WorldWideScience

Sample records for position dominant sequence

  1. SOME CONSIDERATIONS ON ABUSE OF DOMINANT POSITION

    Directory of Open Access Journals (Sweden)

    Ovidiu Maican

    2007-12-01

    Full Text Available Article 82 (formerly 86 EC contains four essential elements (an undertaking, a dominant position, an abuse of that position and the abuse must affect trade between member states. The term undertakings is subject to the same broad interpretation as that applied to article 81 (formerly 85 EC and covers the same activities, both public and private.The Community interest must be also taken into account. Although it is not clear precisely what this element of article 86 requires, it will clearly curtail the scope of the exception provided under this article. Although abusive behavior of undertakings in a dominant position is prohibited, it must be recalled that merely being in a strong position is not a problem in itself. It is necessary for major players in a market to be aware of their position because practices which would not fall foul of article 82 (formerly 86 EC, where an undertaking is not dominant, will do so where dominance is established. A refusal to deal by a non-dominant undertaking would not be an abuse within article 82 (formerly 86 EC, but it will be so where the undertaking is dominant.

  2. Comparison of Scapular Position in Dominant and Non Dominant Sides of Healthy Adult\\'s Females

    Directory of Open Access Journals (Sweden)

    Afsoun Nodehi-Moghaddam

    2008-01-01

    Full Text Available Objective: The goal of this research was to compare normal scapular position (protraction, rotation and lateral scapular test on arm elevation between dominant and non dominant sides. Materials & Methods: Thirty healthy females (age=21.9 years, weight=53.37 kg, height =160.60 cm were chosen by non probability sampling and participated in this cross – sectional and comparative study. Scapular rest positions (protraction and Rotation were measured by use of Diveta method and scapular asymmetry was assessed by using lateral scapular slide test (Kibler test. Validity and reliability of measurement methods were assessed by determination of ICC and SEM and data were analyzed by use of paired T test. Results: The difference between dominant and non dominant scapular protraction and rotation was not found to be statistically significant (P=0.61, P=0.57.The dominant scapula was found to be more lateral in 2nd and 3rd Kibler tests positions than non dominant scapula (P<0.001. There was no significant difference in lateral scapular slide test between dominant and non dominant sides when the arms were by the side of body (P=0.66. Conclusion: Scapular rest position is influenced by hand dominance

  3. Social dominance, values and ideological positioning in college students

    Directory of Open Access Journals (Sweden)

    Elena Zubieta

    2015-09-01

    Full Text Available Social Dominance Theory (Sidanius & Pratto, 1999 stress that systematic inter group discrimination is related to social ideologies that contribute to coordinate institutions and individuals behaviors. The acceptance of inequity legitimating ideologies is partially determined for individuals general desire of group based domination. This desire is captured by Social Orientation Domination construct -SDO. Pursuing the objective of exploring SDO levels and its relationship with variables such ideological positioning and values, a descriptive correlation study, with a non experimental design, was carried out based on a convenience sample composed by 254 college students from Buenos Aires city surroundings . Results show that SDO is positively associated with Power and Achievement values and negatively with Benevolence and Universalism. SDO is stronger in participants right side ideologically positioned. Participants show a low SDO, emphasize self- trascendence and openness to change values and tend to a left side ideological positioning. Age, participant’s quality of “students” and prevailed career orientation can be seen as factors conditioning a more hierarchies attenuating believes and behaviors. 

  4. Dominant accident sequences in Oconee-1 pressurized water reactor

    International Nuclear Information System (INIS)

    Dearing, J.F.; Henninger, R.J.; Nassersharif, B.

    1985-04-01

    A set of dominant accident sequences in the Oconee-1 pressurized water reactor was selected using probabilistic risk analysis methods. Because some accident scenarios were similar, a subset of four accident sequences was selected to be analyzed with the Transient Reactor Analysis Code (TRAC) to further our insights into similar types of accidents. The sequences selected were loss-of-feedwater, small-small break loss-of-coolant, loss-of-feedwater-initiated transient without scram, and interfacing systems loss-of-coolant accidents. The normal plant response and the impact of equipment availability and potential operator actions were also examined. Strategies were developed for operator actions not covered in existing emergency operator guidelines and were tested using TRAC simulations to evaluate their effectiveness in preventing core uncovery and maintaining core cooling

  5. THE MANIFESTATION OF THE ABUSE OF DOMINANT POSITION IN THE CURRENT ROMANIAN ECONOMY

    Directory of Open Access Journals (Sweden)

    MELINDA CENUŞE

    2011-01-01

    Full Text Available The abuse use of a dominant position constitutes an important form of manifestation of anti-competitive practices. Almost all competition laws have some provisions on the abuse of dominant position. Most European laws, including the one of the European Union, contain an express provision prohibiting the abuse of dominant position. However, they rarely include a definition of what constitutes abuse of dominant position, but most of them pass in review examples of behaviors that may be considered illegal. In countries with a developed market economy, the legal provisions regarding abuse of dominant position were not so important and so widely used as the provisioning governing mergers and the cartel behavior. The explanation is that in a developed economy, the markets are larger, firms are more numerous, and the entry on the market is relatively easy. As a result, there are few markets where a firm with a dominant position can exercise its market influence for longer periods without new entries being attracted. For this study we decided to present the most famous cases involving the abuse of dominant position registered on Romanian market of mobile phones in 2011 and sanctioned by the Romanian Competition Council.

  6. THE ABUSE OF DOMINANT POSITION - RESTRICTING COMPETITION PRACTICE. CASE STUDY: ENI

    Directory of Open Access Journals (Sweden)

    BERINDE Mihai

    2013-07-01

    Full Text Available The abuse of dominant position along with cartel, merger and state aid are practices restricting competition strictly regulated at EU level. These practices can have a disastrous effect on the internal market harming both competition especially consumers. These practices can have a disastrous effect on the domestic market harming both competition and especially consumers. This paper aims to analyze how the abuse of a dominant position is regulated in the European Union. The research methodology used is the study of literature, analysis of legislation, case study, and the collection and interpretation of statistical data. The Competition Law at European level is harmonized among European Union member states. The competition authorities of the EU Member States work together to detect and sanction the practice that is restrictive for competition. Improving legislation that regulates the abuse of dominant position has been an ongoing concern of competition authorities, which is why the EU currently enjoys a very well established procedure. The procedure governing the abuse of dominant position consists of a series of steps that must be taken gradually to have the desired result, i.e. restoring fair competition on a given market. The case study presented in this paper is indicative and shows very clearly the next steps for referral to an abuse of dominant position, with special reference to the outcome arising when applying the procedure correctly. The analysis of statistical data regarding the number of investigations opened and the number of decisions made by competition authorities on abuse of dominant position is relevant, outlining the evolution of the work performed by competition authorities. Throughout the period of ten years analyzed (January 2004 - February 2013 there were 1583 cases of violation of antitrust laws at European level. The percentage of investigations opened by the competition authorities of the Member States is 86%, much

  7. Directional Positive Selection on an Allele of Arbitrary Dominance

    OpenAIRE

    Teshima, Kosuke M.; Przeworski, Molly

    2006-01-01

    Most models of positive directional selection assume codominance of the beneficial allele. We examine the importance of this assumption by implementing a coalescent model of positive directional selection with arbitrary dominance. We find that, for a given mean fixation time, a beneficial allele has a much weaker effect on diversity at linked neutral sites when the allele is recessive.

  8. POSITIVE AND NEGATIVE EFFECTS ANALYSIS IN ABUSE OF DOMINANCE

    Directory of Open Access Journals (Sweden)

    Mihai MĂRGINEAN

    2017-12-01

    Full Text Available Abuse of a dominant position is a threat to the functioning of the free market. This is the reason why we have proposed to highlight the impact of this particular anti-competitive practice in the European Union area. The aim of this paper is to present, from a theoretical and practical approach, the implications and the effects of this type of behavior and also to highlight the main actors in this process. In order to achieve these goals, we will use the content analysis to compress the effects of the abuse of dominant position in two categories: positive and negative effects. The historical method to emphasize the historical origins of the concepts and institutions involved. The comparative method will be used to nominate specific features, concepts or institutions that we will analyze and also it will help us to analyze the evolution that have occurred over time in terms of their development and to highlight certain advantages or disadvantages in terms of choice of competition policy on the abuse of a dominant position. In this paper we will notice that both the companies and the market itself are facing with companies that use anti-competitive since 1900. These kind of practices are harmful both for competition and for consumers, so that should not be allowed to expand. In this context, the European Commission imposed a set of rules that all operators must comply in order to protect, maintain and stimulate competition in the Single Market and to promote fair competition.

  9. Domination, Eternal Domination, and Clique Covering

    Directory of Open Access Journals (Sweden)

    Klostermeyer William F.

    2015-05-01

    Full Text Available Eternal and m-eternal domination are concerned with using mobile guards to protect a graph against infinite sequences of attacks at vertices. Eternal domination allows one guard to move per attack, whereas more than one guard may move per attack in the m-eternal domination model. Inequality chains consisting of the domination, eternal domination, m-eternal domination, independence, and clique covering numbers of graph are explored in this paper.

  10. European dominant position and american monopolization: a unifying approach from basic game theory

    Directory of Open Access Journals (Sweden)

    Pier Luigi Parcu

    2006-06-01

    Full Text Available In this paper we explore the meaning of some fundamental legal definitions of Europeanand American antitrust using basic concepts of game theory. Important definitions in EU law likedominant position of a firm, abuse of such a dominant position, special responsibility of thedominant firm, or in US law like monopoly or monopolization offence, acquire more precisemeaning and operational content. Moreover they look closer than usually contended.In a competition game, in which there is a truly monopolistic/dominant firm (MDF andcompetition law is respected, we state in a formal theorem that an MDF has a dominant strategy, soits choices should never be a source of ex post regret. Other players of the game, understanding andanticipating the realization of this dominant strategy, will optimize their behaviour taking it intoaccount and thus be more able to select a best solution among all possible outcomes.In this context which kind of behaviours can an MDF adopt to defend its market shares andeconomic position? Following the US Supreme Court and EU Court of Justice an MDF mustcompete using normal methods of competition, superior product or business acumen, therefore weargue that market power, whatever its origin, can be defended only through competition on themerit. This definition has practical consequences: unpredictable behaviours and actions that anormal firm would not adopt might be identified as illegal abuses of dominant position ormonopolization offences, also this idea is formalized in a theorem.

  11. Accuracy of maxillary positioning after standard and inverted orthognathic sequencing.

    Science.gov (United States)

    Ritto, Fabio G; Ritto, Thiago G; Ribeiro, Danilo Passeado; Medeiros, Paulo José; de Moraes, Márcio

    2014-05-01

    This study aimed to compare the accuracy of maxillary positioning after bimaxillary orthognathic surgery, using 2 sequences. A total of 80 cephalograms (40 preoperative and 40 postoperative) from 40 patients were analyzed. Group 1 included radiographs of patients submitted to conventional sequence, whereas group 2 patients were submitted to inverted sequence. The final position of the maxillary central incisor was obtained after vertical and horizontal measurements of the tracings, and it was compared with what had been planned. The null hypothesis, which stated that there would be no difference between the groups, was tested. After applying the Welch t test for comparison of mean differences between maxillary desired and achieved position, considering a statistical significance of 5% and a 2-tailed test, the null hypothesis was not rejected (P > .05). Thus, there was no difference in the accuracy of maxillary positioning between groups. Conventional and inverted sequencing proved to be reliable in positioning the maxilla after LeFort I osteotomy in bimaxillary orthognathic surgeries. Copyright © 2014 Elsevier Inc. All rights reserved.

  12. Detecting false positive sequence homology: a machine learning approach.

    Science.gov (United States)

    Fujimoto, M Stanley; Suvorov, Anton; Jensen, Nicholas O; Clement, Mark J; Bybee, Seth M

    2016-02-24

    Accurate detection of homologous relationships of biological sequences (DNA or amino acid) amongst organisms is an important and often difficult task that is essential to various evolutionary studies, ranging from building phylogenies to predicting functional gene annotations. There are many existing heuristic tools, most commonly based on bidirectional BLAST searches that are used to identify homologous genes and combine them into two fundamentally distinct classes: orthologs and paralogs. Due to only using heuristic filtering based on significance score cutoffs and having no cluster post-processing tools available, these methods can often produce multiple clusters constituting unrelated (non-homologous) sequences. Therefore sequencing data extracted from incomplete genome/transcriptome assemblies originated from low coverage sequencing or produced by de novo processes without a reference genome are susceptible to high false positive rates of homology detection. In this paper we develop biologically informative features that can be extracted from multiple sequence alignments of putative homologous genes (orthologs and paralogs) and further utilized in context of guided experimentation to verify false positive outcomes. We demonstrate that our machine learning method trained on both known homology clusters obtained from OrthoDB and randomly generated sequence alignments (non-homologs), successfully determines apparent false positives inferred by heuristic algorithms especially among proteomes recovered from low-coverage RNA-seq data. Almost ~42 % and ~25 % of predicted putative homologies by InParanoid and HaMStR respectively were classified as false positives on experimental data set. Our process increases the quality of output from other clustering algorithms by providing a novel post-processing method that is both fast and efficient at removing low quality clusters of putative homologous genes recovered by heuristic-based approaches.

  13. An ILP based memetic algorithm for finding minimum positive influence dominating sets in social networks

    Science.gov (United States)

    Lin, Geng; Guan, Jian; Feng, Huibin

    2018-06-01

    The positive influence dominating set problem is a variant of the minimum dominating set problem, and has lots of applications in social networks. It is NP-hard, and receives more and more attention. Various methods have been proposed to solve the positive influence dominating set problem. However, most of the existing work focused on greedy algorithms, and the solution quality needs to be improved. In this paper, we formulate the minimum positive influence dominating set problem as an integer linear programming (ILP), and propose an ILP based memetic algorithm (ILPMA) for solving the problem. The ILPMA integrates a greedy randomized adaptive construction procedure, a crossover operator, a repair operator, and a tabu search procedure. The performance of ILPMA is validated on nine real-world social networks with nodes up to 36,692. The results show that ILPMA significantly improves the solution quality, and is robust.

  14. Late Pleistocene sequence architecture on the geostrophic current-dominated southwest margin of the Ulleung Basin, East Sea

    Science.gov (United States)

    Choi, Dong-Lim; Shin, Dong-Hyeok; Kum, Byung-Cheol; Jang, Seok; Cho, Jin-Hyung; Jou, Hyeong-Tae; Jang, Nam-Do

    2018-06-01

    High-resolution multichannel seismic data were collected to identify depositional sequences on the southwestern shelf of the Ulleung Basin, where a unidirectional ocean current is dominant at water depths exceeding 130 m. Four aggradational stratigraphic sequences with a 100,000-year cycle were recognized since marine isotope stage (MIS) 10. These sequences consist only of lowstand systems tracts (LSTs) and falling-stage systems tracts (FSSTs). Prograding wedge-shaped deposits are present in the LSTs near the shelf break. Oblique progradational clinoforms of forced regressive deposits are present in the FSSTs on the outer continental shelf. Each FSST has non-uniform forced regressional stratal geometries, reflecting that the origins of sediments in each depositional sequence changed when sea level was falling. Slump deposits are characteristically developed in the upper layer of the FSSTs, and this was used as evidence to distinguish the sequence boundaries. The subsidence rates around the shelf break reached as much as 0.6 mm/year since MIS 10, which contributed to the well-preserved depositional sequence. During the Quaternary sea-level change, the water depth in the Korea Strait declined and the intensity of the Tsushima Current flowing near the bottom of the inner continental shelf increased. This resulted in greater erosion of sediments that were delivered to the outer continental shelf, which was the main cause of sediment deposition on the deep, low-angled outer shelf. Therefore, a depositional sequence formation model that consists of only FSSTs and LSTs, excluding highstand systems tracts (HSTs) and transgressive systems tracts (TSTs), best explains the depositional sequence beneath this shelf margin dominated by a geostrophic current.

  15. Subfamily logos: visualization of sequence deviations at alignment positions with high information content

    Directory of Open Access Journals (Sweden)

    Beitz Eric

    2006-06-01

    Full Text Available Abstract Background Recognition of relevant sequence deviations can be valuable for elucidating functional differences between protein subfamilies. Interesting residues at highly conserved positions can then be mutated and experimentally analyzed. However, identification of such sites is tedious because automated approaches are scarce. Results Subfamily logos visualize subfamily-specific sequence deviations. The display is similar to classical sequence logos but extends into the negative range. Positive, upright characters correspond to residues which are characteristic for the subfamily, negative, upside-down characters to residues typical for the remaining sequences. The symbol height is adjusted to the information content of the alignment position. Residues which are conserved throughout do not appear. Conclusion Subfamily logos provide an intuitive display of relevant sequence deviations. The method has proven to be valid using a set of 135 aligned aquaporin sequences in which established subfamily-specific positions were readily identified by the algorithm.

  16. A comparison of ball velocity in different kicking positions with dominant and non-dominant leg in junior soccer players

    Directory of Open Access Journals (Sweden)

    MÁRIO C. MARQUES

    2011-06-01

    Full Text Available Problem Statement: The aim of this study was to compare the ball velocity in different kicking conditions with dominant and non-dominant leg in junior soccer players.Approach: Sixteen junior soccer players (age 17.6±0.6yr, height 1.76±0.06m, and weight 67.9±5.2kg participated in this study. All participants kicked a soccer ball three times in seven conditions with the dominant and non-dominant leg. 1 Kicking the ball from 11m straight forwards, 2 and 3 kicking the ball from 11m to the left and right side of the goal, 4 and 5 kicking the ball straight forwards from 11m after a pass from the left and right side, 6 and 7 kicking the ball straight forwards from 11m after a pass that came from a diagonal position (45º from the left and right side. The highest ball velocity was used for analysis.Results: Significant differences were found in ball velocity between the dominant and non-dominant leg in all conditions (p<0.001. For the dominant leg also significant differences were found in the kicking of eleven meters (ideal conditions compared with: the perpendicular passing kick after the ball on the right (p=0.0024 and left (p=0.0080 and also with a diagonal kick after pass (45 ° of the ball on the right (p=0.0017 and left (p = 0.0381. Significant differences in the kicking with the non-dominant leg were found when kicking from eleven meters to the right side of the goal in comparison to: the kick under the same conditions, to the left side of the goal (p=0.0243 after pass and shot from the left side perpendicular (p=0.0222.Conclusions/Recommendations: kicking velocity is influenced very much under different conditions when kicking with the dominant leg while for the non-dominant leg this influence was small, because the non-dominant leg is less trained, so the values of velocity in different conditions, in addition to being the lowest, are closer than those obtained with the dominant leg

  17. Genome-wide SNP identification by high-throughput sequencing and selective mapping allows sequence assembly positioning using a framework genetic linkage map

    Directory of Open Access Journals (Sweden)

    Xu Xiangming

    2010-12-01

    Full Text Available Abstract Background Determining the position and order of contigs and scaffolds from a genome assembly within an organism's genome remains a technical challenge in a majority of sequencing projects. In order to exploit contemporary technologies for DNA sequencing, we developed a strategy for whole genome single nucleotide polymorphism sequencing allowing the positioning of sequence contigs onto a linkage map using the bin mapping method. Results The strategy was tested on a draft genome of the fungal pathogen Venturia inaequalis, the causal agent of apple scab, and further validated using sequence contigs derived from the diploid plant genome Fragaria vesca. Using our novel method we were able to anchor 70% and 92% of sequences assemblies for V. inaequalis and F. vesca, respectively, to genetic linkage maps. Conclusions We demonstrated the utility of this approach by accurately determining the bin map positions of the majority of the large sequence contigs from each genome sequence and validated our method by mapping single sequence repeat markers derived from sequence contigs on a full mapping population.

  18. Domination versus disjunctive domination in graphs | Henning ...

    African Journals Online (AJOL)

    Domination versus disjunctive domination in graphs. Michael A Henning, Sinclair A Marcon. Abstract. A dominating set in a graph G is a set S of vertices of G such that every vertex not in S is adjacent to a vertex of S. The domination number of G is the minimum cardinality of a dominating set of G. For a positive integer b, ...

  19. The positive and negative framing of affirmative action: a group dominance perspective.

    Science.gov (United States)

    Haley, Hillary; Sidanius, Jim

    2006-05-01

    Using a sample of 328 White, Latino, and Black Los Angeles County adults, the authors examined the tendency to employ various affirmative action "frames" (e.g., affirmative action as a "tie-breaking" device or as a quota-based policy). All three groups agreed about which frames cast affirmative action in a positive light and which cast it in a negative light. Although minorities had a tendency to frame affirmative action in terms that most people find morally acceptable, Whites had a tendency to frame affirmative action in terms most people find unacceptable. In addition, compared to minorities, Whites were less supportive of affirmative action regardless of how it was framed. LISREL modeling also was employed to test two competing models regarding predictors of the tendency to use frames that one personally finds to be relatively negative versus positive. Consistent with the expectations of social dominance theory and a motivated cognition perspective, the authors found that social dominance orientation (SDO) had significant net direct and indirect effects on one's framing of affirmative action.

  20. Nucleotide sequence alignment of hdcA from Gram-positive bacteria.

    Science.gov (United States)

    Diaz, Maria; Ladero, Victor; Redruello, Begoña; Sanchez-Llana, Esther; Del Rio, Beatriz; Fernandez, Maria; Martin, Maria Cruz; Alvarez, Miguel A

    2016-03-01

    The decarboxylation of histidine -carried out mainly by some gram-positive bacteria- yields the toxic dietary biogenic amine histamine (Ladero et al. 2010 〈10.2174/157340110791233256〉 [1], Linares et al. 2016 〈http://dx.doi.org/10.1016/j.foodchem.2015.11.013〉〉 [2]). The reaction is catalyzed by a pyruvoyl-dependent histidine decarboxylase (Linares et al. 2011 〈10.1080/10408398.2011.582813〉 [3]), which is encoded by the gene hdcA. In order to locate conserved regions in the hdcA gene of Gram-positive bacteria, this article provides a nucleotide sequence alignment of all the hdcA sequences from Gram-positive bacteria present in databases. For further utility and discussion, see 〈http://dx.doi.org/ 10.1016/j.foodcont.2015.11.035〉〉 [4].

  1. Sequence stratigraphy from ``spot'' outcrops—example from a carbonate-dominated setting: Devonian-Carboniferous transition, Dinant synclinorium (Belgium)

    Science.gov (United States)

    Van Steenwinkel, M.

    1990-12-01

    The application of sequence stratigraphy appears to be perfectly valid in isolated "spot" outcrops, which usually are badly exposed and located in areas of strong tectonic overprint. The case study presented here is in a carbonate-dominated setting at the northern edge of the Cornwall-Rhenish basin, during latest Devonian and earliest Carboniferous times. The approach taken involved the analysis of facies and vertical facies evolutions, in combination with detailed biostratigraphy. The subsequent deduction of deepening and shallowing events, and the understanding of the sedimentary response to these events in different palaeogeographical positions, are the basis for lateral correlation of facies sequences. A similar trend in the changes of deepenings and shallowings throughout the area, regardless of lateral facies differentiation, indicates a relationship between bathymetric changes and relative sea-level changes, that is independent of local differences in the sedimentation or subsidence rates. The studied stratigraphic interval, with its apparently "abrupt" changes in facies or lithology, is the sedimentary response to six, gradually changing trends in the rate of relative sea-level fall and rise. End-Devonian, offshore highstand deposits (1) are capped by an unconformity surface or by a surface of submarine erosion and nondeposition, representing a sequence boundary (2). The overlying lowstand unit consists of a basal (3) and an upper (4) part. The basal part contains an oolitic and crinoidal sand shoals, associated with a transgressive lag deposit in offshore position; the upper, main part is a prograding wedge of shallow-marine crinoidal sands, intercalated with increasingly deeper-water shaly facies (higher-order fluctuation). This lowstand unit was deposited during the initial, slow phase of relative sea-level rise. It levelled the topographic relief before the final drowning during the subsequent rapid (near the rise inflection point) relative sea

  2. Exon sequencing of PKD1 gene in an Iranian patient with autosomal-dominant polycystic kidney disease.

    Science.gov (United States)

    Hafizi, Atousa; Khatami, Saeid Reza; Galehdari, Hamid; Shariati, Gholamreza; Saberi, Ali Hossein; Hamid, Mohammad

    2014-07-01

    Autosomal dominant polycystic kidney disease (ADPKD) is one of the most common genetic kidney disorders with the incidence of 1 in 1,000 births. ADPKD is genetically heterogeneous with two genes identified: PKD1 (16p13.3, 46 exons) and PKD2 (4q21, 15 exons). Eighty five percent of the patients with ADPKD have at least one mutation in the PKD1 gene. Genetic studies have demonstrated an important allelic variability among patients, but very few data are known about the genetic variation among Iranian populations. In this study, exon direct sequencing of PKD1 was performed in a seven-year old boy with ADPKD and in his parents. The patient's father was ADPKD who was affected without any kidney dysfunction, and the patient's mother was congenitally missing one kidney. Molecular genetic testing found a mutation in all three members of this family. It was a missense mutation GTG>ATG at position 3057 in exon 25 of PKD1. On the other hand, two novel missense mutations were reported just in the 7-year-old boy: ACA>GCA found in exon 15 at codon 2241 and CAC>AAC found in exon 38 at codon 3710. For checking the pathogenicity of these mutations, exons 15, 25, and 38 of 50 unrelated normal cases were sequenced. our findings suggested that GTG>ATG is a polymorphism with high frequency (60%) as well as ACA>GCA and CAC>AAC are polymorphisms with frequencies of 14% and 22%, respectively in the population of Southwest Iran.

  3. Genome sequence of a urease-positive Campylobacter lari strain

    Science.gov (United States)

    Campylobacter lari is frequently isolated from shore birds and can cause illness in humans. Here we report the draft whole genome sequence of an urease-positive strain of C. lari that was isolated in estuarial water on the coast of Delaware, USA....

  4. Diversity and dynamics of dominant and rare bacterial taxa in replicate sequencing batch reactors operated under different solids retention time

    KAUST Repository

    Bagchi, Samik

    2014-10-19

    In this study, 16S rRNA gene pyrosequencing was applied in order to provide a better insight on the diversity and dynamics of total, dominant, and rare bacterial taxa in replicate lab-scale sequencing batch reactors (SBRs) operated at different solids retention time (SRT). Rank-abundance curves showed few dominant operational taxonomic units (OTUs) and a long tail of rare OTUs in all reactors. Results revealed that there was no detectable effect of SRT (2 vs. 10 days) on Shannon diversity index and OTU richness of both dominant and rare taxa. Nonmetric multidimensional scaling analysis showed that the total, dominant, and rare bacterial taxa were highly dynamic during the entire period of stable reactor performance. Also, the rare taxa were more dynamic than the dominant taxa despite expected low invasion rates because of the use of sterile synthetic media.

  5. Interchangeable Positions in Interaction Sequences in Science Classrooms

    Directory of Open Access Journals (Sweden)

    Carol Rees

    2017-03-01

    Full Text Available Triadic dialogue, the Initiation, Response, Evaluation sequence typical of teacher /student interactions in classrooms, has long been identified as a barrier to students’ access to learning, including science learning. A large body of research on the subject has over the years led to projects and policies aimed at increasing opportunities for students to learn through interactive dialogue in classrooms. However, the triadic dialogue pattern continues to dominate, even when teachers intend changing this. Prior quantitative research on the subject has focused on identifying independent variables such as style of teacher questioning that have an impact, while qualitative researchers have worked to interpret the use of dialogue within the whole context of work in the classroom. A recent paper offers an alternative way to view the triadic dialogue pattern and its origin; the triadic dialogue pattern is an irreducible social phenomenon that arises in a particular situation regardless of the identity of the players who inhabit the roles in the turn-taking sequence (Roth & Gardner, 2012. According to this perspective, alternative patterns of dialogue would exist which are alternative irreducible social phenomena that arise in association with different situations. The aim of this paper is to examine as precisely as possible, the characteristics of dialogue patterns in a seventh-eighth grade classroom during science inquiry, and the precise situations from which these dialogue patterns emerge, regardless of the staffing (teacher or students in the turn-taking sequence. Three different patterns were identified each predominating in a particular situation. This fine-grained analysis could offer valuable insights into ways to support teachers working to alter the kinds of dialogue patterns that arise in their classrooms.

  6. Diversity and dynamics of dominant and rare bacterial taxa in replicate sequencing batch reactors operated under different solids retention time

    KAUST Repository

    Bagchi, Samik; Garcia Tellez, Berenice; Rao, Hari Ananda; Lamendella, Regina; Saikaly, Pascal

    2014-01-01

    In this study, 16S rRNA gene pyrosequencing was applied in order to provide a better insight on the diversity and dynamics of total, dominant, and rare bacterial taxa in replicate lab-scale sequencing batch reactors (SBRs) operated at different

  7. Social dominance, values and ideological positioning in college students

    OpenAIRE

    Elena Zubieta; Gisela Delfino; Omar Fernández

    2015-01-01

    Social Dominance Theory (Sidanius & Pratto, 1999) stress that systematic inter group discrimination is related to social ideologies that contribute to coordinate institutions and individuals behaviors. The acceptance of inequity legitimating ideologies is partially determined for individuals general desire of group based domination. This desire is captured by Social Orientation Domination construct -SDO. Pursuing the objective of exploring SDO levels and its relationship with variables su...

  8. Role of dominant versus non-dominant hand position during uninterrupted chest compression CPR by novice rescuers: a randomized double-blind crossover study.

    Science.gov (United States)

    Nikandish, Reza; Shahbazi, Sharbanoo; Golabi, Sedigheh; Beygi, Najimeh

    2008-02-01

    Previous research has suggested improved quality of chest compressions when the dominant hand was in contact with the sternum. However, the study was in health care professionals and during conventional chest compression-ventilation CPR. The aim of this study was to test the hypothesis, in null form, that the quality of external chest compressions (ECC) in novice rescuers during 5min of uninterrupted chest compression CPR (UCC-CPR) is independent of the hand in contact with the sternum. Confirmation of the hypothesis would allow the use of either hand by the novice rescuers during UCC-CPR. Fifty-nine first year public heath students participated in this randomised double-blind crossover study. After completion of a standard adult BLS course, they performed single rescuer adult UCC-CPR for 5 min on a recording Resusci Anne. One week later they changed the hand of contact with the sternum while performing ECC. The quality of ECC was recorded by the skill meter for the dominant and non-dominant hand during 5 min ECC. The total number of correct chest compressions in the dominant hand group (DH), mean 183+/-152, was not statistically different from the non-dominant hand group (NH), mean 152+/-135 (P=0.09). The number of ECC with inadequate depth in the DH group, mean 197+/-174 and NH group, mean 196+/-173 were comparable (P=0.1). The incidence of ECC exceeding the recommended depth in the DH group, mean 51+/-110 and NH group, mean 32+/-75 were comparable (P=0.1). Although there is a trend to increased incidence of correct chest compressions with positioning the dominant hand in contact with the sternum, it does not reach statistical significance during UCC-CPR by the novice rescuers for 5 min.

  9. The role of noise and positive feedback in the onset of autosomal dominant diseases

    Directory of Open Access Journals (Sweden)

    Bosl William J

    2010-06-01

    Full Text Available Abstract Background Autosomal dominant (AD diseases result when a single mutant or non-functioning gene is present on an autosomal chromosome. These diseases often do not emerge at birth. There are presently two prevailing theories explaining the expression of AD diseases. One explanation originates from the Knudson two-hit theory of hereditary cancers, where loss of heterozygosity or occurrence of somatic mutations impairs the function of the wild-type copy. While these somatic second hits may be sufficient for stable disease states, it is often difficult to determine if their occurrence necessarily marks the initiation of disease progression. A more direct consequence of a heterozygous genetic background is haploinsufficiency, referring to a lack of sufficient gene function due to reduced wild-type gene copy number; however, haploinsufficiency can involve a variety of additional mechanisms, such as noise in gene expression or protein levels, injury and second hit mutations in other genes. In this study, we explore the possible contribution to the onset of autosomal dominant diseases from intrinsic factors, such as those determined by the structure of the molecular networks governing normal cellular physiology. Results First, simple models of single gene insufficiency using the positive feedback loops that may be derived from a three-component network were studied by computer simulation using Bionet software. The network structure is shown to affect the dynamics considerably; some networks are relatively stable even when large stochastic variations in are present, while others exhibit switch-like dynamics. In the latter cases, once the network switches over to the disease state it remains in that state permanently. Model pathways for two autosomal dominant diseases, AD polycystic kidney disease and mature onset diabetes of youth (MODY were simulated and the results are compared to known disease characteristics. Conclusions By identifying the

  10. Dominant obligate anaerobes revealed in lower respiratory tract infection in horses by 16S rRNA gene sequencing.

    Science.gov (United States)

    Kinoshita, Yuta; Niwa, Hidekazu; Katayama, Yoshinari; Hariu, Kazuhisa

    2014-04-01

    Obligate anaerobes are important etiological agents in pneumonia or pleuropneumonia in horses, because they are isolated more commonly from ill horses that have died or been euthanized than from those that survive. We performed bacterial identification and antimicrobial susceptibility testing for obligate anaerobes to establish effective antimicrobial therapy. We used 16S rRNA gene sequencing to identify 58 obligate anaerobes and compared the results with those from a phenotypic identification kit. The identification results of 16S rRNA gene sequencing were more reliable than those of the commercial kit. We concluded that genera Bacteroides and Prevotella-especially B. fragilis and P. heparinolytica-are dominant anaerobes in lower respiratory tract infection in horses; these organisms were susceptible to metronidazole, imipenem and clindamycin.

  11. Winnowing sequences from a database search.

    Science.gov (United States)

    Berman, P; Zhang, Z; Wolf, Y I; Koonin, E V; Miller, W

    2000-01-01

    In database searches for sequence similarity, matches to a distinct sequence region (e.g., protein domain) are frequently obscured by numerous matches to another region of the same sequence. In order to cope with this problem, algorithms are developed to discard redundant matches. One model for this problem begins with a list of intervals, each with an associated score; each interval gives the range of positions in the query sequence that align to a database sequence, and the score is that of the alignment. If interval I is contained in interval J, and I's score is less than J's, then I is said to be dominated by J. The problem is then to identify each interval that is dominated by at least K other intervals, where K is a given level of "tolerable redundancy." An algorithm is developed to solve the problem in O(N log N) time and O(N*) space, where N is the number of intervals and N* is a precisely defined value that never exceeds N and is frequently much smaller. This criterion for discarding database hits has been implemented in the Blast program, as illustrated herein with examples. Several variations and extensions of this approach are also described.

  12. Whole-exome sequencing, without prior linkage, identifies a mutation in LAMB3 as a cause of dominant hypoplastic amelogenesis imperfecta.

    Science.gov (United States)

    Poulter, James A; El-Sayed, Walid; Shore, Roger C; Kirkham, Jennifer; Inglehearn, Chris F; Mighell, Alan J

    2014-01-01

    The conventional approach to identifying the defective gene in a family with an inherited disease is to find the disease locus through family studies. However, the rapid development and decreasing cost of next generation sequencing facilitates a more direct approach. Here, we report the identification of a frameshift mutation in LAMB3 as a cause of dominant hypoplastic amelogenesis imperfecta (AI). Whole-exome sequencing of three affected family members and subsequent filtering of shared variants, without prior genetic linkage, sufficed to identify the pathogenic variant. Simultaneous analysis of multiple family members confirms segregation, enhancing the power to filter the genetic variation found and leading to rapid identification of the pathogenic variant. LAMB3 encodes a subunit of Laminin-5, one of a family of basement membrane proteins with essential functions in cell growth, movement and adhesion. Homozygous LAMB3 mutations cause junctional epidermolysis bullosa (JEB) and enamel defects are seen in JEB cases. However, to our knowledge, this is the first report of dominant AI due to a LAMB3 mutation in the absence of JEB.

  13. A novel mutation in PRPF31, causative of autosomal dominant retinitis pigmentosa, using the BGISEQ-500 sequencer

    Directory of Open Access Journals (Sweden)

    Yu Zheng

    2018-01-01

    Full Text Available AIM: To study the genes responsible for retinitis pigmentosa. METHODS: A total of 15 Chinese families with retinitis pigmentosa, containing 94 sporadically afflicted cases, were recruited. The targeted sequences were captured using the Target_Eye_365_V3 chip and sequenced using the BGISEQ-500 sequencer, according to the manufacturer’s instructions. Data were aligned to UCSC Genome Browser build hg19, using the Burroughs Wheeler Aligner MEM algorithm. Local realignment was performed with the Genome Analysis Toolkit (GATK v.3.3.0 IndelRealigner, and variants were called with the Genome Analysis Toolkit Haplotypecaller, without any use of imputation. Variants were filtered against a panel derived from 1000 Genomes Project, 1000G_ASN, ESP6500, ExAC and dbSNP138. In all members of Family ONE and Family TWO with available DNA samples, the genetic variant was validated using Sanger sequencing. RESULTS: A novel, pathogenic variant of retinitis pigmentosa, c.357_358delAA (p.Ser119SerfsX5 was identified in PRPF31 in 2 of 15 autosomal-dominant retinitis pigmentosa (ADRP families, as well as in one, sporadic case. Sanger sequencing was performed upon probands, as well as upon other family members. This novel, pathogenic genotype co-segregated with retinitis pigmentosa phenotype in these two families. CONCLUSION: ADRP is a subtype of retinitis pigmentosa, defined by its genotype, which accounts for 20%-40% of the retinitis pigmentosa patients. Our study thus expands the spectrum of PRPF31 mutations known to occur in ADRP, and provides further demonstration of the applicability of the BGISEQ500 sequencer for genomics research.

  14. A novel mutation in PRPF31, causative of autosomal dominant retinitis pigmentosa, using the BGISEQ-500 sequencer

    Science.gov (United States)

    Zheng, Yu; Wang, Hai-Lin; Li, Jian-Kang; Xu, Li; Tellier, Laurent; Li, Xiao-Lin; Huang, Xiao-Yan; Li, Wei; Niu, Tong-Tong; Yang, Huan-Ming; Zhang, Jian-Guo; Liu, Dong-Ning

    2018-01-01

    AIM To study the genes responsible for retinitis pigmentosa. METHODS A total of 15 Chinese families with retinitis pigmentosa, containing 94 sporadically afflicted cases, were recruited. The targeted sequences were captured using the Target_Eye_365_V3 chip and sequenced using the BGISEQ-500 sequencer, according to the manufacturer's instructions. Data were aligned to UCSC Genome Browser build hg19, using the Burroughs Wheeler Aligner MEM algorithm. Local realignment was performed with the Genome Analysis Toolkit (GATK v.3.3.0) IndelRealigner, and variants were called with the Genome Analysis Toolkit Haplotypecaller, without any use of imputation. Variants were filtered against a panel derived from 1000 Genomes Project, 1000G_ASN, ESP6500, ExAC and dbSNP138. In all members of Family ONE and Family TWO with available DNA samples, the genetic variant was validated using Sanger sequencing. RESULTS A novel, pathogenic variant of retinitis pigmentosa, c.357_358delAA (p.Ser119SerfsX5) was identified in PRPF31 in 2 of 15 autosomal-dominant retinitis pigmentosa (ADRP) families, as well as in one, sporadic case. Sanger sequencing was performed upon probands, as well as upon other family members. This novel, pathogenic genotype co-segregated with retinitis pigmentosa phenotype in these two families. CONCLUSION ADRP is a subtype of retinitis pigmentosa, defined by its genotype, which accounts for 20%-40% of the retinitis pigmentosa patients. Our study thus expands the spectrum of PRPF31 mutations known to occur in ADRP, and provides further demonstration of the applicability of the BGISEQ500 sequencer for genomics research. PMID:29375987

  15. Abuse of dominant position in Albania based in jurisprudence

    Directory of Open Access Journals (Sweden)

    Endri Papajorgji

    2016-11-01

    Full Text Available Competition law and cartel is the basis of a modern economy. While in the US, competition law exists and is terminologically known and is part of legislation since 1890 (Sherman Law, in Europe, it has become part of the founding treaties of the EU since 1957 by the Treaty of Rome. However, at that time, “culture of competition” would be born in the member states of the EU, which traditionally favour cartel agreements, state aid and the promotion of national products. Some EU member states have included competition law in their national legislation in the early 90-s. Rules were set for the first time on competition in the coal and steel market under Articles 65 and 66 of the Treaty of Rome, constituted a new terminology for member states. Albania has worked during these 24 years of democracy, to apply the basic principles of market economy and along with it the Lisbon Treaty, Regulations and EU Directives in the frame of competition. Main purpose of this manuscript is to give an overview of the abuse of dominant position in the frame of the most important court decision of this legal institution in Albania.

  16. Solvation of positive ions in water: the dominant role of water-water interaction

    International Nuclear Information System (INIS)

    Krekeler, Christian; Site, Luigi Delle

    2007-01-01

    Local polarization effects, induced by monovalent and divalent positive ions in water, influence (and in turn are influenced by) the large-scale structural properties of the solvent. Experiments can only distinguish this process of interplay in a generic qualitative way. Instead, first-principles calculations can address the question at both the electronic and atomistic scale, accounting for electronic polarization as well as geometrical conformations. For this reason we study the extension of the scales' interconnection by means of first-principle Car-Parrinello molecular dynamics applied to systems of different size. In this way we identify the general aspects dominating the physics of the first solvation shell and their connection to the effects related to the formation of the outer shells and eventually the bulk. We show that while the influence of the ions is extended to the first shell only, the water-water interaction is instead playing a dominant role even within the first shell independently of the size or the charge of the ion. (fast track communication)

  17. Estimates of statistical significance for comparison of individual positions in multiple sequence alignments

    Directory of Open Access Journals (Sweden)

    Sadreyev Ruslan I

    2004-08-01

    Full Text Available Abstract Background Profile-based analysis of multiple sequence alignments (MSA allows for accurate comparison of protein families. Here, we address the problems of detecting statistically confident dissimilarities between (1 MSA position and a set of predicted residue frequencies, and (2 between two MSA positions. These problems are important for (i evaluation and optimization of methods predicting residue occurrence at protein positions; (ii detection of potentially misaligned regions in automatically produced alignments and their further refinement; and (iii detection of sites that determine functional or structural specificity in two related families. Results For problems (1 and (2, we propose analytical estimates of P-value and apply them to the detection of significant positional dissimilarities in various experimental situations. (a We compare structure-based predictions of residue propensities at a protein position to the actual residue frequencies in the MSA of homologs. (b We evaluate our method by the ability to detect erroneous position matches produced by an automatic sequence aligner. (c We compare MSA positions that correspond to residues aligned by automatic structure aligners. (d We compare MSA positions that are aligned by high-quality manual superposition of structures. Detected dissimilarities reveal shortcomings of the automatic methods for residue frequency prediction and alignment construction. For the high-quality structural alignments, the dissimilarities suggest sites of potential functional or structural importance. Conclusion The proposed computational method is of significant potential value for the analysis of protein families.

  18. Clinical neurogenetics: autosomal dominant spinocerebellar ataxia.

    Science.gov (United States)

    Shakkottai, Vikram G; Fogel, Brent L

    2013-11-01

    The autosomal dominant spinocerebellar ataxias are a diverse and clinically heterogeneous group of disorders characterized by degeneration and dysfunction of the cerebellum and its associated pathways. Clinical and diagnostic evaluation can be challenging because of phenotypic overlap among causes, and a stratified and systematic approach is essential. Recent advances include the identification of additional genes causing dominant genetic ataxia, a better understanding of cellular pathogenesis in several disorders, the generation of new disease models that may stimulate development of new therapies, and the use of new DNA sequencing technologies, including whole-exome sequencing, to improve diagnosis. Copyright © 2013 Elsevier Inc. All rights reserved.

  19. An Adaptive Method for Switching between Pedestrian/Car Indoor Positioning Algorithms based on Multilayer Time Sequences

    Directory of Open Access Journals (Sweden)

    Zhining Gu

    2018-02-01

    Full Text Available Pedestrian dead reckoning (PDR positioning algorithms can be used to obtain a target’s location only for movement with step features and not for driving, for which the trilateral Bluetooth indoor positioning method can be used. In this study, to obtain the precise locations of different states (pedestrian/car using the corresponding positioning algorithms, we propose an adaptive method for switching between the PDR and car indoor positioning algorithms based on multilayer time sequences (MTSs. MTSs, which consider the behavior context, comprise two main aspects: filtering of noisy data in small-scale time sequences and using a state chain to reduce the time delay of algorithm switching in large-scale time sequences. The proposed method can be expected to realize the recognition of stationary, walking, driving, or other states; switch to the correct indoor positioning algorithm; and improve the accuracy of localization compared to using a single positioning algorithm. Our experiments show that the recognition of static, walking, driving, and other states improves by 5.5%, 45.47%, 26.23%, and 21% on average, respectively, compared with convolutional neural network (CNN method. The time delay decreases by approximately 0.5–8.5 s for the transition between states and by approximately 24 s for the entire process.

  20. An Adaptive Method for Switching between Pedestrian/Car Indoor Positioning Algorithms based on Multilayer Time Sequences.

    Science.gov (United States)

    Gu, Zhining; Guo, Wei; Li, Chaoyang; Zhu, Xinyan; Guo, Tao

    2018-02-27

    Pedestrian dead reckoning (PDR) positioning algorithms can be used to obtain a target's location only for movement with step features and not for driving, for which the trilateral Bluetooth indoor positioning method can be used. In this study, to obtain the precise locations of different states (pedestrian/car) using the corresponding positioning algorithms, we propose an adaptive method for switching between the PDR and car indoor positioning algorithms based on multilayer time sequences (MTSs). MTSs, which consider the behavior context, comprise two main aspects: filtering of noisy data in small-scale time sequences and using a state chain to reduce the time delay of algorithm switching in large-scale time sequences. The proposed method can be expected to realize the recognition of stationary, walking, driving, or other states; switch to the correct indoor positioning algorithm; and improve the accuracy of localization compared to using a single positioning algorithm. Our experiments show that the recognition of static, walking, driving, and other states improves by 5.5%, 45.47%, 26.23%, and 21% on average, respectively, compared with convolutional neural network (CNN) method. The time delay decreases by approximately 0.5-8.5 s for the transition between states and by approximately 24 s for the entire process.

  1. Visual Statistical Learning Works after Binding the Temporal Sequences of Shapes and Spatial Positions

    Directory of Open Access Journals (Sweden)

    Osamu Watanabe

    2011-05-01

    Full Text Available The human visual system can acquire the statistical structures in temporal sequences of object feature changes, such as changes in shape, color, and its combination. Here we investigate whether the statistical learning for spatial position and shape changes operates separately or not. It is known that the visual system processes these two types of information separately; the spatial information is processed in the parietal cortex, whereas object shapes and colors are detected in the temporal pathway, and, after that, we perceive bound information in the two streams. We examined whether the statistical learning operates before or after binding the shape and the spatial information by using the “re-paired triplet” paradigm proposed by Turk-Browne, Isola, Scholl, and Treat (2008. The result showed that observers acquired combined sequences of shape and position changes, but no statistical information in individual sequence was obtained. This finding suggests that the visual statistical learning works after binding the temporal sequences of shapes and spatial structures and would operate in the higher-order visual system; this is consistent with recent ERP (Abla & Okanoya, 2009 and fMRI (Turk-Browne, Scholl, Chun, & Johnson, 2009 studies.

  2. Logo2PWM: a tool to convert sequence logo to position weight matrix.

    Science.gov (United States)

    Gao, Zhen; Liu, Lu; Ruan, Jianhua

    2017-10-03

    position weight matrix (PWM) and sequence logo are the most widely used representations of transcription factor binding site (TFBS) in biological sequences. Sequence logo - a graphical representation of PWM, has been widely used in scientific publications and reports, due to its easiness of human perception, rich information, and simple format. Different from sequence logo, PWM works great as a precise and compact digitalized form, which can be easily used by a variety of motif analysis software. There are a few available tools to generate sequence logos from PWM; however, no tool does the reverse. Such tool to convert sequence logo back to PWM is needed to scan a TFBS represented in logo format in a publication where the PWM is not provided or hard to be acquired. A major difficulty in developing such tool to convert sequence logo to PWM is to deal with the diversity of sequence logo images. We propose logo2PWM for reconstructing PWM from a large variety of sequence logo images. Evaluation results on over one thousand logos from three sources of different logo format show that the correlation between the reconstructed PWMs and the original PWMs are constantly high, where median correlation is greater than 0.97. Because of the high recognition accuracy, the easiness of usage, and, the availability of both web-based service and stand-alone application, we believe that logo2PWM can readily benefit the study of transcription by filling the gap between sequence logo and PWM.

  3. Primary somatosensory/motor cortical thickness distinguishes paresthesia-dominant from pain-dominant carpal tunnel syndrome.

    Science.gov (United States)

    Maeda, Yumi; Kettner, Norman; Kim, Jieun; Kim, Hyungjun; Cina, Stephen; Malatesta, Cristina; Gerber, Jessica; McManus, Claire; Libby, Alexandra; Mezzacappa, Pia; Mawla, Ishtiaq; Morse, Leslie R; Audette, Joseph; Napadow, Vitaly

    2016-05-01

    Paresthesia-dominant and pain-dominant subgroups have been noted in carpal tunnel syndrome (CTS), a peripheral neuropathic disorder characterized by altered primary somatosensory/motor (S1/M1) physiology. We aimed to investigate whether brain morphometry dissociates these subgroups. Subjects with CTS were evaluated with nerve conduction studies, whereas symptom severity ratings were used to allocate subjects into paresthesia-dominant (CTS-paresthesia), pain-dominant (CTS-pain), and pain/paresthesia nondominant (not included in further analysis) subgroups. Structural brain magnetic resonance imaging data were acquired at 3T using a multiecho MPRAGE T1-weighted pulse sequence, and gray matter cortical thickness was calculated across the entire brain using validated, automated methods. CTS-paresthesia subjects demonstrated reduced median sensory nerve conduction velocity (P = 0.05) compared with CTS-pain subjects. In addition, cortical thickness in precentral and postcentral gyri (S1/M1 hand area) contralateral to the more affected hand was significantly reduced in CTS-paresthesia subgroup compared with CTS-pain subgroup. Moreover, in CTS-paresthesia subjects, precentral cortical thickness was negatively correlated with paresthesia severity (r(34) = -0.40, P = 0.016) and positively correlated with median nerve sensory velocity (r(36) = 0.51, P = 0.001), but not with pain severity. Conversely, in CTS-pain subjects, contralesional S1 (r(9) = 0.62, P = 0.042) and M1 (r(9) = 0.61, P = 0.046) cortical thickness were correlated with pain severity, but not median nerve velocity or paresthesia severity. This double dissociation in somatotopically specific S1/M1 areas suggests a neuroanatomical substrate for symptom-based CTS subgroups. Such fine-grained subgrouping of CTS may lead to improved personalized therapeutic approaches, based on superior characterization of the linkage between peripheral and central neuroplasticity.

  4. Positive Selection or Free to Vary? Assessing the Functional Significance of Sequence Change Using Molecular Dynamics.

    Directory of Open Access Journals (Sweden)

    Jane R Allison

    Full Text Available Evolutionary arms races between pathogens and their hosts may be manifested as selection for rapid evolutionary change of key genes, and are sometimes detectable through sequence-level analyses. In the case of protein-coding genes, such analyses frequently predict that specific codons are under positive selection. However, detecting positive selection can be non-trivial, and false positive predictions are a common concern in such analyses. It is therefore helpful to place such predictions within a structural and functional context. Here, we focus on the p19 protein from tombusviruses. P19 is a homodimer that sequesters siRNAs, thereby preventing the host RNAi machinery from shutting down viral infection. Sequence analysis of the p19 gene is complicated by the fact that it is constrained at the sequence level by overprinting of a viral movement protein gene. Using homology modeling, in silico mutation and molecular dynamics simulations, we assess how non-synonymous changes to two residues involved in forming the dimer interface-one invariant, and one predicted to be under positive selection-impact molecular function. Interestingly, we find that both observed variation and potential variation (where a non-synonymous change to p19 would be synonymous for the overprinted movement protein does not significantly impact protein structure or RNA binding. Consequently, while several methods identify residues at the dimer interface as being under positive selection, MD results suggest they are functionally indistinguishable from a site that is free to vary. Our analyses serve as a caveat to using sequence-level analyses in isolation to detect and assess positive selection, and emphasize the importance of also accounting for how non-synonymous changes impact structure and function.

  5. Development of severe accident evaluation technology (level 2 PSA) for sodium-cooled fast reactors. (5) Identification of dominant factors in ex-vessel accident sequences

    International Nuclear Information System (INIS)

    Ohno, Shuji; Seino, Hiroshi; Miyahara, Shinya

    2009-01-01

    The evaluation of accident progression outside of a reactor vessel (ex-vessel) and subsequent transfer behavior of radioactive materials is of great importance from the viewpoint of Level 2 PSA. Hence typical ex-vessel accident sequences in the JAEA Sodium-cooled Fast Reactor are qualitatively discussed in this paper and dominant behaviors or factors in the sequences are investigated through parametric calculations using the CONTAIN/LMR code. Scenarios to be focused on are, 1) sodium vapor leakage from the reactor vessel and 2) sodium-concrete reaction, which are both to be considered in the accident category of LOHRS (loss of heat removal system) and might be followed by an early containment failure due to the thermal effect of sodium combustion and hydrogen burning respectively. The calculated results clarify that the sodium vapor leak rate and the scale of sodium-concrete reaction are the important factors to dominate the ex-vessel accident progression. In addition to the understandings of the dominant factors, the analyzed results also provide the specific information such as pressure loading value to the containment and the timing of pressurization, which is indispensable as technical base in Level 2 PSA for developing event trees and for quantifying the accident consequences. (author)

  6. [Influence of "prehistory" of sequential movements of the right and the left hand on reproduction: coding of positions, movements and sequence structure].

    Science.gov (United States)

    Bobrova, E V; Liakhovetskiĭ, V A; Borshchevskaia, E R

    2011-01-01

    The dependence of errors during reproduction of a sequence of hand movements without visual feedback on the previous right- and left-hand performance ("prehistory") and on positions in space of sequence elements (random or ordered by the explicit rule) was analyzed. It was shown that the preceding information about the ordered positions of the sequence elements was used during right-hand movements, whereas left-hand movements were performed with involvement of the information about the random sequence. The data testify to a central mechanism of the analysis of spatial structure of sequence elements. This mechanism activates movement coding specific for the left hemisphere (vector coding) in case of an ordered sequence structure and positional coding specific for the right hemisphere in case of a random sequence structure.

  7. Abundant Trimethylornithine Lipids and Specific Gene Sequences Are Indicative of Planctomycete Importance at the Oxic/Anoxic Interface in Sphagnum-Dominated Northern Wetlands.

    Science.gov (United States)

    Moore, Eli K; Villanueva, Laura; Hopmans, Ellen C; Rijpstra, W Irene C; Mets, Anchelique; Dedysh, Svetlana N; Sinninghe Damsté, Jaap S

    2015-09-01

    Northern wetlands make up a substantial terrestrial carbon sink and are often dominated by decay-resistant Sphagnum mosses. Recent studies have shown that planctomycetes appear to be involved in degradation of Sphagnum-derived debris. Novel trimethylornithine (TMO) lipids have recently been characterized as abundant lipids in various Sphagnum wetland planctomycete isolates, but their occurrence in the environment has not yet been confirmed. We applied a combined intact polar lipid (IPL) and molecular analysis of peat cores collected from two northern wetlands (Saxnäs Mosse [Sweden] and Obukhovskoye [Russia]) in order to investigate the preferred niche and abundance of TMO-producing planctomycetes. TMOs were present throughout the profiles of Sphagnum bogs, but their concentration peaked at the oxic/anoxic interface, which coincided with a maximum abundance of planctomycete-specific 16S rRNA gene sequences. The sequences detected at the oxic/anoxic interface were affiliated with the Isosphaera group, while sequences present in the anoxic peat layers were related to an uncultured planctomycete group. Pyrosequencing-based analysis identified Planctomycetes as the major bacterial group at the oxic/anoxic interface at the Obukhovskoye peat (54% of total 16S rRNA gene sequence reads), followed by Acidobacteria (19% reads), while in the Saxnäs Mosse peat, Acidobacteria were dominant (46%), and Planctomycetes contributed to 6% of the total reads. The detection of abundant TMO lipids in planctomycetes isolated from peat bogs and the lack of TMO production by cultures of acidobacteria suggest that planctomycetes are the producers of TMOs in peat bogs. The higher accumulation of TMOs at the oxic/anoxic interface and the change in the planctomycete community with depth suggest that these IPLs could be synthesized as a response to changing redox conditions at the oxic/anoxic interface. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  8. Ichnology applied to sequence stratigraphic analysis of Siluro-Devonian mud-dominated shelf deposits, Paraná Basin, Brazil

    Science.gov (United States)

    Sedorko, Daniel; Netto, Renata G.; Savrda, Charles E.

    2018-04-01

    Previous studies of the Paraná Supersequence (Furnas and Ponta Grossa formations) of the Paraná Basin in southern Brazil have yielded disparate sequence stratigraphic interpretations. An integrated sedimentological, paleontological, and ichnological model was created to establish a refined sequence stratigraphic framework for this succession, focusing on the Ponta Grossa Formation. Twenty-nine ichnotaxa are recognized in the Ponta Grossa Formation, recurring assemblages of which define five trace fossil suites that represent various expressions of the Skolithos, Glossifungites and Cruziana ichnofacies. Physical sedimentologic characteristics and associated softground ichnofacies provide the basis for recognizing seven facies that reflect a passive relationship to bathymetric gradients from shallow marine (shoreface) to offshore deposition. The vertical distribution of facies provides the basis for dividing the Ponta Grossa Formation into three major (3rd-order) depositional sequences- Siluro-Devonian and Devonian I and II-each containing a record of three to seven higher-order relative sea-level cycles. Major sequence boundaries, commonly coinciding with hiatuses recognized from previously published biostratigraphic data, are locally marked by firmground Glossifungites Ichnofacies associated with submarine erosion. Maximum transgressive horizons are prominently marked by unbioturbated or weakly bioturbated black shales. By integrating observations of the Ponta Grossa Formation with those recently made on the underlying marginal- to shallow-marine Furnas Formation, the entire Paraná Supersequence can be divided into four disconformity-bound sequences: a Lower Silurian (Llandovery-Wenlock) sequence, corresponding to lower and middle units of the Furnas; a Siluro-Devonian sequence (?Pridoli-Early Emsian), and Devonian sequences I (Late Emsian-Late Eifelian) and II (Late Eifelian-Early Givetian). Stratigraphic positions of sequence boundaries generally coincide with

  9. Describing the organization of dominance relationships by dominance-directed tree method.

    Science.gov (United States)

    Izar, Patrícia; Ferreira, Renata G; Sato, Takechi

    2006-02-01

    Methods to describe dominance hierarchies are a key tool in primatology studies. Most current methods are appropriate for analyzing linear and near-linear hierarchies; however, more complex structures are common in primate groups. We propose a method termed "dominance-directed tree." This method is based on graph theory and set theory to analyze dominance relationships in social groups. The method constructs a transitive matrix by imposing transitivity to the dominance matrix and produces a graphical representation of the dominance relationships, which allows an easy visualization of the hierarchical position of the individuals, or subsets of individuals. The method is also able to detect partial and complete hierarchies, and to describe situations in which hierarchical and nonhierarchical principles operate. To illustrate the method, we apply a dominance tree analysis to artificial data and empirical data from a group of Cebus apella. Copyright 2006 Wiley-Liss, Inc.

  10. Protection algorithm for a wind turbine generator based on positive- and negative-sequence fault components

    DEFF Research Database (Denmark)

    Zheng, Tai-Ying; Cha, Seung-Tae; Crossley, Peter A.

    2011-01-01

    A protection relay for a wind turbine generator (WTG) based on positive- and negative-sequence fault components is proposed in the paper. The relay uses the magnitude of the positive-sequence component in the fault current to detect a fault on a parallel WTG, connected to the same power collection...... feeder, or a fault on an adjacent feeder; but for these faults, the relay remains stable and inoperative. A fault on the power collection feeder or a fault on the collection bus, both of which require an instantaneous tripping response, are distinguished from an inter-tie fault or a grid fault, which...... in the fault current is used to decide on either instantaneous or delayed operation. The operating performance of the relay is then verified using various fault scenarios modelled using EMTP-RV. The scenarios involve changes in the position and type of fault, and the faulted phases. Results confirm...

  11. Diversity and Structure of Diazotrophic Communities in Mangrove Rhizosphere, Revealed by High-Throughput Sequencing.

    Science.gov (United States)

    Zhang, Yanying; Yang, Qingsong; Ling, Juan; Van Nostrand, Joy D; Shi, Zhou; Zhou, Jizhong; Dong, Junde

    2017-01-01

    Diazotrophic communities make an essential contribution to the productivity through providing new nitrogen. However, knowledge of the roles that both mangrove tree species and geochemical parameters play in shaping mangove rhizosphere diazotrophic communities is still elusive. Here, a comprehensive examination of the diversity and structure of microbial communities in the rhizospheres of three mangrove species, Rhizophora apiculata , Avicennia marina , and Ceriops tagal , was undertaken using high - throughput sequencing of the 16S rRNA and nifH genes. Our results revealed a great diversity of both the total microbial composition and the diazotrophic composition specifically in the mangrove rhizosphere. Deltaproteobacteria and Gammaproteobacteria were both ubiquitous and dominant, comprising an average of 45.87 and 86.66% of total microbial and diazotrophic communities, respectively. Sulfate-reducing bacteria belonging to the Desulfobacteraceae and Desulfovibrionaceae were the dominant diazotrophs. Community statistical analyses suggested that both mangrove tree species and additional environmental variables played important roles in shaping total microbial and potential diazotroph communities in mangrove rhizospheres. In contrast to the total microbial community investigated by analysis of 16S rRNA gene sequences, most of the dominant diazotrophic groups identified by nifH gene sequences were significantly different among mangrove species. The dominant diazotrophs of the family Desulfobacteraceae were positively correlated with total phosphorus, but negatively correlated with the nitrogen to phosphorus ratio. The Pseudomonadaceae were positively correlated with the concentration of available potassium, suggesting that diazotrophs potentially play an important role in biogeochemical cycles, such as those of nitrogen, phosphorus, sulfur, and potassium, in the mangrove ecosystem.

  12. Diversity and Structure of Diazotrophic Communities in Mangrove Rhizosphere, Revealed by High-Throughput Sequencing

    Directory of Open Access Journals (Sweden)

    Yanying Zhang

    2017-10-01

    Full Text Available Diazotrophic communities make an essential contribution to the productivity through providing new nitrogen. However, knowledge of the roles that both mangrove tree species and geochemical parameters play in shaping mangove rhizosphere diazotrophic communities is still elusive. Here, a comprehensive examination of the diversity and structure of microbial communities in the rhizospheres of three mangrove species, Rhizophora apiculata, Avicennia marina, and Ceriops tagal, was undertaken using high-throughput sequencing of the 16S rRNA and nifH genes. Our results revealed a great diversity of both the total microbial composition and the diazotrophic composition specifically in the mangrove rhizosphere. Deltaproteobacteria and Gammaproteobacteria were both ubiquitous and dominant, comprising an average of 45.87 and 86.66% of total microbial and diazotrophic communities, respectively. Sulfate-reducing bacteria belonging to the Desulfobacteraceae and Desulfovibrionaceae were the dominant diazotrophs. Community statistical analyses suggested that both mangrove tree species and additional environmental variables played important roles in shaping total microbial and potential diazotroph communities in mangrove rhizospheres. In contrast to the total microbial community investigated by analysis of 16S rRNA gene sequences, most of the dominant diazotrophic groups identified by nifH gene sequences were significantly different among mangrove species. The dominant diazotrophs of the family Desulfobacteraceae were positively correlated with total phosphorus, but negatively correlated with the nitrogen to phosphorus ratio. The Pseudomonadaceae were positively correlated with the concentration of available potassium, suggesting that diazotrophs potentially play an important role in biogeochemical cycles, such as those of nitrogen, phosphorus, sulfur, and potassium, in the mangrove ecosystem.

  13. Naturally occurring dominant drug resistance mutations occur infrequently in the setting of recently acquired hepatitis C.

    Science.gov (United States)

    Applegate, Tanya L; Gaudieri, Silvana; Plauzolles, Anne; Chopra, Abha; Grebely, Jason; Lucas, Michaela; Hellard, Margaret; Luciani, Fabio; Dore, Gregory J; Matthews, Gail V

    2015-01-01

    Direct-acting antivirals (DAAs) are predicted to transform hepatitis C therapy, yet little is known about the prevalence of naturally occurring resistance mutations in recently acquired HCV. This study aimed to determine the prevalence and frequency of drug resistance mutations in the viral quasispecies among HIV-positive and -negative individuals with recent HCV. The NS3 protease, NS5A and NS5B polymerase genes were amplified from 50 genotype 1a participants of the Australian Trial in Acute Hepatitis C. Amino acid variations at sites known to be associated with possible drug resistance were analysed by ultra-deep pyrosequencing. A total of 12% of individuals harboured dominant resistance mutations, while 36% demonstrated non-dominant resistant variants below that detectable by bulk sequencing (that is, Resistance variants (resistance from all classes, with the exception of sofosbuvir. Dominant resistant mutations were uncommonly observed in the setting of recent HCV. However, low-level mutations to all DAA classes were observed by deep sequencing at the majority of sites and in most individuals. The significance of these variants and impact on future treatment options remains to be determined. Clinicaltrials.gov NCT00192569.

  14. Rearing room affects the non-dominant chicken caecum microbiota, while diet affects the dominant microbiota

    Directory of Open Access Journals (Sweden)

    Jane eLudvigsen

    2016-02-01

    Full Text Available The combined effect of environment and diet in shaping the gut microbiota remain largely unknown. This knowledge, however, is important for animal welfare and safe food production. For these reasons we determined the effect of experimental units on the chicken caecum microbiota for a full factorial experiment where we tested the combined effect of room, diet and antimicrobial treatment. By Illumina Deep sequencing of the 16S rRNA gene, we found that diet mainly affected the dominant microbiota, while the room as a proxy for environment had major effects on the non-dominant microbiota (p=0.006, Kruskal Wallis test. We therefore propose that the dominant and non-dominant microbiotas are shaped by different experimental units. These findings have implications both for our general understanding of the host-associated microbiota, and for setting up experiments related to specific targeting of pathogens.

  15. G+C content dominates intrinsic nucleosome occupancy

    Directory of Open Access Journals (Sweden)

    Hughes Timothy R

    2009-12-01

    Full Text Available Abstract Background The relative preference of nucleosomes to form on individual DNA sequences plays a major role in genome packaging. A wide variety of DNA sequence features are believed to influence nucleosome formation, including periodic dinucleotide signals, poly-A stretches and other short motifs, and sequence properties that influence DNA structure, including base content. It was recently shown by Kaplan et al. that a probabilistic model using composition of all 5-mers within a nucleosome-sized tiling window accurately predicts intrinsic nucleosome occupancy across an entire genome in vitro. However, the model is complicated, and it is not clear which specific DNA sequence properties are most important for intrinsic nucleosome-forming preferences. Results We find that a simple linear combination of only 14 simple DNA sequence attributes (G+C content, two transformations of dinucleotide composition, and the frequency of eleven 4-bp sequences explains nucleosome occupancy in vitro and in vivo in a manner comparable to the Kaplan model. G+C content and frequency of AAAA are the most important features. G+C content is dominant, alone explaining ~50% of the variation in nucleosome occupancy in vitro. Conclusions Our findings provide a dramatically simplified means to predict and understand intrinsic nucleosome occupancy. G+C content may dominate because it both reduces frequency of poly-A-like stretches and correlates with many other DNA structural characteristics. Since G+C content is enriched or depleted at many types of features in diverse eukaryotic genomes, our results suggest that variation in nucleotide composition may have a widespread and direct influence on chromatin structure.

  16. [Transposition errors during learning to reproduce a sequence by the right- and the left-hand movements: simulation of positional and movement coding].

    Science.gov (United States)

    Liakhovetskiĭ, V A; Bobrova, E V; Skopin, G N

    2012-01-01

    Transposition errors during the reproduction of a hand movement sequence make it possible to receive important information on the internal representation of this sequence in the motor working memory. Analysis of such errors showed that learning to reproduce sequences of the left-hand movements improves the system of positional coding (coding ofpositions), while learning of the right-hand movements improves the system of vector coding (coding of movements). Learning of the right-hand movements after the left-hand performance involved the system of positional coding "imposed" by the left hand. Learning of the left-hand movements after the right-hand performance activated the system of vector coding. Transposition errors during learning to reproduce movement sequences can be explained by neural network using either vector coding or both vector and positional coding.

  17. Zebra finches can use positional and transitional cues to distinguish vocal element strings.

    Science.gov (United States)

    Chen, Jiani; Ten Cate, Carel

    2015-08-01

    Learning sequences is of great importance to humans and non-human animals. Many motor and mental actions, such as singing in birds and speech processing in humans, rely on sequential learning. At least two mechanisms are considered to be involved in such learning. The chaining theory proposes that learning of sequences relies on memorizing the transitions between adjacent items, while the positional theory suggests that learners encode the items according to their ordinal position in the sequence. Positional learning is assumed to dominate sequential learning. However, human infants exposed to a string of speech sounds can learn transitional (chaining) cues. So far, it is not clear whether birds, an increasingly important model for examining vocal processing, can do this. In this study we use a Go-Nogo design to examine whether zebra finches can use transitional cues to distinguish artificially constructed strings of song elements. Zebra finches were trained with sequences differing in transitional and positional information and next tested with novel strings sharing positional and transitional similarities with the training strings. The results show that they can attend to both transitional and positional cues and that their sequential coding strategies can be biased toward transitional cues depending on the learning context. This article is part of a Special Issue entitled: In Honor of Jerry Hogan. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Excessive Pricing and the Prohibition of the Abuse of a Dominant Position

    OpenAIRE

    Pozdnakova, Alla

    2010-01-01

    This article contributes to the European debate on exploitative pricing abuses by dominant undertakings. Although it is questionable whether competition policy should interfere with such market behaviour, case law shows that Article 82 EC applies, in principle, to exploitative pricing abuses by dominant undertakings. The legal test for excessive pricing needs further clarification and simplification, although the test must remain sufficiently flexible for application on a case-by-case basis. ...

  19. Examining the Center: Positions, Dominance, and Star Formation Rates of Most Massive Group Galaxies at Intermediate Redshift

    Science.gov (United States)

    Connelly, Jennifer L.; Parker, Laura C.; McGee, Sean; Mulchaey, John S.; Finoguenov, Alexis; Balogh, Michael; Wilman, David; Group Environment Evolution Collaboration

    2015-01-01

    The group environment is believed to be the stage for many galaxy transformations, helping evolve blue star-forming galaxies to red passive ones. In local studies of galaxy clusters, the central member is usually a single dominant giant galaxy at the center of the potential with little star formation thought to be the result of galaxy mergers. In nearby groups, a range of morphologies and star formation rates are observed and the formation history is less clear. Further, the position and dominance of the central galaxy cannot be assumed in groups, which are less massive and evolved than clusters. To understand the connections between global group properties and properties of the central group galaxy at intermediate redshift, we examine galaxy groups from the Group Environment and Evolution Collaboration (GEEC) catalog, including both optically- and X-ray-selected groups at redshift z~0.4. The sample is diverse, containing a range in overall mass and evolutionary state. The number of groups is significant, membership is notably complete, and measurements span the IR to the UV allowing the properties of the members to be connected to those of the host groups. Having investigated trends in the global group properties previously, including mass and velocity substructure, we turn our attention now to the galaxy populations, focusing on the central regions of these systems. The most massive and second most massive group galaxies are identified by their stellar mass. The positions of the most massive galaxies (MMGs) are determined with respect to both the luminosity-weighted and X-ray center. Star formation rates are used to explore the fraction of passive/quiescent versus star-forming MMGs and the dominance of the MMGs in our group sample is also tested. Determinations of these characteristics and trends constitute the important first steps toward a detailed understanding of the relationships between the properties of host groups and their most massive galaxies and the

  20. A highly restricted T-cell receptor dominates the CD8+ T-cell response to parvovirus B19 infection in HLA-A*2402-positive individuals

    DEFF Research Database (Denmark)

    Kasprowicz, V; Isa, Adiba; Jeffery, K

    2006-01-01

    Six of seven HLA-A*2402-positive individuals with acute parvovirus B19 infections made vigorous CD8-positive cytotoxic T-cell (CTL) responses to the viral epitope FYTPLADQF. All responders showed highly focused T-cell receptor (TCR) usage, using almost exclusively BV5.1. The BV5.1 TCR dominated...

  1. Variability of the protein sequences of lcrV between epidemic and atypical rhamnose-positive strains of Yersinia pestis.

    Science.gov (United States)

    Anisimov, Andrey P; Panfertsev, Evgeniy A; Svetoch, Tat'yana E; Dentovskaya, Svetlana V

    2007-01-01

    Sequencing of lcrV genes and comparison of the deduced amino acid sequences from ten Y. pestis strains belonging mostly to the group of atypical rhamnose-positive isolates (non-pestis subspecies or pestoides group) showed that the LcrV proteins analyzed could be classified into five sequence types. This classification was based on major amino acid polymorphisms among LcrV proteins in the four "hot points" of the protein sequences. Some additional minor polymorphisms were found throughout these sequence types. The "hot points" corresponded to amino acids 18 (Lys --> Asn), 72 (Lys --> Arg), 273 (Cys --> Ser), and 324-326 (Ser-Gly-Lys --> Arg) in the LcrV sequence of the reference Y. pestis strain CO92. One possible explanation for polymorphism in amino acid sequences of LcrV among different strains is that strain-specific variation resulted from adaptation of the plague pathogen to different rodent and lagomorph hosts.

  2. EDAR mutation in autosomal dominant hypohidrotic ectodermal dysplasia in two Swedish families

    Directory of Open Access Journals (Sweden)

    Schmitt-Egenolf Marcus

    2006-11-01

    Full Text Available Abstract Background Hypohidrotic ectodermal dysplasia (HED is a genetic disorder characterized by defective development of teeth, hair, nails and eccrine sweat glands. Both autosomal dominant and autosomal recessive forms of HED have previously been linked to mutations in the ectodysplasin 1 anhidrotic receptor (EDAR protein that plays an important role during embryogenesis. Methods The coding DNA sequence of the EDAR gene was analyzed in two large Swedish three-generational families with autosomal dominant HED. Results A non-sense C to T mutation in exon 12 was identified in both families. This disease-specific mutation changes an arginine amino acid in position 358 of the EDAR protein into a stop codon (p.Arg358X, thereby truncating the protein. In addition to the causative mutation two polymorphisms, not associated with the HED disorder, were also found in the EDAR gene. Conclusion The finding of the p.Arg358X mutation in the Swedish families is the first corroboration of a previously described observation in an American family. Thus, our study strengthens the role of this particular mutation in the aetiology of autosomal dominant HED and confirms the importance of EDAR for the development of HED.

  3. SCREEN FOR DOMINANT BEHAVIORAL MUTATIONS CAUSED BY GENOMIC INSERTION OF P-ELEMENT TRANSPOSONS IN DROSOPHILA: AN EXAMINATION OF THE INTEGRATION OF VIRAL VECTOR SEQUENCES

    OpenAIRE

    FOX, LYLE E.; GREEN, DAVID; YAN, ZIYING; ENGELHARDT, JOHN F.; WU, CHUN-FANG

    2007-01-01

    Here we report the development of a high-throughput screen to assess dominant mutation rates caused by P-element transposition within the Drosophila genome that is suitable for assessing the undesirable effects of integrating foreign regulatory sequences (viral cargo) into a host genome. Three different behavioral paradigms were used: sensitivity to mechanical stress, response to heat stress, and ability to fly. The results, from our screen of 35,000 flies, indicate that mutations caused by t...

  4. Simultaneous sequencing of coding and noncoding RNA reveals a human transcriptome dominated by a small number of highly expressed noncoding genes.

    Science.gov (United States)

    Boivin, Vincent; Deschamps-Francoeur, Gabrielle; Couture, Sonia; Nottingham, Ryan M; Bouchard-Bourelle, Philia; Lambowitz, Alan M; Scott, Michelle S; Abou-Elela, Sherif

    2018-07-01

    Comparing the abundance of one RNA molecule to another is crucial for understanding cellular functions but most sequencing techniques can target only specific subsets of RNA. In this study, we used a new fragmented ribodepleted TGIRT sequencing method that uses a thermostable group II intron reverse transcriptase (TGIRT) to generate a portrait of the human transcriptome depicting the quantitative relationship of all classes of nonribosomal RNA longer than 60 nt. Comparison between different sequencing methods indicated that FRT is more accurate in ranking both mRNA and noncoding RNA than viral reverse transcriptase-based sequencing methods, even those that specifically target these species. Measurements of RNA abundance in different cell lines using this method correlate with biochemical estimates, confirming tRNA as the most abundant nonribosomal RNA biotype. However, the single most abundant transcript is 7SL RNA, a component of the signal recognition particle. S tructured n on c oding RNAs (sncRNAs) associated with the same biological process are expressed at similar levels, with the exception of RNAs with multiple functions like U1 snRNA. In general, sncRNAs forming RNPs are hundreds to thousands of times more abundant than their mRNA counterparts. Surprisingly, only 50 sncRNA genes produce half of the non-rRNA transcripts detected in two different cell lines. Together the results indicate that the human transcriptome is dominated by a small number of highly expressed sncRNAs specializing in functions related to translation and splicing. © 2018 Boivin et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  5. [Dominating motivation in systemic memory mechanisms].

    Science.gov (United States)

    Sudakov, K V

    2005-01-01

    The materials provided in the article support the key role of dominating motivation in the systemic processes of fixation and opening of memory mechanisms. The activating mechanisms of dominating motivations in the systemic architectonics of behavioural acts provide the basis for development of a multicomponent acceptor apparatus of an action outcomes broadly represented in various analysing brain sections. As result of enhancement of action outcomes on acceptors structures, molecular behaviour engrammes form within the functional systems. It is these molecular engrammes that are opened by dominating motivations in the same spatial-temporal sequence in which training takes place, and determine deliberate actions of animals. It was demonstrated that dominating motivation opens genetic information with an approximating-exploratory reaction under strong activation of early genes expression, in particular, of c-fos gene protein. Inherent motivation reactions are not blocked by inhibitors of proteins synthesis, by cycloheximide, in particular. In the process of training animals, i.e., satisfaction of the demands which are the basis of dominating motivations, expression of early genes in reduced, while expression of late genes is initiated. In this case, blockators of protein synthesis begin to produce strong inhibiting impact on behaviour of animals.

  6. Application of the whole-transcriptome shotgun sequencing approach to the study of Philadelphia-positive acute lymphoblastic leukemia

    International Nuclear Information System (INIS)

    Iacobucci, I; Ferrarini, A; Sazzini, M; Giacomelli, E; Lonetti, A; Xumerle, L; Ferrari, A; Papayannidis, C; Malerba, G; Luiselli, D; Boattini, A; Garagnani, P; Vitale, A; Soverini, S; Pane, F; Baccarani, M; Delledonne, M; Martinelli, G

    2012-01-01

    Although the pathogenesis of BCR–ABL1-positive acute lymphoblastic leukemia (ALL) is mainly related to the expression of the BCR–ABL1 fusion transcript, additional cooperating genetic lesions are supposed to be involved in its development and progression. Therefore, in an attempt to investigate the complex landscape of mutations, changes in expression profiles and alternative splicing (AS) events that can be observed in such disease, the leukemia transcriptome of a BCR–ABL1-positive ALL patient at diagnosis and at relapse was sequenced using a whole-transcriptome shotgun sequencing (RNA-Seq) approach. A total of 13.9 and 15.8 million sequence reads was generated from de novo and relapsed samples, respectively, and aligned to the human genome reference sequence. This led to the identification of five validated missense mutations in genes involved in metabolic processes (DPEP1, TMEM46), transport (MVP), cell cycle regulation (ABL1) and catalytic activity (CTSZ), two of which resulted in acquired relapse variants. In all, 6390 and 4671 putative AS events were also detected, as well as expression levels for 18 315 and 18 795 genes, 28% of which were differentially expressed in the two disease phases. These data demonstrate that RNA-Seq is a suitable approach for identifying a wide spectrum of genetic alterations potentially involved in ALL

  7. The morphological classification of heartbeats as dominant and non-dominant in ECG signals

    International Nuclear Information System (INIS)

    Chiarugi, Franco; Emmanouilidou, Dimitra; Tsamardinos, Ioannis

    2010-01-01

    Surface electrocardiography (ECG) is the art of analyzing the heart's electrical activity by applying electrodes to certain positions on the body and measuring potentials at the body surface resulting from this electrical activity. Usually, significant clinical information can be obtained from analysis of the dominant beat morphology. In this respect, identification of the dominant beats and their averaging can be very helpful, allowing clinicians to carry out the measurement of amplitudes and intervals on a beat much cleaner from noise than a generic beat selected from the entire ECG recording. In this paper a standard clustering algorithm for the morphological grouping of heartbeats has been analyzed based on K-means, different signal representations, distance metrics and validity indices. The algorithm has been tested on all the records of the MIT-BIH Arrhythmia Database (MIT-BIH AD) obtaining satisfying performances in terms of averaged dominant beat estimation, but the results have not been fully satisfactory in terms of sensitivity and specificity. In order to improve the clustering accuracy, an ad hoc algorithm based on a two-phase decision tree, which integrates additional specific knowledge related to the ECG domain, has been implemented. Similarity features extracted from every beat have been used in the decision trees for the identification of different morphological classes of ECG beats. The results, in terms of dominant beat discrimination, have been evaluated on all annotated beats of the MIT-BIH AD with sensitivity = 99.05%, specificity = 93.94%, positive predictive value = 99.32% and negative predictive value = 91.69%. Further tests have shown a very slight decrement of the performances on all detected beats of the same database using an already published QRS detector, demonstrating the validity of the algorithm in real unsupervised clustering situations where annotated beat positions are not available but beats are detected with a high

  8. Single Machine Scheduling and Due Date Assignment with Past-Sequence-Dependent Setup Time and Position-Dependent Processing Time

    Directory of Open Access Journals (Sweden)

    Chuan-Li Zhao

    2014-01-01

    Full Text Available This paper considers single machine scheduling and due date assignment with setup time. The setup time is proportional to the length of the already processed jobs; that is, the setup time is past-sequence-dependent (p-s-d. It is assumed that a job's processing time depends on its position in a sequence. The objective functions include total earliness, the weighted number of tardy jobs, and the cost of due date assignment. We analyze these problems with two different due date assignment methods. We first consider the model with job-dependent position effects. For each case, by converting the problem to a series of assignment problems, we proved that the problems can be solved in On4 time. For the model with job-independent position effects, we proved that the problems can be solved in On3 time by providing a dynamic programming algorithm.

  9. From nature-dominated to human-dominated environmental changes

    Science.gov (United States)

    Messerli, Bruno; Grosjean, Martin; Hofer, Thomas; Núñez, Lautaro; Pfister, Christian

    2000-01-01

    To what extent is it realistic and useful to view human history as a sequence of changes from highly vulnerable societies of hunters and gatherers through periods with less vulnerable, well buffered and highly productive agrarian-urban societies to a world with regions of extreme overpopulation and overuse of life support systems, so that vulnerability to climatic-environmental changes and extreme events is again increasing? This question cannot be fully answered in our present state of knowledge, but at least we can try to illustrate, with three case studies from different continents, time periods and ecosystems, some fundamental changes in the relationship between natural processes and human activities that occur, as we pass from a nature-dominated to a human dominated environment. 1. Early-mid Holocene: Nature dominated environment — human adaptation, mitigation, and migration. In the central Andes, the Holocene climate changed from humid (10,800-8000 BP) to extreme arid (8000-3600 BP) conditions. Over the same period, prehistoric hunting communities adopted a more sedentary pattern of resource use by settling close to the few perennial water bodies, where they began the process of domesticating camelids around 5000 BP and irrigation from about 3100 BP. 2. Historical period: An agrarian society in transition from an "enduring" to an innovative human response. Detailed documentary evidence from Western Europe may be used to reconstruct quite precisely the impacts of climatic variations on agrarian societies. The period considered spans a major transition from an apparently passive response to the vagaries of the environment during the 16th century to an active and innovative attitude from the onset of the agrarian revolution in the late 18th century through to the present day. The associated changes in technology and in agricultural practices helped to create a society better able to survive the impact of climatic extremes. 3. The present day: A human dominated

  10. A complex dominance hierarchy is controlled by polymorphism of small RNAs and their targets.

    Science.gov (United States)

    Yasuda, Shinsuke; Wada, Yuko; Kakizaki, Tomohiro; Tarutani, Yoshiaki; Miura-Uno, Eiko; Murase, Kohji; Fujii, Sota; Hioki, Tomoya; Shimoda, Taiki; Takada, Yoshinobu; Shiba, Hiroshi; Takasaki-Yasuda, Takeshi; Suzuki, Go; Watanabe, Masao; Takayama, Seiji

    2016-12-22

    In diploid organisms, phenotypic traits are often biased by effects known as Mendelian dominant-recessive interactions between inherited alleles. Phenotypic expression of SP11 alleles, which encodes the male determinants of self-incompatibility in Brassica rapa, is governed by a complex dominance hierarchy 1-3 . Here, we show that a single polymorphic 24 nucleotide small RNA, named SP11 methylation inducer 2 (Smi2), controls the linear dominance hierarchy of the four SP11 alleles (S 44 > S 60 > S 40 > S 29 ). In all dominant-recessive interactions, small RNA variants derived from the linked region of dominant SP11 alleles exhibited high sequence similarity to the promoter regions of recessive SP11 alleles and acted in trans to epigenetically silence their expression. Together with our previous study 4 , we propose a new model: sequence similarity between polymorphic small RNAs and their target regulates mono-allelic gene expression, which explains the entire five-phased linear dominance hierarchy of the SP11 phenotypic expression in Brassica.

  11. Effects of High Intensity White Noise on Short-Term Memory for Position in a List and Sequence

    Science.gov (United States)

    Daee, Safar; Wilding, J. M.

    1977-01-01

    Seven experiments are described investigating the effecy of high intensity white noise during the visual presentation of words on a number of short-term memory tasks. Examines results relative to position learning and sequence learning. (Editor/RK)

  12. Deep sequencing of the viral phoH gene reveals temporal variation, depth-specific composition, and persistent dominance of the same viral phoH genes in the Sargasso Sea

    Directory of Open Access Journals (Sweden)

    Dawn B. Goldsmith

    2015-06-01

    Full Text Available Deep sequencing of the viral phoH gene, a host-derived auxiliary metabolic gene, was used to track viral diversity throughout the water column at the Bermuda Atlantic Time-series Study (BATS site in the summer (September and winter (March of three years. Viral phoH sequences reveal differences in the viral communities throughout a depth profile and between seasons in the same year. Variation was also detected between the same seasons in subsequent years, though these differences were not as great as the summer/winter distinctions. Over 3,600 phoH operational taxonomic units (OTUs; 97% sequence identity were identified. Despite high richness, most phoH sequences belong to a few large, common OTUs whereas the majority of the OTUs are small and rare. While many OTUs make sporadic appearances at just a few times or depths, a small number of OTUs dominate the community throughout the seasons, depths, and years.

  13. Mitochondrial recessive ataxia syndrome mimicking dominant spinocerebellar ataxia.

    Science.gov (United States)

    Palin, Eino J H; Hakonen, Anna H; Korpela, Mari; Paetau, Anders; Suomalainen, Anu

    2012-04-15

    We studied the genetic background of a family with SCA, showing dominant inheritance and anticipation. Muscle histology, POLG1 gene sequence, neuropathology and mitochondrial DNA analyses in a mother and a son showed typical findings for a mitochondrial disorder, and both were shown to be homozygous for a recessive POLG1 mutation, underlying mitochondrial recessive ataxia syndrome, MIRAS. The healthy father was a heterozygous carrier for the same mutation. Recessively inherited MIRAS mutations should be tested in dominantly inherited SCAs cases of unknown cause, as the high carrier frequency of MIRAS may result in two independent introductions of the mutant allele in the family and thereby mimic dominant inheritance. Copyright © 2011 Elsevier B.V. All rights reserved.

  14. Sequencing of allotetraploid cotton (Gossypium hirsutum L. acc. TM-1) provides a resource for fiber improvement.

    Science.gov (United States)

    Zhang, Tianzhen; Hu, Yan; Jiang, Wenkai; Fang, Lei; Guan, Xueying; Chen, Jiedan; Zhang, Jinbo; Saski, Christopher A; Scheffler, Brian E; Stelly, David M; Hulse-Kemp, Amanda M; Wan, Qun; Liu, Bingliang; Liu, Chunxiao; Wang, Sen; Pan, Mengqiao; Wang, Yangkun; Wang, Dawei; Ye, Wenxue; Chang, Lijing; Zhang, Wenpan; Song, Qingxin; Kirkbride, Ryan C; Chen, Xiaoya; Dennis, Elizabeth; Llewellyn, Danny J; Peterson, Daniel G; Thaxton, Peggy; Jones, Don C; Wang, Qiong; Xu, Xiaoyang; Zhang, Hua; Wu, Huaitong; Zhou, Lei; Mei, Gaofu; Chen, Shuqi; Tian, Yue; Xiang, Dan; Li, Xinghe; Ding, Jian; Zuo, Qiyang; Tao, Linna; Liu, Yunchao; Li, Ji; Lin, Yu; Hui, Yuanyuan; Cao, Zhisheng; Cai, Caiping; Zhu, Xiefei; Jiang, Zhi; Zhou, Baoliang; Guo, Wangzhen; Li, Ruiqiang; Chen, Z Jeffrey

    2015-05-01

    Upland cotton is a model for polyploid crop domestication and transgenic improvement. Here we sequenced the allotetraploid Gossypium hirsutum L. acc. TM-1 genome by integrating whole-genome shotgun reads, bacterial artificial chromosome (BAC)-end sequences and genotype-by-sequencing genetic maps. We assembled and annotated 32,032 A-subgenome genes and 34,402 D-subgenome genes. Structural rearrangements, gene loss, disrupted genes and sequence divergence were more common in the A subgenome than in the D subgenome, suggesting asymmetric evolution. However, no genome-wide expression dominance was found between the subgenomes. Genomic signatures of selection and domestication are associated with positively selected genes (PSGs) for fiber improvement in the A subgenome and for stress tolerance in the D subgenome. This draft genome sequence provides a resource for engineering superior cotton lines.

  15. Stratigraphic position, origin and characteristics of manganese mineralization horizons in the Late Cretaceous volcano-sedimentary sequence, south-southwest of Sabzevar

    Directory of Open Access Journals (Sweden)

    Sajjad Maghfouri

    2014-10-01

    part or LMV unit comprised of limestone, marl and volcanic rocks, overlies concordantly on the lower part (K2tv. The manganese mineralization within the host volcano-sedimentary sequence, based on stratigraphic position, relative age and type of host rocks involved the two horizons: the first horizon (Mn Ia, Ib consisting of Benesbourd (Masoudi, 2008, Nudeh (Nasrolahi et al., 2012, Homaie (Nasiri et al., 2010, Goft and Manganese Gostar Khavar Zamin deposits, occurred in the lower part of the sequence (K2tv unit and is hosted by red tuffs. The second horizon (Mn II comprising of Zakeri (Taghizadeh et al., 2012, Cheshmeh Safeid, Mohammad Abad Oryan and Chah Setareh deposits, is hosted by marly-carbonate tuffs and locates within the upper part of the sequence (LMV unit (Maghfouri, 2012. Geometry and shape of the ore bodies in various deposits are as stratiform, layered, parallel and concordant with layering of the host rocks. Textures of the ores include massive, lenticular, banded, laminated and disseminated. Mineralogy of the ores in the two ore horizons is simple and similar and is dominated by pyrolusite, psilomelane and braunite. Gangue minerals are predominantly the host rock-forming minerals including quartz, chlorite and feldspar. Discussion Geochemical data, structures and textures, stratigraphic position and lithologic characteristics of the host rocks represent that manganese reserves in south-southwest Sabzevar were formed as sedimentary-exhalative. Acknowledgements The authors are grateful to the Tarbiat Modares University Grant Commission for research funding. References Maghfouri, S., 2012. Geology, Mineralogy, Geochemistry and Genesis of Cu Mineralization within Late Cretaceous Volcano-Sedimentary Sequence in Southwest of Sabzevar, with emphasis on the Nudeh Deposit. M.Sc. Thesis, Tarbiat Modares University, Tehran, Iran, 312 pp. (in Persian Masoudi, M., 2008. Geology, mineralogy, geochemistry and genesis of Benesbourd Mn deposit in the Southwest Sabzevar

  16. Sequence based polymorphic (SBP marker technology for targeted genomic regions: its application in generating a molecular map of the Arabidopsis thaliana genome

    Directory of Open Access Journals (Sweden)

    Sahu Binod B

    2012-01-01

    Full Text Available Abstract Background Molecular markers facilitate both genotype identification, essential for modern animal and plant breeding, and the isolation of genes based on their map positions. Advancements in sequencing technology have made possible the identification of single nucleotide polymorphisms (SNPs for any genomic regions. Here a sequence based polymorphic (SBP marker technology for generating molecular markers for targeted genomic regions in Arabidopsis is described. Results A ~3X genome coverage sequence of the Arabidopsis thaliana ecotype, Niederzenz (Nd-0 was obtained by applying Illumina's sequencing by synthesis (Solexa technology. Comparison of the Nd-0 genome sequence with the assembled Columbia-0 (Col-0 genome sequence identified putative single nucleotide polymorphisms (SNPs throughout the entire genome. Multiple 75 base pair Nd-0 sequence reads containing SNPs and originating from individual genomic DNA molecules were the basis for developing co-dominant SBP markers. SNPs containing Col-0 sequences, supported by transcript sequences or sequences from multiple BAC clones, were compared to the respective Nd-0 sequences to identify possible restriction endonuclease enzyme site variations. Small amplicons, PCR amplified from both ecotypes, were digested with suitable restriction enzymes and resolved on a gel to reveal the sequence based polymorphisms. By applying this technology, 21 SBP markers for the marker poor regions of the Arabidopsis map representing polymorphisms between Col-0 and Nd-0 ecotypes were generated. Conclusions The SBP marker technology described here allowed the development of molecular markers for targeted genomic regions of Arabidopsis. It should facilitate isolation of co-dominant molecular markers for targeted genomic regions of any animal or plant species, whose genomic sequences have been assembled. This technology will particularly facilitate the development of high density molecular marker maps, essential for

  17. Application of Whole Exome Sequencing in Six Families with an Initial Diagnosis of Autosomal Dominant Retinitis Pigmentosa: Lessons Learned

    Science.gov (United States)

    Fernandez-San Jose, Patricia; Liu, Yichuan; March, Michael; Pellegrino, Renata; Golhar, Ryan; Corton, Marta; Blanco-Kelly, Fiona; López-Molina, Maria Isabel; García-Sandoval, Blanca; Guo, Yiran; Tian, Lifeng; Liu, Xuanzhu; Guan, Liping; Zhang, Jianguo; Keating, Brendan; Xu, Xun

    2015-01-01

    This study aimed to identify the genetics underlying dominant forms of inherited retinal dystrophies using whole exome sequencing (WES) in six families extensively screened for known mutations or genes. Thirty-eight individuals were subjected to WES. Causative variants were searched among single nucleotide variants (SNVs) and insertion/deletion variants (indels) and whenever no potential candidate emerged, copy number variant (CNV) analysis was performed. Variants or regions harboring a candidate variant were prioritized and segregation of the variant with the disease was further assessed using Sanger sequencing in case of SNVs and indels, and quantitative PCR (qPCR) for CNVs. SNV and indel analysis led to the identification of a previously reported mutation in PRPH2. Two additional mutations linked to different forms of retinal dystrophies were identified in two families: a known frameshift deletion in RPGR, a gene responsible for X-linked retinitis pigmentosa and p.Ser163Arg in C1QTNF5 associated with Late-Onset Retinal Degeneration. A novel heterozygous deletion spanning the entire region of PRPF31 was also identified in the affected members of a fourth family, which was confirmed with qPCR. This study allowed the identification of the genetic cause of the retinal dystrophy and the establishment of a correct diagnosis in four families, including a large heterozygous deletion in PRPF31, typically considered one of the pitfalls of this method. Since all findings in this study are restricted to known genes, we propose that targeted sequencing using gene-panel is an optimal first approach for the genetic screening and that once known genetic causes are ruled out, WES might be used to uncover new genes involved in inherited retinal dystrophies. PMID:26197217

  18. Blazar Sequence in Fermi Era Liang Chen

    Indian Academy of Sciences (India)

    Abstract. In this paper, we review the latest research results on the topic of blazar sequence. It seems that the blazar sequence is phenomenally ruled out, while the theoretical blazar sequence still holds. We point out that black hole mass is a dominated parameter accounting for high-power- high-synchrotron-peaked and ...

  19. Improved protection system for phase faults on marine vessels based on ratio between negative sequence and positive sequence of the fault current

    DEFF Research Database (Denmark)

    Ciontea, Catalin-Iosif; Hong, Qiteng; Booth, Campbell

    2018-01-01

    algorithm is implemented in a programmable digital relay embedded in a hardware-in-the-loop (HIL) test set-up that emulates a typical maritime feeder using a real-time digital simulator. The HIL set-up allows testing of the new protection method under a wide range of faults and network conditions......This study presents a new method to protect the radial feeders on marine vessels. The proposed protection method is effective against phase–phase (PP) faults and is based on evaluation of the ratio between the negative sequence and positive sequence of the fault currents. It is shown...... that the magnitude of the introduced ratio increases significantly during the PP fault, hence indicating the fault presence in an electric network. Here, the theoretical background of the new method of protection is firstly discussed, based on which the new protection algorithm is described afterwards. The proposed...

  20. Motif finding in DNA sequences based on skipping nonconserved positions in background Markov chains.

    Science.gov (United States)

    Zhao, Xiaoyan; Sze, Sing-Hoi

    2011-05-01

    One strategy to identify transcription factor binding sites is through motif finding in upstream DNA sequences of potentially co-regulated genes. Despite extensive efforts, none of the existing algorithms perform very well. We consider a string representation that allows arbitrary ignored positions within the nonconserved portion of single motifs, and use O(2(l)) Markov chains to model the background distributions of motifs of length l while skipping these positions within each Markov chain. By focusing initially on positions that have fixed nucleotides to define core occurrences, we develop an algorithm to identify motifs of moderate lengths. We compare the performance of our algorithm to other motif finding algorithms on a few benchmark data sets, and show that significant improvement in accuracy can be obtained when the sites are sufficiently conserved within a given sample, while comparable performance is obtained when the site conservation rate is low. A software program (PosMotif ) and detailed results are available online at http://faculty.cse.tamu.edu/shsze/posmotif.

  1. Dominant missense mutations in ABCC9 cause Cantu syndrome

    NARCIS (Netherlands)

    Harakalova, M.; van Harssel, J.J.; Terhal, P.A.; van Lieshout, S.; Duran, K.; Renkens, I.; Amor, D.J.; Wilson, L.C.; Kirk, E.P.; Turner, C.L.; Shears, D.; Garcia-Minaur, S.; Lees, M.M.; Ross, A.; Venselaar, H.; Vriend, G.; Takanari, H.; Rook, M.B.; van der Heyden, M.A.; Asselbergs, F.W.; Breur, H.M.; Swinkels, M.E.; Scurr, I.J.; Smithson, S.F.; Knoers, N.V.; van der Smagt, J.J.; Nijman, I.J.; Kloosterman, W.P.; van Haelst, M.M.; van Haaften, G.; Cuppen, E.

    2012-01-01

    Cantu syndrome is characterized by congenital hypertrichosis, distinctive facial features, osteochondrodysplasia and cardiac defects. By using family-based exome sequencing, we identified a de novo mutation in ABCC9. Subsequently, we discovered novel dominant missense mutations in ABCC9 in 14 of the

  2. Dominant missense mutations in ABCC9 cause Cantu syndrome.

    NARCIS (Netherlands)

    Harakalova, M.; Harssel, J.J. van; Terhal, P.A.; Lieshout, S. van; Duran, K.; Renkens, I.; Amor, D.J.; Wilson, L.C.; Kirk, E.P.; Turner, C.L.; Shears, D.; Garcia-Minaur, S.; Lees, M.M.; Ross, A.; Venselaar, H.; Vriend, G.; Takanari, H.; Rook, M.B.; Heyden, M.A. van der; Asselbergs, F.W.; Breur, H.M.; Swinkels, M.E.; Scurr, I.J.; Smithson, S.F.; Knoers, N.V.A.M.; Smagt, J.J. van der; Nijman, IJ; Kloosterman, W.P.; Haelst, M.M. van; Haaften, G. van; Cuppen, E.

    2012-01-01

    Cantu syndrome is characterized by congenital hypertrichosis, distinctive facial features, osteochondrodysplasia and cardiac defects. By using family-based exome sequencing, we identified a de novo mutation in ABCC9. Subsequently, we discovered novel dominant missense mutations in ABCC9 in 14 of the

  3. Complete genome sequence of Paenibacillus riograndensis SBR5(T), a Gram-positive diazotrophic rhizobacterium.

    Science.gov (United States)

    Brito, Luciana Fernandes; Bach, Evelise; Kalinowski, Jörn; Rückert, Christian; Wibberg, Daniel; Passaglia, Luciane M; Wendisch, Volker F

    2015-08-10

    Paenibacillus riograndensis is a Gram-positive rhizobacterium which exhibits plant growth promoting activities. It was isolated from the rhizosphere of wheat grown in the state of Rio Grande do Sul, Brazil. Here we announce the complete genome sequence of P. riograndensis strain SBR5(T). The genome of P. riograndensis SBR5(T) consists of a circular chromosome of 7,893,056bps. The genome was finished and fully annotated, containing 6705 protein coding genes, 87 tRNAs and 27 rRNAs. The knowledge of the complete genome helped to explain why P. riograndensis SBR5(T) can grow with the carbon sources arabinose and mannitol, but not myo-inositol, and to explain physiological features such as biotin auxotrophy and antibiotic resistances. The genome sequence will be valuable for functional genomics and ecological studies as well as for application of P. riograndensis SBR5(T) as plant growth-promoting rhizobacterium. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Design and Evaluation of a Protection Relay for a Wind Generator Based on the Positive- and Negative-Sequence Fault Components

    DEFF Research Database (Denmark)

    Zheng, T. Y.; Cha, Seung-Tae; Crossley, P. A.

    2013-01-01

    To avoid undesirable disconnection of healthy wind generators (WGs) or a wind power plant, a WG protection relay should discriminate among faults, so that it can operate instantaneously for WG, connected feeder or connection bus faults, it can operate after a delay for inter-tie or grid faults......, and it can avoid operating for parallel WG or adjacent feeder faults. A WG protection relay based on the positive- and negativesequence fault components is proposed in the paper. At stage 1, the proposed relay uses the magnitude of the positive-sequence component in the fault current to distinguish faults...... at a parallel WG connected to the same feeder or at an adjacent feeder, from other faults at a connected feeder, an inter-tie, or a grid. At stage 2, the fault type is first determined using the relationships between the positive- and negative-sequence fault components. Then, the relay differentiates between...

  5. A novel frameshift mutation in CX46 associated with hereditary dominant cataracts in a Chinese family

    Directory of Open Access Journals (Sweden)

    Xiu-Kun Cui

    2017-05-01

    Full Text Available AIM: To investigate the genetic mutations that are associated the hereditary autosomal dominant cataract in a Chinese family. METHODS: A Chinese family consisting of 20 cataract patients (including 9 male and 11 female and 2 unaffected individuals from 5 generations were diagnosed to be a typical autosomal dominant cataract pedigree. Genomic DNA samples were extracted from the peripheral blood cells of the participants in this pedigree. Exon sequence was used for genetic mutation screening. In silico analysis was used to study the structure characteristics of connexin 46 (CX46 mutant. Immunoblotting was conduceted for testing the expression of CX46. RESULTS: To determine the involved genetic mutations, 11 well-known cataract-associated genes (cryaa, cryab, crybb1, crybb2, crygc, crygd, Gja3, Gja8, Hsf4, Mip and Pitx3 were chosen for genetic mutation test by using exon sequencing. A novel cytosine insertion at position 1195 of CX46 cDNA (c.1194_1195ins C was found in the samples of 5 tested cataract patients but not in the unaffected 2 individuals nor in normal controls, which resulted in 30 amino acids more extension in CX46C-terminus (cx46fs400 compared with the wild-type CX46. In silico protein structure analysis indicated that the mutant showed distinctive hydrophobicity and protein secondary structure compared with the wild-type CX46. The immunoblot results revealed that CX46 protein, which expressed in the aging cataract lens tissues, was absence in the proband lens. In contrast, CX50, alpha A-crystallin and alphaB-crystallin expressed equally in both proband and aging cataract tissues. Those results revealed that the cx46fs400 mutation could impair CX46 protein expression. CONCLUSION: The insertion of cytosine at position 1195 of CX46 cDNA is a novel mutation site that is associated with the autosomal dominant cataracts in this Chinese family. The C-terminal frameshift mutation is involved in regulating CX46 protein expression.

  6. Do axes of rotation change during fast and slow motions of the dominant and non-dominate arms?

    Directory of Open Access Journals (Sweden)

    Pagano Christopher

    2011-12-01

    Full Text Available The velocity-dependent change in rotational axes observed in the control of unconstrained 3D arm rotations for the dominant limb seems to conform to a minimum inertia resistance (MIR principle [4]. This is an efficient biomechanical solution that allows for the reduction of torques. We tested whether the MIR principle governs rotating movement when subjects were instructed to maintain the shoulder-elbow joint axis close to horizontal for both dominant and non dominant limbs. Subjects (n=12 performed externalinternal rotations of their arms in two angular positions (90° versus 150°, two angular velocities (slow (S versus fast (F, and in two sensory conditions (kinaesthetic (K versus visuo- kinaesthetic (VK. We expected more scattered displacements of the rotation axis employed for rotating the non dominant limb compared to the dominant limb. The results showed that the rotational axis of a multiarticulated limb coincided with SH-EL at S & F velocity for both arms.

  7. Type III Bartter-like syndrome in an infant boy with Gitelman syndrome and autosomal dominant familial neurohypophyseal diabetes insipidus.

    Science.gov (United States)

    Brugnara, Milena; Gaudino, Rossella; Tedeschi, Silvana; Syrèn, Marie-Louise; Perrotta, Silverio; Maines, Evelina; Zaffanello, Marco

    2014-09-01

    We report the case of an infant boy with polyuria and a familial history of central diabetes insipidus. Laboratory blood tests disclosed hypokalemia, metabolic alkalosis, hyperreninemia, and hyperaldosteronism. Plasma magnesium concentration was slightly low. Urine analysis showed hypercalciuria, hyposthenuria, and high excretion of potassium. Such findings oriented toward type III Bartter syndrome (BSIII). Direct sequencing of the CLCNKB gene revealed no disease-causing mutations. The water deprivation test was positive. Magnetic resonance imaging showed a lack of posterior pituitary hyperintensity. Finally, direct sequencing of the AVP-NPII gene showed a point mutation (c.1884G>A) in a heterozygous state, confirming an autosomal dominant familial neurohypophyseal diabetes insipidus (adFNDI). This condition did not explain the patient's phenotype; thus, we investigated for Gitelman syndrome (GS). A direct sequencing of the SLC12A3 gene showed c.269A>C and c.1205C>A new mutations. In conclusion, the patient had a genetic combination of GS and adFNDI with a BSIII-like phenotype.

  8. Highly dominating, highly authoritarian personalities.

    Science.gov (United States)

    Altemeyer, Bob

    2004-08-01

    The author considered the small part of the population whose members score highly on both the Social Dominance Orientation scale and the Right-Wing Authoritarianism scale. Studies of these High SDO-High RWAs, culled from samples of nearly 4000 Canadian university students and over 2600 of their parents and reported in the present article, reveal that these dominating authoritarians are among the most prejudiced persons in society. Furthermore, they seem to combine the worst elements of each kind of personality, being power-hungry, unsupportive of equality, manipulative, and amoral, as social dominators are in general, while also being religiously ethnocentric and dogmatic, as right-wing authoritarians tend to be. The author suggested that, although they are small in number, such persons can have considerable impact on society because they are well-positioned to become the leaders of prejudiced right-wing political movements.

  9. Proximal dominant hereditary motor and sensory neuropathy with proximal dominance association with mutation in the TRK-fused gene.

    Science.gov (United States)

    Lee, Sang-Soo; Lee, Hye Jin; Park, Jin-Mo; Hong, Young Bin; Park, Kee-Duk; Yoo, Jeong Hyun; Koo, Heasoo; Jung, Sung-Chul; Park, Hyung Soon; Lee, Ji Hyun; Lee, Min Goo; Hyun, Young Se; Nakhro, Khriezhanou; Chung, Ki Wha; Choi, Byung-Ok

    2013-05-01

    Hereditary motor and sensory neuropathy with proximal dominance (HMSN-P) has been reported as a rare type of autosomal dominant adult-onset Charcot-Marie-Tooth disease. HMSN-P has been described only in Japanese descendants since 1997, and the causative gene has not been found. To identify the genetic cause of HMSN-P in a Korean family and determine the pathogenic mechanism. Genetic and observational analysis. Translational research center for rare neurologic disease. Twenty-eight individuals (12 men and 16 women) from a Korean family with HMSN-P. Whole-exome sequencing, linkage analysis, and magnetic resonance imaging. Through whole-exome sequencing, we revealed that HMSN-P is caused by a mutation in the TRK-fused gene (TFG). Clinical heterogeneities were revealed in HMSN-P between Korean and Japanese patients. The patients in the present report showed faster progression of the disease compared with the Japanese patients, and sensory nerve action potentials of the sural nerve were lost in the early stages of the disease. Moreover, tremor and hyperlipidemia were frequently found. Magnetic resonance imaging of the lower extremity revealed a distinct proximal dominant and sequential pattern of muscular involvement with a clearly different pattern than patients with Charcot-Marie-Tooth disease type 1A. Particularly, endoneural blood vessels revealed marked narrowing of the lumen with swollen vesicular endothelial cells. The underlying cause of HMSN-P proves to be a mutation in TFG that lies on chromosome 3q13.2. This disease is not limited to Japanese descendants, and marked narrowing of endoneural blood vessels was noted in the present study. We believe that TFG can affect the peripheral nerve tissue.

  10. Identification and positional distribution analysis of transcription factor binding sites for genes from the wheat fl-cDNA sequences.

    Science.gov (United States)

    Chen, Zhen-Yong; Guo, Xiao-Jiang; Chen, Zhong-Xu; Chen, Wei-Ying; Wang, Ji-Rui

    2017-06-01

    The binding sites of transcription factors (TFs) in upstream DNA regions are called transcription factor binding sites (TFBSs). TFBSs are important elements for regulating gene expression. To date, there have been few studies on the profiles of TFBSs in plants. In total, 4,873 sequences with 5' upstream regions from 8530 wheat fl-cDNA sequences were used to predict TFBSs. We found 4572 TFBSs for the MADS TF family, which was twice as many as for bHLH (1951), B3 (1951), HB superfamily (1914), ERF (1820), and AP2/ERF (1725) TFs, and was approximately four times higher than the remaining TFBS types. The percentage of TFBSs and TF members showed a distinct distribution in different tissues. Overall, the distribution of TFBSs in the upstream regions of wheat fl-cDNA sequences had significant difference. Meanwhile, high frequencies of some types of TFBSs were found in specific regions in the upstream sequences. Both TFs and fl-cDNA with TFBSs predicted in the same tissues exhibited specific distribution preferences for regulating gene expression. The tissue-specific analysis of TFs and fl-cDNA with TFBSs provides useful information for functional research, and can be used to identify relationships between tissue-specific TFs and fl-cDNA with TFBSs. Moreover, the positional distribution of TFBSs indicates that some types of wheat TFBS have different positional distribution preferences in the upstream regions of genes.

  11. Finding positives after disaster: Insights from nurses following the 2010-2011 Canterbury, NZ earthquake sequence.

    Science.gov (United States)

    Johal, Sarbjit S; Mounsey, Zoe R

    2015-11-01

    This paper identifies positive aspects of nurse experiences during the Canterbury 2010-2011 earthquake sequence and subsequent recovery process. Qualitative semi-structured interviews were undertaken with 11 nurses from the Christchurch area to explore the challenges faced by the nurses during and following the earthquakes. The interviews took place three years after the start of the earthquake experience to enable exploration of the longer term recovery process. The interview transcripts were analysed and coded using a grounded theory approach. The data analysis identified that despite the many challenges faced by the nurses during and following the earthquakes they were able to identify positives from their experience. A number of themes were identified that are related to posttraumatic growth, including; improvement in relationships with others, change in perspective/values, changed views of self and acknowledgement of the value of the experience. The research indicates that nurses were able to identify positive aspects of their experiences of the earthquakes and recovery process, suggesting that both positive and negative impacts on wellbeing can co-exist. These insights have value for employers designing support processes following disasters as focusing on positive elements could enhance nurse wellbeing during stressful times. Copyright © 2015 College of Emergency Nursing Australasia Ltd. Published by Elsevier Ltd. All rights reserved.

  12. Categorization of PWR accident sequences and guidelines for fault trees: seismic initiators

    International Nuclear Information System (INIS)

    Kimura, C.Y.

    1984-09-01

    This study developed a set of dominant accident sequences that could be applied generically to domestic commercial PWRs as a standardized basis for a probabilistic seismic risk assessment. This was accomplished by ranking the Zion 1 accident sequences. The pertinent PWR safety systems were compared on a plant-by-plant basis to determine the applicability of the dominant accident sequences of Zion 1 to other PWR plants. The functional event trees were developed to describe the system functions that must work or not work in order for a certain accident sequence to happen, one for pipe breaks and one for transients

  13. Different Vocal Parameters Predict Perceptions of Dominance and Attractiveness

    OpenAIRE

    Hodges-Simeon, Carolyn R.; Gaulin, Steven J. C.; Puts, David A.

    2010-01-01

    Low mean fundamental frequency (F 0) in men’s voices has been found to positively influence perceptions of dominance by men and attractiveness by women using standardized speech. Using natural speech obtained during an ecologically valid social interaction, we examined relationships between multiple vocal parameters and dominance and attractiveness judgments. Male voices from an unscripted dating game were judged by men for physical and social dominance and by women in fert...

  14. Evaluation of Dixon Sequence on Hybrid PET/MR Compared with Contrast-Enhanced PET/CT for PET-Positive Lesions

    International Nuclear Information System (INIS)

    Jeong, Ju Hye; Cho, Ihn Ho; Kong, Eun Jung; Chun, Kyung Ah

    2014-01-01

    Hybrid positron emission tomography and magnetic resonance (PET/MR) imaging performs a two-point Dixon MR sequence for attenuation correction. However, MR data in hybrid PET/MR should provide anatomic and morphologic information as well as an attenuation map. We evaluated the Dixon sequence of hybrid PET/MR for anatomic correlation of PET-positive lesions compared with contrast-enhanced PET/computed tomography (CT) in patients with oncologic diseases. Twelve patients underwent a single injection, dual imaging protocol. PET/CT was performed with an intravenous contrast agent (85±13 min after 18 F-FDG injection of 403± 45 MBq) and then (125±19 min after injection) PET/MR was performed. Attenuation correction and anatomic allocation of PET were performed using contrast-enhanced CT for PET/CT and Dixon MR sequence for hybrid PET/MR. The Dixon MR sequence and contrast-enhanced CT were compared for anatomic correlation of PET-positive lesions (scoring scale ranging from 0 to 3 for visual ratings). Additionally, standardized uptake values (SUVs) for the detected lesions were assessed for quantitative comparison. Both hybrid PET/MR and contrast-enhanced PET/CT identified 55 lesions with increased FDG uptake in ten patients. In total, 28 lymph nodes, 11 bone lesions, 3 dermal nodules, 3 pleural thickening lesions, 2 thyroid nodules, 1 pancreas, 1 liver, 1 ovary, 1 uterus, 1 breast, 1 soft tissue and 2 lung lesions were present. The best performance was observed for anatomic correlation of PET findings by the contrast-enhanced CT scans (contrast-enhanced CT, 2.64± 0.70; in-phase, 1.29±1.01; opposed-phase, 1.29±1.15; water-weighted, 1.71±1.07; fat weighted, 0.56±1.03). A significant difference was observed between the scores obtained from the contrast-enhanced CT and all four coregistered Dixon MR images. Quantitative evaluation revealed a high correlation between the SUVs measured with hybrid PET/MR (SUVmean, 2.63±1.62; SUVmax, 4.30±2.88) and contrast-enhanced PET

  15. Evaluation of Dixon Sequence on Hybrid PET/MR Compared with Contrast-Enhanced PET/CT for PET-Positive Lesions

    Energy Technology Data Exchange (ETDEWEB)

    Jeong, Ju Hye; Cho, Ihn Ho; Kong, Eun Jung; Chun, Kyung Ah [Yeungnam Univ. Hospital, Daegu (Korea, Republic of)

    2014-03-15

    Hybrid positron emission tomography and magnetic resonance (PET/MR) imaging performs a two-point Dixon MR sequence for attenuation correction. However, MR data in hybrid PET/MR should provide anatomic and morphologic information as well as an attenuation map. We evaluated the Dixon sequence of hybrid PET/MR for anatomic correlation of PET-positive lesions compared with contrast-enhanced PET/computed tomography (CT) in patients with oncologic diseases. Twelve patients underwent a single injection, dual imaging protocol. PET/CT was performed with an intravenous contrast agent (85±13 min after {sup 18}F-FDG injection of 403± 45 MBq) and then (125±19 min after injection) PET/MR was performed. Attenuation correction and anatomic allocation of PET were performed using contrast-enhanced CT for PET/CT and Dixon MR sequence for hybrid PET/MR. The Dixon MR sequence and contrast-enhanced CT were compared for anatomic correlation of PET-positive lesions (scoring scale ranging from 0 to 3 for visual ratings). Additionally, standardized uptake values (SUVs) for the detected lesions were assessed for quantitative comparison. Both hybrid PET/MR and contrast-enhanced PET/CT identified 55 lesions with increased FDG uptake in ten patients. In total, 28 lymph nodes, 11 bone lesions, 3 dermal nodules, 3 pleural thickening lesions, 2 thyroid nodules, 1 pancreas, 1 liver, 1 ovary, 1 uterus, 1 breast, 1 soft tissue and 2 lung lesions were present. The best performance was observed for anatomic correlation of PET findings by the contrast-enhanced CT scans (contrast-enhanced CT, 2.64± 0.70; in-phase, 1.29±1.01; opposed-phase, 1.29±1.15; water-weighted, 1.71±1.07; fat weighted, 0.56±1.03). A significant difference was observed between the scores obtained from the contrast-enhanced CT and all four coregistered Dixon MR images. Quantitative evaluation revealed a high correlation between the SUVs measured with hybrid PET/MR (SUVmean, 2.63±1.62; SUVmax, 4.30±2.88) and contrast

  16. AUTOMATIC DOMINANCE DETECTION IN DYADIC CONVERSATIONS (Detección automática de la dominancia en conversaciones diádicas

    Directory of Open Access Journals (Sweden)

    Sergio Escalera

    2010-04-01

    Full Text Available Dominance is referred to the level of influence that a person has in a conversation. Dominance is an important research area in social psychology, but the problem of its automatic estimation is a very recent topic in the contexts of social and wearable computing. In this paper, we focus on the dominance detection of visual cues. We estimate the correla¬tion among observers by categorizing the dominant people in a set of face-to-face conversations. Different dominance indicators from gestural communication are defined, manually annotated, and compared to the observers’ opinion. Moreover, these indicators are automatically extracted from video sequences and learnt by using binary classifiers. Results from the three analyses showed a high correlation and allows the categorization of dominant people in public discussion video sequences.

  17. Phylogenetic position of the North American isolate of Pasteuria that parasitizes the soybean cyst nematode, Heterodera glycines, as inferred from 16S rDNA sequence analysis.

    Science.gov (United States)

    Atibalentja, N; Noel, G R; Domier, L L

    2000-03-01

    A 1341 bp sequence of the 16S rDNA of an undescribed species of Pasteuria that parasitizes the soybean cyst nematode, Heterodera glycines, was determined and then compared with a homologous sequence of Pasteuria ramosa, a parasite of cladoceran water fleas of the family Daphnidae. The two Pasteuria sequences, which diverged from each other by a dissimilarity index of 7%, also were compared with the 16S rDNA sequences of 30 other bacterial species to determine the phylogenetic position of the genus Pasteuria among the Gram-positive eubacteria. Phylogenetic analyses using maximum-likelihood, maximum-parsimony and neighbour-joining methods showed that the Heterodera glycines-infecting Pasteuria and its sister species, P. ramosa, form a distinct line of descent within the Alicyclobacillus group of the Bacillaceae. These results are consistent with the view that the genus Pasteuria is a deeply rooted member of the Clostridium-Bacillus-Streptococcus branch of the Gram-positive eubacteria, neither related to the actinomycetes nor closely related to true endospore-forming bacteria.

  18. The clinical application of genome-wide sequencing for monogenic diseases in Canada: Position Statement of the Canadian College of Medical Geneticists

    OpenAIRE

    Boycott, Kym; Hartley, Taila; Adam, Shelin; Bernier, Francois; Chong, Karen; Fernandez, Bridget A; Friedman, Jan M; Geraghty, Michael T; Hume, Stacey; Knoppers, Bartha M; Laberge, Anne-Marie; Majewski, Jacek; Mendoza-Londono, Roberto; Meyn, M Stephen; Michaud, Jacques L

    2015-01-01

    Purpose and scope The aim of this Position Statement is to provide recommendations for Canadian medical geneticists, clinical laboratory geneticists, genetic counsellors and other physicians regarding the use of genome-wide sequencing of germline DNA in the context of clinical genetic diagnosis. This statement has been developed to facilitate the clinical translation and development of best practices for clinical genome-wide sequencing for genetic diagnosis of monogenic diseases in Canada; it...

  19. Development of dominant sequence characterized amplified region (SCAR marker linked with plume moth (Exelastis atomosa Walsingham 1886 resistance in pigeon-pea

    Directory of Open Access Journals (Sweden)

    Ramya R Mishra

    2015-12-01

    Full Text Available The mode of gene action governing resistance to plume moth (Exelastis atomosa Walsingham 1886 derived from pigeon-pea (Cajanus scarabaeoides (L. Thouars accession ICPW-94 has been determined and the resistance alleles have been designated as PPM1. The progenies of F2 population and F3 families derived from an interspecific cross C. cajan (L. Huth ('ICP-26' x C. scarabaeoides (accession ICPW-94 revealed monogenic gene action for resistance to plume moth, and the dominant control by single locus or cluster of tightly linked alleles. Bulked segregant analysis (BSA of 116 F2 progenies by using 143 parental polymorphic RAPD primers could identify a fragment OPA09(910 associated with plume moth resistance in coupling phase of linkage. Further single plant analysis of the 116 F2 mapping population revealed OPA09(910 was linked to PPMi locus conferring host resistance to plume moth with recombination fraction (rf value of 0.125 (12.7 cM of Kosambi function. The resistance specific fragment OPA09(910 was cloned, sequenced and converted into a sequence characterized amplified region (SCAR marker, SCOPA09(942, which was also closely associated (10.3 cM with the locus PPMl with rf value 0.102. BLAST analysis with pigeon-pea genome sequence also confirmed its occurrence in CcLG02 (Scafseq.LG_V5.0fa and contig 01597 (AFSP01.fsa1. This SCAR marker showed reasonable screening efficiency in the F2, F3, and BC1F1 lines, thus it can be used as genetic handle in marker-assisted introgression of the genomic fragment conferring plume moth resistance and screening of breeding lines in pigeon-pea.

  20. Close Link Between Harmful Cyanobacterial Dominance and Associated Bacterioplankton in a Tropical Eutrophic Reservoir

    Directory of Open Access Journals (Sweden)

    Iame A. Guedes

    2018-03-01

    Full Text Available Cyanobacteria tend to become the dominant phytoplankton component in eutrophic freshwater environments during warmer seasons. However, general observations of cyanobacterial adaptive advantages in these circumstances are insufficient to explain the prevalence of one species over another in a bloom period, which may be related to particular strategies and interactions with other components of the plankton community. In this study, we present an integrative view of a mixed cyanobacterial bloom occurring during a warm, rainy period in a tropical hydropower reservoir. We used high-throughput sequencing to follow temporal shifts in the dominance of cyanobacterial genera and shifts in the associated heterotrophic bacteria community. The bloom occurred during late spring-summer and included two distinct periods. The first period corresponded to Microcystis aeruginosa complex (MAC dominance with a contribution from Dolichospermum circinale; this pattern coincided with high water retention time and low transparency. The second period corresponded to Cylindrospermopsis raciborskii and Synechococcus spp. dominance, and the reservoir presented lower water retention time and higher water transparency. The major bacterial phyla were primarily Cyanobacteria and Proteobacteria, followed by Actinobacteria, Bacteroidetes, Verrucomicrobia, and Planctomycetes. Temporal shifts in the dominance of cyanobacterial genera were not only associated with physical features of the water but also with shifts in the associated heterotrophic bacteria. The MAC bloom was associated with a high abundance of Bacteroidetes, particularly Cytophagales. In the second bloom period, Planctomycetes increased in relative abundance, five Planctomycetes OTUs were positively correlated with Synechococcus or C. raciborskii OTUs. Our results suggest specific interactions of the main cyanobacterial genera with certain groups of the heterotrophic bacterial community. Thus, considering biotic

  1. Combinatorial events of insertion sequences and ICE in Gram-negative bacteria.

    Science.gov (United States)

    Toleman, Mark A; Walsh, Timothy R

    2011-09-01

    The emergence of antibiotic and antimicrobial resistance in Gram-negative bacteria is incremental and linked to genetic elements that function in a so-called 'one-ended transposition' manner, including ISEcp1, ISCR elements and Tn3-like transposons. The power of these elements lies in their inability to consistently recognize one of their own terminal sequences, while recognizing more genetically distant surrogate sequences. This has the effect of mobilizing the DNA sequence found adjacent to their initial location. In general, resistance in Gram-negatives is closely linked to a few one-off events. These include the capture of the class 1 integron by a Tn5090-like transposon; the formation of the 3' conserved segment (3'-CS); and the fusion of the ISCR1 element to the 3'-CS. The structures formed by these rare events have been massively amplified and disseminated in Gram-negative bacteria, but hitherto, are rarely found in Gram-positives. Such events dominate current resistance gene acquisition and are instrumental in the construction of large resistance gene islands on chromosomes and plasmids. Similar combinatorial events appear to have occurred between conjugative plasmids and phages constructing hybrid elements called integrative and conjugative elements or conjugative transposons. These elements are beginning to be closely linked to some of the more powerful resistance mechanisms such as the extended spectrum β-lactamases, metallo- and AmpC type β-lactamases. Antibiotic resistance in Gram-negative bacteria is dominated by unusual combinatorial mistakes of Insertion sequences and gene fusions which have been selected and amplified by antibiotic pressure enabling the formation of extended resistance islands. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  2. Positive selection in octopus haemocyanin indicates functional links to temperature adaptation.

    Science.gov (United States)

    Oellermann, Michael; Strugnell, Jan M; Lieb, Bernhard; Mark, Felix C

    2015-07-05

    Octopods have successfully colonised the world's oceans from the tropics to the poles. Yet, successful persistence in these habitats has required adaptations of their advanced physiological apparatus to compensate impaired oxygen supply. Their oxygen transporter haemocyanin plays a major role in cold tolerance and accordingly has undergone functional modifications to sustain oxygen release at sub-zero temperatures. However, it remains unknown how molecular properties evolved to explain the observed functional adaptations. We thus aimed to assess whether natural selection affected molecular and structural properties of haemocyanin that explains temperature adaptation in octopods. Analysis of 239 partial sequences of the haemocyanin functional units (FU) f and g of 28 octopod species of polar, temperate, subtropical and tropical origin revealed natural selection was acting primarily on charge properties of surface residues. Polar octopods contained haemocyanins with higher net surface charge due to decreased glutamic acid content and higher numbers of basic amino acids. Within the analysed partial sequences, positive selection was present at site 2545, positioned between the active copper binding centre and the FU g surface. At this site, methionine was the dominant amino acid in polar octopods and leucine was dominant in tropical octopods. Sites directly involved in oxygen binding or quaternary interactions were highly conserved within the analysed sequence. This study has provided the first insight into molecular and structural mechanisms that have enabled octopods to sustain oxygen supply from polar to tropical conditions. Our findings imply modulation of oxygen binding via charge-charge interaction at the protein surface, which stabilize quaternary interactions among functional units to reduce detrimental effects of high pH on venous oxygen release. Of the observed partial haemocyanin sequence, residue 2545 formed a close link between the FU g surface and the

  3. Handedness results from Complementary Hemispheric Dominance, not Global Hemispheric Dominance: Evidence from Mechanically Coupled Bilateral Movements.

    Science.gov (United States)

    Woytowicz, Elizabeth J; Westlake, Kelly P; Whitall, Jill; Sainburg, Robert L

    2018-05-09

    Two contrasting views of handedness can be described as 1) complementary dominance, in which each hemisphere is specialized for different aspects of motor control, and 2) global dominance, in which the hemisphere contralateral to the dominant arm is specialized for all aspects of motor control. The present study sought to determine which motor lateralization hypothesis best predicts motor performance during common bilateral task of stabilizing an object (e.g. bread) with one hand while applying forces to the object (e.g. slicing) using the other hand. We designed an experimental equivalent of this task, performed in a virtual environment with the unseen arms supported by frictionless air-sleds. The hands were connected by a spring, and the task was to maintain the position of one hand, while moving the other hand to a target. Thus, the reaching hand was required to take account of the spring load to make smooth and accurate trajectories, while the stabilizer hand was required to impede the spring load to keep a constant position. Right-handed subjects performed two task sessions (right hand reach and left hand stabilize; left hand reach and right hand stabilize) with the order of the sessions counterbalanced between groups. Our results indicate a hand by task-component interaction, such that the right hand showed straighter reaching performance while the left showed more stable holding performance. These findings provide support for the complementary dominance hypothesis and suggest that the specializations of each cerebral hemisphere for impedance and dynamic control mechanisms are expressed during bilateral interactive tasks.

  4. Asymmetry of magnetic motor evoked potentials recorded in calf muscles of the dominant and non-dominant lower extremity.

    Science.gov (United States)

    Olex-Zarychta, Dorota; Koprowski, Robert; Sobota, Grzegorz; Wróbel, Zygmunt

    2009-08-07

    The aim of the study was to determine the applicability of magnetic stimulation and magnetic motor evoked potentials (MEPs) in motor asymmetry studies by obtaining quantitative and qualitative measures of efferent activity during low intensity magnetic stimulation of the dominant and non-dominant lower extremities. Magnetic stimulation of the tibial nerve in the popliteal fossa was performed in 10 healthy male right-handed and right-footed young adults. Responses were recorded from the lateral head of the gastrocnemius muscles of the right and left lower extremities. Response characteristics (duration, onset latency, amplitude) were analyzed in relation to the functional dominance of the limbs and in relation to the direction of the current in the magnetic coil by use of the Wilcoxon pair sequence test. The CCW direction of coil current was related to reduced amplitudes of recorded MEPs. Greater amplitudes of evoked potentials were recorded in the non-dominant extremity, both in the CW and CCW coil current directions, with the statistical significance of this effect (p=0.005). No differences in duration of response were found in the CW current direction, while in CCW the time of the left-side response was prolonged (p=0.01). In the non-dominant extremity longer onset latencies were recorded in both current directions, but only for the CW direction the side asymmetries showed a statistical significance of p=0.005. In the dominant extremity the stimulation correlated with stronger paresthesias, especially using the CCW direction of coil current. The results indicate that low intensity magnetic stimulation may be useful in quantitative and qualitative research into the motor asymmetry.

  5. Role of brain hemispheric dominance in anticipatory postural control strategies.

    Science.gov (United States)

    Cioncoloni, David; Rosignoli, Deborah; Feurra, Matteo; Rossi, Simone; Bonifazi, Marco; Rossi, Alessandro; Mazzocchio, Riccardo

    2016-07-01

    Most of the cerebral functions are asymmetrically represented in the two hemispheres. Moreover, dexterity and coordination of the distal segment of the dominant limbs depend on cortico-motor lateralization. In this study, we investigated whether postural control may be also considered a lateralized hemispheric brain function. To this aim, 15 young subjects were tested in standing position by measuring center of pressure (COP) shifts along the anteroposterior axis (COP-Y) during dynamic posturography before and after continuous Theta Burst Stimulation (cTBS) intervention applied to the dominant or non-dominant M1 hand area as well as to the vertex. We show that when subjects were expecting a forward platform translation, the COP-Y was positioned significantly backward or forward after dominant or non-dominant M1 stimulation, respectively. We postulate that cTBS applied on M1 may have disrupted the functional connectivity between intra- and interhemispheric areas implicated in the anticipatory control of postural stability. This study suggests a functional asymmetry between the two homologous primary motor areas, with the dominant hemisphere playing a critical role in the selection of the appropriate postural control strategy.

  6. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    Science.gov (United States)

    Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.

    2015-01-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

  7. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    Directory of Open Access Journals (Sweden)

    Nathan D. Olson

    2015-03-01

    Full Text Available This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1 identity of biologically conserved position, (2 ratio of 16S rRNA gene copies featuring identified variants, and (3 the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  8. Overview of BWR Severe Accident Sequence Analyses at Oak Ridge National Laboratory

    International Nuclear Information System (INIS)

    Hodge, S.A.

    1983-01-01

    Since its inception in October 1980, the Severe Accident Sequence Analysis (SASA) program at Oak Ridge National Laboratory (ORNL) has completed four studies including Station Blackout, Scram Discharge Volume Break, Loss of Decay Heat Removal, and Loss of Injection accident sequences for the Browns Ferry Nuclear Plant. The accident analyses incorporated in a SASA study provide much greater detail than that practically achievable in a Probabilistic Risk Assessment (PRA). When applied to the candidate dominant accident sequences identified by a PRA, the detailed SASA results determine if factors neglected by the PRA would have a significant effect on the order of dominant sequences. Ongoing SASA work at ORNL involves the analysis of Anticipated Transients Without Scram (ATWS) sequences for Browns Ferry

  9. Exome Sequence Analysis of 14 Families With High Myopia

    DEFF Research Database (Denmark)

    Kloss, Bethany A.; Tompson, Stuart W.; Whisenhunt, Kristina N.

    2017-01-01

    Purpose: To identify causal gene mutations in 14 families with autosomal dominant (AD) high myopia using exome sequencing. Methods: Select individuals from 14 large Caucasian families with high myopia were exome sequenced. Gene variants were filtered to identify potential pathogenic changes. Sang...

  10. Exome Sequencing Identifies a Missense Variant in EFEMP1 Co-Segregating in a Family with Autosomal Dominant Primary Open-Angle Glaucoma.

    Directory of Open Access Journals (Sweden)

    Donna S Mackay

    Full Text Available Primary open-angle glaucoma (POAG is a clinically important and genetically heterogeneous cause of progressive vision loss as a result of retinal ganglion cell death. Here we have utilized trio-based, whole-exome sequencing to identify the genetic defect underlying an autosomal dominant form of adult-onset POAG segregating in an African-American family. Exome sequencing identified a novel missense variant (c.418C>T, p.Arg140Trp in exon-5 of the gene coding for epidermal growth factor (EGF containing fibulin-like extracellular matrix protein 1 (EFEMP1 that co-segregated with disease in the family. Linkage and haplotype analyses with microsatellite markers indicated that the disease interval overlapped a known POAG locus (GLC1H on chromosome 2p. The p.Arg140Trp substitution was predicted in silico to have damaging effects on protein function and transient expression studies in cultured cells revealed that the Trp140-mutant protein exhibited increased intracellular accumulation compared with wild-type EFEMP1. In situ hybridization of the mouse eye with oligonucleotide probes detected the highest levels of EFEMP1 transcripts in the ciliary body, cornea, inner nuclear layer of the retina, and the optic nerve head. The recent finding that a common variant near EFEMP1 was associated with optic nerve-head morphology supports the possibility that the EFEMP1 variant identified in this POAG family may be pathogenic.

  11. Characterization of the immuno dominant regions within gp41 of env gene of HIV in Pakistan

    International Nuclear Information System (INIS)

    Nisar, L.; Qadir, M.I.; Nisa, T.; Malik, S.A.; Tabassum, N.

    2011-01-01

    Objective of the present study was to characterize the immuno dominant sequences of gp41 in HIV strain in Pakistani population so that vaccine may be prepared based upon these regions. A total of 25 specimens were collected from HIV patients of different areas of Pakistan. The viral RNA was isolated using QIAamp MinElute Spin Kit manufactured by Quiagen, California, USA. RT-PCR was done for amplification of the required region and confirmed by gel electrophoresis. The nucleotides of the required regions were sequenced using Big Dye terminator. Less than 20% of the specimens had mutations in immuno dominant regions, so it may be concluded that immuno dominant regions of gp41 in HIV strain in Pakistani population are conservatives and vaccine based upon these regions may prove active immunization against the disease. (author)

  12. Characterization of the immuno dominant regions within gp41 of env gene of HIV in Pakistan

    Energy Technology Data Exchange (ETDEWEB)

    Nisar, L; Qadir, M I; Nisa, T; Malik, S A; Tabassum, N

    2011-08-15

    Objective of the present study was to characterize the immuno dominant sequences of gp41 in HIV strain in Pakistani population so that vaccine may be prepared based upon these regions. A total of 25 specimens were collected from HIV patients of different areas of Pakistan. The viral RNA was isolated using QIAamp MinElute Spin Kit manufactured by Quiagen, California, USA. RT-PCR was done for amplification of the required region and confirmed by gel electrophoresis. The nucleotides of the required regions were sequenced using Big Dye terminator. Less than 20% of the specimens had mutations in immuno dominant regions, so it may be concluded that immuno dominant regions of gp41 in HIV strain in Pakistani population are conservatives and vaccine based upon these regions may prove active immunization against the disease. (author)

  13. On the Dominance of Attitude Emotionality.

    Science.gov (United States)

    Rocklage, Matthew D; Fazio, Russell H

    2016-02-01

    Many situations in our lives require us to make relatively quick decisions as whether to approach or avoid a person or object, buy or pass on a product, or accept or reject an offer. These decisions are particularly difficult when there are both positive and negative aspects to the object. How do people go about navigating this conflict to come to a summary judgment? Using the Evaluative Lexicon (EL), we demonstrate across three studies, 7,700 attitude expressions, and nearly 50 different attitude objects that when positivity and negativity conflict, the valence that is based more on emotion is more likely to dominate. Furthermore, individuals are also more consistent in the expression of their univalent summary judgments when they involve greater emotionality. In sum, valence that is based on emotion tends to dominate when resolving ambivalence and also helps individuals to remain consistent when offering quick judgments. © 2015 by the Society for Personality and Social Psychology, Inc.

  14. Whole-exome sequencing identifies USH2A mutations in a pseudo-dominant Usher syndrome family.

    Science.gov (United States)

    Zheng, Sui-Lian; Zhang, Hong-Liang; Lin, Zhen-Lang; Kang, Qian-Yan

    2015-10-01

    Usher syndrome (USH) is an autosomal recessive (AR) multi-sensory degenerative disorder leading to deaf-blindness. USH is clinically subdivided into three subclasses, and 10 genes have been identified thus far. Clinical and genetic heterogeneities in USH make a precise diagnosis difficult. A dominant‑like USH family in successive generations was identified, and the present study aimed to determine the genetic predisposition of this family. Whole‑exome sequencing was performed in two affected patients and an unaffected relative. Systematic data were analyzed by bioinformatic analysis to remove the candidate mutations via step‑wise filtering. Direct Sanger sequencing and co‑segregation analysis were performed in the pedigree. One novel and two known mutations in the USH2A gene were identified, and were further confirmed by direct sequencing and co‑segregation analysis. The affected mother carried compound mutations in the USH2A gene, while the unaffected father carried a heterozygous mutation. The present study demonstrates that whole‑exome sequencing is a robust approach for the molecular diagnosis of disorders with high levels of genetic heterogeneity.

  15. Autozygosity reveals recessive mutations and novel mechanisms in dominant genes: implications in variant interpretation

    KAUST Repository

    Monies, Dorota

    2017-04-06

    The purpose of this study is to describe recessive alleles in strictly dominant genes. Identifying recessive mutations in genes for which only dominant disease or risk alleles have been reported can expand our understanding of the medical relevance of these genes both phenotypically and mechanistically. The Saudi population is enriched for autozygosity, which enhances the homozygous occurrence of alleles, including pathogenic alleles in genes that have been associated only with a dominant inheritance pattern.Exome sequencing of patients from consanguineous families with likely recessive phenotypes was performed. In one family, the genotype of the deceased children was inferred from their parents due to lack of available samples.We describe the identification of 11 recessive variants (5 of which are reported here for the first time) in 11 genes for which only dominant disease or risk alleles have been reported. The observed phenotypes for these recessive variants were novel (e.g., FBN2-related myopathy and CSF1R-related brain malformation and osteopetrosis), typical (e.g., ACTG2-related visceral myopathy), or an apparently healthy state (e.g., PDE11A), consistent with the corresponding mouse knockout phenotypes.Our results show that, in the era of genomic sequencing and

  16. Autosomal-dominant Leber Congenital Amaurosis Caused by a Heterozygous CRX Mutation in a Father and Son.

    Science.gov (United States)

    Arcot Sadagopan, Karthikeyan; Battista, Robert; Keep, Rosanne B; Capasso, Jenina E; Levin, Alex V

    2015-06-01

    Leber congenital amaurosis (LCA) is most often an autosomal recessive disorder. We report a father and son with autosomal dominant LCA due to a mutation in the CRX gene. DNA screening using an allele specific assay of 90 of the most common LCA-causing variations in the coding sequences of AIPL1, CEP290, CRB1, CRX, GUCY2D, RDH12 and RPE65 was performed on the father. Automated DNA sequencing of his son examining exon 3 of the CRX gene was subsequently performed. Both father and son have a heterozygous single base pair deletion of an adenine at codon 153 in the coding sequence of the CRX gene resulting in a frameshift mutation. Mutations involving the CRX gene may demonstrate an autosomal dominant inheritance pattern for LCA.

  17. Divide and conquer: enriching environmental sequencing data.

    Directory of Open Access Journals (Sweden)

    Anne Bergeron

    2007-09-01

    Full Text Available In environmental sequencing projects, a mix of DNA from a whole microbial community is fragmented and sequenced, with one of the possible goals being to reconstruct partial or complete genomes of members of the community. In communities with high diversity of species, a significant proportion of the sequences do not overlap any other fragment in the sample. This problem will arise not only in situations with a relatively even distribution of many species, but also when the community in a particular environment is routinely dominated by the same few species. In the former case, no genomes may be assembled at all, while in the latter case a few dominant species in an environment will always be sequenced at high coverage to the detriment of coverage of the greater number of sparse species.Here we show that, with the same global sequencing effort, separating the species into two or more sub-communities prior to sequencing can yield a much higher proportion of sequences that can be assembled. We first use the Lander-Waterman model to show that, if the expected percentage of singleton sequences is higher than 25%, then, under the uniform distribution hypothesis, splitting the community is always a wise choice. We then construct simulated microbial communities to show that the results hold for highly non-uniform distributions. We also show that, for the distributions considered in the experiments, it is possible to estimate quite accurately the relative diversity of the two sub-communities.Given the fact that several methods exist to split microbial communities based on physical properties such as size, density, surface biochemistry, or optical properties, we strongly suggest that groups involved in environmental sequencing, and expecting high diversity, consider splitting their communities in order to maximize the information content of their sequencing effort.

  18. The Boys Club: Engineering a More Positive Environment for Women in Male-Dominated Majors

    Directory of Open Access Journals (Sweden)

    Brooke E. Dresden

    2018-01-01

    Full Text Available Sexual harassment has been widely studied in the workforce, but the factors that contribute to hostile educational environments for women have received less attention. The present study focuses on male dominance, gender harassment, gender threats, masculinity, and their influences on creating a hostile environment for women in academia. One hundred and forty-two male participants from a private university in the Southwestern United States self-reported their masculinity, completed a group task with a female confederate leader serving as a gender threat in half the conditions, and had their subsequent affect, perceptions of leadership effectiveness, and behavioral aggression measured. Men from male-dominated majors and men who had received a gender threat did not differ from men from gender-equivalent majors and men who had not received a gender threat on affect, perceptions of leadership effectiveness, or behavioral aggression (ps > 0.201, ηp2s ≤ 0.007. However, post-hoc analyses revealed that as masculinity increased among men from male-dominated majors under gender threat, they became significantly more behaviorally aggressive (b = 5.92, p = 0.003 and perceived their female leader as less effective (b = −0.83, p = 0.076. Implications and suggestions for future research are discussed.

  19. Total Domination Versus Paired-Domination in Regular Graphs

    Directory of Open Access Journals (Sweden)

    Cyman Joanna

    2018-05-01

    Full Text Available A subset S of vertices of a graph G is a dominating set of G if every vertex not in S has a neighbor in S, while S is a total dominating set of G if every vertex has a neighbor in S. If S is a dominating set with the additional property that the subgraph induced by S contains a perfect matching, then S is a paired-dominating set. The domination number, denoted γ(G, is the minimum cardinality of a dominating set of G, while the minimum cardinalities of a total dominating set and paired-dominating set are the total domination number, γt(G, and the paired-domination number, γpr(G, respectively. For k ≥ 2, let G be a connected k-regular graph. It is known [Schaudt, Total domination versus paired domination, Discuss. Math. Graph Theory 32 (2012 435–447] that γpr(G/γt(G ≤ (2k/(k+1. In the special case when k = 2, we observe that γpr(G/γt(G ≤ 4/3, with equality if and only if G ≅ C5. When k = 3, we show that γpr(G/γt(G ≤ 3/2, with equality if and only if G is the Petersen graph. More generally for k ≥ 2, if G has girth at least 5 and satisfies γpr(G/γt(G = (2k/(k + 1, then we show that G is a diameter-2 Moore graph. As a consequence of this result, we prove that for k ≥ 2 and k ≠ 57, if G has girth at least 5, then γpr(G/γt(G ≤ (2k/(k +1, with equality if and only if k = 2 and G ≅ C5 or k = 3 and G is the Petersen graph.

  20. Excessive prices as abuse of dominance?

    DEFF Research Database (Denmark)

    la Cour, Lisbeth; Møllgaard, Peter

    2007-01-01

    firm abused its position by charging excessive prices. We also test whether tightening of the Danish competition act has altered the pricing behaviour on the market. We discuss our results in the light of a Danish competition case against the dominant cement producer that was abandoned by the authority...

  1. Divergent clonal selection dominates medulloblastoma at recurrence

    Science.gov (United States)

    Morrissy, A. Sorana; Garzia, Livia; Shih, David J. H.; Zuyderduyn, Scott; Huang, Xi; Skowron, Patryk; Remke, Marc; Cavalli, Florence M. G.; Ramaswamy, Vijay; Lindsay, Patricia E.; Jelveh, Salomeh; Donovan, Laura K.; Wang, Xin; Luu, Betty; Zayne, Kory; Li, Yisu; Mayoh, Chelsea; Thiessen, Nina; Mercier, Eloi; Mungall, Karen L.; Ma, Yusanne; Tse, Kane; Zeng, Thomas; Shumansky, Karey; Roth, Andrew J. L.; Shah, Sohrab; Farooq, Hamza; Kijima, Noriyuki; Holgado, Borja L.; Lee, John J. Y.; Matan-Lithwick, Stuart; Liu, Jessica; Mack, Stephen C.; Manno, Alex; Michealraj, K. A.; Nor, Carolina; Peacock, John; Qin, Lei; Reimand, Juri; Rolider, Adi; Thompson, Yuan Y.; Wu, Xiaochong; Pugh, Trevor; Ally, Adrian; Bilenky, Mikhail; Butterfield, Yaron S. N.; Carlsen, Rebecca; Cheng, Young; Chuah, Eric; Corbett, Richard D.; Dhalla, Noreen; He, An; Lee, Darlene; Li, Haiyan I.; Long, William; Mayo, Michael; Plettner, Patrick; Qian, Jenny Q.; Schein, Jacqueline E.; Tam, Angela; Wong, Tina; Birol, Inanc; Zhao, Yongjun; Faria, Claudia C.; Pimentel, José; Nunes, Sofia; Shalaby, Tarek; Grotzer, Michael; Pollack, Ian F.; Hamilton, Ronald L.; Li, Xiao-Nan; Bendel, Anne E.; Fults, Daniel W.; Walter, Andrew W.; Kumabe, Toshihiro; Tominaga, Teiji; Collins, V. Peter; Cho, Yoon-Jae; Hoffman, Caitlin; Lyden, David; Wisoff, Jeffrey H.; Garvin, James H.; Stearns, Duncan S.; Massimi, Luca; Schüller, Ulrich; Sterba, Jaroslav; Zitterbart, Karel; Puget, Stephanie; Ayrault, Olivier; Dunn, Sandra E.; Tirapelli, Daniela P. C.; Carlotti, Carlos G.; Wheeler, Helen; Hallahan, Andrew R.; Ingram, Wendy; MacDonald, Tobey J.; Olson, Jeffrey J.; Van Meir, Erwin G.; Lee, Ji-Yeoun; Wang, Kyu-Chang; Kim, Seung-Ki; Cho, Byung-Kyu; Pietsch, Torsten; Fleischhack, Gudrun; Tippelt, Stephan; Ra, Young Shin; Bailey, Simon; Lindsey, Janet C.; Clifford, Steven C.; Eberhart, Charles G.; Cooper, Michael K.; Packer, Roger J.; Massimino, Maura; Garre, Maria Luisa; Bartels, Ute; Tabori, Uri; Hawkins, Cynthia E.; Dirks, Peter; Bouffet, Eric; Rutka, James T.; Wechsler-Reya, Robert J.; Weiss, William A.; Collier, Lara S.; Dupuy, Adam J.; Korshunov, Andrey; Jones, David T. W.; Kool, Marcel; Northcott, Paul A.; Pfister, Stefan M.; Largaespada, David A.; Mungall, Andrew J.; Moore, Richard A.; Jabado, Nada; Bader, Gary D.; Jones, Steven J. M.; Malkin, David; Marra, Marco A.; Taylor, Michael D.

    2016-01-01

    The development of targeted anti-cancer therapies through the study of cancer genomes is intended to increase survival rates and decrease treatment-related toxicity. We treated a transposon–driven, functional genomic mouse model of medulloblastoma with ‘humanized’ in vivo therapy (microneurosurgical tumour resection followed by multi-fractionated, image-guided radiotherapy). Genetic events in recurrent murine medulloblastoma exhibit a very poor overlap with those in matched murine diagnostic samples (sequencing of 33 pairs of human diagnostic and post-therapy medulloblastomas demonstrated substantial genetic divergence of the dominant clone after therapy (recurrence). In both mice and humans, the dominant clone at recurrence arose through clonal selection of a pre-existing minor clone present at diagnosis. Targeted therapy is unlikely to be effective in the absence of the target, therefore our results offer a simple, proximal, and remediable explanation for the failure of prior clinical trials of targeted therapy. PMID:26760213

  2. Novel autosomal dominant TNNT1 mutation causing nemaline myopathy.

    Science.gov (United States)

    Konersman, Chamindra G; Freyermuth, Fernande; Winder, Thomas L; Lawlor, Michael W; Lagier-Tourenne, Clotilde; Patel, Shailendra B

    2017-11-01

    Nemaline myopathy (NEM) is one of the three major forms of congenital myopathy and is characterized by diffuse muscle weakness, hypotonia, respiratory insufficiency, and the presence of nemaline rod structures on muscle biopsy. Mutations in troponin T1 (TNNT1) is 1 of 10 genes known to cause NEM. To date, only homozygous nonsense mutations or compound heterozygous truncating or internal deletion mutations in TNNT1 gene have been identified in NEM. This extended family is of historical importance as some members were reported in the 1960s as initial evidence that NEM is a hereditary disorder. Proband and extended family underwent Sanger sequencing for TNNT1. We performed RT-PCR and immunoblot on muscle to assess TNNT1 RNA expression and protein levels in proband and father. We report a novel heterozygous missense mutation of TNNT1 c.311A>T (p.E104V) that segregated in an autosomal dominant fashion in a large family residing in the United States. Extensive sequencing of the other known genes for NEM failed to identify any other mutant alleles. Muscle biopsies revealed a characteristic pattern of nemaline rods and severe myofiber hypotrophy that was almost entirely restricted to the type 1 fiber population. This novel mutation alters a residue that is highly conserved among vertebrates. This report highlights not only a family with autosomal dominant inheritance of NEM, but that this novel mutation likely acts via a dominant negative mechanism. © 2017 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

  3. Transcriptome sequencing and positive selected genes analysis of Bombyx mandarina.

    Directory of Open Access Journals (Sweden)

    Tingcai Cheng

    Full Text Available The wild silkworm Bombyx mandarina is widely believed to be an ancestor of the domesticated silkworm, Bombyx mori. Silkworms are often used as a model for studying the mechanism of species domestication. Here, we performed transcriptome sequencing of the wild silkworm using an Illumina HiSeq2000 platform. We produced 100,004,078 high-quality reads and assembled them into 50,773 contigs with an N50 length of 1764 bp and a mean length of 941.62 bp. A total of 33,759 unigenes were identified, with 12,805 annotated in the Nr database, 8273 in the Pfam database, and 9093 in the Swiss-Prot database. Expression profile analysis found significant differential expression of 1308 unigenes between the middle silk gland (MSG and posterior silk gland (PSG. Three sericin genes (sericin 1, sericin 2, and sericin 3 were expressed specifically in the MSG and three fibroin genes (fibroin-H, fibroin-L, and fibroin/P25 were expressed specifically in the PSG. In addition, 32,297 Single-nucleotide polymorphisms (SNPs and 361 insertion-deletions (INDELs were detected. Comparison with the domesticated silkworm p50/Dazao identified 5,295 orthologous genes, among which 400 might have experienced or to be experiencing positive selection by Ka/Ks analysis. These data and analyses presented here provide insights into silkworm domestication and an invaluable resource for wild silkworm genomics research.

  4. Macroscopic biofilms in fracture-dominated sediment that anaerobically oxidize methane

    Science.gov (United States)

    Briggs, B.R.; Pohlman, J.W.; Torres, M.; Riedel, M.; Brodie, E.L.; Colwell, F.S.

    2011-01-01

    Methane release from seafloor sediments is moderated, in part, by the anaerobic oxidation of methane (AOM) performed by consortia of archaea and bacteria. These consortia occur as isolated cells and aggregates within the sulfate-methane transition (SMT) of diffusion and seep-dominant environments. Here we report on a new SMT setting where the AOM consortium occurs as macroscopic pink to orange biofilms within subseafloor fractures. Biofilm samples recovered from the Indian and northeast Pacific Oceans had a cellular abundance of 10 7 to 10 8 cells cm -3. This cell density is 2 to 3 orders of magnitude greater than that in the surrounding sediments. Sequencing of bacterial 16S rRNA genes indicated that the bacterial component is dominated by Deltaproteobacteria, candidate division WS3, and Chloroflexi, representing 46%, 15%, and 10% of clones, respectively. In addition, major archaeal taxa found in the biofilm were related to the ANME-1 clade, Thermoplasmatales, and Desulfurococcales, representing 73%, 11%, and 10% of archaeal clones, respectively. The sequences of all major taxa were similar to sequences previously reported from cold seep environments. PhyloChip microarray analysis detected all bacterial phyla identified by the clone library plus an additional 44 phyla. However, sequencing detected more archaea than the PhyloChip within the phyla of Methanosarcinales and Desulfurococcales. The stable carbon isotope composition of the biofilm from the SMT (-35 to-43%) suggests that the production of the biofilm is associated with AOM. These biofilms are a novel, but apparently widespread, aggregation of cells represented by the ANME-1 clade that occur in methane-rich marine sediments. ?? 2011, American Society for Microbiology.

  5. Application of third order stochastic dominance algorithm in investments ranking

    Directory of Open Access Journals (Sweden)

    Lončar Sanja

    2012-01-01

    Full Text Available The paper presents the use of third order stochastic dominance in ranking Investment alternatives, using TSD algorithms (Levy, 2006for testing third order stochastic dominance. The main goal of using TSD rule is minimization of efficient investment set for investor with risk aversion, who prefers more money and likes positive skew ness.

  6. Rapid-Sequence Intubation in the Left-Lateral Tilt Position in a Pregnant Woman with Premature Placental Abruption Utilizing a Videolaryngoscope

    Directory of Open Access Journals (Sweden)

    Kenta Nakao

    2015-04-01

    Full Text Available Case - A 24-year-old pregnant woman was admitted to our hospital with decreased fetal heart rate. Obstetric examination revealed premature placental abruption; emergent caesarean section was planned under general anesthesia. On entering the operating room, the patient showed severe vital sign deterioration (blood pressure, 75/45 mm Hg; heart rate, 142 beats per minute. As left uterine displacement may worsen the premature placental abruption, the patient was placed in the left-lateral tilt position by rotating the operating table to release compression on the inferior vena cava by theuterus. To avoid circulatory collapse, rapid-sequence intubation was performed in this position. Tracheal intubation was performed with the Pentax-AWS Airwayscope (AWS videolaryngoscope, AWS; HOYA, Japan to obtain a good laryngeal view and minimize stress from laryngoscopy. After sufficient oxygenation, 120 mg of thiopental was administered. A second anesthesiologist performed cricoid pressure and 50 mg of rocuronium was administered after confirming loss of consciousness. This was followed by insertion of the AWS with a thin intlock into the mouth. Tracheal intubation was performed uneventfully. Discussion - Rapid-sequence intubation in the left-lateral tilted position with the AWS videolaryngoscope may be beneficial for pregnant women with vital sign deterioration.

  7. Sulfate Reducing Bacteria and Mycobacteria Dominate the Biofilm Communities in a Chloraminated Drinking Water Distribution System.

    Science.gov (United States)

    Gomez-Smith, C Kimloi; LaPara, Timothy M; Hozalski, Raymond M

    2015-07-21

    The quantity and composition of bacterial biofilms growing on 10 water mains from a full-scale chloraminated water distribution system were analyzed using real-time PCR targeting the 16S rRNA gene and next-generation, high-throughput Illumina sequencing. Water mains with corrosion tubercles supported the greatest amount of bacterial biomass (n = 25; geometric mean = 2.5 × 10(7) copies cm(-2)), which was significantly higher (P = 0.04) than cement-lined cast-iron mains (n = 6; geometric mean = 2.0 × 10(6) copies cm(-2)). Despite spatial variation of community composition and bacterial abundance in water main biofilms, the communities on the interior main surfaces were surprisingly similar, containing a core group of operational taxonomic units (OTUs) assigned to only 17 different genera. Bacteria from the genus Mycobacterium dominated all communities at the main wall-bulk water interface (25-78% of the community), regardless of main age, estimated water age, main material, and the presence of corrosion products. Further sequencing of the mycobacterial heat shock protein gene (hsp65) provided species-level taxonomic resolution of mycobacteria. The two dominant Mycobacteria present, M. frederiksbergense (arithmetic mean = 85.7% of hsp65 sequences) and M. aurum (arithmetic mean = 6.5% of hsp65 sequences), are generally considered to be nonpathogenic. Two opportunistic pathogens, however, were detected at low numbers: M. hemophilum (arithmetic mean = 1.5% of hsp65 sequences) and M. abscessus (arithmetic mean = 0.006% of hsp65 sequences). Sulfate-reducing bacteria from the genus Desulfovibrio, which have been implicated in microbially influenced corrosion, dominated all communities located underneath corrosion tubercules (arithmetic mean = 67.5% of the community). This research provides novel insights into the quantity and composition of biofilms in full-scale drinking water distribution systems, which is critical for assessing the risks to public health and to the

  8. Dominant-limb range-of-motion and humeral-retrotorsion adaptation in collegiate baseball and softball position players.

    Science.gov (United States)

    Hibberd, Elizabeth E; Oyama, Sakiko; Tatman, Justin; Myers, Joseph B

    2014-01-01

    Biomechanically, the motions used by baseball and softball pitchers differ greatly; however, the throwing motions of position players in both sports are strikingly similar. Although the adaptations to the dominant limb from overhead throwing have been well documented in baseball athletes, these adaptations have not been clearly identified in softball players. This information is important in order to develop and implement injury-prevention programs specific to decreasing the risk of upper extremity injury in softball athletes. To compare range-of-motion and humeral-retrotorsion characteristics of collegiate baseball and softball position players and of baseball and softball players to sex-matched controls. Cross-sectional study. Research laboratories and athletic training rooms at the University of North Carolina at Chapel Hill. Fifty-three collegiate baseball players, 35 collegiate softball players, 25 male controls (nonoverhead athletes), and 19 female controls (nonoverhead athletes). Range of motion and humeral retrotorsion were measured using a digital inclinometer and diagnostic ultrasound. Glenohumeral internal-rotation deficit, external-rotation gain, total glenohumeral range of motion, and humeral retrotorsion. Baseball players had greater glenohumeral internal-rotation deficit, total-range-of-motion, and humeral-retrotorsion difference than softball players and male controls. There were no differences between glenohumeral internal-rotation deficit, total-range-of-motion, and humeral-retrotorsion difference in softball players and female controls. Few differences were evident between softball players and female control participants, although range-of-motion and humeral-retrotorsion adaptations were significantly different than baseball players. The throwing motions are similar between softball and baseball, but the athletes adapt to the demands of the sport differently; thus, stretching/strengthening programs designed for baseball may not be the most

  9. Self-organizing dominance hierarchies in a wild primate population

    OpenAIRE

    Franz, Mathias; McLean, Emily; Tung, Jenny; Altmann, Jeanne; Alberts, Susan C.

    2015-01-01

    Linear dominance hierarchies, which are common in social animals, can profoundly influence access to limited resources, reproductive opportunities and health. In spite of their importance, the mechanisms that govern the dynamics of such hierarchies remain unclear. Two hypotheses explain how linear hierarchies might emerge and change over time. The ‘prior attributes hypothesis’ posits that individual differences in fighting ability directly determine dominance ranks. By contrast, the ‘social d...

  10. Stress triggering and the Canterbury earthquake sequence

    Science.gov (United States)

    Steacy, Sandy; Jiménez, Abigail; Holden, Caroline

    2014-01-01

    The Canterbury earthquake sequence, which includes the devastating Christchurch event of 2011 February, has to date led to losses of around 40 billion NZ dollars. The location and severity of the earthquakes was a surprise to most inhabitants as the seismic hazard model was dominated by an expected Mw > 8 earthquake on the Alpine fault and an Mw 7.5 earthquake on the Porters Pass fault, 150 and 80 km to the west of Christchurch. The sequence to date has included an Mw = 7.1 earthquake and 3 Mw ≥ 5.9 events which migrated from west to east. Here we investigate whether the later events are consistent with stress triggering and whether a simple stress map produced shortly after the first earthquake would have accurately indicated the regions where the subsequent activity occurred. We find that 100 per cent of M > 5.5 earthquakes occurred in positive stress areas computed using a slip model for the first event that was available within 10 d of its occurrence. We further find that the stress changes at the starting points of major slip patches of post-Darfield main events are consistent with triggering although this is not always true at the hypocentral locations. Our results suggest that Coulomb stress changes contributed to the evolution of the Canterbury sequence and we note additional areas of increased stress in the Christchurch region and on the Porters Pass fault.

  11. An in vitro-identified high-affinity nucleosome-positioning signal is capable of transiently positioning a nucleosome in vivo

    Directory of Open Access Journals (Sweden)

    Gracey Lia E

    2010-07-01

    Full Text Available Abstract Background The physiological function of eukaryotic DNA occurs in the context of nucleosomal arrays that can expose or obscure defined segments of the genome. Certain DNA sequences are capable of strongly positioning a nucleosome in vitro, suggesting the possibility that favorable intrinsic signals might reproducibly structure chromatin segments. As high-throughput sequencing analyses of nucleosome coverage in vitro and in vivo have become possible, a vigorous debate has arisen over the degree to which intrinsic DNA:nucleosome affinities orchestrate the in vivo positions of nucleosomes, thereby controlling physical accessibility of specific sequences in DNA. Results We describe here the in vivo consequences of placing a synthetic high-affinity nucleosome-positioning signal, the 601 sequence, into a DNA plasmid vector in mice. Strikingly, the 601 sequence was sufficient to position nucleosomes during an early phase after introduction of the DNA into the mice (when the plasmid vector transgene was active. This positioning capability was transient, with a loss of strong positioning at a later time point when the transgenes had become silent. Conclusions These results demonstrate an ability of DNA sequences selected solely for nucleosome affinity to organize chromatin in vivo, and the ability of other mechanisms to overcome these interactions in a dynamic nuclear environment.

  12. The CRISPR Spacer Space Is Dominated by Sequences from Species-Specific Mobilomes.

    Science.gov (United States)

    Shmakov, Sergey A; Sitnik, Vassilii; Makarova, Kira S; Wolf, Yuri I; Severinov, Konstantin V; Koonin, Eugene V

    2017-09-19

    Clustered regularly interspaced short palindromic repeats and CRISPR-associated protein (CRISPR-Cas) systems store the memory of past encounters with foreign DNA in unique spacers that are inserted between direct repeats in CRISPR arrays. For only a small fraction of the spacers, homologous sequences, called protospacers, are detectable in viral, plasmid, and microbial genomes. The rest of the spacers remain the CRISPR "dark matter." We performed a comprehensive analysis of the spacers from all CRISPR- cas loci identified in bacterial and archaeal genomes, and we found that, depending on the CRISPR-Cas subtype and the prokaryotic phylum, protospacers were detectable for 1% to about 19% of the spacers (~7% global average). Among the detected protospacers, the majority, typically 80 to 90%, originated from viral genomes, including proviruses, and among the rest, the most common source was genes that are integrated into microbial chromosomes but are involved in plasmid conjugation or replication. Thus, almost all spacers with identifiable protospacers target mobile genetic elements (MGE). The GC content, as well as dinucleotide and tetranucleotide compositions, of microbial genomes, their spacer complements, and the cognate viral genomes showed a nearly perfect correlation and were almost identical. Given the near absence of self-targeting spacers, these findings are most compatible with the possibility that the spacers, including the dark matter, are derived almost completely from the species-specific microbial mobilomes. IMPORTANCE The principal function of CRISPR-Cas systems is thought to be protection of bacteria and archaea against viruses and other parasitic genetic elements. The CRISPR defense function is mediated by sequences from parasitic elements, known as spacers, that are inserted into CRISPR arrays and then transcribed and employed as guides to identify and inactivate the cognate parasitic genomes. However, only a small fraction of the CRISPR spacers

  13. Interpreting a sequenced genome: toward a cosmid transgenic library of Caenorhabditis elegans.

    Science.gov (United States)

    Janke, D L; Schein, J E; Ha, T; Franz, N W; O'Neil, N J; Vatcher, G P; Stewart, H I; Kuervers, L M; Baillie, D L; Rose, A M

    1997-10-01

    We have generated a library of transgenic Caenorhabditis elegans strains that carry sequenced cosmids from the genome of the nematode. Each strain carries an extrachromosomal array containing a single cosmid, sequenced by the C. elegans Genome Sequencing Consortium, and a dominate Rol-6 marker. More than 500 transgenic strains representing 250 cosmids have been constructed. Collectively, these strains contain approximately 8 Mb of sequence data, or approximately 8% of the C. elegans genome. The transgenic strains are being used to rescue mutant phenotypes, resulting in a high-resolution map alignment of the genetic, physical, and DNA sequence maps of the nematode. We have chosen the region of chromosome III deleted by sDf127 and not covered by the duplication sDp8(III;I) as a starting point for a systematic correlation of mutant phenotypes with nucleotide sequence. In this defined region, we have identified 10 new essential genes whose mutant phenotypes range from developmental arrest at early larva, to maternal effect lethal. To date, 8 of these 10 essential genes have been rescued. In this region, these rescues represent approximately 10% of the genes predicted by GENEFINDER and considerably enhance the map alignment. Furthermore, this alignment facilitates future efforts to physically position and clone other genes in the region. [Updated information about the Transgenic Library is available via the Internet at http://darwin.mbb.sfu.ca/imbb/dbaillie/cos mid.html.

  14. Contrasted patterns of molecular evolution in dominant and recessive self-incompatibility haplotypes in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Pauline M Goubet

    Full Text Available Self-incompatibility has been considered by geneticists a model system for reproductive biology and balancing selection, but our understanding of the genetic basis and evolution of this molecular lock-and-key system has remained limited by the extreme level of sequence divergence among haplotypes, resulting in a lack of appropriate genomic sequences. In this study, we report and analyze the full sequence of eleven distinct haplotypes of the self-incompatibility locus (S-locus in two closely related Arabidopsis species, obtained from individual BAC libraries. We use this extensive dataset to highlight sharply contrasted patterns of molecular evolution of each of the two genes controlling self-incompatibility themselves, as well as of the genomic region surrounding them. We find strong collinearity of the flanking regions among haplotypes on each side of the S-locus together with high levels of sequence similarity. In contrast, the S-locus region itself shows spectacularly deep gene genealogies, high variability in size and gene organization, as well as complete absence of sequence similarity in intergenic sequences and striking accumulation of transposable elements. Of particular interest, we demonstrate that dominant and recessive S-haplotypes experience sharply contrasted patterns of molecular evolution. Indeed, dominant haplotypes exhibit larger size and a much higher density of transposable elements, being matched only by that in the centromere. Overall, these properties highlight that the S-locus presents many striking similarities with other regions involved in the determination of mating-types, such as sex chromosomes in animals or in plants, or the mating-type locus in fungi and green algae.

  15. Molecular Diagnostics in Autosomal Dominant Polycystic Kidney Disease: Utility and Limitations

    Science.gov (United States)

    Zhao, Xiao; Paterson, Andrew D.; Zahirieh, Alireza; He, Ning; Wang, Kairong; Pei, York

    2008-01-01

    Background and objectives: Gene-based mutation screening is now available and has the potential to provide diagnostic confirmation or exclusion of autosomal dominant polycystic kidney disease. This study illustrates its utility and limitations in the clinical setting. Design, setting, participants, & measurements: Using a molecular diagnostic service, genomic DNA of one affected individual from each study family was screened for pathologic PKD1 and PKD2 mutations. Bidirectional sequencing was performed to identify sequence variants in all exons and splice junctions of both genes and to confirm the specific mutations in other family members. In two multiplex families, microsatellite markers were genotyped at both PDK1 and PKD2 loci, and pair-wise and multipoint linkage analysis was performed. Results: Three of five probands studied were referred for assessment of renal cystic disease without a family history of autosomal dominant polycystic kidney disease, and two others were younger at-risk members of families with autosomal dominant polycystic kidney disease being evaluated as living-related kidney donors. Gene-based mutation screening identified pathogenic mutations that provided confirmation or exclusion of disease in three probands, but in the other two, only unclassified variants were identified. In one proband in which mutation screening was indeterminate, DNA linkage studies provided strong evidence for disease exclusion. Conclusions: Gene-based mutation screening or DNA linkage analysis should be considered in individuals in whom the diagnosis of autosomal dominant polycystic kidney disease is uncertain because of a lack of family history or equivocal imaging results and in younger at-risk individuals who are being evaluated as living-related kidney donors. PMID:18077784

  16. Further evidence for P59L mutation in GJA3 associated with autosomal dominant congenital cataract

    Directory of Open Access Journals (Sweden)

    Li Wang

    2016-01-01

    Full Text Available Context: Congenital cataracts are one of the common eye disorders leading to visual impairment or blindness in children worldwide. We found a Chinese family with autosomal dominant pulverulent cataract. Aims: To identify the pathogenic gene mutation in a Chinese family with autosomal dominant inherited pulverulent cataract. Subjects and Methods: After obtained informed consent, detailed ophthalmic examinations were carried out; genomic DNAs were obtained from seven family members in a three-generation Chinese family with three affected. All exons of candidate genes were amplified by polymerase chain reaction and were sequenced performed by bidirectional sequencing. Results: By sequencing the encoding regions of the candidate genes, a missense mutation (c. 176C>T was detected in gap junction protein alpha 3 genes (GJA3, which resulted in the substitution of highly conserved proline by leucine at codon 59 (p.P59L. The mutation co-segregated with all patients and was absent in 100 normal Chinese controls. Conclusions: The study identified a missense mutation (c. 176C>T in GJA3 gene associated with autosomal dominant congenital pulverulent cataract in a Chinese family. It gave further evidence of phenotype heterogeneity for P59L mutation in GJA3 associated with congenital cataract.

  17. Contribution of temporal dominance of sensations method to the sensory description of taste properties of commercial green tea brands

    Directory of Open Access Journals (Sweden)

    Noémi Dubová

    2013-03-01

    Full Text Available This paper aims to investigate the most dominant taste attributes of green tea samples in panelists perception over time. In order to assess the samples, a brand new method of sensory evaluation called „Temporal Dominance of Sensations“ was used. The five commercial green tea brands were evaluated by eight trained panelists (students. For each sample of green tea, curves of the dominance of each attribute over time were computed. The TDS curves provided information about the sequence of attributes that were dominant during degustation. This methodology was useful to characterize taste properties of green tea samples.doi:10.5219/274 Normal 0 false false false EN-US X-NONE X-NONE This paper aims to investigate the most dominant taste attributes of green tea samples in panelists perception over time. In order to assess the samples, a brand new method of sensory evaluation called „Temporal Dominance of Sensations“ was used. The five commercial green tea brands were evaluated by eight trained panelists (students. For each sample of green tea, curves of the dominance of each attribute over time were computed. The TDS curves provided information about the sequence of attributes that were dominant during degustation. This methodology was useful to characterize taste properties of green tea samples.doi:10.5219/274

  18. Bulk viscous matter-dominated Universes: asymptotic properties

    Energy Technology Data Exchange (ETDEWEB)

    Avelino, Arturo [Departamento de Física, Campus León, Universidad de Guanajuato, León, Guanajuato (Mexico); García-Salcedo, Ricardo [Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada - Legaria del IPN, México D.F. (Mexico); Gonzalez, Tame [Departamento de Ingeniería Civil, División de Ingeniería, Universidad de Guanajuato, Guanajuato (Mexico); Nucamendi, Ulises [Instituto de Física y Matemáticas, Universidad Michoacana de San Nicolás de Hidalgo, Edificio C-3, Ciudad Universitaria, CP. 58040 Morelia, Michoacán (Mexico); Quiros, Israel, E-mail: avelino@fisica.ugto.mx, E-mail: rigarcias@ipn.mx, E-mail: tamegc72@gmail.com, E-mail: ulises@ifm.umich.mx, E-mail: iquiros6403@gmail.com [Departamento de Matemáticas, Centro Universitario de Ciencias Exactas e Ingenierías (CUCEI), Corregidora 500 S.R., Universidad de Guadalajara, 44420 Guadalajara, Jalisco (Mexico)

    2013-08-01

    By means of a combined use of the type Ia supernovae and H(z) data tests, together with the study of the asymptotic properties in the equivalent phase space — through the use of the dynamical systems tools — we demonstrate that the bulk viscous matter-dominated scenario is not a good model to explain the accepted cosmological paradigm, at least, under the parametrization of bulk viscosity considered in this paper. The main objection against such scenarios is the absence of conventional radiation and matter-dominated critical points in the phase space of the model. This entails that radiation and matter dominance are not generic solutions of the cosmological equations, so that these stages can be implemented only by means of unique and very specific initial conditions, i. e., of very unstable particular solutions. Such a behavior is in marked contradiction with the accepted cosmological paradigm which requires of an earlier stage dominated by relativistic species, followed by a period of conventional non-relativistic matter domination, during which the cosmic structure we see was formed. Also, we found that the bulk viscosity is positive just until very late times in the cosmic evolution, around z < 1. For earlier epochs it is negative, been in tension with the local second law of thermodynamics.

  19. Isolate PM1 populations are dominant and novel methyl tert-butyl ether-degrading bacterial in compost biofilter enrichments.

    Science.gov (United States)

    Bruns, M A; Hanson, J R; Mefford, J; Scow, K M

    2001-03-01

    The gasoline additive MTBE, methyl tert-butyl ether, is a widespread and persistent groundwater contaminant. MTBE undergoes rapid mineralization as the sole carbon and energy source of bacterial strain PM1, isolated from an enrichment culture of compost biofilter material. In this report, we describe the results of microbial community DNA profiling to assess the relative dominance of isolate PM1 and other bacterial strains cultured from the compost enrichment. Three polymerase chain reaction (PCR)-based profiling approaches were evaluated: denaturing gradient gel electrophoresis (DGGE) analysis of 230 bp 16S rDNA fragments; thermal gradient gel electrophoresis (TGGE) analysis of 575 bp 16S rDNA fragments; and non-denaturing polyacrylamide gel electrophoresis of 300-1,500 bp fragments containing 16S/23S ribosomal intergenic transcribed spacer (ITS) regions. Whereas all three DNA profiling approaches indicated that PM1-like bands predominated in mixtures from MTBE-grown enrichments, ITS profiling provided the most abundant and specific sequence data to confirm strain PM1's presence in the enrichment. Moreover, ITS profiling did not produce non-specific PCR products that were observed with T/DGGE. A further advantage of ITS community profiling over other methods requiring restriction digestion (e.g. terminal restriction fragment length polymorphisms) was that it did not require an additional digestion step or the use of automated sequencing equipment. ITS bands, excised from similar locations in profiles of the enrichment and PM1 pure culture, were 99.9% identical across 750 16S rDNA positions and 100% identical across 691 spacer positions. BLAST comparisons of nearly full-length 16S rDNA sequences showed 96% similarity between isolate PM1 and representatives of at least four different genera in the Leptothrix subgroup of the beta-Proteobacteria (Aquabacterium, Leptothrix, Rubrivivax and Ideonella). Maximum likelihood and parsimony analyses of 1,249 nucleotide

  20. A Neural Circuit for Auditory Dominance over Visual Perception.

    Science.gov (United States)

    Song, You-Hyang; Kim, Jae-Hyun; Jeong, Hye-Won; Choi, Ilsong; Jeong, Daun; Kim, Kwansoo; Lee, Seung-Hee

    2017-02-22

    When conflicts occur during integration of visual and auditory information, one modality often dominates the other, but the underlying neural circuit mechanism remains unclear. Using auditory-visual discrimination tasks for head-fixed mice, we found that audition dominates vision in a process mediated by interaction between inputs from the primary visual (VC) and auditory (AC) cortices in the posterior parietal cortex (PTLp). Co-activation of the VC and AC suppresses VC-induced PTLp responses, leaving AC-induced responses. Furthermore, parvalbumin-positive (PV+) interneurons in the PTLp mainly receive AC inputs, and muscimol inactivation of the PTLp or optogenetic inhibition of its PV+ neurons abolishes auditory dominance in the resolution of cross-modal sensory conflicts without affecting either sensory perception. Conversely, optogenetic activation of PV+ neurons in the PTLp enhances the auditory dominance. Thus, our results demonstrate that AC input-specific feedforward inhibition of VC inputs in the PTLp is responsible for the auditory dominance during cross-modal integration. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. The Motivational Salience of Faces Is Related to Both Their Valence and Dominance.

    Science.gov (United States)

    Wang, Hongyi; Hahn, Amanda C; DeBruine, Lisa M; Jones, Benedict C

    2016-01-01

    Both behavioral and neural measures of the motivational salience of faces are positively correlated with their physical attractiveness. Whether physical characteristics other than attractiveness contribute to the motivational salience of faces is not known, however. Research with male macaques recently showed that more dominant macaques' faces hold greater motivational salience. Here we investigated whether dominance also contributes to the motivational salience of faces in human participants. Principal component analysis of third-party ratings of faces for multiple traits revealed two orthogonal components. The first component ("valence") was highly correlated with rated trustworthiness and attractiveness. The second component ("dominance") was highly correlated with rated dominance and aggressiveness. Importantly, both components were positively and independently related to the motivational salience of faces, as assessed from responses on a standard key-press task. These results show that at least two dissociable components underpin the motivational salience of faces in humans and present new evidence for similarities in how humans and non-human primates respond to facial cues of dominance.

  2. Step out - Step in Sequencing Games

    NARCIS (Netherlands)

    Musegaas, M.; Borm, P.E.M.; Quant, M.

    2014-01-01

    In this paper a new class of relaxed sequencing games is introduced: the class of Step out - Step in sequencing games. In this relaxation any player within a coalition is allowed to step out from his position in the processing order and to step in at any position later in the processing order.

  3. Novel CREB3L3 Nonsense Mutation in a Family With Dominant Hypertriglyceridemia.

    Science.gov (United States)

    Cefalù, Angelo B; Spina, Rossella; Noto, Davide; Valenti, Vincenza; Ingrassia, Valeria; Giammanco, Antonina; Panno, Maria D; Ganci, Antonina; Barbagallo, Carlo M; Averna, Maurizio R

    2015-12-01

    Cyclic AMP responsive element-binding protein 3-like 3 (CREB3L3) is a novel candidate gene for dominant hypertriglyceridemia. To date, only 4 kindred with dominant hypertriglyceridemia have been found to be carriers of 2 nonsense mutations in CREB3L3 gene (245fs and W46X). We investigated a family in which hypertriglyceridemia displayed an autosomal dominant pattern of inheritance. The proband was a 49-year-old woman with high plasma triglycerides (≤1300 mg/dL; 14.68 mmol/L). Her father had a history of moderate hypertriglyceridemia, and her 51-year-old brother had triglycerides levels as high as 1600 mg/dL (18.06 mmol/L). To identify the causal mutation in this family, we analyzed the candidate genes of recessive and dominant forms of primary hypertriglyceridemia by direct sequencing. The sequencing of CREB3L3 gene led to the discovery of a novel minute frame shift mutation in exon 3 of CREB3L3 gene, predicted to result in the formation of a truncated protein devoid of function (c.359delG-p.K120fsX20). Heterozygosity for the c.359delG mutation resulted in a severe phenotype occurring later in life in the proband and her brother and a good response to diet and a hypotriglyceridemic treatment. The same mutation was detected in a 13-year-old daughter who to date is normotriglyceridemic. We have identified a novel pathogenic mutation in CREB3L3 gene in a family with dominant hypertriglyceridemia with a variable pattern of penetrance. © 2015 American Heart Association, Inc.

  4. Step out-step in sequencing games

    NARCIS (Netherlands)

    Musegaas, Marieke; Borm, Peter; Quant, Marieke

    2015-01-01

    In this paper a new class of relaxed sequencing games is introduced: the class of Step out–Step in sequencing games. In this relaxation any player within a coalition is allowed to step out from his position in the processing order and to step in at any position later in the processing order. First,

  5. A nonsense mutation in CRYGC associated with autosomal dominant congenital nuclear cataract in a Chinese family.

    Science.gov (United States)

    Yao, Ke; Jin, Chongfei; Zhu, Ning; Wang, Wei; Wu, Renyi; Jiang, Jin; Shentu, Xingchao

    2008-07-09

    To identify the genetic defect associated with autosomal dominant congenital nuclear cataract in a Chinese family. Family history and phenotypic data were recorded, and the phenotypes were documented by slit lamp photography. The genomic DNA was extracted from peripheral blood leukocytes. All the exons and flanking intronic sequences of CRYGC and CRYGD were amplified by polymerase chain reaction (PCR) and screened for mutation by direct DNA sequencing. Structural models of the wild type and mutant gammaC-crystallin were generated and analyzed by SWISS-MODEL. Sequencing of the coding regions of CRYGC and CRYGD showed the presence of a heterozygous C>A transversion at c.327 of the coding sequence in exon 3 of CRYGC (c.327C>A), which results in the substitution of a wild type cysteine to a nonsense codon (C109X). One and a half Greek key motifs at the COOH-terminus were found to be absent in the structural model of the mutant truncated gammaC-crystallin. A novel nonsense mutation in CRYGC was detected in a Chinese family with consistent autosomal dominant congenital nuclear cataract, providing clear evidence of a relationship between the genotype and the corresponding cataract phenotype.

  6. Sex-linked dominant

    Science.gov (United States)

    Inheritance - sex-linked dominant; Genetics - sex-linked dominant; X-linked dominant; Y-linked dominant ... can be either an autosomal chromosome or a sex chromosome. It also depends on whether the trait ...

  7. Nucleosome Positioning and Epigenetics

    Science.gov (United States)

    Schwab, David; Bruinsma, Robijn

    2008-03-01

    The role of chromatin structure in gene regulation has recently taken center stage in the field of epigenetics, phenomena that change the phenotype without changing the DNA sequence. Recent work has also shown that nucleosomes, a complex of DNA wrapped around a histone octamer, experience a sequence dependent energy landscape due to the variation in DNA bend stiffness with sequence composition. In this talk, we consider the role nucleosome positioning might play in the formation of heterochromatin, a compact form of DNA generically responsible for gene silencing. In particular, we discuss how different patterns of nucleosome positions, periodic or random, could either facilitate or suppress heterochromatin stability and formation.

  8. Why large cells dominate estuarine phytoplankton

    Science.gov (United States)

    Cloern, James E.

    2018-01-01

    Surveys across the world oceans have shown that phytoplankton biomass and production are dominated by small cells (picoplankton) where nutrient concentrations are low, but large cells (microplankton) dominate when nutrient-rich deep water is mixed to the surface. I analyzed phytoplankton size structure in samples collected over 25 yr in San Francisco Bay, a nutrient-rich estuary. Biomass was dominated by large cells because their biomass selectively grew during blooms. Large-cell dominance appears to be a characteristic of ecosystems at the land–sea interface, and these places may therefore function as analogs to oceanic upwelling systems. Simulations with a size-structured NPZ model showed that runs of positive net growth rate persisted long enough for biomass of large, but not small, cells to accumulate. Model experiments showed that small cells would dominate in the absence of grazing, at lower nutrient concentrations, and at elevated (+5°C) temperatures. Underlying these results are two fundamental scaling laws: (1) large cells are grazed more slowly than small cells, and (2) grazing rate increases with temperature faster than growth rate. The model experiments suggest testable hypotheses about phytoplankton size structure at the land–sea interface: (1) anthropogenic nutrient enrichment increases cell size; (2) this response varies with temperature and only occurs at mid-high latitudes; (3) large-cell blooms can only develop when temperature is below a critical value, around 15°C; (4) cell size diminishes along temperature gradients from high to low latitudes; and (5) large-cell blooms will diminish or disappear where planetary warming increases temperature beyond their critical threshold.

  9. Radiation-induced dominant skeletal mutations in mice

    International Nuclear Information System (INIS)

    Selby, P.B.

    1979-01-01

    Skeletons were chosen for the attempt to determine the overall damage by radiation to one body system largely bacause they can be prepared readily for detailed study. Dominant mutations were of special interest because they are the type of mutations that would account for almost all damage induced in the early generations. The male offsprings derived from spermatogonial irradiation were used in the mutation-rate experiment, and the mutation frequency of 1.4% per gamete was found. The general dominant skeletal mutations are 1) the fusions of bones or other changes in individual bones, 2) the gross changes in bone shapes, usually caused by incomplete or too extensive bone growth, or 3) the shifts in the relative positions of bones. The recessive lethality in the period between implantation and birth can be recognized by the expected high death rate of implants in approximately 1/4 of the crosses that are between heterozygotes for a given mutation. The recessive lethal mutations may account for an important fraction of human genetic disorders owing to their dominant deleterious effects which represent only a small fraction, but because of their easy detection, they have been studied more than other dominants. At least 45, or 27%, of 164 dominant visibles in mice, ignoring those concerned with enzyme polymorphisms and immunological traits, appear to be recessive lethals. (Yamashita, S.)

  10. The dominance behavioral system and manic temperament: motivation for dominance, self-perceptions of power, and socially dominant behaviors.

    Science.gov (United States)

    Johnson, Sheri L; Carver, Charles S

    2012-12-15

    The dominance behavioral system has been conceptualized as a biologically based system comprising motivation to achieve social power and self-perceptions of power. Biological, behavioral, and social correlates of dominance motivation and self-perceived power have been related to a range of psychopathological tendencies. Preliminary evidence suggests that mania and risk for mania (manic temperament) relate to the dominance system. Four studies examine whether manic temperament, measured with the Hypomanic Personality Scale (HPS), is related to elevations in dominance motivation, self-perceptions of power, and engagement in socially dominant behavior across multiple measures. In Study 1, the HPS correlated with measures of dominance motivation and the pursuit of extrinsically-oriented ambitions for fame and wealth among 454 undergraduates. In Study 2, the HPS correlated with perceptions of power and extrinsically-oriented lifetime ambitions among 780 undergraduates. In Study 3, the HPS was related to trait-like tendencies to experience hubristic (dominance-related) pride, as well as dominance motivation and pursuit of extrinsically-oriented ambitions. In Study 4, we developed the Socially Dominant Behavior Scale to capture behaviors reflecting high power. The scale correlated highly with the HPS among 514 undergraduates. The studies rely on self-ratings of manic temperament and dominance constructs, and findings have not yet been generalized to a clinical sample. Taken together, results support the hypothesis that manic temperament is related to a focus on achieving social dominance, ambitions related to achieving social recognition, perceptions of having achieved power, tendencies to experience dominance-related pride, and engagement in social behaviors consistent with this elevated sense of power. Copyright © 2012 Elsevier B.V. All rights reserved.

  11. Nonparametric combinatorial sequence models.

    Science.gov (United States)

    Wauthier, Fabian L; Jordan, Michael I; Jojic, Nebojsa

    2011-11-01

    This work considers biological sequences that exhibit combinatorial structures in their composition: groups of positions of the aligned sequences are "linked" and covary as one unit across sequences. If multiple such groups exist, complex interactions can emerge between them. Sequences of this kind arise frequently in biology but methodologies for analyzing them are still being developed. This article presents a nonparametric prior on sequences which allows combinatorial structures to emerge and which induces a posterior distribution over factorized sequence representations. We carry out experiments on three biological sequence families which indicate that combinatorial structures are indeed present and that combinatorial sequence models can more succinctly describe them than simpler mixture models. We conclude with an application to MHC binding prediction which highlights the utility of the posterior distribution over sequence representations induced by the prior. By integrating out the posterior, our method compares favorably to leading binding predictors.

  12. Genomic selection models for directional dominance: an example for litter size in pigs.

    Science.gov (United States)

    Varona, Luis; Legarra, Andrés; Herring, William; Vitezica, Zulma G

    2018-01-26

    The quantitative genetics theory argues that inbreeding depression and heterosis are founded on the existence of directional dominance. However, most procedures for genomic selection that have included dominance effects assumed prior symmetrical distributions. To address this, two alternatives can be considered: (1) assume the mean of dominance effects different from zero, and (2) use skewed distributions for the regularization of dominance effects. The aim of this study was to compare these approaches using two pig datasets and to confirm the presence of directional dominance. Four alternative models were implemented in two datasets of pig litter size that consisted of 13,449 and 11,581 records from 3631 and 2612 sows genotyped with the Illumina PorcineSNP60 BeadChip. The models evaluated included (1) a model that does not consider directional dominance (Model SN), (2) a model with a covariate b for the average individual homozygosity (Model SC), (3) a model with a parameter λ that reflects asymmetry in the context of skewed Gaussian distributions (Model AN), and (4) a model that includes both b and λ (Model Full). The results of the analysis showed that posterior probabilities of a negative b or a positive λ under Models SC and AN were higher than 0.99, which indicate positive directional dominance. This was confirmed with the predictions of inbreeding depression under Models Full, SC and AN, that were higher than in the SN Model. In spite of differences in posterior estimates of variance components between models, comparison of models based on LogCPO and DIC indicated that Model SC provided the best fit for the two datasets analyzed. Our results confirmed the presence of positive directional dominance for pig litter size and suggested that it should be taken into account when dominance effects are included in genomic evaluation procedures. The consequences of ignoring directional dominance may affect predictions of breeding values and can lead to biased

  13. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    Science.gov (United States)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  14. Next-generation sequencing indicates false-positive MRD results and better predicts prognosis after SCT in patients with childhood ALL.

    Science.gov (United States)

    Kotrova, M; van der Velden, V H J; van Dongen, J J M; Formankova, R; Sedlacek, P; Brüggemann, M; Zuna, J; Stary, J; Trka, J; Fronkova, E

    2017-07-01

    Minimal residual disease (MRD) monitoring via quantitative PCR (qPCR) detection of Ag receptor gene rearrangements has been the most sensitive method for predicting prognosis and making post-transplant treatment decisions for patients with ALL. Despite the broad clinical usefulness and standardization of this method, we and others have repeatedly reported the possibility of false-positive MRD results caused by massive B-lymphocyte regeneration after stem cell transplantation (SCT). Next-generation sequencing (NGS) enables precise and sensitive detection of multiple Ag receptor rearrangements, thus providing a more specific readout compared to qPCR. We investigated two cohorts of children with ALL who underwent SCT (30 patients and 228 samples). The first cohort consisted of 17 patients who remained in long-term CR after SCT despite having low MRD positivity (SCT monitoring using qPCR. Only one of 27 qPCR-positive samples was confirmed to be positive by NGS. Conversely, 10 of 15 samples with low qPCR-detected MRD positivity from 13 patients who subsequently relapsed were also confirmed to be positive by NGS (P=0.002). These data show that NGS has a better specificity in post-SCT ALL management and indicate that treatment interventions aimed at reverting impending relapse should not be based on qPCR only.

  15. Sequence analysis of Leukemia DNA

    Science.gov (United States)

    Nacong, Nasria; Lusiyanti, Desy; Irawan, Muhammad. Isa

    2018-03-01

    Cancer is a very deadly disease, one of which is leukemia disease or better known as blood cancer. The cancer cell can be detected by taking DNA in laboratory test. This study focused on local alignment of leukemia and non leukemia data resulting from NCBI in the form of DNA sequences by using Smith-Waterman algorithm. SmithWaterman algorithm was invented by TF Smith and MS Waterman in 1981. These algorithms try to find as much as possible similarity of a pair of sequences, by giving a negative value to the unequal base pair (mismatch), and positive values on the same base pair (match). So that will obtain the maximum positive value as the end of the alignment, and the minimum value as the initial alignment. This study will use sequences of leukemia and 3 sequences of non leukemia.

  16. Autosomal-dominant non-autoimmune hyperthyroidism presenting with neuromuscular symptoms.

    Science.gov (United States)

    Elgadi, Aziz; Arvidsson, C-G; Janson, Annika; Marcus, Claude; Costagliola, Sabine; Norgren, Svante

    2005-08-01

    Neuromuscular presentations are common in thyroid disease, although the mechanism is unclear. In the present study, we investigated the pathogenesis in a boy with autosomal-dominant hyperthyroidism presenting with neuromuscular symptoms. The TSHr gene was investigated by direct sequencing. Functional properties of the mutant TSHr were investigated during transient expression in COS-7 cells. Family members were investigated by clinical and biochemical examinations. Sequence analysis revealed a previously reported heterozygous missense mutation Glycine 431 for Serine in the first transmembrane segment, leading to an increased specific constitutive activity. Three additional affected family members carried the same mutation. There was no indication of autoimmune disorder. All symptoms disappeared upon treatment with thacapzol and L-thyroxine and subsequent subtotal thyroidectomy. The data imply that neuromuscular symptoms can be caused by excessive thyroid hormone levels rather than by autoimmunity.

  17. Statistical guidance for experimental design and data analysis of mutation detection in rare monogenic mendelian diseases by exome sequencing.

    Directory of Open Access Journals (Sweden)

    Degui Zhi

    Full Text Available Recently, whole-genome sequencing, especially exome sequencing, has successfully led to the identification of causal mutations for rare monogenic Mendelian diseases. However, it is unclear whether this approach can be generalized and effectively applied to other Mendelian diseases with high locus heterogeneity. Moreover, the current exome sequencing approach has limitations such as false positive and false negative rates of mutation detection due to sequencing errors and other artifacts, but the impact of these limitations on experimental design has not been systematically analyzed. To address these questions, we present a statistical modeling framework to calculate the power, the probability of identifying truly disease-causing genes, under various inheritance models and experimental conditions, providing guidance for both proper experimental design and data analysis. Based on our model, we found that the exome sequencing approach is well-powered for mutation detection in recessive, but not dominant, Mendelian diseases with high locus heterogeneity. A disease gene responsible for as low as 5% of the disease population can be readily identified by sequencing just 200 unrelated patients. Based on these results, for identifying rare Mendelian disease genes, we propose that a viable approach is to combine, sequence, and analyze patients with the same disease together, leveraging the statistical framework presented in this work.

  18. A R54L mutation of CRYAA associated with autosomal dominant nuclear cataracts in a Chinese family.

    Science.gov (United States)

    Yang, Zhenfei; Su, Dongmei; Li, Qian; Ma, Zicheng; Yang, Fan; Zhu, Siquan; Ma, Xu

    2013-12-01

    To identify the genetic defect in a three-generation Chinese family with congenital cataracts. The phenotype of a three-generation Chinese family with congenital cataract was recruited. Detailed family history and clinical data of the family were recorded. Candidate genes sequencing was performed to screen out the disease-causing mutation. Bioinformatics analysis was performed to predict the function of mutant gene. The phenotype of the family was identified as nuclear cataract. Direct sequencing revealed a c.161 G > T transversion in exon 1 of crystallin alpha-A (CRYAA). This mutation co-segregated with all affected individuals in the family and was not found in unaffected family members nor in the 100 unrelated controls. Bioinformatics analysis indicated that the 54th amino acid position was highly conserved and the mutation R54L caused an increase of local hydrophobicity around the substitution site. This study identified a novel disease-causing mutation c.161 G > T (p.R54L) in CRYAA in a Chinese family with autosomal dominant nuclear cataracts, this is the first report relating a G > T mutation in CRYAA leading to congenital nuclear cataract.

  19. Environmental consequences of the desire to dominate and be superior.

    Science.gov (United States)

    Milfont, Taciano L; Richter, Isabel; Sibley, Chris G; Wilson, Marc S; Fischer, Ronald

    2013-09-01

    A belief in human dominance over nature lies at the heart of current environmental problems. In this article, we extend the theoretical scope of social dominance theory by arguing that social dominance orientation (SDO) is an important variable in understanding person-environment relations. We argue that individuals high in SDO are more willing to exploit the environment in unsustainable ways because SDO promotes human hierarchical dominance over nature. Four studies provide support for this perspective. High SDO was associated with lower levels of environmental concern in a nationally representative New Zealand sample (Study 1) and in country-level data across 27 nations (Study 2). SDO was also positively related to utilization attitudes toward nature (Study 3) and mediated the gender difference in beliefs about anthropogenic climate change (Study 4), and both occurred independently of right-wing authoritarianism. Implications for the human-dominated view of nature subscribed to by those high in SDO are discussed.

  20. a Continuous-Time Positive Linear System

    Directory of Open Access Journals (Sweden)

    Kyungsup Kim

    2013-01-01

    Full Text Available This paper discusses a computational method to construct positive realizations with sparse matrices for continuous-time positive linear systems with multiple complex poles. To construct a positive realization of a continuous-time system, we use a Markov sequence similar to the impulse response sequence that is used in the discrete-time case. The existence of the proposed positive realization can be analyzed with the concept of a polyhedral convex cone. We provide a constructive algorithm to compute positive realizations with sparse matrices of some positive systems under certain conditions. A sufficient condition for the existence of a positive realization, under which the proposed constructive algorithm works well, is analyzed.

  1. Molecular correlates of social dominance: a novel role for ependymin in aggression.

    Directory of Open Access Journals (Sweden)

    Lynne U Sneddon

    2011-04-01

    Full Text Available Theoretical and empirical studies have sought to explain the formation and maintenance of social relationships within groups. The resulting dominance hierarchies have significant fitness and survival consequences dependent upon social status. We hypothesised that each position or rank within a group has a distinctive brain gene expression profile that correlates with behavioural phenotype. Furthermore, transitions in rank position should determine which genes shift in expression concurrent with the new dominance status. We used a custom cDNA microarray to profile brain transcript expression in a model species, the rainbow trout, which forms tractable linear hierarchies. Dominant, subdominant and submissive individuals had distinctive transcript profiles with 110 gene probes identified using conservative statistical analyses. By removing the dominant, we characterised the changes in transcript expression in sub-dominant individuals that became dominant demonstrating that the molecular transition occurred within 48 hours. A strong, novel candidate gene, ependymin, which was highly expressed in both the transcript and protein in subdominants relative to dominants, was tested further. Using antibody injection to inactivate ependymin in pairs of dominant and subdominant zebrafish, the subdominant fish exhibited a substantial increase in aggression in parallel with an enhanced competitive ability. This is the first study to characterise the molecular signatures of dominance status within groups and the first to implicate ependymin in control of aggressive behaviour. It also provides evidence for indirect genetic effect models in which genotype/phenotype of an individual is influenced by conspecific interactions within a group. The variation in the molecular profile of each individual within a group may offer a new explanation of intraspecific variation in gene expression within undefined groups of animals and provides new candidates for empirical

  2. Relating 2-Rainbow Domination To Roman Domination

    Directory of Open Access Journals (Sweden)

    Alvarado José D.

    2017-11-01

    Full Text Available For a graph G, let R(G and yr2(G denote the Roman domination number of G and the 2-rainbow domination number of G, respectively. It is known that yr2(G ≤ R(G ≤ 3/2yr2(G. Fujita and Furuya [Difference between 2-rainbow domination and Roman domination in graphs, Discrete Appl. Math. 161 (2013 806-812] present some kind of characterization of the graphs G for which R(G − yr2(G = k for some integer k. Unfortunately, their result does not lead to an algorithm that allows to recognize these graphs efficiently. We show that for every fixed non-negative integer k, the recognition of the connected K4-free graphs G with yR(G − yr2(G = k is NP-hard, which implies that there is most likely no good characterization of these graphs. We characterize the graphs G such that yr2(H = yR(H for every induced subgraph H of G, and collect several properties of the graphs G with R(G = 3/2yr2(G.

  3. Negative Ion In-Source Decay Matrix-Assisted Laser Desorption/Ionization Mass Spectrometry for Sequencing Acidic Peptides

    Science.gov (United States)

    McMillen, Chelsea L.; Wright, Patience M.; Cassady, Carolyn J.

    2016-05-01

    Matrix-assisted laser desorption/ionization (MALDI) in-source decay was studied in the negative ion mode on deprotonated peptides to determine its usefulness for obtaining extensive sequence information for acidic peptides. Eight biological acidic peptides, ranging in size from 11 to 33 residues, were studied by negative ion mode ISD (nISD). The matrices 2,5-dihydroxybenzoic acid, 2-aminobenzoic acid, 2-aminobenzamide, 1,5-diaminonaphthalene, 5-amino-1-naphthol, 3-aminoquinoline, and 9-aminoacridine were used with each peptide. Optimal fragmentation was produced with 1,5-diaminonphthalene (DAN), and extensive sequence informative fragmentation was observed for every peptide except hirudin(54-65). Cleavage at the N-Cα bond of the peptide backbone, producing c' and z' ions, was dominant for all peptides. Cleavage of the N-Cα bond N-terminal to proline residues was not observed. The formation of c and z ions is also found in electron transfer dissociation (ETD), electron capture dissociation (ECD), and positive ion mode ISD, which are considered to be radical-driven techniques. Oxidized insulin chain A, which has four highly acidic oxidized cysteine residues, had less extensive fragmentation. This peptide also exhibited the only charged localized fragmentation, with more pronounced product ion formation adjacent to the highly acidic residues. In addition, spectra were obtained by positive ion mode ISD for each protonated peptide; more sequence informative fragmentation was observed via nISD for all peptides. Three of the peptides studied had no product ion formation in ISD, but extensive sequence informative fragmentation was found in their nISD spectra. The results of this study indicate that nISD can be used to readily obtain sequence information for acidic peptides.

  4. Chaos game representation (CGR)-walk model for DNA sequences

    International Nuclear Information System (INIS)

    Jie, Gao; Zhen-Yuan, Xu

    2009-01-01

    Chaos game representation (CGR) is an iterative mapping technique that processes sequences of units, such as nucleotides in a DNA sequence or amino acids in a protein, in order to determine the coordinates of their positions in a continuous space. This distribution of positions has two features: one is unique, and the other is source sequence that can be recovered from the coordinates so that the distance between positions may serve as a measure of similarity between the corresponding sequences. A CGR-walk model is proposed based on CGR coordinates for the DNA sequences. The CGR coordinates are converted into a time series, and a long-memory ARFIMA (p, d, q) model, where ARFIMA stands for autoregressive fractionally integrated moving average, is introduced into the DNA sequence analysis. This model is applied to simulating real CGR-walk sequence data of ten genomic sequences. Remarkably long-range correlations are uncovered in the data, and the results from these models are reasonably fitted with those from the ARFIMA (p, d, q) model. (cross-disciplinary physics and related areas of science and technology)

  5. Previously unclassified bacteria dominate during thermophilic and mesophilic anaerobic pre-treatment of primary sludge.

    Science.gov (United States)

    Pervin, Hasina M; Batstone, Damien J; Bond, Philip L

    2013-06-01

    Thermophilic biological pre-treatment enables enhanced anaerobic digestion for treatment of wastewater sludges but, at present, there is limited understanding of the hydrolytic-acidogenic microbial composition and its contribution to this process. In this study, the process was assessed by comparing the microbiology of thermophilic (50-65 °C) and mesophilic (35 °C) pre-treatment reactors treating primary sludge. A full-cycle approach for the 16S rRNA genes was applied in order to monitor the diversity of bacteria and their abundance in a thermophilic pre-treatment reactor treating primary sludge. For the thermophilic pre-treatment (TP), over 90% of the sequences were previously undetected and these had less than 97% sequence similarity to cultured organisms. During the first 83 days, members of the Betaproteobacteria dominated the community sequences and a newly designed probe was used to monitor a previously unknown bacterium affiliated with the genus Brachymonas. Between days 85 and 183, three phylotypes that affiliated with the genera Comamonas, Clostridium and Lysobacter were persistently dominant in the TP community, as revealed by terminal-restriction fragment length polymorphism (T-RFLP). Hydrolytic and fermentative functions have been speculated for these bacteria. Mesophilic pre-treatment (MP) and TP communities were different but they were both relatively dynamic. Statistical correlation analysis and the function of closely allied reference organisms indicated that previously unclassified bacteria dominated the TP community and may have been functionally involved in the enhanced hydrolytic performance of thermophilic anaerobic pre-treatment. This study is the first to reveal the diversity and dynamics of bacteria during anaerobic digestion of primary sludge. Copyright © 2013 Elsevier GmbH. All rights reserved.

  6. Are professional handball players at risk for developing a glenohumeral internal rotation deficit in their dominant arm?

    Science.gov (United States)

    Seabra, Pedro; Van Eck, Carola F; Sá, Márcia; Torres, João

    2017-05-01

    Overhead athletes, such as baseball players, have been shown to have adaptive changes in the shoulder range of motion (ROM) of their dominant arm. Professional handball players are a unique subtype of overhead athletes with very different demands from baseball players. The aim of this study was to determine if professional handball players demonstrate differences in shoulder ROM between their dominant and non-dominant arm and try to relate them with new variables. Fifty professional male handball players were included and completed a questionnaire regarding age at which they started to play, number of hours they practice a week, field position and arm dominance. ROM measurements were performed including forward flexion (FF), external rotation with the shoulder in abduction (ABER) and with adducted arm (ADER) and internal rotation with shoulder in abduction (IR). Statistical analysis was performed to determine differences in ROM between the dominant and non-dominant shoulder and if there is a relationship between these differences and shoulder load or field position. The dominant arm showed decreased internal rotation (47 vs. 56 degrees, p handball players with a first line position have a significant risk for developing a glenohumeral internal rotation deficit, similar to the phenomenon seen in baseball pitchers.

  7. Topics on domination

    CERN Document Server

    Hedetniemi, ST

    1991-01-01

    The contributions in this volume are divided into three sections: theoretical, new models and algorithmic. The first section focuses on properties of the standard domination number &ggr;(G), the second section is concerned with new variations on the domination theme, and the third is primarily concerned with finding classes of graphs for which the domination number (and several other domination-related parameters) can be computed in polynomial time.

  8. The paired-domination and the upper paired-domination numbers of graphs

    Directory of Open Access Journals (Sweden)

    Włodzimierz Ulatowski

    2015-01-01

    Full Text Available In this paper we continue the study of paired-domination in graphs. A paired-dominating set, abbreviated PDS, of a graph \\(G\\ with no isolated vertex is a dominating set of vertices whose induced subgraph has a perfect matching. The paired-domination number of \\(G\\, denoted by \\(\\gamma_{p}(G\\, is the minimum cardinality of a PDS of \\(G\\. The upper paired-domination number of \\(G\\, denoted by \\(\\Gamma_{p}(G\\, is the maximum cardinality of a minimal PDS of \\(G\\. Let \\(G\\ be a connected graph of order \\(n\\geq 3\\. Haynes and Slater in [Paired-domination in graphs, Networks 32 (1998, 199-206], showed that \\(\\gamma_{p}(G\\leq n-1\\ and they determine the extremal graphs \\(G\\ achieving this bound. In this paper we obtain analogous results for \\(\\Gamma_{p}(G\\. Dorbec, Henning and McCoy in [Upper total domination versus upper paired-domination, Questiones Mathematicae 30 (2007, 1-12] determine \\(\\Gamma_{p}(P_n\\, instead in this paper we determine \\(\\Gamma_{p}(C_n\\. Moreover, we describe some families of graphs \\(G\\ for which the equality \\(\\gamma_{p}(G=\\Gamma_{p}(G\\ holds.

  9. SU-E-J-231: Comparison of Delineation Variability of Soft Tissue Volume and Position in Head-And-Neck Between Two T1-Weighted Pulse Sequences Using An MR-Simulator with Immobilization

    Energy Technology Data Exchange (ETDEWEB)

    Wong, O; Lo, G; Yuan, J; Law, M; Ding, A; Cheng, K; Chan, K; Cheung, K; Yu, S [Hong Kong Sanatorium & Hospital, Hong Kong (Hong Kong)

    2015-06-15

    Purpose: There is growing interests in applying MR-simulator(MR-sim) in radiotherapy but MR images subject to hardware, patient and pulse sequence dependent geometric distortion that may potentially influence target definition. This study aimed to evaluate the influence on head-and-neck tissue delineation, in terms of positional and volumetric variability, of two T1-weighted(T1w) MR sequences on a 1.5T MR-sim Methods: Four healthy volunteers were scanned (4 scans for each on different days) using both spin-echo (3DCUBE, TR/TE=500/14ms, TA=183s) and gradient-echo sequences (3DFSPGR, TE/TR=7/4ms, TA=173s) with identical coverage, voxel-size(0.8×0.8×1.0mm3), receiver-bandwidth(62.5kHz/pix) and geometric correction on a 1.5T MR-sim immobilized with personalized thermoplastic cast and head-rest. Under this setting, similar T1w contrast and signal-to-noise ratio were obtained, and factors other than sequence that might bias image distortion and tissue delineation were minimized. VOIs of parotid gland(PGR, PGL), pituitary gland(PIT) and eyeballs(EyeL, EyeR) were carefully drawn, and inter-scan coefficient-of-variation(CV) of VOI centroid position and volume were calculated for each subject. Mean and standard deviation(SD) of the CVs for four subjects were compared between sequences using Wilcoxon ranksum test. Results: The mean positional(<4%) and volumetric(<7%) CVs varied between tissues, majorly dependent on tissue inherent properties like volume, location, mobility and deformability. Smaller mean volumetric CV was found in 3DCUBE, probably due to its less proneness to tissue susceptibility, but only PGL showed significant difference(P<0.05). Positional CVs had no significant differences for all VOIs(P>0.05) between sequences, suggesting volumetric variation might be more sensitive to sequence-dependent delineation difference. Conclusion: Although 3DCUBE is considered less prone to tissue susceptibility-induced artifact and distortion, our preliminary data showed

  10. A comparison of abused and non-abused women's definitions of domestic violence and attitudes to acceptance of male dominance.

    Science.gov (United States)

    Faramarzi, M; Esmailzadeh, S; Mosavi, S

    2005-10-01

    To examine the effects of women's subjective definitions of wife abuse and of their general attitudes to acceptance of male dominance on the occurrence of domestic violence. A case-control survey was conducted in the public health center of Babol University of Medical Sciences from November 2002 to October 2003. The Abuse Assessment Screen Form was used to identify partner violence, and the Abuse Definition Form and Abuse Attitude Form were applied to measure how the women defined wife abuse and their attitudes to male dominance. Women with positive attitudes to male dominance had experienced more physical and emotional abuse than those with negative attitudes toward male dominance (p family income were important risk factors for domestic violence, the strongest predictor of physical abuse was a positive attitude to male dominance. A positive attitude of women to male dominance increases the acceptance and frequency of partner violence. This finding shows the need to raise the educational levels of women and raise their awareness of their rights. This could convert an attitude of male dominance to equality of men and women.

  11. Status-Dependent Vasotocin Modulation of Dominance and Subordination in the Weakly Electric Fish Gymnotus omarorum

    Directory of Open Access Journals (Sweden)

    Rossana Perrone

    2018-01-01

    Full Text Available Dominant-subordinate status emerges from agonistic encounters. The weakly electric fish, Gymnotus omarorum, displays a clear-cut example of non-breeding territorial aggression. The asymmetry in the behavior of dominants and subordinates is outstanding. Dominants are highly aggressive and subordinates signal submission in a precise sequence of locomotor and electric traits: retreating, decreasing their electric organ discharge rate, and emitting transient electric signals. The hypothalamic neuropeptide arginine-vasotocin (AVT and its mammalian homolog arginine-vasopressin, are key modulators of social behavior, known to adapt their actions to different contexts. By analyzing the effects of pharmacological manipulations of the AVT system in both dominants and subordinates, we show evidence of distinct status-dependent actions of AVT. We demonstrate an endogenous effect of AVT on dominants' aggression levels: blocking the V1a AVT receptor induced a significant decrease in dominants' attack rate. AVT administered to subordinates enhanced the expression of the electric signals of submission, without affecting subordinates' locomotor displays. This study contributes a clear example of status-dependent AVT modulation of agonistic behavior in teleosts, and reveals distinctive activation patterns of the AVT system between dominants and subordinates.

  12. Status-Dependent Vasotocin Modulation of Dominance and Subordination in the Weakly Electric Fish Gymnotus omarorum.

    Science.gov (United States)

    Perrone, Rossana; Silva, Ana C

    2018-01-01

    Dominant-subordinate status emerges from agonistic encounters. The weakly electric fish, Gymnotus omarorum , displays a clear-cut example of non-breeding territorial aggression. The asymmetry in the behavior of dominants and subordinates is outstanding. Dominants are highly aggressive and subordinates signal submission in a precise sequence of locomotor and electric traits: retreating, decreasing their electric organ discharge rate, and emitting transient electric signals. The hypothalamic neuropeptide arginine-vasotocin (AVT) and its mammalian homolog arginine-vasopressin, are key modulators of social behavior, known to adapt their actions to different contexts. By analyzing the effects of pharmacological manipulations of the AVT system in both dominants and subordinates, we show evidence of distinct status-dependent actions of AVT. We demonstrate an endogenous effect of AVT on dominants' aggression levels: blocking the V1a AVT receptor induced a significant decrease in dominants' attack rate. AVT administered to subordinates enhanced the expression of the electric signals of submission, without affecting subordinates' locomotor displays. This study contributes a clear example of status-dependent AVT modulation of agonistic behavior in teleosts, and reveals distinctive activation patterns of the AVT system between dominants and subordinates.

  13. A novel mutation in the ELOVL4 gene causes autosomal dominant Stargardt-like macular dystrophy.

    NARCIS (Netherlands)

    Maugeri, A.; Meire, F.; Hoyng, C.B.; Vink, C.W.; Regemorter, N. van; Karan, G.; Yang, Z.; Cremers, F.P.M.; Zhang, K.

    2004-01-01

    PURPOSE: To conduct clinical and genetic studies in a European family with autosomal dominant Stargardt-like macular dystrophy (adSTGD-like MD) and to investigate the functional consequences of a novel ELOVL4 mutation. METHODS: Ophthalmic examination and mutation screening by direct sequencing of

  14. Polymorphism Sequence - JSNP | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us JSNP Polymorphism Sequence Data detail Data name Polymorphism Sequence DOI 10.18908/lsdba.nb...dc00114-001 Description of data contents Information on polymorphisms (SNPs and insertions/deletions) and th...se Name database name JSNP_SNP: single nucleotide polymorphism JSNP_InsDel_IND: insertion/deletion JSNP_InsD...ved allele observed 3' Flanking Sequence 3' flanking sequence Offset in Flanking Sequence position of the polymorphism...uence Accession No. accession No. of the sequence for polymorphism screening Offset in Record position of the polymorphism

  15. K-mer Content, Correlation, and Position Analysis of Genome DNA Sequences for the Identification of Function and Evolutionary Features

    Directory of Open Access Journals (Sweden)

    Aaron Sievers

    2017-04-01

    Full Text Available In genome analysis, k-mer-based comparison methods have become standard tools. However, even though they are able to deliver reliable results, other algorithms seem to work better in some cases. To improve k-mer-based DNA sequence analysis and comparison, we successfully checked whether adding positional resolution is beneficial for finding and/or comparing interesting organizational structures. A simple but efficient algorithm for extracting and saving local k-mer spectra (frequency distribution of k-mers was developed and used. The results were analyzed by including positional information based on visualizations as genomic maps and by applying basic vector correlation methods. This analysis was concentrated on small word lengths (1 ≤ k ≤ 4 on relatively small viral genomes of Papillomaviridae and Herpesviridae, while also checking its usability for larger sequences, namely human chromosome 2 and the homologous chromosomes (2A, 2B of a chimpanzee. Using this alignment-free analysis, several regions with specific characteristics in Papillomaviridae and Herpesviridae formerly identified by independent, mostly alignment-based methods, were confirmed. Correlations between the k-mer content and several genes in these genomes have been found, showing similarities between classified and unclassified viruses, which may be potentially useful for further taxonomic research. Furthermore, unknown k-mer correlations in the genomes of Human Herpesviruses (HHVs, which are probably of major biological function, are found and described. Using the chromosomes of a chimpanzee and human that are currently known, identities between the species on every analyzed chromosome were reproduced. This demonstrates the feasibility of our approach for large data sets of complex genomes. Based on these results, we suggest k-mer analysis with positional resolution as a method for closing a gap between the effectiveness of alignment-based methods (like NCBI BLAST and the

  16. Differences in xylogenesis between dominant and suppressed trees.

    Science.gov (United States)

    Liu, Shushan; Li, Xiaoxia; Rossi, Sergio; Wang, Lily; Li, Wei; Liang, Eryuan; Leavitt, Steven W

    2018-05-01

    Most dendroecological studies focus on dominant trees, but little is known about the growing season of trees belonging to different size classes and their sensitivity to biotic factors. The objective of this study was to compare the dynamics of xylem formation between dominant and suppressed trees of Abies fabri of similar age growing in the Gongga Mountains, southeastern Tibetan Plateau, and to identify the association between xylem growth and climate. The timing and duration of xylogenesis in histological sections were investigated weekly during the 2013-2015 growing seasons. Our investigation found that timing and duration of xylogenesis varied with canopy position and its associated tree size. Xylogenesis started 6-14 days earlier, and ended 5-11 days later in dominant trees than in suppressed trees, resulting in a significantly longer growing season. Dominant trees also exhibited higher temperature sensitivity of tracheid production rate than suppressed trees. The observed differences in xylogenesis among trees suggested that competition affects tree growth by reducing the growing period in suppressed trees. Representative climate-growth relationships should involve trees of all size classes when evaluating the effects of the environment on forest dynamics. © 2018 Botanical Society of America.

  17. Feminists' heterosexual relationships: more on dominance and mating.

    Science.gov (United States)

    Abernethy, V

    1978-04-01

    The hypothesis that female dominance inhibits mating whereas male dominance facilitates it, and seemingly incongruous findings suggesting that dominant women take more initiative and are more interested than others in sex, are explored through comparison of feminist and control subjects, ie, women who were expected, a priori, to be located at widely separated points on a theoretical dominance continuum. Principal findings are the following: (1) sexual initiative and satisfaction appear to be greater among feminists than others, (2) there is no difference between groups in frequency of coitus in a present (or most recent) sexual relationship, but (3) there is a tendency for feminists to have had less stable first marriages than control subjects. These findings do permit more than one interpretation: the greater sexual satisfaction combined with marital instability among feminists may reflect their energy and willingness to change an unsatisfactory condition, or, in addition, the more general proposition that personal power is associated with positive sexual response in both men and women, so that there is minimal complementarity along this dimension. Both cultural and biologic factors appear to contribute to the relative instability of feminists' marriages.

  18. Stratigraphy and stable isotope geochemistry of the carbonate sequence from the Paraguay belt

    International Nuclear Information System (INIS)

    Santos, Roberto Ventura.; Alvarenga, Carlos Jose Souza de; Dantas, Elton Luiz

    2001-01-01

    isotope data across 1300 m of carbonates from the northern Paraguay Belt that are stratigraphically placed above glacial sediments. The whole sequence may be divided into three different horizons that shows a general increase in δ 13 C PDB values from the base to the top: 1) a lower horizon in which the δ 13 C PDB values are negative; 2) a intermediate horizon dominated by slightly positive carbon isotope values; and 3) an upper horizon in which the carbon isotope values vary from -1% o to +9.3% o Compared to the carbonate sequences from the Brasilia Belt (Bambui Group), the amount of high δ 13 C PDB values in the Paraguay belt is much less prominent. Rocks from the lower horizon lay directly above the glacial diamictites and present variable δ 18 O PDB values. Besides presenting negative δ 13 C PDB values, they also display a negative carbon isotope peak that may reach values as low as 10% o . The intermediate horizon is best represented in the Provincia Serrana area and is characterized by homogeneous δ 13 C PDB values through out the sequence. This horizon is dominated by dolostones and present δ 18 O PDB values ranging between + 1.9% o and +2.7% o . The upper horizon is dominated by dolostones and present variable δ 13 C PDB and δ 18 O PDB values. The highest δ 13 C PDB values were found on samples from a narrow layer from the Provincia Serrana area. Although the Guia area also has positive values (+3.8% o , they were not as high as those from the Provincia Serrana. At the end of the profile, and just bellow the contact with the upper siliciclastic unit, there is an abrupt decrease in the δ 13 C PDB values down to -2.0% o (au)

  19. Different Vocal Parameters Predict Perceptions of Dominance and Attractiveness.

    Science.gov (United States)

    Hodges-Simeon, Carolyn R; Gaulin, Steven J C; Puts, David A

    2010-12-01

    Low mean fundamental frequency (F(0)) in men's voices has been found to positively influence perceptions of dominance by men and attractiveness by women using standardized speech. Using natural speech obtained during an ecologically valid social interaction, we examined relationships between multiple vocal parameters and dominance and attractiveness judgments. Male voices from an unscripted dating game were judged by men for physical and social dominance and by women in fertile and non-fertile menstrual cycle phases for desirability in short-term and long-term relationships. Five vocal parameters were analyzed: mean F(0) (an acoustic correlate of vocal fold size), F(0) variation, intensity (loudness), utterance duration, and formant dispersion (D(f), an acoustic correlate of vocal tract length). Parallel but separate ratings of speech transcripts served as controls for content. Multiple regression analyses were used to examine the independent contributions of each of the predictors. Physical dominance was predicted by low F(0) variation and physically dominant word content. Social dominance was predicted only by socially dominant word content. Ratings of attractiveness by women were predicted by low mean F(0), low D(f), high intensity, and attractive word content across cycle phase and mating context. Low D(f) was perceived as attractive by fertile-phase women only. We hypothesize that competitors and potential mates may attend more strongly to different components of men's voices because of the different types of information these vocal parameters provide.

  20. Generalized locally Toeplitz sequences theory and applications

    CERN Document Server

    Garoni, Carlo

    2017-01-01

    Based on their research experience, the authors propose a reference textbook in two volumes on the theory of generalized locally Toeplitz sequences and their applications. This first volume focuses on the univariate version of the theory and the related applications in the unidimensional setting, while the second volume, which addresses the multivariate case, is mainly devoted to concrete PDE applications. This book systematically develops the theory of generalized locally Toeplitz (GLT) sequences and presents some of its main applications, with a particular focus on the numerical discretization of differential equations (DEs). It is the first book to address the relatively new field of GLT sequences, which occur in numerous scientific applications and are especially dominant in the context of DE discretizations. Written for applied mathematicians, engineers, physicists, and scientists who (perhaps unknowingly) encounter GLT sequences in their research, it is also of interest to those working in the fields of...

  1. Use of cycle stacking patterns to define third-order depositional sequences: Middle to Late Cambrian Bonanza King Formation, southern Great basin

    Energy Technology Data Exchange (ETDEWEB)

    Montanez, I.P.; Droser, M.L. (Univ. of California, Riverside (United States))

    1991-03-01

    The Middle to Late Cambrian Bonanza King Formation (CA, NV) is characterized by superimposed scales of cyclicity. Small-scale cycles (0.5 to 10m) occur as shallowing-upward peritidal and subtidal cycles that repeat at high frequencies (10{sup 4} to 10{sup 5}). Systematic changes in stacking patterns of meter-scale cycles define several large-scale (50-250 m) third-order depositional sequences in the Bonanza King Formation. Third-order depositional sequences can be traced within ranges and correlated regionally across the platform. Peritidal cycles in the Bonanza King Formation are both subtidal- and tidal flat-dominated. Tidal flat-dominated cycles consist of muddy bases grading upward into thrombolites or columnar stromatolites all capped by planar stromatolites. Subtidal cycles in the Bonanza King Formation consist of grainstone bases that commonly fine upward and contain stacked hardgrounds. These are overlain by digitate-algal bioherms with grainstone channel fills and/or bioturbated ribbon carbonates with grainstone lenses. Transgressive depositional facies of third-order depositional sequences consist primarily of stacks of subtidal-dominated pertidial cycles and subtidal cycles, whereas regressive depositional facies are dominated by stacks of tidal flat-dominated peritidal cycles and regoliths developed over laminite cycle caps. The use of high frequency cycles in the Bonanza King Formation to delineate regionally developed third-order depositional sequences thus provides a link between cycle stratigraphy and sequence stratigraphy.

  2. Dominance and Leadership: Useful Concepts in Human–Horse Interactions?

    DEFF Research Database (Denmark)

    Hartmann, Elke; Christensen, Janne Winther; McGreevy, Paul D.

    2017-01-01

    of management scenarios, ranging from taking a horse out of its social group to the prospect of humans mimicking the horse's social system by taking a putative leadership role and seeking after an alpha position in the dominance hierarchy to achieve compliance. Yet, there is considerable debate about whether...... the roles horses attain in their social group are of any relevance in their reactions to humans. This article reviews the empirical data on social dynamics in horses, focusing on dominance and leadership theories and the merits of incorporating those concepts into the human–horse context. This will provide...

  3. E6-associated transcription patterns in human papilloma virus 16-positive cervical tissues.

    Science.gov (United States)

    Lin, Kezhi; Lu, Xulian; Chen, Jun; Zou, Ruanmin; Zhang, Lifang; Xue, Xiangyang

    2015-01-01

    The change in transcription pattern induced by post-transcriptional RNA splicing is an important mechanism in the regulation of the early gene expression of human papilloma virus (HPV). The present study was conducted to establish a method to specifically amplify HPV-16 E6-associated transcripts. The E6-related transcripts from 63 HPV-16-positive cervical tumor tissue samples were amplified, consisting of eight cases of low-risk intraepithelial lesions, 38 cases of high-risk intraepithelial lesions and 17 cases of cervical cancer (CxCa). The appropriate amplified segments were recovered following agarose gel electrophoresis, and subjected to further sequencing and sequence alignment analysis. Six groups of E6 transcription patterns were identified from HPV-16-positive cervical tumor tissue, including five newly-discovered transcripts. Different HPV-16 E6-associated transcription patterns were detected during the development of CxCa. Over the course of the progression of the low-grade squamous intraepithelial lesions to CxCa, the specific HPV-16 E6-associated transcription patterns and the dominant transcripts were all different. As indicated by this study, the transcription pattern of the E6 early gene of HPV-16 was closely associated with the stages of cervical carcinogenesis, and may also be involved in the development of CxCa.

  4. Dominant KCNA2 mutation causes episodic ataxia and pharmacoresponsive epilepsy.

    Science.gov (United States)

    Corbett, Mark A; Bellows, Susannah T; Li, Melody; Carroll, Renée; Micallef, Silvana; Carvill, Gemma L; Myers, Candace T; Howell, Katherine B; Maljevic, Snezana; Lerche, Holger; Gazina, Elena V; Mefford, Heather C; Bahlo, Melanie; Berkovic, Samuel F; Petrou, Steven; Scheffer, Ingrid E; Gecz, Jozef

    2016-11-08

    To identify the genetic basis of a family segregating episodic ataxia, infantile seizures, and heterogeneous epilepsies and to study the phenotypic spectrum of KCNA2 mutations. A family with 7 affected individuals over 3 generations underwent detailed phenotyping. Whole genome sequencing was performed on a mildly affected grandmother and her grandson with epileptic encephalopathy (EE). Segregating variants were filtered and prioritized based on functional annotations. The effects of the mutation on channel function were analyzed in vitro by voltage clamp assay and in silico by molecular modeling. KCNA2 was sequenced in 35 probands with heterogeneous phenotypes. The 7 family members had episodic ataxia (5), self-limited infantile seizures (5), evolving to genetic generalized epilepsy (4), focal seizures (2), and EE (1). They had a segregating novel mutation in the shaker type voltage-gated potassium channel KCNA2 (CCDS_827.1: c.765_773del; p.255_257del). A rare missense SCN2A (rs200884216) variant was also found in 2 affected siblings and their unaffected mother. The p.255_257del mutation caused dominant negative loss of channel function. Molecular modeling predicted repositioning of critical arginine residues in the voltage-sensing domain. KCNA2 sequencing revealed 1 de novo mutation (CCDS_827.1: c.890G>A; p.Arg297Gln) in a girl with EE, ataxia, and tremor. A KCNA2 mutation caused dominantly inherited episodic ataxia, mild infantile-onset seizures, and later generalized and focal epilepsies in the setting of normal intellect. This observation expands the KCNA2 phenotypic spectrum from EE often associated with chronic ataxia, reflecting the marked variation in severity observed in many ion channel disorders. © 2016 American Academy of Neurology.

  5. An LMNB1 Duplication Caused Adult-Onset Autosomal Dominant Leukodystrophy in Chinese Family: Clinical Manifestations, Neuroradiology and Genetic Diagnosis

    Directory of Open Access Journals (Sweden)

    Yi Dai

    2017-07-01

    Full Text Available Autosomal dominant adult-onset demyelinating leukodystrophy (ADLD is a very rare neurological disorder featured with late onset, slowly progressive central nervous system demyelination. Duplication or over expression of the lamin B1 (LMNB1 gene causes ADLD. In this study, we undertook a comprehensive clinical evaluation and genetic detection for a Chinese family with ADLD. The proband is a 52-year old man manifested with autonomic abnormalities, pyramidal tract dysfunction. MRI brain scan identified bilateral symmetric white matter (WM hyper-intensities in periventricular and semi-oval WM, cerebral peduncles and middle cerebellar peduncles. The proband has a positive autosomal dominant family history with similar clinical manifestations with a trend of genetic anticipation. In order to understand the genetic cause of the disease in this family, target exome capture based next generation sequencing has been done, but no causative variants or possibly pathogenic variants has been identified. However, Multiplex ligand-dependent probe amplification (MLPA showed whole duplication of LMNB1 gene which is co-segregated with the disease phenotype in this family. This is the first genetically confirmed LMNB1 associated ADLD pedigree from China.

  6. Some AFLP amplicons are highly conserved DNA sequences mapping to the same linkage groups in two F2 populations of carrot

    Directory of Open Access Journals (Sweden)

    Santos Carlos A.F.

    2002-01-01

    Full Text Available Amplified fragment length polymorphism (AFLP is a fast and reliable tool to generate a large number of DNA markers. In two unrelated F2 populations of carrot (Daucus carota L., Brasilia x HCM and B493 x QAL (wild carrot, it was hypothesized that DNA 1 digested with the same restriction endonuclease enzymes and amplified with the same primer combination and 2 sharing the same position in polyacrylamide gels should be conserved sequences. To test this hypothesis AFLP fragments from polyacrylamide gels were eluted, reamplified, separated in agarose gels, purified, cloned and sequenced. Among thirty-one paired fragments from each F2 population, twenty-six had identity greater than 91% and five presented identity of 24% to 44%. Among the twenty-six conserved AFLPs only one mapped to different linkage groups in the two populations while four of the five less-conserved bands mapped to different linkage groups. Of eight SCAR (sequence characterized amplified regions primers tested, one conserved AFLP resulted in co-dominant markers in both populations. Screening among 14 carrot inbreds or cultivars with three AFLP-SCAR primers revealed clear and polymorphic PCR products, with similar molecular sizes on agarose gels. The development of co-dominant markers based on conserved AFLP fragments will be useful to detect seed mixtures among hybrids, to improve and to merge linkage maps and to study diversity and phylogenetic relationships.

  7. Minimotif Miner 3.0: database expansion and significantly improved reduction of false-positive predictions from consensus sequences.

    Science.gov (United States)

    Mi, Tian; Merlin, Jerlin Camilus; Deverasetty, Sandeep; Gryk, Michael R; Bill, Travis J; Brooks, Andrew W; Lee, Logan Y; Rathnayake, Viraj; Ross, Christian A; Sargeant, David P; Strong, Christy L; Watts, Paula; Rajasekaran, Sanguthevar; Schiller, Martin R

    2012-01-01

    Minimotif Miner (MnM available at http://minimotifminer.org or http://mnm.engr.uconn.edu) is an online database for identifying new minimotifs in protein queries. Minimotifs are short contiguous peptide sequences that have a known function in at least one protein. Here we report the third release of the MnM database which has now grown 60-fold to approximately 300,000 minimotifs. Since short minimotifs are by their nature not very complex we also summarize a new set of false-positive filters and linear regression scoring that vastly enhance minimotif prediction accuracy on a test data set. This online database can be used to predict new functions in proteins and causes of disease.

  8. Yeast genome sequencing:

    DEFF Research Database (Denmark)

    Piskur, Jure; Langkjær, Rikke Breinhold

    2004-01-01

    For decades, unicellular yeasts have been general models to help understand the eukaryotic cell and also our own biology. Recently, over a dozen yeast genomes have been sequenced, providing the basis to resolve several complex biological questions. Analysis of the novel sequence data has shown...... of closely related species helps in gene annotation and to answer how many genes there really are within the genomes. Analysis of non-coding regions among closely related species has provided an example of how to determine novel gene regulatory sequences, which were previously difficult to analyse because...... they are short and degenerate and occupy different positions. Comparative genomics helps to understand the origin of yeasts and points out crucial molecular events in yeast evolutionary history, such as whole-genome duplication and horizontal gene transfer(s). In addition, the accumulating sequence data provide...

  9. Dominance of Endozoicomonas bacteria throughout coral bleaching and mortality suggests structural inflexibility of the Pocillopora verrucosa microbiome

    KAUST Repository

    Pogoreutz, Claudia; Radecker, Nils; Cardenas, Anny; Gä rdes, Astrid; Wild, Christian; Voolstra, Christian R.

    2018-01-01

    sequences. This dominance of Endozoicomonas even under conditions of coral bleaching and mortality suggests the bacterial community of P. verrucosa may be rather inflexible and thereby unable to respond or acclimatize to rapid changes in the environment

  10. [The use of 16S rDNA sequencing in species diversity analysis for sputum of patients with ventilator-associated pneumonia].

    Science.gov (United States)

    Yang, Xiaojun; Wang, Xiaohong; Liang, Zhijuan; Zhang, Xiaoya; Wang, Yanbo; Wang, Zhenhai

    2014-05-01

    To study the species and amount of bacteria in sputum of patients with ventilator-associated pneumonia (VAP) by using 16S rDNA sequencing analysis, and to explore the new method for etiologic diagnosis of VAP. Bronchoalveolar lavage sputum samples were collected from 31 patients with VAP. Bacterial DNA of the samples were extracted and identified by polymerase chain reaction (PCR). At the same time, sputum specimens were processed for routine bacterial culture. The high flux sequencing experiment was conducted on PCR positive samples with 16S rDNA macro genome sequencing technology, and sequencing results were analyzed using bioinformatics, then the results between the sequencing and bacteria culture were compared. (1) 550 bp of specific DNA sequences were amplified in sputum specimens from 27 cases of the 31 patients with VAP, and they were used for sequencing analysis. 103 856 sequences were obtained from those sputum specimens using 16S rDNA sequencing, yielding approximately 39 Mb of raw data. Tag sequencing was able to inform genus level in all 27 samples. (2) Alpha-diversity analysis showed that sputum samples of patients with VAP had significantly higher variability and richness in bacterial species (Shannon index values 1.20, Simpson index values 0.48). Rarefaction curve analysis showed that there were more species that were not detected by sequencing from some VAP sputum samples. (3) Analysis of 27 sputum samples with VAP by using 16S rDNA sequences yielded four phyla: namely Acitinobacteria, Bacteroidetes, Firmicutes, Proteobacteria. With genus as a classification, it was found that the dominant species included Streptococcus 88.9% (24/27), Limnohabitans 77.8% (21/27), Acinetobacter 70.4% (19/27), Sphingomonas 63.0% (17/27), Prevotella 63.0% (17/27), Klebsiella 55.6% (15/27), Pseudomonas 55.6% (15/27), Aquabacterium 55.6% (15/27), and Corynebacterium 55.6% (15/27). (4) Pyrophosphate sequencing discovered that Prevotella, Limnohabitans, Aquabacterium

  11. POWRS: position-sensitive motif discovery.

    Directory of Open Access Journals (Sweden)

    Ian W Davis

    Full Text Available Transcription factors and the short, often degenerate DNA sequences they recognize are central regulators of gene expression, but their regulatory code is challenging to dissect experimentally. Thus, computational approaches have long been used to identify putative regulatory elements from the patterns in promoter sequences. Here we present a new algorithm "POWRS" (POsition-sensitive WoRd Set for identifying regulatory sequence motifs, specifically developed to address two common shortcomings of existing algorithms. First, POWRS uses the position-specific enrichment of regulatory elements near transcription start sites to significantly increase sensitivity, while providing new information about the preferred localization of those elements. Second, POWRS forgoes position weight matrices for a discrete motif representation that appears more resistant to over-generalization. We apply this algorithm to discover sequences related to constitutive, high-level gene expression in the model plant Arabidopsis thaliana, and then experimentally validate the importance of those elements by systematically mutating two endogenous promoters and measuring the effect on gene expression levels. This provides a foundation for future efforts to rationally engineer gene expression in plants, a problem of great importance in developing biotech crop varieties.BSD-licensed Python code at http://grassrootsbio.com/papers/powrs/.

  12. Genomic Model with Correlation Between Additive and Dominance Effects.

    Science.gov (United States)

    Xiang, Tao; Christensen, Ole Fredslund; Vitezica, Zulma Gladis; Legarra, Andres

    2018-05-09

    Dominance genetic effects are rarely included in pedigree-based genetic evaluation. With the availability of single nucleotide polymorphism markers and the development of genomic evaluation, estimates of dominance genetic effects have become feasible using genomic best linear unbiased prediction (GBLUP). Usually, studies involving additive and dominance genetic effects ignore possible relationships between them. It has been often suggested that the magnitude of functional additive and dominance effects at the quantitative trait loci are related, but there is no existing GBLUP-like approach accounting for such correlation. Wellmann and Bennewitz showed two ways of considering directional relationships between additive and dominance effects, which they estimated in a Bayesian framework. However, these relationships cannot be fitted at the level of individuals instead of loci in a mixed model and are not compatible with standard animal or plant breeding software. This comes from a fundamental ambiguity in assigning the reference allele at a given locus. We show that, if there has been selection, assigning the most frequent as the reference allele orients the correlation between functional additive and dominance effects. As a consequence, the most frequent reference allele is expected to have a positive value. We also demonstrate that selection creates negative covariance between genotypic additive and dominance genetic values. For parameter estimation, it is possible to use a combined additive and dominance relationship matrix computed from marker genotypes, and to use standard restricted maximum likelihood (REML) algorithms based on an equivalent model. Through a simulation study, we show that such correlations can easily be estimated by mixed model software and accuracy of prediction for genetic values is slightly improved if such correlations are used in GBLUP. However, a model assuming uncorrelated effects and fitting orthogonal breeding values and dominant

  13. Weighted A-statistical convergence for sequences of positive linear operators.

    Science.gov (United States)

    Mohiuddine, S A; Alotaibi, Abdullah; Hazarika, Bipan

    2014-01-01

    We introduce the notion of weighted A-statistical convergence of a sequence, where A represents the nonnegative regular matrix. We also prove the Korovkin approximation theorem by using the notion of weighted A-statistical convergence. Further, we give a rate of weighted A-statistical convergence and apply the classical Bernstein polynomial to construct an illustrative example in support of our result.

  14. The dominance behavioral system and manic temperament: Motivation for dominance, self-perceptions of power, and socially dominant behaviors

    OpenAIRE

    Johnson, Sheri L.; Carver, Charles S.

    2012-01-01

    The dominance behavioral system has been conceptualized as a biologically based system comprising motivation to achieve social power and self-perceptions of power. Biological, behavioral, and social correlates of dominance motivation and self-perceived power have been related to a range of psychopathological tendencies. Preliminary evidence suggests that mania and risk for mania (manic temperament) relate to the dominance system.

  15. Self-reinforcing dominance interactions between virtual males and females. Hypothesis generation for primate studies

    NARCIS (Netherlands)

    Hemelrijk, C.K.

    2000-01-01

    Although in group-living primates an individual's dominance position is a consequence of its social skills with both sexes, there are few data and hardly any theory on male-female dominance relationships. In order to stimulate a systematic study on this topic, I present a simple individual-oriented

  16. The nucleotide sequences of two leghemoglobin genes from soybean

    DEFF Research Database (Denmark)

    Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O

    1982-01-01

    We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

  17. A New Algorithm Using the Non-Dominated Tree to Improve Non-Dominated Sorting.

    Science.gov (United States)

    Gustavsson, Patrik; Syberfeldt, Anna

    2018-01-01

    Non-dominated sorting is a technique often used in evolutionary algorithms to determine the quality of solutions in a population. The most common algorithm is the Fast Non-dominated Sort (FNS). This algorithm, however, has the drawback that its performance deteriorates when the population size grows. The same drawback applies also to other non-dominating sorting algorithms such as the Efficient Non-dominated Sort with Binary Strategy (ENS-BS). An algorithm suggested to overcome this drawback is the Divide-and-Conquer Non-dominated Sort (DCNS) which works well on a limited number of objectives but deteriorates when the number of objectives grows. This article presents a new, more efficient algorithm called the Efficient Non-dominated Sort with Non-Dominated Tree (ENS-NDT). ENS-NDT is an extension of the ENS-BS algorithm and uses a novel Non-Dominated Tree (NDTree) to speed up the non-dominated sorting. ENS-NDT is able to handle large population sizes and a large number of objectives more efficiently than existing algorithms for non-dominated sorting. In the article, it is shown that with ENS-NDT the runtime of multi-objective optimization algorithms such as the Non-Dominated Sorting Genetic Algorithm II (NSGA-II) can be substantially reduced.

  18. Analysis of risk-dominant sequences by MAAP3.0 for Kuosheng Nuclear Power Plant

    International Nuclear Information System (INIS)

    Lin, J.D.; Chieng, C.C.; Wang, T.K.; Hsiue, R.K.

    1987-01-01

    Kuosheng Nuclear Power Plant is the first operating model-6/Mark III boiling water reactor (BWR6/Mark III) in the world, and a probabilistic risk assessment (PRA) has been performed to determine the likely frequencies of core melt accidents and the magnitude, composition, and fraction of fission products released in these accidents. The final report of this PRA indicates that categories 8 and 15 are ranked No. 1 by risk index (the product of release frequency and release fraction) and release frequency, respectively. The dominant contributors of these two categories are frequent earthquakes and typhoons

  19. Evaluation of positive Rift Valley fever virus formalin-fixed paraffin embedded samples as a source of sequence data for retrospective phylogenetic analysis.

    Science.gov (United States)

    Mubemba, B; Thompson, P N; Odendaal, L; Coetzee, P; Venter, E H

    2017-05-01

    Rift Valley fever (RVF), caused by an arthropod borne Phlebovirus in the family Bunyaviridae, is a haemorrhagic disease that affects ruminants and humans. Due to the zoonotic nature of the virus, a biosafety level 3 laboratory is required for isolation of the virus. Fresh and frozen samples are the preferred sample type for isolation and acquisition of sequence data. However, these samples are scarce in addition to posing a health risk to laboratory personnel. Archived formalin-fixed, paraffin-embedded (FFPE) tissue samples are safe and readily available, however FFPE derived RNA is in most cases degraded and cross-linked in peptide bonds and it is unknown whether the sample type would be suitable as reference material for retrospective phylogenetic studies. A RT-PCR assay targeting a 490 nt portion of the structural G N glycoprotein encoding gene of the RVFV M-segment was applied to total RNA extracted from archived RVFV positive FFPE samples. Several attempts to obtain target amplicons were unsuccessful. FFPE samples were then analysed using next generation sequencing (NGS), i.e. Truseq ® (Illumina) and sequenced on the Miseq ® genome analyser (Illumina). Using reference mapping, gapped virus sequence data of varying degrees of shallow depth was aligned to a reference sequence. However, the NGS did not yield long enough contigs that consistently covered the same genome regions in all samples to allow phylogenetic analysis. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Use of tuf as a target for sequence-based identification of Gram-positive cocci of the genus Enterococcus, Streptococcus, coagulase-negative Staphylococcus, and Lactococcus

    Directory of Open Access Journals (Sweden)

    Li Xuerui

    2012-11-01

    Full Text Available Abstract Background Accurate identification of isolates belonging to genus Enterococcus, Streptococcus, coagulase-negative Staphylococcus, and Lactococcus at the species level is necessary to provide a better understanding of their pathogenic potential, to aid in making clinical decisions, and to conduct epidemiologic investigations,especially when large blind samples must be analyzed. It is useful to simultaneously identify species in different genera using a single primer pair. Methods We developed a primer pair based on the tuf gene (encoding elongation factor sequence to identify 56 Gram-positive cocci isolates. Results The target sequences were amplified from all 56 samples. The sequencing results and the phylogenetic tree derived from the partial tuf gene sequences identified the isolates as three enterococcal species, two lactococcal species, two staphylococcal species, and six streptococcal species, as well as eight isolates that were novel species of the genus Streptococcus. Partial gene sequence analysis of the sodA, dnaK, and 16S RNA genes confirmed the results obtained by tuf gene sequencing. Conclusion Based on the uniform amplification of the tuf gene from all samples and the ability to identify all isolates at both the genus and species levels, we conclude that the primer pair developed in this research provides a powerful tool for identifying these organisms in clinical laboratories where large blind samples are used.

  1. Dominance genetic variance for traits under directional selection in Drosophila serrata.

    Science.gov (United States)

    Sztepanacz, Jacqueline L; Blows, Mark W

    2015-05-01

    In contrast to our growing understanding of patterns of additive genetic variance in single- and multi-trait combinations, the relative contribution of nonadditive genetic variance, particularly dominance variance, to multivariate phenotypes is largely unknown. While mechanisms for the evolution of dominance genetic variance have been, and to some degree remain, subject to debate, the pervasiveness of dominance is widely recognized and may play a key role in several evolutionary processes. Theoretical and empirical evidence suggests that the contribution of dominance variance to phenotypic variance may increase with the correlation between a trait and fitness; however, direct tests of this hypothesis are few. Using a multigenerational breeding design in an unmanipulated population of Drosophila serrata, we estimated additive and dominance genetic covariance matrices for multivariate wing-shape phenotypes, together with a comprehensive measure of fitness, to determine whether there is an association between directional selection and dominance variance. Fitness, a trait unequivocally under directional selection, had no detectable additive genetic variance, but significant dominance genetic variance contributing 32% of the phenotypic variance. For single and multivariate morphological traits, however, no relationship was observed between trait-fitness correlations and dominance variance. A similar proportion of additive and dominance variance was found to contribute to phenotypic variance for single traits, and double the amount of additive compared to dominance variance was found for the multivariate trait combination under directional selection. These data suggest that for many fitness components a positive association between directional selection and dominance genetic variance may not be expected. Copyright © 2015 by the Genetics Society of America.

  2. Weighted A-Statistical Convergence for Sequences of Positive Linear Operators

    Directory of Open Access Journals (Sweden)

    S. A. Mohiuddine

    2014-01-01

    Full Text Available We introduce the notion of weighted A-statistical convergence of a sequence, where A represents the nonnegative regular matrix. We also prove the Korovkin approximation theorem by using the notion of weighted A-statistical convergence. Further, we give a rate of weighted A-statistical convergence and apply the classical Bernstein polynomial to construct an illustrative example in support of our result.

  3. Value of a dixon-based MR/PET attenuation correction sequence for the localization and evaluation of PET-positive lesions

    International Nuclear Information System (INIS)

    Eiber, Matthias; Holzapfel, Konstantin; Rummeny, Ernst J.; Martinez-Moeller, Axel; Souvatzoglou, Michael; Ziegler, Sibylle; Schwaiger, Markus; Nekolla, Stephan G.; Beer, Ambros J.; Pickhard, Anja; Loeffelbein, Dennys; Santi, Ivan

    2011-01-01

    In this study, the potential contribution of Dixon-based MR imaging with a rapid low-resolution breath-hold sequence, which is a technique used for MR-based attenuation correction (AC) for MR/positron emission tomography (PET), was evaluated for anatomical correlation of PET-positive lesions on a 3T clinical scanner compared to low-dose CT. This technique is also used in a recently installed fully integrated whole-body MR/PET system. Thirty-five patients routinely scheduled for oncological staging underwent 18 F-fluorodeoxyglucose (FDG) PET/CT and a 2-point Dixon 3-D volumetric interpolated breath-hold examination (VIBE) T1-weighted MR sequence on the same day. Two PET data sets reconstructed using attenuation maps from low-dose CT (PET AC C T ) or simulated MR-based segmentation (PET AC M R ) were evaluated for focal PET-positive lesions. The certainty for the correlation with anatomical structures was judged in the low-dose CT and Dixon-based MRI on a 4-point scale (0-3). In addition, the standardized uptake values (SUVs) for PET AC C T and PET AC M R were compared. Statistically, no significant difference could be found concerning anatomical localization for all 81 PET-positive lesions in low-dose CT compared to Dixon-based MR (mean 2.51 ± 0.85 and 2.37 ± 0.87, respectively; p = 0.1909). CT tended to be superior for small lymph nodes, bone metastases and pulmonary nodules, while Dixon-based MR proved advantageous for soft tissue pathologies like head/neck tumours and liver metastases. For the PET AC C T - and PET AC M R -based SUVs (mean 6.36 ± 4.47 and 6.31 ± 4.52, respectively) a nearly complete concordance with a highly significant correlation was found (r = 0.9975, p < 0.0001). Dixon-based MR imaging for MR AC allows for anatomical allocation of PET-positive lesions similar to low-dose CT in conventional PET/CT. Thus, this approach appears to be useful for future MR/PET for body regions not fully covered by diagnostic MRI due to potential time

  4. Personality predicts social dominance in male domestic fowl.

    Directory of Open Access Journals (Sweden)

    Anna Favati

    Full Text Available Individuals in social species commonly form dominance relationships, where dominant individuals enjoy greater access to resources compared to subordinates. A range of factors such as sex, age, body size and prior experiences has to varying degrees been observed to affect the social status an individual obtains. Recent work on animal personality (i.e. consistent variation in behavioural responses of individuals demonstrates that personality can co-vary with social status, suggesting that also behavioural variation can play an important role in establishment of status. We investigated whether personality could predict the outcome of duels between pairs of morphologically matched male domestic fowl (Gallus gallus domesticus, a species where individuals readily form social hierarchies. We found that males that more quickly explored a novel arena, or remained vigilant for a longer period following the playback of a warning call were more likely to obtain a dominant position. These traits were uncorrelated to each other and were also uncorrelated to aggression during the initial part of the dominance-determining duel. Our results indicate that several behavioural traits independently play a role in the establishment of social status, which in turn can have implications for the reproductive success of different personality types.

  5. Social Dominance Orientation Relates to Believing Men Should Dominate Sexually, Sexual Self-Efficacy, and Taking Free Female Condoms Among Undergraduate Women and Men.

    Science.gov (United States)

    Rosenthal, Lisa; Levy, Sheri R; Earnshaw, Valerie A

    2012-12-01

    Gendered-based power affects heterosexual relationships, with beliefs in the U.S. prescribing that men dominate women sexually. We draw on social dominance theory to examine whether women's and men's level of support for group-based hierarchy (i.e., social dominance orientation; SDO) helps explain gender-based power beliefs and dynamics in heterosexual relationships. We conducted a laboratory study at a Northeastern U.S. university among 357 women and 126 men undergraduates who reported being heterosexual and sexually active, testing three sets of hypotheses. First, as hypothesized, women endorsed SDO and the belief that men should dominate sexually less than men did. Second, as hypothesized, among women and men, SDO was positively correlated with the belief that men should dominate sexually, and negatively correlated with sexual self-efficacy (confidence in sexual situations) and number of female condoms (a woman-controlled source of protection) taken. Third, structural equation modeling, controlling for age, family income, number of sexual partners in the past month, and perceived HIV/AIDS risk, supported the hypothesis that among women and men, the belief that men should dominate sexually mediates SDO's association with sexual self-efficacy. The hypothesis that the belief that men should dominate sexually mediates SDO's association with number of female condoms taken was supported for women only. The hypothesis that sexual self-efficacy mediates SDO's association with number of female condoms taken was not supported. Results suggest SDO influences power beliefs and dynamics in heterosexual relationships. Although female condoms are an important woman-controlled source of protection, power-related beliefs may pose a challenge to their use.

  6. The social dominance paradox.

    Science.gov (United States)

    Cook, Jennifer Louise; den Ouden, Hanneke E M; Heyes, Cecilia M; Cools, Roshan

    2014-12-01

    Dominant individuals report high levels of self-sufficiency, self-esteem, and authoritarianism. The lay stereotype suggests that such individuals ignore information from others, preferring to make their own choices. However, the nonhuman animal literature presents a conflicting view, suggesting that dominant individuals are avid social learners, whereas subordinates focus on learning from private experience. Whether dominant humans are best characterized by the lay stereotype or the animal view is currently unknown. Here, we present a "social dominance paradox": using self-report scales and computerized tasks, we demonstrate that socially dominant people explicitly value independence, but, paradoxically, in a complex decision-making task, they show an enhanced reliance (relative to subordinate individuals) on social learning. More specifically, socially dominant people employed a strategy of copying other agents when the agents' responses had a history of being correct. However, in humans, two subtypes of dominance have been identified: aggressive and social. Aggressively dominant individuals, who are as likely to "get their own way" as socially dominant individuals but who do so through the use of aggressive or Machiavellian tactics, did not use social information, even when it was beneficial to do so. This paper presents the first study of dominance and social learning in humans and challenges the lay stereotype in which all dominant individuals ignore others' views. The more subtle perspective we offer could have important implications for decision making in both the boardroom and the classroom. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Deletion of Indian hedgehog gene causes dominant semi-lethal Creeper trait in chicken

    Science.gov (United States)

    Jin, Sihua; Zhu, Feng; Wang, Yanyun; Yi, Guoqiang; Li, Junying; Lian, Ling; Zheng, Jiangxia; Xu, Guiyun; Jiao, Rengang; Gong, Yu; Hou, Zhuocheng; Yang, Ning

    2016-01-01

    The Creeper trait, a classical monogenic phenotype of chicken, is controlled by a dominant semi-lethal gene. This trait has been widely cited in the genetics and molecular biology textbooks for illustrating autosomal dominant semi-lethal inheritance over decades. However, the genetic basis of the Creeper trait remains unknown. Here we have utilized ultra-deep sequencing and extensive analysis for targeting causative mutation controlling the Creeper trait. Our results indicated that the deletion of Indian hedgehog (IHH) gene was only found in the whole-genome sequencing data of lethal embryos and Creeper chickens. Large scale segregation analysis demonstrated that the deletion of IHH was fully linked with early embryonic death and the Creeper trait. Expression analysis showed a much lower expression of IHH in Creeper than wild-type chickens. We therefore suggest the deletion of IHH to be the causative mutation for the Creeper trait in chicken. Our findings unravel the genetic basis of the longstanding Creeper phenotype mystery in chicken as the same gene also underlies bone dysplasia in human and mouse, and thus highlight the significance of IHH in animal development and human haploinsufficiency disorders. PMID:27439785

  8. Proline: the distribution, frequency, positioning, and common functional roles of proline and polyproline sequences in the human proteome.

    Directory of Open Access Journals (Sweden)

    Alexander A Morgan

    Full Text Available Proline is an anomalous amino acid. Its nitrogen atom is covalently locked within a ring, thus it is the only proteinogenic amino acid with a constrained phi angle. Sequences of three consecutive prolines can fold into polyproline helices, structures that join alpha helices and beta pleats as architectural motifs in protein configuration. Triproline helices are participants in protein-protein signaling interactions. Longer spans of repeat prolines also occur, containing as many as 27 consecutive proline residues. Little is known about the frequency, positioning, and functional significance of these proline sequences. Therefore we have undertaken a systematic bioinformatics study of proline residues in proteins. We analyzed the distribution and frequency of 687,434 proline residues among 18,666 human proteins, identifying single residues, dimers, trimers, and longer repeats. Proline accounts for 6.3% of the 10,882,808 protein amino acids. Of all proline residues, 4.4% are in trimers or longer spans. We detected patterns that influence function based on proline location, spacing, and concentration. We propose a classification based on proline-rich, polyproline-rich, and proline-poor status. Whereas singlet proline residues are often found in proteins that display recurring architectural patterns, trimers or longer proline sequences tend be associated with the absence of repetitive structural motifs. Spans of 6 or more are associated with DNA/RNA processing, actin, and developmental processes. We also suggest a role for proline in Kruppel-type zinc finger protein control of DNA expression, and in the nucleation and translocation of actin by the formin complex.

  9. Phylogenetic diversity of dominant bacterial communities during bioremediation of crude oil-polluted soil

    Directory of Open Access Journals (Sweden)

    Eugene Thomas Cloete

    2011-08-01

    degradation. Cluster analysis of DGGE bands using simple matching group average setting revealed that poultry droppings-amended soils and calcium ammonium nitrate-amended soils formed distinct clades meaning that the treatment selected similar bacterial populations for each of the treatments whereas NPK soils showed less association. Excision, reamplification and sequencing of dominant DGGE bands in biostimulated soils revealed the presence of distinct hydrocarbon degraders like Corynebacterium spp., Dietzia spp., low G+C Gram positive bacteria and some uncultured bacterial clones. Phylogenetic analysis of the 16S rRNA gene sequences of these dominant bacterial communities was conducted using the neighbour joining method of PHYLIP. Two distinct clades appeared in the tree clustered members of the Actinobacteria and Firmicutes separately. The overall data suggested that Gram positive bacteria especially members of the Actinobacteria may have a key role in bioremediation of crude oil-polluted soil.

  10. POU4F3 mutation screening in Japanese hearing loss patients: Massively parallel DNA sequencing-based analysis identified novel variants associated with autosomal dominant hearing loss.

    Directory of Open Access Journals (Sweden)

    Tomohiro Kitano

    Full Text Available A variant in a transcription factor gene, POU4F3, is responsible for autosomal dominant nonsyndromic hereditary hearing loss, DFNA15. To date, 14 variants, including a whole deletion of POU4F3, have been reported to cause HL in various ethnic groups. In the present study, genetic screening for POU4F3 variants was carried out for a large series of Japanese hearing loss (HL patients to clarify the prevalence and clinical characteristics of DFNA15 in the Japanese population. Massively parallel DNA sequencing of 68 target candidate genes was utilized in 2,549 unrelated Japanese HL patients (probands to identify genomic variations responsible for HL. The detailed clinical features in patients with POU4F3 variants were collected from medical charts and analyzed. Novel 12 POU4F3 likely pathogenic variants (six missense variants, three frameshift variants, and three nonsense variants were successfully identified in 15 probands (2.5% among 602 families exhibiting autosomal dominant HL, whereas no variants were detected in the other 1,947 probands with autosomal recessive or inheritance pattern unknown HL. To obtain the audiovestibular configuration of the patients harboring POU4F3 variants, we collected audiograms and vestibular symptoms of the probands and their affected family members. Audiovestibular phenotypes in a total of 24 individuals from the 15 families possessing variants were characterized by progressive HL, with a large variation in the onset age and severity with or without vestibular symptoms observed. Pure-tone audiograms indicated the most prevalent configuration as mid-frequency HL type followed by high-frequency HL type, with asymmetry observed in approximately 20% of affected individuals. Analysis of the relationship between age and pure-tone average suggested that individuals with truncating variants showed earlier onset and slower progression of HL than did those with non-truncating variants. The present study showed that variants

  11. Position-dependent Effects of Polylysine on Sec Protein Transport*

    Science.gov (United States)

    Liang, Fu-Cheng; Bageshwar, Umesh K.; Musser, Siegfried M.

    2012-01-01

    The bacterial Sec protein translocation system catalyzes the transport of unfolded precursor proteins across the cytoplasmic membrane. Using a recently developed real time fluorescence-based transport assay, the effects of the number and distribution of positive charges on the transport time and transport efficiency of proOmpA were examined. As expected, an increase in the number of lysine residues generally increased transport time and decreased transport efficiency. However, the observed effects were highly dependent on the polylysine position in the mature domain. In addition, a string of consecutive positive charges generally had a more significant effect on transport time and efficiency than separating the charges into two or more charged segments. Thirty positive charges distributed throughout the mature domain resulted in effects similar to 10 consecutive charges near the N terminus of the mature domain. These data support a model in which the local effects of positive charge on the translocation kinetics dominate over total thermodynamic constraints. The rapid translocation kinetics of some highly charged proOmpA mutants suggest that the charge is partially shielded from the electric field gradient during transport, possibly by the co-migration of counter ions. The transport times of precursors with multiple positively charged sequences, or “pause sites,” were fairly well predicted by a local effect model. However, the kinetic profile predicted by this local effect model was not observed. Instead, the transport kinetics observed for precursors with multiple polylysine segments support a model in which translocation through the SecYEG pore is not the rate-limiting step of transport. PMID:22367204

  12. Position-dependent effects of polylysine on Sec protein transport.

    Science.gov (United States)

    Liang, Fu-Cheng; Bageshwar, Umesh K; Musser, Siegfried M

    2012-04-13

    The bacterial Sec protein translocation system catalyzes the transport of unfolded precursor proteins across the cytoplasmic membrane. Using a recently developed real time fluorescence-based transport assay, the effects of the number and distribution of positive charges on the transport time and transport efficiency of proOmpA were examined. As expected, an increase in the number of lysine residues generally increased transport time and decreased transport efficiency. However, the observed effects were highly dependent on the polylysine position in the mature domain. In addition, a string of consecutive positive charges generally had a more significant effect on transport time and efficiency than separating the charges into two or more charged segments. Thirty positive charges distributed throughout the mature domain resulted in effects similar to 10 consecutive charges near the N terminus of the mature domain. These data support a model in which the local effects of positive charge on the translocation kinetics dominate over total thermodynamic constraints. The rapid translocation kinetics of some highly charged proOmpA mutants suggest that the charge is partially shielded from the electric field gradient during transport, possibly by the co-migration of counter ions. The transport times of precursors with multiple positively charged sequences, or "pause sites," were fairly well predicted by a local effect model. However, the kinetic profile predicted by this local effect model was not observed. Instead, the transport kinetics observed for precursors with multiple polylysine segments support a model in which translocation through the SecYEG pore is not the rate-limiting step of transport.

  13. Dominant petroleum hydrocarbon-degrading bacteria in the Archipelago Sea in South-West Finland (Baltic Sea) belong to different taxonomic groups than hydrocarbon degraders in the oceans.

    Science.gov (United States)

    Reunamo, Anna; Riemann, Lasse; Leskinen, Piia; Jørgensen, Kirsten S

    2013-07-15

    The natural petroleum hydrocarbon degrading capacity of the Archipelago Sea water in S-W Finland was studied in a microcosm experiment. Pristine and previously oil exposed sites were examined. Bacterial community fingerprinting was performed using terminal restriction fragment length polymorphism (T-RFLP) and samples from selected microcosms were sequenced. The abundance of PAH degradation genes was measured by quantitative PCR. Bacterial communities in diesel exposed microcosms diverged from control microcosms during the experiment. Gram positive PAH degradation genes dominated at both sites in situ, whereas gram negative PAH degrading genes became enriched in diesel microcosms. The dominant bacterial groups after a 14 days of diesel exposure were different depending on the sampling site, belonging to the class Actinobacteria (32%) at a pristine site and Betaproteobacteria (52%) at a previously oil exposed site. The hydrocarbon degrading bacteria in the Baltic Sea differ from those in the oceans, where most hydrocarbon degraders belong to Gammaproteobacteria. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. An intuitive graphical webserver for multiple-choice protein sequence search.

    Science.gov (United States)

    Banky, Daniel; Szalkai, Balazs; Grolmusz, Vince

    2014-04-10

    Every day tens of thousands of sequence searches and sequence alignment queries are submitted to webservers. The capitalized word "BLAST" becomes a verb, describing the act of performing sequence search and alignment. However, if one needs to search for sequences that contain, for example, two hydrophobic and three polar residues at five given positions, the query formation on the most frequently used webservers will be difficult. Some servers support the formation of queries with regular expressions, but most of the users are unfamiliar with their syntax. Here we present an intuitive, easily applicable webserver, the Protein Sequence Analysis server, that allows the formation of multiple choice queries by simply drawing the residues to their positions; if more than one residue are drawn to the same position, then they will be nicely stacked on the user interface, indicating the multiple choice at the given position. This computer-game-like interface is natural and intuitive, and the coloring of the residues makes possible to form queries requiring not just certain amino acids in the given positions, but also small nonpolar, negatively charged, hydrophobic, positively charged, or polar ones. The webserver is available at http://psa.pitgroup.org. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Molecular Diagnostic Experience of Whole-Exome Sequencing in Adult Patients

    Science.gov (United States)

    Posey, Jennifer E.; Rosenfeld, Jill A.; James, Regis A.; Bainbridge, Matthew; Niu, Zhiyv; Wang, Xia; Dhar, Shweta; Wiszniewski, Wojciech; Akdemir, Zeynep H.C.; Gambin, Tomasz; Xia, Fan; Person, Richard E.; Walkiewicz, Magdalena; Shaw, Chad A.; Sutton, V. Reid; Beaudet, Arthur L.; Muzny, Donna; Eng, Christine M.; Yang, Yaping; Gibbs, Richard A.; Lupski, James R.; Boerwinkle, Eric; Plon, Sharon E.

    2015-01-01

    Purpose Whole exome sequencing (WES) is increasingly used as a diagnostic tool in medicine, but prior reports focus on predominantly pediatric cohorts with neurologic or developmental disorders. We describe the diagnostic yield and characteristics of whole exome sequencing in adults. Methods We performed a retrospective analysis of consecutive WES reports for adults from a diagnostic laboratory. Phenotype composition was determined using Human Phenotype Ontology terms. Results Molecular diagnoses were reported for 17.5% (85/486) of adults, lower than a primarily pediatric population (25.2%; p=0.0003); the diagnostic rate was higher (23.9%) in those 18–30 years of age compared to patients over 30 years (10.4%; p=0.0001). Dual Mendelian diagnoses contributed to 7% of diagnoses, revealing blended phenotypes. Diagnoses were more frequent among individuals with abnormalities of the nervous system, skeletal system, head/neck, and growth. Diagnostic rate was independent of family history information, and de novo mutations contributed to 61.4% of autosomal dominant diagnoses. Conclusion Early WES experience in adults demonstrates molecular diagnoses in a substantial proportion of patients, informing clinical management, recurrence risk and recommendations for relatives. A positive family history was not predictive, consistent with molecular diagnoses often revealed by de novo events, informing the Mendelian basis of genetic disease in adults. PMID:26633545

  16. Universitetsundervisningens (u)mulige position i Akademia

    DEFF Research Database (Denmark)

    Sørensen, Kasper Anthon

    2016-01-01

    uses positioning theory to analyse how six interviewed academics position themselves and others as right and wrong participants in Academia in relation to their teaching and research activities. My analysis shows that a dominant research discourse, driven by a harsh research-publishing obligation...

  17. INTERACTION ASPECTS OF DOMINANT STYLES: OF TEACHING AND OF AUTHORITY

    Directory of Open Access Journals (Sweden)

    Cristian PETRE

    2014-04-01

    Full Text Available Problem Statement. Teaching style is the expression (form of expression of preferred behavioral modalities who return with some regularity in the work of teacher (E.Geissler, Purpose of Study. The intention of this paper is to identify a pattern of expression interact between two dimensions-professional of primary school teachers: the dominant teaching style and the dominant authority type of each teacher. I opted for a classification according to the particular act of communication: emotional-improvising style, emotional-methodical style, rational-improvising style and rational-methodical style. Methods. To identify the dominant teaching style was built a questionnaire consisting of 16 questions. The second questionnaire was proposed for a self-evaluative kind of authority expressed in the daily professional work. To identify the dominant type of authority were updated two classifications: traditional axis authoritarian - democratic - laissez-faire and a classification inspired by John RP French and B. Raven expert authority, rewards, position and personal. In this investigation were involved 30 teachers for primary education. Findings and Results. Exists a moderate correlation between rational-improvising style and authoritarian and position styles of authority. Also, indicates significant statistical connection between rational-improviser teaching style and authoritarian, democratic and expert teacher’s authority. The indexes indicate statistical connections moderate correlation between rational-methodical style and personal authority. The indexes of correlation indicates significant statistical link between emotional-improvisational style teaching styles and reward and expert authority. The indexes indicate statistical connections moderate correlation between emotional-style improvisation and styles of authority laissez-faire, and his model.

  18. Yeasts dominate soil fungal communities in three lowland Neotropical rainforests.

    Science.gov (United States)

    Dunthorn, Micah; Kauserud, Håvard; Bass, David; Mayor, Jordan; Mahé, Frédéric

    2017-10-01

    Forest soils typically harbour a vast diversity of fungi, but are usually dominated by filamentous (hyphae-forming) taxa. Compared to temperate and boreal forests, though, we have limited knowledge about the fungal diversity in tropical rainforest soils. Here we show, by environmental metabarcoding of soil samples collected in three Neotropical rainforests, that Yeasts dominate the fungal communities in terms of the number of sequencing reads and OTUs. These unicellular forms are commonly found in aquatic environments, and their hyperdiversity may be the result of frequent inundation combined with numerous aquatic microenvironments in these rainforests. Other fungi that are frequent in aquatic environments, such as the abundant Chytridiomycotina, were also detected. While there was low similarity in OTU composition within and between the three rainforests, the fungal communities in Central America were more similar to each other than the communities in South America, reflecting a general biogeographic pattern also seen in animals, plants and protists. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  19. Perceptual Dominant Color Extraction by Multidimensional Particle Swarm Optimization

    Directory of Open Access Journals (Sweden)

    Moncef Gabbouj

    2009-01-01

    Full Text Available Color is the major source of information widely used in image analysis and content-based retrieval. Extracting dominant colors that are prominent in a visual scenery is of utmost importance since the human visual system primarily uses them for perception and similarity judgment. In this paper, we address dominant color extraction as a dynamic clustering problem and use techniques based on Particle Swarm Optimization (PSO for finding optimal (number of dominant colors in a given color space, distance metric and a proper validity index function. The first technique, so-called Multidimensional (MD PSO can seek both positional and dimensional optima. Nevertheless, MD PSO is still susceptible to premature convergence due to lack of divergence. To address this problem we then apply Fractional Global Best Formation (FGBF technique. In order to extract perceptually important colors and to further improve the discrimination factor for a better clustering performance, an efficient color distance metric, which uses a fuzzy model for computing color (dis- similarities over HSV (or HSL color space is proposed. The comparative evaluations against MPEG-7 dominant color descriptor show the superiority of the proposed technique.

  20. Management of High-Throughput DNA Sequencing Projects: Alpheus.

    Science.gov (United States)

    Miller, Neil A; Kingsmore, Stephen F; Farmer, Andrew; Langley, Raymond J; Mudge, Joann; Crow, John A; Gonzalez, Alvaro J; Schilkey, Faye D; Kim, Ryan J; van Velkinburgh, Jennifer; May, Gregory D; Black, C Forrest; Myers, M Kathy; Utsey, John P; Frost, Nicholas S; Sugarbaker, David J; Bueno, Raphael; Gullans, Stephen R; Baxter, Susan M; Day, Steve W; Retzel, Ernest F

    2008-12-26

    High-throughput DNA sequencing has enabled systems biology to begin to address areas in health, agricultural and basic biological research. Concomitant with the opportunities is an absolute necessity to manage significant volumes of high-dimensional and inter-related data and analysis. Alpheus is an analysis pipeline, database and visualization software for use with massively parallel DNA sequencing technologies that feature multi-gigabase throughput characterized by relatively short reads, such as Illumina-Solexa (sequencing-by-synthesis), Roche-454 (pyrosequencing) and Applied Biosystem's SOLiD (sequencing-by-ligation). Alpheus enables alignment to reference sequence(s), detection of variants and enumeration of sequence abundance, including expression levels in transcriptome sequence. Alpheus is able to detect several types of variants, including non-synonymous and synonymous single nucleotide polymorphisms (SNPs), insertions/deletions (indels), premature stop codons, and splice isoforms. Variant detection is aided by the ability to filter variant calls based on consistency, expected allele frequency, sequence quality, coverage, and variant type in order to minimize false positives while maximizing the identification of true positives. Alpheus also enables comparisons of genes with variants between cases and controls or bulk segregant pools. Sequence-based differential expression comparisons can be developed, with data export to SAS JMP Genomics for statistical analysis.

  1. Truncating SLC5A7 mutations underlie a spectrum of dominant hereditary motor neuropathies.

    Science.gov (United States)

    Salter, Claire G; Beijer, Danique; Hardy, Holly; Barwick, Katy E S; Bower, Matthew; Mademan, Ines; De Jonghe, Peter; Deconinck, Tine; Russell, Mark A; McEntagart, Meriel M; Chioza, Barry A; Blakely, Randy D; Chilton, John K; De Bleecker, Jan; Baets, Jonathan; Baple, Emma L; Walk, David; Crosby, Andrew H

    2018-04-01

    To identify the genetic cause of disease in 2 previously unreported families with forms of distal hereditary motor neuropathies (dHMNs). The first family comprises individuals affected by dHMN type V, which lacks the cardinal clinical feature of vocal cord paralysis characteristic of dHMN-VII observed in the second family. Next-generation sequencing was performed on the proband of each family. Variants were annotated and filtered, initially focusing on genes associated with neuropathy. Candidate variants were further investigated and confirmed by dideoxy sequence analysis and cosegregation studies. Thorough patient phenotyping was completed, comprising clinical history, examination, and neurologic investigation. dHMNs are a heterogeneous group of peripheral motor neuron disorders characterized by length-dependent neuropathy and progressive distal limb muscle weakness and wasting. We previously reported a dominant-negative frameshift mutation located in the concluding exon of the SLC5A7 gene encoding the choline transporter (CHT), leading to protein truncation, as the likely cause of dominantly-inherited dHMN-VII in an extended UK family. In this study, our genetic studies identified distinct heterozygous frameshift mutations located in the last coding exon of SLC5A7 , predicted to result in the truncation of the CHT C-terminus, as the likely cause of the condition in each family. This study corroborates C-terminal CHT truncation as a cause of autosomal dominant dHMN, confirming upper limb predominating over lower limb involvement, and broadening the clinical spectrum arising from CHT malfunction.

  2. Eurasian otters, Lutra lutra, have a dominant mtDNA haplotype from the Iberian Peninsula to Scandinavia.

    Science.gov (United States)

    Ferrando, Ainhoa; Ponsà, Montserrat; Marmi, Josep; Domingo-Roura, Xavier

    2004-01-01

    The Eurasian otter, Lutra lutra, has a Palaearctic distribution and has suffered a severe decline throughout Europe during the last century. Previous studies in this and other mustelids have shown reduced levels of variability in mitochondrial DNA, although otter phylogeographic studies were restricted to central-western Europe. In this work we have sequenced 361 bp of the mtDNA control region in 73 individuals from eight countries and added our results to eight sequences available from GenBank and the literature. The range of distribution has been expanded in relation to previous works north towards Scandinavia, east to Russia and Belarus, and south to the Iberian Peninsula. We found a single dominant haplotype in 91.78% of the samples, and six more haplotypes deviating a maximum of two mutations from the dominant haplotype restricted to a single country. Variability was extremely low in western Europe but higher in eastern countries. This, together with the lack of phylogeographical structuring, supports the postglacial recolonization of Europe from a single refugium. The Eurasian otter mtDNA control region has a 220-bp variable minisatellite in Domain III that we sequenced in 29 otters. We found a total of 19 minisatellite haplotypes, but they showed no phylogenetic information.

  3. Cloning, sequence and expression of the pel gene from an Amycolata sp.

    Science.gov (United States)

    Brühlmann, F; Keen, N T

    1997-11-20

    The pel gene from an Amycolata sp. encoding a pectate lyase (EC 4.2.2.2) was isolated by activity screening a genomic DNA library in Streptomyces lividans TK24. Subsequent subcloning and sequencing of a 2.3 kb BamHI BglII fragment revealed an open reading frame of 930 nt corresponding to a protein of 29,660 Da. The overall G + C content for the coding region was 65%, with a strong G + C preference in the third (wobble) codon position (93%). A putative ribosome-binding site 5'-GGGAG-3' preceded the translational start codon by 7 base pairs. The Amycolata pectate lyase contains a signal peptide of 26 amino acids, that is cleaved after the sequence Ala-Thr-Ala. The size of the deduced protein as well as its N-terminal amino-acid sequence match the wild-type pectate lyase from the Amycolata sp. Expression of the pel gene in S. lividans TK24 resulted in high pectate lyase activity in the culture supernatant, concomitant with the appearance of a dominant protein band on a sodium dodecyl polyacrylamide gel at 30 kDa. No pectate lyase activity was detected in E. coli BL21 with the pel gene under the strong T7 promotor. The deduced amino-acid sequence showed 40% identity with PelE from Erwinia chrysanthemi and the pectate lyase from Glomerella cingulata. The Amycolata pectate lyase clearly belongs to the pectate lyase superfamily, sharing all functional amino acids and likely has a similar structural topology as Pels from Erwinia chrysanthemi and Bacillus subtilis.

  4. Counselor-Advocate-Scholar Model: Changing the Dominant Discourse in Counseling

    Science.gov (United States)

    Ratts, Manivong J.; Greenleaf, Arie T.

    2018-01-01

    Discourse represents the languages, ideas, and images that together shape one's understanding of the world. In counseling, discourse determines clinical practice. The authors posit that dominant discourse in counseling promotes an intrapsychic status quo that discounts the relationship between individuals and their environment, which often leads…

  5. Dispersed repetitive sequences in eukaryotic genomes and their possible biological significance

    International Nuclear Information System (INIS)

    Georgiev, G.P.; Kramerov, D.A.; Ryskov, A.P.; Skryabin, K.G.; Lukanidin, E.M.

    1983-01-01

    In this paper is described the properties of a novel mouse mdg-like element, the A2 sequence, which is the most abundant repetitive sequence. We also characterized an ubiquitous B2 sequence that represents, after B1, the dominant family among the short interspersed repeats of the mouse genome. The existence of some putative transposition intermediates was shown for repeats of both A and B types of the mouse genome. These are closed circular DNA of the A type and small polyadenylated B + RNAs. The fundamental question that arises is whether these sequences are simply selfish DNA capable of transpositions or do they fulfill some useful biological functions within the genome. 66 references, 11 figures, 1 table

  6. Attitudes toward group-based inequality: social dominance or social identity?

    Science.gov (United States)

    Schmitt, Michael T; Branscombe, Nyla R; Kappen, Diane M

    2003-06-01

    In five studies we explored how the context in which people think about the social structure and the implications of the social structure for one's in-group affect attitudes toward inequality. In Studies 1 and 2 we found that social dominance orientation (SDO) scores reflect attitudes toward specific types of inequality that are salient in context. Consistent with social identity theory, in Studies 3 to 5 we found that SDO scores reflected the interests of specific group identities. Indeed, when we compared existing privileged and disadvantaged groups, and when we manipulated in-group status, we found that participants held more positive attitudes toward inequality when the in-group was privileged, compared to when the in-group was disadvantaged. Across all of our studies, results were consistent with the contention that attitudes toward inequality are group-specific and depend on the social-structural position of salient in-groups. We discuss the implications of our findings for social dominance theory.

  7. Insight into Dominant Cellulolytic Bacteria from Two Biogas Digesters and Their Glycoside Hydrolase Genes

    Science.gov (United States)

    Zhang, Jun; Zhang, Lei; Geng, Alei; Liu, Fanghua; Zhao, Guoping; Wang, Shengyue; Zhou, Zhihua; Yan, Xing

    2015-01-01

    Diverse cellulolytic bacteria are essential for maintaining high lignocellulose degradation ability in biogas digesters. However, little was known about functional genes and gene clusters of dominant cellulolytic bacteria in biogas digesters. This is the foundation to understand lignocellulose degradation mechanisms of biogas digesters and apply these gene resource for optimizing biofuel production. A combination of metagenomic and 16S rRNA gene clone library methods was used to investigate the dominant cellulolytic bacteria and their glycoside hydrolase (GH) genes in two biogas digesters. The 16S rRNA gene analysis revealed that the dominant cellulolytic bacteria were strains closely related to Clostridium straminisolvens and an uncultured cellulolytic bacterium designated BG-1. To recover GH genes from cellulolytic bacteria in general, and BG-1 in particular, a refined assembly approach developed in this study was used to assemble GH genes from metagenomic reads; 163 GH-containing contigs ≥ 1 kb in length were obtained. Six recovered GH5 genes that were expressed in E. coli demonstrated multiple lignocellulase activities and one had high mannanase activity (1255 U/mg). Eleven fosmid clones harboring the recovered GH-containing contigs were sequenced and assembled into 10 fosmid contigs. The composition of GH genes in the 163 assembled metagenomic contigs and 10 fosmid contigs indicated that diverse GHs and lignocellulose degradation mechanisms were present in the biogas digesters. In particular, a small portion of BG-1 genome information was recovered by PhyloPythiaS analysis. The lignocellulase gene clusters in BG-1 suggested that it might use a possible novel lignocellulose degradation mechanism to efficiently degrade lignocellulose. Dominant cellulolytic bacteria of biogas digester possess diverse GH genes, not only in sequences but also in their functions, which may be applied for production of biofuel in the future. PMID:26070087

  8. Incomplete dominance of deleterious alleles contributes substantially to trait variation and heterosis in maize.

    Directory of Open Access Journals (Sweden)

    Jinliang Yang

    2017-09-01

    Full Text Available Deleterious alleles have long been proposed to play an important role in patterning phenotypic variation and are central to commonly held ideas explaining the hybrid vigor observed in the offspring of a cross between two inbred parents. We test these ideas using evolutionary measures of sequence conservation to ask whether incorporating information about putatively deleterious alleles can inform genomic selection (GS models and improve phenotypic prediction. We measured a number of agronomic traits in both the inbred parents and hybrids of an elite maize partial diallel population and re-sequenced the parents of the population. Inbred elite maize lines vary for more than 350,000 putatively deleterious sites, but show a lower burden of such sites than a comparable set of traditional landraces. Our modeling reveals widespread evidence for incomplete dominance at these loci, and supports theoretical models that more damaging variants are usually more recessive. We identify haplotype blocks using an identity-by-decent (IBD analysis and perform genomic prediction analyses in which we weigh blocks on the basis of complementation for segregating putatively deleterious variants. Cross-validation results show that incorporating sequence conservation in genomic selection improves prediction accuracy for grain yield and other fitness-related traits as well as heterosis for those traits. Our results provide empirical support for an important role for incomplete dominance of deleterious alleles in explaining heterosis and demonstrate the utility of incorporating functional annotation in phenotypic prediction and plant breeding.

  9. Incomplete dominance of deleterious alleles contributes substantially to trait variation and heterosis in maize.

    Science.gov (United States)

    Yang, Jinliang; Mezmouk, Sofiane; Baumgarten, Andy; Buckler, Edward S; Guill, Katherine E; McMullen, Michael D; Mumm, Rita H; Ross-Ibarra, Jeffrey

    2017-09-01

    Deleterious alleles have long been proposed to play an important role in patterning phenotypic variation and are central to commonly held ideas explaining the hybrid vigor observed in the offspring of a cross between two inbred parents. We test these ideas using evolutionary measures of sequence conservation to ask whether incorporating information about putatively deleterious alleles can inform genomic selection (GS) models and improve phenotypic prediction. We measured a number of agronomic traits in both the inbred parents and hybrids of an elite maize partial diallel population and re-sequenced the parents of the population. Inbred elite maize lines vary for more than 350,000 putatively deleterious sites, but show a lower burden of such sites than a comparable set of traditional landraces. Our modeling reveals widespread evidence for incomplete dominance at these loci, and supports theoretical models that more damaging variants are usually more recessive. We identify haplotype blocks using an identity-by-decent (IBD) analysis and perform genomic prediction analyses in which we weigh blocks on the basis of complementation for segregating putatively deleterious variants. Cross-validation results show that incorporating sequence conservation in genomic selection improves prediction accuracy for grain yield and other fitness-related traits as well as heterosis for those traits. Our results provide empirical support for an important role for incomplete dominance of deleterious alleles in explaining heterosis and demonstrate the utility of incorporating functional annotation in phenotypic prediction and plant breeding.

  10. Clinical Whole-Exome Sequencing for the Diagnosis of Mendelian Disorders

    Science.gov (United States)

    Yang, Yaping; Muzny, Donna M.; Reid, Jeffrey G.; Bainbridge, Matthew N.; Willis, Alecia; Ward, Patricia A.; Braxton, Alicia; Beuten, Joke; Xia, Fan; Niu, Zhiyv; Hardison, Matthew; Person, Richard; Bekheirnia, Mir Reza; Leduc, Magalie S.; Kirby, Amelia; Pham, Peter; Scull, Jennifer; Wang, Min; Ding, Yan; Plon, Sharon E.; Lupski, James R.; Beaudet, Arthur L.; Gibbs, Richard A.; Eng, Christine M.

    2014-01-01

    BACKGROUND Whole-exome sequencing is a diagnostic approach for the identification of molecular defects in patients with suspected genetic disorders. METHODS We developed technical, bioinformatic, interpretive, and validation pipelines for whole-exome sequencing in a certified clinical laboratory to identify sequence variants underlying disease phenotypes in patients. RESULTS We present data on the first 250 probands for whom referring physicians ordered whole-exome sequencing. Patients presented with a range of phenotypes suggesting potential genetic causes. Approximately 80% were children with neurologic pheno-types. Insurance coverage was similar to that for established genetic tests. We identified 86 mutated alleles that were highly likely to be causative in 62 of the 250 patients, achieving a 25% molecular diagnostic rate (95% confidence interval, 20 to 31). Among the 62 patients, 33 had autosomal dominant disease, 16 had auto-somal recessive disease, and 9 had X-linked disease. A total of 4 probands received two nonoverlapping molecular diagnoses, which potentially challenged the clinical diagnosis that had been made on the basis of history and physical examination. A total of 83% of the autosomal dominant mutant alleles and 40% of the X-linked mutant alleles occurred de novo. Recurrent clinical phenotypes occurred in patients with mutations that were highly likely to be causative in the same genes and in different genes responsible for genetically heterogeneous disorders. CONCLUSIONS Whole-exome sequencing identified the underlying genetic defect in 25% of consecutive patients referred for evaluation of a possible genetic condition. (Funded by the National Human Genome Research Institute.) PMID:24088041

  11. Positive integer solutions of certain diophantine equations

    Indian Academy of Sciences (India)

    BIJAN KUMAR PATEL

    2018-03-19

    Mar 19, 2018 ... integer solutions. They also found all the positive integer solutions of the given equations in terms of Fibonacci and Lucas numbers. Another interesting number sequence which is closely related to the sequence of. Fibonacci numbers is the sequence of balancing numbers. In 1999, Behera et al. [1] intro-.

  12. Generalized Power Domination

    OpenAIRE

    Omerzel, Aleš

    2014-01-01

    The power domination problem is an optimization problem that has emerged together with the development of the power networks. It is important to control the voltage and current in all the nodes and links in a power network. Measuring devices are expensive, which is why there is a tendency to place a minimum number of devices in a power network so that the network remains fully supervised. The k-power domination is a generalization of the power domination. The thesis represents the rules of th...

  13. Draft genome sequence of Therminicola potens strain JR

    Energy Technology Data Exchange (ETDEWEB)

    Byrne-Bailey, K.G.; Wrighton, K.C.; Melnyk, R.A.; Agbo, P.; Hazen, T.C.; Coates, J.D.

    2010-07-01

    'Thermincola potens' strain JR is one of the first Gram-positive dissimilatory metal-reducing bacteria (DMRB) for which there is a complete genome sequence. Consistent with the physiology of this organism, preliminary annotation revealed an abundance of multiheme c-type cytochromes that are putatively associated with the periplasm and cell surface in a Gram-positive bacterium. Here we report the complete genome sequence of strain JR.

  14. Recommendations for the use of tolvaptan in autosomal dominant polycystic kidney disease: a position statement on behalf of the ERA-EDTA Working Groups on Inherited Kidney Disorders and European Renal Best Practice.

    Science.gov (United States)

    Gansevoort, Ron T; Arici, Mustafa; Benzing, Thomas; Birn, Henrik; Capasso, Giovambattista; Covic, Adrian; Devuyst, Olivier; Drechsler, Christiane; Eckardt, Kai-Uwe; Emma, Francesco; Knebelmann, Bertrand; Le Meur, Yannick; Massy, Ziad A; Ong, Albert C M; Ortiz, Alberto; Schaefer, Franz; Torra, Roser; Vanholder, Raymond; Więcek, Andrzej; Zoccali, Carmine; Van Biesen, Wim

    2016-03-01

    Recently, the European Medicines Agency approved the use of the vasopressin V2 receptor antagonist tolvaptan to slow the progression of cyst development and renal insufficiency of autosomal dominant polycystic kidney disease (ADPKD) in adult patients with chronic kidney disease stages 1-3 at initiation of treatment with evidence of rapidly progressing disease. In this paper, on behalf of the ERA-EDTA Working Groups of Inherited Kidney Disorders and European Renal Best Practice, we aim to provide guidance for making the decision as to which ADPKD patients to treat with tolvaptan. The present position statement includes a series of recommendations resulting in a hierarchical decision algorithm that encompasses a sequence of risk-factor assessments in a descending order of reliability. By examining the best-validated markers first, we aim to identify ADPKD patients who have documented rapid disease progression or are likely to have rapid disease progression. We believe that this procedure offers the best opportunity to select patients who are most likely to benefit from tolvaptan, thus improving the benefit-to-risk ratio and cost-effectiveness of this treatment. It is important to emphasize that the decision to initiate treatment requires the consideration of many factors besides eligibility, such as contraindications, potential adverse events, as well as patient motivation and lifestyle factors, and requires shared decision-making with the patient. © The Author 2016. Published by Oxford University Press on behalf of ERA-EDTA.

  15. Authoritarianism, dominance and assertiveness.

    Science.gov (United States)

    Ray, J J

    1981-08-01

    It is shown that there are definitions of the three constructs of authoritarianism, dominance and assertiveness which read very similarly; so much so that no distinction is immediately evident. It is proposed that authoritarianism might be conceived as aggressive dominance and at least some types of assertiveness as nonaggressive dominance. A new scale of Dominance suitable for general population use was produced, and compared with the existing Ray (1976) behavior inventory of authoritarianism. Both scales showed highly significant correlations with peer rated dominance and submission (the latter being negative in sign) but only the authoritarianism scale showed significant correlations with rated aggressiveness and rigidity. It was concluded that the new definitions could be operationalized into valid scales.

  16. Molecular Typing of Staphylococcus aureus Isolated from Patients with Autosomal Dominant Hyper IgE Syndrome

    Directory of Open Access Journals (Sweden)

    Inka Sastalla

    2017-06-01

    Full Text Available Autosomal dominant hyper IgE syndrome (AD-HIES is a primary immunodeficiency caused by a loss-of-function mutation in the Signal Transducer and Activator of Transcription 3 (STAT3. This immune disorder is clinically characterized by increased susceptibility to cutaneous and sinopulmonary infections, in particular with Candida and Staphylococcus aureus. It has recently been recognized that the skin microbiome of patients with AD-HIES is altered with an overrepresentation of certain Gram-negative bacteria and Gram-positive staphylococci. However, these alterations have not been characterized at the species- and strain-level. Since S. aureus infections are influenced by strain-specific expression of virulence factors, information on colonizing strain characteristics may provide insights into host-pathogen interactions and help guide management strategies for treatment and prophylaxis. The aim of this study was to determine whether the immunodeficiency of AD-HIES selects for unique strains of colonizing S. aureus. Using multi-locus sequence typing (MLST, protein A (spa typing, and PCR-based detection of toxin genes, we performed a detailed analysis of the S. aureus isolates (n = 13 found on the skin of twenty-one patients with AD-HIES. We found a low diversity of sequence types, and an abundance of strains that expressed methicillin resistance, Panton-Valentine leukocidin (PVL, and staphylococcal enterotoxins K and Q (SEK, SEQ. Our results indicate that patients with AD-HIES may often carry antibiotic-resistant strains that harbor key virulence factors.

  17. Autosomal dominant hypoparathyroidism caused by germline mutation in GNA11: phenotypic and molecular characterization.

    Science.gov (United States)

    Li, Dong; Opas, Evan E; Tuluc, Florin; Metzger, Daniel L; Hou, Cuiping; Hakonarson, Hakon; Levine, Michael A

    2014-09-01

    Most cases of autosomal dominant hypoparathyroidism (ADH) are caused by gain-of-function mutations in CASR or dominant inhibitor mutations in GCM2 or PTH. Our objectives were to identify the genetic basis for ADH in a multigenerational family and define the underlying disease mechanism. Here we evaluated a multigenerational family with ADH in which affected subjects had normal sequences in these genes and were shorter than unaffected family members. We collected clinical and biochemical data from 6 of 11 affected subjects and performed whole-exome sequence analysis on DNA from two affected sisters and their affected father. Functional studies were performed after expression of wild-type and mutant Gα11 proteins in human embryonic kidney-293-CaR cells that stably express calcium-sensing receptors. Whole-exome-sequencing followed by Sanger sequencing revealed a heterozygous mutation, c.179G>T; p.R60L, in GNA11, which encodes the α-subunit of G11, the principal heterotrimeric G protein that couples calcium-sensing receptors to signal activation in parathyroid cells. Functional studies of Gα11 R60L showed increased accumulation of intracellular concentration of free calcium in response to extracellular concentration of free calcium with a significantly decreased EC50 compared with wild-type Gα11. By contrast, R60L was significantly less effective than the oncogenic Q209L form of Gα11 as an activator of the MAPK pathway. Compared to subjects with CASR mutations, patients with GNA11 mutations lacked hypercalciuria and had normal serum magnesium levels. Our findings indicate that the germline gain-of-function mutation of GNA11 is a cause of ADH and implicate a novel role for GNA11 in skeletal growth.

  18. [Study on Microbial Diversity of Peri-implantitis Subgingival by High-throughput Sequencing].

    Science.gov (United States)

    Li, Zhi-jie; Wang, Shao-guo; Li, Yue-hong; Tu, Dong-xiang; Liu, Shi-yun; Nie, Hong-bing; Li, Zhi-qiang; Zhang, Ju-mei

    2015-07-01

    To study microbial diversity of peri-implantitis subgingival with high-throughput sequencing, and investigate microbiological etiology of peri-implantitis. Subgingival plaques were sampled from the patients with peri-implantitis (D group) and non-peri-implantitis subjects (N group). The microbiological diversity of the subgingival plaques was detected by sequencing V4 region of 16S rRNA with Illumina Miseq platform. The diversity of the community structure was analyzed using Mothur software. A total of 156 507 gene sequences were detected in nine samples and 4 402 operational taxonomic units (OTUs) were found. Selenomonas, Pseudomonas, and Fusobacterium were dominant bacteria in D group, while Fusobacterium, Veillonella and Streptococcus were dominant bacteria in N group. Differences between peri-implantitis and non-peri-implantitis bacterial communities were observed at all phylogenetic levels by LEfSe, which was also found in PcoA test. The occurrence of peri-implantitis is not only related to periodontitis pathogenic microbe, but also related with the changes of oral microbial community structure. Treponema, Herbaspirillum, Butyricimonas and Phaeobacte may be closely related to the occurrence and development of peri-implantitis.

  19. Dominance in domestic dogs

    NARCIS (Netherlands)

    Borg, Van Der J.A.M.; Schilder, M.B.H.; Vinke, C.M.; Vries, De Han; Petit, Odile

    2015-01-01

    A dominance hierarchy is an important feature of the social organisation of group living animals. Although formal and/or agonistic dominance has been found in captive wolves and free-ranging dogs, applicability of the dominance concept in domestic dogs is highly debated, and quantitative data are

  20. Nitrogenase gene amplicons from global marine surface waters are dominated by genes of non-cyanobacteria.

    Directory of Open Access Journals (Sweden)

    Hanna Farnelid

    Full Text Available Cyanobacteria are thought to be the main N(2-fixing organisms (diazotrophs in marine pelagic waters, but recent molecular analyses indicate that non-cyanobacterial diazotrophs are also present and active. Existing data are, however, restricted geographically and by limited sequencing depths. Our analysis of 79,090 nitrogenase (nifH PCR amplicons encoding 7,468 unique proteins from surface samples (ten DNA samples and two RNA samples collected at ten marine locations world-wide provides the first in-depth survey of a functional bacterial gene and yield insights into the composition and diversity of the nifH gene pool in marine waters. Great divergence in nifH composition was observed between sites. Cyanobacteria-like genes were most frequent among amplicons from the warmest waters, but overall the data set was dominated by nifH sequences most closely related to non-cyanobacteria. Clusters related to Alpha-, Beta-, Gamma-, and Delta-Proteobacteria were most common and showed distinct geographic distributions. Sequences related to anaerobic bacteria (nifH Cluster III were generally rare, but preponderant in cold waters, especially in the Arctic. Although the two transcript samples were dominated by unicellular cyanobacteria, 42% of the identified non-cyanobacterial nifH clusters from the corresponding DNA samples were also detected in cDNA. The study indicates that non-cyanobacteria account for a substantial part of the nifH gene pool in marine surface waters and that these genes are at least occasionally expressed. The contribution of non-cyanobacterial diazotrophs to the global N(2 fixation budget cannot be inferred from sequence data alone, but the prevalence of non-cyanobacterial nifH genes and transcripts suggest that these bacteria are ecologically significant.

  1. Does Social Media Benefit Dominant or Alternative Water Discourses?

    Directory of Open Access Journals (Sweden)

    María Mancilla-García

    2015-06-01

    Full Text Available Political ecology and cognate fields have highlighted the social constructedness of different water discourses, exposing them as the product of a particular view of nature with underpinning interests and political consequences. Integrated Water Resources Management, technical approaches, or the privatisation of drinking water services have enjoyed dominant positions, being able to determine what constitutes common sense. This has excluded numerous other alternative approaches, such as those championed by indigenous peoples. Social media, through its easy accessibility and its emphasis on visual, interactive, and short communication forms, bears the promise to challenge dominant discourses. Whether social media benefits dominant or alternative discourses has not yet been explored by the political ecology literature to which this article contributes. The article conducts a qualitative analysis of the use of two of the main social networking services (Facebook and Twitter by nine organisations working on water. Organisations were selected considering their likelihood to champion different water discourses. The article analyses the formats used, the place of communities, and the kind of language employed. It argues that while social media presents an interesting potential for alternative discourses, it also offers important tools for dominant discourses to consolidate themselves. The article concludes that social media does not structurally challenge the status quo and suggests avenues for future research.

  2. Men's sex-dominance inhibition: do men automatically refrain from sexually dominant behavior?

    Science.gov (United States)

    Kiefer, Amy K; Sanchez, Diana T

    2007-12-01

    Men receive conflicting messages about their sexual roles in heterosexual relationships. Men are socialized to initiate and direct sexual activities with women; yet societal norms also proscribe the sexual domination and coercion of women. The authors test these competing hypotheses by assessing whether men inhibit the link between sex and dominance. In Studies 1a and b, using a subliminal priming procedure embedded in a lexical decision task, the authors demonstrate that men automatically suppress the concept of dominance following exposure to subliminal sex primes relative to neutral primes. In Studies 2 and 3, the authors show that men who are less likely to perceive sexual assertiveness as necessary, to refrain from dominant sexual behavior, and who do not invest in masculine gender ideals are more likely to inhibit dominant thoughts following sex primes. Implications for theories of automatic cognitive networks and gender-based sexual roles are discussed.

  3. Total well dominated trees

    DEFF Research Database (Denmark)

    Finbow, Arthur; Frendrup, Allan; Vestergaard, Preben D.

    cardinality then G is a total well dominated graph. In this paper we study composition and decomposition of total well dominated trees. By a reversible process we prove that any total well dominated tree can both be reduced to and constructed from a family of three small trees....

  4. Marine Group II Dominates Planktonic Archaea in Water Column of the Northeastern South China Sea

    Directory of Open Access Journals (Sweden)

    Haodong Liu

    2017-06-01

    Full Text Available Temperature, nutrients, and salinity are among the important factors constraining the distribution and abundance of microorganisms in the ocean. Marine Group II (MGII belonging to Euryarchaeota commonly dominates the planktonic archaeal community in shallow water and Marine Group I (MGI, now is called Thaumarchaeota in deeper water in global oceans. Results of quantitative PCR (qPCR and 454 sequencing in our study, however, showed the dominance of MGII in planktonic archaea throughout the water column of the northeastern South China Sea (SCS that is characterized by strong water mixing. The abundance of ammonia-oxidizing archaea (AOA representing the main group of Thaumarchaeota in deeper water in the northeastern SCS was significantly lower than in other oceanic regions. Phylogenetic analysis showed that the top operational taxonomic units (OTUs of the MGII occurring predominantly below 200 m depth may be unique in the northeastern SCS based on the observation that they are distantly related to known sequences (identity ranging from 90–94%. The abundance of MGII was also significantly correlated with total bacteria in the whole column, which may indicate that MGII and bacteria may have similar physiological or biochemical properties or responses to environmental variation. This study provides valuable information about the dominance of MGII over AOA in both shallow and deep water in the northeastern SCS and highlights the need for comprehensive studies integrating physical, chemical, and microbial oceanography.

  5. Sequence walkers: a graphical method to display how binding proteins interact with DNA or RNA sequences | Center for Cancer Research

    Science.gov (United States)

    A graphical method is presented for displaying how binding proteins and other macromolecules interact with individual bases of nucleotide sequences. Characters representing the sequence are either oriented normally and placed above a line indicating favorable contact, or upside-down and placed below the line indicating unfavorable contact. The positive or negative height of each letter shows the contribution of that base to the average sequence conservation of the binding site, as represented by a sequence logo.

  6. Real or symbolic domination: New revision of La Domination masculine

    Directory of Open Access Journals (Sweden)

    Tassadit Yacine

    2017-07-01

    Full Text Available This paper does a rereading of Pierre Bourdieu’s Masculine Domination (1998, from the context in which it was developed. Thus, we rely on the work carried out during the 50s in Algeria (Sociologie de l'Algérie, 1958, Esquisse d'une théorie de la pratique, 1972 and Le Sens pratique, 1980 and later in France, to show that Masculine Domination was not born spontaneously, but as a result of a long decantation enriched by field experiences and the theoretical advances of the author’s concepts. If it is true that the situation of the women described in Sociologie de l'Algérie is the result of empirical research, it is less so for Masculine Domination, whose analysis retakes the concepts forged by the social anthropologist, such as habitus and symbolic domination. In this way, this article proposes a rereading of this work through the analysis of the work that preceded it in the field.

  7. Discovering frequently recurring movement sequences in team-sport athlete spatiotemporal data.

    Science.gov (United States)

    Sweeting, Alice J; Aughey, Robert J; Cormack, Stuart J; Morgan, Stuart

    2017-12-01

    Athlete external load is typically analysed from predetermined movement thresholds. The combination of movement sequences and differences in these movements between playing positions is also currently unknown. This study developed a method to discover the frequently recurring movement sequences across playing position during matches. The external load of 12 international female netball athletes was collected by a local positioning system during four national-level matches. Velocity, acceleration and angular velocity were calculated from positional (X, Y) data, clustered via one-dimensional k-means and assigned a unique alphabetic label. Combinations of velocity, acceleration and angular velocity movement were compared using the Levenshtein distance and similarities computed by the longest common substring problem. The contribution of each movement sequence, according to playing position and relative to the wider data set, was then calculated via the Minkowski distance. A total of 10 frequently recurring combinations of movement were discovered, regardless of playing position. Only the wing attack, goal attack and goal defence playing positions are closely related. We developed a technique to discover the movement sequences, according to playing position, performed by elite netballers. This methodology can be extended to discover the frequently recurring movements within other team sports and across levels of competition.

  8. Identification of Bacillus anthracis specific chromosomal sequences by suppressive subtractive hybridization

    Directory of Open Access Journals (Sweden)

    Redkar Rajendra

    2004-02-01

    Full Text Available Abstract Background Bacillus anthracis, Bacillus thuringiensis and Bacillus cereus are closely related members of the B. cereus-group of bacilli. Suppressive subtractive hybridization (SSH was used to identify specific chromosomal sequences unique to B. anthracis. Results Two SSH libraries were generated. Genomic DNA from plasmid-cured B. anthracis was used as the tester DNA in both libraries, while genomic DNA from either B. cereus or B. thuringiensis served as the driver DNA. Progressive screening of the libraries by colony filter and Southern blot analyses identified 29 different clones that were specific for the B. anthracis chromosome relative not only to the respective driver DNAs, but also to seven other different strains of B. cereus and B. thuringiensis included in the process. The nucleotide sequences of the clones were compared with those found in genomic databases, revealing that over half of the clones were located into 2 regions on the B. anthracis chromosome. Conclusions Genes encoding potential cell wall synthesis proteins dominated one region, while bacteriophage-related sequences dominated the other region. The latter supports the hypothesis that acquisition of these bacteriophage sequences occurred during or after speciation of B. anthracis relative to B. cereus and B. thuringiensis. This study provides insight into the chromosomal differences between B. anthracis and its closest phylogenetic relatives.

  9. Universal sequence replication, reversible polymerization and early functional biopolymers: a model for the initiation of prebiotic sequence evolution.

    Directory of Open Access Journals (Sweden)

    Sara Imari Walker

    Full Text Available Many models for the origin of life have focused on understanding how evolution can drive the refinement of a preexisting enzyme, such as the evolution of efficient replicase activity. Here we present a model for what was, arguably, an even earlier stage of chemical evolution, when polymer sequence diversity was generated and sustained before, and during, the onset of functional selection. The model includes regular environmental cycles (e.g. hydration-dehydration cycles that drive polymers between times of replication and functional activity, which coincide with times of different monomer and polymer diffusivity. Template-directed replication of informational polymers, which takes place during the dehydration stage of each cycle, is considered to be sequence-independent. New sequences are generated by spontaneous polymer formation, and all sequences compete for a finite monomer resource that is recycled via reversible polymerization. Kinetic Monte Carlo simulations demonstrate that this proposed prebiotic scenario provides a robust mechanism for the exploration of sequence space. Introduction of a polymer sequence with monomer synthetase activity illustrates that functional sequences can become established in a preexisting pool of otherwise non-functional sequences. Functional selection does not dominate system dynamics and sequence diversity remains high, permitting the emergence and spread of more than one functional sequence. It is also observed that polymers spontaneously form clusters in simulations where polymers diffuse more slowly than monomers, a feature that is reminiscent of a previous proposal that the earliest stages of life could have been defined by the collective evolution of a system-wide cooperation of polymer aggregates. Overall, the results presented demonstrate the merits of considering plausible prebiotic polymer chemistries and environments that would have allowed for the rapid turnover of monomer resources and for

  10. Optimization of sequence alignment for simple sequence repeat regions

    Directory of Open Access Journals (Sweden)

    Ogbonnaya Francis C

    2011-07-01

    Full Text Available Abstract Background Microsatellites, or simple sequence repeats (SSRs, are tandemly repeated DNA sequences, including tandem copies of specific sequences no longer than six bases, that are distributed in the genome. SSR has been used as a molecular marker because it is easy to detect and is used in a range of applications, including genetic diversity, genome mapping, and marker assisted selection. It is also very mutable because of slipping in the DNA polymerase during DNA replication. This unique mutation increases the insertion/deletion (INDELs mutation frequency to a high ratio - more than other types of molecular markers such as single nucleotide polymorphism (SNPs. SNPs are more frequent than INDELs. Therefore, all designed algorithms for sequence alignment fit the vast majority of the genomic sequence without considering microsatellite regions, as unique sequences that require special consideration. The old algorithm is limited in its application because there are many overlaps between different repeat units which result in false evolutionary relationships. Findings To overcome the limitation of the aligning algorithm when dealing with SSR loci, a new algorithm was developed using PERL script with a Tk graphical interface. This program is based on aligning sequences after determining the repeated units first, and the last SSR nucleotides positions. This results in a shifting process according to the inserted repeated unit type. When studying the phylogenic relations before and after applying the new algorithm, many differences in the trees were obtained by increasing the SSR length and complexity. However, less distance between different linage had been observed after applying the new algorithm. Conclusions The new algorithm produces better estimates for aligning SSR loci because it reflects more reliable evolutionary relations between different linages. It reduces overlapping during SSR alignment, which results in a more realistic

  11. Autosomal dominant spastic paraplegia with peripheral neuropathy maps to chr12q23-24.

    Science.gov (United States)

    Schüle, R; Bonin, M; Dürr, A; Forlani, S; Sperfeld, A D; Klimpe, S; Mueller, J C; Seibel, A; van de Warrenburg, B P; Bauer, P; Schöls, L

    2009-06-02

    Hereditary spastic paraplegias (HSP) are genetically exceedingly heterogeneous. To date, 37 genetic loci for HSP have been described (SPG1-41), among them 16 loci for autosomal dominant disease. Notwithstanding, further genetic heterogeneity is to be expected in HSP, as various HSP families do not link to any of the known HSP loci. In this study, we aimed to map the disease locus in a German family segregating autosomal dominant complicated HSP. A genome-wide linkage analysis was performed using the GeneChip Mapping 10Kv2.0 Xba Array containing 10,204 SNP markers. Suggestive loci were further analyzed by mapping of microsatellite markers. One locus on chromosome 12q23-24, termed SPG36, was confirmed by high density microsatellite fine mapping with a significant LOD score of 3.2. SPG36 is flanked by markers D12S318 and D12S79. Linkage to SPG36 was excluded in >20 additional autosomal dominant HSP families. Candidate genes were selected and sequenced. No disease-causing mutations were identified in the coding regions of ATXN2, HSPB8, IFT81, Myo1H, UBE3B, and VPS29. SPG36 is complicated by a sensory and motor neuropathy; it is therefore the eighth autosomal dominant subtype of complicated HSP. We report mapping of a new locus for autosomal dominant hereditary spastic paraplegia (HSP) (SPG36) on chromosome 12q23-24 in a German family with autosomal dominant HSP complicated by peripheral neuropathy.

  12. Intrinsic position uncertainty impairs overt search performance.

    Science.gov (United States)

    Semizer, Yelda; Michel, Melchi M

    2017-08-01

    Uncertainty regarding the position of the search target is a fundamental component of visual search. However, due to perceptual limitations of the human visual system, this uncertainty can arise from intrinsic, as well as extrinsic, sources. The current study sought to characterize the role of intrinsic position uncertainty (IPU) in overt visual search and to determine whether it significantly limits human search performance. After completing a preliminary detection experiment to characterize sensitivity as a function of visual field position, observers completed a search task that required localizing a Gabor target within a field of synthetic luminance noise. The search experiment included two clutter conditions designed to modulate the effect of IPU across search displays of varying set size. In the Cluttered condition, the display was tiled uniformly with feature clutter to maximize the effects of IPU. In the Uncluttered condition, the clutter at irrelevant locations was removed to attenuate the effects of IPU. Finally, we derived an IPU-constrained ideal searcher model, limited by the IPU measured in human observers. Ideal searchers were simulated based on the detection sensitivity and fixation sequences measured for individual human observers. The IPU-constrained ideal searcher predicted performance trends similar to those exhibited by the human observers. In the Uncluttered condition, performance decreased steeply as a function of increasing set size. However, in the Cluttered condition, the effect of IPU dominated and performance was approximately constant as a function of set size. Our findings suggest that IPU substantially limits overt search performance, especially in crowded displays.

  13. Extremal values on Zagreb indices of trees with given distance k-domination number.

    Science.gov (United States)

    Pei, Lidan; Pan, Xiangfeng

    2018-01-01

    Let [Formula: see text] be a graph. A set [Formula: see text] is a distance k -dominating set of G if for every vertex [Formula: see text], [Formula: see text] for some vertex [Formula: see text], where k is a positive integer. The distance k -domination number [Formula: see text] of G is the minimum cardinality among all distance k -dominating sets of G . The first Zagreb index of G is defined as [Formula: see text] and the second Zagreb index of G is [Formula: see text]. In this paper, we obtain the upper bounds for the Zagreb indices of n -vertex trees with given distance k -domination number and characterize the extremal trees, which generalize the results of Borovićanin and Furtula (Appl. Math. Comput. 276:208-218, 2016). What is worth mentioning, for an n -vertex tree T , is that a sharp upper bound on the distance k -domination number [Formula: see text] is determined.

  14. Socially dominant mice in C57BL6 background show increased social motivation.

    Science.gov (United States)

    Kunkel, Thaddeus; Wang, Hongbing

    2018-01-15

    A series of behavioral tests measuring social dominance, social motivation, and non-social motivation are examined in adult male C57BL6 mice. By using the well-known tube dominance test to determine social dominance and rank, we find that, in the absence of competition for resource and mating, group-housed mouse cage-mates display stable and mostly linear and transitive social hierarchies. Mice with top and bottom social ranks are subjected to a three-chamber social interaction test to measure social motivation. The top ranked mice spend more time interacting with a stranger mouse than the bottom ranked mice, suggesting that social dominance may positively influence social motivation. When subjected to a novel environment, mice with different social ranks show similar locomotion and exploring activity in the open field test, suggesting no detectable difference in certain aspects of non-social motivation. These results demonstrate a behavioral correlation between social dominance and social motivation. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. High signals in the uterine cervix on T2-weighted MRI sequences

    International Nuclear Information System (INIS)

    Graef, De M.; Karam, R.; Daclin, P.Y.; Rouanet, J.P.; Juhan, V.; Maubon, A.J.

    2003-01-01

    The aim of this pictorial review was to illustrate the normal cervix appearance on T2-weighted images, and give a review of common or less common disorders of the uterine cervix that appear as high signal intensity lesions on T2-weighted sequences. Numerous aetiologies dominated by cervical cancer are reviewed and discussed. This gamut is obviously incomplete; however, radiologists who perform MR women's imaging should perform T2-weighted sequences in the sagittal plane regardless of the indication for pelvic MR. Those sequences will diagnose some previously unknown cervical cancers as well as many other unknown cervical or uterine lesions. (orig.)

  16. Domination of the Golden Horde in Wallachia and Moldavia

    Directory of Open Access Journals (Sweden)

    Victor Spinei

    2016-12-01

    Full Text Available Research objective: to explore the characteristics and effects of the period of the Golden Horde domination in Wallachia and Moldavia. Research materials: The impact of the Great Mongol Invasion of 1241–1242 on the Romanian regions was particularly deep, causing massive economic and political disruptions that inter alia resulted in the inclusion of wide territories outside the Carpathian arch into the Golden Horde State for more than a century. Naturally, this historical sequence raised a major interest in historiography, being the subject of numerous studies and monographs. Moreover, monographic volumes and various other studies that synthetically treat the events related to the Mongol conquests in Eastern and Central Europe also illustrate aspects regarding the Carpato-Danubian lands. The conclusions made by the historians interested in the above topics were mainly based, until several decades ago, on the information resulting from the Western and Eastern narrative and diplomatic sources. During the years that followed World War II, while progress was being registered in the field of medieval archaeology, numerous vestiges dated to the period of the Mongol expansion were brought to light, thus substantially enriching the topics related to the contacts between the autochthones and the invaders. In the current phase of research, comprehensive investigations regarding the history of the Romanians and the Mongols of the thirteenth–fourteenth centuries cannot be undertaken without a thorough parallel examination of the written and archaeological sources. Research results and novelty: As everywhere in the invaded countries, the Mongol intrusion into the regions inhabited by the Romanians caused large damage demographically, economically and politically. Important goods were destroyed or plundered, causing disturbances within the economic life, particularly in the field of commercial exchanges. The capturing of the local inhabitants’ wide

  17. Brazilian Credit Union Member Groups: Borrower-dominated, Saver-dominated or Neutral Behavior?

    Directory of Open Access Journals (Sweden)

    Valéria Gama Fully Bressan

    2013-01-01

    Full Text Available Theoretical models concerning Credit Unions (CUs suggest that the type of CU domination determines the way it allocates the monetary value it generates. A borrower- (saver- dominated CU benefits borrower (saver members at the expenses of saver (borrower members, and a neutral CU equally benefits its member groups.This paper applies direct measure of monetary benefits to each member group (Patin & McNiel, 1991a to testfor the existence of dominated behavior in Brazilian CUs, and is the first to apply panel data regressions to identify the determinants of CUs behavior. We use a unique panel data with 40,664 observations taken from 533 CUs affiliated with the largest Brazilian cooperative network. Results indicate Brazilian CUs are dominated by borrowers, but behave close to neutrality. Panel regression estimates show that common or multiple bond type,size and overdue loans of a CU have no effect on its behavior, the greater the total amount of loans over social capital and adjusted equity over total assets are the more likely a CU is borrower dominated, and the greater the age and current operational expenses over total asset of a CU are the more likely a CU is saver dominated.

  18. Perfect secure domination in graphs

    Directory of Open Access Journals (Sweden)

    S.V. Divya Rashmi

    2017-07-01

    Full Text Available Let $G=(V,E$ be a graph. A subset $S$ of $V$ is a dominating set of $G$ if every vertex in $Vsetminus  S$ is adjacent to a vertex in $S.$ A dominating set $S$ is called a secure dominating set if for each $vin Vsetminus S$ there exists $uin S$ such that $v$ is adjacent to $u$ and $S_1=(Ssetminus{u}cup {v}$ is a dominating set. If further the vertex $uin S$ is unique, then $S$ is called a perfect secure dominating set. The minimum cardinality of a perfect secure dominating set of $G$ is called the perfect  secure domination number of $G$ and is denoted by $gamma_{ps}(G.$ In this paper we initiate a study of this parameter and present several basic results.

  19. Evaluation of exome variants using the Ion Proton Platform to sequence error-prone regions.

    Science.gov (United States)

    Seo, Heewon; Park, Yoomi; Min, Byung Joo; Seo, Myung Eui; Kim, Ju Han

    2017-01-01

    The Ion Proton sequencer from Thermo Fisher accurately determines sequence variants from target regions with a rapid turnaround time at a low cost. However, misleading variant-calling errors can occur. We performed a systematic evaluation and manual curation of read-level alignments for the 675 ultrarare variants reported by the Ion Proton sequencer from 27 whole-exome sequencing data but that are not present in either the 1000 Genomes Project and the Exome Aggregation Consortium. We classified positive variant calls into 393 highly likely false positives, 126 likely false positives, and 156 likely true positives, which comprised 58.2%, 18.7%, and 23.1% of the variants, respectively. We identified four distinct error patterns of variant calling that may be bioinformatically corrected when using different strategies: simplicity region, SNV cluster, peripheral sequence read, and base inversion. Local de novo assembly successfully corrected 201 (38.7%) of the 519 highly likely or likely false positives. We also demonstrate that the two sequencing kits from Thermo Fisher (the Ion PI Sequencing 200 kit V3 and the Ion PI Hi-Q kit) exhibit different error profiles across different error types. A refined calling algorithm with better polymerase may improve the performance of the Ion Proton sequencing platform.

  20. Evaluation of exome variants using the Ion Proton Platform to sequence error-prone regions.

    Directory of Open Access Journals (Sweden)

    Heewon Seo

    Full Text Available The Ion Proton sequencer from Thermo Fisher accurately determines sequence variants from target regions with a rapid turnaround time at a low cost. However, misleading variant-calling errors can occur. We performed a systematic evaluation and manual curation of read-level alignments for the 675 ultrarare variants reported by the Ion Proton sequencer from 27 whole-exome sequencing data but that are not present in either the 1000 Genomes Project and the Exome Aggregation Consortium. We classified positive variant calls into 393 highly likely false positives, 126 likely false positives, and 156 likely true positives, which comprised 58.2%, 18.7%, and 23.1% of the variants, respectively. We identified four distinct error patterns of variant calling that may be bioinformatically corrected when using different strategies: simplicity region, SNV cluster, peripheral sequence read, and base inversion. Local de novo assembly successfully corrected 201 (38.7% of the 519 highly likely or likely false positives. We also demonstrate that the two sequencing kits from Thermo Fisher (the Ion PI Sequencing 200 kit V3 and the Ion PI Hi-Q kit exhibit different error profiles across different error types. A refined calling algorithm with better polymerase may improve the performance of the Ion Proton sequencing platform.

  1. Third-Generation Sequencing and Analysis of Four Complete Pig Liver Esterase Gene Sequences in Clones Identified by Screening BAC Library.

    Science.gov (United States)

    Zhou, Qiongqiong; Sun, Wenjuan; Liu, Xiyan; Wang, Xiliang; Xiao, Yuncai; Bi, Dingren; Yin, Jingdong; Shi, Deshi

    2016-01-01

    Pig liver carboxylesterase (PLE) gene sequences in GenBank are incomplete, which has led to difficulties in studying the genetic structure and regulation mechanisms of gene expression of PLE family genes. The aim of this study was to obtain and analysis of complete gene sequences of PLE family by screening from a Rongchang pig BAC library and third-generation PacBio gene sequencing. After a number of existing incomplete PLE isoform gene sequences were analysed, primers were designed based on conserved regions in PLE exons, and the whole pig genome used as a template for Polymerase chain reaction (PCR) amplification. Specific primers were then selected based on the PCR amplification results. A three-step PCR screening method was used to identify PLE-positive clones by screening a Rongchang pig BAC library and PacBio third-generation sequencing was performed. BLAST comparisons and other bioinformatics methods were applied for sequence analysis. Five PLE-positive BAC clones, designated BAC-10, BAC-70, BAC-75, BAC-119 and BAC-206, were identified. Sequence analysis yielded the complete sequences of four PLE genes, PLE1, PLE-B9, PLE-C4, and PLE-G2. Complete PLE gene sequences were defined as those containing regulatory sequences, exons, and introns. It was found that, not only did the PLE exon sequences of the four genes show a high degree of homology, but also that the intron sequences were highly similar. Additionally, the regulatory region of the genes contained two 720bps reverse complement sequences that may have an important function in the regulation of PLE gene expression. This is the first report to confirm the complete sequences of four PLE genes. In addition, the study demonstrates that each PLE isoform is encoded by a single gene and that the various genes exhibit a high degree of sequence homology, suggesting that the PLE family evolved from a single ancestral gene. Obtaining the complete sequences of these PLE genes provides the necessary foundation for

  2. The socialization of dominance: peer group contextual effects on homophobic and dominance attitudes.

    Science.gov (United States)

    Poteat, V Paul; Espelage, Dorothy L; Green, Harold D

    2007-06-01

    Using the framework of social dominance theory, the current investigation tested for the contextual effects of adolescent peer groups on individuals' homophobic and social dominance attitudes. Results from multilevel models indicated that significant differences existed across peer groups on homophobic attitudes. In addition, these differences were accounted for on the basis of the hierarchy-enhancing or -attenuating climate of the group. A group socialization effect on individuals' social dominance attitudes over time was also observed. Furthermore, the social climate of the peer group moderated the stability of individuals' social dominance attitudes. Findings support the need to examine more proximal and informal group affiliations and earlier developmental periods in efforts to build more comprehensive theoretical models explaining when and how prejudiced and dominance attitudes are formed and the way in which they are perpetuated. (c) 2007 APA, all rights reserved.

  3. Complete sequencing of the bla(NDM-1)-positive IncA/C plasmid from Escherichia coli ST38 isolate suggests a possible origin from plant pathogens.

    Science.gov (United States)

    Sekizuka, Tsuyoshi; Matsui, Mari; Yamane, Kunikazu; Takeuchi, Fumihiko; Ohnishi, Makoto; Hishinuma, Akira; Arakawa, Yoshichika; Kuroda, Makoto

    2011-01-01

    The complete sequence of the plasmid pNDM-1_Dok01 carrying New Delhi metallo-β-lactamase (NDM-1) was determined by whole genome shotgun sequencing using Escherichia coli strain NDM-1_Dok01 (multilocus sequence typing type: ST38) and the transconjugant E. coli DH10B. The plasmid is an IncA/C incompatibility type composed of 225 predicted coding sequences in 195.5 kb and partially shares a sequence with bla(CMY-2)-positive IncA/C plasmids such as E. coli AR060302 pAR060302 (166.5 kb) and Salmonella enterica serovar Newport pSN254 (176.4 kb). The bla(NDM-1) gene in pNDM-1_Dok01 is terminally flanked by two IS903 elements that are distinct from those of the other characterized NDM-1 plasmids, suggesting that the bla(NDM-1) gene has been broadly transposed, together with various mobile elements, as a cassette gene. The chaperonin groES and groEL genes were identified in the bla(NDM-1)-related composite transposon, and phylogenetic analysis and guanine-cytosine content (GC) percentage showed similarities to the homologs of plant pathogens such as Pseudoxanthomonas and Xanthomonas spp., implying that plant pathogens are the potential source of the bla(NDM-1) gene. The complete sequence of pNDM-1_Dok01 suggests that the bla(NDM-1) gene was acquired by a novel composite transposon on an extensively disseminated IncA/C plasmid and transferred to the E. coli ST38 isolate.

  4. Conditions characterizing a dominant market position in the EU Internal Market. Decision of the European Commission dated 17 March 1998, IV/M. 1107 - EDFI/ESTAG; Voraussetzungen einer marktbeherrschenden Stellung im Binnenmarkt. Entscheidung der EG-Kommission vom 17.3.1998, IV/M. 1107-EDFI/ESTAG

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    1998-07-01

    A merger of electricity companies which hold a dominant market position in geographically different markets (here: France and Austria) does not lead to creation or strengthening of a dominant market position in the European Economic Area or an essential part thereof. This is the appealable head note of the decision. (orig./CB) [Deutsch] Ein Zusammenschluss von Stromversorgungsunternehmen, die jeweils auf geographisch voneinander getrennten Maerkten (hier: Frankreich und Oesterreich) beherrschend sind, fuehrt nicht zu einer Schaffung oder Verstaerkung einer marktbeherrschenden Stellung im europaeischen Wirtschaftsraum (EWR) oder einem wesentlichen Teil dieses Gebiets. So lautet der nicht amtliche Leitsatz der Entscheidung. (orig./CB)

  5. Mutation in CPT1C Associated With Pure Autosomal Dominant Spastic Paraplegia.

    Science.gov (United States)

    Rinaldi, Carlo; Schmidt, Thomas; Situ, Alan J; Johnson, Janel O; Lee, Philip R; Chen, Ke-Lian; Bott, Laura C; Fadó, Rut; Harmison, George H; Parodi, Sara; Grunseich, Christopher; Renvoisé, Benoît; Biesecker, Leslie G; De Michele, Giuseppe; Santorelli, Filippo M; Filla, Alessandro; Stevanin, Giovanni; Dürr, Alexandra; Brice, Alexis; Casals, Núria; Traynor, Bryan J; Blackstone, Craig; Ulmer, Tobias S; Fischbeck, Kenneth H

    2015-05-01

    The family of genes implicated in hereditary spastic paraplegias (HSPs) is quickly expanding, mostly owing to the widespread availability of next-generation DNA sequencing methods. Nevertheless, a genetic diagnosis remains unavailable for many patients. To identify the genetic cause for a novel form of pure autosomal dominant HSP. We examined and followed up with a family presenting to a tertiary referral center for evaluation of HSP for a decade until August 2014. Whole-exome sequencing was performed in 4 patients from the same family and was integrated with linkage analysis. Sanger sequencing was used to confirm the presence of the candidate variant in the remaining affected and unaffected members of the family and screen the additional patients with HSP. Five affected and 6 unaffected participants from a 3-generation family with pure adult-onset autosomal dominant HSP of unknown genetic origin were included. Additionally, 163 unrelated participants with pure HSP of unknown genetic cause were screened. Mutation in the neuronal isoform of carnitine palmitoyl-transferase (CPT1C) gene. We identified the nucleotide substitution c.109C>T in exon 3 of CPT1C, which determined the base substitution of an evolutionarily conserved Cys residue for an Arg in the gene product. This variant strictly cosegregated with the disease phenotype and was absent in online single-nucleotide polymorphism databases and in 712 additional exomes of control participants. We showed that CPT1C, which localizes to the endoplasmic reticulum, is expressed in motor neurons and interacts with atlastin-1, an endoplasmic reticulum protein encoded by the ATL1 gene known to be mutated in pure HSPs. The mutation, as indicated by nuclear magnetic resonance spectroscopy studies, alters the protein conformation and reduces the mean (SD) number (213.0 [46.99] vs 81.9 [14.2]; P lipid droplets on overexpression in cells. We also observed a reduction of mean (SD) lipid droplets in primary cortical neurons

  6. Molecular design of sequence specific DNA alkylating agents.

    Science.gov (United States)

    Minoshima, Masafumi; Bando, Toshikazu; Shinohara, Ken-ichi; Sugiyama, Hiroshi

    2009-01-01

    Sequence-specific DNA alkylating agents have great interest for novel approach to cancer chemotherapy. We designed the conjugates between pyrrole (Py)-imidazole (Im) polyamides and DNA alkylating chlorambucil moiety possessing at different positions. The sequence-specific DNA alkylation by conjugates was investigated by using high-resolution denaturing polyacrylamide gel electrophoresis (PAGE). The results showed that polyamide chlorambucil conjugates alkylate DNA at flanking adenines in recognition sequences of Py-Im polyamides, however, the reactivities and alkylation sites were influenced by the positions of conjugation. In addition, we synthesized conjugate between Py-Im polyamide and another alkylating agent, 1-(chloromethyl)-5-hydroxy-1,2-dihydro-3H-benz[e]indole (seco-CBI). DNA alkylation reactivies by both alkylating polyamides were almost comparable. In contrast, cytotoxicities against cell lines differed greatly. These comparative studies would promote development of appropriate sequence-specific DNA alkylating polyamides against specific cancer cells.

  7. Overlapping positive and negative regulatory domains of the human β-interferon gene

    International Nuclear Information System (INIS)

    Goodbourn, S.; Maniatis, T.

    1988-01-01

    Virus of poly(I) x poly(C) induction of human β-interferon gene expression requires a 40-base-pair DNA sequence designated the interferon gene regulatory element (IRE). Previous studies have shown that the IRE contains both positive and negative regulatory DNA sequences. To localize these sequences and study their interactions, the authors have examined the effects of a large number of single-base mutations within the IRE on β-interferon gene regulation. They find that the IRE consists of two genetically separable positive regulatory domains and an overlapping negative control sequence. They propose that the β-interferon gene is switched off in uninduced cells by a repressor that blocks the interaction between one of the two positive regulatory sequences and a specific transcription factor. Induction would then lead to inactivation or displacement of the repressor and binding of transcription factors to both positive regulatory domains

  8. Identification and characterization of the multidrug resistance gene cfr in a Panton-Valentine leukocidin-positive sequence type 8 methicillin-resistant Staphylococcus aureus IVa (USA300) isolate.

    LENUS (Irish Health Repository)

    Shore, Anna C

    2010-12-01

    The staphylococcal cfr gene mediates resistance to phenicols, lincosamides, oxazolidinones, pleuromutilins, and streptogramin A, a phenotype that has been termed PhLOPS(A). The cfr gene has mainly been associated with coagulase-negative staphylococcal isolates from animals, and only a few cfr-positive methicillin-resistant Staphylococcus aureus (MRSA) isolates have been described so far. This study reports the first description of a cfr-positive MRSA isolate (M05\\/0060) belonging to the pandemic Panton-Valentine leukocidin (PVL)-positive sequence type 8 MRSA IVa\\/USA300 (ST8-MRSA-IVa\\/USA300) clone. The cfr gene was detected in M05\\/0060 using a DNA microarray which was used to screen PVL-positive MRSA isolates for the presence of virulence genes, typing markers, and antimicrobial resistance genes. Antimicrobial susceptibility testing revealed that M05\\/0060 exhibited the cfr-associated resistance phenotype. Molecular analysis identified the presence of cfr and a second phenicol resistance gene, fexA, on a novel 45-kb conjugative plasmid, which was designated pSCFS7. Within pSCFS7, a DNA segment consisting of cfr, a truncated copy of insertion sequence IS21-558, and a region with homology to the DNA invertase gene bin3 of transposon Tn552 from Bacillus mycoides was integrated into the transposase gene tnpB of the fexA-carrying transposon Tn558. The emergence of a multidrug-resistant cfr-positive variant of ST8-MRSA-IVa\\/USA300 is alarming and requires ongoing surveillance. Moreover, the identification of a novel conjugative plasmid carrying the cfr gene indicates the ability of cfr to spread to other MRSA strains.

  9. Successful treatment of multifocal pedal infection in a feline immunodeficiency virus-positive cat with multiple Bowenoid in situ carcinomas containing papillomaviral DNA sequences

    OpenAIRE

    Allan E Kessell; Derek McNair; John S Munday; Richard Savory; Catriona Halliday; Richard Malik

    2017-01-01

    Case summary A 16-year-old, castrated male, feline immunodeficiency virus (FIV)-positive, domestic shorthair cat developed multiple skin lesions. Most of these were Bowenoid carcinoma in situ and contained DNA sequences consistent with Felis catus papillomavirus type 2. Two additional lesions that developed in the skin and subcutaneous tissues between the digital and carpal pads on the left forelimb and right hindlimb were shown by cytology, histology and culture to be caused by Prototheca wi...

  10. [Whole Genome Sequencing of Human mtDNA Based on Ion Torrent PGM™ Platform].

    Science.gov (United States)

    Cao, Y; Zou, K N; Huang, J P; Ma, K; Ping, Y

    2017-08-01

    To analyze and detect the whole genome sequence of human mitochondrial DNA (mtDNA) by Ion Torrent PGM™ platform and to study the differences of mtDNA sequence in different tissues. Samples were collected from 6 unrelated individuals by forensic postmortem examination, including chest blood, hair, costicartilage, nail, skeletal muscle and oral epithelium. Amplification of whole genome sequence of mtDNA was performed by 4 pairs of primer. Libraries were constructed with Ion Shear™ Plus Reagents kit and Ion Plus Fragment Library kit. Whole genome sequencing of mtDNA was performed using Ion Torrent PGM™ platform. Sanger sequencing was used to determine the heteroplasmy positions and the mutation positions on HVⅠ region. The whole genome sequence of mtDNA from all samples were amplified successfully. Six unrelated individuals belonged to 6 different haplotypes. Different tissues in one individual had heteroplasmy difference. The heteroplasmy positions and the mutation positions on HVⅠ region were verified by Sanger sequencing. After a consistency check by the Kappa method, it was found that the results of mtDNA sequence had a high consistency in different tissues. The testing method used in present study for sequencing the whole genome sequence of human mtDNA can detect the heteroplasmy difference in different tissues, which have good consistency. The results provide guidance for the further applications of mtDNA in forensic science. Copyright© by the Editorial Department of Journal of Forensic Medicine

  11. Prediction of nucleosome positioning based on transcription factor binding sites.

    Directory of Open Access Journals (Sweden)

    Xianfu Yi

    Full Text Available BACKGROUND: The DNA of all eukaryotic organisms is packaged into nucleosomes, the basic repeating units of chromatin. The nucleosome consists of a histone octamer around which a DNA core is wrapped and the linker histone H1, which is associated with linker DNA. By altering the accessibility of DNA sequences, the nucleosome has profound effects on all DNA-dependent processes. Understanding the factors that influence nucleosome positioning is of great importance for the study of genomic control mechanisms. Transcription factors (TFs have been suggested to play a role in nucleosome positioning in vivo. PRINCIPAL FINDINGS: Here, the minimum redundancy maximum relevance (mRMR feature selection algorithm, the nearest neighbor algorithm (NNA, and the incremental feature selection (IFS method were used to identify the most important TFs that either favor or inhibit nucleosome positioning by analyzing the numbers of transcription factor binding sites (TFBSs in 53,021 nucleosomal DNA sequences and 50,299 linker DNA sequences. A total of nine important families of TFs were extracted from 35 families, and the overall prediction accuracy was 87.4% as evaluated by the jackknife cross-validation test. CONCLUSIONS: Our results are consistent with the notion that TFs are more likely to bind linker DNA sequences than the sequences in the nucleosomes. In addition, our results imply that there may be some TFs that are important for nucleosome positioning but that play an insignificant role in discriminating nucleosome-forming DNA sequences from nucleosome-inhibiting DNA sequences. The hypothesis that TFs play a role in nucleosome positioning is, thus, confirmed by the results of this study.

  12. PEPTIDE SOLUBILITY, STRUCTURE AND CHARGE POSITION EFFECT ON ADSORPTION BY ALUMINIUM HYDROXIDE

    Directory of Open Access Journals (Sweden)

    Mary Trujillo

    2008-04-01

    Full Text Available Solubility, structure and position of charges in a peptide antigen sequence can be mentioned as being amongst the basic features of adsorption. In order to study their effect on adsorption, seven analogue series were synthesized from a MSP-1 peptide sequence by systematically replacing each one of the positions in the peptide sequence by aspartic acid, glutamic acid, serine, alanine, asparagine, glutamine or lysine. Such modifications in analogue peptide sequences showed a non-regular tendency regarding solubility and adsorption data. Aspartic acid and Glutamic acid analogue series showed great improvements in adsorption, especially in peptides where Lysine in position 6 and Arginine in position 13 were replaced. Solubility of position 5 analogue was greater than the position 6 analogue in Aspartic acid series; however, the position 6 analogue showed best adsorption results whilst the Aspartic acid in position 5 analogue showed no adsorption in the same conditions. Nuclear Magnetic Resonance structural analysis revealed differences in the -helical structureextension between these analogues. The Aspartic acid in position 6, located in the polar side of the helix, may allow this analogueto fit better onto the adsorption regions suggesting that the local electrostatic charge is responsible for this behavior.

  13. Boldness traits, not dominance, predict exploratory flight range and homing behaviour in homing pigeons.

    Science.gov (United States)

    Portugal, Steven J; Ricketts, Rhianna L; Chappell, Jackie; White, Craig R; Shepard, Emily L; Biro, Dora

    2017-08-19

    Group living has been proposed to yield benefits that enhance fitness above the level that would be achieved through living as solitary individuals. Dominance hierarchies occur commonly in these social assemblages, and result, by definition, in resources not being evenly distributed between group members. Determinants of rank within a dominance hierarchy can be associated with morphological characteristics, previous experience of the individual, or personality traits such as exploration tendencies. The purpose of this study was to investigate whether greater exploration and positive responses to novel objects in homing pigeons ( Columba livia ) measured under laboratory conditions were associated with (i) greater initial exploration of the local area around the home loft during spontaneous exploration flights (SEF), (ii) faster and more efficient homing flights when released from further afield, and (iii) whether the traits of greater exploration and more positive responses to novel objects were more likely to be exhibited by the more dominant individuals within the group. There was no relationship between laboratory-based novel object exploration and position within the dominance hierarchy. Pigeons that were neophobic under laboratory conditions did not explore the local area during SEF opportunities. When released from sites further from home, neophobic pigeons took longer routes to home compared to those birds that had not exhibited neophobic traits under laboratory conditions, and had spontaneously explored to a greater extent. The lack of exploration in the neophobic birds is likely to have resulted in the increased costs of homing following release: unfamiliarity with the landscape likely led to the greater distances travelled and less efficient routes taken. Birds that demonstrated a lack of neophobia were not the dominant individuals inside the loft, and thus would have less access to resources such as food and potentially mates. However, a lack of

  14. Interrelationships Among Men’s Threat Potential, Facial Dominance, and Vocal Dominance

    Directory of Open Access Journals (Sweden)

    Chengyang Han

    2017-03-01

    Full Text Available The benefits of minimizing the costs of engaging in violent conflict are thought to have shaped adaptations for the rapid assessment of others’ capacity to inflict physical harm. Although studies have suggested that men’s faces and voices both contain information about their threat potential, one recent study suggested that men’s faces are a more valid cue of their threat potential than their voices are. Consequently, the current study investigated the interrelationships among a composite measure of men’s actual threat potential (derived from the measures of their upper-body strength, height, and weight and composite measures of these men’s perceived facial and vocal threat potential (derived from dominance, strength, and weight ratings of their faces and voices, respectively. Although men’s perceived facial and vocal threat potential were positively correlated, men’s actual threat potential was related to their perceived facial, but not vocal, threat potential. These results present new evidence that men’s faces may be a more valid cue of these aspects of threat potential than their voices are.

  15. Facies analysis and sequence stratigraphy of neoproterozoic Platform deposits in Adrar of Mauritania, Taoudeni basin, West Africa

    Science.gov (United States)

    Benan, C. A. A.; Deynoux, M.

    The Neoproterozoic and Palaeozoic Taoudeni basin forms the flat-lying and unmetamorphosed sedimentary cover of the West African Craton. In the western part of this basin, the Char Group and the lower part of the Atar Group make up a 400-m-thick Neoproterozoic siliciclastic succession which rests on the Palaeoproterozoic metamorphic and granitic basement. Five erosional bounding surfaces of regional extent have been identified in this succession. These surfaces separate five stratigraphic units with lithofacies associations ranging from fluvial to coastal and fluvial-, tide-, or wave-dominated shallow marine deposits. Owing to their regional extent and their position within the succession, the erosive bounding surfaces correspond to relative sea-level falls, and accordingly the five stratigraphic units they bound represent allocyclic transgressive-regressive depositional sequences (S1-S5). Changes in the nature of the deposits forming the transgressive-regressive cycles reflect landward or seaward shifts of the stacked sequences. These successive relative sea-level changes are related to the reactivation of basement faults and tilting during rifting of the Pan-Afro-Brasiliano supercontinent 1000 m.y. ago. The stromatolite bearing carbonate-shale sequences which form the rest of the Atar Group mark the onset of a quiet period of homogeneous subsidence contemporaneous with the Pan-African I oceanization 800-700 m.y. ago.

  16. Quantiprot - a Python package for quantitative analysis of protein sequences.

    Science.gov (United States)

    Konopka, Bogumił M; Marciniak, Marta; Dyrka, Witold

    2017-07-17

    The field of protein sequence analysis is dominated by tools rooted in substitution matrices and alignments. A complementary approach is provided by methods of quantitative characterization. A major advantage of the approach is that quantitative properties defines a multidimensional solution space, where sequences can be related to each other and differences can be meaningfully interpreted. Quantiprot is a software package in Python, which provides a simple and consistent interface to multiple methods for quantitative characterization of protein sequences. The package can be used to calculate dozens of characteristics directly from sequences or using physico-chemical properties of amino acids. Besides basic measures, Quantiprot performs quantitative analysis of recurrence and determinism in the sequence, calculates distribution of n-grams and computes the Zipf's law coefficient. We propose three main fields of application of the Quantiprot package. First, quantitative characteristics can be used in alignment-free similarity searches, and in clustering of large and/or divergent sequence sets. Second, a feature space defined by quantitative properties can be used in comparative studies of protein families and organisms. Third, the feature space can be used for evaluating generative models, where large number of sequences generated by the model can be compared to actually observed sequences.

  17. Mutations in DNMT1 cause autosomal dominant cerebellar ataxia, deafness and narcolepsy

    DEFF Research Database (Denmark)

    Winkelmann, Juliane; Lin, Ling; Schormair, Barbara

    2012-01-01

    to HDAC2. It is also highly expressed in immune cells and required for the differentiation of CD4+ into T regulatory cells. Mutations in exon 20 of this gene were recently reported to cause hereditary sensory neuropathy with dementia and hearing loss (HSAN1). Our mutations are all located in exon 21......Autosomal dominant cerebellar ataxia, deafness and narcolepsy (ADCA-DN) is characterized by late onset (30-40 years old) cerebellar ataxia, sensory neuronal deafness, narcolepsy-cataplexy and dementia. We performed exome sequencing in five individuals from three ADCA-DN kindreds and identified DNMT...

  18. Elitism and Stochastic Dominance

    OpenAIRE

    Bazen, Stephen; Moyes, Patrick

    2011-01-01

    Stochastic dominance has typically been used with a special emphasis on risk and inequality reduction something captured by the concavity of the utility function in the expected utility model. We claim that the applicability of the stochastic dominance approach goes far beyond risk and inequality measurement provided suitable adpations be made. We apply in the paper the stochastic dominance approach to the measurment of elitism which may be considered the opposite of egalitarianism. While the...

  19. Asymmetric dominance and asymmetric mate choice oppose premating isolation after allopatric divergence.

    Science.gov (United States)

    Sefc, Kristina M; Hermann, Caroline M; Steinwender, Bernd; Brindl, Hanna; Zimmermann, Holger; Mattersdorfer, Karin; Postl, Lisbeth; Makasa, Lawrence; Sturmbauer, Christian; Koblmüller, Stephan

    2015-04-01

    Assortative mating promotes reproductive isolation and allows allopatric speciation processes to continue in secondary contact. As mating patterns are determined by mate preferences and intrasexual competition, we investigated male-male competition and behavioral isolation in simulated secondary contact among allopatric populations. Three allopatric color morphs of the cichlid fish Tropheus were tested against each other. Dyadic male-male contests revealed dominance of red males over bluish and yellow-blotch males. Reproductive isolation in the presence of male-male competition was assessed from genetic parentage in experimental ponds and was highly asymmetric among pairs of color morphs. Red females mated only with red males, whereas the other females performed variable degrees of heteromorphic mating. Discrepancies between mating patterns in ponds and female preferences in a competition-free, two-way choice paradigm suggested that the dominance of red males interfered with positive assortative mating of females of the subordinate morphs and provoked asymmetric hybridization. Between the nonred morphs, a significant excess of negative assortative mating by yellow-blotch females with bluish males did not coincide with asymmetric dominance among males. Hence, both negative assortative mating preferences and interference of male-male competition with positive assortative preferences forestall premating isolation, the latter especially in environments unsupportive of competition-driven spatial segregation.

  20. No Girls Allowed: Women in Male-Dominated Majors Experience Increased Gender Harassment and Bias.

    Science.gov (United States)

    Dresden, Brooke E; Dresden, Alexander Y; Ridge, Robert D; Yamawaki, Niwako

    2018-06-01

    The prevalence of gender harassment in male-dominated workforces has been well established, but little is known regarding the experiences of women in male-dominated majors within academia. The current study examines the experiences and gender-related biases of 146 male and female students in male-dominated (MD) and gender-equivalent (GE) majors. This study hypothesizes that men from MD majors, as opposed to GE majors, will exhibit more explicit and implicit bias regarding women in positions of power and authority, resulting in a higher prevalence of gender harassment towards women in MD majors. Results showed that there was no significant difference in self-reported explicit bias against women in positions of power and authority between men from MD and GE majors, but there was significantly more implicit bias among men from MD majors as opposed to GE majors. Additionally, women from MD majors experienced significantly more gender harassment than women from GE majors. Implications of these findings and suggestions to assist those working in education to combat these biases and instances of harassment are discussed.

  1. Relations between Spatial Distribution, Social Affiliations and Dominance Hierarchy in a Semi-Free Mandrill Population.

    Science.gov (United States)

    Naud, Alexandre; Chailleux, Eloise; Kestens, Yan; Bret, Céline; Desjardins, Dominic; Petit, Odile; Ngoubangoye, Barthélémy; Sueur, Cédric

    2016-01-01

    Although there exist advantages to group-living in comparison to a solitary lifestyle, costs and gains of group-living may be unequally distributed among group members. Predation risk, vigilance levels and food intake may be unevenly distributed across group spatial geometry and certain within-group spatial positions may be more or less advantageous depending on the spatial distribution of these factors. In species characterized with dominance hierarchy, high-ranking individuals are commonly observed in advantageous spatial position. However, in complex social systems, individuals can develop affiliative relationships that may balance the effect of dominance relationships in individual's spatial distribution. The objective of the present study is to investigate how the group spatial distribution of a semi-free ranging colony of Mandrills relates to its social organization. Using spatial observations in an area surrounding the feeding zone, we tested the three following hypothesis: (1) does dominance hierarchy explain being observed in proximity or far from a food patch? (2) Do affiliative associations also explain being observed in proximity or far from a food patch? (3) Do the differences in rank in the group hierarchy explain being co-observed in proximity of a food patch? Our results showed that high-ranking individuals were more observed in proximity of the feeding zone while low-ranking individuals were more observed at the boundaries of the observation area. Furthermore, we observed that affiliative relationships were also associated with individual spatial distributions and explain more of the total variance of the spatial distribution in comparison with dominance hierarchy. Finally, we found that individuals observed at a same moment in proximity of the feeding zone were more likely to be distant in the hierarchy while controlling for maternal kinship, age and sex similarity. This study brings some elements about how affiliative networks and dominance

  2. Relations Between Spatial Distribution, Social Affiliations And Dominance Hierarchy In A Semi-Free Mandrill Population

    Directory of Open Access Journals (Sweden)

    Alexandre eNaud

    2016-05-01

    Full Text Available Although there exist advantages to group-living in comparison to a solitary lifestyle, costs and gains of group-living may be unequally distributed among group members. Predation risk, vigilance levels and food intake may be unevenly distributed across group spatial geometry and certain within-group spatial positions may be more or less advantageous depending on the spatial distribution of these factors. In species characterized with dominance hierarchy, high-ranking individuals are commonly observed in advantageous spatial position. However, in complex social systems, individuals can develop affiliative relationships that may balance the effect of dominance relationships in individual’s spatial distribution. The objective of the present study is to investigate how the group spatial distribution of a semi-free ranging colony of Mandrills relates to its social organization. Using spatial observations in an area surrounding the feeding zone, we tested the three following hypothesis: (1 does dominance hierarchy explain being observed in proximity or far from a food patch? (2 Do affiliative associations also explain being observed in proximity or far from a food patch? (3 Do the differences in rank in the group hierarchy explain being co-observed in proximity of a food patch? Our results showed that high-ranking individuals were more observed in proximity of the feeding zone while low-ranking individuals were more observed at the boundaries of the observation area. Furthermore, we observed that affiliative relationships were also associated with individual spatial distributions and explain more of the total variance of the spatial distribution in comparison with dominance hierarchy. Finally, we found that individuals observed at a same moment in proximity of the feeding zone were more likely to be distant in the hierarchy while controlling for maternal kinship, age and sex similarity. This study brings some elements about how affiliative networks

  3. ϕ-statistically quasi Cauchy sequences

    Directory of Open Access Journals (Sweden)

    Bipan Hazarika

    2016-04-01

    Full Text Available Let P denote the space whose elements are finite sets of distinct positive integers. Given any element σ of P, we denote by p(σ the sequence {pn(σ} such that pn(σ=1 for n ∈ σ and pn(σ=0 otherwise. Further Ps={σ∈P:∑n=1∞pn(σ≤s}, i.e. Ps is the set of those σ whose support has cardinality at most s. Let (ϕn be a non-decreasing sequence of positive integers such that nϕn+1≤(n+1ϕn for all n∈N and the class of all sequences (ϕn is denoted by Φ. Let E⊆N. The number δϕ(E=lims→∞1ϕs|{k∈σ,σ∈Ps:k∈E}| is said to be the ϕ-density of E. A sequence (xn of points in R is ϕ-statistically convergent (or Sϕ-convergent to a real number ℓ for every ε > 0 if the set {n∈N:|xn−ℓ|≥ɛ} has ϕ-density zero. We introduce ϕ-statistically ward continuity of a real function. A real function is ϕ-statistically ward continuous if it preserves ϕ-statistically quasi Cauchy sequences where a sequence (xn is called to be ϕ-statistically quasi Cauchy (or Sϕ-quasi Cauchy when (Δxn=(xn+1−xn is ϕ-statistically convergent to 0. i.e. a sequence (xn of points in R is called ϕ-statistically quasi Cauchy (or Sϕ-quasi Cauchy for every ε > 0 if {n∈N:|xn+1−xn|≥ɛ} has ϕ-density zero. Also we introduce the concept of ϕ-statistically ward compactness and obtain results related to ϕ-statistically ward continuity, ϕ-statistically ward compactness, statistically ward continuity, ward continuity, ward compactness, ordinary compactness, uniform continuity, ordinary continuity, δ-ward continuity, and slowly oscillating continuity.

  4. Genetic sorting of subordinate species in grassland modulated by intraspecific variation in dominant species.

    Directory of Open Access Journals (Sweden)

    Danny J Gustafson

    Full Text Available Genetic variation in a single species can have predictable and heritable effects on associated communities and ecosystem processes, however little is known about how genetic variation of a dominant species affects plant community assembly. We characterized the genetic structure of a dominant grass (Sorghastrum nutans and two subordinate species (Chamaecrista fasciculata, Silphium integrifolium, during the third growing season in grassland communities established with genetically distinct (cultivated varieties or local ecotypes seed sources of the dominant grasses. There were genetic differences between subordinate species growing in the cultivar versus local ecotype communities, indicating that intraspecific genetic variation in the dominant grasses affected the genetic composition of subordinate species during community assembly. A positive association between genetic diversity of S. nutans, C. fasciculata, and S. integrifolium and species diversity established the role of an intraspecific biotic filter during community assembly. Our results show that intraspecific variation in dominant species can significantly modulate the genetic composition of subordinate species.

  5. Apoptosis-inducing signal sequence mutation in carbonic anhydrase IV identified in patients with the RP17 form of retinitis pigmentosa

    Science.gov (United States)

    Rebello, George; Ramesar, Rajkumar; Vorster, Alvera; Roberts, Lisa; Ehrenreich, Liezle; Oppon, Ekow; Gama, Dumisani; Bardien, Soraya; Greenberg, Jacquie; Bonapace, Giuseppe; Waheed, Abdul; Shah, Gul N.; Sly, William S.

    2004-01-01

    Genetic and physical mapping of the RP17 locus on 17q identified a 3.6-megabase candidate region that includes the gene encoding carbonic anhydrase IV (CA4), a glycosylphosphatidylinositol-anchored protein that is highly expressed in the choriocapillaris of the human eye. By sequencing candidate genes in this region, we identified a mutation that causes replacement of an arginine with a tryptophan (R14W) in the signal sequence of the CA4 gene at position -5 relative to the signal sequence cleavage site. This mutation was found to cosegregate with the disease phenotype in two large families and was not found in 36 unaffected family members or 100 controls. Expression of the mutant cDNA in COS-7 cells produced several findings, suggesting a mechanism by which the mutation can explain the autosomal dominant disease. In transfected COS-7 cells, the R14W mutation (i) reduced the steady-state level of carbonic anhydrase IV activity expressed by 28% due to a combination of decreased synthesis and accelerated turnover; (ii) led to up-regulation of immunoglobulin-binding protein, double-stranded RNA-regulated protein kinase-like ER kinase, and CCAAT/enhancer-binding protein homologous protein, markers of the unfolded protein response and endoplasmic reticulum stress; and (iii) induced apoptosis, as evidenced by annexin V binding and terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling staining, in most cells expressing the mutant, but not the WT, protein. We suggest that a high level of expression of the mutant allele in the endothelial cells of the choriocapillaris leads to apoptosis, leading in turn to ischemia in the overlying retina and producing autosomal dominant retinitis pigmentosa. PMID:15090652

  6. System reliability analysis using dominant failure modes identified by selective searching technique

    International Nuclear Information System (INIS)

    Kim, Dong-Seok; Ok, Seung-Yong; Song, Junho; Koh, Hyun-Moo

    2013-01-01

    The failure of a redundant structural system is often described by innumerable system failure modes such as combinations or sequences of local failures. An efficient approach is proposed to identify dominant failure modes in the space of random variables, and then perform system reliability analysis to compute the system failure probability. To identify dominant failure modes in the decreasing order of their contributions to the system failure probability, a new simulation-based selective searching technique is developed using a genetic algorithm. The system failure probability is computed by a multi-scale matrix-based system reliability (MSR) method. Lower-scale MSR analyses evaluate the probabilities of the identified failure modes and their statistical dependence. A higher-scale MSR analysis evaluates the system failure probability based on the results of the lower-scale analyses. Three illustrative examples demonstrate the efficiency and accuracy of the approach through comparison with existing methods and Monte Carlo simulations. The results show that the proposed method skillfully identifies the dominant failure modes, including those neglected by existing approaches. The multi-scale MSR method accurately evaluates the system failure probability with statistical dependence fully considered. The decoupling between the failure mode identification and the system reliability evaluation allows for effective applications to larger structural systems

  7. The clinical application of genome-wide sequencing for monogenic diseases in Canada: Position Statement of the Canadian College of Medical Geneticists

    Science.gov (United States)

    Boycott, Kym; Hartley, Taila; Adam, Shelin; Bernier, Francois; Chong, Karen; Fernandez, Bridget A; Friedman, Jan M; Geraghty, Michael T; Hume, Stacey; Knoppers, Bartha M; Laberge, Anne-Marie; Majewski, Jacek; Mendoza-Londono, Roberto; Meyn, M Stephen; Michaud, Jacques L; Nelson, Tanya N; Richer, Julie; Sadikovic, Bekim; Skidmore, David L; Stockley, Tracy; Taylor, Sherry; van Karnebeek, Clara; Zawati, Ma'n H; Lauzon, Julie; Armour, Christine M

    2015-01-01

    Purpose and scope The aim of this Position Statement is to provide recommendations for Canadian medical geneticists, clinical laboratory geneticists, genetic counsellors and other physicians regarding the use of genome-wide sequencing of germline DNA in the context of clinical genetic diagnosis. This statement has been developed to facilitate the clinical translation and development of best practices for clinical genome-wide sequencing for genetic diagnosis of monogenic diseases in Canada; it does not address the clinical application of this technology in other fields such as molecular investigation of cancer or for population screening of healthy individuals. Methods of statement development Two multidisciplinary groups consisting of medical geneticists, clinical laboratory geneticists, genetic counsellors, ethicists, lawyers and genetic researchers were assembled to review existing literature and guidelines on genome-wide sequencing for clinical genetic diagnosis in the context of monogenic diseases, and to make recommendations relevant to the Canadian context. The statement was circulated for comment to the Canadian College of Medical Geneticists (CCMG) membership-at-large and, following incorporation of feedback, approved by the CCMG Board of Directors. The CCMG is a Canadian organisation responsible for certifying medical geneticists and clinical laboratory geneticists, and for establishing professional and ethical standards for clinical genetics services in Canada. Results and conclusions Recommendations include (1) clinical genome-wide sequencing is an appropriate approach in the diagnostic assessment of a patient for whom there is suspicion of a significant monogenic disease that is associated with a high degree of genetic heterogeneity, or where specific genetic tests have failed to provide a diagnosis; (2) until the benefits of reporting incidental findings are established, we do not endorse the intentional clinical analysis of disease-associated genes

  8. The clinical application of genome-wide sequencing for monogenic diseases in Canada: Position Statement of the Canadian College of Medical Geneticists.

    Science.gov (United States)

    Boycott, Kym; Hartley, Taila; Adam, Shelin; Bernier, Francois; Chong, Karen; Fernandez, Bridget A; Friedman, Jan M; Geraghty, Michael T; Hume, Stacey; Knoppers, Bartha M; Laberge, Anne-Marie; Majewski, Jacek; Mendoza-Londono, Roberto; Meyn, M Stephen; Michaud, Jacques L; Nelson, Tanya N; Richer, Julie; Sadikovic, Bekim; Skidmore, David L; Stockley, Tracy; Taylor, Sherry; van Karnebeek, Clara; Zawati, Ma'n H; Lauzon, Julie; Armour, Christine M

    2015-07-01

    The aim of this Position Statement is to provide recommendations for Canadian medical geneticists, clinical laboratory geneticists, genetic counsellors and other physicians regarding the use of genome-wide sequencing of germline DNA in the context of clinical genetic diagnosis. This statement has been developed to facilitate the clinical translation and development of best practices for clinical genome-wide sequencing for genetic diagnosis of monogenic diseases in Canada; it does not address the clinical application of this technology in other fields such as molecular investigation of cancer or for population screening of healthy individuals. Two multidisciplinary groups consisting of medical geneticists, clinical laboratory geneticists, genetic counsellors, ethicists, lawyers and genetic researchers were assembled to review existing literature and guidelines on genome-wide sequencing for clinical genetic diagnosis in the context of monogenic diseases, and to make recommendations relevant to the Canadian context. The statement was circulated for comment to the Canadian College of Medical Geneticists (CCMG) membership-at-large and, following incorporation of feedback, approved by the CCMG Board of Directors. The CCMG is a Canadian organisation responsible for certifying medical geneticists and clinical laboratory geneticists, and for establishing professional and ethical standards for clinical genetics services in Canada. Recommendations include (1) clinical genome-wide sequencing is an appropriate approach in the diagnostic assessment of a patient for whom there is suspicion of a significant monogenic disease that is associated with a high degree of genetic heterogeneity, or where specific genetic tests have failed to provide a diagnosis; (2) until the benefits of reporting incidental findings are established, we do not endorse the intentional clinical analysis of disease-associated genes other than those linked to the primary indication; and (3) clinicians should

  9. Research on cutoff wavelength of dominant mode and field patterns in trapezoidal microshield lines

    OpenAIRE

    SUN, Hai; WU, Yujiang

    2012-01-01

    The influence of the position of the metallic signal strip on the cutoff characteristic of the dominant mode and the field patterns in 3 types of trapezoidal microshield lines are calculated by the edge-based finite element method. These trapezoidal microshield lines include trapezoidal microshield lines with a single signal line, dual signal lines, and 3 signal lines. The cutoff wavelength of the dominant mode can be adjusted by changing the dimensions of metallic signal strips as w...

  10. Metagenomic Assembly of the Dominant Zetaproteobacteria in an Iron-oxidizing Hydrothermal Microbial Mat

    Science.gov (United States)

    Moyer, C. L.; Fullerton, H.

    2013-12-01

    Iron is the fourth most abundant element in the Earth's crust and is potentially one of the most abundant energy sources on the earth as an electron donor for chemolithoautotrophic growth coupled to Fe(II) oxidation. Despite the rapid abiotic oxidation rate of iron, many microbes have adapted to feeding off this fleeting energy source. One such bacterial class is the Zetaproteobacteria. Iron-dominated microbial mat material was collected with a small-scale syringe sampler from Loihi Seamount, Hawaii. From this sample, gDNA was extracted and prepared for paired-end Illumina sequencing. Reconstruction of SSU rDNA genes using EMERGE allowed for comparison to previous SSU rDNA surveys. Clone libraries and qPCR show these microbial mats to be dominated by Zetaproteobacteria. Results from our in silico reconstruction confirm these initial findings. RDP classification of the EMERGE reconstructed sequences resulted in 44% of the community being identified as Zetaproteobacteria. The most abundant SSU rDNA has 99% similarity to Zeta OTU-2, and only a 94% similarity to M. ferrooxidans PV-1. Zeta OTU-2 has been shown to be the most cosmopolitan population in iron-dominated hydrothermal systems from across Pacific Ocean. Metagenomic assembly has resulted in many contigs with high identity to M. ferrooxidans as identified, by BLAST. However, with large differences in SSU rRNA similarity, M. ferrooxidans PV-1 is not an adequate reference. Current work is focusing on reconstruction of the dominant microbial mat member, without the use of a reference genome through an iterative assembly approach. The resulting 'pan-genome' will be compared to other Zetaproteobacteria (at the class level) and the functional ecology of this cosmopolitan microbial mat community member will be extrapolated. Thus far, we have detected multiple housekeeping genes involved in DNA replication, transcription and translation. The most abundant metabolic gene we have found is Aconitase, a key enzyme in the

  11. VVER-1000 dominance ratio

    International Nuclear Information System (INIS)

    Gorodkov, S.

    2009-01-01

    Dominance ratio, or more precisely, its closeness to unity, is important characteristic of large reactor. It allows evaluate beforehand the number of source iterations required in deterministic calculations of power spatial distribution. Or the minimal number of histories to be modeled for achievement of statistical error level desired in large core Monte Carlo calculations. In this work relatively simple approach for dominance ratio evaluation is proposed. It essentially uses core symmetry. Dependence of dominance ratio on neutron flux spatial distribution is demonstrated. (author)

  12. WWER-1000 dominance ratio

    International Nuclear Information System (INIS)

    Gorodkov, S.S.

    2009-01-01

    Dominance ratio, or more precisely, its closeness to unity, is important characteristic of large reactor. It allows evaluate beforehand the number of source iterations required in deterministic calculations of power spatial distribution. Or the minimal number of histories to be modeled for achievement of statistical error level desired in large core Monte Carlo calculations. In this work relatively simple approach for dominance ratio evaluation is proposed. It essentially uses core symmetry. Dependence of dominance ratio on neutron flux spatial distribution is demonstrated. (Authors)

  13. The TRK-fused gene is mutated in hereditary motor and sensory neuropathy with proximal dominant involvement.

    Science.gov (United States)

    Ishiura, Hiroyuki; Sako, Wataru; Yoshida, Mari; Kawarai, Toshitaka; Tanabe, Osamu; Goto, Jun; Takahashi, Yuji; Date, Hidetoshi; Mitsui, Jun; Ahsan, Budrul; Ichikawa, Yaeko; Iwata, Atsushi; Yoshino, Hiide; Izumi, Yuishin; Fujita, Koji; Maeda, Kouji; Goto, Satoshi; Koizumi, Hidetaka; Morigaki, Ryoma; Ikemura, Masako; Yamauchi, Naoko; Murayama, Shigeo; Nicholson, Garth A; Ito, Hidefumi; Sobue, Gen; Nakagawa, Masanori; Kaji, Ryuji; Tsuji, Shoji

    2012-08-10

    Hereditary motor and sensory neuropathy with proximal dominant involvement (HMSN-P) is an autosomal-dominant neurodegenerative disorder characterized by widespread fasciculations, proximal-predominant muscle weakness, and atrophy followed by distal sensory involvement. To date, large families affected by HMSN-P have been reported from two different regions in Japan. Linkage and haplotype analyses of two previously reported families and two new families with the use of high-density SNP arrays further defined the minimum candidate region of 3.3 Mb in chromosomal region 3q12. Exome sequencing showed an identical c.854C>T (p.Pro285Leu) mutation in the TRK-fused gene (TFG) in the four families. Detailed haplotype analysis suggested two independent origins of the mutation. Pathological studies of an autopsied patient revealed TFG- and ubiquitin-immunopositive cytoplasmic inclusions in the spinal and cortical motor neurons. Fragmentation of the Golgi apparatus, a frequent finding in amyotrophic lateral sclerosis, was also observed in the motor neurons with inclusion bodies. Moreover, TAR DNA-binding protein 43 kDa (TDP-43)-positive cytoplasmic inclusions were also demonstrated. In cultured cells expressing mutant TFG, cytoplasmic aggregation of TDP-43 was demonstrated. These findings indicate that formation of TFG-containing cytoplasmic inclusions and concomitant mislocalization of TDP-43 underlie motor neuron degeneration in HMSN-P. Pathological overlap of proteinopathies involving TFG and TDP-43 highlights a new pathway leading to motor neuron degeneration. Copyright © 2012 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  14. Cloning and sequence analysis of putative type II fatty acid synthase ...

    Indian Academy of Sciences (India)

    Prakash

    Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. ... acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, β-ketoacyl-ACP .... Helix II plays a dominant role in the interaction ... main distinguishing features of plant ACPs in plastids and ..... synthase component; J. Biol.

  15. Phylogenetic and functional analysis of metagenome sequence from high-temperature archaeal habitats demonstrate linkages between metabolic potential and geochemistry

    Directory of Open Access Journals (Sweden)

    William P. Inskeep

    2013-05-01

    Full Text Available Geothermal habitats in Yellowstone National Park (YNP provide an unparalled opportunity to understand the environmental factors that control the distribution of archaea in thermal habitats. Here we describe, analyze and synthesize metagenomic and geochemical data collected from seven high-temperature sites that contain microbial communities dominated by archaea relative to bacteria. The specific objectives of the study were to use metagenome sequencing to determine the structure and functional capacity of thermophilic archaeal-dominated microbial communities across a pH range from 2.5 to 6.4 and to discuss specific examples where the metabolic potential correlated with measured environmental parameters and geochemical processes occurring in situ. Random shotgun metagenome sequence (~40-45 Mbase Sanger sequencing per site was obtained from environmental DNA extracted from high-temperature sediments and/or microbial mats and subjected to numerous phylogenetic and functional analyses. Analysis of individual sequences (e.g., MEGAN and G+C content and assemblies from each habitat type revealed the presence of dominant archaeal populations in all environments, 10 of whose genomes were largely reconstructed from the sequence data. Analysis of protein family occurrence, particularly of those involved in energy conservation, electron transport and autotrophic metabolism, revealed significant differences in metabolic strategies across sites consistent with differences in major geochemical attributes (e.g., sulfide, oxygen, pH. These observations provide an ecological basis for understanding the distribution of indigenous archaeal lineages across high temperature systems of YNP.

  16. The glacial sequence at Killiney, SE Ireland: terrestrial deglaciation and polyphase glacitectonic deformation

    NARCIS (Netherlands)

    Rijsdijk, K.F.; Warren, W.P.; van der Meer, J.J.M.

    2010-01-01

    Depositional conditions of a complexly deformed glacigenic sequence at Killiney Bay, on the west-central margin of the Irish Sea are reconstructed. Deformation geometries provide conclusive evidence for polyphase glacitectonic deformation generated by terrestrial ice sheets. They are dominated by

  17. Implicit vs. explicit dimensions of guilt and dominance in criminal psychopathy.

    Science.gov (United States)

    Nentjes, Lieke; Bernstein, David P; Cima, Maaike; Wiers, Reinout W

    The current study investigated the relationship between psychopathy and two concepts that hold a central position in conceptualizations of this disorder, being guilt and dominance. Both constructs were measured using explicit measures (i.e., self-report), as well as indirect assessment (i.e., the Single Category Implicit Association Test; Sc-IAT). Our sample consisted of 43 psychopathic offenders, 42 nonpsychopathic offenders, and 26 nonoffender controls. Although no overall group differences emerged, the lifestyle/antisocial traits of psychopathy (Factor 2) predicted reduced self-reported guilt on a dimensional level. As hypothesized, such a relationship was absent for the interpersonal/affective dimension of psychopathy (Factor 1). Psychopathy was unrelated to implicit self-guilt associations. Regarding dominance, psychopathy was not significantly associated with indirectly or explicitly assessed dominance. These findings are interpreted in the light of empirical knowledge on moral emotions, insight and response distortion in highly antisocial offenders. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Data-driven models of dominantly-inherited Alzheimer's disease progression.

    Science.gov (United States)

    Oxtoby, Neil P; Young, Alexandra L; Cash, David M; Benzinger, Tammie L S; Fagan, Anne M; Morris, John C; Bateman, Randall J; Fox, Nick C; Schott, Jonathan M; Alexander, Daniel C

    2018-03-22

    Dominantly-inherited Alzheimer's disease is widely hoped to hold the key to developing interventions for sporadic late onset Alzheimer's disease. We use emerging techniques in generative data-driven disease progression modelling to characterize dominantly-inherited Alzheimer's disease progression with unprecedented resolution, and without relying upon familial estimates of years until symptom onset. We retrospectively analysed biomarker data from the sixth data freeze of the Dominantly Inherited Alzheimer Network observational study, including measures of amyloid proteins and neurofibrillary tangles in the brain, regional brain volumes and cortical thicknesses, brain glucose hypometabolism, and cognitive performance from the Mini-Mental State Examination (all adjusted for age, years of education, sex, and head size, as appropriate). Data included 338 participants with known mutation status (211 mutation carriers in three subtypes: 163 PSEN1, 17 PSEN2, and 31 APP) and a baseline visit (age 19-66; up to four visits each, 1.1 ± 1.9 years in duration; spanning 30 years before, to 21 years after, parental age of symptom onset). We used an event-based model to estimate sequences of biomarker changes from baseline data across disease subtypes (mutation groups), and a differential equation model to estimate biomarker trajectories from longitudinal data (up to 66 mutation carriers, all subtypes combined). The two models concur that biomarker abnormality proceeds as follows: amyloid deposition in cortical then subcortical regions (∼24 ± 11 years before onset); phosphorylated tau (17 ± 8 years), tau and amyloid-β changes in cerebrospinal fluid; neurodegeneration first in the putamen and nucleus accumbens (up to 6 ± 2 years); then cognitive decline (7 ± 6 years), cerebral hypometabolism (4 ± 4 years), and further regional neurodegeneration. Our models predicted symptom onset more accurately than predictions that used familial estimates: root mean squared error of 1

  19. Profiling of the metabolically active community from a production-scale biogas plant by means of high-throughput metatranscriptome sequencing

    DEFF Research Database (Denmark)

    Zakrzewski, Martha; Goesmann, Alexander; Jaenicke, Sebastian

    2012-01-01

    of the community by classification of 16S ribosomal sequence tags revealed that members of the Euryarchaeota and Firmicutes account for the dominant phyla. Only smaller fractions of the 16S ribosomal sequence tags were assigned to the phyla Bacteroidetes, Actinobacteria and Synergistetes. Among the m...

  20. Pairwise local structural alignment of RNA sequences with sequence similarity less than 40%

    DEFF Research Database (Denmark)

    Havgaard, Jakob Hull; Lyngsø, Rune B.; Stormo, Gary D.

    2005-01-01

    detect two genes with low sequence similarity, where the genes are part of a larger genomic region. Results: Here we present such an approach for pairwise local alignment which is based on FILDALIGN and the Sankoff algorithm for simultaneous structural alignment of multiple sequences. We include...... the ability to conduct mutual scans of two sequences of arbitrary length while searching for common local structural motifs of some maximum length. This drastically reduces the complexity of the algorithm. The scoring scheme includes structural parameters corresponding to those available for free energy....... The structure prediction performance for a family is typically around 0.7 using Matthews correlation coefficient. In case (2), the algorithm is successful at locating RNA families with an average sensitivity of 0.8 and a positive predictive value of 0.9 using a BLAST-like hit selection scheme. Availability...

  1. Genome sequence of Desulfitobacterium hafniense DCB-2, a Gram-positive anaerobe capable of dehalogenation and metal reduction

    Directory of Open Access Journals (Sweden)

    Kim Sang-Hoon

    2012-02-01

    Full Text Available Abstract Background The genome of the Gram-positive, metal-reducing, dehalorespiring Desulfitobacterium hafniense DCB-2 was sequenced in order to gain insights into its metabolic capacities, adaptive physiology, and regulatory machineries, and to compare with that of Desulfitobacterium hafniense Y51, the phylogenetically closest strain among the species with a sequenced genome. Results The genome of Desulfitobacterium hafniense DCB-2 is composed of a 5,279,134-bp circular chromosome with 5,042 predicted genes. Genome content and parallel physiological studies support the cell's ability to fix N2 and CO2, form spores and biofilms, reduce metals, and use a variety of electron acceptors in respiration, including halogenated organic compounds. The genome contained seven reductive dehalogenase genes and four nitrogenase gene homologs but lacked the Nar respiratory nitrate reductase system. The D. hafniense DCB-2 genome contained genes for 43 RNA polymerase sigma factors including 27 sigma-24 subunits, 59 two-component signal transduction systems, and about 730 transporter proteins. In addition, it contained genes for 53 molybdopterin-binding oxidoreductases, 19 flavoprotein paralogs of the fumarate reductase, and many other FAD/FMN-binding oxidoreductases, proving the cell's versatility in both adaptive and reductive capacities. Together with the ability to form spores, the presence of the CO2-fixing Wood-Ljungdahl pathway and the genes associated with oxygen tolerance add flexibility to the cell's options for survival under stress. Conclusions D. hafniense DCB-2's genome contains genes consistent with its abilities for dehalogenation, metal reduction, N2 and CO2 fixation, anaerobic respiration, oxygen tolerance, spore formation, and biofilm formation which make this organism a potential candidate for bioremediation at contaminated sites.

  2. Nucleotide sequence analysis of the recA gene and discrimination of the three isolates of urease-positive thermophilic Campylobacter (UPTC) isolated from seagulls (Larus spp.) in Northern Ireland.

    Science.gov (United States)

    Matsuda, M; Tai, K; Moore, J E; Millar, B C; Murayama, O

    2004-01-01

    Nucleotide sequencing after TA cloning of the amplicon of the almost-full length recA gene from three strains of UPTC (A1, A2, and A3) isolated from seagulls in Northern Ireland, the phenotypical and genotypical characteristics of which have been demonstrated to be indistinguishable, clarified nucleotide differences at three nucleotide positions among the three strains. In conclusion, the nucleotide sequences of the recA gene were found to discriminate among the three strains of UPTC, A1, A2, and A3, which are indistinguishable phenotypically and genotypically. Thus, the present study strongly suggests that nucleotide sequence data of the amplicon of a suitable gene or region could aid in discriminating among isolates of the UPTC group, which are indistinguishable phenotypically and genotypically. Copyright 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

  3. Unveiling Mycoplasma hyopneumoniae Promoters: Sequence Definition and Genomic Distribution

    Science.gov (United States)

    Weber, Shana de Souto; Sant'Anna, Fernando Hayashi; Schrank, Irene Silveira

    2012-01-01

    Several Mycoplasma species have had their genome completely sequenced, including four strains of the swine pathogen Mycoplasma hyopneumoniae. Nevertheless, little is known about the nucleotide sequences that control transcriptional initiation in these microorganisms. Therefore, with the objective of investigating the promoter sequences of M. hyopneumoniae, 23 transcriptional start sites (TSSs) of distinct genes were mapped. A pattern that resembles the σ70 promoter −10 element was found upstream of the TSSs. However, no −35 element was distinguished. Instead, an AT-rich periodic signal was identified. About half of the experimentally defined promoters contained the motif 5′-TRTGn-3′, which was identical to the −16 element usually found in Gram-positive bacteria. The defined promoters were utilized to build position-specific scoring matrices in order to scan putative promoters upstream of all coding sequences (CDSs) in the M. hyopneumoniae genome. Two hundred and one signals were found associated with 169 CDSs. Most of these sequences were located within 100 nucleotides of the start codons. This study has shown that the number of promoter-like sequences in the M. hyopneumoniae genome is more frequent than expected by chance, indicating that most of the sequences detected are probably biologically functional. PMID:22334569

  4. Single-base resolution and long-coverage sequencing based on single-molecule nanomanipulation

    International Nuclear Information System (INIS)

    An Hongjie; Huang Jiehuan; Lue Ming; Li Xueling; Lue Junhong; Li Haikuo; Zhang Yi; Li Minqian; Hu Jun

    2007-01-01

    We show new approaches towards a novel single-molecule sequencing strategy which consists of high-resolution positioning isolation of overlapping DNA fragments with atomic force microscopy (AFM), subsequent single-molecule PCR amplification and conventional Sanger sequencing. In this study, a DNA labelling technique was used to guarantee the accuracy in positioning the target DNA. Single-molecule multiplex PCR was carried out to test the contamination. The results showed that the two overlapping DNA fragments isolated by AFM could be successfully sequenced with high quality and perfect contiguity, indicating that single-base resolution and long-coverage sequencing have been achieved simultaneously

  5. Downhill Domination in Graphs

    Directory of Open Access Journals (Sweden)

    Haynes Teresa W.

    2014-08-01

    Full Text Available A path π = (v1, v2, . . . , vk+1 in a graph G = (V,E is a downhill path if for every i, 1 ≤ i ≤ k, deg(vi ≥ deg(vi+1, where deg(vi denotes the degree of vertex vi ∈ V. The downhill domination number equals the minimum cardinality of a set S ⊆ V having the property that every vertex v ∈ V lies on a downhill path originating from some vertex in S. We investigate downhill domination numbers of graphs and give upper bounds. In particular, we show that the downhill domination number of a graph is at most half its order, and that the downhill domination number of a tree is at most one third its order. We characterize the graphs obtaining each of these bounds

  6. Generation of pseudo-random sequences for spread spectrum systems

    Science.gov (United States)

    Moser, R.; Stover, J.

    1985-05-01

    The characteristics of pseudo random radio signal sequences (PRS) are explored. The randomness of the PSR is a matter of artificially altering the sequence of binary digits broadcast. Autocorrelations of the two sequences shifted in time, if high, determine if the signals are the same and thus allow for position identification. Cross-correlation can also be calculated between sequences. Correlations closest to zero are obtained with large volume of prime numbers in the sequences. Techniques for selecting optimal and maximal lengths for the sequences are reviewed. If the correlations are near zero in the sequences, then signal channels can accommodate multiple users. Finally, Gold codes are discussed as a technique for maximizing the code lengths.

  7. Is there any relationship between right and left hand dominance and right and left nasal airflow dominance?

    Science.gov (United States)

    Price, A; Eccles, R

    2017-10-01

    Left- or right-handedness is a common human trait, and it has been previously reported that human nasal airflow dominance correlates with hand dominance. Any relationship between hand dominance and nasal airflow dominance would be unusual. This study aimed to measure nasal airflow and look for any relationship to handedness. The modified Glatzel mirror was used to record the dominant nasal passage at 15-minute intervals over a 6-hour period in 29 healthy participants consisting of 15 left-handers and 14 right-handers. In left-handers, the percentage of time that the left nasal passage was dominant ranged from 0 to 100 per cent. In right-handers, the percentage of time that the right nasal passage was dominant ranged from 4.2 to 95.8 per cent. No correlation between nasal airflow dominance and hand dominance was identified. The results do not support the hypothesis that nasal airflow and handedness are related.

  8. Parcellation as a stylistic dominant characteristic in the novel Nigdina by Svetlana Velmar Janković

    Directory of Open Access Journals (Sweden)

    Mimović Milica P.

    2015-01-01

    Full Text Available The subject of this research is parcellation as a stylistic dominant characteristic in the novel 'Nigdina' by Svetlana Velmar Janković, and also as the means of expression which is superior in regard to the other linguistic procedures. Considering the aim of syntactic-stylistic analysis in this paper, the examples were divided according to their syntactic functions identifying and interpreting syntactic structures that change word order, and simultaneously point out stylistic marking of the parcellated structure. The most frequent structures are the ones with parcellated positions of adjuncts. Adverbs and constructions with prepositions and case are comparably found in these syntactic positions. Moreover, the most frequent are adjuncts for the parcellation of syntactic position, then intonational and positional emphasis of apposition, and finally the parcellation of elements such as object, subject and an attributive. In conclusion, this procedure of making syntactic units independent, their frequency and superiority to the other stylistic procedures, contribute to the style of this novel, and point out parcellation as a dominant stylistic characteristic of this novel.

  9. Mutation of miRNA target sequences during human evolution

    DEFF Research Database (Denmark)

    Gardner, Paul P; Vinther, Jeppe

    2008-01-01

    It has long-been hypothesized that changes in non-protein-coding genes and the regulatory sequences controlling expression could undergo positive selection. Here we identify 402 putative microRNA (miRNA) target sequences that have been mutated specifically in the human lineage and show that genes...... containing such deletions are more highly expressed than their mouse orthologs. Our findings indicate that some miRNA target mutations are fixed by positive selection and might have been involved in the evolution of human-specific traits....

  10. Identification of IncA/C Plasmid Replication and Maintenance Genes and Development of a Plasmid Multilocus Sequence Typing Scheme.

    Science.gov (United States)

    Hancock, Steven J; Phan, Minh-Duy; Peters, Kate M; Forde, Brian M; Chong, Teik Min; Yin, Wai-Fong; Chan, Kok-Gan; Paterson, David L; Walsh, Timothy R; Beatson, Scott A; Schembri, Mark A

    2017-02-01

    Plasmids of incompatibility group A/C (IncA/C) are becoming increasingly prevalent within pathogenic Enterobacteriaceae They are associated with the dissemination of multiple clinically relevant resistance genes, including bla CMY and bla NDM Current typing methods for IncA/C plasmids offer limited resolution. In this study, we present the complete sequence of a bla NDM-1 -positive IncA/C plasmid, pMS6198A, isolated from a multidrug-resistant uropathogenic Escherichia coli strain. Hypersaturated transposon mutagenesis, coupled with transposon-directed insertion site sequencing (TraDIS), was employed to identify conserved genetic elements required for replication and maintenance of pMS6198A. Our analysis of TraDIS data identified roles for the replicon, including repA, a toxin-antitoxin system; two putative partitioning genes, parAB; and a putative gene, 053 Construction of mini-IncA/C plasmids and examination of their stability within E. coli confirmed that the region encompassing 053 contributes to the stable maintenance of IncA/C plasmids. Subsequently, the four major maintenance genes (repA, parAB, and 053) were used to construct a new plasmid multilocus sequence typing (PMLST) scheme for IncA/C plasmids. Application of this scheme to a database of 82 IncA/C plasmids identified 11 unique sequence types (STs), with two dominant STs. The majority of bla NDM -positive plasmids examined (15/17; 88%) fall into ST1, suggesting acquisition and subsequent expansion of this bla NDM -containing plasmid lineage. The IncA/C PMLST scheme represents a standardized tool to identify, track, and analyze the dissemination of important IncA/C plasmid lineages, particularly in the context of epidemiological studies. Copyright © 2017 American Society for Microbiology.

  11. Positive Feedbacks Enhance Macroalgal Resilience on Degraded Coral Reefs.

    Science.gov (United States)

    Dell, Claire L A; Longo, Guilherme O; Hay, Mark E

    2016-01-01

    Many reefs have shifted from coral and fish dominated habitats to less productive macroalgal dominated habitats, and current research is investigating means of reversing this phase shift. In the tropical Pacific, overfished reefs with inadequate herbivory can become dominated by the brown alga Sargassum polycystum. This alga suppresses recruitment and survival of corals and fishes, thus limiting the potential for reef recovery. Here we investigate the mechanisms that reinforce S. polycystum dominance and show that in addition to negatively affecting other species, this species acts in a self-reinforcing manner, positively promoting survival and growth of conspecifics. We found that survival and growth of both recruit-sized and mature S. polycystum fronds were higher within Sargassum beds than outside the beds and these results were found in both protected and fished reefs. Much of this benefit resulted from reduced herbivory within the Sargassum beds, but adult fronds also grew ~50% more within the beds even when herbivory did not appear to be occurring, suggesting some physiological advantage despite the intraspecific crowding. Thus via positive feedbacks, S. polycystum enhances its own growth and resistance to herbivores, facilitating its dominance (perhaps also expansion) and thus its resilience on degraded reefs. This may be a key feedback mechanism suppressing the recovery of coral communities in reefs dominated by macroalgal beds.

  12. Positive Feedbacks Enhance Macroalgal Resilience on Degraded Coral Reefs.

    Directory of Open Access Journals (Sweden)

    Claire L A Dell

    Full Text Available Many reefs have shifted from coral and fish dominated habitats to less productive macroalgal dominated habitats, and current research is investigating means of reversing this phase shift. In the tropical Pacific, overfished reefs with inadequate herbivory can become dominated by the brown alga Sargassum polycystum. This alga suppresses recruitment and survival of corals and fishes, thus limiting the potential for reef recovery. Here we investigate the mechanisms that reinforce S. polycystum dominance and show that in addition to negatively affecting other species, this species acts in a self-reinforcing manner, positively promoting survival and growth of conspecifics. We found that survival and growth of both recruit-sized and mature S. polycystum fronds were higher within Sargassum beds than outside the beds and these results were found in both protected and fished reefs. Much of this benefit resulted from reduced herbivory within the Sargassum beds, but adult fronds also grew ~50% more within the beds even when herbivory did not appear to be occurring, suggesting some physiological advantage despite the intraspecific crowding. Thus via positive feedbacks, S. polycystum enhances its own growth and resistance to herbivores, facilitating its dominance (perhaps also expansion and thus its resilience on degraded reefs. This may be a key feedback mechanism suppressing the recovery of coral communities in reefs dominated by macroalgal beds.

  13. High resolution melting detects sequence polymorphism in rubus occidentalis L. monomorphic microsatellite markers

    Science.gov (United States)

    Microsatellite, or simple sequence repeat (SSR) markers, are valuable as co-dominant genetic markers with a variety of applications such as DNA fingerprinting, linkage mapping, and population structure analysis. However, primer pairs designed from the regions that flank SSRs often generate fragment...

  14. The mitochondrial genome sequence of the Tasmanian tiger (Thylacinus cynocephalus)

    DEFF Research Database (Denmark)

    Miller, Webb; Drautz, Daniela I; Janecka, Jan E

    2009-01-01

    We report the first two complete mitochondrial genome sequences of the thylacine (Thylacinus cynocephalus), or so-called Tasmanian tiger, extinct since 1936. The thylacine's phylogenetic position within australidelphian marsupials has long been debated, and here we provide strong support for the ......We report the first two complete mitochondrial genome sequences of the thylacine (Thylacinus cynocephalus), or so-called Tasmanian tiger, extinct since 1936. The thylacine's phylogenetic position within australidelphian marsupials has long been debated, and here we provide strong support...... for the thylacine's basal position in Dasyuromorphia, aided by mitochondrial genome sequence that we generated from the extant numbat (Myrmecobius fasciatus). Surprisingly, both of our thylacine sequences differ by 11%-15% from putative thylacine mitochondrial genes in GenBank, with one of our samples originating...... at a very low genetic diversity shortly before extinction. Despite the samples' heavy contamination with bacterial and human DNA and their temperate storage history, we estimate that as much as one-third of the total DNA in each sample is from the thylacine. The microbial content of the two thylacine...

  15. Seq2Logo: a method for construction and visualization of amino acid binding motifs and sequence profiles including sequence weighting, pseudo counts and two-sided representation of amino acid enrichment and depletion

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Nielsen, Morten

    2012-01-01

    Seq2Logo is a web-based sequence logo generator. Sequence logos are a graphical representation of the information content stored in a multiple sequence alignment (MSA) and provide a compact and highly intuitive representation of the position-specific amino acid composition of binding motifs, active...... related to amino acid enrichment and depletion. Besides allowing input in the format of peptides and MSA, Seq2Logo accepts input as Blast sequence profiles, providing easy access for non-expert end-users to characterize and identify functionally conserved/variable amino acids in any given protein...... sites, etc. in biological sequences. Accurate generation of sequence logos is often compromised by sequence redundancy and low number of observations. Moreover, most methods available for sequence logo generation focus on displaying the position-specific enrichment of amino acids, discarding the equally...

  16. Assessing the fidelity of ancient DNA sequences amplified from nuclear genes

    DEFF Research Database (Denmark)

    Binladen, Jonas; Wiuf, Carsten Henrik; Gilbert, M. Thomas P.

    2006-01-01

    To date, the field of ancient DNA has relied almost exclusively on mitochondrial DNA (mtDNA) sequences. However, a number of recent studies have reported the successful recovery of ancient nuclear DNA (nuDNA) sequences, thereby allowing the characterization of genetic loci directly involved...... in phenotypic traits of extinct taxa. It is well documented that postmortem damage in ancient mtDNA can lead to the generation of artifactual sequences. However, as yet no one has thoroughly investigated the damage spectrum in ancient nuDNA. By comparing clone sequences from 23 fossil specimens, recovered from...... adenine), respectively. Type 2 transitions are by far the most dominant and increase relative to those of type 1 with damage load. The results suggest that the deamination of cytosine (and 5-methyl cytosine) to uracil (and thymine) is the main cause of miscoding lesions in both ancient mtDNA and nu...

  17. On The Roman Domination Stable Graphs

    Directory of Open Access Journals (Sweden)

    Hajian Majid

    2017-11-01

    Full Text Available A Roman dominating function (or just RDF on a graph G = (V,E is a function f : V → {0, 1, 2} satisfying the condition that every vertex u for which f(u = 0 is adjacent to at least one vertex v for which f(v = 2. The weight of an RDF f is the value f(V (G = Pu2V (G f(u. The Roman domination number of a graph G, denoted by R(G, is the minimum weight of a Roman dominating function on G. A graph G is Roman domination stable if the Roman domination number of G remains unchanged under removal of any vertex. In this paper we present upper bounds for the Roman domination number in the class of Roman domination stable graphs, improving bounds posed in [V. Samodivkin, Roman domination in graphs: the class RUV R, Discrete Math. Algorithms Appl. 8 (2016 1650049].

  18. The Offlap Break Position Vs Sea Level: A Discussion

    Science.gov (United States)

    Tropeano, M.; Pieri, P.; Pomar, L.; Sabato, L.

    the offlap break might cause a misinterpretation of the ancient sea-level positions and the inferred relative sea-level changes. 2) both baselevels, the sea level and the wave/tide base, govern sedimentary accumulation in wave/tide dominated shelves and, consequently, two offlap breaks may coexist (beach edge and shoreface edge) in shallow-marine depositional profiles (Carter et al., 1991). In this setting, two seaward-clinobedded lithosomes, separated by an unconformity, may develop during relative still-stand or falls of the sea-level (Hill et al., 1998). In this case, the two stacked lithosomes could be misinterpreted as two different systems tracts, or sequences, and it could led to the construction of an 1 uncorrect curve of sea-level changes. Carter R.M., Abbott S.T., Fulthorpe C.S., Haywick D.W. and Henderson R.A. (1991): Application of global sea-level and sequence-stratigraphic models in Southern Hemi- sphere Neogene strata from New Zealand. Sp. Publ. IAS, 12, 41-65. Hernández- Molina F.J., Fernández-Salas L.M., Lobo F., Somoza L., Diaz-del-Rio V. and Alver- inho Dias J.M. (2000): The infralittoral prograding wedge: a new large-scale prograda- tional sedimentary body in shallow marine environments. Geo-Marine Letters, 20, 109-117. Hill P.R., Longuépée H. and Roberge M. (1998). Live from Canada: forced regression in action; deltaic shoreface sandbodies being formed. Abstracts, 15th Int. Cong. IAS, Alicante (Spain), 427-428. Pomar L. and Tropeano M. (2001). The Cal- carenite di Gravina Formation in Matera (southern Italy): new insights for coarse- grained, large-scale, cross-bedded bodies encased in offshore deposits. AAPG Bull., 85, 661-689. 2

  19. The Accident Sequence Precursor program: Methods improvements and current results

    International Nuclear Information System (INIS)

    Minarick, J.W.; Manning, F.M.; Harris, J.D.

    1987-01-01

    Changes in the US NRC Accident Sequence Precursor program methods since the initial program evaluations of 1969-81 operational events are described, along with insights from the review of 1984-85 events. For 1984-85, the number of significant precursors was consistent with the number observed in 1980-81, dominant sequences associated with significant events were reasonably consistent with PRA estimates for BWRs, but lacked the contribution due to small-break LOCAs previously observed and predicted in PWRs, and the frequency of initiating events and non-recoverable system failures exhibited some reduction compared to 1980-81. Operational events which provide information concerning additional PRA modeling needs are also described

  20. Mutations in DSTYK and dominant urinary tract malformations.

    Science.gov (United States)

    Sanna-Cherchi, Simone; Sampogna, Rosemary V; Papeta, Natalia; Burgess, Katelyn E; Nees, Shannon N; Perry, Brittany J; Choi, Murim; Bodria, Monica; Liu, Yan; Weng, Patricia L; Lozanovski, Vladimir J; Verbitsky, Miguel; Lugani, Francesca; Sterken, Roel; Paragas, Neal; Caridi, Gianluca; Carrea, Alba; Dagnino, Monica; Materna-Kiryluk, Anna; Santamaria, Giuseppe; Murtas, Corrado; Ristoska-Bojkovska, Nadica; Izzi, Claudia; Kacak, Nilgun; Bianco, Beatrice; Giberti, Stefania; Gigante, Maddalena; Piaggio, Giorgio; Gesualdo, Loreto; Vukic, Durdica Kosuljandic; Vukojevic, Katarina; Saraga-Babic, Mirna; Saraga, Marijan; Gucev, Zoran; Allegri, Landino; Latos-Bielenska, Anna; Casu, Domenica; State, Matthew; Scolari, Francesco; Ravazzolo, Roberto; Kiryluk, Krzysztof; Al-Awqati, Qais; D'Agati, Vivette D; Drummond, Iain A; Tasic, Velibor; Lifton, Richard P; Ghiggeri, Gian Marco; Gharavi, Ali G

    2013-08-15

    Congenital abnormalities of the kidney and the urinary tract are the most common cause of pediatric kidney failure. These disorders are highly heterogeneous, and the etiologic factors are poorly understood. We performed genomewide linkage analysis and whole-exome sequencing in a family with an autosomal dominant form of congenital abnormalities of the kidney or urinary tract (seven affected family members). We also performed a sequence analysis in 311 unrelated patients, as well as histologic and functional studies. Linkage analysis identified five regions of the genome that were shared among all affected family members. Exome sequencing identified a single, rare, deleterious variant within these linkage intervals, a heterozygous splice-site mutation in the dual serine-threonine and tyrosine protein kinase gene (DSTYK). This variant, which resulted in aberrant splicing of messenger RNA, was present in all affected family members. Additional, independent DSTYK mutations, including nonsense and splice-site mutations, were detected in 7 of 311 unrelated patients. DSTYK is highly expressed in the maturing epithelia of all major organs, localizing to cell membranes. Knockdown in zebrafish resulted in developmental defects in multiple organs, which suggested loss of fibroblast growth factor (FGF) signaling. Consistent with this finding is the observation that DSTYK colocalizes with FGF receptors in the ureteric bud and metanephric mesenchyme. DSTYK knockdown in human embryonic kidney cells inhibited FGF-stimulated phosphorylation of extracellular-signal-regulated kinase (ERK), the principal signal downstream of receptor tyrosine kinases. We detected independent DSTYK mutations in 2.3% of patients with congenital abnormalities of the kidney or urinary tract, a finding that suggests that DSTYK is a major determinant of human urinary tract development, downstream of FGF signaling. (Funded by the National Institutes of Health and others.).

  1. High-throughput sequencing of the B-cell receptor in African Burkitt lymphoma reveals clues to pathogenesis.

    Science.gov (United States)

    Lombardo, Katharine A; Coffey, David G; Morales, Alicia J; Carlson, Christopher S; Towlerton, Andrea M H; Gerdts, Sarah E; Nkrumah, Francis K; Neequaye, Janet; Biggar, Robert J; Orem, Jackson; Casper, Corey; Mbulaiteye, Sam M; Bhatia, Kishor G; Warren, Edus H

    2017-03-28

    Burkitt lymphoma (BL), the most common pediatric cancer in sub-Saharan Africa, is a malignancy of antigen-experienced B lymphocytes. High-throughput sequencing (HTS) of the immunoglobulin heavy ( IGH ) and light chain ( IGK / IGL ) loci was performed on genomic DNA from 51 primary BL tumors: 19 from Uganda and 32 from Ghana. Reverse transcription polymerase chain reaction analysis and tumor RNA sequencing (RNAseq) was performed on the Ugandan tumors to confirm and extend the findings from the HTS of tumor DNA. Clonal IGH and IGK / IGL rearrangements were identified in 41 and 46 tumors, respectively. Evidence for rearrangement of the second IGH allele was observed in only 6 of 41 tumor samples with a clonal IGH rearrangement, suggesting that the normal process of biallelic IGHD to IGHJ diversity-joining (DJ) rearrangement is often disrupted in BL progenitor cells. Most tumors, including those with a sole dominant, nonexpressed DJ rearrangement, contained many IGH and IGK / IGL sequences that differed from the dominant rearrangement by < 10 nucleotides, suggesting that the target of ongoing mutagenesis of these loci in BL tumor cells is not limited to expressed alleles. IGHV usage in both BL tumor cohorts revealed enrichment for IGHV genes that are infrequently used in memory B cells from healthy subjects. Analysis of publicly available DNA sequencing and RNAseq data revealed that these same IGHV genes were overrepresented in dominant tumor-associated IGH rearrangements in several independent BL tumor cohorts. These data suggest that BL derives from an abnormal B-cell progenitor and that aberrant mutational processes are active on the immunoglobulin loci in BL cells.

  2. A note on isolate domination

    Directory of Open Access Journals (Sweden)

    Ismail Sahul Hamid

    2016-04-01

    Full Text Available A set $S$ of vertices of a graph $G$ such that $\\left\\langle S\\right\\rangle$ has an isolated vertex is called an \\emph{isolate set} of $G$. The minimum and maximum cardinality of a maximal isolate set are called the \\emph{isolate number} $i_0(G$ and the \\emph{upper isolate number} $I_0(G$ respectively. An isolate set that is also a dominating set (an irredundant set is an $\\emph{isolate dominating set} \\ (\\emph{an isolate irredundant set}$. The \\emph{isolate domination number} $\\gamma_0(G$ and the \\emph{upper isolate domination number} $\\Gamma_0(G$ are respectively the minimum and maximum cardinality of a minimal isolate dominating set while the \\emph{isolate irredundance number} $ir_0(G$ and the \\emph{upper isolate irredundance number} $IR_0(G$ are the minimum and maximum cardinality of a maximal isolate irredundant set of $G$. The notion of isolate domination was introduced in \\cite{sb} and the remaining were introduced in \\cite{isrn}. This paper further extends a study of these parameters.   

  3. MetaGaAP: A Novel Pipeline to Estimate Community Composition and Abundance from Non-Model Sequence Data

    Directory of Open Access Journals (Sweden)

    Christopher Noune

    2017-02-01

    Full Text Available Next generation sequencing and bioinformatic approaches are increasingly used to quantify microorganisms within populations by analysis of ‘meta-barcode’ data. This approach relies on comparison of amplicon sequences of ‘barcode’ regions from a population with public-domain databases of reference sequences. However, for many organisms relevant ‘barcode’ regions may not have been identified and large databases of reference sequences may not be available. A workflow and software pipeline, ‘MetaGaAP,’ was developed to identify and quantify genotypes through four steps: shotgun sequencing and identification of polymorphisms in a metapopulation to identify custom ‘barcode’ regions of less than 30 polymorphisms within the span of a single ‘read’, amplification and sequencing of the ‘barcode’, generation of a custom database of polymorphisms, and quantitation of the relative abundance of genotypes. The pipeline and workflow were validated in a ‘wild type’ Alphabaculovirus isolate, Helicoverpa armigera single nucleopolyhedrovirus (HaSNPV-AC53 and a tissue-culture derived strain (HaSNPV-AC53-T2. The approach was validated by comparison of polymorphisms in amplicons and shotgun data, and by comparison of predicted dominant and co-dominant genotypes with Sanger sequences. The computational power required to generate and search the database effectively limits the number of polymorphisms that can be included in a barcode to 30 or less. The approach can be used in quantitative analysis of the ecology and pathology of non-model organisms.

  4. Bias in phylogenetic reconstruction of vertebrate rhodopsin sequences.

    Science.gov (United States)

    Chang, B S; Campbell, D L

    2000-08-01

    Two spurious nodes were found in phylogenetic analyses of vertebrate rhodopsin sequences in comparison with well-established vertebrate relationships. These spurious reconstructions were well supported in bootstrap analyses and occurred independently of the method of phylogenetic analysis used (parsimony, distance, or likelihood). Use of this data set of vertebrate rhodopsin sequences allowed us to exploit established vertebrate relationships, as well as the considerable amount known about the molecular evolution of this gene, in order to identify important factors contributing to the spurious reconstructions. Simulation studies using parametric bootstrapping indicate that it is unlikely that the spurious nodes in the parsimony analyses are due to long branches or other topological effects. Rather, they appear to be due to base compositional bias at third positions, codon bias, and convergent evolution at nucleotide positions encoding the hydrophobic residues isoleucine, leucine, and valine. LogDet distance methods, as well as maximum-likelihood methods which allow for nonstationary changes in base composition, reduce but do not entirely eliminate support for the spurious resolutions. Inclusion of five additional rhodopsin sequences in the phylogenetic analyses largely corrected one of the spurious reconstructions while leaving the other unaffected. The additional sequences not only were more proximal to the corrected node, but were also found to have intermediate levels of base composition and codon bias as compared with neighboring sequences on the tree. This study shows that the spurious reconstructions can be corrected either by excluding third positions, as well as those encoding the amino acids Ile, Val, and Leu (which may not be ideal, as these sites can contain useful phylogenetic signal for other parts of the tree), or by the addition of sequences that reduce problems associated with convergent evolution.

  5. Impact of absorptive capacity and dominant logic on ERP assimilation in Chinese firms

    Directory of Open Access Journals (Sweden)

    Farhan Khan

    2017-09-01

    Full Text Available Firms belong to social communities that are experts in creation of new knowledge from environment. Knowledge that is generated from past experience and from environment can affect firm’s process positively. Processing knowledge assimilation in a better way, strong leadership abilities are needed. That can recognize knowledge from environment in the sense of opportunities and threats. In this article, we discuss the effect of absorptive capacity (ACAP and dominant logic (DL on enterprise resource planning (ERP. Dynamic capabilities (DC of top managers to absorb the knowledge from the environment and assimilate it according to their needs that improve firm’s enterprise resource planning (ERP. Our main focus in this article is knowledge and how top-level managers routine that knowledge to get the future benefits for their respective firms. The model was adopted from past literature that shows the effect of absorptive capacity its subsets and dominant logic and its dimensions on ERP assimilation. For this study we examined the Chinese firms located in Hefei city (Anhui province China. Hefei is one of the fastest developing and emerging economic hub in China. Employees from top level are the target group in this study. The results prove our hypotheses that absorptive capacity and dominant logic have a positive influence on ERP in Chinese firms, that not only increases the productivity and performance of the firm, but also helps in the allocation of resources and decision making processes to stand in the dynamic market and oppose any kind of threats. Our results showed positive correlation between all the variables.

  6. Dominant, open nonverbal displays are attractive at zero-acquaintance.

    Science.gov (United States)

    Vacharkulksemsuk, Tanya; Reit, Emily; Khambatta, Poruz; Eastwick, Paul W; Finkel, Eli J; Carney, Dana R

    2016-04-12

    Across two field studies of romantic attraction, we demonstrate that postural expansiveness makes humans more romantically appealing. In a field study (n = 144 speed-dates), we coded nonverbal behaviors associated with liking, love, and dominance. Postural expansiveness-expanding the body in physical space-was most predictive of attraction, with each one-unit increase in coded behavior from the video recordings nearly doubling a person's odds of getting a "yes" response from one's speed-dating partner. In a subsequent field experiment (n = 3,000), we tested the causality of postural expansion (vs. contraction) on attraction using a popular Global Positioning System-based online-dating application. Mate-seekers rapidly flipped through photographs of potential sexual/date partners, selecting those they desired to meet for a date. Mate-seekers were significantly more likely to select partners displaying an expansive (vs. contractive) nonverbal posture. Mediation analyses demonstrate one plausible mechanism through which expansiveness is appealing: Expansiveness makes the dating candidate appear more dominant. In a dating world in which success sometimes is determined by a split-second decision rendered after a brief interaction or exposure to a static photograph, single persons have very little time to make a good impression. Our research suggests that a nonverbal dominance display increases a person's chances of being selected as a potential mate.

  7. Dominance relationships among siamang males living in multimale groups.

    Science.gov (United States)

    Morino, Luca

    2016-03-01

    Intense intolerance among males is considered to be an important mechanism maintaining the uni-male organization traditionally attributed to socially monogamous gibbons. Long-term field work, however, has revealed the existence of stable, socially polyandrous groups in at least two populations, raising questions about the mechanism that allows two adult males to co-reside in the same group. I collected 21 months of behavioral data on 7 two-male groups of wild siamangs (Symphalangus syndactylus) in southern Sumatra (Indonesia) to test the hypothesis that dominance relationships regulate the interactions of adult male siamangs and ultimately facilitate multi-male social groups. A dominant male could clearly be identified in each dyad, based on a consistent direction of agonistic interactions, displacements and the maintenance of an advantageous position in the canopy. Males identified as dominant enjoyed greater social access to the resident female and monopolized copulations. These results suggest that gibbons possess the psycho-social flexibility to regulate intra-sexual aggression and live in multi-male social units under certain social conditions. I discuss the effects that relatedness between males and female choice have in determining this grouping pattern, and the role of male intolerance in the maintenance of primate mating systems. © 2015 Wiley Periodicals, Inc.

  8. Sedimentology and geochemistry of early Proterozoic storm-dominated deposits in the transition zone from microbanded Kuruman to granular Griquatown iron-formation, Griqualand West

    International Nuclear Information System (INIS)

    Beukes, N.J.; Klein, C.

    1990-01-01

    A transition from microbanded Kuruman to granular Griquatown iron-formation is described in terms of sedimentological, petrographic, and geochemical characteristics, as well as whole rock carbon and oxygen isotopic compositions. Five major lithofacies are present in the Kuruman-Griquatown transition zone. The lithofacies are arranged in an upward coarsening sequence. It is concluded that the coarsening upward microbanded-granular iron-formation units in the Kuruman-Griquatown sequence represent shallowing upward storm-dominated deposits. 2 refs

  9. Effects of sequence on DNA wrapping around histones

    Science.gov (United States)

    Ortiz, Vanessa

    2011-03-01

    A central question in biophysics is whether the sequence of a DNA strand affects its mechanical properties. In epigenetics, these are thought to influence nucleosome positioning and gene expression. Theoretical and experimental attempts to answer this question have been hindered by an inability to directly resolve DNA structure and dynamics at the base-pair level. In our previous studies we used a detailed model of DNA to measure the effects of sequence on the stability of naked DNA under bending. Sequence was shown to influence DNA's ability to form kinks, which arise when certain motifs slide past others to form non-native contacts. Here, we have now included histone-DNA interactions to see if the results obtained for naked DNA are transferable to the problem of nucleosome positioning. Different DNA sequences interacting with the histone protein complex are studied, and their equilibrium and mechanical properties are compared among themselves and with the naked case. NLM training grant to the Computation and Informatics in Biology and Medicine Training Program (NLM T15LM007359).

  10. Positive Predictive Values of International Classification of Diseases, 10th Revision Coding Algorithms to Identify Patients With Autosomal Dominant Polycystic Kidney Disease

    Directory of Open Access Journals (Sweden)

    Vinusha Kalatharan

    2016-12-01

    Full Text Available Background: International Classification of Diseases, 10th Revision codes (ICD-10 for autosomal dominant polycystic kidney disease (ADPKD is used within several administrative health care databases. It is unknown whether these codes identify patients who meet strict clinical criteria for ADPKD. Objective: The objective of this study is (1 to determine whether different ICD-10 coding algorithms identify adult patients who meet strict clinical criteria for ADPKD as assessed through medical chart review and (2 to assess the number of patients identified with different ADPKD coding algorithms in Ontario. Design: Validation study of health care database codes, and prevalence. Setting: Ontario, Canada. Patients: For the chart review, 201 adult patients with hospital encounters between April 1, 2002, and March 31, 2014, assigned either ICD-10 codes Q61.2 or Q61.3. Measurements: This study measured positive predictive value of the ICD-10 coding algorithms and the number of Ontarians identified with different coding algorithms. Methods: We manually reviewed a random sample of medical charts in London, Ontario, Canada, and determined whether or not ADPKD was present according to strict clinical criteria. Results: The presence of either ICD-10 code Q61.2 or Q61.3 in a hospital encounter had a positive predictive value of 85% (95% confidence interval [CI], 79%-89% and identified 2981 Ontarians (0.02% of the Ontario adult population. The presence of ICD-10 code Q61.2 in a hospital encounter had a positive predictive value of 97% (95% CI, 86%-100% and identified 394 adults in Ontario (0.003% of the Ontario adult population. Limitations: (1 We could not calculate other measures of validity; (2 the coding algorithms do not identify patients without hospital encounters; and (3 coding practices may differ between hospitals. Conclusions: Most patients with ICD-10 code Q61.2 or Q61.3 assigned during their hospital encounters have ADPKD according to the clinical

  11. Sequence polymorphism in an insect RNA virus field population: A snapshot from a single point in space and time reveals stochastic differences among and within individual hosts

    Energy Technology Data Exchange (ETDEWEB)

    Stenger, Drake C., E-mail: drake.stenger@ars.usda.gov [USDA, Agricultural Research Service, San Joaquin Valley Agricultural Sciences Center, 9611 South Riverbend Ave., Parlier, CA 93648-9757 (United States); Krugner, Rodrigo [USDA, Agricultural Research Service, San Joaquin Valley Agricultural Sciences Center, 9611 South Riverbend Ave., Parlier, CA 93648-9757 (United States); Nouri, Shahideh; Ferriol, Inmaculada; Falk, Bryce W. [Department of Plant Pathology, University of California, Davis, CA 95616 (United States); Sisterson, Mark S. [USDA, Agricultural Research Service, San Joaquin Valley Agricultural Sciences Center, 9611 South Riverbend Ave., Parlier, CA 93648-9757 (United States)

    2016-11-15

    Population structure of Homalodisca coagulata Virus-1 (HoCV-1) among and within field-collected insects sampled from a single point in space and time was examined. Polymorphism in complete consensus sequences among single-insect isolates was dominated by synonymous substitutions. The mutant spectrum of the C2 helicase region within each single-insect isolate was unique and dominated by nonsynonymous singletons. Bootstrapping was used to correct the within-isolate nonsynonymous:synonymous arithmetic ratio (N:S) for RT-PCR error, yielding an N:S value ~one log-unit greater than that of consensus sequences. Probability of all possible single-base substitutions for the C2 region predicted N:S values within 95% confidence limits of the corrected within-isolate N:S when the only constraint imposed was viral polymerase error bias for transitions over transversions. These results indicate that bottlenecks coupled with strong negative/purifying selection drive consensus sequences toward neutral sequence space, and that most polymorphism within single-insect isolates is composed of newly-minted mutations sampled prior to selection. -- Highlights: •Sampling protocol minimized differential selection/history among isolates. •Polymorphism among consensus sequences dominated by negative/purifying selection. •Within-isolate N:S ratio corrected for RT-PCR error by bootstrapping. •Within-isolate mutant spectrum dominated by new mutations yet to undergo selection.

  12. An evaluation of Comparative Genome Sequencing (CGS by comparing two previously-sequenced bacterial genomes

    Directory of Open Access Journals (Sweden)

    Herring Christopher D

    2007-08-01

    Full Text Available Abstract Background With the development of new technology, it has recently become practical to resequence the genome of a bacterium after experimental manipulation. It is critical though to know the accuracy of the technique used, and to establish confidence that all of the mutations were detected. Results In order to evaluate the accuracy of genome resequencing using the microarray-based Comparative Genome Sequencing service provided by Nimblegen Systems Inc., we resequenced the E. coli strain W3110 Kohara using MG1655 as a reference, both of which have been completely sequenced using traditional sequencing methods. CGS detected 7 of 8 small sequence differences, one large deletion, and 9 of 12 IS element insertions present in W3110, but did not detect a large chromosomal inversion. In addition, we confirmed that CGS also detected 2 SNPs, one deletion and 7 IS element insertions that are not present in the genome sequence, which we attribute to changes that occurred after the creation of the W3110 lambda clone library. The false positive rate for SNPs was one per 244 Kb of genome sequence. Conclusion CGS is an effective way to detect multiple mutations present in one bacterium relative to another, and while highly cost-effective, is prone to certain errors. Mutations occurring in repeated sequences or in sequences with a high degree of secondary structure may go undetected. It is also critical to follow up on regions of interest in which SNPs were not called because they often indicate deletions or IS element insertions.

  13. Genetic Dominance & Cellular Processes

    Science.gov (United States)

    Seager, Robert D.

    2014-01-01

    In learning genetics, many students misunderstand and misinterpret what "dominance" means. Understanding is easier if students realize that dominance is not a mechanism, but rather a consequence of underlying cellular processes. For example, metabolic pathways are often little affected by changes in enzyme concentration. This means that…

  14. Colorimetric and dynamic light scattering detection of DNA sequences by using positively charged gold nanospheres: a comparative study with gold nanorods

    Science.gov (United States)

    Pylaev, T. E.; Khanadeev, V. A.; Khlebtsov, B. N.; Dykman, L. A.; Bogatyrev, V. A.; Khlebtsov, N. G.

    2011-07-01

    We introduce a new genosensing approach employing CTAB (cetyltrimethylammonium bromide)-coated positively charged colloidal gold nanoparticles (GNPs) to detect target DNA sequences by using absorption spectroscopy and dynamic light scattering. The approach is compared with a previously reported method employing unmodified CTAB-coated gold nanorods (GNRs). Both approaches are based on the observation that whereas the addition of probe and target ssDNA to CTAB-coated particles results in particle aggregation, no aggregation is observed after addition of probe and nontarget DNA sequences. Our goal was to compare the feasibility and sensitivity of both methods. A 21-mer ssDNA from the human immunodeficiency virus type 1 HIV-1 U5 long terminal repeat (LTR) sequence and a 23-mer ssDNA from the Bacillus anthracis cryptic protein and protective antigen precursor (pagA) genes were used as ssDNA models. In the case of GNRs, unexpectedly, the colorimetric test failed with perfect cigar-like particles but could be performed with dumbbell and dog-bone rods. By contrast, our approach with cationic CTAB-coated GNPs is easy to implement and possesses excellent feasibility with retention of comparable sensitivity—a 0.1 nM concentration of target cDNA can be detected with the naked eye and 10 pM by dynamic light scattering (DLS) measurements. The specificity of our method is illustrated by successful DLS detection of one-three base mismatches in cDNA sequences for both DNA models. These results suggest that the cationic GNPs and DLS can be used for genosensing under optimal DNA hybridization conditions without any chemical modifications of the particle surface with ssDNA molecules and signal amplification. Finally, we discuss a more than two-three-order difference in the reported estimations of the detection sensitivity of colorimetric methods (0.1 to 10-100 pM) to show that the existing aggregation models are inconsistent with the detection limits of about 0.1-1 pM DNA and that

  15. Unexpected Dominance of Elusive Acidobacteria in Early Industrial Soft Coal Slags

    Directory of Open Access Journals (Sweden)

    Carl-Eric Wegner

    2017-06-01

    Full Text Available Acid mine drainage (AMD and mine tailing environments are well-characterized ecosystems known to be dominated by organisms involved in iron- and sulfur-cycling. Here we examined the microbiology of industrial soft coal slags that originate from alum leaching, an ecosystem distantly related to AMD environments. Our study involved geochemical analyses, bacterial community profiling, and shotgun metagenomics. The slags still contained high amounts of alum constituents (aluminum, sulfur, which mediated direct and indirect effects on bacterial community structure. Bacterial groups typically found in AMD systems and mine tailings were not present. Instead, the soft coal slags were dominated by uncharacterized groups of Acidobacteria (DA052 [subdivision 2], KF-JG30-18 [subdivision 13], Actinobacteria (TM214, Alphaproteobacteria (DA111, and Chloroflexi (JG37-AG-4, which have previously been detected primarily in peatlands and uranium waste piles. Shotgun metagenomics allowed us to reconstruct 13 high-quality Acidobacteria draft genomes, of which two genomes could be directly linked to dominating groups (DA052, KF-JG30-18 by recovered 16S rRNA gene sequences. Comparative genomics revealed broad carbon utilization capabilities for these two groups of elusive Acidobacteria, including polysaccharide breakdown (cellulose, xylan and the competence to metabolize C1 compounds (ribulose monophosphate pathway and lignin derivatives (dye-decolorizing peroxidases. Equipped with a broad range of efflux systems for metal cations and xenobiotics, DA052 and KF-JG30-18 may have a competitive advantage over other bacterial groups in this unique habitat.

  16. Subclinical primary psychopathy, but not physical formidability or attractiveness, predicts conversational dominance in a zero-acquaintance situation.

    Science.gov (United States)

    Manson, Joseph H; Gervais, Matthew M; Fessler, Daniel M T; Kline, Michelle A

    2014-01-01

    The determinants of conversational dominance are not well understood. We used videotaped triadic interactions among unacquainted same-sex American college students to test predictions drawn from the theoretical distinction between dominance and prestige as modes of human status competition. Specifically, we investigated the effects of physical formidability, facial attractiveness, social status, and self-reported subclinical psychopathy on quantitative (proportion of words produced), participatory (interruptions produced and sustained), and sequential (topic control) dominance. No measure of physical formidability or attractiveness was associated with any form of conversational dominance, suggesting that the characteristics of our study population or experimental frame may have moderated their role in dominance dynamics. Primary psychopathy was positively associated with quantitative dominance and (marginally) overall triad talkativeness, and negatively associated (in men) with affect word use, whereas secondary psychopathy was unrelated to conversational dominance. The two psychopathy factors had significant opposing effects on quantitative dominance in a multivariate model. These latter findings suggest that glibness in primary psychopathy may function to elicit exploitable information from others in a relationally mobile society.

  17. Subclinical primary psychopathy, but not physical formidability or attractiveness, predicts conversational dominance in a zero-acquaintance situation.

    Directory of Open Access Journals (Sweden)

    Joseph H Manson

    Full Text Available The determinants of conversational dominance are not well understood. We used videotaped triadic interactions among unacquainted same-sex American college students to test predictions drawn from the theoretical distinction between dominance and prestige as modes of human status competition. Specifically, we investigated the effects of physical formidability, facial attractiveness, social status, and self-reported subclinical psychopathy on quantitative (proportion of words produced, participatory (interruptions produced and sustained, and sequential (topic control dominance. No measure of physical formidability or attractiveness was associated with any form of conversational dominance, suggesting that the characteristics of our study population or experimental frame may have moderated their role in dominance dynamics. Primary psychopathy was positively associated with quantitative dominance and (marginally overall triad talkativeness, and negatively associated (in men with affect word use, whereas secondary psychopathy was unrelated to conversational dominance. The two psychopathy factors had significant opposing effects on quantitative dominance in a multivariate model. These latter findings suggest that glibness in primary psychopathy may function to elicit exploitable information from others in a relationally mobile society.

  18. Subclinical Primary Psychopathy, but Not Physical Formidability or Attractiveness, Predicts Conversational Dominance in a Zero-Acquaintance Situation

    Science.gov (United States)

    Manson, Joseph H.; Gervais, Matthew M.; Fessler, Daniel M. T.; Kline, Michelle A.

    2014-01-01

    The determinants of conversational dominance are not well understood. We used videotaped triadic interactions among unacquainted same-sex American college students to test predictions drawn from the theoretical distinction between dominance and prestige as modes of human status competition. Specifically, we investigated the effects of physical formidability, facial attractiveness, social status, and self-reported subclinical psychopathy on quantitative (proportion of words produced), participatory (interruptions produced and sustained), and sequential (topic control) dominance. No measure of physical formidability or attractiveness was associated with any form of conversational dominance, suggesting that the characteristics of our study population or experimental frame may have moderated their role in dominance dynamics. Primary psychopathy was positively associated with quantitative dominance and (marginally) overall triad talkativeness, and negatively associated (in men) with affect word use, whereas secondary psychopathy was unrelated to conversational dominance. The two psychopathy factors had significant opposing effects on quantitative dominance in a multivariate model. These latter findings suggest that glibness in primary psychopathy may function to elicit exploitable information from others in a relationally mobile society. PMID:25426962

  19. COMPARISON OF UNILATERAL SQUAT STRENGTH BETWEEN THE DOMINANT AND NON-DOMINANT LEG IN MEN AND WOMEN

    Directory of Open Access Journals (Sweden)

    Kevin McCurdy

    2005-06-01

    Full Text Available The purpose of this study was to compare unilateral squat strength of the dominant and non-dominant leg in young adult men and women. Seventeen apparently healthy men (mean mass 90.5 ± 20.9 kg and age 21.7 ± 1.8 yrs and 25 women (mean mass 62.2 ± 14.5 kg and age 21.9 ± 1.3 yrs completed the study. To determine unilateral strength, the subjects completed a one repetition maximum (1RM modified unilateral squat (MUS on the dominant and non-dominant leg. The subjects completed the squat to a depth that attained a 90º angle at the knee. This exercise was executed by placing the top of the metatarsophalangeal area of the foot of the uninvolved leg on a support bar behind the subject to isolate the use of the lead leg. Paired samples t-test revealed no significant difference between the men's 1RM mean strength on the dominant (107.0 ± 21.4 kg and non-dominant (106.0 ± 21.4 kg leg with a mean side-to-side difference (comparing the stronger to the weaker leg of 2.8 %. Leg strength symmetry was also found between the women's 1RM mean strength on the dominant (45.3 ± 12.5 kg and non-dominant (45.0 ± 12.4 kg leg with a mean side-to-side difference of 5.0 %. The data indicate that unilateral squat strength, measured in a weight bearing stance, is similar in the dominant and non-dominant leg in apparently healthy young adult men and women

  20. Nature of protein family signatures: insights from singular value analysis of position-specific scoring matrices.

    Directory of Open Access Journals (Sweden)

    Akira R Kinjo

    Full Text Available Position-specific scoring matrices (PSSMs are useful for detecting weak homology in protein sequence analysis, and they are thought to contain some essential signatures of the protein families. In order to elucidate what kind of ingredients constitute such family-specific signatures, we apply singular value decomposition to a set of PSSMs and examine the properties of dominant right and left singular vectors. The first right singular vectors were correlated with various amino acid indices including relative mutability, amino acid composition in protein interior, hydropathy, or turn propensity, depending on proteins. A significant correlation between the first left singular vector and a measure of site conservation was observed. It is shown that the contribution of the first singular component to the PSSMs act to disfavor potentially but falsely functionally important residues at conserved sites. The second right singular vectors were highly correlated with hydrophobicity scales, and the corresponding left singular vectors with contact numbers of protein structures. It is suggested that sequence alignment with a PSSM is essentially equivalent to threading supplemented with functional information. In addition, singular vectors may be useful for analyzing and annotating the characteristics of conserved sites in protein families.

  1. Adolescent male chimpanzees do not form a dominance hierarchy with their peers.

    Science.gov (United States)

    Sandel, Aaron A; Reddy, Rachna B; Mitani, John C

    2017-01-01

    Dominance hierarchies are a prominent feature of the lives of many primate species. These hierarchies have important fitness consequences, as high rank is often positively correlated with reproduction. Although adult male chimpanzees strive for status to gain fitness benefits, the development of dominance relationships is not well understood. While two prior studies found that adolescent males do not display dominance relationships with peers, additional research at Ngogo in Kibale National Park, Uganda, indicates that adolescents there form a linear dominance hierarchy. These conflicting findings could reflect different patterns of rank acquisition across sites. An alternate possibility arises from a recent re-evaluation of age estimates at Ngogo and suggests that the report describing decided dominance relationships between adolescent males may have been due to the accidental inclusion of young adult males in the sample. To investigate these issues, we conducted a study of 23 adolescent male chimpanzees of known age during 12 months at Ngogo. Adolescent male chimpanzees exchanged pant grunts, a formal signal of submission, only 21 times. Recipients of pant grunts were late adolescent males, ranging between 14 and 16 years old. In contrast, younger adolescent males never received pant grunts from other males. Aggression between adolescent males was also rare. Analysis of pant grunts and aggressive interactions did not produce a linear dominance hierarchy among adolescent males. These data indicate that adolescent male chimpanzees do not form decided dominance relationships with their peers and are consistent with the hypothesis that the hierarchy described previously at Ngogo resulted from inaccurate age estimates of male chimpanzees. Because dominance relationships develop before adulthood in other primates, our finding that adolescent male chimpanzees do not do so is surprising. We offer possible explanations for why this is the case and suggest future studies

  2. Mycoplasma salivarium as a dominant coloniser of Fanconi anaemia associated oral carcinoma.

    Directory of Open Access Journals (Sweden)

    Birgit Henrich

    Full Text Available Mycoplasma salivarium belongs to the class of the smallest self-replicating Tenericutes and is predominantly found in the oral cavity of humans. In general it is considered as a non-pathogenic commensal. However, some reports point to an association with human diseases. M. salivarium was found e.g. as causative agent of a submasseteric abscess, in necrotic dental pulp, in brain abscess and clogged biliary stent. Here we describe the detection of M. salivarium on the surface of a squamous cell carcinoma of the tongue of a patient with Fanconi anaemia (FA. FA is an inherited bone marrow failure syndrome based on defective DNA-repair that increases the risk of carcinomas especially oral squamous cell carcinoma. Employing high coverage, massive parallel Roche/454-next-generation-sequencing of 16S rRNA gene amplicons we analysed the oral microbiome of this FA patient in comparison to that of an FA patient with a benign leukoplakia and five healthy individuals. The microbiota of the FA patient with leukoplakia correlated well with that of the healthy controls. A dominance of Streptococcus, Veillonella and Neisseria species was typically observed. In contrast, the microbiome of the cancer bearing FA patient was dominated by Pseudomonas aeruginosa at the healthy sites, which changed to a predominance of 98% M. salivarium on the tumour surface. Quantification of the mycoplasma load in five healthy, two tumour- and two leukoplakia-FA patients by TaqMan-PCR confirmed the prevalence of M. salivarium at the tumour sites. These new findings suggest that this mycoplasma species with its reduced coding capacity found ideal breeding grounds at the tumour sites. Interestingly, the oral cavity of all FA patients and especially samples at the tumour sites were in addition positive for Candida albicans. It remains to be elucidated in further studies whether M. salivarium can be used as a predictive biomarker for tumour development in these patients.

  3. An extended sequence specificity for UV-induced DNA damage.

    Science.gov (United States)

    Chung, Long H; Murray, Vincent

    2018-01-01

    The sequence specificity of UV-induced DNA damage was determined with a higher precision and accuracy than previously reported. UV light induces two major damage adducts: cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). Employing capillary electrophoresis with laser-induced fluorescence and taking advantages of the distinct properties of the CPDs and 6-4PPs, we studied the sequence specificity of UV-induced DNA damage in a purified DNA sequence using two approaches: end-labelling and a polymerase stop/linear amplification assay. A mitochondrial DNA sequence that contained a random nucleotide composition was employed as the target DNA sequence. With previous methodology, the UV sequence specificity was determined at a dinucleotide or trinucleotide level; however, in this paper, we have extended the UV sequence specificity to a hexanucleotide level. With the end-labelling technique (for 6-4PPs), the consensus sequence was found to be 5'-GCTC*AC (where C* is the breakage site); while with the linear amplification procedure, it was 5'-TCTT*AC. With end-labelling, the dinucleotide frequency of occurrence was highest for 5'-TC*, 5'-TT* and 5'-CC*; whereas it was 5'-TT* for linear amplification. The influence of neighbouring nucleotides on the degree of UV-induced DNA damage was also examined. The core sequences consisted of pyrimidine nucleotides 5'-CTC* and 5'-CTT* while an A at position "1" and C at position "2" enhanced UV-induced DNA damage. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

  4. Genomic Analysis and Surveillance of the Coronavirus Dominant in Ducks in China.

    Directory of Open Access Journals (Sweden)

    Qing-Ye Zhuang

    Full Text Available The genetic diversity, evolution, distribution, and taxonomy of some coronaviruses dominant in birds other than chickens remain enigmatic. In this study we sequenced the genome of a newly identified coronavirus dominant in ducks (DdCoV, and performed a large-scale surveillance of coronaviruses in chickens and ducks using a conserved RT-PCR assay. The viral genome harbors a tandem repeat which is rare in vertebrate RNA viruses. The repeat is homologous to some proteins of various cellular organisms, but its origin remains unknown. Many substitutions, insertions, deletions, and some frameshifts and recombination events have occurred in the genome of the DdCoV, as compared with the coronavirus dominant in chickens (CdCoV. The distances between DdCoV and CdCoV are large enough to separate them into different species within the genus Gammacoronavirus. Our surveillance demonstrated that DdCoVs and CdCoVs belong to different lineages and occupy different ecological niches, further supporting that they should be classified into different species. Our surveillance also demonstrated that DdCoVs and CdCoVs are prevalent in live poultry markets in some regions of China. In conclusion, this study shed novel insight into the genetic diversity, evolution, distribution, and taxonomy of the coronaviruses circulating in chickens and ducks.

  5. Neural mechanisms of social dominance

    Science.gov (United States)

    Watanabe, Noriya; Yamamoto, Miyuki

    2015-01-01

    In a group setting, individuals' perceptions of their own level of dominance or of the dominance level of others, and the ability to adequately control their behavior based on these perceptions are crucial for living within a social environment. Recent advances in neural imaging and molecular technology have enabled researchers to investigate the neural substrates that support the perception of social dominance and the formation of a social hierarchy in humans. At the systems' level, recent studies showed that dominance perception is represented in broad brain regions which include the amygdala, hippocampus, striatum, and various cortical networks such as the prefrontal, and parietal cortices. Additionally, neurotransmitter systems such as the dopaminergic and serotonergic systems, modulate and are modulated by the formation of the social hierarchy in a group. While these monoamine systems have a wide distribution and multiple functions, it was recently found that the Neuropeptide B/W contributes to the perception of dominance and is present in neurons that have a limited projection primarily to the amygdala. The present review discusses the specific roles of these neural regions and neurotransmitter systems in the perception of dominance and in hierarchy formation. PMID:26136644

  6. Neural mechanisms of social dominance

    Directory of Open Access Journals (Sweden)

    Noriya eWatanabe

    2015-06-01

    Full Text Available In a group setting, individuals’ perceptions of their own level of dominance or of the dominance level of others, and the ability to adequately control their behavior based on these perceptions are crucial for living within a social environment. Recent advances in neural imaging and molecular technology have enabled researchers to investigate the neural substrates that support the perception of social dominance and the formation of a social hierarchy in humans. At the systems’ level, recent studies showed that dominance perception is represented in broad brain regions which include the amygdala, hippocampus, striatum, and various cortical networks such as the prefrontal, and parietal cortices. Additionally, neurotransmitter systems such as the dopaminergic and serotonergic systems, modulate and are modulated by the formation of the social hierarchy in a group. While these monoamine systems have a wide distribution and multiple functions, it was recently found that the Neuropeptide B/W contributes to the perception of dominance and is present in neurons that have a limited projection primarily to the amygdala. The present review discusses the specific roles of these neural regions and neurotransmitter systems in the perception of dominance and in hierarchy formation.

  7. Safety Assessment of Advanced Imaging Sequences I: Measurements

    DEFF Research Database (Denmark)

    Jensen, Jørgen Arendt; Rasmussen, Morten Fischer; Pihl, Michael Johannes

    2016-01-01

    intensity measurement program. The approach can measure and store data for a full imaging sequence in 3.8 to 8.2 s per spatial position. Based on Ispta, MI, and probe surface temperature, the method gives the ability to determine whether a sequence is within US FDA limits, or alternatively indicate how......A method for rapid measurement of intensities (Ispta), mechanical index (MI), and probe surface temperature for any ultrasound scanning sequence is presented. It uses the scanner’s sampling capability to give an accurate measurement of the whole imaging sequence for all emissions to yield the true...... measurement system (Onda Corporation, Sunnyvale, CA, USA). Four different sequences have been measured: a fixed focus emission, a duplex sequence containing B-mode and flow emissions, a vector flow sequence with B-mode and flow emissions in 17 directions, and finally a synthetic aperture (SA) duplex flow...

  8. The female urinary microbiome in urgency urinary incontinence.

    Science.gov (United States)

    Pearce, Meghan M; Zilliox, Michael J; Rosenfeld, Amy B; Thomas-White, Krystal J; Richter, Holly E; Nager, Charles W; Visco, Anthony G; Nygaard, Ingrid E; Barber, Matthew D; Schaffer, Joseph; Moalli, Pamela; Sung, Vivian W; Smith, Ariana L; Rogers, Rebecca; Nolen, Tracy L; Wallace, Dennis; Meikle, Susan F; Gai, Xiaowu; Wolfe, Alan J; Brubaker, Linda

    2015-09-01

    The purpose of this study was to characterize the urinary microbiota in women who are planning treatment for urgency urinary incontinence and to describe clinical associations with urinary symptoms, urinary tract infection, and treatment outcomes. Catheterized urine samples were collected from multisite randomized trial participants who had no clinical evidence of urinary tract infection; 16S ribosomal RNA gene sequencing was used to dichotomize participants as either DNA sequence-positive or sequence-negative. Associations with demographics, urinary symptoms, urinary tract infection risk, and treatment outcomes were determined. In sequence-positive samples, microbiotas were characterized on the basis of their dominant microorganisms. More than one-half (51.1%; 93/182) of the participants' urine samples were sequence-positive. Sequence-positive participants were younger (55.8 vs 61.3 years old; P = .0007), had a higher body mass index (33.7 vs 30.1 kg/m(2); P = .0009), had a higher mean baseline daily urgency urinary incontinence episodes (5.7 vs 4.2 episodes; P urinary incontinence episodes, -4.4 vs -3.3; P = .0013), and were less likely to experience urinary tract infection (9% vs 27%; P = .0011). In sequence-positive samples, 8 major bacterial clusters were identified; 7 clusters were dominated not only by a single genus, most commonly Lactobacillus (45%) or Gardnerella (17%), but also by other taxa (25%). The remaining cluster had no dominant genus (13%). DNA sequencing confirmed urinary bacterial DNA in many women with urgency urinary incontinence who had no signs of infection. Sequence status was associated with baseline urgency urinary incontinence episodes, treatment response, and posttreatment urinary tract infection risk. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. Roles of the Drosophila LRRK2 homolog in Rab7-dependent lysosomal positioning.

    Science.gov (United States)

    Dodson, Mark W; Zhang, Ting; Jiang, Changan; Chen, Shengdi; Guo, Ming

    2012-03-15

    LRRK2 (PARK8) is the most common genetic determinant of Parkinson's disease (PD), with dominant mutations in LRRK2 causing inherited PD and sequence variation at the LRRK2 locus associated with increased risk for sporadic PD. Although LRRK2 has been implicated in diverse cellular processes encompassing almost all cellular compartments, the precise functions of LRRK2 remain unclear. Here, we show that the Drosophila homolog of LRRK2 (Lrrk) localizes to the membranes of late endosomes and lysosomes, physically interacts with the crucial mediator of late endosomal transport Rab7 and negatively regulates rab7-dependent perinuclear localization of lysosomes. We also show that a mutant form of lrrk analogous to the pathogenic LRRK2(G2019S) allele behaves oppositely to wild-type lrrk in that it promotes rather than inhibits rab7-dependent perinuclear lysosome clustering, with these effects of mutant lrrk on lysosome position requiring both microtubules and dynein. These data suggest that LRRK2 normally functions in Rab7-dependent lysosomal positioning, and that this function is disrupted by the most common PD-causing LRRK2 mutation, linking endolysosomal dysfunction to the pathogenesis of LRRK2-mediated PD.

  10. Psychrophile spoilers dominate the bacterial microbiome in musculature samples of slaughter pigs.

    Science.gov (United States)

    Mann, Evelyne; Wetzels, Stefanie U; Pinior, Beate; Metzler-Zebeli, Barbara U; Wagner, Martin; Schmitz-Esser, Stephan

    2016-07-01

    The aim of this study was to disentangle the microbial diversity on porcine musculature. The hypervariable V1-V2 region of the 16S rRNA gene was amplified from DNA samples of clinically healthy slaughter pigs (n=8). Pyrosequencing yielded 37,000 quality-controlled reads and a diverse microbiome with 54-159 OTUs per sample was detected. Interestingly, 6 out of 8 samples were strongly dominated by 1-2 highly abundant OTUs (best hits of highly abundant OTUs: Serratia proteamaculans, Pseudomonas syringae, Aeromonas allosaccharophila, Brochothrix thermosphacta, Acidiphilium cryptum and Escherichia coli). In 1g musculature scraping, 3.20E+06 16S rRNA gene copies and 4.45E+01 Enterobacteriaceae rRNA gene copies were detected with qPCR. We conclude that i.) next-generation sequencing technologies help encompass the full content of complex, bacterial contamination, ii.) psychrophile spoilers dominated the microbiota and iii.) E. coli is an effective marker species for pork contamination, as it was one of very few abundant species being present in all samples. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. On the relationship between residue structural environment and sequence conservation in proteins.

    Science.gov (United States)

    Liu, Jen-Wei; Lin, Jau-Ji; Cheng, Chih-Wen; Lin, Yu-Feng; Hwang, Jenn-Kang; Huang, Tsun-Tsao

    2017-09-01

    Residues that are crucial to protein function or structure are usually evolutionarily conserved. To identify the important residues in protein, sequence conservation is estimated, and current methods rely upon the unbiased collection of homologous sequences. Surprisingly, our previous studies have shown that the sequence conservation is closely correlated with the weighted contact number (WCN), a measure of packing density for residue's structural environment, calculated only based on the C α positions of a protein structure. Moreover, studies have shown that sequence conservation is correlated with environment-related structural properties calculated based on different protein substructures, such as a protein's all atoms, backbone atoms, side-chain atoms, or side-chain centroid. To know whether the C α atomic positions are adequate to show the relationship between residue environment and sequence conservation or not, here we compared C α atoms with other substructures in their contributions to the sequence conservation. Our results show that C α positions are substantially equivalent to the other substructures in calculations of various measures of residue environment. As a result, the overlapping contributions between C α atoms and the other substructures are high, yielding similar structure-conservation relationship. Take the WCN as an example, the average overlapping contribution to sequence conservation is 87% between C α and all-atom substructures. These results indicate that only C α atoms of a protein structure could reflect sequence conservation at the residue level. © 2017 Wiley Periodicals, Inc.

  12. A universal protocol to generate consensus level genome sequences for foot-and-mouth disease virus and other positive-sense polyadenylated RNA viruses using the Illumina MiSeq.

    Science.gov (United States)

    Logan, Grace; Freimanis, Graham L; King, David J; Valdazo-González, Begoña; Bachanek-Bankowska, Katarzyna; Sanderson, Nicholas D; Knowles, Nick J; King, Donald P; Cottam, Eleanor M

    2014-09-30

    Next-Generation Sequencing (NGS) is revolutionizing molecular epidemiology by providing new approaches to undertake whole genome sequencing (WGS) in diagnostic settings for a variety of human and veterinary pathogens. Previous sequencing protocols have been subject to biases such as those encountered during PCR amplification and cell culture, or are restricted by the need for large quantities of starting material. We describe here a simple and robust methodology for the generation of whole genome sequences on the Illumina MiSeq. This protocol is specific for foot-and-mouth disease virus (FMDV) or other polyadenylated RNA viruses and circumvents both the use of PCR and the requirement for large amounts of initial template. The protocol was successfully validated using five FMDV positive clinical samples from the 2001 epidemic in the United Kingdom, as well as a panel of representative viruses from all seven serotypes. In addition, this protocol was successfully used to recover 94% of an FMDV genome that had previously been identified as cell culture negative. Genome sequences from three other non-FMDV polyadenylated RNA viruses (EMCV, ERAV, VESV) were also obtained with minor protocol amendments. We calculated that a minimum coverage depth of 22 reads was required to produce an accurate consensus sequence for FMDV O. This was achieved in 5 FMDV/O/UKG isolates and the type O FMDV from the serotype panel with the exception of the 5' genomic termini and area immediately flanking the poly(C) region. We have developed a universal WGS method for FMDV and other polyadenylated RNA viruses. This method works successfully from a limited quantity of starting material and eliminates the requirement for genome-specific PCR amplification. This protocol has the potential to generate consensus-level sequences within a routine high-throughput diagnostic environment.

  13. Selenoproteins in Archaea and Gram-positive bacteria.

    Science.gov (United States)

    Stock, Tilmann; Rother, Michael

    2009-11-01

    Selenium is an essential trace element for many organisms by serving important catalytic roles in the form of the 21st co-translationally inserted amino acid selenocysteine. It is mostly found in redox-active proteins in members of all three domains of life and analysis of the ever-increasing number of genome sequences has facilitated identification of the encoded selenoproteins. Available data from biochemical, sequence, and structure analyses indicate that Gram-positive bacteria synthesize and incorporate selenocysteine via the same pathway as enterobacteria. However, recent in vivo studies indicate that selenocysteine-decoding is much less stringent in Gram-positive bacteria than in Escherichia coli. For years, knowledge about the pathway of selenocysteine synthesis in Archaea and Eukarya was only fragmentary, but genetic and biochemical studies guided by analysis of genome sequences of Sec-encoding archaea has not only led to the characterization of the pathways but has also shown that they are principally identical. This review summarizes current knowledge about the metabolic pathways of Archaea and Gram-positive bacteria where selenium is involved, about the known selenoproteins, and about the respective pathways employed in selenoprotein synthesis.

  14. Cloning and sequencing of the gene for human β-casein

    International Nuclear Information System (INIS)

    Loennerdal, B.; Bergstroem, S.; Andersson, Y.; Hialmarsson, K.; Sundgyist, A.; Hernell, O.

    1990-01-01

    Human β-casein is a major protein in human milk. This protein is part of the casein micelle and has been suggested to have several physiological functions in the newborn. Since there is limited information on βcasein and the factors that affect its concentration in human milk, the authors have isolated and sequenced the gene for this protein. A human mammary gland cDNA library (Clontech) in gt 11 was screened by plaque hy-hybridization using a 42-mer synthetic 32 p-labelled oligo-nucleotide. Positive clones were identified and isolated, DNA was prepared and the gene isolated by cleavage with EcoR1. Following subcloning (PUC18), restriction mapping and Southern blotting, DNA for sequencing was prepared. The gene was sequenced by the dideoxy method. Human β-casein has 212 amino acids and the amino acid sequence deducted from the nucleotide sequence is to 91% identical to the published sequence for human β-casein show a high degree of conservation at the leader peptide and the highly phosphorylated sequences, but also deletions and divergence at several positions. These results provide insight into the structure of the human β-casein gene and will facilitate studies on factors affecting its expression

  15. THE RISE AND FALL OF PASSIVE DISK GALAXIES: MORPHOLOGICAL EVOLUTION ALONG THE RED SEQUENCE REVEALED BY COSMOS

    International Nuclear Information System (INIS)

    Bundy, Kevin; Hopkins, Philip; Ma, Chung-Pei; Scarlata, Claudia; Capak, Peter; Carollo, C. M.; Oesch, Pascal; Ellis, Richard S.; Salvato, Mara; Scoville, Nick; Drory, Niv; Leauthaud, Alexie; Koekemoer, Anton M.; Murray, Norman; Ilbert, Olivier; Pozzetti, Lucia

    2010-01-01

    The increasing abundance of passive 'red-sequence' galaxies since z ∼ 1-2 is mirrored by a coincident rise in the number of galaxies with spheroidal morphologies. In this paper, however, we show in detail, that, the correspondence between galaxy morphology and color is not perfect, providing insight into the physical origin of this evolution. Using the COSMOS survey, we study a significant population of red-sequence galaxies with disk-like morphologies. These passive disks typically have Sa-Sb morphological types with large bulges, but they are not confined to dense environments. They represent nearly one-half of all red-sequence galaxies and dominate at lower masses (∼ 10 M sun ) where they are increasingly disk-dominated. As a function of time, the abundance of passive disks with M * ∼ 11 M sun increases, but not as fast as red-sequence spheroidals in the same mass range. At higher mass, the passive disk population has declined since z ∼ 1, likely because they transform into spheroidals. Based on these trends, we estimate that as much as 60% of galaxies transitioning onto the red sequence evolve through a passive disk phase. The origin of passive disks therefore has broad implications for our understanding of how star formation shuts down. Because passive disks tend to be more bulge-dominated than their star-forming counterparts, a simple fading of blue disks does not fully explain their origin. We explore the strengths and weaknesses of several more sophisticated explanations, including environmental effects, internal stabilization, and disk regrowth during gas-rich mergers. While previous work has sought to explain color and morphological transformations with a single process, these observations open the way to new insight by highlighting the fact that galaxy evolution may actually proceed through several separate stages.

  16. Transmission of clonal hepatitis C virus genomes reveals the dominant but transitory role of CD8¿ T cells in early viral evolution

    DEFF Research Database (Denmark)

    Callendret, Benoît; Bukh, Jens; Eccleston, Heather B

    2011-01-01

    occurred slowly over several years of chronic infection. Together these observations indicate that during acute hepatitis C, virus evolution was driven primarily by positive selection pressure exerted by CD8(+) T cells. This influence of immune pressure on viral evolution appears to subside as chronic......The RNA genome of the hepatitis C virus (HCV) diversifies rapidly during the acute phase of infection, but the selective forces that drive this process remain poorly defined. Here we examined whether Darwinian selection pressure imposed by CD8(+) T cells is a dominant force driving early amino acid...... replacement in HCV viral populations. This question was addressed in two chimpanzees followed for 8 to 10 years after infection with a well-defined inoculum composed of a clonal genotype 1a (isolate H77C) HCV genome. Detailed characterization of CD8(+) T cell responses combined with sequencing of recovered...

  17. Repeat Sequence Proteins as Matrices for Nanocomposites

    Energy Technology Data Exchange (ETDEWEB)

    Drummy, L.; Koerner, H; Phillips, D; McAuliffe, J; Kumar, M; Farmer, B; Vaia, R; Naik, R

    2009-01-01

    Recombinant protein-inorganic nanocomposites comprised of exfoliated Na+ montmorillonite (MMT) in a recombinant protein matrix based on silk-like and elastin-like amino acid motifs (silk elastin-like protein (SELP)) were formed via a solution blending process. Charged residues along the protein backbone are shown to dominate long-range interactions, whereas the SELP repeat sequence leads to local protein/MMT compatibility. Up to a 50% increase in room temperature modulus and a comparable decrease in high temperature coefficient of thermal expansion occur for cast films containing 2-10 wt.% MMT.

  18. On the domination and signed domination numbers of zero-divisor graph

    Directory of Open Access Journals (Sweden)

    Ebrahim Vatandoost

    2016-10-01

    Full Text Available Let $R$ be a commutative ring (with 1 and let $Z(R$ be its set of zero-divisors. The zero-divisor graph $\\Gamma(R$ has vertex set $Z^*(R=Z(R \\setminus \\lbrace0 \\rbrace$ and for distinct $x,y \\in Z^*(R$, the vertices $x$ and $y$ are adjacent if and only if $xy=0$. In this paper, we consider the domination number and signed domination number on zero-divisor graph $\\Gamma(R$ of commutative ring $R$ such that for every $0 \

  19. TOUR CONSTRUCTION HEURISTICS FOR AN ORDER SEQUENCING PROBLEM

    Directory of Open Access Journals (Sweden)

    De Villiers, A. P.

    2012-11-01

    Full Text Available An order picking system that requires pickers to move in a clockwise direction around a picking line with fixed locations is considered. The problem is divided into three tiers. The tier in which orders must be sequenced is addressed. Eight tour construction heuristics are developed and implemented for an order picking system operating in unidirectional picking lines. Two classes of tour construction heuristics the tour construction starting position ( and the tour construction ending position ( are developed to sequence orders in a picking line. All algorithms are tested and compared using real life data sets. The best solution quality was obtained by a heuristic with adaptations.

  20. Missense mutations in ITPR1 cause autosomal dominant congenital nonprogressive spinocerebellar ataxia

    Directory of Open Access Journals (Sweden)

    Huang Lijia

    2012-09-01

    Full Text Available Abstract Background Congenital nonprogressive spinocerebellar ataxia is characterized by early gross motor delay, hypotonia, gait ataxia, mild dysarthria and dysmetria. The clinical presentation remains fairly stable and may be associated with cerebellar atrophy. To date, only a few families with autosomal dominant congenital nonprogressive spinocerebellar ataxia have been reported. Linkage to 3pter was demonstrated in one large Australian family and this locus was designated spinocerebellar ataxia type 29. The objective of this study is to describe an unreported Canadian family with autosomal dominant congenital nonprogressive spinocerebellar ataxia and to identify the underlying genetic causes in this family and the original Australian family. Methods and Results Exome sequencing was performed for the Australian family, resulting in the identification of a heterozygous mutation in the ITPR1 gene. For the Canadian family, genotyping with microsatellite markers and Sanger sequencing of ITPR1 gene were performed; a heterozygous missense mutation in ITPR1 was identified. Conclusions ITPR1 encodes inositol 1,4,5-trisphosphate receptor, type 1, a ligand-gated ion channel that mediates calcium release from the endoplasmic reticulum. Deletions of ITPR1 are known to cause spinocerebellar ataxia type 15, a distinct and very slowly progressive form of cerebellar ataxia with onset in adulthood. Our study demonstrates for the first time that, in addition to spinocerebellar ataxia type 15, alteration of ITPR1 function can cause a distinct congenital nonprogressive ataxia; highlighting important clinical heterogeneity associated with the ITPR1 gene and a significant role of the ITPR1-related pathway in the development and maintenance of the normal functions of the cerebellum.

  1. WebPrInSeS: automated full-length clone sequence identification and verification using high-throughput sequencing data.

    Science.gov (United States)

    Massouras, Andreas; Decouttere, Frederik; Hens, Korneel; Deplancke, Bart

    2010-07-01

    High-throughput sequencing (HTS) is revolutionizing our ability to obtain cheap, fast and reliable sequence information. Many experimental approaches are expected to benefit from the incorporation of such sequencing features in their pipeline. Consequently, software tools that facilitate such an incorporation should be of great interest. In this context, we developed WebPrInSeS, a web server tool allowing automated full-length clone sequence identification and verification using HTS data. WebPrInSeS encompasses two separate software applications. The first is WebPrInSeS-C which performs automated sequence verification of user-defined open-reading frame (ORF) clone libraries. The second is WebPrInSeS-E, which identifies positive hits in cDNA or ORF-based library screening experiments such as yeast one- or two-hybrid assays. Both tools perform de novo assembly using HTS data from any of the three major sequencing platforms. Thus, WebPrInSeS provides a highly integrated, cost-effective and efficient way to sequence-verify or identify clones of interest. WebPrInSeS is available at http://webprinses.epfl.ch/ and is open to all users.

  2. POST-MERGER SIGNATURES OF RED-SEQUENCE GALAXIES IN RICH ABELL CLUSTERS AT z ∼< 0.1

    International Nuclear Information System (INIS)

    Sheen, Yun-Kyeong; Yi, Sukyoung K.; Lee, Jaehyun; Ree, Chang H.

    2012-01-01

    We have investigated the post-merger signatures of red-sequence galaxies in rich Abell clusters at z ∼ r < –20) cluster red-sequence galaxies show post-merger signatures in four clusters consistently. Most (∼71%) of the featured galaxies were found to be bulge dominated, and for the subsample of bulge-dominated red-sequence galaxies, the post-merger fraction rises to ∼38%. We also found that roughly 4% of bulge-dominated red-sequence galaxies interact (ongoing merger). A total of 42% (38% post-merger, 4% ongoing merger) of galaxies show merger-related features. Compared to a field galaxy study with a similar limiting magnitude by van Dokkum in 2005, our cluster study presents a similar post-merger fraction but a markedly lower ongoing merger fraction. The merger fraction derived is surprisingly high for the high density of our clusters, where the fast internal motions of galaxies are thought to play a negative role in galaxy mergers. The fraction of post-merger and ongoing merger galaxies can be explained as follows. Most of the post-merger galaxies may have carried over their merger features from their previous halo environment, whereas interacting galaxies interact in the current cluster in situ. According to our semi-analytic calculation, massive cluster halos may very well have experienced tens of halo mergers over the last 4-5 Gyr; post-merger features last that long, allowing these features to be detected in our clusters today. The apparent lack of dependence of the merger fraction on the clustocentric distance is naturally explained this way. In this scenario, the galaxy morphology and properties can be properly interpreted only when the halo evolution characteristics are understood first.

  3. A not-so-big crisis: re-reading Silurian conodont diversity in a sequence-stratigraphic framework

    Science.gov (United States)

    Jarochowska, Emilia; Munnecke, Axel

    2016-04-01

    Conodonts are extensively used in Ordovician through Triassic biostratigraphy and fossil-based geochemistry. However, their distribution in rock successions is commonly taken at face value, without taking into account their diverse and poorly understood ecology. Multielement taxonomy, ontogenetic and environmental variability, difficulties in extraction, and relative rarity all contribute to the general lack of quantitative studies on conodont stratigraphic distribution and temporal turnover. With respect to Silurian conodonts, the concept of recurrent conodont extinction events - the so called Ireviken, Mulde and Lau events - has become a standard in the stratigraphic literature. The concept has been proposed based on qualitative observations of local extirpations of open-marine pelagic or nekto-benthic taxa and temporary dominance of shallow-water species in the Silurian succession of the Swedish island of Gotland. These changes coincided with positive carbon isotope excursions, abrupt facies shifts, "blooms" of benthic fauna, and changes in reef communities, which have all been combined into a general view of Silurian bio-geochemical events. This view posits a deterministic, reproducible pattern in Silurian conodont diversity, attributed to recurrent ecological or geochemical conditions. The growing body of sequence-stratigraphic interpretations across these events in Gotland and other sections worldwide indicate that in all cases the Silurian "events" are associated with rapid global regressions. This suggests that faunal changes such as the dominance of shallow-water, low-diversity conodont fauna and the increase of benthic invertebrate diversity and abundance represent predictable consequences of the variation in the completeness of the rock record and preservation potential of different environments. Our studies in Poland and Ukraine indicate that the magnitude of change in the taxonomic composition of conodont assemblages across the middle Silurian global

  4. Detection of Sequence Polymorphism in Rubus Occidentalis L. Monomorphic Microsatellite Markers by High Resolution Melting

    Science.gov (United States)

    Microsatellite, or simple sequence repeat (SSR) markers, are valuable as co-dominant genetic markers with a variety of applications such as DNA fingerprinting, linkage mapping, and population structure analysis. Development of microsatellite primers through the identification of appropriate repeate...

  5. Source terms associated with two severe accident sequences in a 900 MWe PWR

    International Nuclear Information System (INIS)

    Fermandjian, J.; Evrard, J.M.; Berthion, Y.; Lhiaubet, G.; Lucas, M.

    1983-12-01

    Hypothetical accidents taken into account in PWR risk assessment result in fission product release from the fuel, transfer through the primary circuit, transfer into the reactor containment building (RCB) and finally release to the environment. The objective of this paper is to define the characteristics of the source term (noble gases, particles and volatile iodine forms) released from the reactor containment building during two dominant core-melt accident sequences: S 2 CD and TLB according to the ''Reactor Safety Study'' terminology. The reactor chosen for this study is a French 900 MWe PWR unit. The reactor building is a prestressed concrete containment with an internal liner. The first core-melt accident sequence is a 2-break loss-of-coolant accident on the cold leg, with failure of both system and the containment spray system. The second one is a transient initiated by a loss of offsite and onsite power supply and auxiliary feedwater system. These two sequences have been chosen because they are representative of risk dominant scenarios. Source terms associated with hypothetical core-melt accidents S 2 CD and TLB in a French PWR -900 MWe- have been performed using French computer codes (in particular, JERICHO Code for containment response analysis and AEROSOLS/31 for aerosol behavior in the containment)

  6. Sequence Analysis of the Capsid Gene during a Genotype II.4 Dominated Norovirus Season in One University Hospital

    DEFF Research Database (Denmark)

    Holzknecht, Barbara Juliane; Franck, Kristina Træholt; Nielsen, Rikke Thoft

    2015-01-01

    Norovirus (NoV) is a leading cause of gastroenteritis and genotype II.4 (GII.4) is responsible for the majority of nosocomial NoV infections. Our objective was to examine whether sequencing of the capsid gene might be a useful tool for the hospital outbreak investigation to define possible...

  7. Design of Protein Multi-specificity Using an Independent Sequence Search Reduces the Barrier to Low Energy Sequences.

    Directory of Open Access Journals (Sweden)

    Alexander M Sevy

    2015-07-01

    Full Text Available Computational protein design has found great success in engineering proteins for thermodynamic stability, binding specificity, or enzymatic activity in a 'single state' design (SSD paradigm. Multi-specificity design (MSD, on the other hand, involves considering the stability of multiple protein states simultaneously. We have developed a novel MSD algorithm, which we refer to as REstrained CONvergence in multi-specificity design (RECON. The algorithm allows each state to adopt its own sequence throughout the design process rather than enforcing a single sequence on all states. Convergence to a single sequence is encouraged through an incrementally increasing convergence restraint for corresponding positions. Compared to MSD algorithms that enforce (constrain an identical sequence on all states the energy landscape is simplified, which accelerates the search drastically. As a result, RECON can readily be used in simulations with a flexible protein backbone. We have benchmarked RECON on two design tasks. First, we designed antibodies derived from a common germline gene against their diverse targets to assess recovery of the germline, polyspecific sequence. Second, we design "promiscuous", polyspecific proteins against all binding partners and measure recovery of the native sequence. We show that RECON is able to efficiently recover native-like, biologically relevant sequences in this diverse set of protein complexes.

  8. Fifty Shades Flipped: Effects of Reading Erotica Depicting a Sexually Dominant Woman Compared to a Sexually Dominant Man.

    Science.gov (United States)

    Harris, Emily Ann; Thai, Michael; Barlow, Fiona Kate

    2017-01-01

    The present study examined the effects of reading submission- and dominance-themed erotica on attitudes toward women and rape, ideal partner preferences, and subjective sexual arousal. Heterosexual male (n = 241) and female (n = 240) participants read one of three erotic stories depicting male dominance, female dominance, or no dominance, or a fourth nonerotic control story. First, we found that after reading about a sexually dominant man, women reported increased benevolent sexism compared to men, and men reported increased rape myth acceptance compared to women. Second, men and women showed a similar level of preference for partner dominance after reading about a sexually dominant woman. This was in contrast to the typical pattern revealed in all other conditions, whereby women were more likely to favor dominant partners relative to men. Finally, we found no evidence to support the hypothesis that the story describing male dominance would be the most arousing. Rather, all three erotic stories were equally sexually arousing compared to the control condition, and men and women did not differ in the extent to which the erotic stories aroused them. Theoretical and practical implications are discussed.

  9. A Boundary Property for Upper Domination

    KAUST Repository

    AbouEisha, Hassan M.; Hussain, Shahid; Lozin, Vadim; Monnot, Jé rô me; Ries, Bernard; Zamaraev, Viktor

    2016-01-01

    An upper dominating set in a graph is a minimal (with respect to set inclusion) dominating set of maximum cardinality.The problem of finding an upper dominating set is generally NP-hard, but can be solved in polynomial time in some restricted graph

  10. Denitrifying bacteria from the genus Rhodanobacter dominate bacterial communities in the highly contaminated subsurface of a nuclear legacy waste site

    Energy Technology Data Exchange (ETDEWEB)

    Green, Stefan [Florida State University; Prakash, Om [Florida State University; Jasrotia, Puja [Florida State University; Overholt, Will [Florida State University; Cardenas, Erick [Michigan State University, East Lansing; Hubbard, Daniela [Florida State University; Tiedje, James M. [Michigan State University, East Lansing; Watson, David B [ORNL; Schadt, Christopher Warren [ORNL; Brooks, Scott C [ORNL; Kostka, Joel [Florida State University

    2011-01-01

    The effect of long-term mixed-waste contamination, particularly uranium and nitrate, on the microbial community in the terrestrial subsurface was investigated at the field scale at the Oak Ridge Integrated Field Research Challenge (ORIFRC) site in Oak Ridge, TN. The abundance, community composition, and distribution of groundwater microorganisms were examined across the site during two seasonal sampling events. At representative locations, subsurface sediment was also examined from two boreholes, one sampled from the most heavily contaminated area of the site and another from an area with low contamination. A suite of DNA- and RNA-based molecular tools were employed for community characterization, including quantitative PCR of ribosomal RNA and nitrite reductase genes, community composition fingerprinting analysis, and high-throughput pyrotag sequencing of rRNA genes. The results demonstrate that pH is a major driver of the subsurface microbial community structure, and denitrifying bacteria from the genus Rhodanobacter (class Gammaproteobacteria) dominate at low pH. The relative abundance of bacteria from this genus was positively correlated with lower pH conditions, and these bacteria were abundant and active in the most highly contaminated areas. Other factors, such as concentration of nitrogen species, oxygen and sampling season did not appear to strongly influence the distribution of Rhodanobacter. Results indicate that these organisms are acid-tolerant denitrifiers, well suited to the acidic, nitrate-rich subsurface conditions, and pH is confirmed as a dominant driver of bacterial community structure in this contaminated subsurface environment.

  11. Identification of IFRD1 variant in a Han Chinese family with autosomal dominant hereditary spastic paraplegia associated with peripheral neuropathy and ataxia.

    Science.gov (United States)

    Lin, Pengfei; Zhang, Dong; Xu, Guangrun; Yan, Chuanzhu

    2018-04-01

    Spinocerebellar ataxias (SCAs) are a group of autosomal dominant, clinically heterogeneous neurodegenerative disorders. SCA18 is a rare autosomal dominant sensory/motor neuropathy with ataxia (OMIM#607458) associated with a single missense variant c.514 A>G in the interferon related developmental regulator 1 (IFRD1) gene previously reported in a five-generation American family of Irish origin. However, to date, there have been no other reports of the IFRD1 mutation to confirm its role in SCA. Here, we report a Han Chinese family with SCA18; the family members presented with a slowly progressing gait ataxia, pyramidal tract signs, and peripheral neuropathy. We identified a missense variant (c.514 A>G, p.I172V) in IFRD1 gene in the family using targeted next-generation sequencing and Sanger direct sequencing with specific primers. Our results suggest that the IFRD1 gene may be the causative allele for SCA18.

  12. Position specific variation in the rate of evolution intranscription factor binding sites

    Energy Technology Data Exchange (ETDEWEB)

    Moses, Alan M.; Chiang, Derek Y.; Kellis, Manolis; Lander, EricS.; Eisen, Michael B.

    2003-08-28

    The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Here we analyze the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikataeto study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artifacts of computational motif finding algorithms. As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative

  13. Direct typing of Canine parvovirus (CPV) from infected dog faeces by rapid mini sequencing technique.

    Science.gov (United States)

    V, Pavana Jyothi; S, Akila; Selvan, Malini K; Naidu, Hariprasad; Raghunathan, Shwethaa; Kota, Sathish; Sundaram, R C Raja; Rana, Samir Kumar; Raj, G Dhinakar; Srinivasan, V A; Mohana Subramanian, B

    2016-12-01

    Canine parvovirus (CPV) is a non-enveloped single stranded DNA virus with an icosahedral capsid. Mini-sequencing based CPV typing was developed earlier to detect and differentiate all the CPV types and FPV in a single reaction. This technique was further evaluated in the present study by performing the mini-sequencing directly from fecal samples which avoided tedious virus isolation steps by cell culture system. Fecal swab samples were collected from 84 dogs with enteritis symptoms, suggestive of parvoviral infection from different locations across India. Seventy six of these samples were positive by PCR; the subsequent mini-sequencing reaction typed 74 of them as type 2a virus, and 2 samples as type 2b. Additionally, 25 of the positive samples were typed by cycle sequencing of PCR products. Direct CPV typing from fecal samples using mini-sequencing showed 100% correlation with CPV typing by cycle sequencing. Moreover, CPV typing was achieved by mini-sequencing even with faintly positive PCR amplicons which was not possible by cycle sequencing. Therefore, the mini-sequencing technique is recommended for regular epidemiological follow up of CPV types, since the technique is rapid, highly sensitive and high capacity method for CPV typing. Copyright © 2016. Published by Elsevier B.V.

  14. Tree species diversity promotes aboveground carbon storage through functional diversity and functional dominance.

    Science.gov (United States)

    Mensah, Sylvanus; Veldtman, Ruan; Assogbadjo, Achille E; Glèlè Kakaï, Romain; Seifert, Thomas

    2016-10-01

    The relationship between biodiversity and ecosystem function has increasingly been debated as the cornerstone of the processes behind ecosystem services delivery. Experimental and natural field-based studies have come up with nonconsistent patterns of biodiversity-ecosystem function, supporting either niche complementarity or selection effects hypothesis. Here, we used aboveground carbon (AGC) storage as proxy for ecosystem function in a South African mistbelt forest, and analyzed its relationship with species diversity, through functional diversity and functional dominance. We hypothesized that (1) diversity influences AGC through functional diversity and functional dominance effects; and (2) effects of diversity on AGC would be greater for functional dominance than for functional diversity. Community weight mean (CWM) of functional traits (wood density, specific leaf area, and maximum plant height) were calculated to assess functional dominance (selection effects). As for functional diversity (complementarity effects), multitrait functional diversity indices were computed. The first hypothesis was tested using structural equation modeling. For the second hypothesis, effects of environmental variables such as slope and altitude were tested first, and separate linear mixed-effects models were fitted afterward for functional diversity, functional dominance, and both. Results showed that AGC varied significantly along the slope gradient, with lower values at steeper sites. Species diversity (richness) had positive relationship with AGC, even when slope effects were considered. As predicted, diversity effects on AGC were mediated through functional diversity and functional dominance, suggesting that both the niche complementarity and the selection effects are not exclusively affecting carbon storage. However, the effects were greater for functional diversity than for functional dominance. Furthermore, functional dominance effects were strongly transmitted by CWM of

  15. The International Nucleotide Sequence Database Collaboration.

    Science.gov (United States)

    Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu

    2011-01-01

    Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.

  16. Trait aggressiveness does not predict social dominance of rats in the Visible Burrow System.

    Science.gov (United States)

    Buwalda, Bauke; Koolhaas, Jaap M; de Boer, Sietse F

    2017-09-01

    Hierarchical social status greatly influences health and well-being in mammals, including humans. The social rank of an individual is established during competitive encounters with conspecifics. Intuitively, therefore, social dominance and aggressiveness may seem intimately linked. Yet, whether an aggressive personality trait may predispose individuals to a particular rank in a social colony setting remains largely unclear. Here we tested the hypothesis that high trait aggressiveness in Wildtype Groningen (WTG) rats, as assessed in a classic resident-intruder offensive aggression paradigm predicts social dominance in a mixed-sex colony housing using the Visible Burrow System (VBS). We also hypothesized that hierarchical steepness, as reflected in the number and intensity of the social conflicts, positively correlates with the average level of trait aggressiveness of the male subjects in the VBS. Clear and stable hierarchical ranking was formed within a few days in VBS colonies as indicated and reflected by a rapid loss of body weight in subordinates which stabilized after 2-3days. Social conflicts, that occurred mainly during these first few days, also resulted in bite wounds in predominantly subordinate males. Data clearly showed that trait aggressiveness does not predict dominance status. The most aggressive male in a mixed sex group of conspecifics living in a closed VBS environment does not always become the dominant male. In addition, data did not convincingly indicate that in colonies with only highly aggressive males, agonistic interactions were more intense. Number of bite wounds and body weight loss did not positively correlate with trait-aggressiveness of subordinates. In this study, rats from this wild-derived rat strain behave differently from Long-Evans laboratory rats that have been studied up till now in many experiments using the VBS. Strain dependent differences in the capacity to display appropriate social behavior fitting an adaptive strategy to

  17. Narcissism, Bullying, and Social Dominance in Youth: A Longitudinal Analysis.

    Science.gov (United States)

    Reijntjes, Albert; Vermande, Marjolijn; Thomaes, Sander; Goossens, Frits; Olthof, Tjeert; Aleva, Liesbeth; Van der Meulen, Matty

    2016-01-01

    A few previous studies have shown that narcissistic traits in youth are positively associated with bullying. However, research examining the developmental relationship between narcissism and bullying is lacking. Moreover, it is unclear whether narcissists constitute a homogeneous group and whether the bullying of narcissistic youth results in establishing social dominance over peers. The present work addresses these gaps. Children (N = 393; M age = 10.3; 51% girls) were followed during the last 3 years of primary school. Person-centered analyses were used to examine whether groups with distinct developmental trajectories for narcissism and two bullying forms (direct and indirect) can be identified, and how these trajectories are related. Multiple groups emerged for all constructs examined. For girls, higher narcissism was neither related to more intense bullying, nor to higher social dominance. In contrast, highly narcissistic boys were more likely than their peers to show elevated direct bullying, and in particular elevated indirect bullying. Hence, high narcissism is a risk factor for bullying in boys, but not in girls. However, narcissism is not always accompanied by high bullying, given that many boys on the high bullying trajectories were not high in narcissism. Results show that among narcissistic youth only those who engage in high levels of bullying are high in social dominance.

  18. Perchlorate reduction by hydrogen autotrophic bacteria and microbial community analysis using high-throughput sequencing.

    Science.gov (United States)

    Wan, Dongjin; Liu, Yongde; Niu, Zhenhua; Xiao, Shuhu; Li, Daorong

    2016-02-01

    Hydrogen autotrophic reduction of perchlorate have advantages of high removal efficiency and harmless to drinking water. But so far the reported information about the microbial community structure was comparatively limited, changes in the biodiversity and the dominant bacteria during acclimation process required detailed study. In this study, perchlorate-reducing hydrogen autotrophic bacteria were acclimated by hydrogen aeration from activated sludge. For the first time, high-throughput sequencing was applied to analyze changes in biodiversity and the dominant bacteria during acclimation process. The Michaelis-Menten model described the perchlorate reduction kinetics well. Model parameters q(max) and K(s) were 2.521-3.245 (mg ClO4(-)/gVSS h) and 5.44-8.23 (mg/l), respectively. Microbial perchlorate reduction occurred across at pH range 5.0-11.0; removal was highest at pH 9.0. The enriched mixed bacteria could use perchlorate, nitrate and sulfate as electron accepter, and the sequence of preference was: NO3(-) > ClO4(-) > SO4(2-). Compared to the feed culture, biodiversity decreased greatly during acclimation process, the microbial community structure gradually stabilized after 9 acclimation cycles. The Thauera genus related to Rhodocyclales was the dominated perchlorate reducing bacteria (PRB) in the mixed culture.

  19. Semi-strong split domination in graphs

    Directory of Open Access Journals (Sweden)

    Anwar Alwardi

    2014-06-01

    Full Text Available Given a graph $G = (V,E$, a dominating set $D subseteq V$ is called a semi-strong split dominating set of $G$ if $|V setminus D| geq 1$ and the maximum degree of the subgraph induced by $V setminus D$ is 1. The minimum cardinality of a semi-strong split dominating set (SSSDS of G is the semi-strong split domination number of G, denoted $gamma_{sss}(G$. In this work, we introduce the concept and prove several results regarding it.

  20. Positive erotic picture stimuli for emotion research in heterosexual females.

    Science.gov (United States)

    Jacob, Gitta Anne; Arntz, Arnoud; Domes, Gregor; Reiss, Neele; Siep, Nicolette

    2011-12-30

    In most experimental studies, emotional pictures are widely used as stimulus material. However, there is still a lack of standardization of picture stimuli displaying erotic relationships, despite the association between a number of psychological problems and severe impairments and problems in intimate relationships. The aim of the study was to test a set of erotic stimuli, with the potential to be used in experimental studies, with heterosexual female subjects. Twenty International Affective Picture System (IAPS) pictures and an additional 100 pictures showing romantic but not explicitly sexual scenes and/or attractive single males were selected. All pictures were rated with respect to valence, arousal, and dominance by 41 heterosexual women and compared to pictures with negative, positive, and neutral emotional valence. Erotic IAPS pictures and our additional erotic pictures did not differ in any of the evaluation dimensions. Analyses of variance (ANOVAs) for valence, arousal, and dominance comparing different picture valence categories showed strong effects for category. However, valence was not significantly different between erotic and positive pictures, while arousal and control were not significantly different between positive and neutral pictures. The pictures of our new set are as positive for heterosexual women as highly positive IAPS pictures, but higher in arousal and dominance. The picture set can be used in experimental psychiatric studies requiring high numbers of stimuli per category. Limitations are the restriction of stimuli application to heterosexual females only and to self-report data. Copyright © 2011 Elsevier Ltd. All rights reserved.

  1. Phylogenetic position of Loricifera inferred from nearly complete 18S and 28S rRNA gene sequences.

    Science.gov (United States)

    Yamasaki, Hiroshi; Fujimoto, Shinta; Miyazaki, Katsumi

    2015-01-01

    Loricifera is an enigmatic metazoan phylum; its morphology appeared to place it with Priapulida and Kinorhyncha in the group Scalidophora which, along with Nematoida (Nematoda and Nematomorpha), comprised the group Cycloneuralia. Scarce molecular data have suggested an alternative phylogenetic hypothesis, that the phylum Loricifera is a sister taxon to Nematomorpha, although the actual phylogenetic position of the phylum remains unclear. Ecdysozoan phylogeny was reconstructed through maximum-likelihood (ML) and Bayesian inference (BI) analyses of nuclear 18S and 28S rRNA gene sequences from 60 species representing all eight ecdysozoan phyla, and including a newly collected loriciferan species. Ecdysozoa comprised two clades with high support values in both the ML and BI trees. One consisted of Priapulida and Kinorhyncha, and the other of Loricifera, Nematoida, and Panarthropoda (Tardigrada, Onychophora, and Arthropoda). The relationships between Loricifera, Nematoida, and Panarthropoda were not well resolved. Loricifera appears to be closely related to Nematoida and Panarthropoda, rather than grouping with Priapulida and Kinorhyncha, as had been suggested by previous studies. Thus, both Scalidophora and Cycloneuralia are a polyphyletic or paraphyletic groups. In addition, Loricifera and Nematomorpha did not emerge as sister groups.

  2. Effect of pulse sequence parameter selection on signal strength in positive-contrast MRI markers for MRI-based prostate postimplant assessment

    Energy Technology Data Exchange (ETDEWEB)

    Lim, Tze Yee [Department of Radiation Physics, The University of Texas MD Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, Texas 77030 and The University of Texas at Houston Graduate School of Biomedical Sciences, 6767 Bertner Avenue, Houston, Texas 77030 (United States); Kudchadker, Rajat J., E-mail: rkudchad@mdanderson.org; Wang, Jihong; Ibbott, Geoffrey S. [Department of Radiation Physics, The University of Texas MD Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, Texas 77030 (United States); Stafford, R. Jason [Department of Imaging Physics, The University of Texas MD Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, Texas 77030 (United States); MacLellan, Christopher [Department of Imaging Physics, The University of Texas MD Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, Texas 77030 and The University of Texas at Houston Graduate School of Biomedical Sciences, 6767 Bertner Avenue, Houston, Texas 77030 (United States); Rao, Arvind [Department of Bioinformatics and Computational Biology, The University of Texas MD Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, Texas 77030 (United States); Frank, Steven J. [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, Texas 77030 (United States)

    2016-07-15

    Purpose: For postimplant dosimetric assessment, computed tomography (CT) is commonly used to identify prostate brachytherapy seeds, at the expense of accurate anatomical contouring. Magnetic resonance imaging (MRI) is superior to CT for anatomical delineation, but identification of the negative-contrast seeds is challenging. Positive-contrast MRI markers were proposed to replace spacers to assist seed localization on MRI images. Visualization of these markers under varying scan parameters was investigated. Methods: To simulate a clinical scenario, a prostate phantom was implanted with 66 markers and 86 seeds, and imaged on a 3.0T MRI scanner using a 3D fast radiofrequency-spoiled gradient recalled echo acquisition with various combinations of scan parameters. Scan parameters, including flip angle, number of excitations, bandwidth, field-of-view, slice thickness, and encoding steps were systematically varied to study their effects on signal, noise, scan time, image resolution, and artifacts. Results: The effects of pulse sequence parameter selection on the marker signal strength and image noise were characterized. The authors also examined the tradeoff between signal-to-noise ratio, scan time, and image artifacts, such as the wraparound artifact, susceptibility artifact, chemical shift artifact, and partial volume averaging artifact. Given reasonable scan time and managable artifacts, the authors recommended scan parameter combinations that can provide robust visualization of the MRI markers. Conclusions: The recommended MRI pulse sequence protocol allows for consistent visualization of the markers to assist seed localization, potentially enabling MRI-only prostate postimplant dosimetry.

  3. Draft Genome Sequence of the Phytopathogenic Fungus Ganoderma boninense, the Causal Agent of Basal Stem Rot Disease on Oil Palm.

    Science.gov (United States)

    Utomo, Condro; Tanjung, Zulfikar Achmad; Aditama, Redi; Buana, Rika Fithri Nurani; Pratomo, Antonius Dony Madu; Tryono, Reno; Liwang, Tony

    2018-04-26

    Ganoderma boninense is the dominant fungal pathogen of basal stem rot (BSR) disease on Elaeis guineensis We sequenced the nuclear genome of mycelia using both Illumina and Pacific Biosciences platforms for assembly of scaffolds. The draft genome comprised 79.24 Mb, 495 scaffolds, and 26,226 predicted coding sequences. Copyright © 2018 Utomo et al.

  4. Detecting Positive Selection of Korean Native Goat Populations Using Next-Generation Sequencing

    Science.gov (United States)

    Lee, Wonseok; Ahn, Sojin; Taye, Mengistie; Sung, Samsun; Lee, Hyun-Jeong; Cho, Seoae; Kim, Heebal

    2016-01-01

    Goats (Capra hircus) are one of the oldest species of domesticated animals. Native Korean goats are a particularly interesting group, as they are indigenous to the area and were raised in the Korean peninsula almost 2,000 years ago. Although they have a small body size and produce low volumes of milk and meat, they are quite resistant to lumbar paralysis. Our study aimed to reveal the distinct genetic features and patterns of selection in native Korean goats by comparing the genomes of native Korean goat and crossbred goat populations. We sequenced the whole genome of 15 native Korean goats and 11 crossbred goats using next-generation sequencing (Illumina platform) to compare the genomes of the two populations. We found decreased nucleotide diversity in the native Korean goats compared to the crossbred goats. Genetic structural analysis demonstrated that the native Korean goat and crossbred goat populations shared a common ancestry, but were clearly distinct. Finally, to reveal the native Korean goat’s selective sweep region, selective sweep signals were identified in the native Korean goat genome using cross-population extended haplotype homozygosity (XP-EHH) and a cross-population composite likelihood ratio test (XP-CLR). As a result, we were able to identify candidate genes for recent selection, such as the CCR3 gene, which is related to lumbar paralysis resistance. Combined with future studies and recent goat genome information, this study will contribute to a thorough understanding of the native Korean goat genome. PMID:27989103

  5. Detecting Positive Selection of Korean Native Goat Populations Using Next-Generation Sequencing.

    Science.gov (United States)

    Lee, Wonseok; Ahn, Sojin; Taye, Mengistie; Sung, Samsun; Lee, Hyun-Jeong; Cho, Seoae; Kim, Heebal

    2016-12-01

    Goats ( Capra hircus ) are one of the oldest species of domesticated animals. Native Korean goats are a particularly interesting group, as they are indigenous to the area and were raised in the Korean peninsula almost 2,000 years ago. Although they have a small body size and produce low volumes of milk and meat, they are quite resistant to lumbar paralysis. Our study aimed to reveal the distinct genetic features and patterns of selection in native Korean goats by comparing the genomes of native Korean goat and crossbred goat populations. We sequenced the whole genome of 15 native Korean goats and 11 crossbred goats using next-generation sequencing (Illumina platform) to compare the genomes of the two populations. We found decreased nucleotide diversity in the native Korean goats compared to the crossbred goats. Genetic structural analysis demonstrated that the native Korean goat and crossbred goat populations shared a common ancestry, but were clearly distinct. Finally, to reveal the native Korean goat's selective sweep region, selective sweep signals were identified in the native Korean goat genome using cross-population extended haplotype homozygosity (XP-EHH) and a cross-population composite likelihood ratio test (XP-CLR). As a result, we were able to identify candidate genes for recent selection, such as the CCR3 gene, which is related to lumbar paralysis resistance. Combined with future studies and recent goat genome information, this study will contribute to a thorough understanding of the native Korean goat genome.

  6. Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

    Directory of Open Access Journals (Sweden)

    Moore JE

    2006-01-01

    Full Text Available Abstract Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted.

  7. Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

    Science.gov (United States)

    Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC

    2006-01-01

    Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935

  8. The Bouma Sequence and the turbidite mind set

    Science.gov (United States)

    Shanmugam, G.

    1997-11-01

    Conventionally, the Bouma Sequence [Bouma, A.H., 1962. Sedimentology of some Flysch Deposits: A Graphic Approach to Facies Interpretation. Elsevier, Amsterdam, 168 pp.], composed of T a, T b, T c, T d, and T e divisions, is interpreted to be the product of a turbidity current. However, recent core and outcrop studies show that the complete and partial Bouma sequences can also be interpreted to be deposits formed by processes other than turbidity currents, such as sandy debris flows and bottom-current reworking. Many published examples of turbidites, most of them hydrocarbon-bearing sands, in the North Sea, the Norwegian Sea, offshore Nigeria, offshore Gabon, Gulf of Mexico, and the Ouachita Mountains, are being reinterpreted by the present author as dominantly deposits of sandy debris flows and bottom-current reworking with only a minor percentage of true turbidites (i.e., deposits of turbidity currents with fluidal or Newtonian rheology in which sediment is suspended by fluid turbulence). This reinterpretation is based on detailed description of 21,000 ft (6402 m) of conventional cores and 1200 ft (365 m) of outcrop sections. The predominance of interpreted turbidites in these areas by other workers can be attributed to the following: (1) loose applications of turbidity-current concepts without regard for fluid rheology, flow state, and sediment-support mechanism that result in a category of 'turbidity currents' that includes debris flows and bottom currents; (2) field description of deep-water sands using the Bouma Sequence (an interpretive model) that invariably leads to a model-driven turbidite interpretation; (3) the prevailing turbidite mind set that subconsciously forces one to routinely interpret most deep-water sands as some kind of turbidites; (4) the use of our inability to interpret transport mechanism from the depositional record as an excuse for assuming deep-water sands as deposits of turbidity currents; (5) the flawed concept of high

  9. Benefits of Dominance over Additive Models for the Estimation of Average Effects in the Presence of Dominance

    Directory of Open Access Journals (Sweden)

    Pascal Duenk

    2017-10-01

    Full Text Available In quantitative genetics, the average effect at a single locus can be estimated by an additive (A model, or an additive plus dominance (AD model. In the presence of dominance, the AD-model is expected to be more accurate, because the A-model falsely assumes that residuals are independent and identically distributed. Our objective was to investigate the accuracy of an estimated average effect (α^ in the presence of dominance, using either a single locus A-model or AD-model. Estimation was based on a finite sample from a large population in Hardy-Weinberg equilibrium (HWE, and the root mean squared error of α^ was calculated for several broad-sense heritabilities, sample sizes, and sizes of the dominance effect. Results show that with the A-model, both sampling deviations of genotype frequencies from HWE frequencies and sampling deviations of allele frequencies contributed to the error. With the AD-model, only sampling deviations of allele frequencies contributed to the error, provided that all three genotype classes were sampled. In the presence of dominance, the root mean squared error of α^ with the AD-model was always smaller than with the A-model, even when the heritability was less than one. Remarkably, in the absence of dominance, there was no disadvantage of fitting dominance. In conclusion, the AD-model yields more accurate estimates of average effects from a finite sample, because it is more robust against sampling deviations from HWE frequencies than the A-model. Genetic models that include dominance, therefore, yield higher accuracies of estimated average effects than purely additive models when dominance is present.

  10. The Jurassic of Denmark and Greenland: An offshore transgressive–regressive mudstone-dominated succession from the Sinemurian of Skåne, Sweden

    Directory of Open Access Journals (Sweden)

    Surlyk, Finn

    2003-10-01

    Full Text Available A Sinemurian mudstone-dominated succession was exposed until recently in the Gantofta quarry in Skåne, southern Sweden. The deposits are placed in the Döshult and Pankarp Members of the Sinemurian–Aalenian Rya Formation. Similar facies of the same age are widespread in the Danish Basin where they constitute the F-Ib unit (F-I member of the Fjerritslev Formation. The Gantofta succession thus represents the easternmost extension of the environment characteristic of the Fjerritslev Formation and is essentially the only locality where it has been possible tostudy the facies of this formation in outcrop. Sedimentation seems to have taken place under relatively quiet tectonic conditions except for the possible fault-control of the basin margin. Thelower part of the Gantofta section is of Early and early Late Sinemurian age. It represents the upper part of the Döshult Member and consists of muddy, lower shoreface sandstones, abruptlyoverlain by dark, bioturbated, fossiliferous mudstones with thin storm siltstones and sandstones. They are overlain by the Upper Sinemurian Pankarp Member which comprises red-brown, restricted marine calcareous mudstones with an upwards increasing number of storm siltstones and sandstones reflecting general shallowing and shoreline progradation.The succession spans the greater part of two simple sequences with a distal sequence boundary located at the boundary between the Döshult Member and the Pankarp Member. The exposed part of the lower sequence includes a thick transgressive systems tract and a very thin highstand systems tract. The upper sequence is represented by an undifferentiated transgressive and highstand systems tract. An Early Sinemurian sea-level rise, a late Early Sinemurian highstand, an early Late Sinemurian fall and a Late Sinemurian minor rise and a major fall are recognised. Nearby boreholes show evidence for an end-Sinemurian – Early Pliensbachian major rise. This evolution corresponds well with

  11. Sequencing of bimaxillary surgery in the correction of vertical maxillary excess: retrospective study.

    Science.gov (United States)

    Salmen, F S; de Oliveira, T F M; Gabrielli, M A C; Pereira Filho, V A; Real Gabrielli, M F

    2018-06-01

    The aim of this study was to evaluate the precision of bimaxillary surgery performed to correct vertical maxillary excess, when the procedure is sequenced with mandibular surgery first or maxillary surgery first. Thirty-two patients, divided into two groups, were included in this retrospective study. Group 1 comprised patients who received bimaxillary surgery following the classical sequence with repositioning of the maxilla first. Patients in group 2 received bimaxillary surgery, but the mandible was operated on first. The precision of the maxillomandibular repositioning was determined by comparison of the digital prediction and postoperative tracings superimposed on the cranial base. The data were tabulated and analyzed statistically. In this sample, both surgical sequences provided adequate clinical accuracy. The classical sequence, repositioning the maxilla first, resulted in greater accuracy for A-point and the upper incisor edge vertical position. Repositioning the mandible first allowed greater precision in the vertical position of pogonion. In conclusion, although both surgical sequences may be used, repositioning the mandible first will result in greater imprecision in relation to the predictive tracing than repositioning the maxilla first. The classical sequence resulted in greater accuracy in the vertical position of the maxilla, which is key for aesthetics. Copyright © 2017 International Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.

  12. Autosomal dominant hereditary spastic paraplegia with axonal sensory motor polyneuropathy maps to chromosome 21q 22.3.

    Science.gov (United States)

    Peddareddygari, Leema Reddy; Hanna, Philip A; Igo, Robert P; Luo, Yuqun A; Won, Sungho; Hirano, Michio; Grewal, Raji P

    2016-01-01

    Hereditary spastic paraplegia (HSP) are a genetically and clinically heterogeneous group of disorders. At present, 19 autosomal dominant loci for HSP have been mapped. We ascertained an American family of European descent segregating an autosomal dominant HSP associated with peripheral neuropathy. A genome wide scan was performed with 410 microsatellite repeat marker (Weber lab screening set 16) and following linkage and haplotype analysis, fine mapping was performed. Established genes or loci for HSP were excluded by direct sequencing or haplotype analysis. All established loci for HSP were excluded. Fine mapping suggested a locus on chromosome 21q22.3 flanked by markers D21S1411 and D21S1446 with a maximum logarithm of odds score of 2.05 and was supported by haplotype analysis. A number of candidate genes in this region were analyzed and no disease-producing mutations were detected. We present the clinical and genetic analysis of an American family with autosomal dominant HSP with axonal sensory motor polyneuropathy mapping to a novel locus on chromosome 21q22.3 designated SPG56.

  13. On the evaluation of market power and market dominance-The Nordic electricity market

    International Nuclear Information System (INIS)

    Hellmer, Stefan; Warell, Linda

    2009-01-01

    This paper studies different concentration and dominance measures using structural indexes used to initially screen the competitive situation in a market. The Nordic and Swedish electricity markets are used as the empirical cases. Market concentration issues in the Nordic electricity market in general and in Sweden in particular have been, at least in initial screenings, approached by the Herfindahl-Hirschman Index (HHI). This article uses an alternative measure to HHI, which is based on market shares of the two largest firms in the market. The results shows that only the Swedish wholesale market has a firm that can be regarded as dominant, but only during very short periods. The results from a hypothetical merger between the second and third largest company in the Swedish wholesale market shows that when the dominant position of the largest firm is reduced, by increasing the size of the second largest firm, the threshold value indicates that competition actually will increase (contradicting to the HHI).

  14. Resolving the Complexity of Human Skin Metagenomes Using Single-Molecule Sequencing

    Directory of Open Access Journals (Sweden)

    Yu-Chih Tsai

    2016-02-01

    Full Text Available Deep metagenomic shotgun sequencing has emerged as a powerful tool to interrogate composition and function of complex microbial communities. Computational approaches to assemble genome fragments have been demonstrated to be an effective tool for de novo reconstruction of genomes from these communities. However, the resultant “genomes” are typically fragmented and incomplete due to the limited ability of short-read sequence data to assemble complex or low-coverage regions. Here, we use single-molecule, real-time (SMRT sequencing to reconstruct a high-quality, closed genome of a previously uncharacterized Corynebacterium simulans and its companion bacteriophage from a skin metagenomic sample. Considerable improvement in assembly quality occurs in hybrid approaches incorporating short-read data, with even relatively small amounts of long-read data being sufficient to improve metagenome reconstruction. Using short-read data to evaluate strain variation of this C. simulans in its skin community at single-nucleotide resolution, we observed a dominant C. simulans strain with moderate allelic heterozygosity throughout the population. We demonstrate the utility of SMRT sequencing and hybrid approaches in metagenome quantitation, reconstruction, and annotation.

  15. Resolving the Complexity of Human Skin Metagenomes Using Single-Molecule Sequencing

    Science.gov (United States)

    Tsai, Yu-Chih; Deming, Clayton; Segre, Julia A.; Kong, Heidi H.; Korlach, Jonas

    2016-01-01

    ABSTRACT Deep metagenomic shotgun sequencing has emerged as a powerful tool to interrogate composition and function of complex microbial communities. Computational approaches to assemble genome fragments have been demonstrated to be an effective tool for de novo reconstruction of genomes from these communities. However, the resultant “genomes” are typically fragmented and incomplete due to the limited ability of short-read sequence data to assemble complex or low-coverage regions. Here, we use single-molecule, real-time (SMRT) sequencing to reconstruct a high-quality, closed genome of a previously uncharacterized Corynebacterium simulans and its companion bacteriophage from a skin metagenomic sample. Considerable improvement in assembly quality occurs in hybrid approaches incorporating short-read data, with even relatively small amounts of long-read data being sufficient to improve metagenome reconstruction. Using short-read data to evaluate strain variation of this C. simulans in its skin community at single-nucleotide resolution, we observed a dominant C. simulans strain with moderate allelic heterozygosity throughout the population. We demonstrate the utility of SMRT sequencing and hybrid approaches in metagenome quantitation, reconstruction, and annotation. PMID:26861018

  16. Robust Automatic Target Recognition via HRRP Sequence Based on Scatterer Matching

    Directory of Open Access Journals (Sweden)

    Yuan Jiang

    2018-02-01

    Full Text Available High resolution range profile (HRRP plays an important role in wideband radar automatic target recognition (ATR. In order to alleviate the sensitivity to clutter and target aspect, employing a sequence of HRRP is a promising approach to enhance the ATR performance. In this paper, a novel HRRP sequence-matching method based on singular value decomposition (SVD is proposed. First, the HRRP sequence is decoupled into the angle space and the range space via SVD, which correspond to the span of the left and the right singular vectors, respectively. Second, atomic norm minimization (ANM is utilized to estimate dominant scatterers in the range space and the Hausdorff distance is employed to measure the scatter similarity between the test and training data. Next, the angle space similarity between the test and training data is evaluated based on the left singular vector correlations. Finally, the range space matching result and the angle space correlation are fused with the singular values as weights. Simulation and outfield experimental results demonstrate that the proposed matching metric is a robust similarity measure for HRRP sequence recognition.

  17. On domination multisubdivision number of unicyclic graphs

    Directory of Open Access Journals (Sweden)

    Joanna Raczek

    2018-01-01

    Full Text Available The paper continues the interesting study of the domination subdivision number and the domination multisubdivision number. On the basis of the constructive characterization of the trees with the domination subdivision number equal to 3 given in [H. Aram, S.M. Sheikholeslami, O. Favaron, Domination subdivision number of trees, Discrete Math. 309 (2009, 622-628], we constructively characterize all connected unicyclic graphs with the domination multisubdivision number equal to 3. We end with further questions and open problems.

  18. Positive Streptobacillus moniliformis PCR in guinea pigs likely due to Leptotrichia spp.

    Science.gov (United States)

    Boot, Ron; Van de Berg, Lia; Reubsaet, Frans A G; Vlemminx, Maurice J

    2008-04-30

    Streptobacillus moniliformis is a zoonotic bacterium. We obtained positive S. moniliformis PCR results in oral swab samples from guinea pigs from an experimental colony and the breeding colony of origin. Comparison of the DNA sequence of an amplicon with deposited 16S rDNA sequences revealed that Leptotrichia sp. can be the source of a false positive S. moniliformis PCR outcome.

  19. Individual dispersal delays in a cooperative breeder: Ecological constraints, the benefits of philopatry and the social queue for dominance.

    Science.gov (United States)

    Nelson-Flower, Martha J; Wiley, Elizabeth M; Flower, Tom P; Ridley, Amanda R

    2018-03-20

    Delayed dispersal is a key step in the evolution of familial animal societies and cooperative breeding. However, no consensus has been reached on the ecological and social circumstances driving delayed dispersal. Here, we test predictions from the ecological constraints and benefits of philopatry hypotheses as well as the recently proposed dual benefits hypothesis to better understand the evolution of group-living and cooperative breeding. Furthermore, we consider how individual social circumstances within groups affect dispersal decisions. We examine 11 years of life-history information on a wild population of cooperatively breeding southern pied babblers Turdoides bicolor. We investigate the effects of ecological conditions, natal-group membership and individual social context on male and female dispersal delays, disperser survival and acquisition of dominance. Female dispersal decisions are generally unconstrained by ecological or social circumstances. In contrast, males disperse in response to relaxed ecological constraints, decreases in nepotistic tolerance or when low social rank in the queue for dominance decreases their likelihood of gaining a dominant breeding position. Early dispersal by end-of-queue males often leads to a head-of-queue subordinate position in a non-natal group, thereby increasing access to dominant breeding positions. However, males and females remaining in natal groups gain benefits of philopatry via increased survival and, for head-of-queue males, very high likelihood of acquisition of a breeding position. Overall, predictions from the dual benefits hypothesis best describe these results, while some predictions from each of the ecological constraints and benefits of philopatry hypotheses were supported. The benefits of living and working together (collective action benefits) in large stable groups are of central importance in shaping dispersal delays in southern pied babbler societies. In addition, position in the subordinate social

  20. Identification of genomic insertion and flanking sequence of G2-EPSPS and GAT transgenes in soybean using whole genome sequencing method

    Directory of Open Access Journals (Sweden)

    Bingfu Guo

    2016-07-01

    Full Text Available Molecular characterization of sequences flanking exogenous fragment insertions is essential for safety assessment and labeling of genetically modified organisms (GMO. In this study, the T-DNA insertion sites and flanking sequences were identified in two newly developed transgenic glyphosate-tolerant soybeans GE-J16 and ZH10-6 based on whole genome sequencing (WGS method. About 21 Gb sequence data (~21× coverage for each line was generated on Illumina HiSeq 2500 platform. The junction reads mapped to boundary of T-DNA and flanking sequences in these two events were identified by comparing all sequencing reads with soybean reference genome and sequence of transgenic vector. The putative insertion loci and flanking sequences were further confirmed by PCR amplification, Sanger sequencing, and co-segregation analysis. All these analyses supported that exogenous T-DNA fragments were integrated in positions of Chr19: 50543767-50543792 and Chr17: 7980527-7980541 in these two transgenic lines. Identification of the genomic insertion site of the G2-EPSPS and GAT transgenes will facilitate the use of their glyphosate-tolerant traits in soybean breeding program. These results also demonstrated that WGS is a cost-effective and rapid method of identifying sites of T-DNA insertions and flanking sequences in soybean.

  1. Inverted temperature sequences: role of deformation partitioning

    Science.gov (United States)

    Grujic, D.; Ashley, K. T.; Coble, M. A.; Coutand, I.; Kellett, D.; Whynot, N.

    2015-12-01

    The inverted metamorphism associated with the Main Central thrust zone in the Himalaya has been historically attributed to a number of tectonic processes. Here we show that there is actually a composite peak and deformation temperature sequence that formed in succession via different tectonic processes. The deformation partitioning seems to the have played a key role, and the magnitude of each process has varied along strike of the orogen. To explain the formation of the inverted metamorphic sequence across the Lesser Himalayan Sequence (LHS) in eastern Bhutan, we used Raman spectroscopy of carbonaceous material (RSCM) to determine the peak metamorphic temperatures and Ti-in-quartz thermobarometry to determine the deformation temperatures combined with thermochronology including published apatite and zircon U-Th/He and fission-track data and new 40Ar/39Ar dating of muscovite. The dataset was inverted using 3D-thermal-kinematic modeling to constrain the ranges of geological parameters such as fault geometry and slip rates, location and rates of localized basal accretion, and thermal properties of the crust. RSCM results indicate that there are two peak temperature sequences separated by a major thrust within the LHS. The internal temperature sequence shows an inverted peak temperature gradient of 12 °C/km; in the external (southern) sequence, the peak temperatures are constant across the structural sequence. Thermo-kinematic modeling suggest that the thermochronologic and thermobarometric data are compatible with a two-stage scenario: an Early-Middle Miocene phase of fast overthrusting of a hot hanging wall over a downgoing footwall and inversion of the synkinematic isotherms, followed by the formation of the external duplex developed by dominant underthrusting and basal accretion. To reconcile our observations with the experimental data, we suggest that pervasive ductile deformation within the upper LHS and along the Main Central thrust zone at its top stopped at

  2. A recurrent deletion mutation in OPA1 causes autosomal dominant optic atrophy in a Chinese family

    Science.gov (United States)

    Zhang, Liping; Shi, Wei; Song, Liming; Zhang, Xiao; Cheng, Lulu; Wang, Yanfang; Ge, Xianglian; Li, Wei; Zhang, Wei; Min, Qingjie; Jin, Zi-Bing; Qu, Jia; Gu, Feng

    2014-11-01

    Autosomal dominant optic atrophy (ADOA) is the most frequent form of hereditary optic neuropathy and occurs due to the degeneration of the retinal ganglion cells. To identify the genetic defect in a family with putative ADOA, we performed capture next generation sequencing (CNGS) to screen known retinal disease genes. However, six exons failed to be sequenced by CNGS in optic atrophy 1 gene (OPA1). Sequencing of those exons identified a 4 bp deletion mutation (c.2983-1_2985del) in OPA1. Furthermore, we sequenced the transcripts of OPA1 from the patient skin fibroblasts and found there is six-nucleotide deletion (c.2984-c.2989, AGAAAG). Quantitative-PCR and Western blotting showed that OPA1 mRNA and its protein expression have no obvious difference between patient skin fibroblast and control. The analysis of protein structure by molecular modeling suggests that the mutation may change the structure of OPA1 by formation of an alpha helix protruding into an existing pocket. Taken together, we identified an OPA1 mutation in a family with ADOA by filling the missing CNGS data. We also showed that this mutation affects the structural intactness of OPA1. It provides molecular insights for clinical genetic diagnosis and treatment of optic atrophy.

  3. The evolutionary position of nematodes

    Directory of Open Access Journals (Sweden)

    Gojobori Takashi

    2002-04-01

    Full Text Available Abstract Background The complete genomes of three animals have been sequenced by global research efforts: a nematode worm (Caenorhabditis elegans, an insect (Drosophila melanogaster, and a vertebrate (Homo sapiens. Remarkably, their relationships have yet to be clarified. The confusion concerns the enigmatic position of nematodes. Traditionally, nematodes have occupied a basal position, in part because they lack a true body cavity. However, the leading hypothesis now joins nematodes with arthropods in a molting clade, Ecdysozoa, based on data from several genes. Results We tested the Ecdysozoa hypothesis with analyses of more than 100 nuclear protein alignments, under conditions that would expose biases, and found that it was not supported. Instead, we found significant support for the traditional hypothesis, Coelomata. Our result is robust to different rates of sequence change among genes and lineages, different numbers of taxa, and different species of nematodes. Conclusion We conclude that insects (arthropods are genetically and evolutionarily closer to humans than to nematode worms.

  4. Fluency First: Reversing the Traditional ESL Sequence.

    Science.gov (United States)

    MacGowan-Gilhooly, Adele

    1991-01-01

    Describes an ESL department's whole language approach to writing and reading, replacing its traditional grammar-based ESL instructional sequence. Reports the positive quantitative and qualitative results of the first three years of using the new approach. (KEH)

  5. Forward Genetics by Sequencing EMS Variation-Induced Inbred Lines

    Directory of Open Access Journals (Sweden)

    Charles Addo-Quaye

    2017-02-01

    Full Text Available In order to leverage novel sequencing techniques for cloning genes in eukaryotic organisms with complex genomes, the false positive rate of variant discovery must be controlled for by experimental design and informatics. We sequenced five lines from three pedigrees of ethyl methanesulfonate (EMS-mutagenized Sorghum bicolor, including a pedigree segregating a recessive dwarf mutant. Comparing the sequences of the lines, we were able to identify and eliminate error-prone positions. One genomic region contained EMS mutant alleles in dwarfs that were homozygous reference sequences in wild-type siblings and heterozygous in segregating families. This region contained a single nonsynonymous change that cosegregated with dwarfism in a validation population and caused a premature stop codon in the Sorghum ortholog encoding the gibberellic acid (GA biosynthetic enzyme ent-kaurene oxidase. Application of exogenous GA rescued the mutant phenotype. Our method for mapping did not require outcrossing and introduced no segregation variance. This enables work when line crossing is complicated by life history, permitting gene discovery outside of genetic models. This inverts the historical approach of first using recombination to define a locus and then sequencing genes. Our formally identical approach first sequences all the genes and then seeks cosegregation with the trait. Mutagenized lines lacking obvious phenotypic alterations are available for an extension of this approach: mapping with a known marker set in a line that is phenotypically identical to starting material for EMS mutant generation.

  6. Supplementary data: Comparative studies on sequence ...

    Indian Academy of Sciences (India)

    Unknown

    Page 1. Supplementary data: Comparative studies on sequence characteristics around translation initiation codon in four eukaryotes. Qingpo Liu and Qingzhong Xue. J. Genet. 84, 317–322. Table 1. Spearman's rank correlation coefficients of 39 base positions around the AUG codon in the four eukaryotic species studied.

  7. Domination criticality in product graphs

    Directory of Open Access Journals (Sweden)

    M.R. Chithra

    2015-07-01

    Full Text Available A connected dominating set is an important notion and has many applications in routing and management of networks. Graph products have turned out to be a good model of interconnection networks. This motivated us to study the Cartesian product of graphs G with connected domination number, γc(G=2,3 and characterize such graphs. Also, we characterize the k−γ-vertex (edge critical graphs and k−γc-vertex (edge critical graphs for k=2,3 where γ denotes the domination number of G. We also discuss the vertex criticality in grids.

  8. Metagenomic Sequencing of an In Vitro-Simulated Microbial Community

    Energy Technology Data Exchange (ETDEWEB)

    Morgan, Jenna L.; Darling, Aaron E.; Eisen, Jonathan A.

    2009-12-01

    Background: Microbial life dominates the earth, but many species are difficult or even impossible to study under laboratory conditions. Sequencing DNA directly from the environment, a technique commonly referred to as metagenomics, is an important tool for cataloging microbial life. This culture-independent approach involves collecting samples that include microbes in them, extracting DNA from the samples, and sequencing the DNA. A sample may contain many different microorganisms, macroorganisms, and even free-floating environmental DNA. A fundamental challenge in metagenomics has been estimating the abundance of organisms in a sample based on the frequency with which the organism's DNA was observed in reads generated via DNA sequencing. Methodology/Principal Findings: We created mixtures of ten microbial species for which genome sequences are known. Each mixture contained an equal number of cells of each species. We then extracted DNA from the mixtures, sequenced the DNA, and measured the frequency with which genomic regions from each organism was observed in the sequenced DNA. We found that the observed frequency of reads mapping to each organism did not reflect the equal numbers of cells that were known to be included in each mixture. The relative organism abundances varied significantly depending on the DNA extraction and sequencing protocol utilized. Conclusions/Significance: We describe a new data resource for measuring the accuracy of metagenomic binning methods, created by in vitro-simulation of a metagenomic community. Our in vitro simulation can be used to complement previous in silico benchmark studies. In constructing a synthetic community and sequencing its metagenome, we encountered several sources of observation bias that likely affect most metagenomic experiments to date and present challenges for comparative metagenomic studies. DNA preparation methods have a particularly profound effect in our study, implying that samples prepared with

  9. 2×2 dominant achievement goal profiles in high-level swimmers.

    Science.gov (United States)

    Fernandez-Rio, Javier; Cecchini Estrada, Jose A; Mendez-Giménez, Antonio; Fernández-Garcia, Benjamín; Saavedra, Pablo

    2014-01-01

    The goal of this study was to assess achievement goal dominance, self-determined situational motivation and competence in high-level swimmers before and after three training sessions set at different working intensities (medium, sub-maximal and maximal). Nineteen athletes (males, n=9, 18.00±2.32 years; females, n=10, 16.30±2.01 years, range = 14-18) agreed to participate. They completed a questionnaire that included the Dominant Achievement Goal assessment instrument, the 2×2 Achievement Goals Questionnaire for Sport (AGQ-S), The Situational Motivation Scale (SIMS) and the Competence subscale of the Basic Psychological Needs in Exercise questionnaire (BPNES). Results indicated that participants overwhelmingly showed mastery-approach achievement goal dominance, and it remained stable at the conclusion of the different training sessions under all intensity levels. This profile was positively correlated to self-determined situational motivation and competence. However, swimmers' feelings of competence increased only after the medium intensity level training session. After the completion of the maximal intensity training session, swimmers' self-determined motivation was significantly lower compared to the other two training sessions, which could be caused by a temporary period of burnout. Results indicated that high-level swimmers had a distinct mastery-approach dominant achievement goal profile that was not affected by the workload of the different training sessions. They also showed high levels of self-determined situational motivation and competence. However, heavy workloads should be controlled because they can cause transitory burnout.

  10. Molecular Findings Among Patients Referred for Clinical Whole-Exome Sequencing

    Science.gov (United States)

    Yang, Yaping; Muzny, Donna M.; Xia, Fan; Niu, Zhiyv; Person, Richard; Ding, Yan; Ward, Patricia; Braxton, Alicia; Wang, Min; Buhay, Christian; Veeraraghavan, Narayanan; Hawes, Alicia; Chiang, Theodore; Leduc, Magalie; Beuten, Joke; Zhang, Jing; He, Weimin; Scull, Jennifer; Willis, Alecia; Landsverk, Megan; Craigen, William J.; Bekheirnia, Mir Reza; Stray-Pedersen, Asbjorg; Liu, Pengfei; Wen, Shu; Alcaraz, Wendy; Cui, Hong; Walkiewicz, Magdalena; Reid, Jeffrey; Bainbridge, Matthew; Patel, Ankita; Boerwinkle, Eric; Beaudet, Arthur L.; Lupski, James R.; Plon, Sharon E.; Gibbs, Richard A.; Eng, Christine M.

    2015-01-01

    IMPORTANCE Clinical whole-exome sequencing is increasingly used for diagnostic evaluation of patients with suspected genetic disorders. OBJECTIVE To perform clinical whole-exome sequencing and report (1) the rate of molecular diagnosis among phenotypic groups, (2) the spectrum of genetic alterations contributing to disease, and (3) the prevalence of medically actionable incidental findings such as FBN1 mutations causing Marfan syndrome. DESIGN, SETTING, AND PATIENTS Observational study of 2000 consecutive patients with clinical whole-exome sequencing analyzed between June 2012 and August 2014. Whole-exome sequencing tests were performed at a clinical genetics laboratory in the United States. Results were reported by clinical molecular geneticists certified by the American Board of Medical Genetics and Genomics. Tests were ordered by the patient’s physician. The patients were primarily pediatric (1756 [88%]; mean age, 6 years; 888 females [44%], 1101 males [55%], and 11 fetuses [1% gender unknown]), demonstrating diverse clinical manifestations most often including nervous system dysfunction such as developmental delay. MAIN OUTCOMES AND MEASURES Whole-exome sequencing diagnosis rate overall and by phenotypic category, mode of inheritance, spectrum of genetic events, and reporting of incidental findings. RESULTS A molecular diagnosis was reported for 504 patients (25.2%) with 58% of the diagnostic mutations not previously reported. Molecular diagnosis rates for each phenotypic category were 143/526 (27.2%; 95% CI, 23.5%–31.2%) for the neurological group, 282/1147 (24.6%; 95% CI, 22.1%–27.2%) for the neurological plus other organ systems group, 30/83 (36.1%; 95% CI, 26.1%–47.5%) for the specific neurological group, and 49/244 (20.1%; 95% CI, 15.6%–25.8%) for the nonneurological group. The Mendelian disease patterns of the 527 molecular diagnoses included 280 (53.1%) autosomal dominant, 181 (34.3%) autosomal recessive (including 5 with uniparental disomy

  11. MAP Estimation of Chin and Cheek Contours in Video Sequences

    Directory of Open Access Journals (Sweden)

    Kampmann Markus

    2004-01-01

    Full Text Available An algorithm for the estimation of chin and cheek contours in video sequences is proposed. This algorithm exploits a priori knowledge about shape and position of chin and cheek contours in images. Exploiting knowledge about the shape, a parametric 2D model representing chin and cheek contours is introduced. Exploiting knowledge about the position, a MAP estimator is developed taking into account the observed luminance gradient as well as a priori probabilities of chin and cheek contours positions. The proposed algorithm was tested with head and shoulder video sequences (image resolution CIF. In nearly 70% of all investigated video frames, a subjectively error free estimation could be achieved. The 2D estimate error is measured as on average between 2.4 and .

  12. Stratigraphical analysis of the neoproterozoic sedimentary sequences of the Sao Francisco Basin

    International Nuclear Information System (INIS)

    Martins, Mariela; Lemos, Valesca Brasil

    2007-01-01

    A stratigraphic analysis was performed under the principles of Sequence Stratigraphy on the neoproterozoic sedimentary sequences of the Sao Francisco Basin (Central Brazil). Three periods of deposition separated by unconformities were recognized in the Sao Francisco Megasequence: (1) Sequences 1 and 2, a cryogenian glaciogenic sequence, followed by a distal scarp carbonate ramp, developed during stable conditions, (2) Sequence 3, a Upper Cryogenian stack homoclinal ramps with mixed carbonate-siliciclastic sedimentation, deposited under a progressive influence of compressional stresses of the Brasiliano Cycle, (3) Sequence 4, a Lower Ediacaran shallow platform dominated by siliciclastic sedimentation of molassic nature, the erosion product of the nearby uplifted thrust sheets. Each of the carbonate-bearing sequences presents a distinct δ 13 C isotopic signature. The superposition to the global curve for carbon isotopic variation allowed the recognition of a major depositional hiatus between the Paranoa and Sao Francisco Megasequences, and suggested that the glacial diamictite deposition (Jequitai Formation) took place most probably around 800 Ma. This constrains the Sao Francisco Megasequence deposition to the interval between 800 and 600 Ma (the known ages of the Brasiliano Orogeny defines the upper limit). A minor depositional hiatus (700.680 Ma) was also identified separating sequences 2 and 3. Isotopic analyses suggest that from then on, more restricted environmental conditions were established in the basin, probably associated with a first order global event, which prevailed throughout deposition of the Sequence 3. (author)

  13. The isokinetic strength profile of elite soccer players according to playing position.

    Directory of Open Access Journals (Sweden)

    Robert Śliwowski

    Full Text Available The aim of this study was to compare isokinetic strength performance profiles in elite soccer players across different field positions. A total of 111 elite international players of Polish Ekstraklasa (the top division in Poland were examined during the 2010-2015 seasons. The players were classified into six positional roles: central defenders (CD, external defenders (ED, central midfielders (CM, external midfielders (EM, forwards (F, and goalkeepers (G. The concentric isokinetic strength (peak torque [PT] of quadriceps and hamstrings, H/Q ratios was calculated for the dominant leg and the non-dominant leg at angular velocity of 1.05 rad ·s-1, whereas to assess isokinetic muscle endurance, the total work [TW] at angular velocity of 4.19 rad ·s-1, was taken into consideration. The results showed that isokinetic strength performance varies significantly among players in different playing positions. The analysis of PT for quadriceps (PT-Q and hamstrings (PT-H generally showed that the goalkeepers and central midfielders had lower strength levels compared to other playing positions. In the case of PT-H and hamstring/quadricep (H/Q peak torque ratios, statistically significant differences were also noted for the legs, where mean values noted for the dominant leg were higher than for the non-dominant leg. For TW for quadriceps (TW-Q and hamstrings (TW-H, statistically significant differences were noted only between playing positions. TW-Q values for goalkeepers were lower than for central defenders and external midfielders. TW-H values for goalkeepers were lower than for central midfielders, central defenders and external midfielders. This study showed that specific functional activity of players in individual positions on the field influences the varied profile of isokinetic strength performance.

  14. Phage and Nucleocytoplasmic Large Viral Sequences Dominate Coral Viromes from the Arabian Gulf.

    Science.gov (United States)

    Mahmoud, Huda; Jose, Liny

    2017-01-01

    Corals that naturally thrive under extreme conditions are gaining increasing attention due to their importance as living models to understand the impact of global warming on world corals. Here, we present the first metagenomic study of viral communities in corals thriving in a thermally variable water body in which the temperature fluctuates between 11 and 39°C in different seasons. The viral assemblages of two of the most abundant massive ( Porites harrisoni ) and branching ( Acropora downingi ) corals in offshore and inshore reef systems in the northern Arabian Gulf were investigated. Samples were collected from five reef systems during summer, autumn and winter of 2011/2012. The two coral viromes contain 12 viral families, including 10 dsDNA viral families [Siphoviridae, Podoviridae, Myoviridae, Phycodnaviridae, Baculoviridae, Herpesviridae, Adenoviridae, Alloherpesviridae, Mimiviridae and one unclassified family], one-ssDNA viral family (Microviridae) and one RNA viral family (Retroviridae). Overall, sequences significantly similar to Podoviridae were the most abundant in the P. harrisoni and A. downingi viromes. Various morphological types of virus-like particles (VLPs) were confirmed in the healthy coral tissue by transmission electron microscopy, including large tailless VLPs and electron-dense core VLPs. Tailed bacteriophages were isolated from coral tissue using a plaque assay. Higher functional gene diversity was recorded in A. downingi than in P. harrisoni , and comparative metagenomics revealed that the Gulf viral assemblages are functionally distinct from Pacific Ocean coral viral communities.

  15. Phage and Nucleocytoplasmic Large Viral Sequences Dominate Coral Viromes from the Arabian Gulf

    Directory of Open Access Journals (Sweden)

    Huda Mahmoud

    2017-10-01

    Full Text Available Corals that naturally thrive under extreme conditions are gaining increasing attention due to their importance as living models to understand the impact of global warming on world corals. Here, we present the first metagenomic study of viral communities in corals thriving in a thermally variable water body in which the temperature fluctuates between 11 and 39°C in different seasons. The viral assemblages of two of the most abundant massive (Porites harrisoni and branching (Acropora downingi corals in offshore and inshore reef systems in the northern Arabian Gulf were investigated. Samples were collected from five reef systems during summer, autumn and winter of 2011/2012. The two coral viromes contain 12 viral families, including 10 dsDNA viral families [Siphoviridae, Podoviridae, Myoviridae, Phycodnaviridae, Baculoviridae, Herpesviridae, Adenoviridae, Alloherpesviridae, Mimiviridae and one unclassified family], one-ssDNA viral family (Microviridae and one RNA viral family (Retroviridae. Overall, sequences significantly similar to Podoviridae were the most abundant in the P. harrisoni and A. downingi viromes. Various morphological types of virus-like particles (VLPs were confirmed in the healthy coral tissue by transmission electron microscopy, including large tailless VLPs and electron-dense core VLPs. Tailed bacteriophages were isolated from coral tissue using a plaque assay. Higher functional gene diversity was recorded in A. downingi than in P. harrisoni, and comparative metagenomics revealed that the Gulf viral assemblages are functionally distinct from Pacific Ocean coral viral communities.

  16. Hand dominance in orthopaedic surgeons.

    LENUS (Irish Health Repository)

    Lui, Darren F

    2012-08-01

    Handedness is perhaps the most studied human asymmetry. Laterality is the preference shown for one side and it has been studied in many aspects of medicine. Studies have shown that some orthopaedic procedures had poorer outcomes and identified laterality as a contributing factor. We developed a questionnaire to assess laterality in orthopaedic surgery and compared this to an established scoring system. Sixty-two orthopaedic surgeons surveyed with the validated Waterloo Handedness Questionnaire (WHQ) were compared with the self developed Orthopaedic Handedness Questionnaire (OHQ). Fifty-eight were found to be right hand dominant (RHD) and 4 left hand dominant (LHD). In RHD surgeons, the average WHQ score was 44.9% and OHQ 15%. For LHD surgeons the WHQ score was 30.2% and OHQ 9.4%. This represents a significant amount of time using the non dominant hand but does not necessarily determine satisfactory or successful dexterity transferable to the operating room. Training may be required for the non dominant side.

  17. Denys-Drash syndrome associated WT1 glutamine 369 mutants have altered sequence-preferences and altered responses to epigenetic modifications

    Energy Technology Data Exchange (ETDEWEB)

    Hashimoto, Hideharu; Zhang, Xing; Zheng, Yu; Wilson, Geoffrey G.; Cheng, Xiaodong

    2016-09-04

    Mutations in human zinc-finger transcription factor WT1 result in abnormal development of the kidneys and genitalia and an array of pediatric problems including nephropathy, blastoma, gonadal dysgenesis and genital discordance. Several overlapping phenotypes are associated with WT1 mutations, including Wilms tumors, Denys-Drash syndrome (DDS), Frasier syndrome (FS) and WAGR syndrome (Wilms tumor, aniridia, genitourinary malformations, and mental retardation). These conditions vary in severity from individual to individual; they can be fatal in early childhood, or relatively benign into adulthood. DDS mutations cluster predominantly in zinc fingers (ZF) 2 and 3 at the C-terminus of WT1, which together with ZF4 determine the sequence-specificity of DNA binding. We examined three DDS associated mutations in ZF2 of human WT1 where the normal glutamine at position 369 is replaced by arginine (Q369R), lysine (Q369K) or histidine (Q369H). These mutations alter the sequence-specificity of ZF2, we find, changing its affinity for certain bases and certain epigenetic forms of cytosine. X-ray crystallography of the DNA binding domains of normal WT1, Q369R and Q369H in complex with preferred sequences revealed the molecular interactions responsible for these affinity changes. DDS is inherited in an autosomal dominant fashion, implying a gain of function by mutant WT1 proteins. This gain, we speculate, might derive from the ability of the mutant proteins to sequester WT1 into unproductive oligomers, or to erroneously bind to variant target sequences.

  18. Spatio-temporal alignment of pedobarographic image sequences.

    Science.gov (United States)

    Oliveira, Francisco P M; Sousa, Andreia; Santos, Rubim; Tavares, João Manuel R S

    2011-07-01

    This article presents a methodology to align plantar pressure image sequences simultaneously in time and space. The spatial position and orientation of a foot in a sequence are changed to match the foot represented in a second sequence. Simultaneously with the spatial alignment, the temporal scale of the first sequence is transformed with the aim of synchronizing the two input footsteps. Consequently, the spatial correspondence of the foot regions along the sequences as well as the temporal synchronizing is automatically attained, making the study easier and more straightforward. In terms of spatial alignment, the methodology can use one of four possible geometric transformation models: rigid, similarity, affine, or projective. In the temporal alignment, a polynomial transformation up to the 4th degree can be adopted in order to model linear and curved time behaviors. Suitable geometric and temporal transformations are found by minimizing the mean squared error (MSE) between the input sequences. The methodology was tested on a set of real image sequences acquired from a common pedobarographic device. When used in experimental cases generated by applying geometric and temporal control transformations, the methodology revealed high accuracy. In addition, the intra-subject alignment tests from real plantar pressure image sequences showed that the curved temporal models produced better MSE results (P alignment of pedobarographic image data, since previous methods can only be applied on static images.

  19. Business dominant position in innovation process

    OpenAIRE

    BABYCH T.O.

    2015-01-01

    In the international competitive environment innovative development acquires the special urgency for the nation. Innovation is no longer seen as a stochastic process. was The systematic implementation and stimulation of innovation have become the paradigm of economic development for the most of the world. It is important to form and to exploit new methodologies and tools for innovation policy. Such instruments should cover all the factors and results. So the large and small business should be...

  20. Metagenomic sequence of saline desert microbiota from wild ass sanctuary, Little Rann of Kutch, Gujarat, India.

    Science.gov (United States)

    Patel, Rajesh; Mevada, Vishal; Prajapati, Dhaval; Dudhagara, Pravin; Koringa, Prakash; Joshi, C G

    2015-03-01

    We report Metagenome from the saline desert soil sample of Little Rann of Kutch, Gujarat State, India. Metagenome consisted of 633,760 sequences with size 141,307,202 bp and 56% G + C content. Metagenome sequence data are available at EBI under EBI Metagenomics database with accession no. ERP005612. Community metagenomics revealed total 1802 species belonged to 43 different phyla with dominating Marinobacter (48.7%) and Halobacterium (4.6%) genus in bacterial and archaeal domain respectively. Remarkably, 18.2% sequences in a poorly characterized group and 4% gene for various stress responses along with versatile presence of commercial enzyme were evident in a functional metagenome analysis.

  1. In-frame mutations in exon 1 of SKI cause dominant Shprintzen-Goldberg syndrome.

    Science.gov (United States)

    Carmignac, Virginie; Thevenon, Julien; Adès, Lesley; Callewaert, Bert; Julia, Sophie; Thauvin-Robinet, Christel; Gueneau, Lucie; Courcet, Jean-Benoit; Lopez, Estelle; Holman, Katherine; Renard, Marjolijn; Plauchu, Henri; Plessis, Ghislaine; De Backer, Julie; Child, Anne; Arno, Gavin; Duplomb, Laurence; Callier, Patrick; Aral, Bernard; Vabres, Pierre; Gigot, Nadège; Arbustini, Eloisa; Grasso, Maurizia; Robinson, Peter N; Goizet, Cyril; Baumann, Clarisse; Di Rocco, Maja; Sanchez Del Pozo, Jaime; Huet, Frédéric; Jondeau, Guillaume; Collod-Beroud, Gwenaëlle; Beroud, Christophe; Amiel, Jeanne; Cormier-Daire, Valérie; Rivière, Jean-Baptiste; Boileau, Catherine; De Paepe, Anne; Faivre, Laurence

    2012-11-02

    Shprintzen-Goldberg syndrome (SGS) is characterized by severe marfanoid habitus, intellectual disability, camptodactyly, typical facial dysmorphism, and craniosynostosis. Using family-based exome sequencing, we identified a dominantly inherited heterozygous in-frame deletion in exon 1 of SKI. Direct sequencing of SKI further identified one overlapping heterozygous in-frame deletion and ten heterozygous missense mutations affecting recurrent residues in 18 of the 19 individuals screened for SGS; these individuals included one family affected by somatic mosaicism. All mutations were located in a restricted area of exon 1, within the R-SMAD binding domain of SKI. No mutation was found in a cohort of 11 individuals with other marfanoid-craniosynostosis phenotypes. The interaction between SKI and Smad2/3 and Smad 4 regulates TGF-β signaling, and the pattern of anomalies in Ski-deficient mice corresponds to the clinical manifestations of SGS. These findings define SGS as a member of the family of diseases associated with the TGF-β-signaling pathway. Copyright © 2012 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  2. Consumers, health insurance and dominated choices.

    Science.gov (United States)

    Sinaiko, Anna D; Hirth, Richard A

    2011-03-01

    We analyze employee health plan choices when the choice set offered by their employer includes a dominated plan. During our study period, one-third of workers were enrolled in the dominated plan. Some may have selected the plan before it was dominated and then failed to switch out of it. However, a substantial number actively chose the dominated plan when they had an unambiguously better choice. These results suggest limitations in the ability of health reform based solely on consumer choice to achieve efficient outcomes and that implementation of health reform should anticipate, monitor and account for this consumer behavior. Copyright © 2011 Elsevier B.V. All rights reserved.

  3. The OGCleaner: filtering false-positive homology clusters.

    Science.gov (United States)

    Fujimoto, M Stanley; Suvorov, Anton; Jensen, Nicholas O; Clement, Mark J; Snell, Quinn; Bybee, Seth M

    2017-01-01

    Detecting homologous sequences in organisms is an essential step in protein structure and function prediction, gene annotation and phylogenetic tree construction. Heuristic methods are often employed for quality control of putative homology clusters. These heuristics, however, usually only apply to pairwise sequence comparison and do not examine clusters as a whole. We present the Orthology Group Cleaner (the OGCleaner), a tool designed for filtering putative orthology groups as homology or non-homology clusters by considering all sequences in a cluster. The OGCleaner relies on high-quality orthologous groups identified in OrthoDB to train machine learning algorithms that are able to distinguish between true-positive and false-positive homology groups. This package aims to improve the quality of phylogenetic tree construction especially in instances of lower-quality transcriptome assemblies. https://github.com/byucsl/ogcleaner CONTACT: sfujimoto@gmail.comSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  4. On dominator colorings in graphs

    Indian Academy of Sciences (India)

    colors required for a dominator coloring of G is called the dominator .... Theorem 1.3 shows that the complete graph Kn is the only connected graph of order n ... Conversely, if a graph G satisfies condition (i) or (ii), it is easy to see that χd(G) =.

  5. Prediction of Protein Structural Classes for Low-Similarity Sequences Based on Consensus Sequence and Segmented PSSM

    Directory of Open Access Journals (Sweden)

    Yunyun Liang

    2015-01-01

    Full Text Available Prediction of protein structural classes for low-similarity sequences is useful for understanding fold patterns, regulation, functions, and interactions of proteins. It is well known that feature extraction is significant to prediction of protein structural class and it mainly uses protein primary sequence, predicted secondary structure sequence, and position-specific scoring matrix (PSSM. Currently, prediction solely based on the PSSM has played a key role in improving the prediction accuracy. In this paper, we propose a novel method called CSP-SegPseP-SegACP by fusing consensus sequence (CS, segmented PsePSSM, and segmented autocovariance transformation (ACT based on PSSM. Three widely used low-similarity datasets (1189, 25PDB, and 640 are adopted in this paper. Then a 700-dimensional (700D feature vector is constructed and the dimension is decreased to 224D by using principal component analysis (PCA. To verify the performance of our method, rigorous jackknife cross-validation tests are performed on 1189, 25PDB, and 640 datasets. Comparison of our results with the existing PSSM-based methods demonstrates that our method achieves the favorable and competitive performance. This will offer an important complementary to other PSSM-based methods for prediction of protein structural classes for low-similarity sequences.

  6. Organic petrological and organic geochemical characterisation of the Tertiary coal-bearing sequence of Batu Arang, Selangor, Malaysia

    Science.gov (United States)

    Wan Hasiah, Abdullah; Abolins, Peter

    1998-08-01

    The Tertiary coal-bearing sequence at Batu Arang in Selangor, Peninsular Malaysia consists of a sandstone-coal-oil shale facies assemblage. A detailed organic petrological and organic geochemical study was carried out on several organic-rich sediments from this sequence. The oil shales are dominated by Botryococcus-derived telalginite and Pediastrum-derived lamalginite. The coals, hypautochthonous in origin, are mainly duroclarite-type, although other minor microlithotypes also occur. Alginite is not observed in the coals, but other liptinitic constituents are very common, particularly thin-walled cutinite and sporinite. The oil shales and the coals are thermally immature. This immaturity has a considerable influence on the biomarker distributions, particularly so on the triterpanes which are dominated by C 31αβ 22R and C 30ββ compounds. Interestingly, for Tertiary aged sediments of continental origin, the diagnostic biomarker compounds such as 18 α(H)-oleanane and bicadinanes, normally linked to the higher land plant group of angiosperms, are not observed in the samples analysed. Tricyclic terpanes occur only in very low relative abundance or are virtually absent. A clear distinction, however, in the biomarker distributions of the shales and the coals/carbargilite can be made based upon the distribution of C 27-C 29 regular steranes: the shales, with a source input being predominantly planktonic algae, are dominated by 5 α(H),14 α(H),17 α(H) 20R cholestane, while the coals/carbargilites, with a source input consisting mainly of higher plant material, are dominated by 5 α(H),14 α(H),17 α(H) 20R ethyl cholestane. The depositional environment of the Batu Arang coal-bearing sequence is interpreted as varying from an alluvial flood plain peat-swamp to fluvio-lacustrine depositional setting.

  7. Dominance of rumen microorganisms during cheese whey acidification: acidogenesis can be governed by a rare Selenomonas lacticifex-type fermentation.

    Science.gov (United States)

    Ntougias, Spyridon; Tsiamis, George; Soultani, Despoina; Melidis, Paraschos

    2015-11-01

    The microbial basis of acidification process during spontaneous cheese whey wastewater fermentation was decrypted by implementing both culture-dependent and culture-independent techniques. Lac tobacillus and Bifidobacterium were the predominant taxa among the microbiota growing on MRS (deMan, Rogosa, and Sharpe), while Kazachstania unispora and Dekkera anomala yeast species were also isolated. Almost all Lactobacillus isolates were heterofermentative that could ferment glucose and lactose, with most of them being related to Lactobacillus hilgardii (99.0-100 % similarity). By employing fluorescence techniques, the dominance of long crescent-shaped bacteria in the acidogenic sludge was observed. Temperature gradient gel electrophoresis (TGGE), clone library, and next-generation sequencing techniques revealed the dominance of Selenomonas lacticifex. Based on Illumina data, Selenomonas in the continuous stirred-tank reactor (CSTR) represented 70.13 ± 4.64 % of the bacterial reads, while other Veillonellaceae taxa (Megasphaera and Pectinatus) represented a notable proportion (6.54 %). Prevotella was only detected by Illumina sequencing as an important constituent of the microbial population (14.97 ± 1.71 %). Budding yeasts represented 97 % of the fungal population in the CSTR, with Yarrowia strains representing 88.85 ± 5.52 % of the fungal reads. Spontaneous cheese whey acidification can favor the dominance of rumen bacteria and here was driven by the rarely reported S. lacticifex-type fermentation, which should be taken into consideration during evaluation of acidogenesis in process simulation and modelling. Moreover, the important nervonic acid content detected indicates that acidogenic sludge can be used as a source for the production of high value-added biomedical substrates.

  8. Correlations of some Neoproterozoic carbonate-dominated successions in South America based on high-resolution chemostratigraphy

    Directory of Open Access Journals (Sweden)

    Alcides Nobrega Sial

    Full Text Available ABSTRACT: This report reviews and incorporates new elemental and isotope chemostratigraphic data for correlation of Neoproterozoic carbonate-dominated successions in South America (Argentina, Bolivia, Brazil, Paraguay and Uruguay. These thick mixed carbonate/siliciclastic successions were largely deposited in epicontinental basins or accumulated on passive margins on the edges of cratons (e.g. São Francisco, Amazonia, Rio Apa Block, Pampia and Río de la Plata paleocontinents during extensional events related to the rifting of the Rodinia Supercontinent. From the stratigraphic point of view, these successions occur as three mega-sequences: glaciogenic, marine carbonate platform (above glaciomarine diamictites or rift successions, and dominantly continental to transitional siliciclastics. In the orogenic belts surrounding cratons, carbonate-dominated successions with important volcanoclastic/siliciclastic contribution have been, in most cases, strongly deformed. The precise ages of these successions remain a matter of debate, but recently new paleontological and geochronological data have considerably constrained depositional intervals. Here, we report high-resolution C, O, Sr, and S isotope trends measured in well-preserved sample sets and mainly use Sr and C isotopes in concert with lithostratigraphic/biostratigraphic observations to provide detailed correlations of these successions. The establishing of a high-level and definite chemostratigraphic correlation between Neoproterozoic basins in South America is the main goal of this work.

  9. Dominance Hierarchies in Young Children

    Science.gov (United States)

    Edelman, Murray S.; Omark, Donald R.

    1973-01-01

    This study uses the ethological approach of seeking species characteristics and phylogenetic continuities in an investigation of human behavior. Among primates a striking consistency is the presence of some form of dominance hierarchy in many species. The present study examines peer group dominance hierarchies as they are perceived by children in…

  10. Reading in Colette: Domination, Resistance, Autonomy

    Directory of Open Access Journals (Sweden)

    Laurel Cummins

    1996-06-01

    Full Text Available The act of reading on the part of Colette's characters reveals itself as a dynamic involving domination and resistance. A study of passages from two of her semi-autobiographical works, La Maison de Claudine and Sido , brings to light both a positively connoted model of reading, exemplified by the character 'Colette,' and a negatively connoted model, exemplified by the older sister Juliette. While Juliette approaches texts with no sense of self, and seeks instead to be defined by the texts she reads, 'Colette' remains in relation to texts and to the discourses they contain, and resists them. Gender complicates the process. Both father and mother intervene in 'Colette's' apprenticeship as reader. While the censorship that constitutes the father's intervention proves both debilitating and disempowering, the mother's modeling of reading as dialogue and resistance empowers 'Colette,' both as a reader and a female being.

  11. Sequence determinants of human microsatellite variability

    Directory of Open Access Journals (Sweden)

    Jakobsson Mattias

    2009-12-01

    Full Text Available Abstract Background Microsatellite loci are frequently used in genomic studies of DNA sequence repeats and in population studies of genetic variability. To investigate the effect of sequence properties of microsatellites on their level of variability we have analyzed genotypes at 627 microsatellite loci in 1,048 worldwide individuals from the HGDP-CEPH cell line panel together with the DNA sequences of these microsatellites in the human RefSeq database. Results Calibrating PCR fragment lengths in individual genotypes by using the RefSeq sequence enabled us to infer repeat number in the HGDP-CEPH dataset and to calculate the mean number of repeats (as opposed to the mean PCR fragment length, under the assumption that differences in PCR fragment length reflect differences in the numbers of repeats in the embedded repeat sequences. We find the mean and maximum numbers of repeats across individuals to be positively correlated with heterozygosity. The size and composition of the repeat unit of a microsatellite are also important factors in predicting heterozygosity, with tetra-nucleotide repeat units high in G/C content leading to higher heterozygosity. Finally, we find that microsatellites containing more separate sets of repeated motifs generally have higher heterozygosity. Conclusions These results suggest that sequence properties of microsatellites have a significant impact in determining the features of human microsatellite variability.

  12. Dominance of sulfur-fueled iron oxide reduction in low-sulfate freshwater sediments.

    Science.gov (United States)

    Hansel, Colleen M; Lentini, Chris J; Tang, Yuanzhi; Johnston, David T; Wankel, Scott D; Jardine, Philip M

    2015-11-01

    A central tenant in microbial biogeochemistry is that microbial metabolisms follow a predictable sequence of terminal electron acceptors based on the energetic yield for the reaction. It is thereby oftentimes assumed that microbial respiration of ferric iron outcompetes sulfate in all but high-sulfate systems, and thus sulfide has little influence on freshwater or terrestrial iron cycling. Observations of sulfate reduction in low-sulfate environments have been attributed to the presumed presence of highly crystalline iron oxides allowing sulfate reduction to be more energetically favored. Here we identified the iron-reducing processes under low-sulfate conditions within columns containing freshwater sediments amended with structurally diverse iron oxides and fermentation products that fuel anaerobic respiration. We show that despite low sulfate concentrations and regardless of iron oxide substrate (ferrihydrite, Al-ferrihydrite, goethite, hematite), sulfidization was a dominant pathway in iron reduction. This process was mediated by (re)cycling of sulfur upon reaction of sulfide and iron oxides to support continued sulfur-based respiration--a cryptic sulfur cycle involving generation and consumption of sulfur intermediates. Although canonical iron respiration was not observed in the sediments amended with the more crystalline iron oxides, iron respiration did become dominant in the presence of ferrihydrite once sulfate was consumed. Thus, despite more favorable energetics, ferrihydrite reduction did not precede sulfate reduction and instead an inverse redox zonation was observed. These findings indicate that sulfur (re)cycling is a dominant force in iron cycling even in low-sulfate systems and in a manner difficult to predict using the classical thermodynamic ladder.

  13. A new method for evaluating forest thinning: growth dominance in managed Pinus resinosa stands

    Science.gov (United States)

    John B. Bradford; Anthony W. D' Amato; Brian J. Palik; Shawn. Fraver

    2010-01-01

    Growth dominance is a relatively new, simple, quantitative metric of within-stand individual tree growth patterns, and is defined as positive when larger trees in the stand display proportionally greater growth than smaller trees, and negative when smaller trees display proportionally greater growth than larger trees. We examined long-term silvicultural experiments in...

  14. Reducing false-positive incidental findings with ensemble genotyping and logistic regression based variant filtering methods.

    Science.gov (United States)

    Hwang, Kyu-Baek; Lee, In-Hee; Park, Jin-Ho; Hambuch, Tina; Choe, Yongjoon; Kim, MinHyeok; Lee, Kyungjoon; Song, Taemin; Neu, Matthew B; Gupta, Neha; Kohane, Isaac S; Green, Robert C; Kong, Sek Won

    2014-08-01

    As whole genome sequencing (WGS) uncovers variants associated with rare and common diseases, an immediate challenge is to minimize false-positive findings due to sequencing and variant calling errors. False positives can be reduced by combining results from orthogonal sequencing methods, but costly. Here, we present variant filtering approaches using logistic regression (LR) and ensemble genotyping to minimize false positives without sacrificing sensitivity. We evaluated the methods using paired WGS datasets of an extended family prepared using two sequencing platforms and a validated set of variants in NA12878. Using LR or ensemble genotyping based filtering, false-negative rates were significantly reduced by 1.1- to 17.8-fold at the same levels of false discovery rates (5.4% for heterozygous and 4.5% for homozygous single nucleotide variants (SNVs); 30.0% for heterozygous and 18.7% for homozygous insertions; 25.2% for heterozygous and 16.6% for homozygous deletions) compared to the filtering based on genotype quality scores. Moreover, ensemble genotyping excluded > 98% (105,080 of 107,167) of false positives while retaining > 95% (897 of 937) of true positives in de novo mutation (DNM) discovery in NA12878, and performed better than a consensus method using two sequencing platforms. Our proposed methods were effective in prioritizing phenotype-associated variants, and an ensemble genotyping would be essential to minimize false-positive DNM candidates. © 2014 WILEY PERIODICALS, INC.

  15. Stem sapwood permeability in relation to crown dominance and site quality in self-thinning fire-origin lodgepole pine stands.

    Science.gov (United States)

    Reid, Douglas E B; Silins, Uldis; Lieffers, Victor J

    2003-08-01

    Stem sapwood hydraulic permeability, tree leaf area, sapwood basal area, earlywood to latewood ratio of annual rings, radial variation in hydraulic permeability and stem hydraulic capacity were examined in dominant (D), codominant (CD) and suppressed (SP) lodgepole pine (Pinus contorta Dougl. ex Loud.) trees growing on medium and poor sites. Hydraulic permeability on a sapwood area basis (ks) was lower in suppressed trees (0.71 x 10(-12) m2) compared to dominants (1.97 x 10(-12) m2) and codominants (1.79 x 10(-12) m2), and higher on medium than on poor sites. The leaf/sapwood area ratio (S) varied with crown dominance position (D > CD > SP) but not by site type. Leaf specific conductivity (kL) did not vary between crown classes or site types. The relationship between leaf area and stem hydraulic supply capacity (Q*) was strong, but differed among crown classes. Dominant trees and trees from the medium sites had a greater proportion of earlywood in outer rings of sapwood than suppressed trees. Sapwood permeability declined from the cambium to the sapwood-heartwood boundary in all samples, but the decline was more gradual in dominant trees compared to codominant and suppressed trees; differences in the radial variation in sapwood permeability may be related to differences in S. Sapwood permeability is positively related to crown dominance, whereas subdominant (CD and SP) trees have greater Q* in relation to leaf area, leading us to propose that this may give subdominant trees a survival advantage, slowing self-thinning.

  16. A Boundary Property for Upper Domination

    KAUST Repository

    AbouEisha, Hassan M.

    2016-08-08

    An upper dominating set in a graph is a minimal (with respect to set inclusion) dominating set of maximum cardinality.The problem of finding an upper dominating set is generally NP-hard, but can be solved in polynomial time in some restricted graph classes, such as P4-free graphs or 2K2-free graphs.For classes defined by finitely many forbidden induced subgraphs, the boundary separating difficult instances of the problem from polynomially solvable ones consists of the so called boundary classes.However, none of such classes has been identified so far for the upper dominating set problem.In the present paper, we discover the first boundary class for this problem.

  17. Positions in doctors' questions during psychiatric interviews.

    Science.gov (United States)

    Ziółkowska, Justyna

    2009-11-01

    In this article I apply the concept of positioning to the analysis of 15 initial psychiatric interviews. I argue that through their questions the psychiatrists-in-training impose positions requiring the patients to gaze at themselves and their actual problems from particular perspectives. I point to three such positions: (a) the position of the observing assessor, from which it is expected that the patients will make a detached assessment of themselves or their problems, (b) the position of the informing witness, which requires the patients only to verify the information about themselves, and (c) the marginal one, the position of the experiencing narrator, from which talk about experiences and problems is expected. I explore the roots and consequences of the positions, with particular attention toward objectivization of the patients' experiences in the dominant witness and assessor positions. I conclude with a discussion about the medical model in psychiatry.

  18. High-fidelity target sequencing of individual molecules identified using barcode sequences: de novo detection and absolute quantitation of mutations in plasma cell-free DNA from cancer patients.

    Science.gov (United States)

    Kukita, Yoji; Matoba, Ryo; Uchida, Junji; Hamakawa, Takuya; Doki, Yuichiro; Imamura, Fumio; Kato, Kikuya

    2015-08-01

    Circulating tumour DNA (ctDNA) is an emerging field of cancer research. However, current ctDNA analysis is usually restricted to one or a few mutation sites due to technical limitations. In the case of massively parallel DNA sequencers, the number of false positives caused by a high read error rate is a major problem. In addition, the final sequence reads do not represent the original DNA population due to the global amplification step during the template preparation. We established a high-fidelity target sequencing system of individual molecules identified in plasma cell-free DNA using barcode sequences; this system consists of the following two steps. (i) A novel target sequencing method that adds barcode sequences by adaptor ligation. This method uses linear amplification to eliminate the errors introduced during the early cycles of polymerase chain reaction. (ii) The monitoring and removal of erroneous barcode tags. This process involves the identification of individual molecules that have been sequenced and for which the number of mutations have been absolute quantitated. Using plasma cell-free DNA from patients with gastric or lung cancer, we demonstrated that the system achieved near complete elimination of false positives and enabled de novo detection and absolute quantitation of mutations in plasma cell-free DNA. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  19. Sequence of a cloned cDNA encoding human ribosomal protein S11

    Energy Technology Data Exchange (ETDEWEB)

    Lott, J B; Mackie, G A

    1988-02-11

    The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.

  20. Comparison of Plantar Pressure Distribution in Dominant & Non-dominant leg of female Kata and Kumite National Team

    Directory of Open Access Journals (Sweden)

    Elnaz Dizaji

    2016-09-01

    Full Text Available Objective: The aim of this study was to compare the plantar pressure distribution of dominant and non-dominant legs of females who were participated in the kata and kumite national team. Methods: Twelve kumite and 8 kata female athletes of the Karate national team participated in this study. Plantar pressure was measured using emed platform during barefoot walking. After dividing the foot into 10 masks, peak pressure, pressure-time integral, maximum force and force-time integral were calculated. Wilcoxon and U-Mann-Witney tests were used to analyze parameters at a significance level of p ≤ 0.05. Results: In comparison of kata and kumite teams it was found that, kata plantar pressure parameters in Metatarsal-2 (p=0.05 and Metatarsals-3, 4, 5 (p=0.04 were significantly less than those in kumite. Also, in comparison of dominant and non-dominant leg, plantar pressure parameters of dominant leg were less in Metatarsal-2 (p=0.04 and more in Bigtoe (p=0.04 and Toes-3, 4, 5 (p=0.03 than those in the non-dominant leg. Conclusion: Results may be indicative different of natures of the two athletic fields in that Kumite has a higher impact on plantar pressure due to higher mechanical loads. Furthermore, the unequal use of the legs may affect plantar pressure because of leg dominance. Thus, further and more comprehensive studies are necessary to prevent exercise-induced adaptations in professional levels and their treatments.

  1. Experimental assessment of the importance of amino acid positions identified by an entropy-based correlation analysis of multiple-sequence alignments.

    Science.gov (United States)

    Dietrich, Susanne; Borst, Nadine; Schlee, Sandra; Schneider, Daniel; Janda, Jan-Oliver; Sterner, Reinhard; Merkl, Rainer

    2012-07-17

    The analysis of a multiple-sequence alignment (MSA) with correlation methods identifies pairs of residue positions whose occupation with amino acids changes in a concerted manner. It is plausible to assume that positions that are part of many such correlation pairs are important for protein function or stability. We have used the algorithm H2r to identify positions k in the MSAs of the enzymes anthranilate phosphoribosyl transferase (AnPRT) and indole-3-glycerol phosphate synthase (IGPS) that show a high conn(k) value, i.e., a large number of significant correlations in which k is involved. The importance of the identified residues was experimentally validated by performing mutagenesis studies with sAnPRT and sIGPS from the archaeon Sulfolobus solfataricus. For sAnPRT, five H2r mutant proteins were generated by replacing nonconserved residues with alanine or the prevalent residue of the MSA. As a control, five residues with conn(k) values of zero were chosen randomly and replaced with alanine. The catalytic activities and conformational stabilities of the H2r and control mutant proteins were analyzed by steady-state enzyme kinetics and thermal unfolding studies. Compared to wild-type sAnPRT, the catalytic efficiencies (k(cat)/K(M)) were largely unaltered. In contrast, the apparent thermal unfolding temperature (T(M)(app)) was lowered in most proteins. Remarkably, the strongest observed destabilization (ΔT(M)(app) = 14 °C) was caused by the V284A exchange, which pertains to the position with the highest correlation signal [conn(k) = 11]. For sIGPS, six H2r mutant and four control proteins with alanine exchanges were generated and characterized. The k(cat)/K(M) values of four H2r mutant proteins were reduced between 13- and 120-fold, and their T(M)(app) values were decreased by up to 5 °C. For the sIGPS control proteins, the observed activity and stability decreases were much less severe. Our findings demonstrate that positions with high conn(k) values have an

  2. Value Positions in E-government strategies

    DEFF Research Database (Denmark)

    Persson, John Stouby; Reinwald, Anja Kaldahl; Skorve, Espen

    2017-01-01

    by value positions deeply enshrined in the traditions of public administration. We present a theory directed con-tent analysis of value positions in the national e-government strategy for Denmark published for the first time in 1994 and latest in 2016. Our comparison of the value positions in the two e......-government strategies show consistency over time when looking at the ideals of professionalism, service, and efficiency. While the least dominant ideal of engagement, has declined. The 22-year timespan separating the development of these two strategies had major technological advances, but little transformational...... impact on Danish e-government strategies in their general value positions. We discuss how our findings contribute to previous research on values in e-government and have practical implications for working with e-government strategies....

  3. Creep to inertia dominated stick-slip behavior in sliding friction modulated by tilted non-uniform loading

    Science.gov (United States)

    Tian, Pengyi; Tao, Dashuai; Yin, Wei; Zhang, Xiangjun; Meng, Yonggang; Tian, Yu

    2016-09-01

    Comprehension of stick-slip motion is very important for understanding tribological principles. The transition from creep-dominated to inertia-dominated stick-slip as the increase of sliding velocity has been described by researchers. However, the associated micro-contact behavior during this transition has not been fully disclosed yet. In this study, we investigated the stick-slip behaviors of two polymethyl methacrylate blocks actively modulated from the creep-dominated to inertia-dominated dynamics through a non-uniform loading along the interface by slightly tilting the angle of the two blocks. Increasing the tilt angle increases the critical transition velocity from creep-dominated to inertia-dominated stick-slip behaviors. Results from finite element simulation disclosed that a positive tilt angle led to a higher normal stress and a higher temperature on blocks at the opposite side of the crack initiating edge, which enhanced the creep of asperities during sliding friction. Acoustic emission (AE) during the stick-slip has also been measured, which is closely related to the different rupture modes regulated by the distribution of the ratio of shear to normal stress along the sliding interface. This study provided a more comprehensive understanding of the effect of tilted non-uniform loading on the local stress ratio, the local temperature, and the stick-slip behaviors.

  4. Statistical convergence of a non-positive approximation process

    International Nuclear Information System (INIS)

    Agratini, Octavian

    2011-01-01

    Highlights: → A general class of approximation processes is introduced. → The A-statistical convergence is studied. → Applications in quantum calculus are delivered. - Abstract: Starting from a general sequence of linear and positive operators of discrete type, we associate its r-th order generalization. This construction involves high order derivatives of a signal and it looses the positivity property. Considering that the initial approximation process is A-statistically uniform convergent, we prove that the property is inherited by the new sequence. Also, our result includes information about the uniform convergence. Two applications in q-Calculus are presented. We study q-analogues both of Meyer-Koenig and Zeller operators and Stancu operators.

  5. Denitrifying bacteria from the genus Rhodanobacter dominate bacterial communities in the highly contaminated subsurface of a nuclear legacy waste site.

    Science.gov (United States)

    Green, Stefan J; Prakash, Om; Jasrotia, Puja; Overholt, Will A; Cardenas, Erick; Hubbard, Daniela; Tiedje, James M; Watson, David B; Schadt, Christopher W; Brooks, Scott C; Kostka, Joel E

    2012-02-01

    The effect of long-term mixed-waste contamination, particularly uranium and nitrate, on the microbial community in the terrestrial subsurface was investigated at the field scale at the Oak Ridge Integrated Field Research Challenge (ORIFRC) site in Oak Ridge, TN. The abundance, community composition, and distribution of groundwater microorganisms were examined across the site during two seasonal sampling events. At representative locations, subsurface sediment was also examined from two boreholes, one sampled from the most heavily contaminated area of the site and another from an area with low contamination. A suite of DNA- and RNA-based molecular tools were employed for community characterization, including quantitative PCR of rRNA and nitrite reductase genes, community composition fingerprinting analysis, and high-throughput pyrotag sequencing of rRNA genes. The results demonstrate that pH is a major driver of the subsurface microbial community structure and that denitrifying bacteria from the genus Rhodanobacter (class Gammaproteobacteria) dominate at low pH. The relative abundance of bacteria from this genus was positively correlated with lower-pH conditions, and these bacteria were abundant and active in the most highly contaminated areas. Other factors, such as the concentration of nitrogen species, oxygen level, and sampling season, did not appear to strongly influence the distribution of Rhodanobacter bacteria. The results indicate that these organisms are acid-tolerant denitrifiers, well suited to the acidic, nitrate-rich subsurface conditions, and pH is confirmed as a dominant driver of bacterial community structure in this contaminated subsurface environment.

  6. New scoring schema for finding motifs in DNA Sequences

    Directory of Open Access Journals (Sweden)

    Nowzari-Dalini Abbas

    2009-03-01

    Full Text Available Abstract Background Pattern discovery in DNA sequences is one of the most fundamental problems in molecular biology with important applications in finding regulatory signals and transcription factor binding sites. An important task in this problem is to search (or predict known binding sites in a new DNA sequence. For this reason, all subsequences of the given DNA sequence are scored based on an scoring function and the prediction is done by selecting the best score. By assuming no dependency between binding site base positions, most of the available tools for known binding site prediction are designed. Recently Tomovic and Oakeley investigated the statistical basis for either a claim of dependence or independence, to determine whether such a claim is generally true, and they presented a scoring function for binding site prediction based on the dependency between binding site base positions. Our primary objective is to investigate the scoring functions which can be used in known binding site prediction based on the assumption of dependency or independency in binding site base positions. Results We propose a new scoring function based on the dependency between all positions in biding site base positions. This scoring function uses joint information content and mutual information as a measure of dependency between positions in transcription factor binding site. Our method for modeling dependencies is simply an extension of position independency methods. We evaluate our new scoring function on the real data sets extracted from JASPAR and TRANSFAC data bases, and compare the obtained results with two other well known scoring functions. Conclusion The results demonstrate that the new approach improves known binding site discovery and show that the joint information content and mutual information provide a better and more general criterion to investigate the relationships between positions in the TFBS. Our scoring function is formulated by simple

  7. Second generation sequencing of the mesothelioma tumor genome.

    Directory of Open Access Journals (Sweden)

    Raphael Bueno

    2010-05-01

    Full Text Available The current paradigm for elucidating the molecular etiology of cancers relies on the interrogation of small numbers of genes, which limits the scope of investigation. Emerging second-generation massively parallel DNA sequencing technologies have enabled more precise definition of the cancer genome on a global scale. We examined the genome of a human primary malignant pleural mesothelioma (MPM tumor and matched normal tissue by using a combination of sequencing-by-synthesis and pyrosequencing methodologies to a 9.6X depth of coverage. Read density analysis uncovered significant aneuploidy and numerous rearrangements. Method-dependent informatics rules, which combined the results of different sequencing platforms, were developed to identify and validate candidate mutations of multiple types. Many more tumor-specific rearrangements than point mutations were uncovered at this depth of sequencing, resulting in novel, large-scale, inter- and intra-chromosomal deletions, inversions, and translocations. Nearly all candidate point mutations appeared to be previously unknown SNPs. Thirty tumor-specific fusions/translocations were independently validated with PCR and Sanger sequencing. Of these, 15 represented disrupted gene-encoding regions, including kinases, transcription factors, and growth factors. One large deletion in DPP10 resulted in altered transcription and expression of DPP10 transcripts in a set of 53 additional MPM tumors correlated with survival. Additionally, three point mutations were observed in the coding regions of NKX6-2, a transcription regulator, and NFRKB, a DNA-binding protein involved in modulating NFKB1. Several regions containing genes such as PCBD2 and DHFR, which are involved in growth factor signaling and nucleotide synthesis, respectively, were selectively amplified in the tumor. Second-generation sequencing uncovered all types of mutations in this MPM tumor, with DNA rearrangements representing the dominant type.

  8. Hypothalamic digoxin, hemispheric chemical dominance, and eating behavior.

    Science.gov (United States)

    Kurup, Ravi Kumar; Kurup, Parameswara Achutha

    2003-08-01

    The isoprenoid pathway produces an endogenous membrane Na+-K+ ATPase inhibitor, digoxin, which can regulate neurotransmitter and amino acid transport. Digoxin synthesis and neurotransmitter patterns were assessed in eating disorders. The patterns were compared in those with right hemispheric and left hemispheric dominance. The serum HMG CoA reductase activity, RBC membrane Na+-K+ ATPase activity, serum digoxin, magnesium, tryptophan catabolites (serotonin, quinolinic acid, strychnine, and nicotine), and tyrosine catabolites (morphine, dopamine, and noradrenaline) were measured in anorexia nervosa, bulimia nervosa, right hemispheric dominant, left hemispheric dominant, and bihemispheric dominant individuals. Digoxin synthesis was increased with upregulated tryptophan catabolism and downregulated tyrosine catabolism in those with anorexia nervosa and right hemispheric chemical dominance. Digoxin synthesis was reduced with downregulated tryptophan catabolism and upregulated tyrosine catabolism in those with bulimia nervosa and left hemispheric chemical dominance. The membrane Na+-K+ ATPase activity and serum magnesium were decreased in anorexia nervosa and right hemispheric chemical dominance while they were increased in bulimia nervosa and left hemispheric chemical dominance. Hypothalamic digoxin and hemispheric chemical dominance play a central role in the regulation of eating behavior. Anorexia nervosa represents the right hemispheric chemically dominant/hyperdigoxinemic state and bulimia nervosa the left hemispheric chemically dominant/hypodigoxinemic state.

  9. Determinants of self-esteem in early psychosis: The role of perceived social dominance.

    Science.gov (United States)

    MacDougall, Arlene G; Vandermeer, Matthew R J; Norman, Ross M G

    2017-12-01

    Self-esteem plays a role in the formation and maintenance of symptoms and in the recovery from psychotic illness. This study examines the relative contribution of perceived social dominance and other known predictors in determining self-esteem in 102 individuals in an early intervention program for psychosis. Regression analysis demonstrated that scores on the Perceived Relational Evaluation Scale (PRES), depressed mood, social dominance, gender and positive symptoms significantly contributed to the prediction of scores on the Rosenberg Self-esteem Scale (RSES), whereas self-stigma and negative symptoms did not. Our study suggests that low self-esteem in early psychosis can be understood in part as a reflection of low levels of perceived social value and status. Copyright © 2017 Elsevier Ireland Ltd. All rights reserved.

  10. Human pro. cap alpha. 1(III) collagen: cDNA sequence for the 3' end

    Energy Technology Data Exchange (ETDEWEB)

    Mankoo, B S; Dalgleish, R

    1988-03-25

    The authors have previously isolated two overlapping cDNA clones, pIII-21 and pIII-33, which encode the C-terminal end of human type III procollagen. They now present the sequence of 2520 bases encoded in these cDNAs which overlaps other previously published sequences for the same gene. The sequence presented differs from previously published sequences at five positions.

  11. Benign and Deleterious Cystic Fibrosis Transmembrane Conductance Regulator Mutations Identified by Sequencing in Positive Cystic Fibrosis Newborn Screen Children from California.

    Science.gov (United States)

    Salinas, Danieli B; Sosnay, Patrick R; Azen, Colleen; Young, Suzanne; Raraigh, Karen S; Keens, Thomas G; Kharrazi, Martin

    2016-01-01

    Of the 2007 Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) mutations, 202 have been assigned disease liability. California's racially diverse population, along with CFTR sequencing as part of newborn screening model, provides the opportunity to examine the phenotypes of children with uncategorized mutations to help inform disease liability and penetrance. We conducted a retrospective cohort study based on children screened from 2007 to 2011 and followed for two to six years. Newborns that screened positive were divided into three genotype groups: those with two CF-causing mutations (CF-C); those with one mutation of varying clinic consequence (VCC); and those with one mutation of unknown disease liability (Unknown). Sweat chloride tests, pancreatic sufficiency status, and Pseudomonas aeruginosa colonization were compared. Children with two CF-causing mutations had a classical CF phenotype, while 5% of VCC (4/78) and 11% of Unknown (27/244) met diagnostic criteria of CF. Children carrying Unknown mutations 2215insG with D836Y, and T1036N had early and classical CF phenotype, while others carrying 1525-42G>A, L320V, L967S, R170H, and 296+28A>G had a benign clinical presentation, suggesting that these are non-CF causing. While most infants with VCC and Unknown CFTR mutations do not meet diagnostic criteria for CF, a small proportion do. These findings highlight the range of genotypes and phenotypes in the first few years of life following CF newborn screening when CFTR sequencing is performed.

  12. Nursing Student Perceptions Regarding Simulation Experience Sequencing.

    Science.gov (United States)

    Woda, Aimee A; Gruenke, Theresa; Alt-Gehrman, Penny; Hansen, Jamie

    2016-09-01

    The use of simulated learning experiences (SLEs) have increased within nursing curricula with positive learning outcomes for nursing students. The purpose of this study is to explore nursing students' perceptions of their clinical decision making (CDM) related to the block sequencing of different patient care experiences, SLEs versus hospital-based learning experiences (HLEs). A qualitative descriptive design used open-ended survey questions to generate information about the block sequencing of SLEs and its impact on nursing students' perceived CDM. Three themes emerged from the data: Preexperience Anxiety, Real-Time Decision Making, and Increased Patient Care Experiences. Nursing students identified that having SLEs prior to HLEs provided several benefits. Even when students preferred SLEs prior to HLEs, the sequence did not impact their CDM. This suggests that alternating block sequencing can be used without impacting the students' perceptions of their ability to make decisions. [J Nurs Educ. 2016;55(9):528-532.]. Copyright 2016, SLACK Incorporated.

  13. Multiple aspects of ATP-dependent nucleosome translocation by RSC and Mi-2 are directed by the underlying DNA sequence.

    Directory of Open Access Journals (Sweden)

    Joke J F A van Vugt

    Full Text Available BACKGROUND: Chromosome structure, DNA metabolic processes and cell type identity can all be affected by changing the positions of nucleosomes along chromosomal DNA, a reaction that is catalysed by SNF2-type ATP-driven chromatin remodelers. Recently it was suggested that in vivo, more than 50% of the nucleosome positions can be predicted simply by DNA sequence, especially within promoter regions. This seemingly contrasts with remodeler induced nucleosome mobility. The ability of remodeling enzymes to mobilise nucleosomes over short DNA distances is well documented. However, the nucleosome translocation processivity along DNA remains elusive. Furthermore, it is unknown what determines the initial direction of movement and how new nucleosome positions are adopted. METHODOLOGY/PRINCIPAL FINDINGS: We have used AFM imaging and high resolution PAGE of mononucleosomes on 600 and 2500 bp DNA molecules to analyze ATP-dependent nucleosome repositioning by native and recombinant SNF2-type enzymes. We report that the underlying DNA sequence can control the initial direction of translocation, translocation distance, as well as the new positions adopted by nucleosomes upon enzymatic mobilization. Within a strong nucleosomal positioning sequence both recombinant Drosophila Mi-2 (CHD-type and native RSC from yeast (SWI/SNF-type repositioned the nucleosome at 10 bp intervals, which are intrinsic to the positioning sequence. Furthermore, RSC-catalyzed nucleosome translocation was noticeably more efficient when beyond the influence of this sequence. Interestingly, under limiting ATP conditions RSC preferred to position the nucleosome with 20 bp intervals within the positioning sequence, suggesting that native RSC preferentially translocates nucleosomes with 15 to 25 bp DNA steps. CONCLUSIONS/SIGNIFICANCE: Nucleosome repositioning thus appears to be influenced by both remodeler intrinsic and DNA sequence specific properties that interplay to define ATPase

  14. Position dependent mismatch discrimination on DNA microarrays – experiments and model

    Directory of Open Access Journals (Sweden)

    Michel Wolfgang

    2008-12-01

    Full Text Available Abstract Background The propensity of oligonucleotide strands to form stable duplexes with complementary sequences is fundamental to a variety of biological and biotechnological processes as various as microRNA signalling, microarray hybridization and PCR. Yet our understanding of oligonucleotide hybridization, in particular in presence of surfaces, is rather limited. Here we use oligonucleotide microarrays made in-house by optically controlled DNA synthesis to produce probe sets comprising all possible single base mismatches and base bulges for each of 20 sequence motifs under study. Results We observe that mismatch discrimination is mostly determined by the defect position (relative to the duplex ends as well as by the sequence context. We investigate the thermodynamics of the oligonucleotide duplexes on the basis of double-ended molecular zipper. Theoretical predictions of defect positional influence as well as long range sequence influence agree well with the experimental results. Conclusion Molecular zipping at thermodynamic equilibrium explains the binding affinity of mismatched DNA duplexes on microarrays well. The position dependent nearest neighbor model (PDNN can be inferred from it. Quantitative understanding of microarray experiments from first principles is in reach.

  15. Cyanobacteria dominance influences resource use efficiency and community turnover in phytoplankton and zooplankton communities.

    Science.gov (United States)

    Filstrup, Christopher T; Hillebrand, Helmut; Heathcote, Adam J; Harpole, W Stanley; Downing, John A

    2014-04-01

    Freshwater biodiversity loss potentially disrupts ecosystem services related to water quality and may negatively impact ecosystem functioning and temporal community turnover. We analysed a data set containing phytoplankton and zooplankton community data from 131 lakes through 9 years in an agricultural region to test predictions that plankton communities with low biodiversity are less efficient in their use of limiting resources and display greater community turnover (measured as community dissimilarity). Phytoplankton resource use efficiency (RUE = biomass per unit resource) was negatively related to phytoplankton evenness (measured as Pielou's evenness), whereas zooplankton RUE was positively related to phytoplankton evenness. Phytoplankton and zooplankton RUE were high and low, respectively, when Cyanobacteria, especially Microcystis sp., dominated. Phytoplankton communities displayed slower community turnover rates when dominated by few genera. Our findings, which counter findings of many terrestrial studies, suggest that Cyanobacteria dominance may play important roles in ecosystem functioning and community turnover in nutrient-enriched lakes. © 2014 John Wiley & Sons Ltd/CNRS.

  16. AlignMe—a membrane protein sequence alignment web server

    Science.gov (United States)

    Stamm, Marcus; Staritzbichler, René; Khafizov, Kamil; Forrest, Lucy R.

    2014-01-01

    We present a web server for pair-wise alignment of membrane protein sequences, using the program AlignMe. The server makes available two operational modes of AlignMe: (i) sequence to sequence alignment, taking two sequences in fasta format as input, combining information about each sequence from multiple sources and producing a pair-wise alignment (PW mode); and (ii) alignment of two multiple sequence alignments to create family-averaged hydropathy profile alignments (HP mode). For the PW sequence alignment mode, four different optimized parameter sets are provided, each suited to pairs of sequences with a specific similarity level. These settings utilize different types of inputs: (position-specific) substitution matrices, secondary structure predictions and transmembrane propensities from transmembrane predictions or hydrophobicity scales. In the second (HP) mode, each input multiple sequence alignment is converted into a hydrophobicity profile averaged over the provided set of sequence homologs; the two profiles are then aligned. The HP mode enables qualitative comparison of transmembrane topologies (and therefore potentially of 3D folds) of two membrane proteins, which can be useful if the proteins have low sequence similarity. In summary, the AlignMe web server provides user-friendly access to a set of tools for analysis and comparison of membrane protein sequences. Access is available at http://www.bioinfo.mpg.de/AlignMe PMID:24753425

  17. Leaf economics spectrum-productivity relationships in intensively grazed pastures depend on dominant species identity.

    Science.gov (United States)

    Mason, Norman W H; Orwin, Kate; Lambie, Suzanne; Woodward, Sharon L; McCready, Tiffany; Mudge, Paul

    2016-05-01

    Plant functional traits are thought to drive variation in primary productivity. However, there is a lack of work examining how dominant species identity affects trait-productivity relationships. The productivity of 12 pasture mixtures was determined in a 3-year field experiment. The mixtures were based on either the winter-active ryegrass (Lolium perenne) or winter-dormant tall fescue (Festuca arundinacea). Different mixtures were obtained by adding forb, legume, and grass species that differ in key leaf economics spectrum (LES) traits to the basic two-species dominant grass-white clover (Trifolium repens) mixtures. We tested for correlations between community-weighted mean (CWM) trait values, functional diversity, and productivity across all plots and within those based on either ryegrass or tall fescue. The winter-dormant forb species (chicory and plantain) had leaf traits consistent with high relative growth rates both per unit leaf area (high leaf thickness) and per unit leaf dry weight (low leaf dry matter content). Together, the two forb species achieved reasonable abundance when grown with either base grass (means of 36% and 53% of total biomass, respectively, with ryegrass tall fescue), but they competed much more strongly with tall fescue than with ryegrass. Consequently, they had a net negative impact on productivity when grown with tall fescue, and a net positive effect when grown with ryegrass. Strongly significant relationships between productivity and CWM values for LES traits were observed across ryegrass-based mixtures, but not across tall fescue-based mixtures. Functional diversity did not have a significant positive effect on productivity for any of the traits. The results show dominant species identity can strongly modify trait-productivity relationships in intensively grazed pastures. This was due to differences in the intensity of competition between dominant species and additional species, suggesting that resource-use complementarity is a

  18. On a conjecture about inverse domination in graphs

    DEFF Research Database (Denmark)

    Frendrup, Allan; Henning, Michael A.; Randerath, Bert

    Let G = (V,E) be a graph with no isolated vertex. A classical observation in domination theory is that if D is a minimum dominating set of G, then V \\D is also a dominating set of G. A set D′ is an inverse dominating set of G if D′ is a dominating set of G and D′ ⊆ V \\D for some minimum dominatin...

  19. Expressed sequence tags as a tool for phylogenetic analysis of placental mammal evolution.

    Directory of Open Access Journals (Sweden)

    Morgan Kullberg

    Full Text Available BACKGROUND: We investigate the usefulness of expressed sequence tags, ESTs, for establishing divergences within the tree of placental mammals. This is done on the example of the established relationships among primates (human, lagomorphs (rabbit, rodents (rat and mouse, artiodactyls (cow, carnivorans (dog and proboscideans (elephant. METHODOLOGY/PRINCIPAL FINDINGS: We have produced 2000 ESTs (1.2 mega bases from a marsupial mouse and characterized the data for their use in phylogenetic analysis. The sequences were used to identify putative orthologous sequences from whole genome projects. Although most ESTs stem from single sequence reads, the frequency of potential sequencing errors was found to be lower than allelic variation. Most of the sequences represented slowly evolving housekeeping-type genes, with an average amino acid distance of 6.6% between human and mouse. Positive Darwinian selection was identified at only a few single sites. Phylogenetic analyses of the EST data yielded trees that were consistent with those established from whole genome projects. CONCLUSIONS: The general quality of EST sequences and the general absence of positive selection in these sequences make ESTs an attractive tool for phylogenetic analysis. The EST approach allows, at reasonable costs, a fast extension of data sampling from species outside the genome projects.

  20. Directional dominance on stature and cognition in diverse human populations

    DEFF Research Database (Denmark)

    Joshi, Peter K; Esko, Tonu; Mattsson, Hannele

    2015-01-01

    is predicted for traits under directional evolutionary selection, this study provides evidence that increased stature and cognitive function have been positively selected in human evolution, whereas many important risk factors for late-onset complex diseases may not have been....... confounding, directly contributes to phenotypic variance. Contrary to earlier reports in substantially smaller samples, no evidence was seen of an influence of genome-wide homozygosity on blood pressure and low density lipoprotein cholesterol, or ten other cardio-metabolic traits. Since directional dominance...

  1. Indirect genetics effects and evolutionary constraint: an analysis of social dominance in red deer, Cervus elaphus.

    Science.gov (United States)

    Wilson, A J; Morrissey, M B; Adams, M J; Walling, C A; Guinness, F E; Pemberton, J M; Clutton-Brock, T H; Kruuk, L E B

    2011-04-01

    By determining access to limited resources, social dominance is often an important determinant of fitness. Thus, if heritable, standard theory predicts mean dominance should evolve. However, dominance is usually inferred from the tendency to win contests, and given one winner and one loser in any dyadic contest, the mean proportion won will always equal 0.5. Here, we argue that the apparent conflict between quantitative genetic theory and common sense is resolved by recognition of indirect genetic effects (IGEs). We estimate selection on, and genetic (co)variance structures for, social dominance, in a wild population of red deer Cervus elaphus, on the Scottish island of Rum. While dominance is heritable and positively correlated with lifetime fitness, contest outcomes depend as much on the genes carried by an opponent as on the genotype of a focal individual. We show how this dependency imposes an absolute evolutionary constraint on the phenotypic mean, thus reconciling theoretical predictions with common sense. More generally, we argue that IGEs likely provide a widespread but poorly recognized source of evolutionary constraint for traits influenced by competition. © 2011 The Authors. Journal of Evolutionary Biology © 2011 European Society For Evolutionary Biology.

  2. Identification of Novel Recombinant Forms of Hepatitis B Virus Generated from Genotypes Ae and G in HIV-1-Positive Japanese Men Who Have Sex with Men.

    Science.gov (United States)

    Kojima, Yoko; Kawahata, Takuya; Mori, Haruyo; Furubayashi, Keiichi; Taniguchi, Yasushi; Itoda, Ichiro; Komano, Jun

    2015-07-01

    The rare hepatitis B virus (HBV) genotype G (HBV/G) coinfects HIV-1-positive individuals along with HBV/A and generates recombinants. However, the circulation of HBV A/G recombinants remains poorly understood. This molecular epidemiologic study examined HBV A/G recombinants in Japanese HIV-1-positive men who have sex with men (MSM). Initially, blood specimens submitted for confirmatory tests of HIV infection in Osaka and Tokyo, Japan, from 2006 to 2013 were examined for HIV-1, and HIV-1-positive specimens were screened for HBV. Among 817 specimens from HIV-1-positive individuals, HBsAg was detected in 59 specimens; of these, HBV/Ae (alternatively A2), a subgenotype of HBV/A prevalent in Europe and North America, was identified in 70.2%, HBV/C in 17.5%, and HBV/G in 10.5%, and HBV/E in 1.8% according to the core gene sequence. The full-length genome analysis of HBV was performed on HBV/G-positive specimens because some HBV A/G recombinants were historically overlooked by genotyping based on a partial genome analysis. It revealed that five of the specimens contained novel Ae/G recombinants, the core gene of which had a high sequence similarity to HBV/G. Detailed analyses showed that novel recombinants were coinfected with HBV/Ae in a recombinant-dominant fashion. No major drug-resistant mutations were found in the newly identified HBV Ae/G recombinants. Some of the individuals asymptomatically coinfected with HIV/HBV suffered mild liver injury. This study demonstrated that novel Ae/G HBV recombinants were identified in Japanese HIV-1-positive MSM. The pathogenicity of novel HBV Ae/G recombinants should be examined in a future longitudinal study. Surveillance of such viruses in HIV-1-positive individuals should be emphasized.

  3. Dominant drivers of business students

    Directory of Open Access Journals (Sweden)

    Radu Cătălina

    2017-07-01

    Full Text Available Taibi Kahler wrote in 1974 a theory about five main drivers that could explain people’s motivation and a series of positive and negative behavior patterns: Be Strong, Be Perfect, Hurry Up, Try Hard and Please People. Of course, we consider there is no absolute positive or negative behavior, since (1 everything needs to be analyzed by taking into account the context and (2 any behavior pattern can mean a series of advantages as long as people understand their own values, beliefs, attitudes and behaviors. It would be interesting to link Kahler’s drivers to the educational process, in order to be able to adapt our courses and our teaching styles to students’ requirements and also to the requirements in the labor market. Our paper is built on literature review and a questionnaire applied to a sample of 607 students in Bucharest University of Economic Studies, Romania. Information was processed with Microsoft Excel 2013, in order to look at the main working styles our students have, at the main explanations for the differences between them and in order to test a series of hypotheses. We were interested to look at the main traits of the current generation of students in our university: dominant drivers, roles of managers and specialists, the attractiveness of the entrepreneurial career path, etc. and at a series of patterns (i.e. gender-related differences. We consider results of this study are useful both for teaching and research purposes. In terms of teaching, we plan to adapt our educational methods in order to improve the educational process.

  4. Exploring evidence of positive selection reveals genetic basis of meat quality traits in Berkshire pigs through whole genome sequencing.

    Science.gov (United States)

    Jeong, Hyeonsoo; Song, Ki-Duk; Seo, Minseok; Caetano-Anollés, Kelsey; Kim, Jaemin; Kwak, Woori; Oh, Jae-Don; Kim, EuiSoo; Jeong, Dong Kee; Cho, Seoae; Kim, Heebal; Lee, Hak-Kyo

    2015-08-20

    Natural and artificial selection following domestication has led to the existence of more than a hundred pig breeds, as well as incredible variation in phenotypic traits. Berkshire pigs are regarded as having superior meat quality compared to other breeds. As the meat production industry seeks selective breeding approaches to improve profitable traits such as meat quality, information about genetic determinants of these traits is in high demand. However, most of the studies have been performed using trained sensory panel analysis without investigating the underlying genetic factors. Here we investigate the relationship between genomic composition and this phenotypic trait by scanning for signatures of positive selection in whole-genome sequencing data. We generated genomes of 10 Berkshire pigs at a total of 100.6 coverage depth, using the Illumina Hiseq2000 platform. Along with the genomes of 11 Landrace and 13 Yorkshire pigs, we identified genomic variants of 18.9 million SNVs and 3.4 million Indels in the mapped regions. We identified several associated genes related to lipid metabolism, intramuscular fatty acid deposition, and muscle fiber type which attribute to pork quality (TG, FABP1, AKIRIN2, GLP2R, TGFBR3, JPH3, ICAM2, and ERN1) by applying between population statistical tests (XP-EHH and XP-CLR). A statistical enrichment test was also conducted to detect breed specific genetic variation. In addition, de novo short sequence read assembly strategy identified several candidate genes (SLC25A14, IGF1, PI4KA, CACNA1A) as also contributing to lipid metabolism. Results revealed several candidate genes involved in Berkshire meat quality; most of these genes are involved in lipid metabolism and intramuscular fat deposition. These results can provide a basis for future research on the genomic characteristics of Berkshire pigs.

  5. Properties of Sequence Conservation in Upstream Regulatory and Protein Coding Sequences among Paralogs in Arabidopsis thaliana

    Science.gov (United States)

    Richardson, Dale N.; Wiehe, Thomas

    Whole genome duplication (WGD) has catalyzed the formation of new species, genes with novel functions, altered expression patterns, complexified signaling pathways and has provided organisms a level of genetic robustness. We studied the long-term evolution and interrelationships of 5’ upstream regulatory sequences (URSs), protein coding sequences (CDSs) and expression correlations (EC) of duplicated gene pairs in Arabidopsis. Three distinct methods revealed significant evolutionary conservation between paralogous URSs and were highly correlated with microarray-based expression correlation of the respective gene pairs. Positional information on exact matches between sequences unveiled the contribution of micro-chromosomal rearrangements on expression divergence. A three-way rank analysis of URS similarity, CDS divergence and EC uncovered specific gene functional biases. Transcription factor activity was associated with gene pairs exhibiting conserved URSs and divergent CDSs, whereas a broad array of metabolic enzymes was found to be associated with gene pairs showing diverged URSs but conserved CDSs.

  6. Gene discovery by chemical mutagenesis and whole-genome sequencing in Dictyostelium.

    Science.gov (United States)

    Li, Cheng-Lin Frank; Santhanam, Balaji; Webb, Amanda Nicole; Zupan, Blaž; Shaulsky, Gad

    2016-09-01

    Whole-genome sequencing is a useful approach for identification of chemical-induced lesions, but previous applications involved tedious genetic mapping to pinpoint the causative mutations. We propose that saturation mutagenesis under low mutagenic loads, followed by whole-genome sequencing, should allow direct implication of genes by identifying multiple independent alleles of each relevant gene. We tested the hypothesis by performing three genetic screens with chemical mutagenesis in the social soil amoeba Dictyostelium discoideum Through genome sequencing, we successfully identified mutant genes with multiple alleles in near-saturation screens, including resistance to intense illumination and strong suppressors of defects in an allorecognition pathway. We tested the causality of the mutations by comparison to published data and by direct complementation tests, finding both dominant and recessive causative mutations. Therefore, our strategy provides a cost- and time-efficient approach to gene discovery by integrating chemical mutagenesis and whole-genome sequencing. The method should be applicable to many microbial systems, and it is expected to revolutionize the field of functional genomics in Dictyostelium by greatly expanding the mutation spectrum relative to other common mutagenesis methods. © 2016 Li et al.; Published by Cold Spring Harbor Laboratory Press.

  7. Optimization of short amino acid sequences classifier

    Science.gov (United States)

    Barcz, Aleksy; Szymański, Zbigniew

    This article describes processing methods used for short amino acid sequences classification. The data processed are 9-symbols string representations of amino acid sequences, divided into 49 data sets - each one containing samples labeled as reacting or not with given enzyme. The goal of the classification is to determine for a single enzyme, whether an amino acid sequence would react with it or not. Each data set is processed separately. Feature selection is performed to reduce the number of dimensions for each data set. The method used for feature selection consists of two phases. During the first phase, significant positions are selected using Classification and Regression Trees. Afterwards, symbols appearing at the selected positions are substituted with numeric values of amino acid properties taken from the AAindex database. In the second phase the new set of features is reduced using a correlation-based ranking formula and Gram-Schmidt orthogonalization. Finally, the preprocessed data is used for training LS-SVM classifiers. SPDE, an evolutionary algorithm, is used to obtain optimal hyperparameters for the LS-SVM classifier, such as error penalty parameter C and kernel-specific hyperparameters. A simple score penalty is used to adapt the SPDE algorithm to the task of selecting classifiers with best performance measures values.

  8. Simple sequence repeat marker development from bacterial artificial chromosome end sequences and expressed sequence tags of flax (Linum usitatissimum L.).

    Science.gov (United States)

    Cloutier, Sylvie; Miranda, Evelyn; Ward, Kerry; Radovanovic, Natasa; Reimer, Elsa; Walichnowski, Andrzej; Datla, Raju; Rowland, Gordon; Duguid, Scott; Ragupathy, Raja

    2012-08-01

    Flax is an important oilseed crop in North America and is mostly grown as a fibre crop in Europe. As a self-pollinated diploid with a small estimated genome size of ~370 Mb, flax is well suited for fast progress in genomics. In the last few years, important genetic resources have been developed for this crop. Here, we describe the assessment and comparative analyses of 1,506 putative simple sequence repeats (SSRs) of which, 1,164 were derived from BAC-end sequences (BESs) and 342 from expressed sequence tags (ESTs). The SSRs were assessed on a panel of 16 flax accessions with 673 (58 %) and 145 (42 %) primer pairs being polymorphic in the BESs and ESTs, respectively. With 818 novel polymorphic SSR primer pairs reported in this study, the repertoire of available SSRs in flax has more than doubled from the combined total of 508 of all previous reports. Among nucleotide motifs, trinucleotides were the most abundant irrespective of the class, but dinucleotides were the most polymorphic. SSR length was also positively correlated with polymorphism. Two dinucleotide (AT/TA and AG/GA) and two trinucleotide (AAT/ATA/TAA and GAA/AGA/AAG) motifs and their iterations, different from those reported in many other crops, accounted for more than half of all the SSRs and were also more polymorphic (63.4 %) than the rest of the markers (42.7 %). This improved resource promises to be useful in genetic, quantitative trait loci (QTL) and association mapping as well as for anchoring the physical/genetic map with the whole genome shotgun reference sequence of flax.

  9. Receptor homodimerization plays a critical role in a novel dominant negative P2RY12 variant identified in a family with severe bleeding.

    Science.gov (United States)

    Mundell, S J; Rabbolini, D; Gabrielli, S; Chen, Q; Aungraheeta, R; Hutchinson, J L; Kilo, T; Mackay, J; Ward, C M; Stevenson, W; Morel-Kopp, M-C

    2018-01-01

    Essentials Three dominant variants for the autosomal recessive bleeding disorder type-8 have been described. To date, there has been no phenotype/genotype correlation explaining their dominant transmission. Proline plays an important role in P2Y12R ligand binding and signaling defects. P2Y12R homodimer formation is critical for the receptor function and signaling. Background Although inherited platelet disorders are still underdiagnosed worldwide, advances in molecular techniques are improving disease diagnosis and patient management. Objective To identify and characterize the mechanism underlying the bleeding phenotype in a Caucasian family with an autosomal dominant P2RY12 variant. Methods Full blood counts, platelet aggregometry, flow cytometry and western blotting were performed before next-generation sequencing (NGS). Detailed molecular analysis of the identified variant of the P2Y12 receptor (P2Y12R) was subsequently performed in mammalian cells overexpressing receptor constructs. Results All three referred individuals had markedly impaired ADP-induced platelet aggregation with primary wave only, despite normal total and surface P2Y12R expression. By NGS, a single P2RY12:c.G794C substitution (p.R265P) was identified in all affected individuals, and this was confirmed by Sanger sequencing. Mammalian cell experiments with the R265P-P2Y12R variant showed normal receptor surface expression versus wild-type (WT) P2Y12R. Agonist-stimulated R265P-P2Y12R function (both signaling and surface receptor loss) was reduced versus WT P2Y12R. Critically, R265P-P2Y12R acted in a dominant negative manner, with agonist-stimulated WT P2Y12R activity being reduced by variant coexpression, suggesting dramatic loss of WT homodimers. Importantly, platelet P2RY12 cDNA cloning and sequencing in two affected individuals also revealed three-fold mutant mRNA overexpression, decreasing even further the likelihood of WT homodimer formation. R265 located within extracellular loop 3 (EL3) is

  10. Evidence of a dominance hierarchy in captive Caribbean flamingos and its relation to pair bonding and physiological measures of health.

    Science.gov (United States)

    Royer, Erica A; Anderson, Matthew J

    2014-06-01

    Caribbean flamingo social structure, how pair bonds affect the structure of the flock, and how social stress affects health measured by heterophil to lymphocyte ratios (H/L) were investigated at the Philadelphia Zoo. It was hypothesized that a hierarchy may become apparent by analyzing agonistic interactions and that paired individuals would share similar places within the hierarchy. Furthermore, it was hypothesized that a negative relationship between H/L ratio and dominance would exist. Forty observations were conducted and in 70% of interactions instigating bird(s) won the encounter, suggesting either some advantage for instigating birds or a prior expectation of an encounter's outcome based upon an understanding of the flock's hierarchy. The flock possessed a semi-linear hierarchy (in terms of wins/losses) and birds with higher pair-bond strengths maintained dominant positions, suggesting that pair-bonding may help individuals become more successful in agonistic encounters. Birds who won more often had higher lymphocytes percentages and analyses suggested a trend indicating dominant birds may be less stressed. A semi-linear hierarchy was also found in terms of initiation/being targeted, and a bird's rank on the dominance (wins/losses) and initiate/target hierarchies were positively correlated, suggesting that subdominant birds were targeted by dominant birds more frequently than vice versa. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Autosomal dominant cutis laxa with progeroid features due to a novel, de novo mutation in ALDH18A1.

    Science.gov (United States)

    Bhola, Priya T; Hartley, Taila; Bareke, Eric; Boycott, Kym M; Nikkel, Sarah M; Dyment, David A

    2017-06-01

    De novo dominant mutations in the aldehyde dehydrogenase 18 family member A1 (ALDH18A1) gene have recently been shown to cause autosomal dominant cutis laxa with progeroid features (MIM 616603). To date, all de novo dominant mutations have been found in a single highly conserved amino acid residue at position p.Arg138. We report an 8-year-old male with a clinical diagnosis of autosomal dominant cutis laxa (ADCL) with progeroid features and a novel de novo missense mutation in ALDH18A1 (NM_002860.3: c.377G>A (p.Arg126His)). This is the first report of an individual with ALDH18A1-ADCL due to a substitution at a residue other than p.Arg138. Knowledge of the complete spectrum of dominant-acting mutations that cause this rare syndrome will have implications for molecular diagnosis and genetic counselling of these families.

  12. Comparison of four techniques on facility of two-hand Bag-valve-mask (BVM ventilation: E-C, Thenar Eminence, Thenar Eminence (Dominant hand-E-C (non-dominant hand and Thenar Eminence (non-dominant hand – E-C (dominant hand

    Directory of Open Access Journals (Sweden)

    Maryam Soleimanpour

    2016-12-01

    Conclusion: Novice participants did Thenar Eminence (non-dominant hand - E-C (dominant hand technique better than the others. Therefore, it is recommended that training of this technique was placed in educational program of medical students.

  13. Design of the AGS Booster Beam Position Monitor electronics

    International Nuclear Information System (INIS)

    Ciardullo, D.J.; Smith, G.A.; Beadle, E.R.

    1991-01-01

    The operational requirements of the AGS Booster Beam Position Monitor system necessitate the use of electronics with wide dynamic range and broad instantaneous bandwidth. Bunch synchronization is provided by a remote timing sequencer coupled to the local ring electronics via digital fiber-optic links. The Sequencer and local ring circuitry work together to provide single turn trajectory or average orbit and intensity information, integrated over 1 to 225 bunches. Test capabilities are built in for the purpose of enhancing BPM system accuracy. This paper describes the design of the Booster Beam Position Monitor electronics, and presents performance details of the front end processing, acquisition and timing circuitry

  14. Mammalian herbivores confer resilience of Arctic shrub-dominated ecosystems to changing climate.

    Science.gov (United States)

    Kaarlejärvi, Elina; Hoset, Katrine S; Olofsson, Johan

    2015-09-01

    Climate change is resulting in a rapid expansion of shrubs in the Arctic. This expansion has been shown to be reinforced by positive feedbacks, and it could thus set the ecosystem on a trajectory toward an alternate, more productive regime. Herbivores, on the other hand, are known to counteract the effects of simultaneous climate warming on shrub biomass. However, little is known about the impact of herbivores on resilience of these ecosystems, that is, the capacity of a system to absorb disturbance and still remain in the same regime, retaining the same function, structure, and feedbacks. Here, we investigated how herbivores affect resilience of shrub-dominated systems to warming by studying the change of shrub biomass after a cessation of long-term experimental warming in a forest-tundra ecotone. As predicted, warming increased the biomass of shrubs, and in the absence of herbivores, shrub biomass in tundra continued to increase 4 years after cessation of the artificial warming, indicating that positive effects of warming on plant growth may persist even over a subsequent colder period. Herbivores contributed to the resilience of these systems by returning them back to the original low-biomass regime in both forest and tundra habitats. These results support the prediction that higher shrub biomass triggers positive feedbacks on soil processes and microclimate, which enable maintaining the rapid shrub growth even in colder climates. Furthermore, the results show that in our system, herbivores facilitate the resilience of shrub-dominated ecosystems to climate warming. © 2015 John Wiley & Sons Ltd.

  15. Triassic Sequence Geological Development of the Arctic with focus on Svalbard and the Barents Shelf

    Energy Technology Data Exchange (ETDEWEB)

    Moerk, Atle

    1998-12-31

    Triassic rocks are of great interest for exploration in Arctic areas as they have proved to include both good hydrocarbon source rocks and potential hydrogen reservoir rocks. In this thesis, the stratigraphy and sedimentology of the Arctic Triassic successions are studied within a sequence stratigraphical framework. Inter-regional comparisons throughout the Arctic are based on comparisons of transgressive-regressive sequences. Improved dating of the studied sequences, and the recognition and correlation of sequence boundaries of second and third order, facilitate interpretation of facies distribution and the geological development both within and between the studied areas. Main emphasis is given to the Triassic succession of Svalbard and the Barents Shelf, which through this study is integrated within a circum-Arctic sequence stratigraphical framework. Good correspondence of the Triassic sequence boundaries between the different Arctic areas indicate that they are mainly controlled by eustacy, while decreasing correspondence of the sequence boundaries in the Jurassic and Cretaceous periods indicate that local and large scale tectonism becomes progressively more dominant in the circum-Arctic Realm through the Mesozoic Era. These hypotheses are further discussed. 701 refs., 110 figs., 12 tabs.

  16. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  17. Identification of rhabdoviral sequences in oropharyngeal swabs from German and Danish bats.

    Science.gov (United States)

    Fischer, Melina; Freuling, Conrad M; Müller, Thomas; Schatz, Juliane; Rasmussen, Thomas Bruun; Chriel, Mariann; Balkema-Buschmann, Anne; Beer, Martin; Hoffmann, Bernd

    2014-11-25

    In the frame of active lyssavirus surveillance in bats, oropharyngeal swabs from German (N = 2297) and Danish (N = 134) insectivorous bats were investigated using a newly developed generic pan-lyssavirus real-time reverse transcriptase PCR (RT-qPCR). In total, 15 RT-qPCR positive swabs were detected. Remarkably, sequencing of positive samples did not confirm the presence of bat associated lyssaviruses but revealed nine distinct novel rhabdovirus-related sequences. Several novel rhabdovirus-related sequences were detected both in German and Danish insectivorous bats. The results also prove that the novel generic pan-lyssavirus RT-qPCR offers a very broad detection range that allows the collection of further valuable data concerning the broad and complex diversity within the family Rhabdoviridae.

  18. On the edge of language acquisition: inherent constraints on encoding multisyllabic sequences in the neonate brain.

    Science.gov (United States)

    Ferry, Alissa L; Fló, Ana; Brusini, Perrine; Cattarossi, Luigi; Macagno, Francesco; Nespor, Marina; Mehler, Jacques

    2016-05-01

    To understand language, humans must encode information from rapid, sequential streams of syllables - tracking their order and organizing them into words, phrases, and sentences. We used Near-Infrared Spectroscopy (NIRS) to determine whether human neonates are born with the capacity to track the positions of syllables in multisyllabic sequences. After familiarization with a six-syllable sequence, the neonate brain responded to the change (as shown by an increase in oxy-hemoglobin) when the two edge syllables switched positions but not when two middle syllables switched positions (Experiment 1), indicating that they encoded the syllables at the edges of sequences better than those in the middle. Moreover, when a 25 ms pause was inserted between the middle syllables as a segmentation cue, neonates' brains were sensitive to the change (Experiment 2), indicating that subtle cues in speech can signal a boundary, with enhanced encoding of the syllables located at the edges of that boundary. These findings suggest that neonates' brains can encode information from multisyllabic sequences and that this encoding is constrained. Moreover, subtle segmentation cues in a sequence of syllables provide a mechanism with which to accurately encode positional information from longer sequences. Tracking the order of syllables is necessary to understand language and our results suggest that the foundations for this encoding are present at birth. © 2015 John Wiley & Sons Ltd.

  19. A Novel Passive Islanding Detection Scheme for Distributed Generations Based on Rate of Change of Positive Sequence Component of Voltage and Current

    DEFF Research Database (Denmark)

    Rostami, Ali; Jalilian, Amin; Naderi, Seyed Behzad

    2017-01-01

    ) based wind turbine and synchronous diesel generator DGs by MATLAB/Simulink software. Different non-islanding case studies are taken into account to evaluate the effectiveness of the proposed approach. The simulation results show that the proposed method has advantage of detecting the islanding rapidly......Islanding operation is one of serious hazards of distributed generation (DG) applications. According to IEEE 1547 standard, its occurrence must be detected within two seconds. This paper presents a novel passive islanding detection method based on rate of change of positive sequence component...... of RCPSC and RCPSV exceed the predetermined threshold values, it is concluded that the islanding condition has occurred. Otherwise, it is considered as a non-islanding event. The performance of the proposed method is investigated on a sample network in the presence of doubly fed induction generator (DFIG...

  20. Impact of Negative Sequence Current Injection by Wind Power Plants

    DEFF Research Database (Denmark)

    Chaudhary, Sanjay; Göksu, Ömer; Teodorescu, Remus

    2013-01-01

    This paper presents an analysis of the impact from negative sequence current injection by wind power plants in power systems under steady-state and short-term unbalanced conditions, including faults. The separate positive and negative sequence current control capability of the grid-side converters...... of full scale converter type wind turbines may be utilized to alter voltage imbalance at the point of connection and further into the grid, in turn changing the resultant negative sequence current flow in the grid. The effects of such control actions have been analyzed and discussed through theoretical...

  1. Influence of the language dominant hemisphere on the activation region of the cerebral cortex during mastication

    International Nuclear Information System (INIS)

    Matsushima, Yasuhiko

    2005-01-01

    We used functional magnetic resonance imaging (fMRI) to examine the relationship of the activation region of the cerebral cortex during mastication with the language dominant hemisphere. Twelve healthy subjects were asked to chew a special gum 50 times on each side of the mouth, the gum changed color, becoming a deeper red, as it was chewed. The depth of red of the chewed gum was used to ascertain the habitual masticatory side. Measurements were also performed on a conventional whole body 1.5 T clinical scanner using a single shot, multislice echo-planar imaging sequence. The subjects were asked to masticate first on the right side, and then on the left side. As well, they were instructed to do a shiritori test, which is a word game. Computer analysis of the fMRI was done using statistical parametric mapping (SPM) 99 software (p<0.001, paired t-test). We found that the sensorimotor cortex activated by masticatory movements always contains language dominant hemisphere. (author)

  2. A dominant EV71-specific CD4+ T cell epitope is highly conserved among human enteroviruses.

    Directory of Open Access Journals (Sweden)

    Ruicheng Wei

    Full Text Available CD4+ T cell-mediated immunity plays a central role in determining the immunopathogenesis of viral infections. However, the role of CD4+ T cells in EV71 infection, which causes hand, foot and mouth disease (HFMD, has yet to be elucidated. We applied a sophisticated method to identify promiscuous CD4+ T cell epitopes contained within the sequence of the EV71 polyprotein. Fifteen epitopes were identified, and three of them are dominant ones. The most dominant epitope is highly conserved among enterovirus species, including HFMD-related coxsackieviruses, HFMD-unrelated echoviruses and polioviruses. Furthermore, the CD4+ T cells specific to the epitope indeed cross-reacted with the homolog of poliovirus 3 Sabin. Our findings imply that CD4+ T cell responses to poliovirus following vaccination, or to other enteroviruses to which individuals may be exposed in early childhood, may have a modulating effect on subsequent CD4+ T cell response to EV71 infection or vaccine.

  3. A naturally narrow positive-parity Θ+

    International Nuclear Information System (INIS)

    Carlson, Carl E.; Carone, Christopher D.; Kwee, Herry J.; Nazaryan, Vahagn

    2004-01-01

    We present a consistent color-flavor-spin-orbital wave function for a positive-parity Θ + that naturally explains the observed narrowness of the state. The wave function is totally symmetric in its flavor-spin part and totally antisymmetric in its color-orbital part. If flavor-spin interactions dominate, this wave function renders the positive-parity Θ + lighter than its negative-parity counterpart. We consider decays of the Θ + and compute the overlap of this state with the kinematically allowed final states. Our results are numerically small. We note that dynamical correlations between quarks are not necessary to obtain narrow pentaquark widths

  4. Negative Sequence Droop Method based Hierarchical Control for Low Voltage Ride-Through in Grid-Interactive Microgrids

    DEFF Research Database (Denmark)

    Zhao, Xin; Firoozabadi, Mehdi Savaghebi; Quintero, Juan Carlos Vasquez

    2015-01-01

    . In this paper, a voltage support strategy based on negative sequence droop control, which regulate the positive/negative sequence active and reactive power flow by means of sending proper voltage reference to the inner control loop, is proposed for the grid connected MGs to ride through voltage sags under...... complex line impedance conditions. In this case, the MGs should inject a certain amount of positive and negative sequence power to the grid so that the voltage quality at load side can be maintained at a satisfied level. A two layer hierarchical control strategy is proposed in this paper. The primary...... control loop consists of voltage and current inner loops, conventional droop control and virtual impedance loop while the secondary control loop is based on positive/negative sequence droop control which can achieve power injection under voltage sags. Experimental results with asymmetrical voltage sags...

  5. Predicting Folding Sequences Based on the Maximum Rock Strength and Mechanical Equilibrium

    Science.gov (United States)

    Cubas, N.; Souloumiac, P.; Maillot, B.; Leroy, Y. M.

    2007-12-01

    The objective is to propose and validate simple procedures, compared to the finite-element method, to select and optimize the dominant mode of folding in fold-and-thrust belts and accretionary wedges, and to determine its stress distribution. Mechanical equilibrium as well as the constraints due to the limited rock strength of the bulk material and of major discontinuities, such as décollements, are accounted for. The first part of the proposed procedure, which is at the core of the external approach of classical limit analysis, consists in estimating the least upper bound on the tectonic force by minimisation of the internal dissipation and part of the external work. The new twist to the method is that the optimization is also done with respect to the geometry of the evolving fold. If several folding events are possible, the dominant mode is the one leading to the least upper bound. The second part of the procedure is based on the Equilibrium Element Method, which is an application of the internal approach of limit analysis. The optimum stress field, obtained by spatial discretisation of the fold, provides the best lower bound on the tectonic force. The difference between the two bounds defines an error estimate of the exact unknown tectonic force. To show the merits of the proposed procedure, its first part is applied to predict the life span of a thrust within an accretionary prism, from its onset, its development with a relief build up and its arrest because of the onset of a more favorable new thrust (Cubas et al., 2007). This life span is sensitive to the friction angles over the ramp and the décollement. It is shown how the normal sequence of thrusting in a supercritical wedge is ended with the first out-of sequence event. The second part of the procedure provides the stress state over each thrust showing that the active back thrust is a narrow fan which dip is sensitive to the friction angle over the ramp and the amount of relief build up (Souloumiac et

  6. Scheduling Aircraft Landings under Constrained Position Shifting

    Science.gov (United States)

    Balakrishnan, Hamsa; Chandran, Bala

    2006-01-01

    Optimal scheduling of airport runway operations can play an important role in improving the safety and efficiency of the National Airspace System (NAS). Methods that compute the optimal landing sequence and landing times of aircraft must accommodate practical issues that affect the implementation of the schedule. One such practical consideration, known as Constrained Position Shifting (CPS), is the restriction that each aircraft must land within a pre-specified number of positions of its place in the First-Come-First-Served (FCFS) sequence. We consider the problem of scheduling landings of aircraft in a CPS environment in order to maximize runway throughput (minimize the completion time of the landing sequence), subject to operational constraints such as FAA-specified minimum inter-arrival spacing restrictions, precedence relationships among aircraft that arise either from airline preferences or air traffic control procedures that prevent overtaking, and time windows (representing possible control actions) during which each aircraft landing can occur. We present a Dynamic Programming-based approach that scales linearly in the number of aircraft, and describe our computational experience with a prototype implementation on realistic data for Denver International Airport.

  7. Expressed sequence tag-derived polymorphic SSR markers for Fucus serratus and amplification in other species of Fucus

    NARCIS (Netherlands)

    Coyer, J. A.; Hoarau, G.; Beszteri, B.; Pearson, G.; Olsen, J. L.

    The seaweed genus Fucus is a dominant component of intertidal shores throughout the North Atlantic and North Pacific and has been the focus of considerable developmental, ecological, and evolutionary research for the past century. Here, we present details of 21 expressed sequence tag-derived simple

  8. Sedimentology and sequence stratigraphy of the Lopingian (Late Permian) coal measures in southwestern China

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Hao [School of Geosciences and Surveying Engineering, China University of Mining and Technology, Beijing (China); School of Earth and Environment, University of Leeds (United Kingdom); Shao, Longyi; Hao, Liming; Zhang, Pengfei [School of Geosciences and Surveying Engineering, China University of Mining and Technology, Beijing (China); Glasspool, Ian J. [Department of Geology, Field Museum of Natural History, Chicago, Illinois (United States); Wheeley, James R.; Hilton, Jason [School of Geography, Earth and Environmental Sciences, University of Birmingham (United Kingdom); Wignall, Paul B. [School of Earth and Environment, University of Leeds (United Kingdom); Yi, Tongsheng [Guizhou Bureau of Coal Geological Exploration, Guiyang, Guizhou (China); Zhang, Mingquan [Coal Geology and Prospecting Institute of Yunnan Province, Kunming, Yunnan (China)

    2011-01-01

    The Lopingian coal measures of southwestern China were deposited within a range of facies associations spanning a spectrum of settings from fluvial to marine carbonate platform. The transitional to terrestrial coal measures are dominated by siliciclastics, but they also contain fifteen laterally extensive marine bands (limestone beds and mudstone). These bands act as marker horizons that enable correlation between fully marine and terrestrial facies. Examination of this range of facies and their sedimentology has enabled the development of a high-resolution sequence stratigraphic framework. Set against the established backdrop of second-order Lopingian transgression, sixteen fourth-order sequences and three composite sequences (third-order) are recognized. Results show that, in the composite sequences, peat accumulation in the seaward parts of the study area predominantly correlates with early transgressive sequence sets (TSS), while in more landward areas it correlates with the middle TSS to late highstand sequence sets (HSS). Differences in peat-accumulation regimes within the sequence stratigraphic framework are attributed to variations in subsidence and background siliciclastic input rates in different depositional settings, with these combining to produce differences in the rate of accommodation change. The preservation of coal resources in the middle to late HSS in this area was most likely related to the rise of the regional base level throughout the Lopingian. (author)

  9. Spatial Heterogeneity of Climate Change Effects on Dominant Height of Larch Plantations in Northern and Northeastern China

    Directory of Open Access Journals (Sweden)

    Hao Zang

    2016-07-01

    Full Text Available Determining the response of dominant height growth to climate change is important for understanding adaption strategies. Based on 550 permanent plots from a national forest inventory and climate data across seven provinces and three climate zones, we developed a climate-sensitive dominant height growth model under a mixed-effects model framework. The mean temperature of the wettest quarter and precipitation of the wettest month were found to be statistically significant explanatory variables that markedly improved model performance. Generally, future climate change had a positive effect on stand dominant height in northern and northeastern China, but the effect showed high spatial variability linked to local climatic conditions. The range in dominant height difference between the current climate and three future BC-RCP scenarios would change from −0.61 m to 1.75 m (−6.9% to 13.5% during the period 2041–2060 and from −1.17 m to 3.28 m (−9.1% to 41.0% during the period 2061–2080 across provinces. The impacts of climate change on stand dominant height decreased as stand age increased. Forests in cold and warm temperate zones had a smaller decrease in dominant height, owing to climate change, compared with those in the mid temperate zone. Overall, future climate change could impact dominant height growth in northern and northeastern China. As spatial heterogeneity of climate change affects dominant height growth, locally specific mitigation measures should be considered in forest management.

  10. Inverted edge effects on carbon stocks in human-dominated landscapes

    Science.gov (United States)

    Romitelli, I.; Keller, M.; Vieira, S. A.; Metzger, J. P.; Reverberi Tambosi, L.

    2017-12-01

    Although the importance of tropical forests to regulate greenhouse gases is well documented, little is known about what factors affect the ability of these forests to store carbon in human-dominated landscapes. Among those factors, the landscape structure, particularly the amount of forest cover, the type of matrix and edge effects, can have important roles. We tested how carbon stock is influenced by a combination of factors of landscape composition (pasture and forest cover), landscape configuration (edge effect) and relief factors (slope, elevation and aspect). To test those relationships, we performed a robust carbon stock estimation with inventory and LiDAR data in human-dominated landscapes from the Brazilian Atlantic forest region. The study area showed carbon stock mean 45.49 ± 9.34 Mg ha-1. The interaction between forest cover, edge effect and slope was the best combination explanatory of carbon stock. We observed an inverted edge effect pattern where carbon stock is higher close to the edges of the studied secondary forests. This inverted edge effect observed contradicts the usual pattern reported in the literature for mature forests. We suppose this pattern is related with a positive effect that edge conditions can have stimulating forest regeneration, but the underlying processes to explain the observed pattern should still be tested. Those results suggest that Carbon stocks in human-dominated and fragmented landscapes can be highly affected by the landscape structure, and particularly that edges conditions can favor carbon sequestration in regenerating tropical forests.

  11. Serial position learning in honeybees.

    Directory of Open Access Journals (Sweden)

    Randolf Menzel

    Full Text Available Learning of stimulus sequences is considered as a characteristic feature of episodic memory since it contains not only a particular item but also the experience of preceding and following events. In sensorimotor tasks resembling navigational performance, the serial order of objects is intimately connected with spatial order. Mammals and birds develop episodic(-like memory in serial spatio-temporal tasks, and the honeybee learns spatio-temporal order when navigating between the nest and a food source. Here I examine the structure of the bees' memory for a combined spatio-temporal task. I ask whether discrimination and generalization are based solely on simple forms of stimulus-reward learning or whether they require sequential configurations. Animals were trained to fly either left or right in a continuous T-maze. The correct choice was signaled by the sequence of colors (blue, yellow at four positions in the access arm. If only one of the possible 4 signals is shown (either blue or yellow, the rank order of position salience is 1, 2 and 3 (numbered from T-junction. No learning is found if the signal appears at position 4. If two signals are shown, differences at positions 1 and 2 are learned best, those at position 3 at a low level, and those at position 4 not at all. If three or more signals are shown these results are corroborated. This salience rank order again appeared in transfer tests, but additional configural phenomena emerged. Most of the results can be explained with a simple model based on the assumption that the four positions are equipped with different salience scores and that these add up independently. However, deviations from the model are interpreted by assuming stimulus configuration of sequential patterns. It is concluded that, under the conditions chosen, bees rely most strongly on memories developed during simple forms of associative reward learning, but memories of configural serial patterns contribute, too.

  12. Gelada vocal sequences follow Menzerath’s linguistic law

    Science.gov (United States)

    Gustison, Morgan L.; Semple, Stuart; Ferrer-i-Cancho, Ramon; Bergman, Thore J.

    2016-01-01

    Identifying universal principles underpinning diverse natural systems is a key goal of the life sciences. A powerful approach in addressing this goal has been to test whether patterns consistent with linguistic laws are found in nonhuman animals. Menzerath’s law is a linguistic law that states that, the larger the construct, the smaller the size of its constituents. Here, to our knowledge, we present the first evidence that Menzerath’s law holds in the vocal communication of a nonhuman species. We show that, in vocal sequences of wild male geladas (Theropithecus gelada), construct size (sequence size in number of calls) is negatively correlated with constituent size (duration of calls). Call duration does not vary significantly with position in the sequence, but call sequence composition does change with sequence size and most call types are abbreviated in larger sequences. We also find that intercall intervals follow the same relationship with sequence size as do calls. Finally, we provide formal mathematical support for the idea that Menzerath’s law reflects compression—the principle of minimizing the expected length of a code. Our findings suggest that a common principle underpins human and gelada vocal communication, highlighting the value of exploring the applicability of linguistic laws in vocal systems outside the realm of language. PMID:27091968

  13. Edge Cut Domination, Irredundance, and Independence in Graphs

    OpenAIRE

    Fenstermacher, Todd; Hedetniemi, Stephen; Laskar, Renu

    2016-01-01

    An edge dominating set $F$ of a graph $G=(V,E)$ is an \\textit{edge cut dominating set} if the subgraph $\\langle V,G-F \\rangle$ is disconnected. The \\textit{edge cut domination number} $\\gamma_{ct}(G)$ of $G$ is the minimum cardinality of an edge cut dominating set of $G.$ In this paper we study the edge cut domination number and investigate its relationships with other parameters of graphs. We also introduce the properties edge cut irredundance and edge cut independence.

  14. Hypothalamic digoxin, hemispheric chemical dominance and sarcoidosis.

    Science.gov (United States)

    Ravi Kumar, A; Kurup, Parameswara Achutha

    2004-06-01

    The isoprenoid pathway produces three key metabolites: endogenous digoxin (membrane sodium-potassium ATPase inhibitor, immunomodulator and regulator of neurotransmitter/amino acid transport), dolichol (regulates N-glycosylation of proteins) and ubiquinone (free radical scavenger). The role of the isoprenoid pathway in the pathogenesis of sarcoidosis in relation to hemispheric dominance was studied. The isoprenoid pathway-related cascade was assessed in patients with systemic sarcoidosis with pulmonary involvement. The pathway was also assessed in patients with right hemispheric, left hemispheric and bihemispheric dominance for comparison to find out the role of hemispheric dominance in the pathogenesis of sarcoidosis. In patients with sarcoidosis there was elevated digoxin synthesis, increased dolichol and glycoconjugate levels and low ubiquinone and elevated free radical levels. There was also an increase in tryptophan catabolites and a reduction in tyrosine catabolites. There was an increase in the cholesterol:phospholipid ratio and a reduction in the glycoconjugate level of red blood cell (RBC) membrane in this group of patients. The same biochemical patterns were obtained in individuals with right hemispheric dominance. In individuals with left hemispheric dominance the patterns were reversed. Endogenous digoxin, by activating the calcineurin signal transduction pathway of T cells, can contribute to immune activation in sarcoidosis. An altered glycoconjugate metabolism can lead to the generation of endogenous self-glycoprotein antigens in the lung as well as other tissues. Increased free radical generation can also lead to immune activation. The role of a dysfunctional isoprenoid pathway and endogenous digoxin in the pathogenesis of sarcoidosis in relation to right hemispheric chemical dominance is discussed. All the patients with sarcoidosis were right-handed/left hemispheric dominant according to the dichotic listening test, but their biochemical patterns

  15. Hypothalamic digoxin, hemispheric chemical dominance, and creativity.

    Science.gov (United States)

    Kurup, Ravi Kumar; Kurup, Parameswara Achutha

    2003-04-01

    The human hypothalamus produces an endogenous membrane Na(+)-K+ ATPase inhibitor, digoxin, which regulates neuronal transmission. The digoxin status and neurotransmitter patterns were studied in creative and non-creative individuals, as well as in individuals with differing hemispheric dominance, in order to find out the role of cerebral dominance in this respect. The activity of HMG CoA reductase and serum levels of digoxin, magnesium, tryptophan catabolites, and tyrosine catabolites were measured in creative/non-creative individuals, and in individuals with differing hemispheric dominance. In creative individuals there was increased digoxin synthesis, decreased membrane Na(+)-K+ ATPase activity, increased tryptophan catabolites (serotonin, quinolinic acid, and nicotine), and decreased tyrosine catabolites (dopamine, noradrenaline, and morphine). The pattern in creative individuals correlated with right hemispheric dominance. In non-creative individuals there was decreased digoxin synthesis, increased membrane Na(+)-K+ ATPase activity, decreased tryptophan catabolites (serotonin, quinolinic acid, and nicotine), and increased tyrosine catabolites (dopamine, noradrenaline, and morphine). This pattern in non-creative individuals correlated with that obtained in left hemispheric chemical dominance. Hemispheric chemical dominance and hypothalamic digoxin could regulate the predisposition to creative tendency.

  16. Hypothalamic digoxin, hemispheric chemical dominance, and spirituality.

    Science.gov (United States)

    Kurup, Ravi Kumar; Kurup, Parameswara Achutha

    2003-03-01

    The isoprenoid pathway was assessed in atheistic and spiritually inclined individuals. The pathway was also assessed in individuals with differing hemispheric dominance to assess whether hemispheric dominance has a correlation with spiritual and atheistic tendency. HMG CoA reductase activity, serum digoxin, RBC membrane Na(+)-K+ ATPase activity, serum magnesium, and tyrosine/tryptophan catabolic patterns were assessed in spiritual/atheistic individuals and in those differing hemispheric dominance. In spiritually-inclined individuals, there was increased digoxin synthesis, decreased membrane Na(+)-K+ ATPase activity, increased tryptophan catabolites (serotonin, quinolinic acid, and nicotine), and decreased tyrosine catabolites (dopamine, noradrenaline, and morphine). The pattern in spiritually-inclined individuals correlated with right hemispheric chemical dominance. In atheistic individuals there was decreased digoxin synthesis, increased membrane Na(+)-K+ ATPase activity, decreased tryptophan catabolities (serotonin, quinolinic acid, and nicotine), and increased tyrosine catabolites (dopamine, noradrenaline, and morphine). This pattern in atheistic individuals correlated with that obtained in left hemispheric chemical dominance. Hemispheric chemical dominance and hypothalamic digoxin could regulate the predisposition to spirituality or atheism.

  17. Phylogenetic study on Shiraia bambusicola by rDNA sequence analyses.

    Science.gov (United States)

    Cheng, Tian-Fan; Jia, Xiao-Ming; Ma, Xiao-Hang; Lin, Hai-Ping; Zhao, Yu-Hua

    2004-01-01

    In this study, 18S rDNA and ITS-5.8S rDNA regions of four Shiraia bambusicola isolates collected from different species of bamboos were amplified by PCR with universal primer pairs NS1/NS8 and ITS5/ITS4, respectively, and sequenced. Phylogenetic analyses were conducted on three selected datasets of rDNA sequences. Maximum parsimony, distance and maximum likelihood criteria were used to infer trees. Morphological characteristics were also observed. The positioning of Shiraia in the order Pleosporales was well supported by bootstrap, which agreed with the placement by Amano (1980) according to their morphology. We did not find significant inter-hostal differences among these four isolates from different species of bamboos. From the results of analyses and comparison of their rDNA sequences, we conclude that Shiraia should be classified into Pleosporales as Amano (1980) proposed and suggest that it might be positioned in the family Phaeosphaeriaceae. Copyright 2004 WILEY-VCH Verlag GmbH & Co.

  18. Outer-2-independent domination in graphs

    Indian Academy of Sciences (India)

    independent dominating set of a graph is a set of vertices of such that every vertex of ()\\ has a neighbor in and the maximum vertex degree of the subgraph induced by ()\\ is at most one. The outer-2-independent domination ...

  19. Novel approach for identification of influenza virus host range and zoonotic transmissible sequences by determination of host-related associative positions in viral genome segments.

    Science.gov (United States)

    Kargarfard, Fatemeh; Sami, Ashkan; Mohammadi-Dehcheshmeh, Manijeh; Ebrahimie, Esmaeil

    2016-11-16

    Recent (2013 and 2009) zoonotic transmission of avian or porcine influenza to humans highlights an increase in host range by evading species barriers. Gene reassortment or antigenic shift between viruses from two or more hosts can generate a new life-threatening virus when the new shuffled virus is no longer recognized by antibodies existing within human populations. There is no large scale study to help understand the underlying mechanisms of host transmission. Furthermore, there is no clear understanding of how different segments of the influenza genome contribute in the final determination of host range. To obtain insight into the rules underpinning host range determination, various supervised machine learning algorithms were employed to mine reassortment changes in different viral segments in a range of hosts. Our multi-host dataset contained whole segments of 674 influenza strains organized into three host categories: avian, human, and swine. Some of the sequences were assigned to multiple hosts. In point of fact, the datasets are a form of multi-labeled dataset and we utilized a multi-label learning method to identify discriminative sequence sites. Then algorithms such as CBA, Ripper, and decision tree were applied to extract informative and descriptive association rules for each viral protein segment. We found informative rules in all segments that are common within the same host class but varied between different hosts. For example, for infection of an avian host, HA14V and NS1230S were the most important discriminative and combinatorial positions. Host range identification is facilitated by high support combined rules in this study. Our major goal was to detect discriminative genomic positions that were able to identify multi host viruses, because such viruses are likely to cause pandemic or disastrous epidemics.

  20. Razões entre componentes da variabilidade de características quantitativas simuladas com efeitos genéticos de dominância e sobredominância Ratios between variability components of simulated quantitative traits with genetic effects of dominance and overdominance

    Directory of Open Access Journals (Sweden)

    Elizângela Emídio Cunha

    2009-10-01

    Full Text Available Foram avaliadas as razões entre componentes da variabilidade de características quantitativas simuladas a partir de genoma incorporando efeitos genéticos não-aditivos em populações de acasalamento ao acaso e de seleção fenotípica a curto prazo. Estudaram-se uma característica de baixa (h² = 0,10 e outra de alta herdabilidade (h² = 0,60 influenciadas por 600 locos bialélicos. Cinco modelos de ação gênica foram simulados, dos quais quatro incluíram dominância completa e positiva para 25, 50, 75 e 100% dos locos (D25, D50, D75 e D100, respectivamente; e um modelo incluiu sobredominância positiva para 50% dos locos. Todos os modelos incluíram efeitos aditivos dos alelos para 100% dos locos. As principais razões quantificadas foram d² (variância de dominância/variância fenotípica e d²a (variância de dominância/variância aditiva. Para as duas características, d² e d²a aumentaram de acordo com o acréscimo na variância de dominância, decorrente da inclusão crescente de locos com desvio da dominância e sob sobredominância. No mesmo modelo, ambas as razões, sobretudo d², são mais elevadas sob alta herdabilidade, o que indica que os efeitos da dominância explicam a maior parte da variabilidade total dessa característica sob seleção.Ratios were assessed between variability components of quantitative traits simulated from the genome incorporating non-additive genetic effects in random mating populations and short-term phenotypic selection. A trait of low (h² = 0.10 heritability and another of high (h² = 0.60 heritability were studied, both influenced by 600 bi-allelic loci. Five gene action models were simulated, of which four included complete and positive dominance for 25, 50, 75 and 100% of the loci (D25, D50, D75 and D100, respectively; and one model included positive overdominance for 50% of the loci. Every model included additive effects of the alleles for 100% of the loci. The main quantified ratios were