current study attempts to unravel the puzzle of bony vertebrates' conserved noncoding elements (CNE) enhancer evolution. Bayesian phylogenetics of enhancer sequences spotlights promising interordinal relationships among placental mammals, proposing a closer relationship between humans and laurasiatherians while placing rodents at the basal position. Clock-based estimates of enhancer evolution provided a dynamic picture of interspecific rate changes across the bony vertebrate lineage. Moreover, coelacanth in the study augmented our appreciation of the vertebrate cis-regulatory evolution during water-land transition. Intriguingly, we observed a pronounced upsurge in enhancer evolution in land-dwelling vertebrates. These novel findings triggered us to further investigate the evolutionary trend of coding as well as CNE nonenhancer repertoires, to highlight the relative evolutionary dynamics of diverse genomic landscapes. Surprisingly, the evolutionary rates of enhancer sequences were clearly at odds with those of the coding and the CNE nonenhancer sequences during vertebrate adaptation to land, with land vertebrates exhibiting significantly reduced rates of coding sequence evolution in comparison to their fast evolving regulatory landscape. The observed variation in tetrapod cis-regulatory elements caused the fine-tuning of associated gene regulatory networks. Therefore, the increased evolutionary rate of tetrapods' enhancer sequences might be responsible for the variation in developmental regulatory circuits during the process of vertebrate adaptation to land. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for

Design of Protein Multi-specificity Using an Independent Sequence Search Reduces the Barrier to Low Energy Sequences.

Directory of Open Access Journals (Sweden)

Alexander M Sevy

2015-07-01

Full Text Available Computational protein design has found great success in engineering proteins for thermodynamic stability, binding specificity, or enzymatic activity in a 'single state' design (SSD paradigm. Multi-specificity design (MSD, on the other hand, involves considering the stability of multiple protein states simultaneously. We have developed a novel MSD algorithm, which we refer to as REstrained CONvergence in multi-specificity design (RECON. The algorithm allows each state to adopt its own sequence throughout the design process rather than enforcing a single sequence on all states. Convergence to a single sequence is encouraged through an incrementally increasing convergence restraint for corresponding positions. Compared to MSD algorithms that enforce (constrain an identical sequence on all states the energy landscape is simplified, which accelerates the search drastically. As a result, RECON can readily be used in simulations with a flexible protein backbone. We have benchmarked RECON on two design tasks. First, we designed antibodies derived from a common germline gene against their diverse targets to assess recovery of the germline, polyspecific sequence. Second, we design "promiscuous", polyspecific proteins against all binding partners and measure recovery of the native sequence. We show that RECON is able to efficiently recover native-like, biologically relevant sequences in this diverse set of protein complexes.

Robustness analysis of chiller sequencing control

International Nuclear Information System (INIS)

Liao, Yundan; Sun, Yongjun; Huang, Gongsheng

2015-01-01

Highlights: • Uncertainties with chiller sequencing control were systematically quantified. • Robustness of chiller sequencing control was systematically analyzed. • Different sequencing control strategies were sensitive to different uncertainties. • A numerical method was developed for easy selection of chiller sequencing control. - Abstract: Multiple-chiller plant is commonly employed in the heating, ventilating and air-conditioning system to increase operational feasibility and energy-efficiency under part load condition. In a multiple-chiller plant, chiller sequencing control plays a key role in achieving overall energy efficiency while not sacrifices the cooling sufficiency for indoor thermal comfort. Various sequencing control strategies have been developed and implemented in practice. Based on the observation that (i) uncertainty, which cannot be avoided in chiller sequencing control, has a significant impact on the control performance and may cause the control fail to achieve the expected control and/or energy performance; and (ii) in current literature few studies have systematically addressed this issue, this paper therefore presents a study on robustness analysis of chiller sequencing control in order to understand the robustness of various chiller sequencing control strategies under different types of uncertainty. Based on the robustness analysis, a simple and applicable method is developed to select the most robust control strategy for a given chiller plant in the presence of uncertainties, which will be verified using case studies

Glutamatergic synaptic currents of nigral dopaminergic neurons follow a postnatal developmental sequence

Directory of Open Access Journals (Sweden)

Edouard ePearlstein

2015-05-01

Full Text Available The spontaneous activity pattern of adult dopaminergic (DA neurons of the substantia nigra pars compacta (SNc results from interactions between intrinsic membrane conductances and afferent inputs. In adult SNc DA neurons, low-frequency tonic background activity is generated by intrinsic pacemaker mechanisms, whereas burst generation depends on intact synaptic inputs in particular the glutamatergic ones. Tonic DA release in the striatum during pacemaking is required to maintain motor activity, and burst firing evokes phasic DA release, necessary for cue-dependent learning tasks. However, it is still unknown how the firing properties of SNc DA neurons mature during postnatal development before reaching the adult state. We studied the postnatal developmental profile of spontaneous and evoked AMPA and NMDA receptor-mediated excitatory postsynaptic currents (EPSCs in SNc DA neurons in brain slices from immature (postnatal days P4-10 and young adult (P30-50 tyrosine hydroxylase (TH-GFP mice. We found that somato-dendritic fields of SNc DA neurons are already mature at P4-10. In contrast, spontaneous glutamatergic EPSCs show a developmental sequence. Spontaneous NMDA EPSCs in particular are larger and more frequent in immature SNc DA neurons than in young adult ones and have a bursty pattern. They are mediated by GluN2B and GluN2D subunit-containing NMDA receptors. The latter generate long-lasting, DQP1105-sensitive, spontaneous EPSCs, which are transiently recorded during this early period. Due to high NMDA activity, immature SNc DA neurons generate large and long lasting NMDA receptor-dependent (APV-sensitive bursts in response to the stimulation of the subthalamic nucleus. We conclude that the transient high NMDA activity allows calcium influx into the dendrites of developing SNc DA neurons.

Challenging a bioinformatic tool's ability to detect microbial contaminants using in silico whole genome sequencing data.

Science.gov (United States)

Olson, Nathan D; Zook, Justin M; Morrow, Jayne B; Lin, Nancy J

2017-01-01

High sensitivity methods such as next generation sequencing and polymerase chain reaction (PCR) are adversely impacted by organismal and DNA contaminants. Current methods for detecting contaminants in microbial materials (genomic DNA and cultures) are not sensitive enough and require either a known or culturable contaminant. Whole genome sequencing (WGS) is a promising approach for detecting contaminants due to its sensitivity and lack of need for a priori assumptions about the contaminant. Prior to applying WGS, we must first understand its limitations for detecting contaminants and potential for false positives. Herein we demonstrate and characterize a WGS-based approach to detect organismal contaminants using an existing metagenomic taxonomic classification algorithm. Simulated WGS datasets from ten genera as individuals and binary mixtures of eight organisms at varying ratios were analyzed to evaluate the role of contaminant concentration and taxonomy on detection. For the individual genomes the false positive contaminants reported depended on the genus, with Staphylococcus , Escherichia , and Shigella having the highest proportion of false positives. For nearly all binary mixtures the contaminant was detected in the in-silico datasets at the equivalent of 1 in 1,000 cells, though F. tularensis was not detected in any of the simulated contaminant mixtures and Y. pestis was only detected at the equivalent of one in 10 cells. Once a WGS method for detecting contaminants is characterized, it can be applied to evaluate microbial material purity, in efforts to ensure that contaminants are characterized in microbial materials used to validate pathogen detection assays, generate genome assemblies for database submission, and benchmark sequencing methods.

Analysis and Visualization Tool for Targeted Amplicon Bisulfite Sequencing on Ion Torrent Sequencers.

Directory of Open Access Journals (Sweden)

Stephan Pabinger

Full Text Available Targeted sequencing of PCR amplicons generated from bisulfite deaminated DNA is a flexible, cost-effective way to study methylation of a sample at single CpG resolution and perform subsequent multi-target, multi-sample comparisons. Currently, no platform specific protocol, support, or analysis solution is provided to perform targeted bisulfite sequencing on a Personal Genome Machine (PGM. Here, we present a novel tool, called TABSAT, for analyzing targeted bisulfite sequencing data generated on Ion Torrent sequencers. The workflow starts with raw sequencing data, performs quality assessment, and uses a tailored version of Bismark to map the reads to a reference genome. The pipeline visualizes results as lollipop plots and is able to deduce specific methylation-patterns present in a sample. The obtained profiles are then summarized and compared between samples. In order to assess the performance of the targeted bisulfite sequencing workflow, 48 samples were used to generate 53 different Bisulfite-Sequencing PCR amplicons from each sample, resulting in 2,544 amplicon targets. We obtained a mean coverage of 282X using 1,196,822 aligned reads. Next, we compared the sequencing results of these targets to the methylation level of the corresponding sites on an Illumina 450k methylation chip. The calculated average Pearson correlation coefficient of 0.91 confirms the sequencing results with one of the industry-leading CpG methylation platforms and shows that targeted amplicon bisulfite sequencing provides an accurate and cost-efficient method for DNA methylation studies, e.g., to provide platform-independent confirmation of Illumina Infinium 450k methylation data. TABSAT offers a novel way to analyze data generated by Ion Torrent instruments and can also be used with data from the Illumina MiSeq platform. It can be easily accessed via the Platomics platform, which offers a web-based graphical user interface along with sample and parameter storage

Characteristics of the positive ion source at reduced gas feed

Energy Technology Data Exchange (ETDEWEB)

Sharma, S. K., E-mail: sksharma@ipr.res.in; Bharathi, P.; Prahlad, V.; Patel, P. J.; Choksi, B.; Jana, M. R.; Bansal, L. K.; Qureshi, K.; Sumod, C. B.; Vadher, V.; Thakkar, D.; Gupta, L. N.; Rambabu, S.; Parmar, S.; Contractor, N.; Sahu, A. K.; Pandya, B.; Sridhar, B.; Pandya, S.; Baruah, U. K. [Institute for Plasma Research, Bhat, Gandhinagar (India)

2014-11-15

The neutral beam injector of steady state superconducting tokamak (SST1-NBI) at IPR is designed for injecting upto 1.7 MW of neutral beam (Hº, 30–55 keV) power to the tokamak plasma for heating and current drive. Operations of the positive ion source (PINI or Plug-In-Neutral-Injector) of SST1-NBI were carried out on the NBI test stand. The PINI was operated at reduced gas feed rate of 2–3 Torr l/s, without using the high speed cryo pumps. Experiments were conducted to achieve a stable beam extraction by optimizing operational parameters namely, the arc current (120–300 A), acceleration voltage (16–40 kV), and a suitable control sequence. The beam divergence, power density profiles, and species fractions (H{sup +}:H{sub 2}{sup +}:H{sub 3}{sup +}) were measured by using the diagnostics such as thermal calorimetry, infrared thermography, and Doppler shift spectroscopy. The maximum extracted beam current was about 18 A. A further increase of beam current was found to be limited by the amount of gas feed rate to the ion source.

Method and apparatus for biological sequence comparison

Science.gov (United States)

Marr, T.G.; Chang, W.I.

1997-12-23

A method and apparatus are disclosed for comparing biological sequences from a known source of sequences, with a subject (query) sequence. The apparatus takes as input a set of target similarity levels (such as evolutionary distances in units of PAM), and finds all fragments of known sequences that are similar to the subject sequence at each target similarity level, and are long enough to be statistically significant. The invention device filters out fragments from the known sequences that are too short, or have a lower average similarity to the subject sequence than is required by each target similarity level. The subject sequence is then compared only to the remaining known sequences to find the best matches. The filtering member divides the subject sequence into overlapping blocks, each block being sufficiently large to contain a minimum-length alignment from a known sequence. For each block, the filter member compares the block with every possible short fragment in the known sequences and determines a best match for each comparison. The determined set of short fragment best matches for the block provide an upper threshold on alignment values. Regions of a certain length from the known sequences that have a mean alignment value upper threshold greater than a target unit score are concatenated to form a union. The current block is compared to the union and provides an indication of best local alignment with the subject sequence. 5 figs.

Statistical guidance for experimental design and data analysis of mutation detection in rare monogenic mendelian diseases by exome sequencing.

Directory of Open Access Journals (Sweden)

Degui Zhi

Full Text Available Recently, whole-genome sequencing, especially exome sequencing, has successfully led to the identification of causal mutations for rare monogenic Mendelian diseases. However, it is unclear whether this approach can be generalized and effectively applied to other Mendelian diseases with high locus heterogeneity. Moreover, the current exome sequencing approach has limitations such as false positive and false negative rates of mutation detection due to sequencing errors and other artifacts, but the impact of these limitations on experimental design has not been systematically analyzed. To address these questions, we present a statistical modeling framework to calculate the power, the probability of identifying truly disease-causing genes, under various inheritance models and experimental conditions, providing guidance for both proper experimental design and data analysis. Based on our model, we found that the exome sequencing approach is well-powered for mutation detection in recessive, but not dominant, Mendelian diseases with high locus heterogeneity. A disease gene responsible for as low as 5% of the disease population can be readily identified by sequencing just 200 unrelated patients. Based on these results, for identifying rare Mendelian disease genes, we propose that a viable approach is to combine, sequence, and analyze patients with the same disease together, leveraging the statistical framework presented in this work.

Organization of the cpe locus in CPE-positive clostridium perfringens type C and D isolates.

Directory of Open Access Journals (Sweden)

Jihong Li

2010-06-01

Full Text Available Clostridium perfringens enterotoxin (encoded by the cpe gene contributes to several important human, and possibly veterinary, enteric diseases. The current study investigated whether cpe locus organization in type C or D isolates resembles one of the three (one chromosomal and two plasmid-borne cpe loci commonly found amongst type A isolates. Multiplex PCR assays capable of detecting sequences in those type A cpe loci failed to amplify products from cpe-positive type C and D isolates, indicating these isolates possess different cpe locus arrangements. Therefore, restriction fragments containing the cpe gene were cloned and sequenced from two type C isolates and one type D isolate. The obtained cpe locus sequences were then used to construct an overlapping PCR assay to assess cpe locus diversity amongst other cpe-positive type C and D isolates. All seven surveyed cpe-positive type C isolates had a plasmid-borne cpe locus partially resembling the cpe locus of type A isolates carrying a chromosomal cpe gene. In contrast, all eight type D isolates shared the same plasmid-borne cpe locus, which differed substantially from the cpe locus present in other C. perfringens by containing two copies of an ORF with 67% identity to a transposase gene (COG4644 found in Tn1546, but not previously associated with the cpe gene. These results identify greater diversity amongst cpe locus organization than previously appreciated, providing new insights into cpe locus evolution. Finally, evidence for cpe gene mobilization was found for both type C and D isolates, which could explain their cpe plasmid diversity.

Position specific variation in the rate of evolution intranscription factor binding sites

Energy Technology Data Exchange (ETDEWEB)

Moses, Alan M.; Chiang, Derek Y.; Kellis, Manolis; Lander, EricS.; Eisen, Michael B.

2003-08-28

The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Here we analyze the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikataeto study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artifacts of computational motif finding algorithms. As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative

Rotor position sensor switches currents in brushless dc motors

Science.gov (United States)

1965-01-01

Reluctance switch incorporated in an induction motor is used for sensing rotor position and switching armature circuits in a brushless dc motor. This device drives the solar array system of an unmanned space satellite.

CT breast dose reduction with the use of breast positioning and organ-based tube current modulation.

Science.gov (United States)

Fu, Wanyi; Tian, Xiaoyu; Sturgeon, Gregory M; Agasthya, Greeshma; Segars, William Paul; Goodsitt, Mitchell M; Kazerooni, Ella A; Samei, Ehsan

2017-02-01

This study aimed to investigate the breast dose reduction potential of a breast-positioning (BP) technique for thoracic CT examinations with organ-based tube current modulation (OTCM). This study included 13 female anthropomorphic computational phantoms (XCAT, age range: 27-65 y.o., weight range: 52-105.8 kg). Each phantom was modified to simulate three breast sizes in standard supine geometry. The modeled breasts were then morphed to emulate BP that constrained the majority of the breast tissue inside the 120° anterior tube current (mA) reduction zone. The OTCM mA value was modeled using a ray-tracing program, which reduced the mA to 20% in the anterior region with a corresponding increase to the posterior region. The organ doses were estimated by a validated Monte Carlo program for a typical clinical CT system (SOMATOM Definition Flash, Siemens Healthcare). The simulated organ doses and organ doses normalized by CTDI vol were used to compare three CT protocols: attenuation-based tube current modulation (ATCM), OTCM, and OTCM with BP (OTCM BP ). On average, compared to ATCM, OTCM reduced breast dose by 19.3 ± 4.5%, whereas OTCM BP reduced breast dose by 38.6 ± 8.1% (an additional 23.8 ± 9.4%). The dose saving of OTCM BP was more significant for larger breasts (on average 33, 38, and 44% reduction for 0.5, 1, and 2 kg breasts, respectively). Compared to ATCM, OTCM BP also reduced thymus and heart dose by 15.1 ± 7.4% and 15.9 ± 6.2% respectively. In thoracic CT examinations, OTCM with a breast-positioning technique can markedly reduce unnecessary exposure to radiosensitive organs in anterior chest wall, specifically breast tissue. The breast dose reduction is more notable for women with larger breasts. © 2016 American Association of Physicists in Medicine.

Phylogenetic relationships in Peniocereus (Cactaceae) inferred from plastid DNA sequence data.

Science.gov (United States)

Arias, Salvador; Terrazas, Teresa; Arreola-Nava, Hilda J; Vázquez-Sánchez, Monserrat; Cameron, Kenneth M

2005-10-01

The phylogenetic relationships of Peniocereus (Cactaceae) species were studied using parsimony analyses of DNA sequence data. The plastid rpl16 and trnL-F regions were sequenced for 98 taxa including 17 species of Peniocereus, representatives from all genera of tribe Pachycereeae, four genera of tribe Hylocereeae, as well as from three additional outgroup genera of tribes Calymmantheae, Notocacteae, and Trichocereeae. Phylogenetic analyses support neither the monophyly of Peniocereus as currently circumscribed, nor the monophyly of tribe Pachycereeae since species of Peniocereus subgenus Pseudoacanthocereus are embedded within tribe Hylocereeae. Furthermore, these results show that the eight species of Peniocereus subgenus Peniocereus (Peniocereus sensu stricto) form a well-supported clade within subtribe Pachycereinae; P. serpentinus is also a member of this subtribe, but is sister to Bergerocactus. Moreover, Nyctocereus should be resurrected as a monotypic genus. Species of Peniocereus subgenus Pseudoacanthocereus are positioned among species of Acanthocereus within tribe Hylocereeae, indicating that they may be better classified within that genus. A number of morphological and anatomical characters, especially related to the presence or absence of dimorphic branches, are discussed to support these relationships.

Direct typing of Canine parvovirus (CPV) from infected dog faeces by rapid mini sequencing technique.

Science.gov (United States)

V, Pavana Jyothi; S, Akila; Selvan, Malini K; Naidu, Hariprasad; Raghunathan, Shwethaa; Kota, Sathish; Sundaram, R C Raja; Rana, Samir Kumar; Raj, G Dhinakar; Srinivasan, V A; Mohana Subramanian, B

2016-12-01

Canine parvovirus (CPV) is a non-enveloped single stranded DNA virus with an icosahedral capsid. Mini-sequencing based CPV typing was developed earlier to detect and differentiate all the CPV types and FPV in a single reaction. This technique was further evaluated in the present study by performing the mini-sequencing directly from fecal samples which avoided tedious virus isolation steps by cell culture system. Fecal swab samples were collected from 84 dogs with enteritis symptoms, suggestive of parvoviral infection from different locations across India. Seventy six of these samples were positive by PCR; the subsequent mini-sequencing reaction typed 74 of them as type 2a virus, and 2 samples as type 2b. Additionally, 25 of the positive samples were typed by cycle sequencing of PCR products. Direct CPV typing from fecal samples using mini-sequencing showed 100% correlation with CPV typing by cycle sequencing. Moreover, CPV typing was achieved by mini-sequencing even with faintly positive PCR amplicons which was not possible by cycle sequencing. Therefore, the mini-sequencing technique is recommended for regular epidemiological follow up of CPV types, since the technique is rapid, highly sensitive and high capacity method for CPV typing. Copyright © 2016. Published by Elsevier B.V.

Current Situation and Reforms Making Way for Future Positive Developments in the National Education System of Bulgaria: An Overview

Science.gov (United States)

Genova, Teodora

2015-01-01

This paper on the education system of Bulgaria is aimed at presenting its structure, current situation, problems and challenges that it faces, and on-going reforms leading to some positive trends in the development of the national education sector. At the moment of writing this paper in the year 2015, we will mark the 1160th anniversary of the…

DELIMINATE--a fast and efficient method for loss-less compression of genomic sequences: sequence analysis.

Science.gov (United States)

Mohammed, Monzoorul Haque; Dutta, Anirban; Bose, Tungadri; Chadaram, Sudha; Mande, Sharmila S

2012-10-01

An unprecedented quantity of genome sequence data is currently being generated using next-generation sequencing platforms. This has necessitated the development of novel bioinformatics approaches and algorithms that not only facilitate a meaningful analysis of these data but also aid in efficient compression, storage, retrieval and transmission of huge volumes of the generated data. We present a novel compression algorithm (DELIMINATE) that can rapidly compress genomic sequence data in a loss-less fashion. Validation results indicate relatively higher compression efficiency of DELIMINATE when compared with popular general purpose compression algorithms, namely, gzip, bzip2 and lzma. Linux, Windows and Mac implementations (both 32 and 64-bit) of DELIMINATE are freely available for download at: http://metagenomics.atc.tcs.com/compression/DELIMINATE. sharmila@atc.tcs.com Supplementary data are available at Bioinformatics online.

Degree sequence in message transfer

Science.gov (United States)

Yamuna, M.

2017-11-01

Message encryption is always an issue in current communication scenario. Methods are being devised using various domains. Graphs satisfy numerous unique properties which can be used for message transfer. In this paper, I propose a message encryption method based on degree sequence of graphs.

Modeling of Prepregs during Automated Draping Sequences

DEFF Research Database (Denmark)

Krogh, Christian; Glud, Jens Ammitzbøll; Jakobsen, Johnny

2017-01-01

algorithm used to generate target points on the mold which are used as input to a draping sequence planner. The draping sequence planner prescribes the displacement history for each gripper in the drape tool and these displacements are then applied to each gripper in a transient model of the draping...... sequence. The model is based on a transient finite element analysis with the material’s constitutive behavior currently being approximated as linear elastic orthotropic. In-plane tensile and bias-extension tests as well as bending tests are conducted and used as input for the model. The virtual draping...

Current position of phenobarbital in epilepsy and its future.

Science.gov (United States)

Brodie, Martin J; Kwan, Patrick

2012-12-01

This article reviews the current position of phenobarbital using articles published since 2000 and speculates on its likely future contribution to epilepsy care. Over the last decade there have been no major double-blind randomized placebo-controlled or comparative trials with phenobarbital. Previous studies have suggested that phenobarbital is as effective in monotherapy as phenytoin and carbamazepine. Several observational studies undertaken in developing countries over the last decade have confirmed its efficacy and safety for the common epilepsies. This was particularly so in the substantial demonstration project undertaken in rural China under the auspices of the World Health Organization in partnership with the International League Against Epilepsy and International Bureau for Epilepsy. Phenobarbital is still widely used for neonatal and childhood seizures and for drug-resistant convulsive and nonconvulsive status epilepticus. Recent data have confirmed in a prospective cohort of women taking phenobarbital as monotherapy that the drug can be associated with a range of congenital defects in exposed infants. Much effort has gone into exploring the apparent contradiction of higher withdrawal rates due to cognitive and behavioral side effects in studies undertaken in developed countries but not in those sited in the developing world. A raft of data over the last 10 years, including a systematic review, showed no important differences between the tolerability of phenobarbital compared to that with other antiepileptic drugs. Finally, cognitive test scores and mood ratings in 136 people with epilepsy receiving phenobarbital for a year were similar to those in 137 age-, sex-, and education-matched controls in a number of Chinese villages. Indeed, there were some cognitive gains in the patients possibly due to improved seizure control. Phenobarbital is still the most cost-effective pharmacologic treatment for epilepsy. All these data predict a healthy future for

HPV-QUEST: A highly customized system for automated HPV sequence analysis capable of processing Next Generation sequencing data set.

Science.gov (United States)

Yin, Li; Yao, Jiqiang; Gardner, Brent P; Chang, Kaifen; Yu, Fahong; Goodenow, Maureen M

2012-01-01

Next Generation sequencing (NGS) applied to human papilloma viruses (HPV) can provide sensitive methods to investigate the molecular epidemiology of multiple type HPV infection. Currently a genotyping system with a comprehensive collection of updated HPV reference sequences and a capacity to handle NGS data sets is lacking. HPV-QUEST was developed as an automated and rapid HPV genotyping system. The web-based HPV-QUEST subtyping algorithm was developed using HTML, PHP, Perl scripting language, and MYSQL as the database backend. HPV-QUEST includes a database of annotated HPV reference sequences with updated nomenclature covering 5 genuses, 14 species and 150 mucosal and cutaneous types to genotype blasted query sequences. HPV-QUEST processes up to 10 megabases of sequences within 1 to 2 minutes. Results are reported in html, text and excel formats and display e-value, blast score, and local and coverage identities; provide genus, species, type, infection site and risk for the best matched reference HPV sequence; and produce results ready for additional analyses.

The International Nucleotide Sequence Database Collaboration.

Science.gov (United States)

Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu

2011-01-01

Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.

Independent Control of Positive- and Negative-Sequence Current Components in a Doubly Fed Machine

Czech Academy of Sciences Publication Activity Database

Bendl, Jiří; Chomát, Miroslav; Schreier, Luděk

2005-01-01

Roč. 15, č. 3 (2005), s. 191-202 ISSN 1430-144X R&D Projects: GA ČR(CZ) GA102/03/0046 Institutional research plan: CEZ:AV0Z20570509 Keywords : vector control * adjustable speed generation systems * converter control Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering Impact factor: 0.056, year: 2005

Scalable Kernel Methods and Algorithms for General Sequence Analysis

Science.gov (United States)

Kuksa, Pavel

2011-01-01

Analysis of large-scale sequential data has become an important task in machine learning and pattern recognition, inspired in part by numerous scientific and technological applications such as the document and text classification or the analysis of biological sequences. However, current computational methods for sequence comparison still lack…

Phylogenetic position of Loricifera inferred from nearly complete 18S and 28S rRNA gene sequences.

Science.gov (United States)

Yamasaki, Hiroshi; Fujimoto, Shinta; Miyazaki, Katsumi

2015-01-01

Loricifera is an enigmatic metazoan phylum; its morphology appeared to place it with Priapulida and Kinorhyncha in the group Scalidophora which, along with Nematoida (Nematoda and Nematomorpha), comprised the group Cycloneuralia. Scarce molecular data have suggested an alternative phylogenetic hypothesis, that the phylum Loricifera is a sister taxon to Nematomorpha, although the actual phylogenetic position of the phylum remains unclear. Ecdysozoan phylogeny was reconstructed through maximum-likelihood (ML) and Bayesian inference (BI) analyses of nuclear 18S and 28S rRNA gene sequences from 60 species representing all eight ecdysozoan phyla, and including a newly collected loriciferan species. Ecdysozoa comprised two clades with high support values in both the ML and BI trees. One consisted of Priapulida and Kinorhyncha, and the other of Loricifera, Nematoida, and Panarthropoda (Tardigrada, Onychophora, and Arthropoda). The relationships between Loricifera, Nematoida, and Panarthropoda were not well resolved. Loricifera appears to be closely related to Nematoida and Panarthropoda, rather than grouping with Priapulida and Kinorhyncha, as had been suggested by previous studies. Thus, both Scalidophora and Cycloneuralia are a polyphyletic or paraphyletic groups. In addition, Loricifera and Nematomorpha did not emerge as sister groups.

Effect of pulse sequence parameter selection on signal strength in positive-contrast MRI markers for MRI-based prostate postimplant assessment

Energy Technology Data Exchange (ETDEWEB)

Lim, Tze Yee [Department of Radiation Physics, The University of Texas MD Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, Texas 77030 and The University of Texas at Houston Graduate School of Biomedical Sciences, 6767 Bertner Avenue, Houston, Texas 77030 (United States); Kudchadker, Rajat J., E-mail: rkudchad@mdanderson.org; Wang, Jihong; Ibbott, Geoffrey S. [Department of Radiation Physics, The University of Texas MD Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, Texas 77030 (United States); Stafford, R. Jason [Department of Imaging Physics, The University of Texas MD Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, Texas 77030 (United States); MacLellan, Christopher [Department of Imaging Physics, The University of Texas MD Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, Texas 77030 and The University of Texas at Houston Graduate School of Biomedical Sciences, 6767 Bertner Avenue, Houston, Texas 77030 (United States); Rao, Arvind [Department of Bioinformatics and Computational Biology, The University of Texas MD Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, Texas 77030 (United States); Frank, Steven J. [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, Texas 77030 (United States)

2016-07-15

Purpose: For postimplant dosimetric assessment, computed tomography (CT) is commonly used to identify prostate brachytherapy seeds, at the expense of accurate anatomical contouring. Magnetic resonance imaging (MRI) is superior to CT for anatomical delineation, but identification of the negative-contrast seeds is challenging. Positive-contrast MRI markers were proposed to replace spacers to assist seed localization on MRI images. Visualization of these markers under varying scan parameters was investigated. Methods: To simulate a clinical scenario, a prostate phantom was implanted with 66 markers and 86 seeds, and imaged on a 3.0T MRI scanner using a 3D fast radiofrequency-spoiled gradient recalled echo acquisition with various combinations of scan parameters. Scan parameters, including flip angle, number of excitations, bandwidth, field-of-view, slice thickness, and encoding steps were systematically varied to study their effects on signal, noise, scan time, image resolution, and artifacts. Results: The effects of pulse sequence parameter selection on the marker signal strength and image noise were characterized. The authors also examined the tradeoff between signal-to-noise ratio, scan time, and image artifacts, such as the wraparound artifact, susceptibility artifact, chemical shift artifact, and partial volume averaging artifact. Given reasonable scan time and managable artifacts, the authors recommended scan parameter combinations that can provide robust visualization of the MRI markers. Conclusions: The recommended MRI pulse sequence protocol allows for consistent visualization of the markers to assist seed localization, potentially enabling MRI-only prostate postimplant dosimetry.

Detecting Positive Selection of Korean Native Goat Populations Using Next-Generation Sequencing

Science.gov (United States)

Lee, Wonseok; Ahn, Sojin; Taye, Mengistie; Sung, Samsun; Lee, Hyun-Jeong; Cho, Seoae; Kim, Heebal

2016-01-01

Goats (Capra hircus) are one of the oldest species of domesticated animals. Native Korean goats are a particularly interesting group, as they are indigenous to the area and were raised in the Korean peninsula almost 2,000 years ago. Although they have a small body size and produce low volumes of milk and meat, they are quite resistant to lumbar paralysis. Our study aimed to reveal the distinct genetic features and patterns of selection in native Korean goats by comparing the genomes of native Korean goat and crossbred goat populations. We sequenced the whole genome of 15 native Korean goats and 11 crossbred goats using next-generation sequencing (Illumina platform) to compare the genomes of the two populations. We found decreased nucleotide diversity in the native Korean goats compared to the crossbred goats. Genetic structural analysis demonstrated that the native Korean goat and crossbred goat populations shared a common ancestry, but were clearly distinct. Finally, to reveal the native Korean goat’s selective sweep region, selective sweep signals were identified in the native Korean goat genome using cross-population extended haplotype homozygosity (XP-EHH) and a cross-population composite likelihood ratio test (XP-CLR). As a result, we were able to identify candidate genes for recent selection, such as the CCR3 gene, which is related to lumbar paralysis resistance. Combined with future studies and recent goat genome information, this study will contribute to a thorough understanding of the native Korean goat genome. PMID:27989103

Detecting Positive Selection of Korean Native Goat Populations Using Next-Generation Sequencing.

Science.gov (United States)

Lee, Wonseok; Ahn, Sojin; Taye, Mengistie; Sung, Samsun; Lee, Hyun-Jeong; Cho, Seoae; Kim, Heebal

2016-12-01

Goats ( Capra hircus ) are one of the oldest species of domesticated animals. Native Korean goats are a particularly interesting group, as they are indigenous to the area and were raised in the Korean peninsula almost 2,000 years ago. Although they have a small body size and produce low volumes of milk and meat, they are quite resistant to lumbar paralysis. Our study aimed to reveal the distinct genetic features and patterns of selection in native Korean goats by comparing the genomes of native Korean goat and crossbred goat populations. We sequenced the whole genome of 15 native Korean goats and 11 crossbred goats using next-generation sequencing (Illumina platform) to compare the genomes of the two populations. We found decreased nucleotide diversity in the native Korean goats compared to the crossbred goats. Genetic structural analysis demonstrated that the native Korean goat and crossbred goat populations shared a common ancestry, but were clearly distinct. Finally, to reveal the native Korean goat's selective sweep region, selective sweep signals were identified in the native Korean goat genome using cross-population extended haplotype homozygosity (XP-EHH) and a cross-population composite likelihood ratio test (XP-CLR). As a result, we were able to identify candidate genes for recent selection, such as the CCR3 gene, which is related to lumbar paralysis resistance. Combined with future studies and recent goat genome information, this study will contribute to a thorough understanding of the native Korean goat genome.

Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

Directory of Open Access Journals (Sweden)

Moore JE

2006-01-01

Full Text Available Abstract Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted.

Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

Science.gov (United States)

Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC

2006-01-01

Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935

Insight into biases and sequencing errors for amplicon sequencing with the Illumina MiSeq platform.

Science.gov (United States)

Schirmer, Melanie; Ijaz, Umer Z; D'Amore, Rosalinda; Hall, Neil; Sloan, William T; Quince, Christopher

2015-03-31

With read lengths of currently up to 2 × 300 bp, high throughput and low sequencing costs Illumina's MiSeq is becoming one of the most utilized sequencing platforms worldwide. The platform is manageable and affordable even for smaller labs. This enables quick turnaround on a broad range of applications such as targeted gene sequencing, metagenomics, small genome sequencing and clinical molecular diagnostics. However, Illumina error profiles are still poorly understood and programs are therefore not designed for the idiosyncrasies of Illumina data. A better knowledge of the error patterns is essential for sequence analysis and vital if we are to draw valid conclusions. Studying true genetic variation in a population sample is fundamental for understanding diseases, evolution and origin. We conducted a large study on the error patterns for the MiSeq based on 16S rRNA amplicon sequencing data. We tested state-of-the-art library preparation methods for amplicon sequencing and showed that the library preparation method and the choice of primers are the most significant sources of bias and cause distinct error patterns. Furthermore we tested the efficiency of various error correction strategies and identified quality trimming (Sickle) combined with error correction (BayesHammer) followed by read overlapping (PANDAseq) as the most successful approach, reducing substitution error rates on average by 93%. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Next-generation sequencing (NGS) for assessment of microbial water quality: current progress, challenges, and future opportunities

OpenAIRE

BoonFei eTan; Charmaine Marie Ng; Jean Pierre Nshimyimana; Jean Pierre Nshimyimana; Lay-Leng eLoh; Lay-Leng eLoh; Karina Yew-Hoong Gin; Janelle Renee Thompson; Janelle Renee Thompson

2015-01-01

Water quality is an emergent property of a complex system comprised of interacting microbial populations and introduced microbial and chemical contaminants. Studies leveraging next-generation sequencing (NGS) technologies are providing new insights into the ecology of microbially mediated processes that influence fresh water quality such as algal blooms, contaminant biodegradation, and pathogen dissemination. In addition, sequencing methods targeting small subunit (SSU) rRNA hypervariable reg...

Sequencing of bimaxillary surgery in the correction of vertical maxillary excess: retrospective study.

Science.gov (United States)

Salmen, F S; de Oliveira, T F M; Gabrielli, M A C; Pereira Filho, V A; Real Gabrielli, M F

2018-06-01

The aim of this study was to evaluate the precision of bimaxillary surgery performed to correct vertical maxillary excess, when the procedure is sequenced with mandibular surgery first or maxillary surgery first. Thirty-two patients, divided into two groups, were included in this retrospective study. Group 1 comprised patients who received bimaxillary surgery following the classical sequence with repositioning of the maxilla first. Patients in group 2 received bimaxillary surgery, but the mandible was operated on first. The precision of the maxillomandibular repositioning was determined by comparison of the digital prediction and postoperative tracings superimposed on the cranial base. The data were tabulated and analyzed statistically. In this sample, both surgical sequences provided adequate clinical accuracy. The classical sequence, repositioning the maxilla first, resulted in greater accuracy for A-point and the upper incisor edge vertical position. Repositioning the mandible first allowed greater precision in the vertical position of pogonion. In conclusion, although both surgical sequences may be used, repositioning the mandible first will result in greater imprecision in relation to the predictive tracing than repositioning the maxilla first. The classical sequence resulted in greater accuracy in the vertical position of the maxilla, which is key for aesthetics. Copyright © 2017 International Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.

Sequence Quality Analysis Tool for HIV Type 1 Protease and Reverse Transcriptase

OpenAIRE

DeLong, Allison K.; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W.; Kantor, Rami

2012-01-01

Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802...

Classification of DNA nucleotides with transverse tunneling currents

Science.gov (United States)

Pedersen, Jonas Nyvold; Boynton, Paul; Ventra, Massimiliano Di; Jauho, Antti-Pekka; Flyvbjerg, Henrik

2016-01-01

It has been theoretically suggested and experimentally demonstrated that fast and low-cost sequencing of DNA, RNA, and peptide molecules might be achieved by passing such molecules between electrodes embedded in a nanochannel. The experimental realization of this scheme faces major challenges, however. In realistic liquid environments, typical currents in tunnelling devices are of the order of picoamps. This corresponds to only six electrons per microsecond, and this number affects the integration time required to do current measurements in real experiments. This limits the speed of sequencing, though current fluctuations due to Brownian motion of the molecule average out during the required integration time. Moreover, data acquisition equipment introduces noise, and electronic filters create correlations in time-series data. We discuss how these effects must be included in the analysis of, e.g., the assignment of specific nucleobases to current signals. As the signals from different molecules overlap, unambiguous classification is impossible with a single measurement. We argue that the assignment of molecules to a signal is a standard pattern classification problem and calculation of the error rates is straightforward. The ideas presented here can be extended to other sequencing approaches of current interest. PMID:27897144

Classification of DNA nucleotides with transverse tunneling currents

Science.gov (United States)

Nyvold Pedersen, Jonas; Boynton, Paul; Di Ventra, Massimiliano; Jauho, Antti-Pekka; Flyvbjerg, Henrik

2017-01-01

It has been theoretically suggested and experimentally demonstrated that fast and low-cost sequencing of DNA, RNA, and peptide molecules might be achieved by passing such molecules between electrodes embedded in a nanochannel. The experimental realization of this scheme faces major challenges, however. In realistic liquid environments, typical currents in tunneling devices are of the order of picoamps. This corresponds to only six electrons per microsecond, and this number affects the integration time required to do current measurements in real experiments. This limits the speed of sequencing, though current fluctuations due to Brownian motion of the molecule average out during the required integration time. Moreover, data acquisition equipment introduces noise, and electronic filters create correlations in time-series data. We discuss how these effects must be included in the analysis of, e.g., the assignment of specific nucleobases to current signals. As the signals from different molecules overlap, unambiguous classification is impossible with a single measurement. We argue that the assignment of molecules to a signal is a standard pattern classification problem and calculation of the error rates is straightforward. The ideas presented here can be extended to other sequencing approaches of current interest.

Repetitive sequences and epigenetic modification: inseparable partners play important roles in the evolution of plant sex chromosomes.

Science.gov (United States)

Li, Shu-Fen; Zhang, Guo-Jun; Yuan, Jin-Hong; Deng, Chuan-Liang; Gao, Wu-Jun

2016-05-01

The present review discusses the roles of repetitive sequences played in plant sex chromosome evolution, and highlights epigenetic modification as potential mechanism of repetitive sequences involved in sex chromosome evolution. Sex determination in plants is mostly based on sex chromosomes. Classic theory proposes that sex chromosomes evolve from a specific pair of autosomes with emergence of a sex-determining gene(s). Subsequently, the newly formed sex chromosomes stop recombination in a small region around the sex-determining locus, and over time, the non-recombining region expands to almost all parts of the sex chromosomes. Accumulation of repetitive sequences, mostly transposable elements and tandem repeats, is a conspicuous feature of the non-recombining region of the Y chromosome, even in primitive one. Repetitive sequences may play multiple roles in sex chromosome evolution, such as triggering heterochromatization and causing recombination suppression, leading to structural and morphological differentiation of sex chromosomes, and promoting Y chromosome degeneration and X chromosome dosage compensation. In this article, we review the current status of this field, and based on preliminary evidence, we posit that repetitive sequences are involved in sex chromosome evolution probably via epigenetic modification, such as DNA and histone methylation, with small interfering RNAs as the mediator.

Compressing DNA sequence databases with coil

Directory of Open Access Journals (Sweden)

Hendy Michael D

2008-05-01

Full Text Available Abstract Background Publicly available DNA sequence databases such as GenBank are large, and are growing at an exponential rate. The sheer volume of data being dealt with presents serious storage and data communications problems. Currently, sequence data is usually kept in large "flat files," which are then compressed using standard Lempel-Ziv (gzip compression – an approach which rarely achieves good compression ratios. While much research has been done on compressing individual DNA sequences, surprisingly little has focused on the compression of entire databases of such sequences. In this study we introduce the sequence database compression software coil. Results We have designed and implemented a portable software package, coil, for compressing and decompressing DNA sequence databases based on the idea of edit-tree coding. coil is geared towards achieving high compression ratios at the expense of execution time and memory usage during compression – the compression time represents a "one-off investment" whose cost is quickly amortised if the resulting compressed file is transmitted many times. Decompression requires little memory and is extremely fast. We demonstrate a 5% improvement in compression ratio over state-of-the-art general-purpose compression tools for a large GenBank database file containing Expressed Sequence Tag (EST data. Finally, coil can efficiently encode incremental additions to a sequence database. Conclusion coil presents a compelling alternative to conventional compression of flat files for the storage and distribution of DNA sequence databases having a narrow distribution of sequence lengths, such as EST data. Increasing compression levels for databases having a wide distribution of sequence lengths is a direction for future work.

Complete genome sequence of a novel pestivirus from sheep.

Science.gov (United States)

Becher, Paul; Schmeiser, Stefanie; Oguzoglu, Tuba Cigdem; Postel, Alexander

2012-10-01

We report here the complete genome sequence of pestivirus strain Aydin/04-TR, which is the prototype of a group of similar viruses currently present in sheep and goats in Turkey. Sequence data from this virus showed that it clusters separately from the established and previously proposed tentative pestivirus species.

Complete Genome Sequence of a Novel Pestivirus from Sheep

OpenAIRE

Becher, Paul; Schmeiser, Stefanie; Oguzoglu, Tuba Cigdem; Postel, Alexander

2012-01-01

We report here the complete genome sequence of pestivirus strain Aydin/04-TR, which is the prototype of a group of similar viruses currently present in sheep and goats in Turkey. Sequence data from this virus showed that it clusters separately from the established and previously proposed tentative pestivirus species.

Positive Streptobacillus moniliformis PCR in guinea pigs likely due to Leptotrichia spp.

Science.gov (United States)

Boot, Ron; Van de Berg, Lia; Reubsaet, Frans A G; Vlemminx, Maurice J

2008-04-30

Streptobacillus moniliformis is a zoonotic bacterium. We obtained positive S. moniliformis PCR results in oral swab samples from guinea pigs from an experimental colony and the breeding colony of origin. Comparison of the DNA sequence of an amplicon with deposited 16S rDNA sequences revealed that Leptotrichia sp. can be the source of a false positive S. moniliformis PCR outcome.

Identification of genomic insertion and flanking sequence of G2-EPSPS and GAT transgenes in soybean using whole genome sequencing method

Directory of Open Access Journals (Sweden)

Bingfu Guo

2016-07-01

Full Text Available Molecular characterization of sequences flanking exogenous fragment insertions is essential for safety assessment and labeling of genetically modified organisms (GMO. In this study, the T-DNA insertion sites and flanking sequences were identified in two newly developed transgenic glyphosate-tolerant soybeans GE-J16 and ZH10-6 based on whole genome sequencing (WGS method. About 21 Gb sequence data (~21× coverage for each line was generated on Illumina HiSeq 2500 platform. The junction reads mapped to boundary of T-DNA and flanking sequences in these two events were identified by comparing all sequencing reads with soybean reference genome and sequence of transgenic vector. The putative insertion loci and flanking sequences were further confirmed by PCR amplification, Sanger sequencing, and co-segregation analysis. All these analyses supported that exogenous T-DNA fragments were integrated in positions of Chr19: 50543767-50543792 and Chr17: 7980527-7980541 in these two transgenic lines. Identification of the genomic insertion site of the G2-EPSPS and GAT transgenes will facilitate the use of their glyphosate-tolerant traits in soybean breeding program. These results also demonstrated that WGS is a cost-effective and rapid method of identifying sites of T-DNA insertions and flanking sequences in soybean.

The evolutionary position of nematodes

Directory of Open Access Journals (Sweden)

Gojobori Takashi

2002-04-01

Full Text Available Abstract Background The complete genomes of three animals have been sequenced by global research efforts: a nematode worm (Caenorhabditis elegans, an insect (Drosophila melanogaster, and a vertebrate (Homo sapiens. Remarkably, their relationships have yet to be clarified. The confusion concerns the enigmatic position of nematodes. Traditionally, nematodes have occupied a basal position, in part because they lack a true body cavity. However, the leading hypothesis now joins nematodes with arthropods in a molting clade, Ecdysozoa, based on data from several genes. Results We tested the Ecdysozoa hypothesis with analyses of more than 100 nuclear protein alignments, under conditions that would expose biases, and found that it was not supported. Instead, we found significant support for the traditional hypothesis, Coelomata. Our result is robust to different rates of sequence change among genes and lineages, different numbers of taxa, and different species of nematodes. Conclusion We conclude that insects (arthropods are genetically and evolutionarily closer to humans than to nematode worms.

Fluency First: Reversing the Traditional ESL Sequence.

Science.gov (United States)

MacGowan-Gilhooly, Adele

1991-01-01

Describes an ESL department's whole language approach to writing and reading, replacing its traditional grammar-based ESL instructional sequence. Reports the positive quantitative and qualitative results of the first three years of using the new approach. (KEH)

Forward Genetics by Sequencing EMS Variation-Induced Inbred Lines

Directory of Open Access Journals (Sweden)

Charles Addo-Quaye

2017-02-01

Full Text Available In order to leverage novel sequencing techniques for cloning genes in eukaryotic organisms with complex genomes, the false positive rate of variant discovery must be controlled for by experimental design and informatics. We sequenced five lines from three pedigrees of ethyl methanesulfonate (EMS-mutagenized Sorghum bicolor, including a pedigree segregating a recessive dwarf mutant. Comparing the sequences of the lines, we were able to identify and eliminate error-prone positions. One genomic region contained EMS mutant alleles in dwarfs that were homozygous reference sequences in wild-type siblings and heterozygous in segregating families. This region contained a single nonsynonymous change that cosegregated with dwarfism in a validation population and caused a premature stop codon in the Sorghum ortholog encoding the gibberellic acid (GA biosynthetic enzyme ent-kaurene oxidase. Application of exogenous GA rescued the mutant phenotype. Our method for mapping did not require outcrossing and introduced no segregation variance. This enables work when line crossing is complicated by life history, permitting gene discovery outside of genetic models. This inverts the historical approach of first using recombination to define a locus and then sequencing genes. Our formally identical approach first sequences all the genes and then seeks cosegregation with the trait. Mutagenized lines lacking obvious phenotypic alterations are available for an extension of this approach: mapping with a known marker set in a line that is phenotypically identical to starting material for EMS mutant generation.

Supplementary data: Comparative studies on sequence ...

Indian Academy of Sciences (India)

Unknown

Page 1. Supplementary data: Comparative studies on sequence characteristics around translation initiation codon in four eukaryotes. Qingpo Liu and Qingzhong Xue. J. Genet. 84, 317–322. Table 1. Spearman's rank correlation coefficients of 39 base positions around the AUG codon in the four eukaryotic species studied.

Algorithms for detection of objects in image sequences captured from an airborne imaging system

Science.gov (United States)

Kasturi, Rangachar; Camps, Octavia; Tang, Yuan-Liang; Devadiga, Sadashiva; Gandhi, Tarak

1995-01-01

This research was initiated as a part of the effort at the NASA Ames Research Center to design a computer vision based system that can enhance the safety of navigation by aiding the pilots in detecting various obstacles on the runway during critical section of the flight such as a landing maneuver. The primary goal is the development of algorithms for detection of moving objects from a sequence of images obtained from an on-board video camera. Image regions corresponding to the independently moving objects are segmented from the background by applying constraint filtering on the optical flow computed from the initial few frames of the sequence. These detected regions are tracked over subsequent frames using a model based tracking algorithm. Position and velocity of the moving objects in the world coordinate is estimated using an extended Kalman filter. The algorithms are tested using the NASA line image sequence with six static trucks and a simulated moving truck and experimental results are described. Various limitations of the currently implemented version of the above algorithm are identified and possible solutions to build a practical working system are investigated.

Arbitrarily accurate twin composite π -pulse sequences

Science.gov (United States)

Torosov, Boyan T.; Vitanov, Nikolay V.

2018-04-01

We present three classes of symmetric broadband composite pulse sequences. The composite phases are given by analytic formulas (rational fractions of π ) valid for any number of constituent pulses. The transition probability is expressed by simple analytic formulas and the order of pulse area error compensation grows linearly with the number of pulses. Therefore, any desired compensation order can be produced by an appropriate composite sequence; in this sense, they are arbitrarily accurate. These composite pulses perform equally well as or better than previously published ones. Moreover, the current sequences are more flexible as they allow total pulse areas of arbitrary integer multiples of π .

MAP Estimation of Chin and Cheek Contours in Video Sequences

Directory of Open Access Journals (Sweden)

Kampmann Markus

2004-01-01

Full Text Available An algorithm for the estimation of chin and cheek contours in video sequences is proposed. This algorithm exploits a priori knowledge about shape and position of chin and cheek contours in images. Exploiting knowledge about the shape, a parametric 2D model representing chin and cheek contours is introduced. Exploiting knowledge about the position, a MAP estimator is developed taking into account the observed luminance gradient as well as a priori probabilities of chin and cheek contours positions. The proposed algorithm was tested with head and shoulder video sequences (image resolution CIF. In nearly 70% of all investigated video frames, a subjectively error free estimation could be achieved. The 2D estimate error is measured as on average between 2.4 and .

Influence of upper extremity positioning on pain, paresthesia, and tolerance: advancing current practice.

Science.gov (United States)

Lester, Mark E; Hazelton, Jill; Dewey, William S; Casey, James C; Richard, Reginald

2013-01-01

Loss of upper extremity motion caused by axillary burn scar contracture is a major complication of burn injury. Positioning acutely injured patients with axillary burns in positions above 90° of shoulder abduction may improve shoulder motion and minimize scar contracture. However, these positions may increase injury risk to the nerves of the brachial plexus. This study evaluated the occurrence of paresthesias, pain, and positional intolerance in four shoulder abduction positions in healthy adults. Sixty men and women were placed in four randomly assigned shoulder abduction positions for up to 2 hours: 1) 90° with elbow extension (90 ABD); 2) 130° with elbow flexion at 110° (130 ABD); 3) 150° with elbow extension (150 ABD); and 4) 170° with elbow extension (170 ABD). Outcome measures were assessed at baseline and every 30 minutes and included the occurrence of upper extremity paresthesias, position comfort/tolerance, and pain. Transient paresthesias, lasting less than 3 minutes, occurred in all test positions in 10 to 37% of the cases. Significantly fewer subjects reported paresthesias in the 90 ABD position compared with the other positions (P < .01). Pain was reported more frequently in the 170° position (68%) compared with the other positions (P < .01). Positioning with the elbow flexed or in terminal extension is not recommended, regardless of the degree of shoulder abduction. Positioning patients in a position of 150° of shoulder abduction was shown to be safe and well tolerated. Consideration of positions above this range should be undertaken cautiously and only with strict monitoring in alert and oriented patients for short time periods.

Spatio-temporal alignment of pedobarographic image sequences.

Science.gov (United States)

Oliveira, Francisco P M; Sousa, Andreia; Santos, Rubim; Tavares, João Manuel R S

2011-07-01

This article presents a methodology to align plantar pressure image sequences simultaneously in time and space. The spatial position and orientation of a foot in a sequence are changed to match the foot represented in a second sequence. Simultaneously with the spatial alignment, the temporal scale of the first sequence is transformed with the aim of synchronizing the two input footsteps. Consequently, the spatial correspondence of the foot regions along the sequences as well as the temporal synchronizing is automatically attained, making the study easier and more straightforward. In terms of spatial alignment, the methodology can use one of four possible geometric transformation models: rigid, similarity, affine, or projective. In the temporal alignment, a polynomial transformation up to the 4th degree can be adopted in order to model linear and curved time behaviors. Suitable geometric and temporal transformations are found by minimizing the mean squared error (MSE) between the input sequences. The methodology was tested on a set of real image sequences acquired from a common pedobarographic device. When used in experimental cases generated by applying geometric and temporal control transformations, the methodology revealed high accuracy. In addition, the intra-subject alignment tests from real plantar pressure image sequences showed that the curved temporal models produced better MSE results (P alignment of pedobarographic image data, since previous methods can only be applied on static images.

The OGCleaner: filtering false-positive homology clusters.

Science.gov (United States)

Fujimoto, M Stanley; Suvorov, Anton; Jensen, Nicholas O; Clement, Mark J; Snell, Quinn; Bybee, Seth M

2017-01-01

Detecting homologous sequences in organisms is an essential step in protein structure and function prediction, gene annotation and phylogenetic tree construction. Heuristic methods are often employed for quality control of putative homology clusters. These heuristics, however, usually only apply to pairwise sequence comparison and do not examine clusters as a whole. We present the Orthology Group Cleaner (the OGCleaner), a tool designed for filtering putative orthology groups as homology or non-homology clusters by considering all sequences in a cluster. The OGCleaner relies on high-quality orthologous groups identified in OrthoDB to train machine learning algorithms that are able to distinguish between true-positive and false-positive homology groups. This package aims to improve the quality of phylogenetic tree construction especially in instances of lower-quality transcriptome assemblies. https://github.com/byucsl/ogcleaner CONTACT: sfujimoto@gmail.comSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Positioning consumption

DEFF Research Database (Denmark)

Halkier, Bente; Keller, Margit

2014-01-01

positionings emerges based on empirical examples of research in parent–children consumption. Positionings are flexible discursive fixations of the relationship between the performances of the practitioner, other practitioners, media discourse and consumption activities. The basic positioning types...... are the practice maintenance and the practice change position, with different sorts of adapting in between. Media discourse can become a resource for a resistant position against social control or for an appropriating position in favour of space for action. Regardless of the current relation to a particular media......This article analyses the ways in which media discourses become a part of contested consumption activities. We apply a positioning perspective with practice theory to focus on how practitioners relate to media discourse as a symbolic resource in their everyday practices. A typology of performance...

Reprint of "Application of next generation sequencing in clinical microbiology and infection prevention"

NARCIS (Netherlands)

Deurenberg, Ruud H.; Bathoorn, Erik; Chlebowicz, Monika A.; Monge Gomes do Couto, Natacha; Ferdous, Mithila; Garcia-Cobos, Silvia; Kooistra-Smid, Anna M. D.; Raangs, Erwin C.; Rosema, Sigrid; Veloo, Alida C. M.; Zhou, Kai; Friedrich, Alexander W.; Rossen, John W. A.

2017-01-01

Current molecular diagnostics of human pathogens provide limited information that is often not sufficient for outbreak and transmission investigation. Next generation sequencing (NGS) determines the DNA sequence of a complete bacterial genome in a single sequence run, and from these data,

Sequence determinants of human microsatellite variability

Directory of Open Access Journals (Sweden)

Jakobsson Mattias

2009-12-01

Full Text Available Abstract Background Microsatellite loci are frequently used in genomic studies of DNA sequence repeats and in population studies of genetic variability. To investigate the effect of sequence properties of microsatellites on their level of variability we have analyzed genotypes at 627 microsatellite loci in 1,048 worldwide individuals from the HGDP-CEPH cell line panel together with the DNA sequences of these microsatellites in the human RefSeq database. Results Calibrating PCR fragment lengths in individual genotypes by using the RefSeq sequence enabled us to infer repeat number in the HGDP-CEPH dataset and to calculate the mean number of repeats (as opposed to the mean PCR fragment length, under the assumption that differences in PCR fragment length reflect differences in the numbers of repeats in the embedded repeat sequences. We find the mean and maximum numbers of repeats across individuals to be positively correlated with heterozygosity. The size and composition of the repeat unit of a microsatellite are also important factors in predicting heterozygosity, with tetra-nucleotide repeat units high in G/C content leading to higher heterozygosity. Finally, we find that microsatellites containing more separate sets of repeated motifs generally have higher heterozygosity. Conclusions These results suggest that sequence properties of microsatellites have a significant impact in determining the features of human microsatellite variability.

Beta band transcranial alternating (tACS and direct current stimulation (tDCS applied after initial learning facilitate retrieval of a motor sequence

Directory of Open Access Journals (Sweden)

Vanessa eKrause

2016-01-01

Full Text Available The primary motor cortex (M1 contributes to the acquisition and early consolidation of a motor sequence. Although the relevance of M1 excitability for motor learning has been supported, the significance of M1 oscillations remains an open issue. This study aims at investigating to what extent retrieval of a newly learned motor sequence can be differentially affected by motor-cortical transcranial alternating (tACS and direct current stimulation (tDCS. Alpha (10 Hz, beta (20 Hz or sham tACS was applied in 36 right-handers. Anodal or cathodal tDCS was applied in 30 right-handers. Participants learned an eight-digit serial reaction time task (SRTT; sequential vs. random with the right hand. Stimulation was applied to the left M1 after SRTT acquisition at rest for ten minutes. Reaction times were analyzed at baseline, end of acquisition, retrieval immediately after stimulation and reacquisition after eight further sequence repetitions.Reaction times during retrieval were significantly faster following 20 Hz tACS as compared to 10 Hz and sham tACS indicating a facilitation of early consolidation. TDCS yielded faster reaction times, too, independent of polarity. No significant differences between 20 Hz tACS and tDCS effects on retrieval were found suggesting that 20 Hz effects might be associated with altered motor-cortical excitability. Based on the behavioural modulation yielded by tACS and tDCS one might speculate that altered motor-cortical beta oscillations support early motor consolidation possibly associated with neuroplastic reorganization.

Preparing Historically Underserved Students for STEM Careers: The Role of an Inquiry-based High School Science Sequence Beginning with Physics

Science.gov (United States)

Bridges, Jon P.

Improving the STEM readiness of students from historically underserved groups is a moral and economic imperative requiring greater attention and effort than has been shown to date. The current literature suggests a high school science sequence beginning with physics and centered on developing conceptual understanding, using inquiry labs and modeling to allow students to explore new ideas, and addressing and correcting student misconceptions can increase student interest in and preparation for STEM careers. The purpose of this study was to determine if the science college readiness of historically underserved students can be improved by implementing an inquiry-based high school science sequence comprised of coursework in physics, chemistry, and biology for every student. The study used a retrospective cohort observational design to address the primary research question: are there differences between historically underserved students completing a Physics First science sequence and their peers completing a traditional science sequence in 1) science college-readiness test scores, 2) rates of science college-and career-readiness, and 3) interest in STEM? Small positive effects were found for all three outcomes for historically underserved students in the Physics First sequence.

Biophysical and structural considerations for protein sequence evolution

Directory of Open Access Journals (Sweden)

Grahnen Johan A

2011-12-01

Full Text Available Abstract Background Protein sequence evolution is constrained by the biophysics of folding and function, causing interdependence between interacting sites in the sequence. However, current site-independent models of sequence evolutions do not take this into account. Recent attempts to integrate the influence of structure and biophysics into phylogenetic models via statistical/informational approaches have not resulted in expected improvements in model performance. This suggests that further innovations are needed for progress in this field. Results Here we develop a coarse-grained physics-based model of protein folding and binding function, and compare it to a popular informational model. We find that both models violate the assumption of the native sequence being close to a thermodynamic optimum, causing directional selection away from the native state. Sampling and simulation show that the physics-based model is more specific for fold-defining interactions that vary less among residue type. The informational model diffuses further in sequence space with fewer barriers and tends to provide less support for an invariant sites model, although amino acid substitutions are generally conservative. Both approaches produce sequences with natural features like dN/dS Conclusions Simple coarse-grained models of protein folding can describe some natural features of evolving proteins but are currently not accurate enough to use in evolutionary inference. This is partly due to improper packing of the hydrophobic core. We suggest possible improvements on the representation of structure, folding energy, and binding function, as regards both native and non-native conformations, and describe a large number of possible applications for such a model.

Reducing false-positive incidental findings with ensemble genotyping and logistic regression based variant filtering methods.

Science.gov (United States)

Hwang, Kyu-Baek; Lee, In-Hee; Park, Jin-Ho; Hambuch, Tina; Choe, Yongjoon; Kim, MinHyeok; Lee, Kyungjoon; Song, Taemin; Neu, Matthew B; Gupta, Neha; Kohane, Isaac S; Green, Robert C; Kong, Sek Won

2014-08-01

As whole genome sequencing (WGS) uncovers variants associated with rare and common diseases, an immediate challenge is to minimize false-positive findings due to sequencing and variant calling errors. False positives can be reduced by combining results from orthogonal sequencing methods, but costly. Here, we present variant filtering approaches using logistic regression (LR) and ensemble genotyping to minimize false positives without sacrificing sensitivity. We evaluated the methods using paired WGS datasets of an extended family prepared using two sequencing platforms and a validated set of variants in NA12878. Using LR or ensemble genotyping based filtering, false-negative rates were significantly reduced by 1.1- to 17.8-fold at the same levels of false discovery rates (5.4% for heterozygous and 4.5% for homozygous single nucleotide variants (SNVs); 30.0% for heterozygous and 18.7% for homozygous insertions; 25.2% for heterozygous and 16.6% for homozygous deletions) compared to the filtering based on genotype quality scores. Moreover, ensemble genotyping excluded > 98% (105,080 of 107,167) of false positives while retaining > 95% (897 of 937) of true positives in de novo mutation (DNM) discovery in NA12878, and performed better than a consensus method using two sequencing platforms. Our proposed methods were effective in prioritizing phenotype-associated variants, and an ensemble genotyping would be essential to minimize false-positive DNM candidates. © 2014 WILEY PERIODICALS, INC.

Zebra finches can use positional and transitional cues to distinguish vocal element strings.

Science.gov (United States)

Chen, Jiani; Ten Cate, Carel

2015-08-01

Learning sequences is of great importance to humans and non-human animals. Many motor and mental actions, such as singing in birds and speech processing in humans, rely on sequential learning. At least two mechanisms are considered to be involved in such learning. The chaining theory proposes that learning of sequences relies on memorizing the transitions between adjacent items, while the positional theory suggests that learners encode the items according to their ordinal position in the sequence. Positional learning is assumed to dominate sequential learning. However, human infants exposed to a string of speech sounds can learn transitional (chaining) cues. So far, it is not clear whether birds, an increasingly important model for examining vocal processing, can do this. In this study we use a Go-Nogo design to examine whether zebra finches can use transitional cues to distinguish artificially constructed strings of song elements. Zebra finches were trained with sequences differing in transitional and positional information and next tested with novel strings sharing positional and transitional similarities with the training strings. The results show that they can attend to both transitional and positional cues and that their sequential coding strategies can be biased toward transitional cues depending on the learning context. This article is part of a Special Issue entitled: In Honor of Jerry Hogan. Copyright © 2014 Elsevier B.V. All rights reserved.

Short read sequence typing (SRST: multi-locus sequence types from short reads

Directory of Open Access Journals (Sweden)

Inouye Michael

2012-07-01

Full Text Available Abstract Background Multi-locus sequence typing (MLST has become the gold standard for population analyses of bacterial pathogens. This method focuses on the sequences of a small number of loci (usually seven to divide the population and is simple, robust and facilitates comparison of results between laboratories and over time. Over the last decade, researchers and population health specialists have invested substantial effort in building up public MLST databases for nearly 100 different bacterial species, and these databases contain a wealth of important information linked to MLST sequence types such as time and place of isolation, host or niche, serotype and even clinical or drug resistance profiles. Recent advances in sequencing technology mean it is increasingly feasible to perform bacterial population analysis at the whole genome level. This offers massive gains in resolving power and genetic profiling compared to MLST, and will eventually replace MLST for bacterial typing and population analysis. However given the wealth of data currently available in MLST databases, it is crucial to maintain backwards compatibility with MLST schemes so that new genome analyses can be understood in their proper historical context. Results We present a software tool, SRST, for quick and accurate retrieval of sequence types from short read sets, using inputs easily downloaded from public databases. SRST uses read mapping and an allele assignment score incorporating sequence coverage and variability, to determine the most likely allele at each MLST locus. Analysis of over 3,500 loci in more than 500 publicly accessible Illumina read sets showed SRST to be highly accurate at allele assignment. SRST output is compatible with common analysis tools such as eBURST, Clonal Frame or PhyloViz, allowing easy comparison between novel genome data and MLST data. Alignment, fastq and pileup files can also be generated for novel alleles. Conclusions SRST is a novel

Quality control of next-generation sequencing library through an integrative digital microfluidic platform.

Science.gov (United States)

Thaitrong, Numrin; Kim, Hanyoup; Renzi, Ronald F; Bartsch, Michael S; Meagher, Robert J; Patel, Kamlesh D

2012-12-01

We have developed an automated quality control (QC) platform for next-generation sequencing (NGS) library characterization by integrating a droplet-based digital microfluidic (DMF) system with a capillary-based reagent delivery unit and a quantitative CE module. Using an in-plane capillary-DMF interface, a prepared sample droplet was actuated into position between the ground electrode and the inlet of the separation capillary to complete the circuit for an electrokinetic injection. Using a DNA ladder as an internal standard, the CE module with a compact LIF detector was capable of detecting dsDNA in the range of 5-100 pg/μL, suitable for the amount of DNA required by the Illumina Genome Analyzer sequencing platform. This DMF-CE platform consumes tenfold less sample volume than the current Agilent BioAnalyzer QC technique, preserving precious sample while providing necessary sensitivity and accuracy for optimal sequencing performance. The ability of this microfluidic system to validate NGS library preparation was demonstrated by examining the effects of limited-cycle PCR amplification on the size distribution and the yield of Illumina-compatible libraries, demonstrating that as few as ten cycles of PCR bias the size distribution of the library toward undesirable larger fragments. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Sequence of a cloned cDNA encoding human ribosomal protein S11

Energy Technology Data Exchange (ETDEWEB)

Lott, J B; Mackie, G A

1988-02-11

The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.

Magnetic resonance imaging of the shoulder: Rationale and current applications

International Nuclear Information System (INIS)

Holt, R.G.; Helms, C.A.; Steinbach, L.; Neumann, C.; Munk, P.L.; Genant, H.K.

1990-01-01

Because it can demonstrate a wide range of tissue contrast with excellent resolution, magnetic resonance (MR) imaging has revolutionized imaging in many areas of the musculoskeletal system and has generated excitement among those interested in the painful shoulder. Shoulder impingement syndrome and glenohumeral instability constitute the two major categories of shoulder derangements. Correct diagnosis requires the use of appropriate pulse sequences and imaging planes, proper patient positioning, and a satisfactory surface coil. In addition the imager must have a thorough understanding of shoulder anatomy and pathology. We present a summary of the current status of MR imaging of the shoulder including technical, anatomic, and pathologic considerations and a review of the pertinent literature. (orig.)

The"minimum information about an environmental sequence" (MIENS) specification

Energy Technology Data Exchange (ETDEWEB)

Yilmaz, P.; Kottmann, R.; Field, D.; Knight, R.; Cole, J.R.; Amaral-Zettler, L.; Gilbert, J.A.; Karsch-Mizrachi, I.; Johnston, A.; Cochrane, G.; Vaughan, R.; Hunter, C.; Park, J.; Morrison, N.; Rocca-Serra, P.; Sterk, P.; Arumugam, M.; Baumgartner, L.; Birren, B.W.; Blaser, M.J.; Bonazzi, V.; Bork, P.; Buttigieg, P. L.; Chain, P.; Costello, E.K.; Huot-Creasy, H.; Dawyndt, P.; DeSantis, T.; Fierer, N.; Fuhrman, J.; Gallery, R.E.; Gibbs, R.A.; Giglio, M.G.; Gil, I. San; Gonzalez, A.; Gordon, J.I.; Guralnick, R.; Hankeln, W.; Highlander, S.; Hugenholtz, P.; Jansson, J.; Kennedy, J.; Knights, D.; Koren, O.; Kuczynski, J.; Kyrpides, N.; Larsen, R.; Lauber, C.L.; Legg, T.; Ley, R.E.; Lozupone, C.A.; Ludwig, W.; Lyons, D.; Maguire, E.; Methe, B.A.; Meyer, F.; Nakieny, S.; Nelson, K.E.; Nemergut, D.; Neufeld, J.D.; Pace, N.R.; Palanisamy, G.; Peplies, J.; Peterson, J.; Petrosino, J.; Proctor, L.; Raes, J.; Ratnasingham, S.; Ravel, J.; Relman, D.A.; Assunta-Sansone, S.; Schriml, L.; Sodergren, E.; Spor, A.; Stombaugh, J.; Tiedje, J.M.; Ward, D.V.; Weinstock, G.M.; Wendel, D.; White, O.; Wikle, A.; Wortman, J.R.; Glockner, F.O.; Bushman, F.D.; Charlson, E.; Gevers, D.; Kelley, S.T.; Neubold, L.K.; Oliver, A.E.; Pruesse, E.; Quast, C.; Schloss, P.D.; Sinha, R.; Whitely, A.

2010-10-15

We present the Genomic Standards Consortium's (GSC) 'Minimum Information about an ENvironmental Sequence' (MIENS) standard for describing marker genes. Adoption of MIENS will enhance our ability to analyze natural genetic diversity across the Tree of Life as it is currently being documented by massive DNA sequencing efforts from myriad ecosystems in our ever-changing biosphere.

Experimental assessment of the importance of amino acid positions identified by an entropy-based correlation analysis of multiple-sequence alignments.

Science.gov (United States)

Dietrich, Susanne; Borst, Nadine; Schlee, Sandra; Schneider, Daniel; Janda, Jan-Oliver; Sterner, Reinhard; Merkl, Rainer

2012-07-17

The analysis of a multiple-sequence alignment (MSA) with correlation methods identifies pairs of residue positions whose occupation with amino acids changes in a concerted manner. It is plausible to assume that positions that are part of many such correlation pairs are important for protein function or stability. We have used the algorithm H2r to identify positions k in the MSAs of the enzymes anthranilate phosphoribosyl transferase (AnPRT) and indole-3-glycerol phosphate synthase (IGPS) that show a high conn(k) value, i.e., a large number of significant correlations in which k is involved. The importance of the identified residues was experimentally validated by performing mutagenesis studies with sAnPRT and sIGPS from the archaeon Sulfolobus solfataricus. For sAnPRT, five H2r mutant proteins were generated by replacing nonconserved residues with alanine or the prevalent residue of the MSA. As a control, five residues with conn(k) values of zero were chosen randomly and replaced with alanine. The catalytic activities and conformational stabilities of the H2r and control mutant proteins were analyzed by steady-state enzyme kinetics and thermal unfolding studies. Compared to wild-type sAnPRT, the catalytic efficiencies (k(cat)/K(M)) were largely unaltered. In contrast, the apparent thermal unfolding temperature (T(M)(app)) was lowered in most proteins. Remarkably, the strongest observed destabilization (ΔT(M)(app) = 14 °C) was caused by the V284A exchange, which pertains to the position with the highest correlation signal [conn(k) = 11]. For sIGPS, six H2r mutant and four control proteins with alanine exchanges were generated and characterized. The k(cat)/K(M) values of four H2r mutant proteins were reduced between 13- and 120-fold, and their T(M)(app) values were decreased by up to 5 °C. For the sIGPS control proteins, the observed activity and stability decreases were much less severe. Our findings demonstrate that positions with high conn(k) values have an

Expressed Sequence Tag-Simple Sequence Repeat (EST-SSR Marker Resources for Diversity Analysis of Mango (Mangifera indica L.

Directory of Open Access Journals (Sweden)

Natalie L. Dillon

2014-01-01

Full Text Available In this study, a collection of 24,840 expressed sequence tags (ESTs generated from five mango (Mangifera indica L. cDNA libraries was mined for EST-based simple sequence repeat (SSR markers. Over 1,000 ESTs with SSR motifs were detected from more than 24,000 EST sequences with di- and tri-nucleotide repeat motifs the most abundant. Of these, 25 EST-SSRs in genes involved in plant development, stress response, and fruit color and flavor development pathways were selected, developed into PCR markers and characterized in a population of 32 mango selections including M. indica varieties, and related Mangifera species. Twenty-four of the 25 EST-SSR markers exhibited polymorphisms, identifying a total of 86 alleles with an average of 5.38 alleles per locus, and distinguished between all Mangifera selections. Private alleles were identified for Mangifera species. These newly developed EST-SSR markers enhance the current 11 SSR mango genetic identity panel utilized by the Australian Mango Breeding Program. The current panel has been used to identify progeny and parents for selection and the application of this extended panel will further improve and help to design mango hybridization strategies for increased breeding efficiency.

Statistical convergence of a non-positive approximation process

International Nuclear Information System (INIS)

Agratini, Octavian

2011-01-01

Highlights: → A general class of approximation processes is introduced. → The A-statistical convergence is studied. → Applications in quantum calculus are delivered. - Abstract: Starting from a general sequence of linear and positive operators of discrete type, we associate its r-th order generalization. This construction involves high order derivatives of a signal and it looses the positivity property. Considering that the initial approximation process is A-statistically uniform convergent, we prove that the property is inherited by the new sequence. Also, our result includes information about the uniform convergence. Two applications in q-Calculus are presented. We study q-analogues both of Meyer-Koenig and Zeller operators and Stancu operators.

Very high resolution single pass HLA genotyping using amplicon sequencing on the 454 next generation DNA sequencers: Comparison with Sanger sequencing.

Science.gov (United States)

Yamamoto, F; Höglund, B; Fernandez-Vina, M; Tyan, D; Rastrou, M; Williams, T; Moonsamy, P; Goodridge, D; Anderson, M; Erlich, H A; Holcomb, C L

2015-12-01

Compared to Sanger sequencing, next-generation sequencing offers advantages for high resolution HLA genotyping including increased throughput, lower cost, and reduced genotype ambiguity. Here we describe an enhancement of the Roche 454 GS GType HLA genotyping assay to provide very high resolution (VHR) typing, by the addition of 8 primer pairs to the original 14, to genotype 11 HLA loci. These additional amplicons help resolve common and well-documented alleles and exclude commonly found null alleles in genotype ambiguity strings. Simplification of workflow to reduce the initial preparation effort using early pooling of amplicons or the Fluidigm Access Array™ is also described. Performance of the VHR assay was evaluated on 28 well characterized cell lines using Conexio Assign MPS software which uses genomic, rather than cDNA, reference sequence. Concordance was 98.4%; 1.6% had no genotype assignment. Of concordant calls, 53% were unambiguous. To further assess the assay, 59 clinical samples were genotyped and results compared to unambiguous allele assignments obtained by prior sequence-based typing supplemented with SSO and/or SSP. Concordance was 98.7% with 58.2% as unambiguous calls; 1.3% could not be assigned. Our results show that the amplicon-based VHR assay is robust and can replace current Sanger methodology. Together with software enhancements, it has the potential to provide even higher resolution HLA typing. Copyright © 2015. Published by Elsevier Inc.

New scoring schema for finding motifs in DNA Sequences

Directory of Open Access Journals (Sweden)

Nowzari-Dalini Abbas

2009-03-01

Full Text Available Abstract Background Pattern discovery in DNA sequences is one of the most fundamental problems in molecular biology with important applications in finding regulatory signals and transcription factor binding sites. An important task in this problem is to search (or predict known binding sites in a new DNA sequence. For this reason, all subsequences of the given DNA sequence are scored based on an scoring function and the prediction is done by selecting the best score. By assuming no dependency between binding site base positions, most of the available tools for known binding site prediction are designed. Recently Tomovic and Oakeley investigated the statistical basis for either a claim of dependence or independence, to determine whether such a claim is generally true, and they presented a scoring function for binding site prediction based on the dependency between binding site base positions. Our primary objective is to investigate the scoring functions which can be used in known binding site prediction based on the assumption of dependency or independency in binding site base positions. Results We propose a new scoring function based on the dependency between all positions in biding site base positions. This scoring function uses joint information content and mutual information as a measure of dependency between positions in transcription factor binding site. Our method for modeling dependencies is simply an extension of position independency methods. We evaluate our new scoring function on the real data sets extracted from JASPAR and TRANSFAC data bases, and compare the obtained results with two other well known scoring functions. Conclusion The results demonstrate that the new approach improves known binding site discovery and show that the joint information content and mutual information provide a better and more general criterion to investigate the relationships between positions in the TFBS. Our scoring function is formulated by simple

A Window Into Clinical Next-Generation Sequencing-Based Oncology Testing Practices.

Science.gov (United States)

Nagarajan, Rakesh; Bartley, Angela N; Bridge, Julia A; Jennings, Lawrence J; Kamel-Reid, Suzanne; Kim, Annette; Lazar, Alexander J; Lindeman, Neal I; Moncur, Joel; Rai, Alex J; Routbort, Mark J; Vasalos, Patricia; Merker, Jason D

2017-12-01

- Detection of acquired variants in cancer is a paradigm of precision medicine, yet little has been reported about clinical laboratory practices across a broad range of laboratories. - To use College of American Pathologists proficiency testing survey results to report on the results from surveys on next-generation sequencing-based oncology testing practices. - College of American Pathologists proficiency testing survey results from more than 250 laboratories currently performing molecular oncology testing were used to determine laboratory trends in next-generation sequencing-based oncology testing. - These presented data provide key information about the number of laboratories that currently offer or are planning to offer next-generation sequencing-based oncology testing. Furthermore, we present data from 60 laboratories performing next-generation sequencing-based oncology testing regarding specimen requirements and assay characteristics. The findings indicate that most laboratories are performing tumor-only targeted sequencing to detect single-nucleotide variants and small insertions and deletions, using desktop sequencers and predesigned commercial kits. Despite these trends, a diversity of approaches to testing exists. - This information should be useful to further inform a variety of topics, including national discussions involving clinical laboratory quality systems, regulation and oversight of next-generation sequencing-based oncology testing, and precision oncology efforts in a data-driven manner.

StralSV: assessment of sequence variability within similar 3D structures and application to polio RNA-dependent RNA polymerase

Energy Technology Data Exchange (ETDEWEB)

Zemla, A; Lang, D; Kostova, T; Andino, R; Zhou, C

2010-11-29

Most of the currently used methods for protein function prediction rely on sequence-based comparisons between a query protein and those for which a functional annotation is provided. A serious limitation of sequence similarity-based approaches for identifying residue conservation among proteins is the low confidence in assigning residue-residue correspondences among proteins when the level of sequence identity between the compared proteins is poor. Multiple sequence alignment methods are more satisfactory - still, they cannot provide reliable results at low levels of sequence identity. Our goal in the current work was to develop an algorithm that could overcome these difficulties and facilitate the identification of structurally (and possibly functionally) relevant residue-residue correspondences between compared protein structures. Here we present StralSV, a new algorithm for detecting closely related structure fragments and quantifying residue frequency from tight local structure alignments. We apply StralSV in a study of the RNA-dependent RNA polymerase of poliovirus and demonstrate that the algorithm can be used to determine regions of the protein that are relatively unique or that shared structural similarity with structures that are distantly related. By quantifying residue frequencies among many residue-residue pairs extracted from local alignments, one can infer potential structural or functional importance of specific residues that are determined to be highly conserved or that deviate from a consensus. We further demonstrate that considerable detailed structural and phylogenetic information can be derived from StralSV analyses. StralSV is a new structure-based algorithm for identifying and aligning structure fragments that have similarity to a reference protein. StralSV analysis can be used to quantify residue-residue correspondences and identify residues that may be of particular structural or functional importance, as well as unusual or unexpected

Human pro. cap alpha. 1(III) collagen: cDNA sequence for the 3' end

Energy Technology Data Exchange (ETDEWEB)

Mankoo, B S; Dalgleish, R

1988-03-25

The authors have previously isolated two overlapping cDNA clones, pIII-21 and pIII-33, which encode the C-terminal end of human type III procollagen. They now present the sequence of 2520 bases encoded in these cDNAs which overlaps other previously published sequences for the same gene. The sequence presented differs from previously published sequences at five positions.

Benign and Deleterious Cystic Fibrosis Transmembrane Conductance Regulator Mutations Identified by Sequencing in Positive Cystic Fibrosis Newborn Screen Children from California.

Science.gov (United States)

Salinas, Danieli B; Sosnay, Patrick R; Azen, Colleen; Young, Suzanne; Raraigh, Karen S; Keens, Thomas G; Kharrazi, Martin

2016-01-01

Of the 2007 Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) mutations, 202 have been assigned disease liability. California's racially diverse population, along with CFTR sequencing as part of newborn screening model, provides the opportunity to examine the phenotypes of children with uncategorized mutations to help inform disease liability and penetrance. We conducted a retrospective cohort study based on children screened from 2007 to 2011 and followed for two to six years. Newborns that screened positive were divided into three genotype groups: those with two CF-causing mutations (CF-C); those with one mutation of varying clinic consequence (VCC); and those with one mutation of unknown disease liability (Unknown). Sweat chloride tests, pancreatic sufficiency status, and Pseudomonas aeruginosa colonization were compared. Children with two CF-causing mutations had a classical CF phenotype, while 5% of VCC (4/78) and 11% of Unknown (27/244) met diagnostic criteria of CF. Children carrying Unknown mutations 2215insG with D836Y, and T1036N had early and classical CF phenotype, while others carrying 1525-42G>A, L320V, L967S, R170H, and 296+28A>G had a benign clinical presentation, suggesting that these are non-CF causing. While most infants with VCC and Unknown CFTR mutations do not meet diagnostic criteria for CF, a small proportion do. These findings highlight the range of genotypes and phenotypes in the first few years of life following CF newborn screening when CFTR sequencing is performed.

Nursing Student Perceptions Regarding Simulation Experience Sequencing.

Science.gov (United States)

Woda, Aimee A; Gruenke, Theresa; Alt-Gehrman, Penny; Hansen, Jamie

2016-09-01

The use of simulated learning experiences (SLEs) have increased within nursing curricula with positive learning outcomes for nursing students. The purpose of this study is to explore nursing students' perceptions of their clinical decision making (CDM) related to the block sequencing of different patient care experiences, SLEs versus hospital-based learning experiences (HLEs). A qualitative descriptive design used open-ended survey questions to generate information about the block sequencing of SLEs and its impact on nursing students' perceived CDM. Three themes emerged from the data: Preexperience Anxiety, Real-Time Decision Making, and Increased Patient Care Experiences. Nursing students identified that having SLEs prior to HLEs provided several benefits. Even when students preferred SLEs prior to HLEs, the sequence did not impact their CDM. This suggests that alternating block sequencing can be used without impacting the students' perceptions of their ability to make decisions. [J Nurs Educ. 2016;55(9):528-532.]. Copyright 2016, SLACK Incorporated.

Winnowing sequences from a database search.

Science.gov (United States)

Berman, P; Zhang, Z; Wolf, Y I; Koonin, E V; Miller, W

2000-01-01

In database searches for sequence similarity, matches to a distinct sequence region (e.g., protein domain) are frequently obscured by numerous matches to another region of the same sequence. In order to cope with this problem, algorithms are developed to discard redundant matches. One model for this problem begins with a list of intervals, each with an associated score; each interval gives the range of positions in the query sequence that align to a database sequence, and the score is that of the alignment. If interval I is contained in interval J, and I's score is less than J's, then I is said to be dominated by J. The problem is then to identify each interval that is dominated by at least K other intervals, where K is a given level of "tolerable redundancy." An algorithm is developed to solve the problem in O(N log N) time and O(N*) space, where N is the number of intervals and N* is a precisely defined value that never exceeds N and is frequently much smaller. This criterion for discarding database hits has been implemented in the Blast program, as illustrated herein with examples. Several variations and extensions of this approach are also described.

Multiple aspects of ATP-dependent nucleosome translocation by RSC and Mi-2 are directed by the underlying DNA sequence.

Directory of Open Access Journals (Sweden)

Joke J F A van Vugt

Full Text Available BACKGROUND: Chromosome structure, DNA metabolic processes and cell type identity can all be affected by changing the positions of nucleosomes along chromosomal DNA, a reaction that is catalysed by SNF2-type ATP-driven chromatin remodelers. Recently it was suggested that in vivo, more than 50% of the nucleosome positions can be predicted simply by DNA sequence, especially within promoter regions. This seemingly contrasts with remodeler induced nucleosome mobility. The ability of remodeling enzymes to mobilise nucleosomes over short DNA distances is well documented. However, the nucleosome translocation processivity along DNA remains elusive. Furthermore, it is unknown what determines the initial direction of movement and how new nucleosome positions are adopted. METHODOLOGY/PRINCIPAL FINDINGS: We have used AFM imaging and high resolution PAGE of mononucleosomes on 600 and 2500 bp DNA molecules to analyze ATP-dependent nucleosome repositioning by native and recombinant SNF2-type enzymes. We report that the underlying DNA sequence can control the initial direction of translocation, translocation distance, as well as the new positions adopted by nucleosomes upon enzymatic mobilization. Within a strong nucleosomal positioning sequence both recombinant Drosophila Mi-2 (CHD-type and native RSC from yeast (SWI/SNF-type repositioned the nucleosome at 10 bp intervals, which are intrinsic to the positioning sequence. Furthermore, RSC-catalyzed nucleosome translocation was noticeably more efficient when beyond the influence of this sequence. Interestingly, under limiting ATP conditions RSC preferred to position the nucleosome with 20 bp intervals within the positioning sequence, suggesting that native RSC preferentially translocates nucleosomes with 15 to 25 bp DNA steps. CONCLUSIONS/SIGNIFICANCE: Nucleosome repositioning thus appears to be influenced by both remodeler intrinsic and DNA sequence specific properties that interplay to define ATPase

Position dependent mismatch discrimination on DNA microarrays – experiments and model

Directory of Open Access Journals (Sweden)

Michel Wolfgang

2008-12-01

Full Text Available Abstract Background The propensity of oligonucleotide strands to form stable duplexes with complementary sequences is fundamental to a variety of biological and biotechnological processes as various as microRNA signalling, microarray hybridization and PCR. Yet our understanding of oligonucleotide hybridization, in particular in presence of surfaces, is rather limited. Here we use oligonucleotide microarrays made in-house by optically controlled DNA synthesis to produce probe sets comprising all possible single base mismatches and base bulges for each of 20 sequence motifs under study. Results We observe that mismatch discrimination is mostly determined by the defect position (relative to the duplex ends as well as by the sequence context. We investigate the thermodynamics of the oligonucleotide duplexes on the basis of double-ended molecular zipper. Theoretical predictions of defect positional influence as well as long range sequence influence agree well with the experimental results. Conclusion Molecular zipping at thermodynamic equilibrium explains the binding affinity of mismatched DNA duplexes on microarrays well. The position dependent nearest neighbor model (PDNN can be inferred from it. Quantitative understanding of microarray experiments from first principles is in reach.

AlignMe—a membrane protein sequence alignment web server

Science.gov (United States)

Stamm, Marcus; Staritzbichler, René; Khafizov, Kamil; Forrest, Lucy R.

2014-01-01

We present a web server for pair-wise alignment of membrane protein sequences, using the program AlignMe. The server makes available two operational modes of AlignMe: (i) sequence to sequence alignment, taking two sequences in fasta format as input, combining information about each sequence from multiple sources and producing a pair-wise alignment (PW mode); and (ii) alignment of two multiple sequence alignments to create family-averaged hydropathy profile alignments (HP mode). For the PW sequence alignment mode, four different optimized parameter sets are provided, each suited to pairs of sequences with a specific similarity level. These settings utilize different types of inputs: (position-specific) substitution matrices, secondary structure predictions and transmembrane propensities from transmembrane predictions or hydrophobicity scales. In the second (HP) mode, each input multiple sequence alignment is converted into a hydrophobicity profile averaged over the provided set of sequence homologs; the two profiles are then aligned. The HP mode enables qualitative comparison of transmembrane topologies (and therefore potentially of 3D folds) of two membrane proteins, which can be useful if the proteins have low sequence similarity. In summary, the AlignMe web server provides user-friendly access to a set of tools for analysis and comparison of membrane protein sequences. Access is available at http://www.bioinfo.mpg.de/AlignMe PMID:24753425

Challenging a bioinformatic tool’s ability to detect microbial contaminants using in silico whole genome sequencing data

Directory of Open Access Journals (Sweden)

Nathan D. Olson

2017-09-01

Full Text Available High sensitivity methods such as next generation sequencing and polymerase chain reaction (PCR are adversely impacted by organismal and DNA contaminants. Current methods for detecting contaminants in microbial materials (genomic DNA and cultures are not sensitive enough and require either a known or culturable contaminant. Whole genome sequencing (WGS is a promising approach for detecting contaminants due to its sensitivity and lack of need for a priori assumptions about the contaminant. Prior to applying WGS, we must first understand its limitations for detecting contaminants and potential for false positives. Herein we demonstrate and characterize a WGS-based approach to detect organismal contaminants using an existing metagenomic taxonomic classification algorithm. Simulated WGS datasets from ten genera as individuals and binary mixtures of eight organisms at varying ratios were analyzed to evaluate the role of contaminant concentration and taxonomy on detection. For the individual genomes the false positive contaminants reported depended on the genus, with Staphylococcus, Escherichia, and Shigella having the highest proportion of false positives. For nearly all binary mixtures the contaminant was detected in the in-silico datasets at the equivalent of 1 in 1,000 cells, though F. tularensis was not detected in any of the simulated contaminant mixtures and Y. pestis was only detected at the equivalent of one in 10 cells. Once a WGS method for detecting contaminants is characterized, it can be applied to evaluate microbial material purity, in efforts to ensure that contaminants are characterized in microbial materials used to validate pathogen detection assays, generate genome assemblies for database submission, and benchmark sequencing methods.

Expressed sequence tags as a tool for phylogenetic analysis of placental mammal evolution.

Directory of Open Access Journals (Sweden)

Morgan Kullberg

Full Text Available BACKGROUND: We investigate the usefulness of expressed sequence tags, ESTs, for establishing divergences within the tree of placental mammals. This is done on the example of the established relationships among primates (human, lagomorphs (rabbit, rodents (rat and mouse, artiodactyls (cow, carnivorans (dog and proboscideans (elephant. METHODOLOGY/PRINCIPAL FINDINGS: We have produced 2000 ESTs (1.2 mega bases from a marsupial mouse and characterized the data for their use in phylogenetic analysis. The sequences were used to identify putative orthologous sequences from whole genome projects. Although most ESTs stem from single sequence reads, the frequency of potential sequencing errors was found to be lower than allelic variation. Most of the sequences represented slowly evolving housekeeping-type genes, with an average amino acid distance of 6.6% between human and mouse. Positive Darwinian selection was identified at only a few single sites. Phylogenetic analyses of the EST data yielded trees that were consistent with those established from whole genome projects. CONCLUSIONS: The general quality of EST sequences and the general absence of positive selection in these sequences make ESTs an attractive tool for phylogenetic analysis. The EST approach allows, at reasonable costs, a fast extension of data sampling from species outside the genome projects.

Exploring evidence of positive selection reveals genetic basis of meat quality traits in Berkshire pigs through whole genome sequencing.

Science.gov (United States)

Jeong, Hyeonsoo; Song, Ki-Duk; Seo, Minseok; Caetano-Anollés, Kelsey; Kim, Jaemin; Kwak, Woori; Oh, Jae-Don; Kim, EuiSoo; Jeong, Dong Kee; Cho, Seoae; Kim, Heebal; Lee, Hak-Kyo

2015-08-20

Natural and artificial selection following domestication has led to the existence of more than a hundred pig breeds, as well as incredible variation in phenotypic traits. Berkshire pigs are regarded as having superior meat quality compared to other breeds. As the meat production industry seeks selective breeding approaches to improve profitable traits such as meat quality, information about genetic determinants of these traits is in high demand. However, most of the studies have been performed using trained sensory panel analysis without investigating the underlying genetic factors. Here we investigate the relationship between genomic composition and this phenotypic trait by scanning for signatures of positive selection in whole-genome sequencing data. We generated genomes of 10 Berkshire pigs at a total of 100.6 coverage depth, using the Illumina Hiseq2000 platform. Along with the genomes of 11 Landrace and 13 Yorkshire pigs, we identified genomic variants of 18.9 million SNVs and 3.4 million Indels in the mapped regions. We identified several associated genes related to lipid metabolism, intramuscular fatty acid deposition, and muscle fiber type which attribute to pork quality (TG, FABP1, AKIRIN2, GLP2R, TGFBR3, JPH3, ICAM2, and ERN1) by applying between population statistical tests (XP-EHH and XP-CLR). A statistical enrichment test was also conducted to detect breed specific genetic variation. In addition, de novo short sequence read assembly strategy identified several candidate genes (SLC25A14, IGF1, PI4KA, CACNA1A) as also contributing to lipid metabolism. Results revealed several candidate genes involved in Berkshire meat quality; most of these genes are involved in lipid metabolism and intramuscular fat deposition. These results can provide a basis for future research on the genomic characteristics of Berkshire pigs.

Properties of Sequence Conservation in Upstream Regulatory and Protein Coding Sequences among Paralogs in Arabidopsis thaliana

Science.gov (United States)

Richardson, Dale N.; Wiehe, Thomas

Whole genome duplication (WGD) has catalyzed the formation of new species, genes with novel functions, altered expression patterns, complexified signaling pathways and has provided organisms a level of genetic robustness. We studied the long-term evolution and interrelationships of 5’ upstream regulatory sequences (URSs), protein coding sequences (CDSs) and expression correlations (EC) of duplicated gene pairs in Arabidopsis. Three distinct methods revealed significant evolutionary conservation between paralogous URSs and were highly correlated with microarray-based expression correlation of the respective gene pairs. Positional information on exact matches between sequences unveiled the contribution of micro-chromosomal rearrangements on expression divergence. A three-way rank analysis of URS similarity, CDS divergence and EC uncovered specific gene functional biases. Transcription factor activity was associated with gene pairs exhibiting conserved URSs and divergent CDSs, whereas a broad array of metabolic enzymes was found to be associated with gene pairs showing diverged URSs but conserved CDSs.

Optimization of short amino acid sequences classifier

Science.gov (United States)

Barcz, Aleksy; Szymański, Zbigniew

This article describes processing methods used for short amino acid sequences classification. The data processed are 9-symbols string representations of amino acid sequences, divided into 49 data sets - each one containing samples labeled as reacting or not with given enzyme. The goal of the classification is to determine for a single enzyme, whether an amino acid sequence would react with it or not. Each data set is processed separately. Feature selection is performed to reduce the number of dimensions for each data set. The method used for feature selection consists of two phases. During the first phase, significant positions are selected using Classification and Regression Trees. Afterwards, symbols appearing at the selected positions are substituted with numeric values of amino acid properties taken from the AAindex database. In the second phase the new set of features is reduced using a correlation-based ranking formula and Gram-Schmidt orthogonalization. Finally, the preprocessed data is used for training LS-SVM classifiers. SPDE, an evolutionary algorithm, is used to obtain optimal hyperparameters for the LS-SVM classifier, such as error penalty parameter C and kernel-specific hyperparameters. A simple score penalty is used to adapt the SPDE algorithm to the task of selecting classifiers with best performance measures values.

ESPRIT-Forest: Parallel clustering of massive amplicon sequence data in subquadratic time.

Science.gov (United States)

Cai, Yunpeng; Zheng, Wei; Yao, Jin; Yang, Yujie; Mai, Volker; Mao, Qi; Sun, Yijun

2017-04-01

The rapid development of sequencing technology has led to an explosive accumulation of genomic sequence data. Clustering is often the first step to perform in sequence analysis, and hierarchical clustering is one of the most commonly used approaches for this purpose. However, it is currently computationally expensive to perform hierarchical clustering of extremely large sequence datasets due to its quadratic time and space complexities. In this paper we developed a new algorithm called ESPRIT-Forest for parallel hierarchical clustering of sequences. The algorithm achieves subquadratic time and space complexity and maintains a high clustering accuracy comparable to the standard method. The basic idea is to organize sequences into a pseudo-metric based partitioning tree for sub-linear time searching of nearest neighbors, and then use a new multiple-pair merging criterion to construct clusters in parallel using multiple threads. The new algorithm was tested on the human microbiome project (HMP) dataset, currently one of the largest published microbial 16S rRNA sequence dataset. Our experiment demonstrated that with the power of parallel computing it is now compu- tationally feasible to perform hierarchical clustering analysis of tens of millions of sequences. The software is available at http://www.acsu.buffalo.edu/∼yijunsun/lab/ESPRIT-Forest.html.

Simple sequence repeat marker development from bacterial artificial chromosome end sequences and expressed sequence tags of flax (Linum usitatissimum L.).

Science.gov (United States)

Cloutier, Sylvie; Miranda, Evelyn; Ward, Kerry; Radovanovic, Natasa; Reimer, Elsa; Walichnowski, Andrzej; Datla, Raju; Rowland, Gordon; Duguid, Scott; Ragupathy, Raja

2012-08-01

Flax is an important oilseed crop in North America and is mostly grown as a fibre crop in Europe. As a self-pollinated diploid with a small estimated genome size of ~370 Mb, flax is well suited for fast progress in genomics. In the last few years, important genetic resources have been developed for this crop. Here, we describe the assessment and comparative analyses of 1,506 putative simple sequence repeats (SSRs) of which, 1,164 were derived from BAC-end sequences (BESs) and 342 from expressed sequence tags (ESTs). The SSRs were assessed on a panel of 16 flax accessions with 673 (58 %) and 145 (42 %) primer pairs being polymorphic in the BESs and ESTs, respectively. With 818 novel polymorphic SSR primer pairs reported in this study, the repertoire of available SSRs in flax has more than doubled from the combined total of 508 of all previous reports. Among nucleotide motifs, trinucleotides were the most abundant irrespective of the class, but dinucleotides were the most polymorphic. SSR length was also positively correlated with polymorphism. Two dinucleotide (AT/TA and AG/GA) and two trinucleotide (AAT/ATA/TAA and GAA/AGA/AAG) motifs and their iterations, different from those reported in many other crops, accounted for more than half of all the SSRs and were also more polymorphic (63.4 %) than the rest of the markers (42.7 %). This improved resource promises to be useful in genetic, quantitative trait loci (QTL) and association mapping as well as for anchoring the physical/genetic map with the whole genome shotgun reference sequence of flax.

Design of the AGS Booster Beam Position Monitor electronics

International Nuclear Information System (INIS)

Ciardullo, D.J.; Smith, G.A.; Beadle, E.R.

1991-01-01

The operational requirements of the AGS Booster Beam Position Monitor system necessitate the use of electronics with wide dynamic range and broad instantaneous bandwidth. Bunch synchronization is provided by a remote timing sequencer coupled to the local ring electronics via digital fiber-optic links. The Sequencer and local ring circuitry work together to provide single turn trajectory or average orbit and intensity information, integrated over 1 to 225 bunches. Test capabilities are built in for the purpose of enhancing BPM system accuracy. This paper describes the design of the Booster Beam Position Monitor electronics, and presents performance details of the front end processing, acquisition and timing circuitry

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

Science.gov (United States)

Hori, H; Osawa, S; Murao, K; Ishikura, H

1980-01-01

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

Vacuum Large Current Parallel Transfer Numerical Analysis

Directory of Open Access Journals (Sweden)

Enyuan Dong

2014-01-01

Full Text Available The stable operation and reliable breaking of large generator current are a difficult problem in power system. It can be solved successfully by the parallel interrupters and proper timing sequence with phase-control technology, in which the strategy of breaker’s control is decided by the time of both the first-opening phase and second-opening phase. The precise transfer current’s model can provide the proper timing sequence to break the generator circuit breaker. By analysis of the transfer current’s experiments and data, the real vacuum arc resistance and precise correctional model in the large transfer current’s process are obtained in this paper. The transfer time calculated by the correctional model of transfer current is very close to the actual transfer time. It can provide guidance for planning proper timing sequence and breaking the vacuum generator circuit breaker with the parallel interrupters.

Combinatorial events of insertion sequences and ICE in Gram-negative bacteria.

Science.gov (United States)

Toleman, Mark A; Walsh, Timothy R

2011-09-01

The emergence of antibiotic and antimicrobial resistance in Gram-negative bacteria is incremental and linked to genetic elements that function in a so-called 'one-ended transposition' manner, including ISEcp1, ISCR elements and Tn3-like transposons. The power of these elements lies in their inability to consistently recognize one of their own terminal sequences, while recognizing more genetically distant surrogate sequences. This has the effect of mobilizing the DNA sequence found adjacent to their initial location. In general, resistance in Gram-negatives is closely linked to a few one-off events. These include the capture of the class 1 integron by a Tn5090-like transposon; the formation of the 3' conserved segment (3'-CS); and the fusion of the ISCR1 element to the 3'-CS. The structures formed by these rare events have been massively amplified and disseminated in Gram-negative bacteria, but hitherto, are rarely found in Gram-positives. Such events dominate current resistance gene acquisition and are instrumental in the construction of large resistance gene islands on chromosomes and plasmids. Similar combinatorial events appear to have occurred between conjugative plasmids and phages constructing hybrid elements called integrative and conjugative elements or conjugative transposons. These elements are beginning to be closely linked to some of the more powerful resistance mechanisms such as the extended spectrum β-lactamases, metallo- and AmpC type β-lactamases. Antibiotic resistance in Gram-negative bacteria is dominated by unusual combinatorial mistakes of Insertion sequences and gene fusions which have been selected and amplified by antibiotic pressure enabling the formation of extended resistance islands. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Application of Next-generation Sequencing in Clinical Molecular Diagnostics

Directory of Open Access Journals (Sweden)

Morteza Seifi

2017-05-01

Full Text Available ABSTRACT Next-generation sequencing (NGS is the catch all terms that used to explain several different modern sequencing technologies which let us to sequence nucleic acids much more rapidly and cheaply than the formerly used Sanger sequencing, and as such have revolutionized the study of molecular biology and genomics with excellent resolution and accuracy. Over the past years, many academic companies and institutions have continued technological advances to expand NGS applications from research to the clinic. In this review, the performance and technical features of current NGS platforms were described. Furthermore, advances in the applying of NGS technologies towards the progress of clinical molecular diagnostics were emphasized. General advantages and disadvantages of each sequencing system are summarized and compared to guide the selection of NGS platforms for specific research aims.

Harnessing Whole Genome Sequencing in Medical Mycology.

Science.gov (United States)

Cuomo, Christina A

2017-01-01

Comparative genome sequencing studies of human fungal pathogens enable identification of genes and variants associated with virulence and drug resistance. This review describes current approaches, resources, and advances in applying whole genome sequencing to study clinically important fungal pathogens. Genomes for some important fungal pathogens were only recently assembled, revealing gene family expansions in many species and extreme gene loss in one obligate species. The scale and scope of species sequenced is rapidly expanding, leveraging technological advances to assemble and annotate genomes with higher precision. By using iteratively improved reference assemblies or those generated de novo for new species, recent studies have compared the sequence of isolates representing populations or clinical cohorts. Whole genome approaches provide the resolution necessary for comparison of closely related isolates, for example, in the analysis of outbreaks or sampled across time within a single host. Genomic analysis of fungal pathogens has enabled both basic research and diagnostic studies. The increased scale of sequencing can be applied across populations, and new metagenomic methods allow direct analysis of complex samples.

Identification of rhabdoviral sequences in oropharyngeal swabs from German and Danish bats.

Science.gov (United States)

Fischer, Melina; Freuling, Conrad M; Müller, Thomas; Schatz, Juliane; Rasmussen, Thomas Bruun; Chriel, Mariann; Balkema-Buschmann, Anne; Beer, Martin; Hoffmann, Bernd

2014-11-25

In the frame of active lyssavirus surveillance in bats, oropharyngeal swabs from German (N = 2297) and Danish (N = 134) insectivorous bats were investigated using a newly developed generic pan-lyssavirus real-time reverse transcriptase PCR (RT-qPCR). In total, 15 RT-qPCR positive swabs were detected. Remarkably, sequencing of positive samples did not confirm the presence of bat associated lyssaviruses but revealed nine distinct novel rhabdovirus-related sequences. Several novel rhabdovirus-related sequences were detected both in German and Danish insectivorous bats. The results also prove that the novel generic pan-lyssavirus RT-qPCR offers a very broad detection range that allows the collection of further valuable data concerning the broad and complex diversity within the family Rhabdoviridae.

On the edge of language acquisition: inherent constraints on encoding multisyllabic sequences in the neonate brain.

Science.gov (United States)

Ferry, Alissa L; Fló, Ana; Brusini, Perrine; Cattarossi, Luigi; Macagno, Francesco; Nespor, Marina; Mehler, Jacques

2016-05-01

To understand language, humans must encode information from rapid, sequential streams of syllables - tracking their order and organizing them into words, phrases, and sentences. We used Near-Infrared Spectroscopy (NIRS) to determine whether human neonates are born with the capacity to track the positions of syllables in multisyllabic sequences. After familiarization with a six-syllable sequence, the neonate brain responded to the change (as shown by an increase in oxy-hemoglobin) when the two edge syllables switched positions but not when two middle syllables switched positions (Experiment 1), indicating that they encoded the syllables at the edges of sequences better than those in the middle. Moreover, when a 25 ms pause was inserted between the middle syllables as a segmentation cue, neonates' brains were sensitive to the change (Experiment 2), indicating that subtle cues in speech can signal a boundary, with enhanced encoding of the syllables located at the edges of that boundary. These findings suggest that neonates' brains can encode information from multisyllabic sequences and that this encoding is constrained. Moreover, subtle segmentation cues in a sequence of syllables provide a mechanism with which to accurately encode positional information from longer sequences. Tracking the order of syllables is necessary to understand language and our results suggest that the foundations for this encoding are present at birth. © 2015 John Wiley & Sons Ltd.

Scheduling Aircraft Landings under Constrained Position Shifting

Science.gov (United States)

Balakrishnan, Hamsa; Chandran, Bala

2006-01-01

Optimal scheduling of airport runway operations can play an important role in improving the safety and efficiency of the National Airspace System (NAS). Methods that compute the optimal landing sequence and landing times of aircraft must accommodate practical issues that affect the implementation of the schedule. One such practical consideration, known as Constrained Position Shifting (CPS), is the restriction that each aircraft must land within a pre-specified number of positions of its place in the First-Come-First-Served (FCFS) sequence. We consider the problem of scheduling landings of aircraft in a CPS environment in order to maximize runway throughput (minimize the completion time of the landing sequence), subject to operational constraints such as FAA-specified minimum inter-arrival spacing restrictions, precedence relationships among aircraft that arise either from airline preferences or air traffic control procedures that prevent overtaking, and time windows (representing possible control actions) during which each aircraft landing can occur. We present a Dynamic Programming-based approach that scales linearly in the number of aircraft, and describe our computational experience with a prototype implementation on realistic data for Denver International Airport.

One-Step PCR Sequencing. Final Technical Progress Report for February 15, 1997 - November 30, 2001

Energy Technology Data Exchange (ETDEWEB)

Shaw, B. R.

2004-04-16

We investigated new chemistries and alternate approaches for direct gene sequencing and detection based on the properties of boron-substituted nucleotides as chain delimiters in lieu of conventional chain terminators. Chain terminators, such as the widely used Sanger dideoxynucleotide truncators, stop DNA synthesis during replication and hence are incompatible with further PCR amplification. Chain delimiters, on the other hand, are chemically-modified, ''stealth'' nucleotides that act like normal nucleotides in DNA synthesis and PCR amplification, but can be unmasked following chain extension and exponential amplification. Specifically, chain delimiters give rise to an alternative sequencing strategy based on selective degradation of DNA chains generated by PCR amplification with modified nucleotides. The method as originally devised employed template-directed enzymatic, random incorporation of small amounts of boron-modified nucleotides (e.g., 2'-deoxynucleoside 5'-alpha-[P-borano]- triphosphates) during PCR amplification. Rather than incorporation of dideoxy chain terminators, which are less efficiently incorporated in PCR-based amplification than natural deoxynucleotides, our method is based on selective incorporation and exonuclease degradation of DNA chains generated by efficient PCR amplification of chemically-modified ''stealth'' nucleotides. The stealth nucleotides have a boranophosphate group instead of a normal phosphate, yet behave like normal nucleotides during PCR-amplification. The unique feature of our method is that the position of the stealth nucleotide, and hence DNA sequencing fragments, are revealed at the desired, appropriate moment following PCR amplification. During the current grant period, a variety of new boron-modified nucleotides were synthesized, and new chemistries and enzymatic methods and combinations thereof were explored to improve the method and study the effects of borane modified

Exome sequencing and genetic testing for MODY.

Directory of Open Access Journals (Sweden)

Stefan Johansson

Full Text Available Genetic testing for monogenic diabetes is important for patient care. Given the extensive genetic and clinical heterogeneity of diabetes, exome sequencing might provide additional diagnostic potential when standard Sanger sequencing-based diagnostics is inconclusive.The aim of the study was to examine the performance of exome sequencing for a molecular diagnosis of MODY in patients who have undergone conventional diagnostic sequencing of candidate genes with negative results.We performed exome enrichment followed by high-throughput sequencing in nine patients with suspected MODY. They were Sanger sequencing-negative for mutations in the HNF1A, HNF4A, GCK, HNF1B and INS genes. We excluded common, non-coding and synonymous gene variants, and performed in-depth analysis on filtered sequence variants in a pre-defined set of 111 genes implicated in glucose metabolism.On average, we obtained 45 X median coverage of the entire targeted exome and found 199 rare coding variants per individual. We identified 0-4 rare non-synonymous and nonsense variants per individual in our a priori list of 111 candidate genes. Three of the variants were considered pathogenic (in ABCC8, HNF4A and PPARG, respectively, thus exome sequencing led to a genetic diagnosis in at least three of the nine patients. Approximately 91% of known heterozygous SNPs in the target exomes were detected, but we also found low coverage in some key diabetes genes using our current exome sequencing approach. Novel variants in the genes ARAP1, GLIS3, MADD, NOTCH2 and WFS1 need further investigation to reveal their possible role in diabetes.Our results demonstrate that exome sequencing can improve molecular diagnostics of MODY when used as a complement to Sanger sequencing. However, improvements will be needed, especially concerning coverage, before the full potential of exome sequencing can be realized.

Serial position learning in honeybees.

Directory of Open Access Journals (Sweden)

Randolf Menzel

Full Text Available Learning of stimulus sequences is considered as a characteristic feature of episodic memory since it contains not only a particular item but also the experience of preceding and following events. In sensorimotor tasks resembling navigational performance, the serial order of objects is intimately connected with spatial order. Mammals and birds develop episodic(-like memory in serial spatio-temporal tasks, and the honeybee learns spatio-temporal order when navigating between the nest and a food source. Here I examine the structure of the bees' memory for a combined spatio-temporal task. I ask whether discrimination and generalization are based solely on simple forms of stimulus-reward learning or whether they require sequential configurations. Animals were trained to fly either left or right in a continuous T-maze. The correct choice was signaled by the sequence of colors (blue, yellow at four positions in the access arm. If only one of the possible 4 signals is shown (either blue or yellow, the rank order of position salience is 1, 2 and 3 (numbered from T-junction. No learning is found if the signal appears at position 4. If two signals are shown, differences at positions 1 and 2 are learned best, those at position 3 at a low level, and those at position 4 not at all. If three or more signals are shown these results are corroborated. This salience rank order again appeared in transfer tests, but additional configural phenomena emerged. Most of the results can be explained with a simple model based on the assumption that the four positions are equipped with different salience scores and that these add up independently. However, deviations from the model are interpreted by assuming stimulus configuration of sequential patterns. It is concluded that, under the conditions chosen, bees rely most strongly on memories developed during simple forms of associative reward learning, but memories of configural serial patterns contribute, too.

ASAP: Amplification, sequencing & annotation of plastomes

Directory of Open Access Journals (Sweden)

Folta Kevin M

2005-12-01

Full Text Available Abstract Background Availability of DNA sequence information is vital for pursuing structural, functional and comparative genomics studies in plastids. Traditionally, the first step in mining the valuable information within a chloroplast genome requires sequencing a chloroplast plasmid library or BAC clones. These activities involve complicated preparatory procedures like chloroplast DNA isolation or identification of the appropriate BAC clones to be sequenced. Rolling circle amplification (RCA is being used currently to amplify the chloroplast genome from purified chloroplast DNA and the resulting products are sheared and cloned prior to sequencing. Herein we present a universal high-throughput, rapid PCR-based technique to amplify, sequence and assemble plastid genome sequence from diverse species in a short time and at reasonable cost from total plant DNA, using the large inverted repeat region from strawberry and peach as proof of concept. The method exploits the highly conserved coding regions or intergenic regions of plastid genes. Using an informatics approach, chloroplast DNA sequence information from 5 available eudicot plastomes was aligned to identify the most conserved regions. Cognate primer pairs were then designed to generate ~1 – 1.2 kb overlapping amplicons from the inverted repeat region in 14 diverse genera. Results 100% coverage of the inverted repeat region was obtained from Arabidopsis, tobacco, orange, strawberry, peach, lettuce, tomato and Amaranthus. Over 80% coverage was obtained from distant species, including Ginkgo, loblolly pine and Equisetum. Sequence from the inverted repeat region of strawberry and peach plastome was obtained, annotated and analyzed. Additionally, a polymorphic region identified from gel electrophoresis was sequenced from tomato and Amaranthus. Sequence analysis revealed large deletions in these species relative to tobacco plastome thus exhibiting the utility of this method for structural and

Gelada vocal sequences follow Menzerath’s linguistic law

Science.gov (United States)

Gustison, Morgan L.; Semple, Stuart; Ferrer-i-Cancho, Ramon; Bergman, Thore J.

2016-01-01

Identifying universal principles underpinning diverse natural systems is a key goal of the life sciences. A powerful approach in addressing this goal has been to test whether patterns consistent with linguistic laws are found in nonhuman animals. Menzerath’s law is a linguistic law that states that, the larger the construct, the smaller the size of its constituents. Here, to our knowledge, we present the first evidence that Menzerath’s law holds in the vocal communication of a nonhuman species. We show that, in vocal sequences of wild male geladas (Theropithecus gelada), construct size (sequence size in number of calls) is negatively correlated with constituent size (duration of calls). Call duration does not vary significantly with position in the sequence, but call sequence composition does change with sequence size and most call types are abbreviated in larger sequences. We also find that intercall intervals follow the same relationship with sequence size as do calls. Finally, we provide formal mathematical support for the idea that Menzerath’s law reflects compression—the principle of minimizing the expected length of a code. Our findings suggest that a common principle underpins human and gelada vocal communication, highlighting the value of exploring the applicability of linguistic laws in vocal systems outside the realm of language. PMID:27091968

The Bouma Sequence and the turbidite mind set

Science.gov (United States)

Shanmugam, G.

1997-11-01

Conventionally, the Bouma Sequence [Bouma, A.H., 1962. Sedimentology of some Flysch Deposits: A Graphic Approach to Facies Interpretation. Elsevier, Amsterdam, 168 pp.], composed of T a, T b, T c, T d, and T e divisions, is interpreted to be the product of a turbidity current. However, recent core and outcrop studies show that the complete and partial Bouma sequences can also be interpreted to be deposits formed by processes other than turbidity currents, such as sandy debris flows and bottom-current reworking. Many published examples of turbidites, most of them hydrocarbon-bearing sands, in the North Sea, the Norwegian Sea, offshore Nigeria, offshore Gabon, Gulf of Mexico, and the Ouachita Mountains, are being reinterpreted by the present author as dominantly deposits of sandy debris flows and bottom-current reworking with only a minor percentage of true turbidites (i.e., deposits of turbidity currents with fluidal or Newtonian rheology in which sediment is suspended by fluid turbulence). This reinterpretation is based on detailed description of 21,000 ft (6402 m) of conventional cores and 1200 ft (365 m) of outcrop sections. The predominance of interpreted turbidites in these areas by other workers can be attributed to the following: (1) loose applications of turbidity-current concepts without regard for fluid rheology, flow state, and sediment-support mechanism that result in a category of 'turbidity currents' that includes debris flows and bottom currents; (2) field description of deep-water sands using the Bouma Sequence (an interpretive model) that invariably leads to a model-driven turbidite interpretation; (3) the prevailing turbidite mind set that subconsciously forces one to routinely interpret most deep-water sands as some kind of turbidites; (4) the use of our inability to interpret transport mechanism from the depositional record as an excuse for assuming deep-water sands as deposits of turbidity currents; (5) the flawed concept of high

Phylogenetic study on Shiraia bambusicola by rDNA sequence analyses.

Science.gov (United States)

Cheng, Tian-Fan; Jia, Xiao-Ming; Ma, Xiao-Hang; Lin, Hai-Ping; Zhao, Yu-Hua

2004-01-01

In this study, 18S rDNA and ITS-5.8S rDNA regions of four Shiraia bambusicola isolates collected from different species of bamboos were amplified by PCR with universal primer pairs NS1/NS8 and ITS5/ITS4, respectively, and sequenced. Phylogenetic analyses were conducted on three selected datasets of rDNA sequences. Maximum parsimony, distance and maximum likelihood criteria were used to infer trees. Morphological characteristics were also observed. The positioning of Shiraia in the order Pleosporales was well supported by bootstrap, which agreed with the placement by Amano (1980) according to their morphology. We did not find significant inter-hostal differences among these four isolates from different species of bamboos. From the results of analyses and comparison of their rDNA sequences, we conclude that Shiraia should be classified into Pleosporales as Amano (1980) proposed and suggest that it might be positioned in the family Phaeosphaeriaceae. Copyright 2004 WILEY-VCH Verlag GmbH & Co.

Novel approach for identification of influenza virus host range and zoonotic transmissible sequences by determination of host-related associative positions in viral genome segments.

Science.gov (United States)

Kargarfard, Fatemeh; Sami, Ashkan; Mohammadi-Dehcheshmeh, Manijeh; Ebrahimie, Esmaeil

2016-11-16

Recent (2013 and 2009) zoonotic transmission of avian or porcine influenza to humans highlights an increase in host range by evading species barriers. Gene reassortment or antigenic shift between viruses from two or more hosts can generate a new life-threatening virus when the new shuffled virus is no longer recognized by antibodies existing within human populations. There is no large scale study to help understand the underlying mechanisms of host transmission. Furthermore, there is no clear understanding of how different segments of the influenza genome contribute in the final determination of host range. To obtain insight into the rules underpinning host range determination, various supervised machine learning algorithms were employed to mine reassortment changes in different viral segments in a range of hosts. Our multi-host dataset contained whole segments of 674 influenza strains organized into three host categories: avian, human, and swine. Some of the sequences were assigned to multiple hosts. In point of fact, the datasets are a form of multi-labeled dataset and we utilized a multi-label learning method to identify discriminative sequence sites. Then algorithms such as CBA, Ripper, and decision tree were applied to extract informative and descriptive association rules for each viral protein segment. We found informative rules in all segments that are common within the same host class but varied between different hosts. For example, for infection of an avian host, HA14V and NS1230S were the most important discriminative and combinatorial positions. Host range identification is facilitated by high support combined rules in this study. Our major goal was to detect discriminative genomic positions that were able to identify multi host viruses, because such viruses are likely to cause pandemic or disastrous epidemics.

Thruster allocation for dynamical positioning

NARCIS (Netherlands)

Poppe, K.; van den Berg, J.B.; Blank, E.; Archer, C.; Redeker, M.; Kutter, M.; Hemker, P.

2010-01-01

Positioning a vessel at a fixed position in deep water is of great importance when working offshore. In recent years a Dynamical Positioning (DP) system was developed at Marin [2]. After the measurement of the current position and external forces (like waves, wind etc.), each thruster of the vessel

Maintaining positive

OpenAIRE

Gheorghe Gh. IONESCU; Adina Letitia NEGRUSA

2004-01-01

Maintaining positive work-force relationships includes in effective labor-management relations and making appropriate responses to current employee issues. Among the major current employee issues are protection from arbitrary dismissal, drug and alcohol abuse, privacy rights and family maters and they impact work. In our paper we discus two problems: first, the meanings of industrial democracy; second, the three principal operational concepts of industrial democracy (1) industrial democracy t...

Genome sequence of the Thermotoga thermarum type strain (LA3(T)) from an African solfataric spring.

Science.gov (United States)

Göker, Markus; Spring, Stefan; Scheuner, Carmen; Anderson, Iain; Zeytun, Ahmet; Nolan, Matt; Lucas, Susan; Tice, Hope; Del Rio, Tijana Glavina; Cheng, Jan-Fang; Han, Cliff; Tapia, Roxanne; Goodwin, Lynne A; Pitluck, Sam; Liolios, Konstantinos; Mavromatis, Konstantinos; Pagani, Ioanna; Ivanova, Natalia; Mikhailova, Natalia; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jeffries, Cynthia D; Rohde, Manfred; Detter, John C; Woyke, Tanja; Bristow, James; Eisen, Jonathan A; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C; Klenk, Hans-Peter; Lapidus, Alla

2014-06-15

Thermotoga thermarum Windberger et al. 1989 is a member to the genomically well characterized genus Thermotoga in the phylum 'Thermotogae'. T. thermarum is of interest for its origin from a continental solfataric spring vs. predominantly marine oil reservoirs of other members of the genus. The genome of strain LA3T also provides fresh data for the phylogenomic positioning of the (hyper-)thermophilic bacteria. T. thermarum strain LA3(T) is the fourth sequenced genome of a type strain from the genus Thermotoga, and the sixth in the family Thermotogaceae to be formally described in a publication. Phylogenetic analyses do not reveal significant discrepancies between the current classification of the group, 16S rRNA gene data and whole-genome sequences. Nevertheless, T. thermarum significantly differs from other Thermotoga species regarding its iron-sulfur cluster synthesis, as it contains only a minimal set of the necessary proteins. Here we describe the features of this organism, together with the complete genome sequence and annotation. The 2,039,943 bp long chromosome with its 2,015 protein-coding and 51 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

Protecting genomic sequence anonymity with generalization lattices.

Science.gov (United States)

Malin, B A

2005-01-01

Current genomic privacy technologies assume the identity of genomic sequence data is protected if personal information, such as demographics, are obscured, removed, or encrypted. While demographic features can directly compromise an individual's identity, recent research demonstrates such protections are insufficient because sequence data itself is susceptible to re-identification. To counteract this problem, we introduce an algorithm for anonymizing a collection of person-specific DNA sequences. The technique is termed DNA lattice anonymization (DNALA), and is based upon the formal privacy protection schema of k -anonymity. Under this model, it is impossible to observe or learn features that distinguish one genetic sequence from k-1 other entries in a collection. To maximize information retained in protected sequences, we incorporate a concept generalization lattice to learn the distance between two residues in a single nucleotide region. The lattice provides the most similar generalized concept for two residues (e.g. adenine and guanine are both purines). The method is tested and evaluated with several publicly available human population datasets ranging in size from 30 to 400 sequences. Our findings imply the anonymization schema is feasible for the protection of sequences privacy. The DNALA method is the first computational disclosure control technique for general DNA sequences. Given the computational nature of the method, guarantees of anonymity can be formally proven. There is room for improvement and validation, though this research provides the groundwork from which future researchers can construct genomics anonymization schemas tailored to specific datasharing scenarios.

Nucleotide sequence of tomato ringspot virus RNA-2.

Science.gov (United States)

Rott, M E; Tremaine, J H; Rochon, D M

1991-07-01

The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.

Identification of Y-Chromosome Sequences in Turner Syndrome.

Science.gov (United States)

Silva-Grecco, Roseane Lopes da; Trovó-Marqui, Alessandra Bernadete; Sousa, Tiago Alves de; Croce, Lilian Da; Balarin, Marly Aparecida Spadotto

2016-05-01

To investigate the presence of Y-chromosome sequences and determine their frequency in patients with Turner syndrome. The study included 23 patients with Turner syndrome from Brazil, who gave written informed consent for participating in the study. Cytogenetic analyses were performed in peripheral blood lymphocytes, with 100 metaphases per patient. Genomic DNA was also extracted from peripheral blood lymphocytes, and gene sequences DYZ1, DYZ3, ZFY and SRY were amplified by Polymerase Chain Reaction. The cytogenetic analysis showed a 45,X karyotype in 9 patients (39.2 %) and a mosaic pattern in 14 (60.8 %). In 8.7 % (2 out of 23) of the patients, Y-chromosome sequences were found. This prevalence is very similar to those reported previously. The initial karyotype analysis of these patients did not reveal Y-chromosome material, but they were found positive for Y-specific sequences in the lymphocyte DNA analysis. The PCR technique showed that 2 (8.7 %) of the patients with Turner syndrome had Y-chromosome sequences, both presenting marker chromosomes on cytogenetic analysis.

Application of Quaternion in improving the quality of global sequence alignment scores for an ambiguous sequence target in Streptococcus pneumoniae DNA

Science.gov (United States)

Lestari, D.; Bustamam, A.; Novianti, T.; Ardaneswari, G.

2017-07-01

DNA sequence can be defined as a succession of letters, representing the order of nucleotides within DNA, using a permutation of four DNA base codes including adenine (A), guanine (G), cytosine (C), and thymine (T). The precise code of the sequences is determined using DNA sequencing methods and technologies, which have been developed since the 1970s and currently become highly developed, advanced and highly throughput sequencing technologies. So far, DNA sequencing has greatly accelerated biological and medical research and discovery. However, in some cases DNA sequencing could produce any ambiguous and not clear enough sequencing results that make them quite difficult to be determined whether these codes are A, T, G, or C. To solve these problems, in this study we can introduce other representation of DNA codes namely Quaternion Q = (PA, PT, PG, PC), where PA, PT, PG, PC are the probability of A, T, G, C bases that could appear in Q and PA + PT + PG + PC = 1. Furthermore, using Quaternion representations we are able to construct the improved scoring matrix for global sequence alignment processes, by applying a dot product method. Moreover, this scoring matrix produces better and higher quality of the match and mismatch score between two DNA base codes. In implementation, we applied the Needleman-Wunsch global sequence alignment algorithm using Octave, to analyze our target sequence which contains some ambiguous sequence data. The subject sequences are the DNA sequences of Streptococcus pneumoniae families obtained from the Genebank, meanwhile the target DNA sequence are received from our collaborator database. As the results we found the Quaternion representations improve the quality of the sequence alignment score and we can conclude that DNA sequence target has maximum similarity with Streptococcus pneumoniae.

SU-F-T-350: Continuous Leaf Optimization (CLO) for IMRT Leaf Sequencing

Energy Technology Data Exchange (ETDEWEB)

Long, T; Chen, M; Jiang, S; Lu, W [UT Southwestern Medical Center, Dallas, TX (United States)

2016-06-15

Purpose: To study a new step-and-shoot IMRT leaf sequencing model that avoids the two main pitfalls of conventional leaf sequencing: (1) target fluence being stratified into a fixed number of discrete levels and/or (2) aperture leaf positions being restricted to a discrete set of locations. These assumptions induce error into the sequence or reduce the feasible region of potential plans, respectively. Methods: We develop a one-dimensional (single leaf pair) methodology that does not make assumptions (1) or (2) that can be easily extended to a multi-row model. The proposed continuous leaf optimization (CLO) methodology takes in an existing set of apertures and associated intensities, or solution “seed,” and improves the plan without the restrictiveness of 1or (2). It then uses a first-order descent algorithm to converge onto a locally optimal solution. A seed solution can come from models that assume (1) and (2), thus allowing the CLO model to improve upon existing leaf sequencing methodologies. Results: The CLO model was applied to 208 generated target fluence maps in one dimension. In all cases for all tested sequencing strategies, the CLO model made improvements on the starting seed objective function. The CLO model also was able to keep MUs low. Conclusion: The CLO model can improve upon existing leaf sequencing methods by avoiding the restrictions of (1) and (2). By allowing for more flexible leaf positioning, error can be reduced when matching some target fluence. This study lays the foundation for future models and solution methodologies that can incorporate continuous leaf positions explicitly into the IMRT treatment planning model. Supported by Cancer Prevention & Research Institute of Texas (CPRIT) - ID RP150485.

Genome Sequences of Oryza Species

KAUST Repository

Kumagai, Masahiko

2018-02-14

This chapter summarizes recent data obtained from genome sequencing, annotation projects, and studies on the genome diversity of Oryza sativa and related Oryza species. O. sativa, commonly known as Asian rice, is the first monocot species whose complete genome sequence was deciphered based on physical mapping by an international collaborative effort. This genome, along with its accurate and comprehensive annotation, has become an indispensable foundation for crop genomics and breeding. With the development of innovative sequencing technologies, genomic studies of O. sativa have dramatically increased; in particular, a large number of cultivars and wild accessions have been sequenced and compared with the reference rice genome. Since de novo genome sequencing has become cost-effective, the genome of African cultivated rice, O. glaberrima, has also been determined. Comparative genomic studies have highlighted the independent domestication processes of different rice species, but it also turned out that Asian and African rice share a common gene set that has experienced similar artificial selection. An international project aimed at constructing reference genomes and examining the genome diversity of wild Oryza species is currently underway, and the genomes of some species are publicly available. This project provides a platform for investigations such as the evolution, development, polyploidization, and improvement of crops. Studies on the genomic diversity of Oryza species, including wild species, should provide new insights to solve the problem of growing food demands in the face of rapid climatic changes.

Genome Sequences of Oryza Species

KAUST Repository

Kumagai, Masahiko; Tanaka, Tsuyoshi; Ohyanagi, Hajime; Hsing, Yue-Ie C.; Itoh, Takeshi

2018-01-01

This chapter summarizes recent data obtained from genome sequencing, annotation projects, and studies on the genome diversity of Oryza sativa and related Oryza species. O. sativa, commonly known as Asian rice, is the first monocot species whose complete genome sequence was deciphered based on physical mapping by an international collaborative effort. This genome, along with its accurate and comprehensive annotation, has become an indispensable foundation for crop genomics and breeding. With the development of innovative sequencing technologies, genomic studies of O. sativa have dramatically increased; in particular, a large number of cultivars and wild accessions have been sequenced and compared with the reference rice genome. Since de novo genome sequencing has become cost-effective, the genome of African cultivated rice, O. glaberrima, has also been determined. Comparative genomic studies have highlighted the independent domestication processes of different rice species, but it also turned out that Asian and African rice share a common gene set that has experienced similar artificial selection. An international project aimed at constructing reference genomes and examining the genome diversity of wild Oryza species is currently underway, and the genomes of some species are publicly available. This project provides a platform for investigations such as the evolution, development, polyploidization, and improvement of crops. Studies on the genomic diversity of Oryza species, including wild species, should provide new insights to solve the problem of growing food demands in the face of rapid climatic changes.

Benign and Deleterious Cystic Fibrosis Transmembrane Conductance Regulator Mutations Identified by Sequencing in Positive Cystic Fibrosis Newborn Screen Children from California.

Directory of Open Access Journals (Sweden)

Danieli B Salinas

Full Text Available Of the 2007 Cystic Fibrosis Transmembrane Conductance Regulator (CFTR mutations, 202 have been assigned disease liability. California's racially diverse population, along with CFTR sequencing as part of newborn screening model, provides the opportunity to examine the phenotypes of children with uncategorized mutations to help inform disease liability and penetrance.We conducted a retrospective cohort study based on children screened from 2007 to 2011 and followed for two to six years. Newborns that screened positive were divided into three genotype groups: those with two CF-causing mutations (CF-C; those with one mutation of varying clinic consequence (VCC; and those with one mutation of unknown disease liability (Unknown. Sweat chloride tests, pancreatic sufficiency status, and Pseudomonas aeruginosa colonization were compared.Children with two CF-causing mutations had a classical CF phenotype, while 5% of VCC (4/78 and 11% of Unknown (27/244 met diagnostic criteria of CF. Children carrying Unknown mutations 2215insG with D836Y, and T1036N had early and classical CF phenotype, while others carrying 1525-42G>A, L320V, L967S, R170H, and 296+28A>G had a benign clinical presentation, suggesting that these are non-CF causing.While most infants with VCC and Unknown CFTR mutations do not meet diagnostic criteria for CF, a small proportion do. These findings highlight the range of genotypes and phenotypes in the first few years of life following CF newborn screening when CFTR sequencing is performed.

An examination of retention factors among registered nurses in Northeastern Ontario, Canada: Nurses intent to stay in their current position.

Science.gov (United States)

Nowrouzi, Behdin; Rukholm, Ellen; Lariviere, Michel; Carter, Lorraine; Koren, Irene; Mian, Oxana; Giddens, Emilia

2016-03-10

The purpose of the study was to examine factors related to the retention of registered nurses in northeastern Ontario, Canada. A cross-sectional survey of registered nurses working in northeastern Ontario, Canada was conducted. Logistic regression analyses were used to consider intent to stay in current employment in relation to the following: 1) demographic factors, and 2) occupation and career satisfaction factors. A total of 459 (29.8% response rate) questionnaires were completed. The adjusted odds logistic regression analysis of RNs who intended to remain in their current position for the next five years, demonstrated that respondents in the 46 to 56 age group (OR: 2.65; 95% CI: 1.50 to 4.69), the importance of staff development in the organization (OR: 3.04; 95% CI: 1.13 to 8.13) northeastern Ontario lifestyle (OR: 2.61; 95% CI: 1.55 to 4.40), working in nursing for 14 to 22.5 years (OR: 2.55; 95% CI: 1.10 to 5.93), and working between 0 to 1 hour of overtime per week (OR: 1.20; 95% CI: 1.20 to 4.64) were significant factors in staying in their current position for the next five years. This study shows that a further understanding of the work environment could assist with developing retention for rural nurses. Furthermore, employers may use such information to ameliorate the working conditions of nurses, while researchers may use such evidence to develop interventions that are applicable to improving the working conditions of nurses.

Fault Current Characteristics of the DFIG under Asymmetrical Fault Conditions

Directory of Open Access Journals (Sweden)

Fan Xiao

2015-09-01

Full Text Available During non-severe fault conditions, crowbar protection is not activated and the rotor windings of a doubly-fed induction generator (DFIG are excited by the AC/DC/AC converter. Meanwhile, under asymmetrical fault conditions, the electrical variables oscillate at twice the grid frequency in synchronous dq frame. In the engineering practice, notch filters are usually used to extract the positive and negative sequence components. In these cases, the dynamic response of a rotor-side converter (RSC and the notch filters have a large influence on the fault current characteristics of the DFIG. In this paper, the influence of the notch filters on the proportional integral (PI parameters is discussed and the simplified calculation models of the rotor current are established. Then, the dynamic performance of the stator flux linkage under asymmetrical fault conditions is also analyzed. Based on this, the fault characteristics of the stator current under asymmetrical fault conditions are studied and the corresponding analytical expressions of the stator fault current are obtained. Finally, digital simulation results validate the analytical results. The research results are helpful to meet the requirements of a practical short-circuit calculation and the construction of a relaying protection system for the power grid with penetration of DFIGs.

Successful treatment of multifocal pedal infection in a feline immunodeficiency virus-positive cat with multiple Bowenoid in situ carcinomas containing papillomaviral DNA sequences

Directory of Open Access Journals (Sweden)

Allan E Kessell

2017-01-01

Full Text Available Case summary A 16-year-old, castrated male, feline immunodeficiency virus (FIV-positive, domestic shorthair cat developed multiple skin lesions. Most of these were Bowenoid carcinoma in situ and contained DNA sequences consistent with Felis catus papillomavirus type 2. Two additional lesions that developed in the skin and subcutaneous tissues between the digital and carpal pads on the left forelimb and right hindlimb were shown by cytology, histology and culture to be caused by Prototheca wickerhamii . These lesions failed to improve in response to systemic therapy treatment with itraconazole, but excision by sharp en bloc resection with follow-up oral itraconazole therapy proved curative for one lesion, although the other lesion recurred, necessitating a second surgery. Relevance and novel information This is only the second reported case of feline protothecosis from Australia and the first case that has been cultured and identified to the species level. Also of great interest was the presence of multiple papillomavirus-associated neoplastic lesions, which may have afforded a portal of entry for the algal pathogen and the cat’s positive FIV status; the latter might have impacted on both viral and algal pathogenesis by effects on immunocompetence.

Complete genome sequence of Ikoma lyssavirus.

Science.gov (United States)

Marston, Denise A; Ellis, Richard J; Horton, Daniel L; Kuzmin, Ivan V; Wise, Emma L; McElhinney, Lorraine M; Banyard, Ashley C; Ngeleja, Chanasa; Keyyu, Julius; Cleaveland, Sarah; Lembo, Tiziana; Rupprecht, Charles E; Fooks, Anthony R

2012-09-01

Lyssaviruses (family Rhabdoviridae) constitute one of the most important groups of viral zoonoses globally. All lyssaviruses cause the disease rabies, an acute progressive encephalitis for which, once symptoms occur, there is no effective cure. Currently available vaccines are highly protective against the predominantly circulating lyssavirus species. Using next-generation sequencing technologies, we have obtained the whole-genome sequence for a novel lyssavirus, Ikoma lyssavirus (IKOV), isolated from an African civet in Tanzania displaying clinical signs of rabies. Genetically, this virus is the most divergent within the genus Lyssavirus. Characterization of the genome will help to improve our understanding of lyssavirus diversity and enable investigation into vaccine-induced immunity and protection.

Positive mood broadens visual attention to positive stimuli.

Science.gov (United States)

Wadlinger, Heather A; Isaacowitz, Derek M

2006-03-01

In an attempt to investigate the impact of positive emotions on visual attention within the context of Fredrickson's (1998) broaden-and-build model, eye tracking was used in two studies to measure visual attentional preferences of college students (n=58, n=26) to emotional pictures. Half of each sample experienced induced positive mood immediately before viewing slides of three similarly-valenced images, in varying central-peripheral arrays. Attentional breadth was determined by measuring the percentage viewing time to peripheral images as well as by the number of visual saccades participants made per slide. Consistent with Fredrickson's theory, the first study showed that individuals induced into positive mood fixated more on peripheral stimuli than did control participants; however, this only held true for highly-valenced positive stimuli. Participants under induced positive mood also made more frequent saccades for slides of neutral and positive valence. A second study showed that these effects were not simply due to differences in emotional arousal between stimuli. Selective attentional broadening to positive stimuli may act both to facilitate later building of resources as well as to maintain current positive affective states.

THE MANIFESTATION OF THE ABUSE OF DOMINANT POSITION IN THE CURRENT ROMANIAN ECONOMY

Directory of Open Access Journals (Sweden)

MELINDA CENUŞE

2011-01-01

Full Text Available The abuse use of a dominant position constitutes an important form of manifestation of anti-competitive practices. Almost all competition laws have some provisions on the abuse of dominant position. Most European laws, including the one of the European Union, contain an express provision prohibiting the abuse of dominant position. However, they rarely include a definition of what constitutes abuse of dominant position, but most of them pass in review examples of behaviors that may be considered illegal. In countries with a developed market economy, the legal provisions regarding abuse of dominant position were not so important and so widely used as the provisioning governing mergers and the cartel behavior. The explanation is that in a developed economy, the markets are larger, firms are more numerous, and the entry on the market is relatively easy. As a result, there are few markets where a firm with a dominant position can exercise its market influence for longer periods without new entries being attracted. For this study we decided to present the most famous cases involving the abuse of dominant position registered on Romanian market of mobile phones in 2011 and sanctioned by the Romanian Competition Council.

Learning about evolution from sequence data

Science.gov (United States)

Dayarian, Adel; Shraiman, Boris

2012-02-01

Recent advances in sequencing and in laboratory evolution experiments have made possible to obtain quantitative data on genetic diversity of populations and on the dynamics of evolution. This dynamics is shaped by the interplay between selection acting on beneficial and deleterious mutations and recombination which reshuffles genotypes. Mounting evidence suggests that natural populations harbor extensive fitness diversity, yet most of the currently available tools for analyzing polymorphism data are based on the neutral theory. Our aim is to develop methods to analyze genomic data for populations in the presence of the above-mentioned factors. We consider different evolutionary regimes - Muller's ratchet, mutation-recombination-selection balance and positive adaption rate - and revisit a number of observables considered in the nearly-neutral theory of evolution. In particular, we examine the coalescent structure in the presence of recombination and calculate quantities such as the distribution of the coalescent times along the genome, the distribution of haplotype block sizes and the correlation between ancestors of different loci along the genome. In addition, we characterize the probability and time of fixation of mutations as a function of their fitness effect.

A phylogenetic analysis of Diurideae (Orchidaceae) based on plastid DNA sequence data.

Science.gov (United States)

Kores, P J; Molvray, M; Weston, P H; Hopper, S D; Brown, A P; Cameron, K M; Chase, M W

2001-10-01

DNA sequence data from plastid matK and trnL-F regions were used in phylogenetic analyses of Diurideae, which indicate that Diurideae are not monophyletic as currently delimited. However, if Chloraeinae and Pterostylidinae are excluded from Diurideae, the remaining subtribes form a well-supported, monophyletic group that is sister to a "spiranthid" clade. Chloraea, Gavilea, and Megastylis pro parte (Chloraeinae) are all placed among the spiranthid orchids and form a grade with Pterostylis leading to a monophyletic Cranichideae. Codonorchis, previously included among Chloraeinae, is sister to Orchideae. Within the more narrowly delimited Diurideae two major lineages are apparent. One includes Diuridinae, Cryptostylidinae, Thelymitrinae, and an expanded Drakaeinae; the other includes Caladeniinae s.s., Prasophyllinae, and Acianthinae. The achlorophyllous subtribe Rhizanthellinae is a member of Diurideae, but its placement is otherwise uncertain. The sequence-based trees indicate that some morphological characters used in previous classifications, such as subterranean storage organs, anther position, growth habit, fungal symbionts, and pollination syndromes have more complex evolutionary histories than previously hypothesized. Treatments based upon these characters have produced conflicting classifications, and molecular data offer a tool for reevaluating these phylogenetic hypotheses.

Tracking the position of the underwater robot for nuclear reactor inspection

International Nuclear Information System (INIS)

Jeo, J. W.; Kim, C. H.; Seo, Y. C.; Choi, Y. S.; Kim, S. H.

2003-01-01

The tracking procedure of the underwater mobile robot moving and submerging ahead to nuclear reactor vessel for visual inspection, which is required to find the foreign objects such as loose parts, is described. The yellowish underwater robot body tends to present a big contrast to boron solute cold water of nuclear reactor vessel, tinged with indigo by the Cerenkov effect. In this paper, we have found and tracked the positions of underwater mobile robot using the two color information, yellow and indigo. From the horizontal and vertical profiles analysis of the color image, the blue, green, and the gray component have the inferior signal-to-noise characteristics compared to the red component. The center coordinates extraction procedures areas follows. The first step is to segment the underwater robot body to cold water with indigo background. From the RGB color components of the entire monitoring image taken with the color CCD camera, we have selected the red color component. In the selected red image, we extracted the positions of the underwater mobile robot using the following process sequences; binarization, labelling, and centroid extraction techniques. In the experiment carried out at the Youngkwang unit 5 nuclear reactor vessel, we have tracked the center positions of the underwater robot submerged near the cold leg and the hot leg way, which is fathomed to 10m deep in depth. When the position of the robot vehicle fluctuates between the previous and the current image frame due to the flickering noise and light source, installed temporally in the bottom of the reactor vessel, we adaptively adjusted the ROI window. Adding the ROI windows of the previous frame to the current frame, and then setting up the ROI window of the next image frame, we can robustly track the positions of the underwater robot and control the target position's divergence. From these facts, we can conclude that using the red component from color camera is more efficient tracking method

Positive evolution of the glycoprotein (GP) gene is related to transmission of the Ebola virus.

Science.gov (United States)

Jing, Y X; Wang, L N; Wu, X M; Song, C X

2016-03-28

Ebola hemorrhagic fever is a fatal disease caused by the negative-strand RNA of the Ebola virus. A high-intensity outbreak of this fever was reported in West Africa last year; however, there is currently no definitive treatment strategy available for this disease. In this study, we analyzed the molecular evolutionary history and attempted to determine the positive selection sites in the Ebola genes using multiple-genomic sequences of the various Ebola virus subtypes, in order to gain greater clarity into the evolution of the virus and its various subtypes. Only the glycoprotein (GP) gene was positively selected among the 8 Ebola genes, with the other genes remaining in the purification stage. The positive selection sites in the GP gene were identified by a random-site model; these sites were found to be located in the mucin-like region, which is associated with transmembrane protein binding. Additionally, different branches of the phylogenetic tree displayed different positive sites, which in turn was responsible for differences in the cell adhesion ability of the virus. In conclusion, the pattern of positive sites in the GP gene is associated with the epidemiology and prevalence of Ebola in different areas.

The complete genome sequence of the Gram-positive bacterium Bacillus subtilis

NARCIS (Netherlands)

Kunst, F; Ogasawara, N; Moszer, [No Value; Albertini, AM; Alloni, G; Azevedo, [No Value; Bertero, MG; Bessieres, P; Bolotin, A; Borchert, S; Borriss, R; Boursier, L; Brans, A; Brignell, SC; Bron, S; Brouillet, S; Bruschi, CV; Caldwell, B; Capuano, [No Value; Carter, NM; Choi, SK; Codani, JJ; Connerton, IF; Cummings, NJ; Daniel, RA; Denizot, F; Devine, KM; Dusterhoft, A; Ehrlich, SD; Emmerson, PT; Entian, KD; Errington, J; Fabret, C; Ferrari, E; Foulger, D; Fujita, M; Fujita, Y; Fuma, S; Galizzi, A; Galleron, N; Ghim, SY; Glaser, P; Goffeau, A; Golightly, EJ; Grandi, G; Guiseppi, G; Guy, BJ; Haga, K; Haiech, J; Harwood, CR; Henaut, A; Hilbert, H; Holsappel, S; Hosono, S; Hullo, MF; Itaya, M; Jones, L; Joris, B; Karamata, D; Kasahara, Y; KlaerrBlanchard, M; Klein, C; Kobayashi, Y; Koetter, P; Koningstein, G; Krogh, S; Kumano, M; Kurita, K; Lapidus, A; Lardinois, S; Lauber, J; Lazarevic, [No Value; Lee, SM; Levine, A; Liu, H; Masuda, S; Mauel, C; Medigue, C; Medina, N; Mellado, RP; Mizuno, M; Moestl, D; Nakai, S; Noback, M; Noone, D; OReilly, M; Ogawa, K; Ogiwara, A; Oudega, B; Park, SH; Parro, [No Value; Pohl, TM; Portetelle, D; Porwollik, S; Prescott, AM; Presecan, E; Pujic, P; Purnelle, B; Rapoport, G; Rey, M; Reynolds, S; Rieger, M; Rivolta, C; Rocha, E; Roche, B; Rose, M; Sadaie, Y; Sato, T; Scanlan, E; Schleich, S; Schroeter, R; Scoffone, F; Sekiguchi, J; Sekowska, A; Seror, SJ; Serror, P; Shin, BS; Soldo, B; Sorokin, A; Tacconi, E; Takagi, T; Takahashi, H; Takemaru, K; Takeuchi, M; Tamakoshi, A; Tanaka, T; Terpstra, P; Tognoni, A; Tosato, [No Value; Uchiyama, S; Vandenbol, M; Vannier, F; Vassarotti, A; Viari, A; Wambutt, R; Wedler, E; Wedler, H; Weitzenegger, T; Winters, P; Wipat, A; Yamamoto, H; Yamane, K; Yasumoto, K; Yata, K; Yoshida, K; Yoshikawa, HF; Zumstein, E; Yoshikawa, H; Danchin, A

1997-01-01

Bacillus subtilis is the best-characterized member of the Gram-positive bacteria. Its genome of 4,214,810 base pairs comprises 4,100 protein-coding genes. Of these protein-coding genes, 53% are represented once, while a quarter of the genome corresponds to several gene families that have been

GONOME: measuring correlations between GO terms and genomic positions

Directory of Open Access Journals (Sweden)

Bailey Timothy L

2006-02-01

Full Text Available Abstract Background: Current methods to find significantly under- and over-represented gene ontology (GO terms in a set of genes consider the genes as equally probable "balls in a bag", as may be appropriate for transcripts in micro-array data. However, due to the varying length of genes and intergenic regions, that approach is inappropriate for deciding if any GO terms are correlated with a set of genomic positions. Results: We present an algorithm – GONOME – that can determine which GO terms are significantly associated with a set of genomic positions given a genome annotated with (at least the starts and ends of genes. We show that certain GO terms may appear to be significantly associated with a set of randomly chosen positions in the human genome if gene lengths are not considered, and that these same terms have been reported as significantly over-represented in a number of recent papers. This apparent over-representation disappears when gene lengths are considered, as GONOME does. For example, we show that, when gene length is taken into account, the term "development" is not significantly enriched in genes associated with human CpG islands, in contradiction to a previous report. We further demonstrate the efficacy of GONOME by showing that occurrences of the proteosome-associated control element (PACE upstream activating sequence in the S. cerevisiae genome associate significantly to appropriate GO terms. An extension of this approach yields a whole-genome motif discovery algorithm that allows identification of many other promoter sequences linked to different types of genes, including a large group of previously unknown motifs significantly associated with the terms 'translation' and 'translational elongation'. Conclusion: GONOME is an algorithm that correctly extracts over-represented GO terms from a set of genomic positions. By explicitly considering gene size, GONOME avoids a systematic bias toward GO terms linked to large genes

Hybridization and sequencing of nucleic acids using base pair mismatches

Science.gov (United States)

Fodor, Stephen P. A.; Lipshutz, Robert J.; Huang, Xiaohua

2001-01-01

Devices and techniques for hybridization of nucleic acids and for determining the sequence of nucleic acids. Arrays of nucleic acids are formed by techniques, preferably high resolution, light-directed techniques. Positions of hybridization of a target nucleic acid are determined by, e.g., epifluorescence microscopy. Devices and techniques are proposed to determine the sequence of a target nucleic acid more efficiently and more quickly through such synthesis and detection techniques.

Fast imaging of intermittent electrospraying of water with positive corona discharge

International Nuclear Information System (INIS)

Pongrác, B; Janda, M; Martišovitš, V; Machala, Z; Kim, H H

2014-01-01

The effect of the electrospraying of water in combination with a positive direct current (dc) streamer corona discharge generated in air was investigated in this paper. We employed high-speed camera visualizations and oscilloscopic discharge current measurements in combination with an intensified charge-coupled device camera for fast time-resolved imaging. The repetitive process of Taylor cone formation and droplet formation from the mass fragments of water during the electrospray was visualized. Depending on the applied voltage, the following intermittent modes of electrospraying typical for water were observed: dripping mode, spindle mode, and oscillating-spindle mode. The observed electrospraying modes were repetitive with a frequency of a few hundreds of Hz, as measured from the fast image sequences. This frequency agreed well with the frequency of the measured streamer current pulses. The presence of filamentary streamer discharges at relatively low voltages probably prevented the establishment of a continuous electrospray in the cone–jet mode. After each streamer, a positive glow corona discharge was established on the water filament tip, and it propagated from the stressed electrode along with the water filament elongation. The results show a reciprocal character of intermittent electrospraying of water, and the presence of corona discharge, where both the electrospray and the discharge affect each other. The generation of a corona discharge from the water cone depended on the repetitive process of the cone formation. Also, the propagation and curvature of the water filament were influenced by the discharge and its resultant space charge. Furthermore, these phenomena were partially influenced by the water conductivity. (paper)

Sequence-based classification and identification of Fungi.

Science.gov (United States)

Hibbett, David; Abarenkov, Kessy; Kõljalg, Urmas; Öpik, Maarja; Chai, Benli; Cole, James; Wang, Qiong; Crous, Pedro; Robert, Vincent; Helgason, Thorunn; Herr, Joshua R; Kirk, Paul; Lueschow, Shiloh; O'Donnell, Kerry; Nilsson, R Henrik; Oono, Ryoko; Schoch, Conrad; Smyth, Christopher; Walker, Donald M; Porras-Alfaro, Andrea; Taylor, John W; Geiser, David M

Fungal taxonomy and ecology have been revolutionized by the application of molecular methods and both have increasing connections to genomics and functional biology. However, data streams from traditional specimen- and culture-based systematics are not yet fully integrated with those from metagenomic and metatranscriptomic studies, which limits understanding of the taxonomic diversity and metabolic properties of fungal communities. This article reviews current resources, needs, and opportunities for sequence-based classification and identification (SBCI) in fungi as well as related efforts in prokaryotes. To realize the full potential of fungal SBCI it will be necessary to make advances in multiple areas. Improvements in sequencing methods, including long-read and single-cell technologies, will empower fungal molecular ecologists to look beyond ITS and current shotgun metagenomics approaches. Data quality and accessibility will be enhanced by attention to data and metadata standards and rigorous enforcement of policies for deposition of data and workflows. Taxonomic communities will need to develop best practices for molecular characterization in their focal clades, while also contributing to globally useful datasets including ITS. Changes to nomenclatural rules are needed to enable validPUBLICation of sequence-based taxon descriptions. Finally, cultural shifts are necessary to promote adoption of SBCI and to accord professional credit to individuals who contribute to community resources.

Triangular fibrocartilage lesions: comparison STIR sequence versus arthroscopy findings

International Nuclear Information System (INIS)

Wang Zhi; Meng; Xianghong; Wang Linsen; Suo Yongmei

2013-01-01

Objective: To explore the diagnostic value of short TI inversion recovery (STIR) sequence in evaluating triangular fibrocartilage (TFC) lesions, and to compare the findings with the arthroscopy findings. Materials and Methods: Wrist joint MR examination using STIR sequence and arthroscopy were performed in 56 patients with TFC lesions. The parameters of STIR sequence were: TR: 1164 ms, TE: 16 ms, and TI: 90 ms. The sensibility, specificity, positive predictive value, negative predictive value, and accuracy in the diagnosis of TFC lesions with STIR sequence were calculated, using arthroscopy as the standard. Results: (1) STIR manifested 10 patients with normal TFC; 6 with small edema or mucous degeneration in the body portion but not involving joint surface edge; 6 with horizontal avulsion in the body portion, but not involving joint surface edge; 6 with avulsion involving joint surface edge; 11 with perforation in central portion; 6 with avulsion in radial attached end; 5 with avulsion in ulnar attached end; 3 with avulsion in both radial and ulnar attached ends; 3 with irregular shape and thin on the whole TFC. (2) Arthroscopy manifested 21 patients with normal TFC; 8 with avulsion involving joint surface edge; 10 with perforation in central portion; 7 with avulsion in radial attached end; 5 with avulsion in ulnar attached end; 2 with avulsion in both radial and ulnar attached ends; 3 with irregular shape on the whole TFC. Using STIR sequence, the sensibility, specificity, positive predictive value, negative predictive value. and accuracy were 85.7%, 23.8%, 65.2%, 50%, and 62.5%, respectively, in detection of TFC lesions, with arthroscopy as the standard. Conclusion: STIR sequence has high diagnostic value in detection of TFC lesions. (authors)

Sequence, structure and function relationships in flaviviruses as assessed by evolutive aspects of its conserved non-structural protein domains.

Science.gov (United States)

da Fonseca, Néli José; Lima Afonso, Marcelo Querino; Pedersolli, Natan Gonçalves; de Oliveira, Lucas Carrijo; Andrade, Dhiego Souto; Bleicher, Lucas

2017-10-28

Flaviviruses are responsible for serious diseases such as dengue, yellow fever, and zika fever. Their genomes encode a polyprotein which, after cleavage, results in three structural and seven non-structural proteins. Homologous proteins can be studied by conservation and coevolution analysis as detected in multiple sequence alignments, usually reporting positions which are strictly necessary for the structure and/or function of all members in a protein family or which are involved in a specific sub-class feature requiring the coevolution of residue sets. This study provides a complete conservation and coevolution analysis on all flaviviruses non-structural proteins, with results mapped on all well-annotated available sequences. A literature review on the residues found in the analysis enabled us to compile available information on their roles and distribution among different flaviviruses. Also, we provide the mapping of conserved and coevolved residues for all sequences currently in SwissProt as a supplementary material, so that particularities in different viruses can be easily analyzed. Copyright © 2017 Elsevier Inc. All rights reserved.

Control Strategies for Islanded Microgrid using Enhanced Hierarchical Control Structure with Multiple Current-Loop Damping Schemes

DEFF Research Database (Denmark)

Han, Yang; Shen, Pan; Zhao, Xin

2017-01-01

In this paper, the modeling, controller design, and stability analysis of the islanded microgrid (MG) using enhanced hierarchical control structure with multiple current loop damping schemes is proposed. The islanded MG is consisted of the parallel-connected voltage source inverters using LCL...... output filters, and the proposed control structure includes: the primary control with additional phase-shift loop, the secondary control for voltage amplitude and frequency restoration, the virtual impedance loops which contains virtual positive- and negative-sequence impedance loops at fundamental...... frequency, and virtual variable harmonic impedance loop at harmonic frequencies, and the inner voltage and current loop controllers. A small-signal model for the primary and secondary controls with additional phase-shift loop is presented, which shows an over-damped feature from eigenvalue analysis...

Electric current sensors: a review

International Nuclear Information System (INIS)

Ripka, Pavel

2010-01-01

The review makes a brief overview of traditional methods of measurement of electric current and shows in more detail relatively new types of current sensors. These include Hall sensors with field concentrators, AMR current sensors, magneto-optical and superconducting current sensors. The influence of the magnetic core properties on the error of the current transformer shows why nanocrystalline materials are so advantageous for this application. Built-in CMOS current sensors are important tools for monitoring the health of integrated circuits. Of special industrial value are current clamps which can be installed without breaking the measured conductor. Parameters of current sensors are also discussed, including geometrical selectivity. This parameter specific for current sensors means the ability to suppress the influence of currents external to the sensor (including the position of the return conductor) and also suppress the influence on the position of the measured conductor with respect to the current. (topical review)

Intrinsic position uncertainty impairs overt search performance.

Science.gov (United States)

Semizer, Yelda; Michel, Melchi M

2017-08-01

Uncertainty regarding the position of the search target is a fundamental component of visual search. However, due to perceptual limitations of the human visual system, this uncertainty can arise from intrinsic, as well as extrinsic, sources. The current study sought to characterize the role of intrinsic position uncertainty (IPU) in overt visual search and to determine whether it significantly limits human search performance. After completing a preliminary detection experiment to characterize sensitivity as a function of visual field position, observers completed a search task that required localizing a Gabor target within a field of synthetic luminance noise. The search experiment included two clutter conditions designed to modulate the effect of IPU across search displays of varying set size. In the Cluttered condition, the display was tiled uniformly with feature clutter to maximize the effects of IPU. In the Uncluttered condition, the clutter at irrelevant locations was removed to attenuate the effects of IPU. Finally, we derived an IPU-constrained ideal searcher model, limited by the IPU measured in human observers. Ideal searchers were simulated based on the detection sensitivity and fixation sequences measured for individual human observers. The IPU-constrained ideal searcher predicted performance trends similar to those exhibited by the human observers. In the Uncluttered condition, performance decreased steeply as a function of increasing set size. However, in the Cluttered condition, the effect of IPU dominated and performance was approximately constant as a function of set size. Our findings suggest that IPU substantially limits overt search performance, especially in crowded displays.

Observations of current flow to a positively polarized electrode in a quiescent magnetoplasma

International Nuclear Information System (INIS)

Ferreira, J.L.; Urrutia, J.M.; Stenzel, R.L.

1988-05-01

This work reports experimental studies on the current flow to an electrode immersed in a quiescent magnetized plasma. The observed intense current driven instabilities during the current flow were found to be related with an anomalous current transport. (author)

Applications of nanotechnology, next generation sequencing and microarrays in biomedical research.

Science.gov (United States)

Elingaramil, Sauli; Li, Xiaolong; He, Nongyue

2013-07-01

Next-generation sequencing technologies, microarrays and advances in bio nanotechnology have had an enormous impact on research within a short time frame. This impact appears certain to increase further as many biomedical institutions are now acquiring these prevailing new technologies. Beyond conventional sampling of genome content, wide-ranging applications are rapidly evolving for next-generation sequencing, microarrays and nanotechnology. To date, these technologies have been applied in a variety of contexts, including whole-genome sequencing, targeted re sequencing and discovery of transcription factor binding sites, noncoding RNA expression profiling and molecular diagnostics. This paper thus discusses current applications of nanotechnology, next-generation sequencing technologies and microarrays in biomedical research and highlights the transforming potential these technologies offer.

Comparative analysis of full genomic sequences among different genotypes of dengue virus type 3

Directory of Open Access Journals (Sweden)

Lin Ting-Hsiang

2008-05-01

Full Text Available Abstract Background Although the previous study demonstrated the envelope protein of dengue viruses is under purifying selection pressure, little is known about the genetic differences of full-length viral genomes of DENV-3. In our study, complete genomic sequencing of DENV-3 strains collected from different geographical locations and isolation years were determined and the sequence diversity as well as selection pressure sites in the DENV genome other than within the E gene were also analyzed. Results Using maximum likelihood and Bayesian approaches, our phylogenetic analysis revealed that the Taiwan's indigenous DENV-3 isolated from 1994 and 1998 dengue/DHF epidemics and one 1999 sporadic case were of the three different genotypes – I, II, and III, each associated with DENV-3 circulating in Indonesia, Thailand and Sri Lanka, respectively. Sequence diversity and selection pressure of different genomic regions among DENV-3 different genotypes was further examined to understand the global DENV-3 evolution. The highest nucleotide sequence diversity among the fully sequenced DENV-3 strains was found in the nonstructural protein 2A (mean ± SD: 5.84 ± 0.54 and envelope protein gene regions (mean ± SD: 5.04 ± 0.32. Further analysis found that positive selection pressure of DENV-3 may occur in the non-structural protein 1 gene region and the positive selection site was detected at position 178 of the NS1 gene. Conclusion Our study confirmed that the envelope protein is under purifying selection pressure although it presented higher sequence diversity. The detection of positive selection pressure in the non-structural protein along genotype II indicated that DENV-3 originated from Southeast Asia needs to monitor the emergence of DENV strains with epidemic potential for better epidemic prevention and vaccine development.

Constrained core solutions for totally positive games with ordered players

NARCIS (Netherlands)

van den Brink, J.R.; van der Laan, G.; Vasil'ev, V.

2014-01-01

In many applications of cooperative game theory to economic allocation problems, such as river-, polluted river- and sequencing games, the game is totally positive (i.e., all dividends are nonnegative), and there is some ordering on the set of the players. A totally positive game has a nonempty

Identification of a current hot spot of HIV type 1 transmission in Mongolia by molecular epidemiological analysis.

Science.gov (United States)

Davaalkham, Jagdagsuren; Unenchimeg, Puntsag; Baigalmaa, Chultem; Erdenetuya, Gombo; Nyamkhuu, Dulmaa; Shiino, Teiichiro; Tsuchiya, Kiyoto; Hayashida, Tsunefusa; Gatanaga, Hiroyuki; Oka, Shinichi

2011-10-01

We investigated the current molecular epidemiological status of HIV-1 in Mongolia, a country with very low incidence of HIV-1 though with rapid expansion in recent years. HIV-1 pol (1065 nt) and env (447 nt) genes were sequenced to construct phylogenetic trees. The evolutionary rates, molecular clock phylogenies, and other evolutionary parameters were estimated from heterochronous genomic sequences of HIV-1 subtype B by the Bayesian Markov chain Monte Carlo method. We obtained 41 sera from 56 reported HIV-1-positive cases as of May 2009. The main route of infection was men who have sex with men (MSM). Dominant subtypes were subtype B in 32 cases (78%) followed by subtype CRF02_AG (9.8%). The phylogenetic analysis of the pol gene identified two clusters in subtype B sequences. Cluster 1 consisted of 21 cases including MSM and other routes of infection, and cluster 2 consisted of eight MSM cases. The tree analyses demonstrated very short branch lengths in cluster 1, suggesting a surprisingly active expansion of HIV-1 transmission during a short period with the same ancestor virus. Evolutionary analysis indicated that the outbreak started around the early 2000s. This study identified a current hot spot of HIV-1 transmission and potential seed of the epidemic in Mongolia. Comprehensive preventive measures targeting this group are urgently needed.

Mapping vaccinia virus DNA replication origins at nucleotide level by deep sequencing.

Science.gov (United States)

Senkevich, Tatiana G; Bruno, Daniel; Martens, Craig; Porcella, Stephen F; Wolf, Yuri I; Moss, Bernard

2015-09-01

Poxviruses reproduce in the host cytoplasm and encode most or all of the enzymes and factors needed for expression and synthesis of their double-stranded DNA genomes. Nevertheless, the mode of poxvirus DNA replication and the nature and location of the replication origins remain unknown. A current but unsubstantiated model posits only leading strand synthesis starting at a nick near one covalently closed end of the genome and continuing around the other end to generate a concatemer that is subsequently resolved into unit genomes. The existence of specific origins has been questioned because any plasmid can replicate in cells infected by vaccinia virus (VACV), the prototype poxvirus. We applied directional deep sequencing of short single-stranded DNA fragments enriched for RNA-primed nascent strands isolated from the cytoplasm of VACV-infected cells to pinpoint replication origins. The origins were identified as the switching points of the fragment directions, which correspond to the transition from continuous to discontinuous DNA synthesis. Origins containing a prominent initiation point mapped to a sequence within the hairpin loop at one end of the VACV genome and to the same sequence within the concatemeric junction of replication intermediates. These findings support a model for poxvirus genome replication that involves leading and lagging strand synthesis and is consistent with the requirements for primase and ligase activities as well as earlier electron microscopic and biochemical studies implicating a replication origin at the end of the VACV genome.

Simultaneous Structural Variation Discovery in Multiple Paired-End Sequenced Genomes

Science.gov (United States)

Hormozdiari, Fereydoun; Hajirasouliha, Iman; McPherson, Andrew; Eichler, Evan E.; Sahinalp, S. Cenk

Next generation sequencing technologies have been decreasing the costs and increasing the world-wide capacity for sequence production at an unprecedented rate, making the initiation of large scale projects aiming to sequence almost 2000 genomes [1]. Structural variation detection promises to be one of the key diagnostic tools for cancer and other diseases with genomic origin. In this paper, we study the problem of detecting structural variation events in two or more sequenced genomes through high throughput sequencing . We propose to move from the current model of (1) detecting genomic variations in single next generation sequenced (NGS) donor genomes independently, and (2) checking whether two or more donor genomes indeed agree or disagree on the variations (in this paper we name this framework Independent Structural Variation Discovery and Merging - ISV&M), to a new model in which we detect structural variation events among multiple genomes simultaneously.

Laboratory Sequence in Computational Methods for Introductory Chemistry

Science.gov (United States)

Cody, Jason A.; Wiser, Dawn C.

2003-07-01

A four-exercise laboratory sequence for introductory chemistry integrating hands-on, student-centered experience with computer modeling has been designed and implemented. The progression builds from exploration of molecular shapes to intermolecular forces and the impact of those forces on chemical separations made with gas chromatography and distillation. The sequence ends with an exploration of molecular orbitals. The students use the computers as a tool; they build the molecules, submit the calculations, and interpret the results. Because of the construction of the sequence and its placement spanning the semester break, good laboratory notebook practices are reinforced and the continuity of course content and methods between semesters is emphasized. The inclusion of these techniques in the first year of chemistry has had a positive impact on student perceptions and student learning.

Universal sequence map (USM of arbitrary discrete sequences

Directory of Open Access Journals (Sweden)

Almeida Jonas S

2002-02-01

Full Text Available Abstract Background For over a decade the idea of representing biological sequences in a continuous coordinate space has maintained its appeal but not been fully realized. The basic idea is that any sequence of symbols may define trajectories in the continuous space conserving all its statistical properties. Ideally, such a representation would allow scale independent sequence analysis – without the context of fixed memory length. A simple example would consist on being able to infer the homology between two sequences solely by comparing the coordinates of any two homologous units. Results We have successfully identified such an iterative function for bijective mappingψ of discrete sequences into objects of continuous state space that enable scale-independent sequence analysis. The technique, named Universal Sequence Mapping (USM, is applicable to sequences with an arbitrary length and arbitrary number of unique units and generates a representation where map distance estimates sequence similarity. The novel USM procedure is based on earlier work by these and other authors on the properties of Chaos Game Representation (CGR. The latter enables the representation of 4 unit type sequences (like DNA as an order free Markov Chain transition table. The properties of USM are illustrated with test data and can be verified for other data by using the accompanying web-based tool:http://bioinformatics.musc.edu/~jonas/usm/. Conclusions USM is shown to enable a statistical mechanics approach to sequence analysis. The scale independent representation frees sequence analysis from the need to assume a memory length in the investigation of syntactic rules.

Constrained optimization for position calibration of an NMR field camera.

Science.gov (United States)

Chang, Paul; Nassirpour, Sahar; Eschelbach, Martin; Scheffler, Klaus; Henning, Anke

2018-07-01

Knowledge of the positions of field probes in an NMR field camera is necessary for monitoring the B 0 field. The typical method of estimating these positions is by switching the gradients with known strengths and calculating the positions using the phases of the FIDs. We investigated improving the accuracy of estimating the probe positions and analyzed the effect of inaccurate estimations on field monitoring. The field probe positions were estimated by 1) assuming ideal gradient fields, 2) using measured gradient fields (including nonlinearities), and 3) using measured gradient fields with relative position constraints. The fields measured with the NMR field camera were compared to fields acquired using a dual-echo gradient recalled echo B 0 mapping sequence. Comparisons were done for shim fields from second- to fourth-order shim terms. The position estimation was the most accurate when relative position constraints were used in conjunction with measured (nonlinear) gradient fields. The effect of more accurate position estimates was seen when compared to fields measured using a B 0 mapping sequence (up to 10%-15% more accurate for some shim fields). The models acquired from the field camera are sensitive to noise due to the low number of spatial sample points. Position estimation of field probes in an NMR camera can be improved using relative position constraints and nonlinear gradient fields. Magn Reson Med 80:380-390, 2018. © 2017 International Society for Magnetic Resonance in Medicine. © 2017 International Society for Magnetic Resonance in Medicine.

DeepSimulator: a deep simulator for Nanopore sequencing

KAUST Repository

Li, Yu; Han, Renmin; Bi, Chongwei; Li, Mo; Wang, Sheng; Gao, Xin

2017-01-01

or assembled contigs, we simulate the electrical current signals by a context-dependent deep learning model, followed by a base-calling procedure to yield simulated reads. This workflow mimics the sequencing procedure more naturally. The thorough experiments

Is sequence awareness mandatory for perceptual sequence learning: An assessment using a pure perceptual sequence learning design.

Science.gov (United States)

Deroost, Natacha; Coomans, Daphné

2018-02-01

We examined the role of sequence awareness in a pure perceptual sequence learning design. Participants had to react to the target's colour that changed according to a perceptual sequence. By varying the mapping of the target's colour onto the response keys, motor responses changed randomly. The effect of sequence awareness on perceptual sequence learning was determined by manipulating the learning instructions (explicit versus implicit) and assessing the amount of sequence awareness after the experiment. In the explicit instruction condition (n = 15), participants were instructed to intentionally search for the colour sequence, whereas in the implicit instruction condition (n = 15), they were left uninformed about the sequenced nature of the task. Sequence awareness after the sequence learning task was tested by means of a questionnaire and the process-dissociation-procedure. The results showed that the instruction manipulation had no effect on the amount of perceptual sequence learning. Based on their report to have actively applied their sequence knowledge during the experiment, participants were subsequently regrouped in a sequence strategy group (n = 14, of which 4 participants from the implicit instruction condition and 10 participants from the explicit instruction condition) and a no-sequence strategy group (n = 16, of which 11 participants from the implicit instruction condition and 5 participants from the explicit instruction condition). Only participants of the sequence strategy group showed reliable perceptual sequence learning and sequence awareness. These results indicate that perceptual sequence learning depends upon the continuous employment of strategic cognitive control processes on sequence knowledge. Sequence awareness is suggested to be a necessary but not sufficient condition for perceptual learning to take place. Copyright © 2018 Elsevier B.V. All rights reserved.

A trace display and editing program for data from fluorescence based sequencing machines.

Science.gov (United States)

Gleeson, T; Hillier, L

1991-12-11

'Ted' (Trace editor) is a graphical editor for sequence and trace data from automated fluorescence sequencing machines. It provides facilities for viewing sequence and trace data (in top or bottom strand orientation), for editing the base sequence, for automated or manual trimming of the head (vector) and tail (uncertain data) from the sequence, for vertical and horizontal trace scaling, for keeping a history of sequence editing, and for output of the edited sequence. Ted has been used extensively in the C.elegans genome sequencing project, both as a stand-alone program and integrated into the Staden sequence assembly package, and has greatly aided in the efficiency and accuracy of sequence editing. It runs in the X windows environment on Sun workstations and is available from the authors. Ted currently supports sequence and trace data from the ABI 373A and Pharmacia A.L.F. sequencers.

Bayes Empirical Bayes Inference of Amino Acid Sites Under Positive Selection

DEFF Research Database (Denmark)

Yang, Ziheng; Wong, Wendy Shuk Wan; Nielsen, Rasmus

2005-01-01

, with > 1 indicating positive selection. Statistical distributions are used to model the variation in among sites, allowing a subset of sites to have > 1 while the rest of the sequence may be under purifying selection with ... probabilities that a site comes from the site class with > 1. Current implementations, however, use the naive EB (NEB) approach and fail to account for sampling errors in maximum likelihood estimates of model parameters, such as the proportions and ratios for the site classes. In small data sets lacking...... information, this approach may lead to unreliable posterior probability calculations. In this paper, we develop a Bayes empirical Bayes (BEB) approach to the problem, which assigns a prior to the model parameters and integrates over their uncertainties. We compare the new and old methods on real and simulated...

Validation of a standardized mapping system of the hip joint for radial MRA sequencing

International Nuclear Information System (INIS)

Klenke, Frank M.; Hoffmann, Daniel B.; Cross, Brian J.; Siebenrock, Klaus A.

2015-01-01

Intraarticular gadolinium-enhanced magnetic resonance arthrography (MRA) is commonly applied to characterize morphological disorders of the hip. However, the reproducibility of retrieving anatomic landmarks on MRA scans and their correlation with intraarticular pathologies is unknown. A precise mapping system for the exact localization of hip pathomorphologies with radial MRA sequences is lacking. Therefore, the purpose of the study was the establishment and validation of a reproducible mapping system for radial sequences of hip MRA. Sixty-nine consecutive intraarticular gadolinium-enhanced hip MRAs were evaluated. Radial sequencing consisted of 14 cuts orientated along the axis of the femoral neck. Three orthopedic surgeons read the radial sequences independently. Each MRI was read twice with a minimum interval of 7 days from the first reading. The intra- and inter-observer reliability of the mapping procedure was determined. A clockwise system for hip MRA was established. The teardrop figure served to determine the 6 o'clock position of the acetabulum; the center of the greater trochanter served to determine the 12 o'clock position of the femoral head-neck junction. The intra- and inter-observer ICCs to retrieve the correct 6/12 o'clock positions were 0.906-0.996 and 0.978-0.988, respectively. The established mapping system for radial sequences of hip joint MRA is reproducible and easy to perform. (orig.)

Sequence Learning Under Uncertainty in Children: Self-Reflection vs. Self-Assertion.

Science.gov (United States)

Lange-Küttner, Christiane; Averbeck, Bruno B; Hirsch, Silvia V; Wießner, Isabel; Lamba, Nishtha

2012-01-01

We know that stochastic feedback impairs children's associative stimulus-response (S-R) learning (Crone et al., 2004a; Eppinger et al., 2009), but the impact of stochastic feedback on sequence learning that involves deductive reasoning has not been not tested so far. In the current study, 8- to 11-year-old children (N = 171) learned a sequence of four left and right button presses, LLRR, RRLL, LRLR, RLRL, LRRL, and RLLR, which needed to be deduced from feedback because no directional cues were given. One group of children experienced consistent feedback only (deterministic feedback, 100% correct). In this condition, green feedback on the screen indicated that the children had been right when they were right, and red feedback indicated that the children had been wrong when they were wrong. Another group of children experienced inconsistent feedback (stochastic feedback, 85% correct, 15% false), where in some trials, green feedback on the screen could signal that children were right when in fact they were wrong, and red feedback could indicate that they were wrong when in fact they had been right. Independently of age, children's sequence learning in the stochastic condition was initially much lower than in the deterministic condition, but increased gradually and improved with practice. Responses toward positive vs. negative feedback varied with age. Children were increasingly able to understand that they could have been wrong when feedback indicated they were right (self-reflection), but they remained unable to understand that they could have been right when feedback indicated they were wrong (self-assertion).

Sequence Learning Under Uncertainty in Children: Self-reflection vs. Self-Assertion

Directory of Open Access Journals (Sweden)

Christiane eLange-Küttner

2012-05-01

Full Text Available We know that stochastic feedback impairs children’s associative stimulus-response (S-R learning (Crone, Jennigs, & Van der Molen, 2004a; Eppinger, Mock, & Kray, 2009, but the impact of stochastic feedback on sequence learning that involves deductive reasoning has not been not tested so far. In the current study, 8- to 11-year-old children (N = 171 learned a sequence of four left and right button presses, LLRR, RRLL, LRLR, RLRL, LRRL and RLLR, that needed to be deduced from feedback because no directional cues were given. One group of children experienced consistent feedback only (deterministic feedback, 100% correct. In this condition, green feedback on the screen indicated that the children had been right when they were right, and red feedback indicated that the children had been wrong when they were wrong. Another group of children experienced inconsistent feedback (stochastic feedback, 85% correct, 15% false, where in some trials, green feedback on the screen could signal that children were right when in fact they were wrong, and red feedback could indicate that they were wrong when in fact they had been right. Independently of age, children’s sequence learning in the stochastic condition was initially much lower than in the deterministic condition, but increased gradually and improved with practice. Responses towards positive vs. negative feedback varied with age. Children were increasingly able to understand that they could have been wrong when feedback indicated they were right (self-reflection, but they remained unable to understand that they could have been right when feedback indicated they were wrong (self-assertion.

Attention and memory biases as stable abnormalities among currently depressed and currently remitted individuals with Unipolar Depression

Directory of Open Access Journals (Sweden)

Rashmi eGupta

2012-11-01

Full Text Available BackgroundIn the present study, we explored the possibility of the stability of attention bias and memory bias in currently remitted individuals with unipolar depression compared to currently depressed individuals with unipolar depression and never-depressed individuals. MethodsThe Emotional Stroop and autobiographical memory task were administered on 10 participants, who were currently depressed, currently remitted with unipolar depression, or never-depressed. In the emotional Stroop task (EST, the respondent’s task was to indicate the color of the ink of the positive, negative, and neutral words by selecting one of a series of colored blocks. In the autobiographical memory task (AMT, participants were presented with positive, negative, and neutral cue words. For each word, they were asked to report specific events from their life. ResultsBoth the attention bias and memory bias exist in both the clinical groups. In EST, both currently depressed and currently remitted groups were slower to respond to negative words compared to neutral words. Unlike EST, in AMT both currently depressed and currently remitted groups were slower to respond to positive words compared to neutral words. Interestingly, the capacity to generate specific events for negative events was higher in both currently depressed and currently remitted groups. They were over-general in their memories of positive events. Importantly, the never-depressed group was specific in their memories of both positive and negative events of their life. ConclusionsOur findings provide evidence for the stable existence of attention and memory bias in currently remitted individuals. This study has implications for the cognitive behavior therapy for depression to include modules to resolve the attention and memory bias toward negative thought and content, and to build strategies to overcome such biases.

Rapid and Easy Protocol for Quantification of Next-Generation Sequencing Libraries.

Science.gov (United States)

Hawkins, Steve F C; Guest, Paul C

2018-01-01

The emergence of next-generation sequencing (NGS) over the last 10 years has increased the efficiency of DNA sequencing in terms of speed, ease, and price. However, the exact quantification of a NGS library is crucial in order to obtain good data on sequencing platforms developed by the current market leader Illumina. Different approaches for DNA quantification are available currently and the most commonly used are based on analysis of the physical properties of the DNA through spectrophotometric or fluorometric methods. Although these methods are technically simple, they do not allow exact quantification as can be achieved using a real-time quantitative PCR (qPCR) approach. A qPCR protocol for DNA quantification with applications in NGS library preparation studies is presented here. This can be applied in various fields of study such as medical disorders resulting from nutritional programming disturbances.

SRComp: short read sequence compression using burstsort and Elias omega coding.

Directory of Open Access Journals (Sweden)

Jeremy John Selva

Full Text Available Next-generation sequencing (NGS technologies permit the rapid production of vast amounts of data at low cost. Economical data storage and transmission hence becomes an increasingly important challenge for NGS experiments. In this paper, we introduce a new non-reference based read sequence compression tool called SRComp. It works by first employing a fast string-sorting algorithm called burstsort to sort read sequences in lexicographical order and then Elias omega-based integer coding to encode the sorted read sequences. SRComp has been benchmarked on four large NGS datasets, where experimental results show that it can run 5-35 times faster than current state-of-the-art read sequence compression tools such as BEETL and SCALCE, while retaining comparable compression efficiency for large collections of short read sequences. SRComp is a read sequence compression tool that is particularly valuable in certain applications where compression time is of major concern.

Sequencing genes in silico using single nucleotide polymorphisms

Directory of Open Access Journals (Sweden)

Zhang Xinyi

2012-01-01

Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

Correlated mutations in protein sequences: Phylogenetic and structural effects

Energy Technology Data Exchange (ETDEWEB)

Lapedes, A.S. [Los Alamos National Lab., NM (United States). Theoretical Div.]|[Santa Fe Inst., NM (United States); Giraud, B.G. [C.E.N. Saclay, Gif/Yvette (France). Service Physique Theorique; Liu, L.C. [Los Alamos National Lab., NM (United States). Theoretical Div.; Stormo, G.D. [Univ. of Colorado, Boulder, CO (United States). Dept. of Molecular, Cellular and Developmental Biology

1998-12-01

Covariation analysis of sets of aligned sequences for RNA molecules is relatively successful in elucidating RNA secondary structure, as well as some aspects of tertiary structure. Covariation analysis of sets of aligned sequences for protein molecules is successful in certain instances in elucidating certain structural and functional links, but in general, pairs of sites displaying highly covarying mutations in protein sequences do not necessarily correspond to sites that are spatially close in the protein structure. In this paper the authors identify two reasons why naive use of covariation analysis for protein sequences fails to reliably indicate sequence positions that are spatially proximate. The first reason involves the bias introduced in calculation of covariation measures due to the fact that biological sequences are generally related by a non-trivial phylogenetic tree. The authors present a null-model approach to solve this problem. The second reason involves linked chains of covariation which can result in pairs of sites displaying significant covariation even though they are not spatially proximate. They present a maximum entropy solution to this classic problem of causation versus correlation. The methodologies are validated in simulation.

A structural study for the optimisation of functional motifs encoded in protein sequences

Directory of Open Access Journals (Sweden)

Helmer-Citterich Manuela

2004-04-01

Full Text Available Abstract Background A large number of PROSITE patterns select false positives and/or miss known true positives. It is possible that – at least in some cases – the weak specificity and/or sensitivity of a pattern is due to the fact that one, or maybe more, functional and/or structural key residues are not represented in the pattern. Multiple sequence alignments are commonly used to build functional sequence patterns. If residues structurally conserved in proteins sharing a function cannot be aligned in a multiple sequence alignment, they are likely to be missed in a standard pattern construction procedure. Results Here we present a new procedure aimed at improving the sensitivity and/ or specificity of poorly-performing patterns. The procedure can be summarised as follows: 1. residues structurally conserved in different proteins, that are true positives for a pattern, are identified by means of a computational technique and by visual inspection. 2. the sequence positions of the structurally conserved residues falling outside the pattern are used to build extended sequence patterns. 3. the extended patterns are optimised on the SWISS-PROT database for their sensitivity and specificity. The method was applied to eight PROSITE patterns. Whenever structurally conserved residues are found in the surface region close to the pattern (seven out of eight cases, the addition of information inferred from structural analysis is shown to improve pattern selectivity and in some cases selectivity and sensitivity as well. In some of the cases considered the procedure allowed the identification of functionally interesting residues, whose biological role is also discussed. Conclusion Our method can be applied to any type of functional motif or pattern (not only PROSITE ones which is not able to select all and only the true positive hits and for which at least two true positive structures are available. The computational technique for the identification of

Combination of cytochrome b heteroduplex-assay and sequencing for identification of triatomine blood meals.

Science.gov (United States)

Buitrago, Rosio; Depickère, Stéphanie; Bosseno, Marie-France; Patzi, Edda Siñani; Waleckx, Etienne; Salas, Renata; Aliaga, Claudia; Brenière, Simone Frédérique

2012-01-01

The identification of blood meals in vectors contributes greatly to the understanding of interactions between vectors, microorganisms and hosts. The aim of the current work was to complement the validation of cytochrome b (Cytb) heteroduplex assay (HDA) previously described, and to add the sequencing of the Cytb gene of some samples for the identification of blood meals in triatomines. Experimental feedings of reared triatomines helped to clarify the sensitivity of the HDA. Moreover, the sequencing coupled with the HDA, allowed the assessment of the technique's taxonomic level of discrimination. The primers used to produce DNA fragments of Cytb genes for HDA had a very high sensitivity for vertebrate DNAs, rather similar for mammals, birds and reptiles. However, the formation of heteroduplex depended on blood meal's quality rather than its quantity; a correlation was observed between blood meals' color and the positivity of HDA. HDA electrophoresis profiles were reproducible, and allowed the discrimination of blood origins at the species level. However, in some cases, intraspecific variability of Cytb gene generated different HDA profiles. The HDA based on comparison of electrophoresis profiles is a very useful tool for screening large samples to determine blood origins; the subsequent sequencing of PCR products of Cytb corresponding to different HDA profiles allowed the identification of species whatever the biotope in which the vectors were captured. Copyright © 2011. Published by Elsevier B.V.

TargetM6A: Identifying N6-Methyladenosine Sites From RNA Sequences via Position-Specific Nucleotide Propensities and a Support Vector Machine.

Science.gov (United States)

Li, Guang-Qing; Liu, Zi; Shen, Hong-Bin; Yu, Dong-Jun

2016-10-01

As one of the most ubiquitous post-transcriptional modifications of RNA, N 6 -methyladenosine ( [Formula: see text]) plays an essential role in many vital biological processes. The identification of [Formula: see text] sites in RNAs is significantly important for both basic biomedical research and practical drug development. In this study, we designed a computational-based method, called TargetM6A, to rapidly and accurately target [Formula: see text] sites solely from the primary RNA sequences. Two new features, i.e., position-specific nucleotide/dinucleotide propensities (PSNP/PSDP), are introduced and combined with the traditional nucleotide composition (NC) feature to formulate RNA sequences. The extracted features are further optimized to obtain a much more compact and discriminative feature subset by applying an incremental feature selection (IFS) procedure. Based on the optimized feature subset, we trained TargetM6A on the training dataset with a support vector machine (SVM) as the prediction engine. We compared the proposed TargetM6A method with existing methods for predicting [Formula: see text] sites by performing stringent jackknife tests and independent validation tests on benchmark datasets. The experimental results show that the proposed TargetM6A method outperformed the existing methods for predicting [Formula: see text] sites and remarkably improved the prediction performances, with MCC = 0.526 and AUC = 0.818. We also provided a user-friendly web server for TargetM6A, which is publicly accessible for academic use at http://csbio.njust.edu.cn/bioinf/TargetM6A.

CREST--classification resources for environmental sequence tags.

Directory of Open Access Journals (Sweden)

Anders Lanzén

Full Text Available Sequencing of taxonomic or phylogenetic markers is becoming a fast and efficient method for studying environmental microbial communities. This has resulted in a steadily growing collection of marker sequences, most notably of the small-subunit (SSU ribosomal RNA gene, and an increased understanding of microbial phylogeny, diversity and community composition patterns. However, to utilize these large datasets together with new sequencing technologies, a reliable and flexible system for taxonomic classification is critical. We developed CREST (Classification Resources for Environmental Sequence Tags, a set of resources and tools for generating and utilizing custom taxonomies and reference datasets for classification of environmental sequences. CREST uses an alignment-based classification method with the lowest common ancestor algorithm. It also uses explicit rank similarity criteria to reduce false positives and identify novel taxa. We implemented this method in a web server, a command line tool and the graphical user interfaced program MEGAN. Further, we provide the SSU rRNA reference database and taxonomy SilvaMod, derived from the publicly available SILVA SSURef, for classification of sequences from bacteria, archaea and eukaryotes. Using cross-validation and environmental datasets, we compared the performance of CREST and SilvaMod to the RDP Classifier. We also utilized Greengenes as a reference database, both with CREST and the RDP Classifier. These analyses indicate that CREST performs better than alignment-free methods with higher recall rate (sensitivity as well as precision, and with the ability to accurately identify most sequences from novel taxa. Classification using SilvaMod performed better than with Greengenes, particularly when applied to environmental sequences. CREST is freely available under a GNU General Public License (v3 from http://apps.cbu.uib.no/crest and http://lcaclassifier.googlecode.com.

Determining mutant spectra of three RNA viral samples using ultra-deep sequencing

Energy Technology Data Exchange (ETDEWEB)

Chen, H

2012-06-06

RNA viruses have extremely high mutation rates that enable the virus to adapt to new host environments and even jump from one species to another. As part of a viral transmission study, three viral samples collected from naturally infected animals were sequenced using Illumina paired-end technology at ultra-deep coverage. In order to determine the mutant spectra within the viral quasispecies, it is critical to understand the sequencing error rates and control for false positive calls of viral variants (point mutantations). I will estimate the sequencing error rate from two control sequences and characterize the mutant spectra in the natural samples with this error rate.

Risk assessment for long-term post-accident sequences

International Nuclear Information System (INIS)

Ellia-Hervy, A.; Ducamp, F.

1987-11-01

Probabilistic risk analysis, currently conducted by the CEA (French Atomic Energy Commission) for the French replicate series of 900 MWe power plants, has identified accident sequences requiring long-term operation of some systems after the initiating event. They have been named long-term sequences. Quantification of probabilities of such sequences cannot rely exclusively on equipment failure-on-demand data: it must also take into account operating failures, the probability of which increase with time. Specific studies have therefore been conducted for a number of plant systems actuated during these long-term sequences. This has required: - Definition of the most realistic equipment utilization strategies based on existing emergency procedures for 900 MWe French plants. - Evaluation of the potential to repair failed equipment, given accessibility, repair time, and specific radiation conditions for the given sequence. - Definition of the event bringing the long-term sequence to an end. - Establishment of an appropriate quantification method, capable of taking into account the evolution of assumptions concerning equipment utilization strategies or repair conditions over time. The accident sequence quantification method based on realistic scenarios has been used in the risk assessment of the initiating event loss of reactor coolant accident occurring at power and at shutdown. Compared with the results obtained from conventional methods, this method redistributes the relative weight of accident sequences and also demonstrates that the long term can be a significant contribution to the probability of core melt

Abstracting Sequences: Reasoning That Is a Key to Academic Achievement.

Science.gov (United States)

Pasnak, Robert; Kidd, Julie K; Gadzichowski, K Marinka; Gallington, Debbie A; Schmerold, Katrina Lea; West, Heather

2015-01-01

The ability to understand sequences of items may be an important cognitive ability. To test this proposition, 8 first-grade children from each of 36 classes were randomly assigned to four conditions. Some were taught sequences that represented increasing or decreasing values, or were symmetrical, or were rotations of an object through 6 or 8 positions. Control children received equal numbers of sessions on mathematics, reading, or social studies. Instruction was conducted three times weekly in 15-min sessions for seven months. In May, the children taught sequences applied their understanding to novel sequences, and scored as well or better on three standardized reading tests as the control children. They outscored all children on tests of mathematics concepts, and scored better than control children on some mathematics scales. These findings indicate that developing an understanding of sequences is a form of abstraction, probably involving fluid reasoning, that provides a foundation for academic achievement in early education.

Profiling dehydrin gene sequence and physiological parameters in drought tolerant and susceptible spring wheat cultivars

International Nuclear Information System (INIS)

Baloch, M.J.; Jatoi, W.A.

2012-01-01

Physiological and yield traits such as stomatal conductance (mmol m-/sup 2/s/sup -1/), Leaf relative water content (RWC %) and grain yield per plant were studied in a separate experiment. Results revealed that five out of sixteen cultivars viz. Anmol, Moomal, Sarsabz, Bhitai and Pavan, appeared to be relatively more drought tolerant. Based on morphophysiological results, studies were continued to look at these cultivars for drought tolerance at molecular level. Initially, four well recognized primers for dehydrin genes (DHNs) responsible for drought induction in T. durum L., T. aestivum L. and O. sativa L. were used for profiling gene sequence of sixteen wheat cultivars. The primers amplified the DHN genes variably like Primer WDHN13 (T. aestivum L.) amplified the DHN gene in only seven cultivars whereas primer TdDHN15 ( T. durum L.) amplified all the sixteen cultivars with even different DNA banding patterns some showing second weaker DNA bands. Third primer TdDHN16 (T. durum L.) has shown entirely different PCR amplification prototype, specially showing two strong DNA bands while fourth primer RAB16C (O. sativa L.) failed to amplify DHN gene in any of the cultivars. Examination of DNA sequences revealed several interesting features. First, it identified the two exon/one intron structure of this gene (complete sequences were not shown), a feature not previously described in the two database cDNA sequences available from T. aestivum L. (gi|21850). Secondly, the analysis identified several single nucleotide polymorphisms (SNPs), positions in gene sequence. Although complete gene sequence was not obtained for all the cultivars, yet there were a total of 38 variable positions in exonic (coding region) sequence, from a total gene length of 453 nucleotides. Matrix of SNP shows these 37 positions with individual sequence at positions given for each of the 14 cultivars (sequence of two cultivars was not obtained) included in this analysis. It demonstrated a considerab le

Complete nucleotide sequence and organization of the mitogenome of the silk moth Caligula boisduvalii (Lepidoptera: Saturniidae) and comparison with other lepidopteran insects.

Science.gov (United States)

Hong, Mee Yeon; Lee, Eun Mee; Jo, Yong Hun; Park, Hae Chul; Kim, Seong Ryul; Hwang, Jae Sam; Jin, Byung Rae; Kang, Pil Don; Kim, Ki-Gyoung; Han, Yeon Soo; Kim, Iksoo

2008-04-30

The 15,360-bp long complete mitogenome of Caligula boisduvalii possesses a gene arrangement and content identical to other completely sequenced lepidopteran mitogenomes, but different from the common arrangement found in most insect order, as the result of the movement of tRNA(Met) to a position 5'-upstream of tRNA Ile. The 330-bp A+T-rich region is apparently capable of forming a stem-and-loop structure, which harbors the conserved flanking sequences at both ends. Dissimilar to what has been seen in other sequenced lepidopteran insects, the initiation codon for C. boisduvalii COI appears to be TTG, which is a rare, but apparently possible initiation codon. The ATP8, ATP6, ND4L, and ND6 genes, which neighbor another PCG at their 3' end, all harbored potential sequences for the formation of a hairpin structure. This is suggestive of the importance of such structures for the precise cleavage of the mRNA of mature PCGs. Phylogenetic analyses of available sequenced species of Bombycoidea, Pyraloidea, and Tortricidea supported the morphology-based current hypothesis that Bombycoidea and Pyraloidea are monophyletic (Obtectomera). As previously suggested, Bombycidae (Bombyx mori and B. mandarina) and Saturniidae (Antheraea pernyi and C. boisduvalii) formed a reciprocal monophyletic group.

An Extended Multilocus Sequence Typing (MLST Scheme for Rapid Direct Typing of Leptospira from Clinical Samples.

Directory of Open Access Journals (Sweden)

Sabrina Weiss

2016-09-01

Full Text Available Rapid typing of Leptospira is currently impaired by requiring time consuming culture of leptospires. The objective of this study was to develop an assay that provides multilocus sequence typing (MLST data direct from patient specimens while minimising costs for subsequent sequencing.An existing PCR based MLST scheme was modified by designing nested primers including anchors for facilitated subsequent sequencing. The assay was applied to various specimen types from patients diagnosed with leptospirosis between 2014 and 2015 in the United Kingdom (UK and the Lao Peoples Democratic Republic (Lao PDR. Of 44 clinical samples (23 serum, 6 whole blood, 3 buffy coat, 12 urine PCR positive for pathogenic Leptospira spp. at least one allele was amplified in 22 samples (50% and used for phylogenetic inference. Full allelic profiles were obtained from ten specimens, representing all sample types (23%. No nonspecific amplicons were observed in any of the samples. Of twelve PCR positive urine specimens three gave full allelic profiles (25% and two a partial profile. Phylogenetic analysis allowed for species assignment. The predominant species detected was L. interrogans (10/14 and 7/8 from UK and Lao PDR, respectively. All other species were detected in samples from only one country (Lao PDR: L. borgpetersenii [1/8]; UK: L. kirschneri [1/14], L. santarosai [1/14], L. weilii [2/14].Typing information of pathogenic Leptospira spp. was obtained directly from a variety of clinical samples using a modified MLST assay. This assay negates the need for time-consuming culture of Leptospira prior to typing and will be of use both in surveillance, as single alleles enable species determination, and outbreaks for the rapid identification of clusters.

Standardization and quality management in next-generation sequencing.

Science.gov (United States)

Endrullat, Christoph; Glökler, Jörn; Franke, Philipp; Frohme, Marcus

2016-09-01

DNA sequencing continues to evolve quickly even after > 30 years. Many new platforms suddenly appeared and former established systems have vanished in almost the same manner. Since establishment of next-generation sequencing devices, this progress gains momentum due to the continually growing demand for higher throughput, lower costs and better quality of data. In consequence of this rapid development, standardized procedures and data formats as well as comprehensive quality management considerations are still scarce. Here, we listed and summarized current standardization efforts and quality management initiatives from companies, organizations and societies in form of published studies and ongoing projects. These comprise on the one hand quality documentation issues like technical notes, accreditation checklists and guidelines for validation of sequencing workflows. On the other hand, general standard proposals and quality metrics are developed and applied to the sequencing workflow steps with the main focus on upstream processes. Finally, certain standard developments for downstream pipeline data handling, processing and storage are discussed in brief. These standardization approaches represent a first basis for continuing work in order to prospectively implement next-generation sequencing in important areas such as clinical diagnostics, where reliable results and fast processing is crucial. Additionally, these efforts will exert a decisive influence on traceability and reproducibility of sequence data.

Comparison of illumina and 454 deep sequencing in participants failing raltegravir-based antiretroviral therapy.

Directory of Open Access Journals (Sweden)

Jonathan Z Li

Full Text Available The impact of raltegravir-resistant HIV-1 minority variants (MVs on raltegravir treatment failure is unknown. Illumina sequencing offers greater throughput than 454, but sequence analysis tools for viral sequencing are needed. We evaluated Illumina and 454 for the detection of HIV-1 raltegravir-resistant MVs.A5262 was a single-arm study of raltegravir and darunavir/ritonavir in treatment-naïve patients. Pre-treatment plasma was obtained from 5 participants with raltegravir resistance at the time of virologic failure. A control library was created by pooling integrase clones at predefined proportions. Multiplexed sequencing was performed with Illumina and 454 platforms at comparable costs. Illumina sequence analysis was performed with the novel snp-assess tool and 454 sequencing was analyzed with V-Phaser.Illumina sequencing resulted in significantly higher sequence coverage and a 0.095% limit of detection. Illumina accurately detected all MVs in the control library at ≥0.5% and 7/10 MVs expected at 0.1%. 454 sequencing failed to detect any MVs at 0.1% with 5 false positive calls. For MVs detected in the patient samples by both 454 and Illumina, the correlation in the detected variant frequencies was high (R2 = 0.92, P<0.001. Illumina sequencing detected 2.4-fold greater nucleotide MVs and 2.9-fold greater amino acid MVs compared to 454. The only raltegravir-resistant MV detected was an E138K mutation in one participant by Illumina sequencing, but not by 454.In participants of A5262 with raltegravir resistance at virologic failure, baseline raltegravir-resistant MVs were rarely detected. At comparable costs to 454 sequencing, Illumina demonstrated greater depth of coverage, increased sensitivity for detecting HIV MVs, and fewer false positive variant calls.

Evidence for positive selection on the leptin gene in Cetacea and Pinnipedia.

Directory of Open Access Journals (Sweden)

Li Yu

Full Text Available The leptin gene has received intensive attention and scientific investigation for its importance in energy homeostasis and reproductive regulation in mammals. Furthermore, study of the leptin gene is of crucial importance for public health, particularly for its role in obesity, as well as for other numerous physiological roles that it plays in mammals. In the present work, we report the identification of novel leptin genes in 4 species of Cetacea, and a comparison with 55 publicly available leptin sequences from mammalian genome assemblies and previous studies. Our study provides evidence for positive selection in the suborder Odontoceti (toothed whales of the Cetacea and the family Phocidae (earless seals of the Pinnipedia. We also detected positive selection in several leptin gene residues in these two lineages. To test whether leptin and its receptor evolved in a coordinated manner, we analyzed 24 leptin receptor gene (LPR sequences from available mammalian genome assemblies and other published data. Unlike the case of leptin, our analyses did not find evidence of positive selection for LPR across the Cetacea and Pinnipedia lineages. In line with this, positively selected sites identified in the leptin genes of these two lineages were located outside of leptin receptor binding sites, which at least partially explains why co-evolution of leptin and its receptor was not observed in the present study. Our study provides interesting insights into current understanding of the evolution of mammalian leptin genes in response to selective pressures from life in an aquatic environment, and leads to a hypothesis that new tissue specificity or novel physiologic functions of leptin genes may have arisen in both odontocetes and phocids. Additional data from other species encompassing varying life histories and functional tests of the adaptive role of the amino acid changes identified in this study will help determine the factors that promote the adaptive

Genetic Barrier to Direct Acting Antivirals in HCV Sequences Deposited in the European Databank.

Directory of Open Access Journals (Sweden)

Dimas Alexandre Kliemann

Full Text Available Development of resistance results from mutations in the viral genome, and the presence of selective drug pressure leads to the emergence of a resistant virus population. The aim of this study was to analyze the impact of genetic variability on the genetic barrier to drug resistance to DAAs.The genetic barrier was quantified based on the number and type of nucleotide mutations required to impart resistance, considering full-length HCV NS3, NS5A and NS5B regions segregated by genotype into subtypes 1a, 1b, 2a, 2b and 3a. This study analyzeds 789 NS3 sequences, 708 sequences and 536 NS5B sequences deposited in the European Hepatitis C Virus Database, in the following resistance-associated positions: NS3: F43/I/L/S/V, Q80K/R, R155K/G, A156G/S/T and D168A/C/E/G/H/N/T/V/Y; NS5A: L/M28A/T/V, Q30E/H/R, L31F/I/M/V, H58D or P58S and Y93C/F/H/N/S; NS5B: S282P/R/T, C316H/N/Y, S368T, Y448C/H, S556G/R, D559R.Variants that require only one transversion in NS3 were found in 4 positions and include F43S, R80K, R155K/G and A156T. The genetic barrier to resistance shows subtypic differences at position 155 of the NS3 gene where a single transition is necessary in subtype 1a. In the NS5A gene, 5 positions where only one nucleotide change can confer resistance were found, such as L31M which requires one transversion in all subtypes, except in 0.28% of 1b sequences; and R30H, generated by a single transition, which was found in 10.25% of the sequences of genotype 1b. Other subtypic differences were observed at position 58, where resistance is less likely in genotype 1a because a transversion is required to create the variant 58S. For the NS5B inhibitors, the genetic barrier at positions conferring resistance was nearly identical in subtypes 1a and 1b, and single transitions or transversions were necessary in 5 positions to generate a drug-resistant variant of HCV. The positions C316Y and S556D required only one transition in all genotypes, Y448H and S556 G