Nanotechnology: A Policy Primer
2013-06-24
savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT
Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.
Yofe, Ido; Schuldiner, Maya
2014-02-01
The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.
Levine, Elliott
2001-01-01
Sound technology policies can spell the difference between an effective website and an online nightmare. An effective web development policy addresses six key areas: roles and responsibilities, content/educational value, privacy and safety, adherence to copyright laws, technical standards, and use of commercial sites and services. (MLH)
Knowledge, Power, and Social Policy: John M. MacEachran and Alberta's 1928 Sexual Sterilization Act
Puplampu, Korbla P.
2008-01-01
This article examines how academic knowledge and power have shaped the discourse on human classification and how political authorities use academic knowledge producers to legitimize public policy. Specifically, the article draws on the role of John M. MacEachran, a former academic at the University of Alberta, in the implementation of the Alberta…
The Disappearing Fourth Wall: John Marburger, Science Policy, and the SSC
Crease, Robert
2015-04-01
John H. Marburger (1941-2011) was a skilled science administrator who had a fresh and unique approach to science policy and science leadership. His posthumously published book Science Policy up Close contains recollections of key science policy episodes in which he participated or observed closely. One was the administration of the Superconducting Supercollider (SSC); Marburger was Chairman of the Universities Research Association, the group charged with managing the SSC, from 1988-1994. Many accounts of the SSC saga attribute its demise to a combination of transitory factors: poor management, rising cost estimates, the collapse of the Soviet Union and thus of the Cold War threat, complaints by ``small science'' that the SSC's ``big science'' was consuming their budget, Congress's desire to cut spending, unwarranted contract regulations imposed by the Department of Energy (DOE) in response to environmental lapses at nuclear weapons laboratories, and so forth. Marburger tells a subtler story whose implications for science policy are more significant and far-reaching. The story involves changes in the attitude of the government towards large scientific projects that reach back to management reforms introduced by the administration of Presidents Johnson, Nixon, and Carter in the 1960s and 1970s. This experience impressed Marburger with the inevitability of public oversight of large scientific projects, and with the need for planners of such projects to establish and make public a cost and schedule tracking system that would model the project's progress and expenditures.
MethPrimer: designing primers for methylation PCRs.
Li, Long-Cheng; Dahiya, Rajvir
2002-11-01
DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.
Menopause 101: A Primer for the Perimenopausal
... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...
Directory of Open Access Journals (Sweden)
Tiago Antunes Rezende
2016-10-01
Full Text Available Thisworkistheobjectofstudygovernmentprogramofcompulsoryhospitalizationofdrug addictsdeployedinthestateofSãoPaulo.Thus,theobjectiveofthisresearchistoconducta comparativeanalysisofthethoughtsofJeremyBenthamandJohnRawlsastheconception ofjusticeincasesofcompulsoryhospitalization.Forthis,itwillusethehypothetical- deductivemethodbyanalyzingbooks,scientificarticles,nationallegislationandofficialdata toreachascientificallyvalidconclusion.Thus,thestudyoftheinitialhypothesisonthe perception of justice and injustice of public policies applied to chemical addicts.
Primer3_masker: integrating masking of template sequence with primer design software.
Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido
2018-06-01
Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.
Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.
Françoso, E; Arias, M C
2013-09-01
Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.
Vaccine supply, demand, and policy: a primer.
Muzumdar, Jagannath M; Cline, Richard R
2009-01-01
To provide an overview of supply and demand issues in the vaccine industry and the policy options that have been implemented to resolve these issues. Medline, Policy File, and International Pharmaceutical Abstracts were searched to locate academic journal articles. Other sources reviewed included texts on the topics of vaccine history and policy, government agency reports, and reports from independent think tanks. Keywords included vaccines, immunizations, supply, demand, and policy. Search criteria were limited to English language and human studies. Articles pertaining to vaccine demand, supply, and public policy were selected and reviewed for inclusion. By the authors. Vaccines are biologic medications, therefore making their development and production more difficult and costly compared with "small-molecule" drugs. Research and development costs for vaccines can exceed $800 million, and development may require 10 years or more. Strict manufacturing regulations and facility upgrades add to these costs. Policy options to increase and stabilize the supply of vaccines include those aimed at increasing supply, such as government subsidies for basic vaccine research, liability protection for manufacturers, and fast-track approval for new vaccines. Options to increase vaccine demand include advance purchase commitments, government stockpiles, and government financing for select populations. High development costs and multiple barriers to entry have led to a decline in the number of vaccine manufacturers. Although a number of vaccine policies have met with mixed success in increasing the supply of and demand for vaccines, a variety of concerns remain, including developing vaccines for complex pathogens and increasing immunization rates with available vaccines. New policy innovations such as advance market commitments and Medicare Part D vaccine coverage have been implemented and may aid in resolving some of the problems in the vaccine industry.
A Primer on Macroprudential Policy
Poutineau, Jean-Christophe; Vermandel, Gauthier
2015-01-01
This article introduces macroprudential policy using a static New Keynesian Macroeconomics model with financial frictions. The authors analyze two related questions: First, they show how the procyclicality of financial factors, captured by the financial accelerator, amplifies the transmission of supply and demand shocks and impacts the intuition…
UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes
Directory of Open Access Journals (Sweden)
Nomin Batnyam
2012-01-01
Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.
Dr. John Marburger visits DESY
2003-01-01
Dr. John Marburger, Director of the United States Office of Science and Technology Policy, visited the research center DESY in Hamburg. The American physicist wanted to inform himself about the status of the TESLA X-ray laser and the TESLA linear collider as well as the international collaboration at DESY (1/2 page).
Directory of Open Access Journals (Sweden)
Quintanilla Martínez, Emilio
2012-09-01
Full Text Available Two previously unknown works by the British neoclassical sculptor John Francis dating from the second quarter of the 19th century, representing the 1st Duke of Sutherland and, most likely, the sculptor Sir John Francis, have been located in a Spanish private collection.
Dos obras, hasta ahora inéditas, del escultor neoclásico inglés John Francis del segundo cuarto del siglo XIX, y que representan al primer duque de Sutherland y seguramente al escultor Sir John Francis, en colección privada española.
Polyacid macromolecule primers
Sugama, Toshifumi.
1989-12-26
Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.
PHUSER (Primer Help for USER): a novel tool for USER fusion primer design
DEFF Research Database (Denmark)
Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads
2011-01-01
containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...
VizPrimer: a web server for visualized PCR primer design based on known gene structure.
Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang
2011-12-15
The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.
Characteristics of the population employed in primer sector in Turkey
Directory of Open Access Journals (Sweden)
Bayar Rüya
2006-01-01
Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.
Book Review: The Basics of Digital Forensics: The Primer for Getting Started in Digital Forensics
Directory of Open Access Journals (Sweden)
Stephen Larson
2014-03-01
Full Text Available Sammons, John. (2012. The Basics of Digital Forensics: The Primer for Getting Started in Digital Forensics. Waltham, MA: Syngress, 208 pages, Print Book ISBN: 9781597496612.eBook ISBN : 9781597496629. Print: US $29.95. eBook: US$20.97. Includes exercises, case studies, references, and index.Reviewed by Stephen Larson, PhD. Assistant Professor, Slippery Rock University of PAThe Basics of Digital Forensics: The Primer for Getting Started in Digital Forensics is well-named–it really is very basic. And it should be, as the book’s intended audience includes entry-level digital forensics professionals and complimentary fields such as law enforcement, legal, and general information security. Though the copyright is 2012, some of the data is from 2009, and there is mention of estimates for 2010.(see PDF for full review
Promotion primer. Foerderfibel
Energy Technology Data Exchange (ETDEWEB)
1981-01-01
This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.
Low-copy nuclear primers and ycf1 primers in Cactaceae.
Franck, Alan R; Cochrane, Bruce J; Garey, James R
2012-10-01
To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.
CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.
Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei
2015-07-01
The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.
Bioinformatic tools for PCR Primer design
African Journals Online (AJOL)
ES
reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.
30 CFR 56.6304 - Primer protection.
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...
KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz
International Nuclear Information System (INIS)
Bowman, Stephen M.
2008-01-01
The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of
Avrupa Topluluğu Enstitüsü, Marmara Üniversitesi
2015-01-01
John Mitchell considers EU policies on energy supply security; Tera Allas on energy security of supply in the UK: the way forward; Peter Odell assesses public/private partnerships on the UKCS; Olivier Appert provides an overview of French energy policy.
Serber, Robert
2018-01-01
Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.
DEFF Research Database (Denmark)
Lund, Anders Henrik; Duch, M; Lovmand, J
1997-01-01
, but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....
MPprimer: a program for reliable multiplex PCR primer design
Directory of Open Access Journals (Sweden)
Wang Xiaolei
2010-03-01
Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.
International Nuclear Information System (INIS)
Flude, J.W.; Nicholas, J.R.
1991-04-01
This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs
Energy Technology Data Exchange (ETDEWEB)
Ni, Chun Chun
2009-11-16
Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.
St. John Photo of Peter St. John Peter St. John Researcher III-Chemical Engineering Peter.StJohn @nrel.gov | 303-384-7969 Orcid ID http://orcid.org/0000-0002-7928-3722 Education Peter St. John received his engineering from the University of California at Santa Barbara in 2015. During his Ph.D., St. John applied
Directory of Open Access Journals (Sweden)
Zdeňka Špiclová
2016-11-01
Full Text Available The article deals with two essential aspects of the policy of Queen Elizabeth I. — the enforcement of Protestantism as the state religion and the claim of the British Empire to the New World — and its justification in two famous works: the Faerie Queene by Edmund Spenser and Brytanici Imperii Limites by John Dee. They both used the character of King Arthur to support Queen Elizabeth’s policy.
Piñol, J; Mir, G; Gomez-Polo, P; Agustí, N
2015-07-01
The quantification of the biological diversity in environmental samples using high-throughput DNA sequencing is hindered by the PCR bias caused by variable primer-template mismatches of the individual species. In some dietary studies, there is the added problem that samples are enriched with predator DNA, so often a predator-specific blocking oligonucleotide is used to alleviate the problem. However, specific blocking oligonucleotides could coblock nontarget species to some degree. Here, we accurately estimate the extent of the PCR biases induced by universal and blocking primers on a mock community prepared with DNA of twelve species of terrestrial arthropods. We also compare universal and blocking primer biases with those induced by variable annealing temperature and number of PCR cycles. The results show that reads of all species were recovered after PCR enrichment at our control conditions (no blocking oligonucleotide, 45 °C annealing temperature and 40 cycles) and high-throughput sequencing. They also show that the four factors considered biased the final proportions of the species to some degree. Among these factors, the number of primer-template mismatches of each species had a disproportionate effect (up to five orders of magnitude) on the amplification efficiency. In particular, the number of primer-template mismatches explained most of the variation (~3/4) in the amplification efficiency of the species. The effect of blocking oligonucleotide concentration on nontarget species relative abundance was also significant, but less important (below one order of magnitude). Considering the results reported here, the quantitative potential of the technique is limited, and only qualitative results (the species list) are reliable, at least when targeting the barcoding COI region. © 2014 John Wiley & Sons Ltd.
MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling
Directory of Open Access Journals (Sweden)
Kitchen James L
2012-11-01
Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.
MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.
Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G
2012-11-05
Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.
Energy Technology Data Exchange (ETDEWEB)
2011-04-01
This fact sheet proposes a framework for how states and localities can build policy portfolios by first setting the stage for clean energy in the market with low cost policies, and then growing the market with successive policies until the need for financial incentives can be reduced and eventually eliminated.
High-speed measurement of firearm primer blast waves
Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy
2012-01-01
This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...
Bayesian models: A statistical primer for ecologists
Hobbs, N. Thompson; Hooten, Mevin B.
2015-01-01
Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models
HISTORICAL NOTE JOHN HUNTER (SURGEON) John Hunter FRS ...
African Journals Online (AJOL)
JOHN HUNTER (SURGEON). John Hunter FRS (13 February 1728-16 October 1793) was a Scottish surgeon, one of the most distinguished scientists and surgeons of his day. He was an early advocate of careful observation and scientific method in medicine. He was the husband of Anne Hunter, a teacher, friend and ...
Hexavalent Chromium IV-Free Primer Development
Alldredge, Michael J.; Buck, Amy L.
2015-01-01
Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.
Multiplexing Short Primers for Viral Family PCR
Energy Technology Data Exchange (ETDEWEB)
Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W
2008-06-26
We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.
International Nuclear Information System (INIS)
Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh
2013-01-01
To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education. John Stachel. Articles written in Resonance – Journal of Science Education. Volume 3 Issue 8 August 1998 pp 76-92 Reflections. Albert Einstein-The Man Behind the Myths · John Stachel · More Details Fulltext PDF ...
KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input
International Nuclear Information System (INIS)
Busch, R.D.
2003-01-01
The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a
Primer on spontaneous heating and pyrophoricity
Energy Technology Data Exchange (ETDEWEB)
1994-12-01
This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.
30 CFR 57.6304 - Primer protection.
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...
Arribas-Bel, Daniel; de Graaff, Thomas; Rey, Sergio J.
2017-01-01
This chapter (This manuscript is a chapter version of the original document, which is a reproducible online notebook. The entire, version-controlled project can be found online at: https://bitbucket.org/darribas/reproducible_john_snow.) presents an entirely reproducible spatial analysis of the
John Dewey in Mexico: A Shared Experience in the Rural World
Directory of Open Access Journals (Sweden)
Xóchil Taylor
2016-07-01
Full Text Available This work examines the influence of John Dewey’s ideas on the Mexican pedagogical theories and rural schools in the first decades of the twentieth century, and Dewey’s own experience in Mexico. We look at how Deweyan thought was expressed mainly through educational ideas that shaped the design of policies aimed at improving schooling in rural areas, promoting practices based on community-based «active learning». One of John Dewey’s peculiarities is that the American pedagogue had the opportunity to see how some of his main ideas were appropriated and implemented in the real world, generally in situations fuelled by the desire for social change. In the Mexican context in particular, such change was impelled by the social ideology of the Mexican Revolution, and the life stories of the protagonists of the ensuing pedagogical transformation, the conditions furthering the possibility of new education policies, and above all, the communities who participated in the material and symbolic construction of a new form of schooling are discussed.
Rust transformation/rust compatible primers
Emeric, Dario A.; Miller, Christopher E.
1993-01-01
Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.
76 FR 72731 - John Hancock Variable Insurance Trust, et al.; Notice of Application
2011-11-25
... each of these lines of credit is limited to the amount specified by fundamental investment restrictions... policies and fundamental investment limitations. Applicants assert that each John Hancock Fund's... SECURITIES AND EXCHANGE COMMISSION [Investment Company Act Release No. 29865; File No. 812-13621...
An iterative method for selecting degenerate multiplex PCR primers.
Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong
2007-01-01
Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.
Developing an Online Database of National and Sub-National Clean Energy Policies
Energy Technology Data Exchange (ETDEWEB)
Haynes, R.; Cross, S.; Heinemann, A.; Booth, S.
2014-06-01
The Database of State Incentives for Renewables and Efficiency (DSIRE) was established in 1995 to provide summaries of energy efficiency and renewable energy policies offered by the federal and state governments. This primer provides an overview of the major policy, research, and technical topics to be considered when creating a similar clean energy policy database and website.
Directory of Open Access Journals (Sweden)
Dunn Sade N
2008-06-01
Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.
Policy and System Approach (PSA: A primer
Directory of Open Access Journals (Sweden)
Chandrakant Lahariya
2017-01-01
Full Text Available A number of public health challenges have emerged at global and national level in the last two decades. The response to these challenges has rarely been swift and often “knee-jerk.” The national and state level program officials responsible for the activities often apportion the blame on weak health systems or fragmented health service delivery mechanisms, amongst other. In India, the viral illnesses (including those due to dengue and chikungunya are becoming the increasing realities. The Public health response of early identification, disease surveillance, reporting and the preventive and curative measures, remains suboptimal. The health challenges which require multidimensional interventions are usuallyattempted to be resolved through piece meal solutions. This article proposes “policy and system approach (PSA,” combining concepts of “Health in all policies” for intersectoral coordination and “health system approach” for intra-sectoral tackling of the emerging and existing health challenges.
Bioinformatic tools and guideline for PCR primer design | Abd ...
African Journals Online (AJOL)
Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...
Medium Caliber Lead-Free Electric Primer. Version 2
2012-09-01
2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in
The ethics of public policy RCTs: The principle of policy equipoise.
MacKay, Douglas
2018-01-01
In this article, I ask whether a principle analogous to the principle of clinical equipoise should govern the design and conduct of RCTs evaluating the effectiveness of policy interventions. I answer this question affirmatively, and introduce and defend the principle of policy equipoise. According to this principle, all arms of a policy RCT must be, at minimum, in a state of equipoise with the best proven policy that is also morally and practically attainable and sustainable. For all arms of a policy RCT, policy experts must either (1) reasonably disagree about whether the trial arms are more effective than this policy, or (2) know that they are. © 2017 John Wiley & Sons Ltd.
Pittard, Julian M.
2015-03-01
John Dyson was born on the 7th January 1941 in Meltham Mills, West Yorkshire, England, and later grew up in Harrogate and Leeds. The proudest moment of John's early life was meeting Freddie Trueman, who became one of the greatest fast bowlers of English cricket. John used a state scholarship to study at Kings College London, after hearing a radio lecture by D. M. McKay. He received a first class BSc Special Honours Degree in Physics in 1962, and began a Ph.D. at the University of Manchester Department of Astronomy after being attracted to astronomy by an article of Zdenek Kopal in the semi-popular journal New Scientist. John soon started work with Franz Kahn, and studied the possibility that the broad emission lines seen from the Orion Nebula were due to flows driven by the photoevaporation of neutral globules embedded in a HII region. John's thesis was entitled ``The Age and Dynamics of the Orion Nebula`` and he passed his oral examination on 28th February 1966.
What John Browne actually said at Stanford
International Nuclear Information System (INIS)
Anon.
1997-01-01
In May 1997, the Chief Executive of BP, John Browne, delivered a speech on global climate change at Stanford University, California. A shortened version of the speech is presented. BP have accepted the possibility of a link between greenhouse gas emissions and climate change and are basing their policies on that acceptance. The company is committed to a step-by-step process, involving both action to develop solutions and continuing research to improve knowledge, that will balance the requirements of economic development and environmental protection. Five specific steps are outlined. These are: the monitoring and controlling of carbon dioxide emissions in all aspects of the company's operations increasing the level of support given to continuing scientific work on climate change; technology transfer and joint implementation with other parties to limit and reduce net emission levels; the development of alternative energy sources, in particular, solar power; contributing to the public policy debate in search of wider global answers to the problem. (Author)
Simple sequence repeat marker loci discovery using SSR primer.
Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David
2004-06-12
Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/
Value for money assessment for public-private partnerships : a primer.
2015-01-01
This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.
MPI Enhancements in John the Ripper
International Nuclear Information System (INIS)
Sykes, Edward R; Lin, Michael; Skoczen, Wesley
2010-01-01
John the Ripper (JtR) is an open source software package commonly used by system administrators to enforce password policy. JtR is designed to attack (i.e., crack) passwords encrypted in a wide variety of commonly used formats. While parallel implementations of JtR exist, there are several limitations to them. This research reports on two distinct algorithms that enhance this password cracking tool using the Message Passing Interface. The first algorithm is a novel approach that uses numerous processors to crack one password by using an innovative approach to workload distribution. In this algorithm the candidate password is distributed to all participating processors and the word list is divided based on probability so that each processor has the same likelihood of cracking the password while eliminating overlapping operations. The second algorithm developed in this research involves dividing the passwords within a password file equally amongst available processors while ensuring load-balanced and fault-tolerant behavior. This paper describes John the Ripper, the design of these two algorithms and preliminary results. Given the same amount of time, the original JtR can crack 29 passwords, whereas our algorithms 1 and 2 can crack an additional 35 and 45 passwords respectively.
MPI Enhancements in John the Ripper
Sykes, Edward R.; Lin, Michael; Skoczen, Wesley
2010-11-01
John the Ripper (JtR) is an open source software package commonly used by system administrators to enforce password policy. JtR is designed to attack (i.e., crack) passwords encrypted in a wide variety of commonly used formats. While parallel implementations of JtR exist, there are several limitations to them. This research reports on two distinct algorithms that enhance this password cracking tool using the Message Passing Interface. The first algorithm is a novel approach that uses numerous processors to crack one password by using an innovative approach to workload distribution. In this algorithm the candidate password is distributed to all participating processors and the word list is divided based on probability so that each processor has the same likelihood of cracking the password while eliminating overlapping operations. The second algorithm developed in this research involves dividing the passwords within a password file equally amongst available processors while ensuring load-balanced and fault-tolerant behavior. This paper describes John the Ripper, the design of these two algorithms and preliminary results. Given the same amount of time, the original JtR can crack 29 passwords, whereas our algorithms 1 and 2 can crack an additional 35 and 45 passwords respectively.
Economics : pricing, demand, and economic efficiency : a primer.
2008-11-01
The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...
Antoniou, Grigoris; Harmelen, Frank van
2004-01-01
The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a
John Dewey: la experiencia estética como experiencia educativa
Directory of Open Access Journals (Sweden)
Diana Melisa Paredes Oviedo
2010-02-01
Full Text Available La experiencia estética se constituye en un elemento crucial para la obra de John Dewey. En primer lugar, este pensador recupera la idea de experiencia, en sentido amplio, referida a los procesos conscientes realizados por el ser humano. En segundo lugar, esta experiencia aparece como resultado de la interacción de los hombres con su entorno, de tal modo que se amplían las valoraciones que aquellos tienen acerca de éste. En tercer lugar, la experiencia tiene elementos analíticos y sintéticos que posibilitan cualificar los procesos cognitivos y cognoscitivos de los individuos. En cuarto lugar, la experiencia se clasifica de acuerdo a su función en intelectual, práctica y estética, siendo la última la más importante, en tanto que, se muestra como más universal y ampliada frente a las otras, y se comporta como experiencia educativa al ser la que cualifica de manera más profunda los juicios críticos que se hacen frente al mundo.Los anteriores aspectos serán trabajados en este artículo, con miras a explorar la universalidad de la experiencia estética deweyana y sus derivaciones en el campo de una propuesta educativa, en la que resulta de vital importancia la existencia de una experiencia común entre los diferentes grupos humanos para lograr configurar la inteligencia común que es la base para la educación en John Dewey.
Energy Technology Data Exchange (ETDEWEB)
Dan Arthur; Bruce Langhus; Jon Seekins
2005-05-25
During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education. John P Craig. Articles written in Resonance – Journal of Science Education. Volume 17 Issue 10 October 2012 pp 924-925 Article-in-a-Box. S N De - An Appreciation · John P Craig · More Details Fulltext PDF ...
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education. A John Wilson. Articles written in Resonance – Journal of Science Education. Volume 11 Issue 7 July 2006 pp 70-76 Classroom. Inverting Matrices Constructed from Roots of Unity · A John Wilson · More Details Fulltext PDF ...
John Foster Dulles, his medical history and its impact on Cold War politics.
Pappas, Theodore N; Willett, Christopher G
2018-01-01
John Foster Dulles was the United States Secretary of State during the administration of President Dwight D Eisenhower. At the height of the Cold War, Dulles was Eisenhower's emissary, traveling over 450,000 international miles, leading United States foreign policy. In November of 1956, during an international crisis involving the Suez Canal, Dulles became ill and underwent an operation for a perforated colon cancer. During much of his impactful term as Secretary of State, Dulles was being treated for this cancer that ultimately resulted in his death in May of 1959. This paper highlights the medical care of John Foster Dulles and the global events during his illness.
Quick spacecraft charging primer
International Nuclear Information System (INIS)
Larsen, Brian Arthur
2014-01-01
This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.
Primer design for a prokaryotic differential display RT-PCR.
Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H
1997-05-01
We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.
Climate Change, Health, and Communication: A Primer.
Chadwick, Amy E
2016-01-01
Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.
The National Origins of Policy Ideas
DEFF Research Database (Denmark)
Campbell, John L.; Pedersen, Ove K.
2014-01-01
In this article John Campbell and Ove Pedersen argue that the way policy ideas are generated by knowledge regimes varies considerably across countries; and the effect on national politics is significant. The article is adapted from The National Origins of Policy Ideas: Knowledge Regimes...
Marketing Information Products and Services : A Primer for ...
International Development Research Centre (IDRC) Digital Library (Canada)
Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...
An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET
Energy Technology Data Exchange (ETDEWEB)
Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)
2011-01-15
Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.
Microsatellite primers for fungus-growing ants
DEFF Research Database (Denmark)
Villesen, Palle; Gertsch, P J; Boomsma, JJ
2002-01-01
We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....
Microsatellite Primers for Fungus-Growing Ants
DEFF Research Database (Denmark)
Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)
2002-01-01
We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....
Arciniegas P., Carlos
2002-01-01
En el presente trabajo se propone un modelo de plan estratégico, cuya aplicación se sugiere en la empresa Ponce Yepes S.A., con el objetivo de conseguir una eficiente y eficaz gestión de inventarios para la Línea de Repuestos John Deere. El estudio se ha dividido en tres capítulos, en los cuales se van estructurando progresivamente las diferentes etapas para el establecimiento del plan estratégico que se propone. El primer capítulo contiene un resumen teórico sobre la administr...
Gafaranga, Joseph; Niyomugabo, Cyprien; Uwizeyimana, Valentin
2013-01-01
An invitation to integrate macro and micro level analyses has been extended to researchers as this integration is felt to be the way forward for language policy research (Ricento, Ideology, politics and language policies: Focus on english, John Benjamins, Amsterdam, 2000). In turn, the notion of 'micro' in language policy has been specified as…
A physicists guide to The Los Alamos Primer
International Nuclear Information System (INIS)
Reed, B Cameron
2016-01-01
In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)
Foreword: Sir John Pendry FRS Sir John Pendry FRS
Inglesfield, John; Echenique, Pedro
2008-07-01
John Pendry John Inglesfield and Pedro Echenique write: John Pendry's 65th birthday is on 4 July 2008, and this issue of the Journal of Physics: Condensed Matter is dedicated to him, with articles by friends, colleagues, and former students. By any standards, John Pendry is a great scientist, who has made—and continues to make—an enormous contribution to physics; the wide range of his interests is reflected in the scope of these articles. Not many scientists can establish a completely new and unexpected area of research, but this has been John's achievement in the last few years in the field of metamaterials, materials whose electromagnetic properties depend on their structure rather than the materials of which the structure is built. In this way, structures with effectively negative electrical permittivity and negative magnetic permeability can be constructed, demonstrating negative refraction; through metamaterials scientists now have access to properties not found in nature, and never previously explored experimentally. Never a week goes by without a potential new application of metamaterials, whether it is perfect lensing, or the cloak of invisibility. This has certainly led to tremendous visibility for John himself, with guest lectures all over the world, and radio and television appearances. John Pendry's first paper was published exactly 40 years ago, 'Analytic properties of pseudopotentials' [1], and since then he has published 310 articles at the latest count. But this first paper already reflected something of the way John works. His PhD project, with Volker Heine at the Cavendish Laboratory, was to interpret the scattering of low energy electrons from surfaces, the technique of LEED which was to become the method of choice for determining surface structure. Although the energy of the electrons in LEED is relatively low—say 50 eV—it is much higher than the energy of the conduction electrons, for which pseudopotentials had been devised, and John
The herb St. John's Wort is believed to be helpful in relieving mild to moderate depression, but should only be taken under a physician's supervision. St. John's Wort may clash with other medications or ...
Chinchilla-Brenes, Sonia; Sánchez-Oller, Sylvia
2001-01-01
Proyecto de Investigación El problema de la deserción estudiantil es un fenómeno mundial que involucra principalmente a alumnos de primer ingreso a los centros educativos y de manera particular a las instituciones de educación superior las cuales reportan índices de deserción de alrededor del 30% en el primer año. Ante esta situación se hace necesaria la atención de la población de primer ingreso con programas específicos que acompañen a los y las estudiantes en este proceso de ajuste al m...
RUCS: Rapid identification of PCR primers for unique core sequences
DEFF Research Database (Denmark)
Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik
2017-01-01
Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...
Do we need primer for orthodontic bonding? A randomized controlled trial.
Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R
2015-04-01
To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown
Primer on consumer marketing research : procedures, methods, and tools
1994-03-01
The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...
Primer on electricity futures and other derivatives
International Nuclear Information System (INIS)
Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.
1998-01-01
Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area
Primer on electricity futures and other derivatives
Energy Technology Data Exchange (ETDEWEB)
Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.
1998-01-01
Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.
Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum
Directory of Open Access Journals (Sweden)
Ma Xiaoying
2017-02-01
Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.
Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.
Directory of Open Access Journals (Sweden)
Andrea Fuso
Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.
Criticality calculations with MCNP trademark: A primer
International Nuclear Information System (INIS)
Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.
1994-01-01
With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand
Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.
2012-01-01
DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820
UniPrime2: a web service providing easier Universal Primer design.
Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C
2009-07-01
The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.
Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.
Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis
2018-03-01
Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.
Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok
2018-03-01
We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.
P.P. Wakker (Peter)
1994-01-01
textabstractJohn Quiggin is a professor at the centre for Economic Policy Research of the Australian National University. His research interests are decision making under risk and agricultural economics. The reviewer is an associate professor at the Medical Decision Making Unit, University of
Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings
DEFF Research Database (Denmark)
Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere
2014-01-01
, either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...
A database of PCR primers for the chloroplast genomes of higher plants
Heinze, Berthold
2007-01-01
Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828
A database of PCR primers for the chloroplast genomes of higher plants
Directory of Open Access Journals (Sweden)
Heinze Berthold
2007-02-01
Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.
Directory of Open Access Journals (Sweden)
Puntipar Sonthiphand
Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library
The ability of T2/B4 primers to detect Leishmania infantum among ...
African Journals Online (AJOL)
SERVER
2008-04-03
Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...
Universal primers that amplify RNA from all three flavivirus subgroups
Directory of Open Access Journals (Sweden)
Barnard Ross T
2008-01-01
Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.
Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.
Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G
2013-09-01
New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.
Directory of Open Access Journals (Sweden)
Ni Luh Putu Indi Dharmayanti
2016-07-01
Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.
Clopton, Robert W.
2015-01-01
The subject of the annual Presidential address of Phi Kappa Phi, presented on May 8, 1962, was John Dewey. Dewey is identified in the public mind chiefly as an educational philosopher. In this address, the author describes the life and work of John Dewey as an indefatigable student of life whose interests ranged, like those of Aristotle, over the…
Design of a Percussion and Electric Primer Gun Firing Power Supply
2014-07-01
solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply
Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R
2013-06-06
Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.
Comparison of shear bond strength of orthodontic brackets using various zirconia primers.
Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju
2015-07-01
The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.
Bioinformatic tools for PCR Primer design
African Journals Online (AJOL)
ES
Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.
Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples
Directory of Open Access Journals (Sweden)
Alexandre R. Zuntini
2013-08-01
Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.
Real-time PCR (qPCR) primer design using free online software.
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.
Yetter, Carol J.
2009-01-01
This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…
DNA Extraction and Primer Selection
DEFF Research Database (Denmark)
Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads
Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...
International Nuclear Information System (INIS)
Moriyasu, K.
1981-01-01
A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)
GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.
Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart
2011-01-01
The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.
Tools for Ultraspecific Probe/Primer Design
National Research Council Canada - National Science Library
Fofanov, Yurly
2006-01-01
.... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...
Diversity of internal structures in inhibited epoxy primers
Directory of Open Access Journals (Sweden)
Anthony E. Hughes
2015-10-01
Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.
Shaping Policy Change in Population Health: Policy Entrepreneurs, Ideas, and Institutions.
Béland, Daniel; Katapally, Tarun R
2018-01-14
Political realities and institutional structures are often ignored when gathering evidence to influence population health policies. If these policies are to be successful, social science literature on policy change should be integrated into the population health approach. In this contribution, drawing on the work of John W. Kingdon and related scholarship, we set out to examine how key components of the policy change literature could contribute towards the effective development of population health policies. Shaping policy change would require a realignment of the existing school of thought, where the contribution of population health seems to end at knowledge translation. Through our critical analysis of selected literature, we extend recommendations to advance a burgeoning discussion in adopting new approaches to successfully implement evidence-informed population health policies. © 2018 The Author(s); Published by Kerman University of Medical Sciences. This is an open-access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Knowledge to Policy: Making the Most of Development Research ...
International Development Research Centre (IDRC) Digital Library (Canada)
5 avr. 2009 ... A major contribution to an understudied, poorly understood, but critical aspect of development. — John Young, Director of Programmes, Research and Policy in Development Group (RAPID), Overseas Development Institute, London. Does research influence public policy and decision-making and, if so, ...
Preparation and Characterization of Acrylic Primer for Concrete Substrate Application
Directory of Open Access Journals (Sweden)
El-Sayed Negim
2016-01-01
Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.
Book in three volumes of dr. John Puricha: Theology and pedagogy of St. John Chrysostom
Directory of Open Access Journals (Sweden)
Parlić-Božović Jasna Lj.
2011-01-01
Full Text Available Before the is latest work of Bishop Dr John Puric, by its importance, analytically decorated works, an impressive and voluminous number of facts happy including pedagogical Serbian public. Specifically, our pedagogical public is missing in this way displayed the Orthodox point of view of observation pedagogical crown and top categories. Episkom John was the there / volume work attempted to provide the interested reader the personality profile of any precise data from the conception of St. John Crisostom by looking at the same time as its pedagogy, and theology. Moreover these two concepts and bringing them to their assence, John episcope them actually connects into one inseparable unity. Therefore, this work has a multiple value and importance esportance especially for educators, who have not tried or had the oppotunality to see and understand the pedagogy of Orthodox theology in general, decorated with the ideas of Saint John Chrysostom special. Mindfullpeace as heir and successor creative Cappadocia 'novonikejske' trijadologije, St. John Chrystom recognizes the statut of Divine pedagogy educational philanthropy and philanthropic saving of pedagogy in each of the three Divine Persons. God the Father is this part, written by Bishop John, and from the perspective of John Chrysostom, is uncreated and unborn educationak philanthropy source of grace of the Holy Trinity. God the Son, and of the Father, uncreated etrinilly born, only begotten Son of God, newborn Logos, Jesus Christ the God/ man, BewAdam is alive and saving, hypostatic Ikonomija God, great mystery of the faith- God is reported in the body, the Divine Krishna- resurrect pedagogy, in which the comic-eschatologiocal Body, Church of Heaven and Earth, The Secret New Substances contain - the salvation of all creation, all creatures animate and inanimate. The salvation of man and the world, in the Divine dispensation and the pedagogy of salvation invation involve all there persons of the Holy
DEFF Research Database (Denmark)
Raussen, Martin; Skau, Christian
2012-01-01
This interview was given by Professor John Milnor in connection to the Abel Prize 2011 ceremony. Originally the interview appeared in the September issue of the Newsletter of the European Mathematical Society......This interview was given by Professor John Milnor in connection to the Abel Prize 2011 ceremony. Originally the interview appeared in the September issue of the Newsletter of the European Mathematical Society...
Bond strength of compomers to dentin using acidic primers.
Tate, W H; You, C; Powers, J M
1999-10-01
To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.
Directory of Open Access Journals (Sweden)
Jonathan Hill
2004-03-01
Full Text Available This interview aims at assessing the internal organisation of the Conservative Party and how policy making, election campaigning and communication strategy are worked out. Its purpose is also to suggest the political advisers’ role and influence in these three domains.David Haigron: There are two issues I would like to broach with you. My first question is about your role as a member of the Policy Unit and as John Major’s Political Secretary. And the second aspect I would like to talk about w...
Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael
2014-01-01
Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...
A Primer on Alberta’s Oil sands Royalties
Directory of Open Access Journals (Sweden)
Sarah Dobson
2015-12-01
Full Text Available Fulfilling its campaign promise, the new NDP government announced a review of Alberta’s royalty framework in June 2015. The province receives royalty revenue from three main sources – natural gas, crude oil, and oil sands. Since the 2009-10 fiscal year the largest contributor to Alberta’s royalty revenues has been the oil sands. If you want a sense of how important oil sands royalties have been for Alberta’s finances, consider this: In the 2014–15 fiscal year, the government collected just over $5 billion from oil sands royalties. These royalties covered over 10 per cent of the province’s operational expenses of $48.6 billion in the same fiscal year. Over the last six fiscal years the oil sands have contributed an average of 10 per cent of revenues to provincial coffers. This makes oil sands royalties the fourth largest contributor behind personal income taxes (23 per cent, federal transfers (13 per cent and corporate income taxes (11 per cent. But how many Albertans really understand how the royalty system works? What do we mean when we say “royalty”? How does the Alberta Government calculate royalties on oil sands producers? If the system is going to change, it’s important that Albertans understand how the current system works. That is what this paper is designed to do. For Albertans to properly judge the impact of new policy, they need a solid understanding of the current policy environment. We all know that oil prices have dropped and oil sands producers are losing profitability. As such, changes to the royalty system could have a deep and profound impact on the sector. Here are some of the issues this primer will study: • Pre-payout projects vs. post-payout projects, in other words, the classification of projects for royalty purposes based on whether the cumulative costs of a project exceed its cumulative revenues • Monthly payment of royalties vs. annual payment • Understanding the unit price of bitumen and how that
Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae
Directory of Open Access Journals (Sweden)
Francesco Dal Grande
2013-03-01
Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.
40 CFR 63.745 - Standards: Primer and topcoat application operations.
2010-07-01
... CATEGORIES (CONTINUED) National Emission Standards for Aerospace Manufacturing and Rework Facilities § 63.745.../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g... (4.5 lb/gal) of primer (less water and exempt solvents), as applied, for general aviation rework...
John Van Reenen
2011-01-01
In the last CentrePiece, John Van Reenen stressed the importance of competition and labour market flexibility for productivity growth. His latest in CEP's 'big ideas' series describes the impact of research on how policy-makers can influence innovation more directly - through tax credits for business spending on research and development.
Sommer, Alfred
2016-03-01
During its first century, the Johns Hopkins University Bloomberg School of Public Health has been home to several faculty members who have played leading roles in defining and expanding the field and science of epidemiology. They have done so by training leaders in the field, creating new methods and applications, and making relevant discoveries in the worlds of infectious and chronic diseases. These methodologic innovations and discoveries underlie many of today's major health policies and practices. © The Author 2016. Published by Oxford University Press on behalf of the Johns Hopkins Bloomberg School of Public Health. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou
2016-11-01
It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.
Cheng, Yu-Huei
2014-12-01
Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.
John Donne no Brasil John Donne no Brasil
Directory of Open Access Journals (Sweden)
Jose Garcez Ghirardi
2008-04-01
Full Text Available O leitor fica sem saber a troco do que John Donne lhe surge de repente, num virar de página, e através de períodos que parecem responder a uma pergunta que não foi formulada.(... Ninguém, nem o Sr. Afrânio Coutinho falara, até então, de John Donne,(.... Simplesmente, esse trecho, como inúmeros outros (quase todos do livro, revela que leituras apaixonantes obrigaram o professor Afrânio Coutinho a tomar em seu caderno alguns apontamentos eruditos. (MARTINS 1983 vol.I: 621 A citação acima, extraída de um artigo de Wilson Martins (in O Estado de São Paulo, 25/02/54, ilustra bem a posição reservada a John Donne, até então, por aqueles que, no Brasil, se dedicavam aos estudos de literatura. “A troco do que” - perguntava o autor - deveria ser o leitor de Correntes Cruzadas confrontado com o nome de Donne? Quem, até aquele momento, dele se ocupara? Ninguém, respondia o erudito articulista (nem mesmo o Sr. Afrânio Coutinho, embora reconhecendo que o nome do poeta pudesse ter sido fonte de algumas “leituras apaixonantes” . Interessava-lhe apontar enfaticamente, porém, que a lembrança de Donne surgia de maneira gratuita, desligada de qualquer argumentação ou contexto que a preparas se ou justificasse. Não apenas Afrânio Coutinho silenciara sobre a obra de Donne em seu livro; ninguém, de fato, havia, até aquele momento, dedicado, ao poeta, qualquer atenção mais demorada. Curiosamente, o próprio artigo, assim como o livro nele discutido, atestava, no entanto, que o esquecimento do nome de Donne estava por findar.
The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.
Zellweger, Polle T.; Mackinlay, Jock D.
A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…
Targeted reduction of highly abundant transcripts using pseudo-random primers.
Arnaud, Ophélie; Kato, Sachi; Poulain, Stéphane; Plessy, Charles
2016-04-01
Transcriptome studies based on quantitative sequencing can estimate levels of gene expression by measuring target RNA abundance in sequencing libraries. Sequencing costs are proportional to the total number of sequenced reads, and in order to cover rare RNAs, considerable quantities of abundant and identical reads are needed. This major limitation can be addressed by depleting a proportion of the most abundant sequences from the library. However, such depletion strategies involve either extra handling of the input RNA sample or use of a large number of reverse transcription primers, termed not-so-random (NSR) primers, which are costly to synthesize. Taking advantage of the high tolerance of reverse transcriptase to mis-prime, we found that it is possible to use as few as 40 pseudo-random (PS) reverse transcription primers to decrease the rate of undesirable abundant sequences within a library without affecting the overall transcriptome diversity. PS primers are simple to design and can be used to deplete several undesirable RNAs simultaneously, thus creating a flexible tool for enriching transcriptome libraries for rare transcript sequences.
Defense Primer: DOD Contractors
2017-02-10
functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel
Wakker, Peter
1994-01-01
textabstractJohn Quiggin is a professor at the centre for Economic Policy Research of the Australian National University. His research interests are decision making under risk and agricultural economics. The reviewer is an associate professor at the Medical Decision Making Unit, University of Leiden, Leiden, The Netherlands. His main interest is decision making under uncertainty.
2005-01-01
A few weeks ago John Lindsay passed away unexpectedly at his home in St. Genis. With his death we have lost a pioneer in detector electronics and one of the founding fathers of the CERN Electronics Group. John came to CERN in 1956 to join the Electronics Group, which was being formed in the SC Division. He thus participated from the beginning in the design, development, production, commissioning and support of electronics for the experiments at the CERN accelerators, initially at the SC and finally at the SPS. From the University of Glasgow he brought his expertise on pulse height analyzers, which were called kick sorters in those days, and did pioneering work with it in the early CERN experiments. He designed read-out systems for successive generations of detectors, such as wire spark chambers, multiwire proportional chambers, calorimeters, etc., often coming up with innovative solutions. Surely one of his finest moments must have been when he worked on complex detector systems, such as liquid argon calo...
Directory of Open Access Journals (Sweden)
Li Kelvin
2012-11-01
Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus
Freshwater Wetlands: A Citizen's Primer.
Catskill Center for Conservation and Development, Inc., Hobart, NY.
The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…
Quantitative Microbial Risk Assessment Tutorial - Primer
This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...
A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics
DEFF Research Database (Denmark)
Busk, Peter Kamp
2014-01-01
of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...
WIT Diversity Talk with John Ellis
CERN. Geneva; Ellis, Jonathan R.
2017-01-01
Sudeshna Datta Cockerill, CERN Ombudsperson, will interview John Ellis, a renown British theoretical physicist with a long career both at CERN and externally. John Ellis has also been awarded several prizes for his work in physics. Among many other outstanding roles and positions, he was Division Leader of the Theory Division at CERN from 1988-1994. John Ellis is currently Clerk Maxwell Professor of Theoretical Physics at King's College London.
Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.
Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela
2014-08-01
Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.
Sensory reception of the primer pheromone ethyl oleate
Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang
2012-05-01
Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.
The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers
Danford, M. D.; Mendrek, M. J.; Walsh, D. W.
1995-01-01
The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.
PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.
Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong
2015-01-01
Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.
GST-PRIME: an algorithm for genome-wide primer design.
Leister, Dario; Varotto, Claudio
2007-01-01
The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.
DEFF Research Database (Denmark)
Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine
2015-01-01
) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...
Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.
Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe
2018-01-17
In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.
Obituary: John Louis Perdrix, 1926-2005
Orchiston, D. Wayne
2006-12-01
John Perdrix, astronomical historian and co-founder of the Journal of Astronomical History and Heritage, died on 27 June 2005. John Louis Perdrix was born in Adelaide, Australia, on 30 June 1926. After studying chemistry at Melbourne Technical College and working in industry, he joined the Commonwealth Scientific and Industrial Research Organisation's Division of Minerals and Geochemistry. In 1974 the Division relocated to the Western Australian capital, Perth, and John spent the rest of his working life there involved in geochemical research. From his teenage years John had a passion for astronomy, which he fine-tuned through the Astronomical Society of Victoria and the Victorian Branch of the British Astronomical Association. He was very active in both groups, serving as President of the former and Secretary/Treasurer of the latter. He was also an FRAS, and a member of the AAS, the BAA parent body, and the IAU (Commission 41)?no mean feat for an Australian amateur astronomer. Throughout his life, he was a strong advocate of close amateur-professional relations. John's main research interest was history of astronomy, and over the years he wrote a succession of research papers, mainly about aspects of Australian astronomy. His well-researched and neatly-illustrated papers on the Melbourne Observatory and the Great Melbourne Telescope are classics, and when the Observatory's future was in the balance they played a key role in the State Government's decision to convert this unique facility into a museum precinct. To support his research activities, John built up an amazing library that developed its own distinctive personality and quickly took over his house and garage before invading commercial storage facilities! Apart from writing papers, John had an even greater passion for editing and publishing. From 1985 to 1997 he produced the Australian Journal of Astronomy, and in 1998 this was replaced by the Journal of Astronomical History and Heritage (JAH2). Both
Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer
Directory of Open Access Journals (Sweden)
Helen Hencida Thangamony
2018-01-01
Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.
Ekstrom, Claus Thorn
2011-01-01
Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i
Bhattacharya, N. C.
1974-01-01
This article takes a brief but critical look at John Dewey's version of pragmatism, his contribution to philosophical scholarship generally as well as his theory and practice of liberalism. (Author/RK)
Primer sets for cloning the human repertoire of T cell Receptor Variable regions.
Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele
2008-08-29
Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.
THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY
Directory of Open Access Journals (Sweden)
Prima Ditahardiyani
2008-01-01
Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.
Directory of Open Access Journals (Sweden)
Paul Rousseau
2015-11-01
Full Text Available In this series of short films made by Jonathan Law, the art historian James Boaden, and the curator of The John Deakin Archive, Paul Rousseau, discuss the double-exposure images made by the photographer John Deakin (1912-1972 in the 1950s and 1960s. The films ask you, firstly, to look closely at the images being discussed. Each one begins with a sustained and intense shot of a single image before opening up to a wide-ranging discussion about Deakin, double exposures, and photography.
Galkiewicz, Julia P; Kellogg, Christina A
2008-12-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.
Galkiewicz, Julia P.; Kellogg, Christina A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.
Directory of Open Access Journals (Sweden)
Vanessa Leclercq
2009-10-01
Full Text Available Public diplomacy was first implemented under the impulsion of John F. Kennedy and Edward R. Murrow by the United States Information Agency in the 1960s. This article emphasizes the critical role of public diplomacy in the fight against communism as well as the way the British authorities resorted to this concept almost forty years later to offer public opinion abroad a more modern and efficient image of the UK. In this perspective, it is legitimate to observe the evolution of both technology and the various media as well as to focus on Edward R. Murrow and Mark Leonard, Murrow’s British counterpart. Far from being mere communication, public diplomacy consists in the actual representation of a country’s policies and core values, and can therefore not avoid being assimilated to propaganda, even if it serves the noble purpose of information, not disinformation.
Molecular passportization of clones of karelian birch using PCRwith semi-specific primers
Directory of Open Access Journals (Sweden)
Tatyana V Matveeva
2008-09-01
Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.
John Leask Lumley: Whither Turbulence?
Leibovich, Sidney; Warhaft, Zellman
2018-01-01
John Lumley's contributions to the theory, modeling, and experiments on turbulent flows played a seminal role in the advancement of our understanding of this subject in the second half of the twentieth century. We discuss John's career and his personal style, including his love and deep knowledge of vintage wine and vintage cars. His intellectual contributions range from abstract theory to applied engineering. Here we discuss some of his major advances, focusing on second-order modeling, proper orthogonal decomposition, path-breaking experiments, research on geophysical turbulence, and important contributions to the understanding of drag reduction. John Lumley was also an influential teacher whose books and films have molded generations of students. These and other aspects of his professional career are described.
Galkiewicz, Julia P.; Kellogg, Christina A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299
Specific primer design of mitochondrial 12S rRNA for species identification in raw meats
Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.
2018-01-01
Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.
John Smithi kaks palet / Johannes Saar
Saar, Johannes, 1965-
2003-01-01
Näitus "John Smith. Marko ja Kaido" Tallinna Kunstihoones. Kaido Ole ja Marko Mäetamm esindavad rühmitusena "John Smith" Eestit 2003. a. Veneetsia biennaalil. Ilmunud ka kogumikus "Päevast päeva", lk. 90-96
El primer virreinato americano
Directory of Open Access Journals (Sweden)
Cassá, Roberto
2006-12-01
Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the
logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.
El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.
2006-01-01
Our friend and colleague John Strong was cruelly taken from us by a brain tumour on 31 July, a few days before his 65th birthday. John started his career and obtained his PhD in a group from Westfield College, initially working on experiments at Rutherford Appleton Laboratory (RAL). From the early 1970s onwards, however, his research was focused on experiments in CERN, with several particularly notable contributions. The Omega spectrometer adopted a system John had originally developed for experiments at RAL using vidicon cameras (a type of television camera) to record the sparks in the spark chambers. This highly automated system allowed Omega to be used in a similar way to bubble chambers. He contributed to the success of NA1 and NA7, where he became heavily involved in the electronic trigger systems. In these experiments the Westfield group joined forces with Italian colleagues to measure the form factors of the pion and the kaon, and the lifetime of some of the newly discovered charm particles. Such h...
Wickens, F
Our friend and colleague John Strong was cruelly taken from us by a brain tumour on Monday 31st July, a few days before his 65th birthday John started his career working with a group from Westfield College, under the leadership of Ted Bellamy. He obtained his PhD and spent the early part of his career on experiments at Rutherford Appleton Laboratory (RAL), but after the early 1970s his research was focussed on experiments in CERN. Over the years he made a number of notable contributions to experiments in CERN: The Omega spectrometer adopted a system John had originally developed for experiments at RAL using vidicon cameras to record the sparks in the spark chambers; He contributed to the success of NA1 and NA7, where he became heavily involved in the electronic trigger systems; He was responsible for the second level trigger system for the ALEPH detector and spent five years leading a team that designed and built the system, which ran for twelve years with only minor interventions. Following ALEPH he tur...
Obituary: John W. Firor (1927-2007)
Gilman, Peter A.
2009-12-01
John W. Firor, a former Director of the High Altitude Observatory and the National Center for Atmospheric Research, and a founder of the Solar Physics Division of the American Astronomical Society, died of Alzheimer's disease in Pullman, Washington on November 5, 2007, he was 80. He was born in Athens Georgia on October 18, 1927, where his father was a professor of agricultural economics. John had an unusually diverse scientific career. His interest in physics and astrophysics began while serving in the army, during which time he was assigned to the Los Alamos National Laboratory, where he guarded highly radioactive materials (many have heard him describe how informal the protections were compared to later times). After his service he returned to college and graduated in physics from Georgia Tech in 1949. He received his Ph.D. from the University of Chicago in 1954, writing his thesis on cosmic rays under John Simpson. John Firor would later remark that: "If you needed cosmic rays to actually do anything, you are sunk." That thought, partly in jest, may help explain his motivation for moving to so many new scientific and management pursuits. John moved from cosmic ray physics to radio astronomy (particularly of the Sun) when he began work at the Carnegie Institution of Washington's Department of Terrestrial Magnetism, where he remained until 1961. During this time, he met Walter Orr Roberts, then the Director of the High Altitude Observatory (HAO) in Boulder, Colorado. HAO was then affiliated with the University of Colorado. In 1959, a movement began to upgrade the atmospheric sciences in the United States by establishing a National Center, where the largest, most important atmospheric research problems could be addressed. Roberts became the first Director of NCAR, as well as the first president of the University Corporation for Atmospheric Research (UCAR), the consortium of universities that was commissioned to manage and staff the new Center. HAO became a
Sediment transport primer: estimating bed-material transport in gravel-bed rivers
Peter Wilcock; John Pitlick; Yantao Cui
2009-01-01
This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...
Caetano-Anollés, G; Gresshoff, P M
1996-06-01
DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.
Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae
Directory of Open Access Journals (Sweden)
Andrew L. Krohn
2013-07-01
Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.
In vivo effect of a self-etching primer on dentin.
Milia, E; Lallai, M R; García-Godoy, F
1999-08-01
To determine the ultrastructural aspects of the dentin collagen area in the cavity preparation floor produced in vivo after phosphoric acid acid-etching or after using Clearfil Liner Bond 2 self-etching primer (LB2 Primer). Twenty-four non-carious third molars scheduled for extraction from young adult patients (16-30 years old) were used. Conventional Class I cavities (+/- 2 mm deep) were prepared on the occlusal surfaces of all teeth using a cylindrical diamond bur on a high-speed handpiece with copious water spray. To avoid dehydration of the dentin, the smear layer-covered dentin was briefly air-dried for 2 seconds. Cavities were assigned at random to the following groups: Group A: Dentin etched for 15 seconds with 34% phosphoric acid, rinsed for 20 seconds and then briefly air-dried for 2 seconds with oil-free compressed air leaving the surfaces slightly moist. Group B: LB2 Primer was applied to the cavity surfaces for 30 seconds and then briefly air-dried to remove the solvent. Group C: The untreated dentin smear layer was used as a control. In all three groups, the cavities were filled incrementally with a resin-based composite (APX), light curing every increment for 40 seconds. After 30 minutes, the teeth were extracted atraumatically and the samples immediately prepared for evaluation with the transmission electron microscope. The use of a self-etching primer did not produce significant morphological changes in the moist dentin substrate. Adverse morphological conditions where observed when there was an excess water on the dentin surface. Phosphoric acid altered the collagen more severely than the self-etching primer.
Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito
2012-01-01
Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625
Directory of Open Access Journals (Sweden)
Jose Garcez Ghirardi
2008-04-01
Full Text Available O leitor fica sem saber a troco do que John Donne lhe surge de repente, num virar de página, e através de períodos que parecem responder a uma pergunta que não foi formulada.(... Ninguém, nem o Sr. Afrânio Coutinho falara, até então, de John Donne,(.... Simplesmente, esse trecho, como inúmeros outros (quase todos do livro, revela que leituras apaixonantes obrigaram o professor Afrânio Coutinho a tomar em seu caderno alguns apontamentos eruditos. (MARTINS 1983 vol.I:621
Directory of Open Access Journals (Sweden)
Martin Beránek
2012-01-01
Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.
Primer sets for cloning the human repertoire of T cell Receptor Variable regions
Directory of Open Access Journals (Sweden)
Santoro Claudio
2008-08-01
Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.
Genus-Specific Primers for Study of Fusarium Communities in Field Samples
Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna
2015-01-01
Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387
Galkiewicz, J.P.; Kellogg, C.A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.
Cryer, CW
2014-01-01
Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula
Majid, Shahn
2002-05-01
Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.
Directory of Open Access Journals (Sweden)
Wang Xiaowei
2008-12-01
Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.
John Stuart Mill, John Rawls y Amartya Sen, los tres nombres de la equidad
Directory of Open Access Journals (Sweden)
María Teresa Lopera
1997-07-01
Full Text Available Tres autores como John Stuart Mill, John Rawls y Amartia Sen son objeto de análisis en este artículo que estudia el tema de la equidad en un contexto que se caracteriza por el abandono casi generalizado del estudio de los valores en relación a los grandes problemas económicos; el artículo defiende como necesaria la recuperación de las preocupaciones éticas en la ciencia económica. La segunda parte, presenta una bibliografía reciente presentada como respuesta a la obra de John Rawls a partir de 1985, cuando este autor da el llamado giro desde su teoría de la justicia como equidad hacia un reciente liberalismo político, período de gran interés para comprender las discusiones actuales de la filosofía política y el futuro de la discusión interdisciplinaria con la economía.
Obituary: John Leroy Climenhaga, 1916-2008
Scarfe, Colin
2009-01-01
John Leroy Climenhaga was born on 7 November 1916 on a farm some 10 km from Delisle, a small town on the Canadian prairies, located about 50 km south-west of Saskatoon, Saskatchewan, and died at his home in Victoria, British Columbia, on 27 May 2008. His parents, Reuben and Elizabeth (nee Bert) Climenhaga, were farming folk, and he carried their honest and open attitude to the world throughout his life. John was the seventh born, and last to die, of their ten children. His father also served as an ordained minister of the Brethren in Christ. In early adulthood, John worked on his father's farm, but then attended the University of Saskatchewan, obtaining a B.A. with Honors in Mathematics and Physics and an M.A. in Physics, in 1945 and 1949 respectively. Between these events he worked as a Physics Instructor at Regina College from 1946 to 1948. In 1949 Climenhaga joined the faculty of Victoria College, as one of only two physicists in a small institution that was then part of the University of British Columbia. He remained in Victoria for the rest of his career, playing a major role in the College's growth into a full-fledged university, complete with thriving graduate programs in physics and astronomy as well as in many other fields. He served as Head of the Physics Department during the 1960s, a period which saw the College become the University of Victoria, with a full undergraduate program in Physics, and campaigned successfully for the establishment of a program in Astronomy, which began in 1965. From 1969 until 1972 he held the position of Dean of Arts and Science, and championed the university's participation in the Tri-University Meson Facility, whose high-current medium-energy beam was ideal for the production and study of mesons and their physics. That period was a turbulent one in the university's history, but John's integrity and his balanced and fair-minded approach to conflicts were of immeasurable importance in steering the young institution through it
Directory of Open Access Journals (Sweden)
Jose Garcez Ghirardi
2003-04-01
Full Text Available http://dx.doi.org/10.5007/2175-8026.2003n45p77 O leitor fica sem saber a troco do que John Donne lhe surge de repente, num virar de página, e através de períodos que parecem responder a uma pergunta que não foi formulada.(... Ninguém, nem o Sr. Afrânio Coutinho falara, até então, de John Donne,(.... Simplesmente, esse trecho, como inúmeros outros (quase todos do livro, revela que leituras apaixonantes obrigaram o professor Afrânio Coutinho a tomar em seu caderno alguns apontamentos eruditos. (MARTINS 1983 vol.I:621
Lenguaje, realidad social y poder: John Searle
Directory of Open Access Journals (Sweden)
Nelson Jair Cuchumbé Holguín
2012-01-01
Full Text Available En el artículo se analiza cómo John Searle explica la instauración o la destrucción del poder convencional. El punto de partida es que la explicación de Searle se sustenta en la idea del poder convencional, entendido como un acontecimiento único que hace parte de la realidad social constituida por el lenguaje, lo cual permite expresar que cuando un acto de habla performativo es realizado en circunstancias apropiadas por un agente se sigue la imposición de la función de estatus al acontecimiento, la comprensión de la fuerza explicativa de las reglas constitutivas, la ejecución de poderes deónticos y la creación de un nuevo hecho institucional. No obstante, tal formulación deja por fuera la actitud de riesgo de los participantes en la creación o destrucción de los poderes que componen los hechos institucionales. Para demostrar este punto de partida, en primer lugar, se ubica el aporte filosófico de Searle sobre el lenguaje en términos de la perspectiva pragmática. En segundo lugar, se muestra que desde el lenguaje la intencionalidad colectiva impone funciones de estatus que crean formas de poderes deónticos. Para concluir, se afirma que el mantenimiento o la destrucción del poder convencional no se agota en las reglas constitutivas ni en las funciones de estatus, sino que se complementa con la actitud de riesgo desarrollarla por los participantes en el momento en que hacen uso del lenguaje. El análisis de la información recogida, mediante la reseña crítica, se realizó utilizando herramientas del enfoque metodológico reconstructivo conceptual.
Scrimer: designing primers from transcriptome data
Czech Academy of Sciences Publication Activity Database
Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.
2015-01-01
Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education; Volume 18; Issue 1. John Archibald Wheeler - Man with Picturesque Imagination. Jayant V Narlikar. General Article Volume 18 Issue 1 January 2013 pp 22-28. Fulltext. Click here to view fulltext PDF. Permanent link:
Prunier, Rachel; Latimer, Andrew
2010-01-01
Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.
Profitability primer: a guide to profitability analysis in the electric power industry
International Nuclear Information System (INIS)
Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.
1996-06-01
As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated
Obituary: John Louis Africano III, 1951-2006
Barker, Edwin, S.
2007-12-01
The orbital debris, space surveillance, and astronomical communities lost a valued and beloved friend when John L. Africano passed away on July 27, 2006, at the young age of 55. John passed away in Honolulu, Hawaii, from complications following a heart attack suffered while playing racquetball, which was his avocation in life. Born on February 8, 1951, in Saint Louis, Missouri, John graduated with a B.S. in Physics from the University of Missouri at Saint Louis in 1973, and received a Master's degree in Astronomy from Vanderbilt University in 1974. John had a real love for astronomical observing and for conveying his many years of experience to others. He encouraged many young astronomers and mentored them in the basics of photometry and astronomical instrumentation. John was author or co-author on nearly one-hundred refereed publications ranging from analyses of cool stars to the timing of occultations to space surveillance. He was honored for his contributions to minor planet research when the Jet Propulsion Laboratory named Minor Planet 6391 (Africano) after him. John held operational staff positions at several major observatories including McDonald Observatory in Texas, Kitt Peak National Observatory in Arizona, and the Cloudcroft Telescope Facility in New Mexico. He observed at numerous observatories worldwide, including Cerro Tololo Inter-American Observatory (CTIO) in Chile, developing a world-wide network of friends and colleagues. John's ability to build diverse teams through his managerial and technical skills, not to mention his smiling personality, resulted in numerous successes in the observational astronomy and space surveillance arenas. As an astronomer for Boeing LTS Inc., he worked for many years at the Advanced Maui Optical and Space Surveillance site (AMOS) on Maui, Hawaii, where he contributed his operational and instrumental expertise to both the astronomy and space surveillance communities. He was also the co-organizer of the annual AMOS
Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G
2017-02-01
To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.
Temas de Física para Ingeniería: Primer principio de la termodinámica
Beléndez Vázquez, Augusto
1992-01-01
Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.
John locke on personal identity.
Nimbalkar, Namita
2011-01-01
John Locke speaks of personal identity and survival of consciousness after death. A criterion of personal identity through time is given. Such a criterion specifies, insofar as that is possible, the necessary and sufficient conditions for the survival of persons. John Locke holds that personal identity is a matter of psychological continuity. He considered personal identity (or the self) to be founded on consciousness (viz. memory), and not on the substance of either the soul or the body.
John Locke on Personal Identity**
Nimbalkar, Namita
2011-01-01
John Locke speaks of personal identity and survival of consciousness after death. A criterion of personal identity through time is given. Such a criterion specifies, insofar as that is possible, the necessary and sufficient conditions for the survival of persons. John Locke holds that personal identity is a matter of psychological continuity. He considered personal identity (or the self) to be founded on consciousness (viz. memory), and not on the substance of either the soul or the body.
A primer on motor vehicle air pollution.
1973-01-01
This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...
Primer on CDM programme of activities
Energy Technology Data Exchange (ETDEWEB)
Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)
2009-07-01
As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)
Bookshelf. John Adams biography
International Nuclear Information System (INIS)
Billinge, Roy
1993-01-01
Full text: When John Bertram Adams died on 3 March 1984, CERN lost one of its principal architects. The late Sir John Adams was a very private person who rarely confided in his colleagues. This made the job of his biographer particularly difficult. Michael Crowley- Milling has succeeded admirably, and has performed a very important service. Is it a potted history of CERN, or the story of the building of the PS, or of the SPS? Yes, all of these, but most of all it is a thoughtful and discerning biography and a fitting tribute to a veritable giant of European science and technology. The sub-title,' Engineer Extraordinary' refers not only to John's outstanding ability as a builder of accelerators, but perhaps even more importantly, as a builder of teams and an 'engineer of opinions'. The book describes how John's attention to detail and intuitive engineering skills developed during the early part of his career, when working in radar research, and how he emerged as a natural leader in the building of the CERN PS. Then later, how his statesmanship enabled him to ''...rescue it (the 300 GeV Programme) from seeming political disaster and nurse it through technical problems to a successful conclusion.'' One crucial part of this process described is the visit to CERN in 1970 by Margaret Thatcher, at that time UK Secretary of State for Education and Science, and her subsequent letters of thanks, not only to Bernard Gregory as Director General, but also to John. It is interesting to speculate to what extent the good impression made on that occasion helped many years later, when as Prime Minister Mrs Thatcher decided that Britain should stay in CERN! After the successful commissioning of the SPS, the book goes on to describe the period when the two CERN Laboratories were merged under two Directors General. Unfortunately I found this part a little too low key, given that John and Leon van Hove presided over what was undoubtedly
1993 in review: Science policy developments
Jones, Richard M.; Mockler, Susan Bucci
Looking back over 1993, here are some of the major policy developments affecting the geophysical sciences community:JANUARY: John Gibbons confirmed as Office of Science and Technology Policy director and President Clinton's science advisor… Walter Massey resigns as National Science Foundation director… Hazel O'Leary becomes Department of Energy secretary … House Science, Space and Technology Committee is reorganized, reducing its six subcommittees to five… NSF's Division of Polar Programs elevated to the Office of Polar Programs, now a part of the Office of the Director… Bruce Babbitt confirmed as Secretary of the Interior.
Forest Interpreter's Primer on Fire Management.
Zelker, Thomas M.
Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…
Designing for transportation management and operations : a primer.
2013-02-01
This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...
Evaluation of genetic diversity in open pollinated guava by iPBS primers
International Nuclear Information System (INIS)
Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.
2013-01-01
DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)
Titular Tilting in John Ashbery
DEFF Research Database (Denmark)
Balle, Søren Hattesen
2008-01-01
Among the numerous poems published by the American poet John Ashbery since his debut in 1956 one finds a few that specifically deal with the issue of entitlement. These poems do not appear in one single of his volumes, but are disseminated throughout Ashbery’s career and production. Their occurre......Among the numerous poems published by the American poet John Ashbery since his debut in 1956 one finds a few that specifically deal with the issue of entitlement. These poems do not appear in one single of his volumes, but are disseminated throughout Ashbery’s career and production....... Their occurrence neither follows any particular plan, nor do they form part of a larger poetic or thematic whole in the volumes where they have been published. Rather, they are perhaps better characterized as “typically atypical of Ashbery’s poetry” – to put it in paradoxical terms used by John Shoptaw in his 1994...
The UVM primer a step-by-step introduction to the universal verification methodology
Salemi, Ray
2013-01-01
The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.
A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets
Energy Technology Data Exchange (ETDEWEB)
Warwick, William M.
2002-06-03
This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.
Financial Incentives to Enable Clean Energy Deployment: Policy Overview and Good Practices
Energy Technology Data Exchange (ETDEWEB)
Cox, Sadie [National Renewable Energy Lab. (NREL), Golden, CO (United States)
2016-02-24
Financial incentives have been widely implemented by governments around the world to support scaled up deployment of renewable energy and energy efficiency technologies and practices. As of 2015, at least 48 countries have adopted financial incentives to support renewable energy and energy efficiency deployment. Broader clean energy strategies and plans provide a crucial foundation for financial incentives that often complement regulatory policies such as renewable energy targets, standards, and other mandates. This policy brief provides a primer on key financial incentive design elements, lessons from different country experiences, and curated support resources for more detailed and country-specific financial incentive design information.
First John structure resolved: Exegetical analysis, Part 2
Directory of Open Access Journals (Sweden)
Ron J. Bigalke
2013-11-01
Full Text Available Numerous attempts have been suggested regarding the structure of First John. The only nearly unanimous agreement amongst commentators is concerning the prologue (1:1–4 and the conclusion (5:13–21. The lack of unanimity can be frustrating for the majority of those who seek to understand the macrostructure of the First Epistle of John. Consequentially, some commentators have opined that it is impossible to determine a notable structure of First John, and the epistle is thus regarded as a relatively imprecise series of various thoughts that were composed on the basis of mere association. Many exegetes have therefore proposed suggested outlines to aid the understanding of First John as opposed to providing genuine efforts to articulate a discernable structure of the epistle. The final part of this exegetical analysis seeks to demonstrate that exegetes need not succumb to such pessimism because there does appear to be a discernable structure to First John. Providing and stating resolve concerning the First John structure is fundamental for understanding the revealed contents of the epistle.
Coastal erosion and beach nourishment in Scania as issues in Swedish coastal policy
Bontje, L.E.; Frederiksson, Caroline; Wang, Zilin; Slinger, J.H.
2016-01-01
This paper discusses the dynamics of coastal policy change in Sweden, using erosion and beach nourishments as an example. The Multiple Stream Model is a theoretical model on agenda setting and policy change developed by the political scientist John Kingdon (1984, 2003). This paper applies Kingdon’s
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education; Volume 10; Issue 11. John Maynard Smith (1920-2004). Featured Scientist Volume 10 Issue 11 November 2005 pp 110-110. Fulltext. Click here to view fulltext PDF. Permanent link: https://www.ias.ac.in/article/fulltext/reso/010/11/0110-0110. Resonance ...
Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo
Castillo Canales, Braulio
2017-01-01
En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...
Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer
Energy Technology Data Exchange (ETDEWEB)
Lucas, D.S.
2004-10-03
This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.
Móvil remisión de V. cinta del primer móvil.
2011-01-01
[ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.
John of Salisbury on Aristotelian Science
DEFF Research Database (Denmark)
Bloch, David
The First substantial treatment of John of Salisbury's views on Aristotelian science. Important for our understanding of the reception of Aristotle's works and for the history of theories of science.......The First substantial treatment of John of Salisbury's views on Aristotelian science. Important for our understanding of the reception of Aristotle's works and for the history of theories of science....
THE SHEFFIELD ALCOHOL POLICY MODEL - A MATHEMATICAL DESCRIPTION.
Brennan, Alan; Meier, Petra; Purshouse, Robin; Rafia, Rachid; Meng, Yang; Hill-Macmanus, Daniel; Angus, Colin; Holmes, John
2014-09-30
This methodology paper sets out a mathematical description of the Sheffield Alcohol Policy Model version 2.0, a model to evaluate public health strategies for alcohol harm reduction in the UK. Policies that can be appraised include a minimum price per unit of alcohol, restrictions on price discounting, and broader public health measures. The model estimates the impact on consumers, health services, crime, employers, retailers and government tax revenues. The synthesis of public and commercial data sources to inform the model structure is described. A detailed algebraic description of the model is provided. This involves quantifying baseline levels of alcohol purchasing and consumption by age and gender subgroups, estimating the impact of policies on consumption, for example, using evidence on price elasticities of demand for alcohol, quantification of risk functions relating alcohol consumption to harms including 47 health conditions, crimes, absenteeism and unemployment, and finally monetary valuation of the consequences. The results framework, shown for a minimum price per unit of alcohol, has been used to provide policy appraisals for the UK government policy-makers. In discussion and online appendix, we explore issues around valuation and scope, limitations of evidence/data, how the framework can be adapted to other countries and decisions, and ongoing plans for further development. © 2014 The Authors. Health Economics published by John Wiley & Sons Ltd. © 2014 The Authors. Health Economics published by John Wiley & Sons Ltd.
Leopold, Luna Bergere; Langbein, Walter Basil
1960-01-01
When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to
Energy Technology Data Exchange (ETDEWEB)
Zhang, Xuan; Zhang, Xiaofeng; Yan, Yue; Zhong, Yanli; Li, Lei; Zhang, Guanli [Beijing Institute of Aeronautical Materials (BIAM), Haidian District, Beijing, 100095 (China)
2015-04-01
A silicone-based primer layer was developed to improve the adhesion and thermal stability of amorphous transparent indium zinc oxide (IZO) films on polycarbonate (PC). The IZO films deposited by direct current magnetron sputtering at room temperature on primer-treated and untreated PCs were evaluated ex situ in terms of surface morphology, adhesion, optical, and electrical properties during annealing at 120 C in air. Nano-scratch tests indicated the adhesion of IZO films on primer-treated substrates was superior to that on untreated PCs. This superior adhesion can be attributed to the strong Si-O-Si inorganic bonds abundant in the primer layer and better matches of the primer layer in the terms of thermal expansion to the IZO. Moreover, the electrical resistivity of IZO films prepared on primer-treated PCs remained stable during the annealing treatment, whereas those of IZO films on untreated PCs presented a continuously increasing trend, which was attributed to the decrease in carrier concentration that resulted from oxygen adsorption. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
Directory of Open Access Journals (Sweden)
Christopher Ryan Penton
2013-09-01
Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.
Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen
2015-09-01
Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.
Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants
Directory of Open Access Journals (Sweden)
Aleksić Jelena M.
2016-01-01
Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005
D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto
2018-02-01
Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.
The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings
Energy Technology Data Exchange (ETDEWEB)
Lech, L.M. [DuPont, Parkersburg, WV (United States)
1999-11-01
Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.
Nudges, shoves and budges: Behavioural economic policy frameworks.
Oliver, Adam
2018-01-01
Behavioural economics-the study of human decision making and how it sometimes deviates systematically from the assumptions of standard economic theory-has attracted a lot of attention in the health policy discourse over recent years. Many appear to believe that behavioural economic findings can be used only to help inform policies that manipulate the choices made by citizens, ie, the so-called nudge policy. However, these findings can be used to inform several different policy frameworks, from seemingly innocuous liberty-preserving changes to the contexts people operate in, to the outlawing of certain corporate behaviours. This article depicts diagrammatically, with the aid of a "behavioural policy cube" and in relation to smoking cessation interventions, the conceptual parameters of several behavioural economic-informed policy frameworks, which could be easily extended to other areas of health, and indeed broader public, policy. Copyright © 2017 John Wiley & Sons, Ltd.
Leonhardt, U.
2001-01-01
Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...
Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers
DEFF Research Database (Denmark)
Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.
2011-01-01
BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...
The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy
Energy Technology Data Exchange (ETDEWEB)
Lu Xiangyu [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zuo Yu, E-mail: zuoy@mail.buct.edu.c [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zhao Xuhui; Tang Yuming; Feng Xingguo [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China)
2011-01-15
Research highlights: {yields} A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. {yields} The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. {yields} EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R{sub ct} at the magnesium particle/coating interface decreased and the double-layer capacitance Q{sub dl} increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH){sub 2} in the coating also provided some degree of barrier protection.
The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy
International Nuclear Information System (INIS)
Lu Xiangyu; Zuo Yu; Zhao Xuhui; Tang Yuming; Feng Xingguo
2011-01-01
Research highlights: → A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. → The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. → EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R ct at the magnesium particle/coating interface decreased and the double-layer capacitance Q dl increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH) 2 in the coating also provided some degree of barrier protection.
Liu, Xiaojing; Locasale, Jason W
2017-04-01
Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.
John Calvin and John Locke on the Sensus Divinitatis and Innatism
Directory of Open Access Journals (Sweden)
J. Caleb Clanton
2017-02-01
Full Text Available Inheritors of the Calvinist Reformed tradition have long disagreed about whether knowledge of God’s nature and existence can be or need be acquired inferentially by means of the standard arguments of natural theology. Nonetheless, they have traditionally coalesced around the thought that some sense or awareness of God is naturally implanted or innate in human beings. A root of this orientation can be found in John Calvin’s discussion of the sensus divinitatis in the first book of The Institutes of the Christian Religion. This paper outlines a pedagogical strategy for organizing and evaluating Calvin’s treatment of the sensus divinitatis, chiefly by putting it in tension with John Locke’s polemic against innatism in Book I of An Essay concerning Human Understanding. I begin by reconstructing Calvin’s depiction of the sensus divinitatis, as well as his case for thinking that it is innate. I then explain how Locke’s critique of innatism offers a fairly direct response to Calvin and, hence, a useful framework for exploring the limits of Calvin’s treatment of the sensus divinitatis.
Sassis tuumamajandus / John Carey
Carey, John
2008-01-01
USA presidendikandidaadi John McCaini energeetikakava kohaselt tuleks USA-sse ehitada 100 uut tuumaelektrijaama, neist esimesed 45 peaksid valmima aastaks 2030. Tuumaelektrijaamad aitaksid rahuldada USA energiavajadust ning võitleksid ka kliimasoojenemise vastu. Eksperdid on arengukava suhtes kriitilised
Directory of Open Access Journals (Sweden)
David L Nordstrom
2012-06-01
Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.
Directory of Open Access Journals (Sweden)
Diana Sari
2015-05-01
Full Text Available AbstrakDismenore primer merupakan nyeri menstruasi yang dijumpai tanpa kelainan yang nyata pada alat-alat genital. Lebih dari 50% wanita mengalami dismenore primer dan 15% diantaranya mengalami nyeri yang hebat.Tujuan penelitian ini adalah untuk menentukan hubungan tingkat stres dengan derajat dismenore primer. Penelitian dilakukan pada mahasiswi pendidikan dokter Fakultas Kedokteran Universitas Andalas angkatan 2009 dan 2010. Desain penelitian ini menggunakan cross sectional study dengan jumlah subjek 165 orang. Pengumpulan data dari responden dilakukan dengan wawancara terpimpin (pengisian kuesioner. Analisa statistik yang digunakan adalah uji chi-square dan uji koefisien korelasi sederhana. Uji chi-square menunjukan ada hubungan yang bermakna antara stres dengan kejadian dismenore primer dan uji statistik koefisien korelasi sederhana menunjukkan ada hubungan yang bermakna dengan korelasi agak lemah antara tingkat stres dengan derajat dismenore primer.Kata kunci: stres, dismenore primer, mahasiswi fakultas kedokteran AbstractPrimary dysmenorrhoea is menstrual pain founded without real abnormalities in genital organs. More than 50% woman experiance it and 15% had severe pain. The objective of this study was to determine relationship between stress and primary dysmenorrhoea. Research was executed to education medical female students medical faculty of Andalas University class of 2009 and 2010. This research use cross sectional study design with 165 subjects. Data was collected by guided interview. Statistic analysis use chi-square test and simple correlation test. Chi-square test show there is significant relationship between stress and primary dysmenorrhoea and simple coefficient test show there is weak correlation between stress levels and degree of primary dysmenorrhoea.Keywords: stress, primary dysmenorrhoea, female student of medical faculty
Obituary: John J. Hillman, 1938-2006
Chanover, Nancy
2007-12-01
John J. Hillman, a dedicated NASA civil servant, spectroscopist, astrophysicist, planetary scientist, and mentor, died on February 12, 2006 of ocular melanoma at his home in Columbia, Maryland. His professional and personal interests were wide-reaching and varied, and he devoted his career to the advancement of our understanding of the beauty and wonder in the world around us. His love of nature, art, and science made him a true Renaissance man. John was born in Fort Jay, New York, on November 22, 1938, and was raised in Washington, D.C. He received his B.S., M.S., and Ph.D. degrees in Physics from American University in 1967, 1970, and 1975, respectively. He began working at NASA's Goddard Space Flight Center, then in its infancy, in 1969, juggling a full-time position as a Research Physicist, the completion of his M.S. and Ph.D. degrees, and a young family. His background in molecular spectroscopy enabled him to apply his skills to numerous disciplines within NASA: infrared and radio astronomy; electronic, vibrational, and rotational structure of interstellar molecules; solar and stellar atmospheres; and planetary atmospheres. He published more than 70 journal papers in these disciplines. He was a frequent contributor to the Ohio State University International Symposium on Molecular Spectroscopy, and possessed a rare ability to bridge the gap between laboratory and remote sensing spectroscopy, bringing scientists from different disciplines together to understand our Universe. The last fifteen years of John's career were devoted to the development of acousto-optic tunable filter (AOTF) cameras. He championed this technology as a low-cost, low-power alternative to traditional imaging cameras for in situ or remotely sensed planetary exploration. It was within this context that I got to know John, and eventually worked closely with him on the demonstration and application of this technology for planetary science using ground-based telescopes in New Mexico, California
Qualification and Flight Test of Non-Chrome Primers for C-130 Aircraft
2011-08-17
system Significant hexavalent chrome reduction in finish system Potential exposure level of spray applied chromated conversion coating not as...Lockheed Martin Aeronautics Company Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft Scott Jones Lockheed Martin...00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft 5a. CONTRACT NUMBER 5b. GRANT
Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E
2001-04-01
Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.
Energy Technology Data Exchange (ETDEWEB)
Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.
2013-06-28
Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource
International Nuclear Information System (INIS)
Jothikumar, N.; Hill, Vincent R.
2013-01-01
Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource
Single primer amplification reaction methods reveal exotic and ...
Indian Academy of Sciences (India)
Unknown
mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...
Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas
2016-01-01
Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic
Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders
Energy Technology Data Exchange (ETDEWEB)
Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.
2000-09-27
This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.
Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders
Energy Technology Data Exchange (ETDEWEB)
A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson
1998-12-10
This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.
Summary of the primer on tumor immunology and the biological therapy of cancer
Directory of Open Access Journals (Sweden)
Margolin Kim
2009-01-01
Full Text Available Abstract The International Society for Biological Therapy of Cancer (iSBTc is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this program includes investigators from academic, regulatory, and biopharmaceutical venues. The program goal is to enable the attendees to learn the current status and the most recent advances in biologic therapies, and to leverage this knowledge towards the improvement of cancer therapy. The 2008 immunologic primer course was held on October 30 at the 23rd Annual meeting of iSBTc in San Diego, CA. Nine internationally renowned investigators gave excellent presentations on different topics. The topics covered in this primer included: (1 cytokines in cancer immunology; (2 anti-angiogenic therapy; (3 end stage: immune killing of tumors; (4 blocking T cell checkpoints; (5 approach to identification and therapeutic exploitation of tumor antigens; (6 T regulatory cells; (7 adoptive T cell therapy; (8 immune monitoring of cancer immunotherapy; and (9 immune adjuvants. We summarized the topics in this primer for public education. The related topic slides and schedule can be accessed online http://www.isbtc.org/meetings/am08/primer08.
Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools
Directory of Open Access Journals (Sweden)
Melissa Agsalda
2009-01-01
Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.
Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.
Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce
2009-01-01
Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.
International Nuclear Information System (INIS)
Amaldi, E.
1986-01-01
In this first John Adams' Memorial Lecture, an outline is given of his work, especially from the beginning of CERN in 1952 until his death in 1984. The historical survey covers John Adams' technical and managerial contributions to the development of CERN and its accelerators, as well as to fusion research in Britain and Europe. Exemplified by his role as member and president of the International Committee for Future Accelerators (ICFA), Adams' interest in international co-operation is also stressed. In the spirit of this great European, arguments are given for CERN to continue to be the first-rate high-energy physics laboratory which it has been in the past. (orig.)
1999-01-01
Rockbändi "The Velvet Underground" asutajaliige John Cale avaldas oma autobiograafia "What's Welsh for Zen?". Koos biograafiakirjanik Victor Bockrisiga kirjutatud teos räägib 60ndate lõpu kultuurielust New Yorgis, koostööst Andy Warholiga jm.
Translating The Infinities by John Banville
Irene Abigail Piccinini
2015-01-01
Abstract - John Banville’s talent as a prose stylist is widely recognized. The polished elegance of his phrases constitutes a continuing and fascinating challenge for his translator, due to the intricacies of the source text, its manifold registers and lexical choices. In his novel The Infinities, in Italian Teoria degli Infiniti, John Banville takes cue from Kleist’s Amphytrion to devise a novel where classicality interweaves with science and science fiction through the invention of a world ...
Genomic sequencing: assessing the health care system, policy, and big-data implications.
Phillips, Kathryn A; Trosman, Julia R; Kelley, Robin K; Pletcher, Mark J; Douglas, Michael P; Weldon, Christine B
2014-07-01
New genomic sequencing technologies enable the high-speed analysis of multiple genes simultaneously, including all of those in a person's genome. Sequencing is a prominent example of a "big data" technology because of the massive amount of information it produces and its complexity, diversity, and timeliness. Our objective in this article is to provide a policy primer on sequencing and illustrate how it can affect health care system and policy issues. Toward this end, we developed an easily applied classification of sequencing based on inputs, methods, and outputs. We used it to examine the implications of sequencing for three health care system and policy issues: making care more patient-centered, developing coverage and reimbursement policies, and assessing economic value. We conclude that sequencing has great promise but that policy challenges include how to optimize patient engagement as well as privacy, develop coverage policies that distinguish research from clinical uses and account for bioinformatics costs, and determine the economic value of sequencing through complex economic models that take into account multiple findings and downstream costs. Project HOPE—The People-to-People Health Foundation, Inc.
International Nuclear Information System (INIS)
Oldendorf, W.; Oldendorf, W. Jr.
1991-01-01
Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI
A primer of multivariate statistics
Harris, Richard J
2014-01-01
Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why
2011-03-09
... the United States. DATES: This policy became effective on February 11, 2011. ADDRESSES: This notice... available at http://www.homeport.uscg.mil under the Port State Control tab; Foreign Vessel Safety; Policy...: If you have questions on this notice or the policy, call or e-mail Mr. John S. Sedlak, P.E., Foreign...
International Nuclear Information System (INIS)
Zhan Fangfang; Zhou Xiaoming; Xing Da
2013-01-01
Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental
John Kotter on Leadership, Management and Change.
Bencivenga, Jim
2002-01-01
Excerpts from interview with John Kotter, Konosuke Matsushita Professor of Leadership at the Harvard Business School, about his thoughts on the role of the superintendent as leader and manager. Describes his recent book "John P. Kotter on What Leaders Really Do," 1999. Lists eight-step change process from his book "Leading Change," 1996. (PKP)
A Primer on Basic Effect Size Concepts.
Elmore, Patricia B.; Rotou, Ourania
The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…
In memoriam: John Warren Aldrich, 1906-1995
Banks, Richard C.
1997-01-01
John Aldrich was born in Providence, Rhode Island, on 23 February 1906, and went to the Providence public schools. He developed a broad interest in natural history at an early age, being stimulated by his mother, a kindergarten teacher, who introduced him to nature books. His interest was strengthened by Harold L. Madison, Director of the Park Museum in Providence, an Associate ( = member) of the AOU. As a high school student, John taught nature study at the Rhode Island Boy Scout Camp in summers. John was President of his class at Classical High School, and manager of the school's football team in his senior year. Also in that year, 1923, John published his first paper, a note in Bird-Lore on the occurrence of the Mockingbird in Rhode Island. That paper is a literary gem, showing that his skill in writing developed as early as his knowledge of birds. His early interest in football continued as well; he was a devoted fan of the Washington Redskins in his later years.
The National Origins of Policy Ideas
DEFF Research Database (Denmark)
Campbell, John L.; Pedersen, Ove K.
In politics, ideas matter. They provide the foundation for economic policymaking, which in turn shapes what is possible in domestic and international politics. Yet until now, little attention has been paid to how these ideas are produced and disseminated, and how this process varies between...... countries. The National Origins of Policy Ideas provides the first comparative analysis of how "knowledge regimes" communities of policy research organizations like think tanks, political party foundations, ad hoc commissions, and state research offices, and the institutions that govern them generate ideas...... and communicate them to policymakers. John Campbell and Ove Pedersen examine how knowledge regimes are organized, operate, and have changed over the last thirty years in the United States, France, Germany, and Denmark. They show how there are persistent national differences in how policy ideas are produced. Some...
The Universal Primer - An open source solution for archiving, organizing and streaming live lectures
DEFF Research Database (Denmark)
Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej
2011-01-01
. The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...
Beauchaine, Theodore P.
2009-01-01
Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222
Magnesium-Based Sacrificial Anode Cathodic Protection Coatings (Mg-Rich Primers for Aluminum Alloys
Directory of Open Access Journals (Sweden)
Michael D. Blanton
2012-09-01
Full Text Available Magnesium is electrochemically the most active metal employed in common structural alloys of iron and aluminum. Mg is widely used as a sacrificial anode to provide cathodic protection of underground and undersea metallic structures, ships, submarines, bridges, decks, aircraft and ground transportation systems. Following the same principle of utilizing Mg characteristics in engineering advantages in a decade-long successful R&D effort, Mg powder is now employed in organic coatings (termed as Mg-rich primers as a sacrificial anode pigment to protect aerospace grade aluminum alloys against corrosion. Mg-rich primers have performed very well on aluminum alloys when compared against the current chromate standard, but the carcinogenic chromate-based coatings/pretreatments are being widely used by the Department of Defense (DoD to protect its infrastructure and fleets against corrosion damage. Factors such as reactivity of Mg particles in the coating matrix during exposure to aggressive corrosion environments, interaction of atmospheric gases with Mg particles and the impact of Mg dissolution, increases in pH and hydrogen gas liberation at coating-metal interface, and primer adhesion need to be considered for further development of Mg-rich primer technology.
Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da
2016-07-15
Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.
Gamper, H.A.; Leuchtmann, A.
2007-01-01
Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking
Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.
Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong
2014-08-01
The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.
Zoreda, Margaret Lee
This paper forms part of an investigation about how the philosophy of John Dewey (1859-1952) can illuminate the practice of the teaching of English as a foreign language. The paper seeks to interpret and synthesize John Dewey's philosophical works to construct a "Deweyian lens" with which to analyze and evaluate the field of the teaching…
Molecular Basis for DNA Double-Strand Break Annealing and Primer Extension by an NHEJ DNA Polymerase
Directory of Open Access Journals (Sweden)
Nigel C. Brissett
2013-11-01
Full Text Available Nonhomologous end-joining (NHEJ is one of the major DNA double-strand break (DSB repair pathways. The mechanisms by which breaks are competently brought together and extended during NHEJ is poorly understood. As polymerases extend DNA in a 5′-3′ direction by nucleotide addition to a primer, it is unclear how NHEJ polymerases fill in break termini containing 3′ overhangs that lack a primer strand. Here, we describe, at the molecular level, how prokaryotic NHEJ polymerases configure a primer-template substrate by annealing the 3′ overhanging strands from opposing breaks, forming a gapped intermediate that can be extended in trans. We identify structural elements that facilitate docking of the 3′ ends in the active sites of adjacent polymerases and reveal how the termini act as primers for extension of the annealed break, thus explaining how such DSBs are extended in trans. This study clarifies how polymerases couple break-synapsis to catalysis, providing a molecular mechanism to explain how primer extension is achieved on DNA breaks.
DEFF Research Database (Denmark)
Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus
2005-01-01
A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted....... A ribonuclease mix was developed to specifically cleave the chimeric primers, irrespective of the base of the ribonucleotide, whereas standard primers without a ribonucleotide were unaffected by the ribonuclease treatment. The SBE products were analyzed in linear mode using a matrix-assisted laser desorption...... containing 9 chimeric primers and 8 standard primers....
Armed To Learn: Aiming At California K 12 School Gun Policy
2016-03-01
AIMING AT CALIFORNIA K-12 SCHOOL GUN POLICY by Catherine Wilson Jones March 2016 Thesis Co-Advisors: Kathleen Kiernan John Rollins...Master’s thesis 4. TITLE AND SUBTITLE ARMED TO LEARN: AIMING AT CALIFORNIA K-12 SCHOOL GUN POLICY 5. FUNDING NUMBERS 6. AUTHOR(S) Catherine...gap in viewpoints between gun control advocates who want tighter gun control and constitutionalists who believe as strongly in the Second Amendment
The astrobiology primer: an outline of general knowledge--version 1, 2006.
Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S
2006-10-01
The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Each section includes a brief overview of a topic and a short list of readable and important literature for those interested in deeper knowledge. Because of the great diversity of material, each section was written by a different author with a different expertise. Contributors, authors, and editors are listed at the beginning, along with a list of those chapters and sections for which they were responsible. We are deeply indebted to the NASA Astrobiology Institute (NAI), in particular to Estelle Dodson, David Morrison, Ed Goolish, Krisstina Wilmoth, and Rose Grymes for their continued enthusiasm and support. The Primer came about in large part because of NAI support for graduate student research, collaboration, and inclusion as well as direct funding. We have entitled the Primer version 1 in hope that it will be only the first in a series, whose future volumes will be produced every 3-5 years. This way we can insure that the Primer keeps up with the current state of research. We hope that it will be a great resource for anyone trying to stay abreast of an ever-changing field.
Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V
2015-12-01
The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.
Anamnesis and the Silent Narrator in Plato and John
Directory of Open Access Journals (Sweden)
George L. Parsenios
2017-03-01
Full Text Available The Gospel of John is often compared to the dialogues of Plato by those who connect Johannine theology and Platonic philosophy. The comparison operates on the level of ideas. The present paper does not ignore issues of theology and philosophy but grounds a comparison of John and Plato first and foremost on the literary level. In several key places in John 1, 3, and 14, the Johannine narrator recedes from view and is unexpectedly silent where one would expect a narrator’s comment to organize the conversations and interactions between characters in John. Plato also renders the voice of the narrator silent in a dialogue like the Theaetetus. This paper argues that John and Plato both suppress the narrator’s voice in order to further their anamnetic efforts and to make later generations not only readers but participants in their original conversations.
Gold nanoparticle-assisted primer walking for closing the human chromosomal gap
DEFF Research Database (Denmark)
Li, H; Shi, B; Li, X
2013-01-01
The finished sequence of the human genome still contains 260 euchromatic gaps. All the PCR-based genome walking techniques used to close gaps have common limitations, such as low efficiency and low specificity. We herein describe a strategy to solve this problem by employing gold nanoparticles (Au......NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...
Wang, Yong
2009-10-09
Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.
Energy Technology Data Exchange (ETDEWEB)
Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)
2013-01-25
Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection
Effect of oligonucleotide primers in determining viral variability within hosts
Directory of Open Access Journals (Sweden)
Moya Andrés
2004-12-01
Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.
Effect of oligonucleotide primers in determining viral variability within hosts.
Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando
2004-12-09
Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.
Obituary: John Daniel Kraus, 1910-2004
Kraus, John D., Jr.; Marhefka, Ronald J.
2005-12-01
John Daniel Kraus, 94, of Delaware, Ohio, director of the Ohio State University "Big Ear" Radio Observatory, physicist, inventor, and environmentalist died 18 July 2004 at his home in Delaware, Ohio. He was born on 28 June 1910 in Ann Arbor, Michigan. He received a Bachelor of Science in 1930, a Master of Science in 1931, and a PhD in physics in 1933 (at 23 years of age), all from the University of Michigan, Ann Arbor. During the 1930s at Michigan, he was involved in physics projects, antenna consulting, and in atomic-particle-accelerator research using the University of Michigan's premier cyclotron. Throughout the late 1920s and the 1930s, John was an avid radio amateur with call sign W8JK. He was back on the air in the 1970s. In 2001 the amateur radio magazine CQ named him to the inaugural class of its Amateur Radio Hall of Fame. He developed many widely used innovative antennas. The "8JK closely spaced array" and the "corner reflector" were among his early designs. Edwin H. Armstrong wrote John in July 1941 indicating in part, "I have read with interest your article in the Proceedings of the Institute on the corner reflector...Please let me congratulate you on a very fine piece of work." Perhaps John's most famous invention, and a product of his intuitive reasoning process, is the helical antenna, widely used in space communications, on global positioning satellites, and for other applications. During World War II, John was in Washington, DC as a civilian scientist with the U.S. Navy responsible for "degaussing" the electromagnetic fields of steel ships to make them safe from magnetic mines. He also worked on radar countermeasures at Harvard University's Radio Research Laboratory. He received the U.S. Navy Meritorious Civilian Service Award for his war work. In 1946 he took a faculty position at Ohio State University, becoming professor in 1949, and retiring in 1980 as McDougal Professor Emeritus of Electrical Engineering and Astronomy. Even so, he never retired
International Nuclear Information System (INIS)
Hulm, J.
1988-01-01
John Hulm has made profound contributions to the field of superconductivity as a research scientist and as an engineer. He and his colleagues discovered the superconducting materials in commercial use today, and he played a key role in the development of commercial superconducting magnets. Dr. Hulm now serves as Chief Scientist at Westinghouse Electric Corporation. This story describes many milestones in the history of superconductivity and offers personal insight into this distinguished scientist
Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup
This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.
Directory of Open Access Journals (Sweden)
Luk Ketut Budi Maitriani
2015-10-01
Full Text Available ABSTRAK : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb. ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is
FullSSR: Microsatellite Finder and Primer Designer
Directory of Open Access Journals (Sweden)
Sebastián Metz
2016-01-01
Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.
Directory of Open Access Journals (Sweden)
Juan Lanero Fernández
2005-12-01
Full Text Available De todos los libros de cuentas de John Isham tan sólo se conservan dos Libros Mayores. Representan el esfuerzo continuado, durante un intervalo de doce años, para confeccionar un balance de situación. Es indudable que John Isham se había familiarizado con los rudimentos del arte de la teneduría de libros durante su periodo de aprendiz, bajo la supervisión de su patrón, probablemente en Amberes. El uso que hace de la partida doble, aunque sólo ocupa una pequeña parte del primer Libro Mayor y ninguna del segundo, indica que apostaba por el progreso.El valor de estos dos Libros Mayores del siglo XVI es grande, pues nos dice mucho de la estructura de la exportación de paños, usos que un mercader mediano hace de su capital y otros aspectos dfíciles de averiguar por otras vías. En ambos volúmenes las partidas recogen multitud de detalles que nos hablan del entramado del comercio internacional inglés en el floreciente reinado de Isabel I. Al lado de la parida dole aparecen las compañías gremiales que concedieron al comercio inglés la fueza y el esplendor sobre los que se asentó el Imperio Británico.Out of all the account books of John Isham, only two ledgers are preserved at present. They represent a constant effort, for a twelve-year interval, in order to produce a balance sheet. John Isham, no doubt, had learnt the technicalities of the art of bookkeeping duritng his appenticeship period, under his master's supervision, probably in Antwerp. His use of the double entry system, despite it si only present in some sections of the first ledger and none of the second, it is a clear indication that he favoured progress.The value of these two ledgers is remarkable. They talk about the structure of cloth exportation, how a medium-sized merchant used his capital and some other aspects which are difficult to find out through other means. In both volumes entries release multiple details which tell us about the international English commerce
Directory of Open Access Journals (Sweden)
Cheng-Hong Yang
Full Text Available BACKGROUND: Complete mitochondrial (mt genome sequencing is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. For long template sequencing, i.e., like the entire mtDNA, it is essential to design primers for Polymerase Chain Reaction (PCR amplicons which are partly overlapping each other. The presented chromosome walking strategy provides the overlapping design to solve the problem for unreliable sequencing data at the 5' end and provides the effective sequencing. However, current algorithms and tools are mostly focused on the primer design for a local region in the genomic sequence. Accordingly, it is still challenging to provide the primer sets for the entire mtDNA. METHODOLOGY/PRINCIPAL FINDINGS: The purpose of this study is to develop an integrated primer design algorithm for entire mt genome in general, and for the common primer sets for closely-related species in particular. We introduce ClustalW to generate the multiple sequence alignment needed to find the conserved sequences in closely-related species. These conserved sequences are suitable for designing the common primers for the entire mtDNA. Using a heuristic algorithm particle swarm optimization (PSO, all the designed primers were computationally validated to fit the common primer design constraints, such as the melting temperature, primer length and GC content, PCR product length, secondary structure, specificity, and terminal limitation. The overlap requirement for PCR amplicons in the entire mtDNA is satisfied by defining the overlapping region with the sliding window technology. Finally, primer sets were designed within the overlapping region. The primer sets for the entire mtDNA sequences were successfully demonstrated in the example of two closely-related fish species. The pseudo code for the primer design algorithm is provided. CONCLUSIONS/SIGNIFICANCE: In conclusion, it can be said that our proposed sliding window-based PSO
Directory of Open Access Journals (Sweden)
Joseph-Alexander Verreet
2011-01-01
Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.
Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S
2015-06-01
Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.
75 FR 5803 - John Day/Snake Resource Advisory Council; Meetings
2010-02-04
...] John Day/Snake Resource Advisory Council; Meetings AGENCY: Bureau of Land Management, Interior. ACTION: Meeting Notice for the John Day/Snake Resource Advisory Council. SUMMARY: Pursuant to the Federal Land..., Bureau of Land Management (BLM) John Day/Snake Resource Advisory Council (JDSRAC) will meet as indicated...
Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR
Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan
2002-01-01
AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381
PIPEMicroDB: microsatellite database and primer generation tool for pigeonpea genome.
Sarika; Arora, Vasu; Iquebal, M A; Rai, Anil; Kumar, Dinesh
2013-01-01
Molecular markers play a significant role for crop improvement in desirable characteristics, such as high yield, resistance to disease and others that will benefit the crop in long term. Pigeonpea (Cajanus cajan L.) is the recently sequenced legume by global consortium led by ICRISAT (Hyderabad, India) and been analysed for gene prediction, synteny maps, markers, etc. We present PIgeonPEa Microsatellite DataBase (PIPEMicroDB) with an automated primer designing tool for pigeonpea genome, based on chromosome wise as well as location wise search of primers. Total of 123 387 Short Tandem Repeats (STRs) were extracted from pigeonpea genome, available in public domain using MIcroSAtellite tool (MISA). The database is an online relational database based on 'three-tier architecture' that catalogues information of microsatellites in MySQL and user-friendly interface is developed using PHP. Search for STRs may be customized by limiting their location on chromosome as well as number of markers in that range. This is a novel approach and is not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of selected markers with left and right flankings of size up to 500 bp. This will enable researchers to select markers of choice at desired interval over the chromosome. Furthermore, one can use individual STRs of a targeted region over chromosome to narrow down location of gene of interest or linked Quantitative Trait Loci (QTLs). Although it is an in silico approach, markers' search based on characteristics and location of STRs is expected to be beneficial for researchers. Database URL: http://cabindb.iasri.res.in/pigeonpea/
Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL
International Nuclear Information System (INIS)
Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.
2000-01-01
This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums
Short-Circuiting the Bureaucracy: Policy Origins in Education.
Graham, Hugh Davis
The Great Society's secret task forces created by Lyndon Johnson, particularly in the case-study area of federal education policy, show the use and misuse of the task force device. Modern use of it began with John F. Kennedy. Although he used the task force device effectively sometimes, he did not use it effectively in his educational programs in…
Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko
2016-02-01
The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.
Would John Stuart Mill have regulated pornography?
McGlynn, C.; Ward, I.
2014-01-01
John Stuart Mill dominates contemporary pornography debates where he is routinely invoked as an authoritative defence against regulation. This article, by contrast, argues that a broader understanding of Mill's ethical liberalism, his utilitarianism, and his feminism casts doubt over such an assumption. New insights into Mill's approach to sex, sexual activity, and the regulation of prostitution reveal an altogether more nuanced and activist approach. We conclude that John Stuart Mill would a...
2006-01-01
John started his career and obtained his PhD in a group from Westfield College, initially working on experiments at Rutherford Appleton Laboratory (RAL). From the early 1970s onwards, however, his research was focused on experiments in CERN, with several particularly notable contributions. The Omega spectrometer adopted a system John had originally developed for experiments at RAL using vidicon Cameras (a type of television camera) to record the sparks in the spark chambers. This highly automated system allowed Omega to be used in a similar way to bubble chambers. He contributed to the success of NA1 and NA7, where he became heavily involved in the electronic trigger systems. In these experiments the Westfield group joined forces with Italian colleagues to measure the form factors of the pion and the kaon, and the lifetime of some of the newly discovered charm particles. Such has been the lasting impact of these measurements that the paper on the pion form-factor had been cited 323 times up to the time of J...
Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.
Wu, Z; Nagano, I; Xu, D; Takahashi, Y
1997-03-01
Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.
Xiao, Jing; Zhao, Jin; Liu, Mengjun; Liu, Ping; Dai, Li; Zhao, Zhihui
2015-01-01
Chinese jujube (Ziziphus jujuba), an economically important species in the Rhamnaceae family, is a popular fruit tree in Asia. Here, we surveyed and characterized simple sequence repeats (SSRs) in the jujube genome. A total of 436,676 SSR loci were identified, with an average distance of 0.93 Kb between the loci. A large proportion of the SSRs included mononucleotide, dinucleotide and trinucleotide repeat motifs, which accounted for 64.87%, 24.40%, and 8.74% of all repeats, respectively. Among the mononucleotide repeats, A/T was the most common, whereas AT/TA was the most common dinucleotide repeat. A total of 30,565 primer pairs were successfully designed and screened using a series of criteria. Moreover, 725 of 1,000 randomly selected primer pairs were effective among 6 cultivars, and 511 of these primer pairs were polymorphic. Sequencing the amplicons of two SSRs across three jujube cultivars revealed variations in the repeats. The transferability of jujube SSR primers proved that 35/64 SSRs could be transferred across family boundary. Using jujube SSR primers, clustering analysis results from 15 species were highly consistent with the Angiosperm Phylogeny Group (APGIII) System. The genome-wide characterization of SSRs in Chinese jujube is very valuable for whole-genome characterization and marker-assisted selection in jujube breeding. In addition, the transferability of jujube SSR primers could provide a solid foundation for their further utilization. PMID:26000739
Signals and systems primer with Matlab
Poularikas, Alexander D
2006-01-01
Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,
indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.
Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J
2017-01-01
Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.
Energy Technology Data Exchange (ETDEWEB)
Bertlmann, Reinhold A.
2015-07-15
John Bell, with whom I had a fruitful collaboration and warm friendship, is best known for his seminal work on the foundations of quantum physics, but he also made outstanding contributions to particle physics and accelerator physics.
International Nuclear Information System (INIS)
Bertlmann, Reinhold A.
2015-01-01
John Bell, with whom I had a fruitful collaboration and warm friendship, is best known for his seminal work on the foundations of quantum physics, but he also made outstanding contributions to particle physics and accelerator physics
DEFF Research Database (Denmark)
Hansen, A C; Grunwald, T; Lund, Anders Henrik
2001-01-01
could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold...
17 JOHN 12,20-22 AS A MISSIONARY TEXT: AN EXEGETICAL ...
African Journals Online (AJOL)
(John 3,17) and executor of judgement (John 5,27). By this singular act of glorification, other sheep that are not of the fold would be gathered under one Shepherd (John 10,16; 11,49-52). John 12,22 is ladened with the verb of movement ― e;r cetai. First, it is Philip going to Andrew and then both of them going to Jesus.
Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA
Energy Technology Data Exchange (ETDEWEB)
Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J. (Pharmasset); (Emerald)
2012-08-01
The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.
Glennon, Kelsey L; Cron, Glynis V
2016-05-01
Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species.
Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, A.D. van; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martín, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, Z.W. de; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, G.S. de; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, M. de; Robert, V.
2015-01-01
The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic
Geology of St. John, U.S. Virgin Islands
Rankin, Douglas W.
2002-01-01
The rocks of St. John, which is located near the eastern end of the Greater Antilles and near the northeastern corner of the Caribbean plate, consist of Cretaceous basalt, andesite, keratophyre, their volcaniclastic and hypabyssal intrusive equivalents, and minor calcareous rocks and chert. These rocks were intruded by Tertiary mafic dikes and tonalitic plutons. The oldest rocks formed in an extensional oceanic environment characterized by abundant keratophyre and sheeted dikes. Subduction-related volcanism of the east-west-trending marine Greater Antilles volcanic arc began on St. John near the transition between the Early and Late Cretaceous. South-directed compression, probably caused by the initial collision between the Greater Antilles arc of the Caribbean plate and the Bahama platform of the North American plate, deformed the Cretaceous strata into east-west-trending folds with axial-plane cleavage. Late Eocene tonalitic intrusions, part of the Greater Antilles arc magmatism, produced a contact aureole that is as much as two kilometers wide and that partly annealed the axial-plane cleavage. East-west compression, possibly related to the relative eastward transport of the Caribbean plate in response to the beginning of spreading at the Cayman Trough, produced long-wavelength, low-amplitude folds whose axes plunge gently north and warp the earlier folds. A broad north-plunging syncline-anticline pair occupies most of St. John. The last tectonic event affecting St. John is recorded by a series of post-late Eocene sinistral strike-slip faults related to the early stages of spreading at the Cayman Trough spreading center and sinistral strike-slip accommodation near the northern border of the Caribbean plate. Central St. John is occupied by a rhomb horst bounded by two of these sinistral faults. Unlike other parts of the Greater Antilles, evidence for recent tectonic movement has not been observed on St. John.
a speech act analysis of John 9: 35
African Journals Online (AJOL)
The significance of Jesus' utterance in relation to the Johannine son of man: a speech act analysis of John 9: 35: research. ... In order to accomplish that, this article will examine the significance of Jesus' utterance in John 9: 35, which contains some difficulty in interpreting the meaning of the title Son of Man.
John Ellis considers cosmology, colloquiums and new collaborations
Katarina Anthony
2011-01-01
On 13 September, physicists from around the world joined John Ellis in a colloquium to celebrate his 65th birthday. In our last issue, we talked to John about the Higgs, the lack of the Higgs and extra dimensions. In this second part of the interview, John speaks about the colloquium and the wide range of topics it covered, all inspired by his career. John Ellis in his office (July 2011). How did your birthday colloquium come about? When physicists here at CERN reach a “certain age” – or reach a transition point in their careers – it is traditional to hold some kind of colloquium. I had previously resisted pressure to hold one of these events. But this year, my official duties for the Organization have come to an end. While it is unlikely you will see any difference in my working habits, it was a milestone that proved too important to not give into requests for an event. Rather than a very long sequence of people talking about what they d...
Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers
Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li
2017-01-01
Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424
Bergkemper, Fabian; Kublik, Susanne; Lang, Friederike; Krüger, Jaane; Vestergaard, Gisle; Schloter, Michael; Schulz, Stefanie
2016-06-01
Phosphorus (P) is of central importance for cellular life but likewise a limiting macronutrient in numerous environments. Certainly microorganisms have proven their ability to increase the phosphorus bioavailability by mineralization of organic-P and solubilization of inorganic-P. On the other hand they efficiently take up P and compete with other biota for phosphorus. However the actual microbial community that is associated to the turnover of this crucial macronutrient in different ecosystems remains largely anonymous especially taking effects of seasonality and spatial heterogeneity into account. In this study seven oligonucleotide primers are presented which target genes coding for microbial acid and alkaline phosphatases (phoN, phoD), phytases (appA), phosphonatases (phnX) as well as the quinoprotein glucose dehydrogenase (gcd) and different P transporters (pitA, pstS). Illumina amplicon sequencing of soil genomic DNA underlined the high rate of primer specificity towards the respective target gene which usually ranged between 98% and 100% (phoN: 87%). As expected the primers amplified genes from a broad diversity of distinct microorganisms. Using DNA from a beech dominated forest soil, the highest microbial diversity was detected for the alkaline phosphatase (phoD) gene which was amplified from 15 distinct phyla respectively 81 families. Noteworthy the primers also allowed amplification of phoD from 6 fungal orders. The genes coding for acid phosphatase (phoN) and the quinoprotein glucose dehydrogenase (gcd) were amplified from 20 respectively 17 different microbial orders. In comparison the phytase and phosphonatase (appA, phnX) primers covered 13 bacterial orders from 2 different phyla respectively. Although the amplified microbial diversity was apparently limited both primers reliably detected all orders that contributed to the P turnover in the investigated soil as revealed by a previous metagenomic approach. Genes that code for microbial P transporter
Stielow, J.B.; Lévesque, C.A.; Seifert, K.A.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.J.M.; Groenewald, M.; Chaduli, D.; Lomascolo, A.; Welti, S.; Lesage-Meessen, L.; Favel, A.; Al-Hatmi, A.M.S.; Damm, U.; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, van A.D.; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martin, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, de Z.W.; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, de G.S.; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, de M.; Robert, V.
2015-01-01
The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers
Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.
Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J
2015-07-28
Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.
Indian Academy of Sciences (India)
IAS Admin
of matter and the development of science in the world, especially in. Europe. During ... He belonged to a family of Quakers. (Society of ... During this period, Dalton came under the influence of John Gough, who suggested that he maintain a ...
John Hennessey, Barrier Breaker
Nelson, Stephen J.
2018-01-01
John Hennessey lived a remarkable, full life as a professor, as a leader in his field of management and business, and moral, ethical leadership, and as dean at Dartmouth College's Tuck School of Business and provost at the University of Vermont. He was extraordinary on many fronts, a great man who lived in tumultuous times marked by world war as a…
The effect of various primers on shear bond strength of zirconia ceramic and resin composite.
Sanohkan, Sasiwimol; Kukiattrakoon, Boonlert; Larpboonphol, Narongrit; Sae-Yib, Taewalit; Jampa, Thibet; Manoppan, Satawat
2013-11-01
To determine the in vitro shear bond strengths (SBS) of zirconia ceramic to resin composite after various primer treatments. Forty zirconia ceramic (Zeno, Wieland Dental) specimens (10 mm in diameter and 2 mm thick) were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10). Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE), AP (Alloy Primer, Kuraray Medical), and MP (Monobond Plus, Ivoclar Vivadent AG). One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE) cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE) and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa) were analyzed with one-way analysis of variance (ANOVA) and the Tukey's Honestly Significant Difference (HSD) test (α = 0.05). Group AP yielded the highest mean and standard deviation (SD) value of SBS (16.8 ± 2.5 MPa) and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa). The SBS did not differ significantly among the groups (P = 0.079). Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.
Blood Donation and Transfusion: A Primer for Health Educators.
Felts, W. Michael; Glascoff, Mary A.
1991-01-01
Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)
Small Commercial Building Re-tuning: A Primer
Energy Technology Data Exchange (ETDEWEB)
Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas
2013-09-30
To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.
Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae
Directory of Open Access Journals (Sweden)
Warren B. Chatwin
2014-10-01
Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.
Directory of Open Access Journals (Sweden)
Christopher A Gulvik
Full Text Available Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies. Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI's BLAST (De-MetaST-BLAST, the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications.
Beneath sci-fi sound: primer, science fiction sound design, and American independent cinema
Johnston, Nessa
2012-01-01
Primer is a very low budget science-fiction film that deals with the subject of time travel; however, it looks and sounds quite distinctively different from other films associated with the genre. While Hollywood blockbuster sci-fi relies on “sound spectacle” as a key attraction, in contrast Primer sounds “lo-fi” and screen-centred, mixed to two channel stereo rather than the now industry-standard 5.1 surround sound. Although this is partly a consequence of the economics of its production, the...
Primers As Socializing Agents in American and Finnish Schools.
Hyona, Jukka; And Others
1995-01-01
Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…
Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer
Energy Technology Data Exchange (ETDEWEB)
D. S. Lucas
2004-10-01
A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.
Clarke, R W
1997-01-01
Oliver St John Gogarty--Otolaryngologist to fashionable Edwardian Dublin--was a distinguished poet and a Senator in the fledgling Irish Free State after its establishment in 1922. He numbered amongst his acquaintances the poet William Butler Yeats, the novelist James Joyce and a host of political and literary persona who helped to shape modern Ireland. He was satirised as 'stately plump Buck Mulligan' in Joyce's novel Ulysses.
Thomas, John Meurig
2013-10-11
"My greatest achievement has been to combine being a teacher, a researcher, and a popularizer of science for over 50 years. My worst nightmare is to find myself dumbstruck when I am about to give a lecture …︁" This and more about Sir John Meurig Thomas can be found on page 10938. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
A New Reading of Shakespeare's King John.
Usher, Peter D.
1995-12-01
Shakespeare wrote King John c.1594, six years after the defeat of the Spanish Armada, and ~ 50 years after publication of the Copernican heliocentric hypothesis. It is said to be the most unhistorical of the History Plays, ``anomalous'', ``puzzling'', and ``odd'', and as such it has engendered far more than the customary range of interpretive opinion. I suggest that the play alerts Elizabethans not just to military and political threats, but to a changing cosmic world view, all especially threatening as they arise in Catholic countries. (a) Personification characterizes the play. John personifies the old order, while Arthur and the Dauphin's armies personify the new. I suggest that Shakespeare decenters King John just as Copernicus decentered the world. (b) Hubert menaces Arthur's eyes for a whole scene (4.1), but the need for such cruelty is not explained and is especially odd as Arthur is already under sentence of death (3.3.65-66). This hitherto unexplained anomaly suggests that the old order fears what the new might see. (c) Eleanor's confession is made only to Heaven and to her son the King (1.1.42-43), yet by echoing and word play the Messenger from France later reveals to John that he is privy to it (4.2.119-124). This circumstance has not been questioned heretofore. I suggest that the Messenger is like the wily Hermes (Mercury), chief communicator of the gods and patron of the sciences; by revealing that he moves in the highest circles, he tells John that he speaks with an authority that transcends even that of a king. The message from on high presages more than political change; it warns of a new cosmic and religious world order (d) Most agree that John is a weak king, so Shakespeare must have suspected flaws in the old ways. He would have known that Tycho Brahe's new star of 1572, the comet of 1577, and the 1576 model of his compatriot Thomas Digges, were shattering old ideas. (e) The tensions of the play are not resolved because in 1594 the new order was
John Maynard Smith (1920-2004)
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education; Volume 10; Issue 11. John Maynard Smith (1920-2004) - “One of the last Grand Evolutionary Theorists of the 20th Century”. Vidyanand Nanjundiah. General Article Volume 10 Issue 11 November 2005 pp 70-78 ...
RESNICK, R. M.; Cornelissen, M. T.; WRIGHT, D. K.; EICHINGER, G. H.; FOX, H. S.; ter Schegget, J.; MANOS, M. M.
1990-01-01
We developed a polymerase chain reaction DNA amplification system using two distinct consensus oligonucleotide primer sets for the improved detection and typing of a broad spectrum of human genital papillomavirus (HPV) sequences, including those of novel viruses. The system incorporates one primer
Directory of Open Access Journals (Sweden)
Claire Kimberly
2013-10-01
Full Text Available Since Extension agents work with a variety of families, there is a desperate need to further our understanding of how to educate diverse communities on a family-related topic. Focused on assisting those teaching marital education to a diverse population, this study attempts to understand how individual differences impact relationship satisfaction and marital communication. Based on John Gottman’s research on marital communication and John Lee’s six loves styles, 653 participants completed a survey to further understanding of the relationship between inter- and intrapersonal variables. Results revealed that marital communication and love styles accounted for 54.6% of the variance in marital satisfaction regardless of difference in demographics. Results of this study provide a resource for educators and practitioners to use with diverse clientele, while also emphasizing the need to understand both intra- and interpersonal variables when working with families.
Shinohara, Ayano; Taira, Yohsuke; Sakihara, Michino; Sawase, Takashi
2018-01-01
Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study.
Kuus kirja / John Keats ; tlk. Märt Väljataga
Keats, John
2004-01-01
Sisu: Benjamin Bailey'le, 22. novembril 1817 ; George ja Tom Keatsile, 21., 27. (?) detsembril 1817 ; John Taylorile, 27. veebruaril 1818 ; John Hamilton Reynoldsile, 3. mail 1818 ; Richard Woodhouse'ile, 27. oktoobril 1818 ; George ja Georgiana Keatsile, 14. veebruar-3. mai 1819. Saatesõna lk. 84
Directory of Open Access Journals (Sweden)
Anderson Pinheiro de Freitas
2004-06-01
Full Text Available To evaluate the effect of different surface treatments on shear bond strength between a metallic alloy (Co-Cr-Mo - Remanium CD and a resin cement (Rely X TM and to evaluate the mode of fracture after testing, forty couples of metallic-alloy disks were melted, regularized, polished, submitted to four thermal cycles (Vacuum, 960ºC, 8 minutes and randomly separated into four groups. Each group received a different type of treatment: Group PSP: Polished with sandpaper 600; Group PCP: Polished with sandpaper 600 and application of the metal primer Alloy Primer (Kuraray; Group JSP: Sandblasted with 100µm aluminum oxide; Group JCP: Sandblasted with 100mm aluminum oxide and treated with a metal Primer. The groups were cemented and stored in distilled water at 37ºC for 36 hours and submitted to the shear bond strength test. The mean and standard deviation (in Kgf/cm² obtained for each group was: PSP 4.0/0.4; PCP 88.9/33.6; JSP 163.2/27.6; JCP 144.5/54.0. After the statistical analysis the authors concluded that: the highest values were obtained for the sandblasted groups (JSP, JCP, regardless of the primer application; the Alloy Primer increased the retention between the Rely X cement and the polished surface of the Co-Cr-Mo alloy, yet its bond strength was not greater than that obtained with sandblasting; all specimens showed adhesive failures in the tested interface.Para avaliar o efeito de diferentes tratamentos superficiais sobre a resistência ao cisalhamento da união entre uma liga metálica (Co-Cr-Mo - Remanium CD e um cimento resinoso (Rely X TM e analisar o tipo de fratura durante a separação dos espécimes, quarenta pares de discos metálicos foram fundidos, regularizados e polidos, submetidos a quatro ciclos térmicos (vácuo, 960ºC, 8 minutos e divididos aleatoriamente em quatro grupos. Cada grupo recebeu um tipo de tratamento: Grupo PSP: Polimento com lixa d'água Nº 600; Grupo PCP: Polimento com lixa 600 e aplicação do
Primer: Fracture mechanics in the nuclear power industry
International Nuclear Information System (INIS)
Wessel, E.T.; Server, W.L.; Kennedy, E.L.
1990-01-01
This Primer is intended to familiarize utility engineers with the fracture mechanics technology and to provide the basis for a working knowledge of the subject. It is directed towards all the engineering disciplines that are involved either directly or indirectly with the structural reliability of electrical power generation equipment and systems. These engineering disciplines include such areas as: design and stress analysis, metallurgy and materials, nondestructive inspection and quality control, structural analysis and reliability engineering, chemical engineering and water chemistry control, and architectural engineering. This Primer does not provide a comprehensive, in-depth treatment of all the detailed aspects involved in fracture mechanics. It does, however, provide sufficient information and a common vocabulary that should enable engineers to: read and converse intelligently about the subject, understand and utilize ASME Codes and Regulatory Guides involving fracture mechanics, absorb technical information presented and discussed at various technical meetings, and begin to apply this technology towards actual engineering problems encountered in the course of their work. Example problems are provided to further enhance an understanding of fracture mechanics. Also, Appendix A describes fracture mechanics computer codes available through EPRI to analyze rotors, reactor pressure vessels and piping
Directory of Open Access Journals (Sweden)
Cristiane Becher Rosa
2008-06-01
Full Text Available OBJETIVO: o objetivo deste trabalho foi avaliar a resistência ao cisalhamento da colagem ortodôntica de um adesivo hidrofílico (Transbond Moisture-Insensitive Primer, 3M Unitek, Monrovia, Califórnia, de um adesivo auto-condicionante (Transbond Self-Etching Primer, 3M Unitek, Monrovia, Califórnia, e sem uso de adesivo, em superfícies de esmalte secas ou contaminadas por saliva. METODOLOGIA: incisivos bovinos (60 foram divididos em 6 grupos: (1 controle sem contaminação salivar (sem adesivo, (2 controle com contaminação salivar (sem adesivo, (3 adesivo auto-condicionante sem contaminação salivar, (4 adesivo auto-condicionante com contaminação salivar antes do adesivo, (5 adesivo hidrofílico sem contaminação salivar e (6 adesivo hidrofílico com contaminação salivar antes do adesivo. Braquetes metálicos foram colados com compósito (Transbond XT, 3M Unitek, Monrovia, Califórnia. Após a colagem, os corpos-de prova foram armazenados a 37±1ºC em ambiente úmido até a realização do teste de cisalhamento. Diferença estatística foi determinada com valor de probabilidade de 0,05 ou menos (p AIM: The purpose of this study was to evaluate the shear bond strength of orthodontic bonding with the use of a hydrophilic primer (Transbond Moisture-Insensitive Primer, 3M Unitek, Monrovia, Calif., a self-etching primer (Transbond Plus Self-etching Primer, 3M Unitek, Monrovia, Calif. and without primer application, in dry and saliva contaminated enamel surfaces. METHODS: Bovine incisors (60 were divided into 6 groups: (1 uncontaminated control (no primer, (2 control with saliva contamination (no primer, (3 uncontaminated self-etching primer, (4 saliva contamination before self-etching primer, (5 uncontaminated hydrophilic primer and (6 saliva contamination before hydrophilic primer. Stainless steel brackets were bonded with composite resin (Transbond XT, 3M Unitek, Monrovia, Calif.. After bonding, all samples were stored at 37±1°C in a
Rees, Prof. Lord Martin (John)
Indian Academy of Sciences (India)
Home; Fellowship. Fellow Profile. Elected: 1991 Honorary. Rees, Prof. Lord Martin (John) FRS. Date of birth: 23 June 1942. Address: Emeritus professor of Cosmology & Astrophysics, Institute of Astronomy, University of Cambridge, Madingley Road, Cambridge CB3 0HA, U.K.. Contact: Office: (+44-1223) 33 7548
Sardell, Alice; Johnson, Kay
1998-01-01
The Early and Periodic Screening, Diagnosis and Treatment (EPSDT) program, which was designed to ensure that Medicaid-eligible children receive comprehensive health services, is the only national attempt to provide a right to these services. The political factors that have shaped national EPSDT policy during the past decade are described, based on a conceptual framework developed by John W. Kingdon. The analysis focuses on the roles of two distinct sets of policy entrepreneurs: child health advocates and fiscally conservative governors. Their activities are described in relation to the larger political environment, or “political stream,” from the period of the expansion of Medicaid eligibility for pregnant women and children in the late 1980s to the enactment of a new State Children’s Health Insurance Program (SCHIP) in 1997. The relative saliency of eligibility and benefit issues in children’s health policies had a major influence on the politics and outcomes. PMID:9614420
John von Neumann selected letters
2005-01-01
John von Neuman was perhaps the most influential mathematician of the twentieth century, especially if his broad influence outside mathematics is included. Not only did he contribute to almost all branches of mathematics and created new fields, but he also changed post-World War II history with his work on the design of computers and with being a sought-after technical advisor to many figures in the U.S. military-political establishment in the 1940s and 1950s. The present volume is the first substantial collection of (previously mainly unpublished) letters written by von Neumann to colleagues, friends, government officials, and others. The letters give us a glimpse of the thinking of John von Neumann about mathematics, physics, computer science, science management, education, consulting, politics, and war. Readers of quite diverse backgrounds will find much of interest in this fascinating first-hand look at one of the towering figures of twentieth century science.
Directory of Open Access Journals (Sweden)
Pérez-Rey David
2010-08-01
Full Text Available Abstract Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1 convert each document into a tree of paper sections, (2 detect the candidate sequences using a set of finite state machine-based recognizers, (3 refine problem sequences using a rule-based expert system, and (4 annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch.
Johns Hopkins Particulate Matter Research Center
Federal Laboratory Consortium — The Johns Hopkins Particulate Matter Research Center will map health risks of PM across the US based on analyses of national databases on air pollution, mortality,...
Primer on molecular genetics. DOE Human Genome Program
Energy Technology Data Exchange (ETDEWEB)
1992-04-01
This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.
Adhesion of epoxy primer to hydrotalcite conversion coated AA2024
Leggat, Robert Benton, III
Hydrotalcite-based (HT) conversion coatings are being developed as an environmentally benign alternative to chromate conversion coatings (CCC). Accelerated exposure tests were conducted on epoxy primed, HT-modified AA2024 to gauge service performance. HT-based conversion coatings did not perform as well as the CCC when used with an epoxy primer. The current HT chemistries are optimized for stand-alone corrosion protection, however additional research into the primer/HT interactions is necessary before they can be implemented within a coating scheme. The relative contribution of mechanical and physico-chemical interactions in controlling adhesion has been investigated in this study. Practical adhesion tests were used to assess the dry and wet bond strength of epoxy primer on HT coatings using the pull-off tensile strength (POTS) as the figure of merit. The practical adhesion of HT coated samples generally fell between that observed for the CCC and bare AA2024. Laboratory testing was done to assess the physical and chemical properties of HT coatings. Contact angle measurements were performed using powders representative of different HT chemistries to evaluate the dispersive and acid-base character of the surface. The wet POTS correlated with the electrodynamic (dipole + dispersive) parameter of the surface tension. The HT surfaces were found to be predominantly basic. Given the basicity of epoxy, these results indicate that increasing the acidic character of HT coatings may increase the adhesion performance. This was supported by electrokinetic measurements in which the dry POTS was found to increase with decreasing conversion coating iso-electric point. The correlations with the dry and wet state adhesion are interpreted as indicating that dry state adhesion is optimized by minimizing unfavorable polar interactions between the basic epoxy and HT interfaces. Wet state adhesion, where polar interactions are disrupted, is dictated by non-polar bonding. FTIR
A Primer on Concepts and Applications of Proteomics in Neuroscience
DEFF Research Database (Denmark)
Hosp, Fabian; Mann, Matthias
2017-01-01
The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS...
The effects of pH on N-methacryloyl glycine primer on bond strength to acid-etched dentin.
Nishiyama, N; Suzuki, K; Asakura, T; Nakai, H; Yasuda, S; Nemoto, K
1996-07-01
To develop a more effective adhesive primer, it is imperative to understand the adhesion mechanisms of the resin to the demineralized dentin through a dentin primer. When the bonding agent was directly applied to the dentin etched by 40 wt % phosphoric acid without a primer pretreatment, the bond strength of the resin to the dentin was 5 MPa. Conversely, when the demineralized dentin was pretreated with the N-methacryloyl glycine (NM alpha A) primer solution with a pH value of 1.5, the bond strength increased considerably to 15 MPa. However, the bond strength dropped dramatically from 15 to 3 MPa when the sodium salt of NM alpha A was added, thereby increasing the pH value of the NM alpha A primer solution from 3.2 to 5.0. When the pH value was increased above 3.5 (pKa value), the number of ionized NM alpha A species increased in the solution. As a result, the bond strength of the resin fell to approximately 3 MPa. This result was obtained despite the 5-micron-thick hybrid layer that was created in the subsurface of the intertubular dentin. The number of unionized NM alpha A species increased by lowering the pH value below 3.5. As a result, the NM alpha A primer provided a higher bond strength of the resin to the demineralized dentin. In contrast, when 10 wt % citric acid containing 3 wt % ferric chloride was applied to the dentin, maximum bond strength was obtained when the pH value of the NM alpha A primer solution was 3.5. The pH dependency of the bond strength obtained following 10 wt % citric acid containing 3 wt % ferric chloride etching is different from the results obtained from 40 wt % phosphoric acid etching. This can be attributed to the difference in the characteristics of the demineralized collageous layer.
Transportation Management Area Planning Certification Review Primer: Revised January 18, 2018
2018-01-18
This primer outlines key concepts and expectations of a Transportation Management Area (TMA) Planning Certification Review. Reflecting on the collective experiences of past Certification Reviews, this includes references to relevant laws and regulati...
Note: Primer Amysat 001; Fragment size is 211bp
Indian Academy of Sciences (India)
Renuka
Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.
Indian Academy of Sciences (India)
Thomas, Prof. Sir John Meurig FRS. Date of birth: 15 December 1932. Address: Department of Materials Science and, Metallurgy, New Museums Site, 27, Babbage ... Theory Of Evolution. Posted on 23 January 2018. Joint Statement by the Three Science Academies of India on the teaching of the theory of evolution more.
Directory of Open Access Journals (Sweden)
Alútiz, Juan Carlos
2004-12-01
Full Text Available This article shows a global vision of the work of John Rawls, describing the evolution of his thought since his initial and original proposal of «Justice as Faimess», to his last contributions about Political Liberalism.
El presente artículo trata de ofrecer una visión panorámica de la obra de John Rawls, describiendo la evolución de su pensamiento desde su inicial y original propuesta de «Justicia como equidad», hasta sus últimas aportaciones en tomo al Liberalismo político
The Utility of a Physics Education in Science Policy
Roberts, Drew
2016-03-01
In order for regulators to create successful policies on technical issues, ranging from environmental protection to distribution of national Grant money, the scientific community must play an integral role in the legislative process. Through a summer-long internship with the Science, Space, and Technology Committee of the U.S. House of Representatives, I have learned that skills developed while pursuing an undergraduate degree in physics are very valuable in the policy realm. My physics education provided me the necessary tools to bridge the goals of the scientific and political communities. The need for effective comprehension and communication of technical subjects provides an important opportunity for individuals with physics degrees to make substantial contributions to government policy. Science policy should be encouraged as one of the many career pathways for physics students. Society of Physics Students, John and Jane Mather Foundation for Science and the Arts.
DEFF Research Database (Denmark)
Lassen, Kristin Marie; Kjær, Erik Dahl; Ouédraogo, Moussa
2014-01-01
Premise of the study: Microsatellite primers were developed for an indigenous fruit tree, Parkia biglobosa, as a tool to study reproductive biology and population structure. Here we use the primers to determine the number of fathers per pod. Methods and Results: Microsatellite loci were enriched...
Directory of Open Access Journals (Sweden)
S Hamid Raji
2011-01-01
Conclusion: The shear bond strength of clearfil protect bond and transbond plus self-etch primer was enough for bonding the orthodontic brackets. The mode of failure of bonded brackets with these two self-etch primers is safe for enamel.
Vähesed head portfellihaldurid / John Mauldin
Mauldin, John
2005-01-01
USA investeerimisnõustaja olulisematest põhimõtetest ja -reeglitest portfellihaldurite valikul. Investeerimissüsteemi analüüsist, minevikutootluse väheolulisusest ja fondimaailmas ellujäämisvõimalustest. Vt. samas: John Maudlin
Geographic Information Systems: A Primer
1990-10-01
Albert Bargeski Page Building 1 2001 Wisconsin Ave., N.W. Washington, DC 20235 (202) 673-5594 DATA: Physical Biological Chemical National Technical...Information Systems Proceedings. ’an Francisco, CA, Oct. 26-30. ASPRS and ACSM. Vol. 1. pp. 1’ - 147. John, N. 1982. Megatrends - Ten New Directions
Detection of gunshot primer residue on bone in an experimental setting-an unexpected finding.
Berryman, Hugh E; Kutyla, Alicja K; Russell Davis, J
2010-03-01
Pork ribs with intact muscle tissue were used in an experimental attempt to identify bullet wipe on bone at distances from 1 to 6 feet with 0.45 caliber, full metal jacket ammunition. This resulted in the unexpected finding of primer-derived gunshot residue (GSR) deep within the wound tract. Of significance is the fact that the GSR was deposited on the bone, under the periosteum, after the bullet passed through a Ziploc bag and c. 1 inch of muscle tissue. It is also important to note that the GSR persisted on the bone after the periosteum was forcibly removed. The presence of primer-derived GSR on bone provides the potential to differentiate gunshot trauma from blunt trauma when the bone presents an atypical gunshot wound. In this study, the presence of gunshot primer residue at a distance of 6 feet demonstrates the potential for establishing maximum gun-to-target distance for remote shootings.
Marburger, John H
2015-01-01
In a career that included tenures as president of Stony Brook University, director of Brookhaven National Laboratory, and science advisor to President George W. Bush, John Marburger (1941 2011) found himself on the front line of battles that pulled science ever deeper into the political arena. From nuclear power to global warming and stem cell research, science controversies, he discovered, are never just about science. Science Policy Up Close" presents Marburger s reflections on the challenges science administrators face in the twenty-first century. In each phase of public service Marburger came into contact with a new dimension of science policy. The Shoreham Commission exposed him to the problem of handling a volatile public controversy over nuclear power. The Superconducting Super Collider episode gave him insights into the collision between government requirements and scientists expectations and feelings of entitlement. The Directorship of Brookhaven taught him how to talk to the public about the risks ...
An anti-steroidogenic inhibitory primer pheromone in male sea lamprey (Petromyzon marinus)
Chung-Davidson, Yu-Wen; Wang, Huiyong; Bryan, Mara B.; Wu, Hong; Johnson, Nicholas S.; Li, Weiming
2013-01-01
Reproductive functions can be modulated by both stimulatory and inhibitory primer pheromones released by conspecifics. Many stimulatory primer pheromones have been documented, but relatively few inhibitory primer pheromones have been reported in vertebrates. The sea lamprey male sex pheromone system presents an advantageous model to explore the stimulatory and inhibitory primer pheromone functions in vertebrates since several pheromone components have been identified. We hypothesized that a candidate sex pheromone component, 7α, 12α-dihydroxy-5α-cholan-3-one-24-oic acid (3 keto-allocholic acid or 3kACA), exerts priming effects through the hypothalamic-pituitary-gonadal (HPG) axis. To test this hypothesis, we measured the peptide concentrations and gene expressions of lamprey gonadotropin releasing hormones (lGnRH) and the HPG output in immature male sea lamprey exposed to waterborne 3kACA. Exposure to waterborne 3kACA altered neuronal activation markers such as jun and jun N-terminal kinase (JNK), and lGnRH mRNA levels in the brain. Waterborne 3kACA also increased lGnRH-III, but not lGnRH-I or -II, in the forebrain. In the plasma, 3kACA exposure decreased all three lGnRH peptide concentrations after 1 h exposure. After 2 h exposure, 3kACA increased lGnRHI and -III, but decreased lGnRH-II peptide concentrations in the plasma. Plasma lGnRH peptide concentrations showed differential phasic patterns. Group housing condition appeared to increase the averaged plasma lGnRH levels in male sea lamprey compared to isolated males. Interestingly, 15α-hydroxyprogesterone (15α-P) concentrations decreased after prolonged 3kACA exposure (at least 24 h). To our knowledge, this is the only known synthetic vertebrate pheromone component that inhibits steroidogenesis in males.
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2017-07-01
Full Text Available Porcine adulteration in meatball samples were analyzed using real-time polymerase chain reaction (RT-PCR, based on the ND5 primer obtained by previous study. This work consisted of three stages which were annealing temperature optimization, method validation, and application. DNA template was extracted using phenol-CIAA (chloroform-iso amyl alcohol method. The optimum annealing temperature for ND5 primers (forward primer 5'-CATTCGCCTCACTCACATTAACC-3' and reverse primer 5'-AAGAGAGAGTTCTACGGTCTGTAG-3' was 58.0 °C, obtained after testing annealing at 50.5 to 59.5 °C gradient temperature with 5 °C interval. Melting curve analysis was done at 65.0 to 95.0 °C, with increasing temperature for 0.5 °C per 2 sec. Method was validated for its specificity, precision and limit of detection. RT-PCR method with ND5 primers produced 227 bp DNA fragment with 78.50 °C Tm value. From eight commercial meatball samples, one was detected containing porcine. The methods showed high specificity and precision, with experimentally determined limits for porcine were no less than 1%.
Development of a microsatellite primer set to investigate the genetic ...
Indian Academy of Sciences (India)
Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545-549. Table 1.
Development of specific primers for genus Fusarium and F. solani ...
African Journals Online (AJOL)
Yomi
2012-01-05
Jan 5, 2012 ... reproductive parts of plants. They are ... plant species in most parts of the world. .... 20 µl 2.5X master mix (Eppendorf) and 1 µl of each forward and ... List of primers developed for rapid detection of Fusarium sp. and F. solani.
John Kjaer : Nõukogude Liitu ja euroliitu seob vaid sõna "liit" / John Kjaer ; interv. Tuuli Koch
Kjaer, John
2003-01-01
Euroopa Komisjoni delegatsiooni juht Eestis John Kjaer vastab küsimustele, mis puudutavad Edgar Savisaare kõnet Keskerakonna kongressil, kus ta võrdles NSV Liitu Euroopa Liiduga; peamisi erinevusi EL-i ja totalitaarriigi vahel, otsuste langetamise põhimõtteid EL-is
John Dewey--Philosopher and Educational Reformer
Talebi, Kandan
2015-01-01
John Dewey was an American philosopher and educator, founder of the philosophical movement known as pragmatism, a pioneer in functional psychology, and a leader of the progressive movement in education in the United States.
Camilo, Cesar M; Lima, Gustavo M A; Maluf, Fernando V; Guido, Rafael V C; Polikarpov, Igor
2016-01-01
Following burgeoning genomic and transcriptomic sequencing data, biochemical and molecular biology groups worldwide are implementing high-throughput cloning and mutagenesis facilities in order to obtain a large number of soluble proteins for structural and functional characterization. Since manual primer design can be a time-consuming and error-generating step, particularly when working with hundreds of targets, the automation of primer design process becomes highly desirable. HTP-OligoDesigner was created to provide the scientific community with a simple and intuitive online primer design tool for both laboratory-scale and high-throughput projects of sequence-independent gene cloning and site-directed mutagenesis and a Tm calculator for quick queries.
Glennon, Kelsey L.; Cron, Glynis V.
2016-01-01
Premise of the study: Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Methods and Results: Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. Conclusions: These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species. PMID:27213125
An Interview with John Liontas
Sadeghi, Karim
2017-01-01
John I. Liontas, Ph.D. is an associate professor of foreign languages, English for speakers of other languages (ESOL), and technology in education and second language acquisition (TESLA), and director and faculty of the TESLA doctoral program at the University of South Florida. Dr. Liontas is a distinguished thought leader, author, and…
Directory of Open Access Journals (Sweden)
Marco Suárez
2006-05-01
Full Text Available Objetivo. Estudiar los factores ambientales y genéticos que influyen sobre la edad al primer parto dehembras romosinuano. Materiales y métodos. Fueron estudiados 932 datos de la edad al primer partode hembras de la raza Romosinuano, nacidas en el Centro de Investigación Turipaná de CORPOICA,Cereté, Colombia, en el período de 1980 a 2001. Para el estudio de los factores ambientales se utilizóel análisis de varianza mediante modelos lineales utilizando el procedimiento GLM de SAS (1995.Resultados. La edad al primer parto fue de 1162.3±4.2 días, con un coeficiente de variación del 11.19%.El análisis de varianza reveló que el año y mes de nacimiento fueron causas estadísticamente significativasde variación de la edad al primer parto. La heredabilidad, calculada por la correlación intraclase entremedias hermanas paternas fue de 0.16±0.08. Conclusión. El año y mes de nacimiento influyeron en laedad al primer parto de hembras romosinuano, pero la heredabilidad de la edad al primer parto y elsexo de la cría no se constituyen en características importantes a tener en cuenta.
Ares, Janus, Globalization: A Primer For The Military Leader in NATO
National Research Council Canada - National Science Library
Clemons, Dean
2002-01-01
...: international military and commercial investment; dual-use technologies; and export control. As a primer on these stakes for the rising military leader within the North Atlantic Treaty, the study elucidates the issue of cooperation vs...
John Bell and the Identical Twins
1984-01-01
A biographical profile of John S.Bell is presented based on extensive interviews the author had with Bell. Bell’s vierws on the quantum theory are presented along with a simple explanation of his idenity.
Bayesian models a statistical primer for ecologists
Hobbs, N Thompson
2015-01-01
Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili
John B. Watson's Alleged Sex Research: An Appraisal of the Evidence
Benjamin, Ludy T. Jr.; Whitaker, Jodi L.; Ramsey, Russell M.; Zeve, Daniel R.
2007-01-01
In 1974, a story was published about clandestine research done by John B. Watson that was judged to be so reprehensible that it was offered as the real reason he was fired from his faculty position at Johns Hopkins University in 1920, at perhaps the peak of his academic career. Watson's dismissal from Johns Hopkins may have been the most important…
Directory of Open Access Journals (Sweden)
Lenka Maršálková
2014-07-01
Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.
Primer for criticality calculations with DANTSYS
International Nuclear Information System (INIS)
Busch, R.D.
1996-01-01
With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses
A web-based adaptive tutor to teach PCR primer design
van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.
2012-01-01
When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used
A Web-based Adaptive Tutor to Teach PCR Primer Design
Seters, van J.R.; Wellink, J.; Tramper, J.; Goedhart, M.J.; Ossevoort, M.A.
2012-01-01
When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used
Tribes of Men: John Joseph Mathews and Indian Internationalism
Lutenski, Emily
2012-01-01
In this article, the author discusses John Joseph Mathews and Indian internationalism. As an old man, Osage intellectual, writer, and historian, John Joseph Mathews recalled his expatriation from the United States during the 1920s. After growing up in Pawhuska, Oklahoma, seat of the Osage Nation, where he had been born in 1894 to a white mother…
MoKS teistes koostööprojektides / John Grzinich
Grzinich, John
2005-01-01
13. III Genfis toimunud helikunstiüritusest "VernalFLUX / Kevadvool", millest Eestist võtsid osa MoKS'i koordinaatorid John Grzinich ja Evelyn Müürsepp, nende performance'ist "Maaheli. Unustatud unistused". Uuest organisatsioonist Claudmirror, mis on välja andnud seitse CD-ROM-i, nende seas John Grzinichi CD-ROM-i "Võrdsed ja kauged jooned"
The manifesto as genre in Ibsen's John Gabriel Borkman
Directory of Open Access Journals (Sweden)
Christine Korte
2015-02-01
Full Text Available This article examines John Gabriel Borkman’s neo-aristocratic performance of power and authority in Ibsen’s eponymously titled play (1896. After his downfall, John Gabriel has retreated into his once grand reception hall wherein he has become like a petrified relic from a preceding era. His performance within the “fading glory” of the upstairs hall– a veritable theatre for his delusions of grandeur – is one of an outmoded type of bourgeois “hero” whose flagrantly illicit dealings are no longer tenable as capitalism becomes ever-more “rational” and bureaucratic in its façade. The article focuses on John Gabriel’s performance of a “sovereign” or charismatic authority and examines his future visions as “manifestos”. The manifesto is a form belonging to a feudal era of rule by divine right – one that is necessarily “theatrical” in its performance of a legitimate authority. Assuming the voice of the sovereign, John Gabriel attempts to address the needs of the iron-ore miners – a desiring, albeit latent force in Ibsen’s text. The desires of the workers, however, are continually effaced by the bewitching powers of capitalist abstraction, which account for the alienation of family and individuals in Ibsen’s play. Comparing John Gabriel’s manifesto with Marx and Engels’ Communist Manifesto not only accounts for the end of an age of neo-aristocratic bourgeois decadence, but also marks labour as the definitive socio-political issue of the late 19th century. Where John Gabriel uses a dramaturgy rooted in past models of rule to address the workers in his vision of a benevolent “kingdom”, the Communist Manifesto heralds the death of his class and replaces the voice of the “sovereign authority” with the self-authorising voice of the workers themselves. Borkman’s fatal flaw then is failing to sufficiently address the plight of the iron-ore miners with whom he claims intimate acquaintance but with whom
International Nuclear Information System (INIS)
Aigner, R.; Melzer, E.; Seissler, H.
1986-01-01
This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de
Bond strength of primer/cement systems to zirconia subjected to artificial aging.
Zhao, Li; Jian, Yu-Tao; Wang, Xiao-Dong; Zhao, Ke
2016-11-01
Creating reliable and durable adhesion to the nonactive zirconia surface is difficult and has limited zirconia use. The introduction of functional monomers such as 10-methacryloyloxydecyl dihydrogen phosphate (MDP) appears to have enhanced bond strength to zirconia. The purpose of this in vitro study was to evaluate the long-term bond strength of several MDP-containing primer/cement systems to zirconia. Zirconia blocks were divided into 6 groups (n=24) according to the 3 primers/cements to be bonded, as follows: Scotchbond Universal/RelyX Ultimate (SU/RU; consisting of MDP-containing primer/MDP-free cement); Clearfil ceramic primer/Panavia F (CCP/PAN; consisting ofMDP-containing/MDP-containing); and Z-Prime Plus/Duo-Link (ZP/DUO; consisting ofMDP-containing/MDP-free), which were compared with 3 nonprimed groups, RU, PAN, and DUO. After bonding, each group was further divided into 3 subgroups (n=8) according to the level of aging: 24-hour storage in water at 37°C (24H); 30-day storage at 37°C (30D); and 30-day storage at 37°C followed by 3000 thermal cycles (30D/TC). After aging, a shear bond strength test and failure mode analysis were performed. The data were analyzed using 2-way ANOVA (α=.05). After aging, nearly all primer/cement groups presented significantly higher bond strength than the related nonprimed groups for each level of aging (P<.05), except for CCP/PAN versus PAN with 24H (P=.741). SU/RU had the highest bond strength among the groups for all treatments (P<.05), except for CCP/PAN versus SU/RU with 30D/TC (P=.171). Among the nonprimed groups, only RU went through 30D/TC without premature debonding. With 24H and 30D, the failure modes in SU/RU and CCP/PAN were purely mixed, whereas those in the other groups were mainly adhesive, except for RU. The superiority of the initial bond strength in SU/RU may result from some functional components other than MDP. The presence of MDP in the cement did not appear to have a positive effect on long-term bond
Directory of Open Access Journals (Sweden)
Marta Vaamonde Gamo
2016-07-01
Full Text Available This article demonstrates how feminism welcomed and was influenced by the pragmatism of John Dewey. While in real terms his impact on European feminism has been minimal, this was not the case in contemporary America. In this article we study both how Dewey’s ideas were received amongst American feminists, as well as certain aspects of his thinking that could be enormously useful in present-day debates between critical and postmodern feminists. We compare the Deweyan and feminist arguments against the traditional dualisms that acted as philosophical support for social inequality, paying particular attention to mind–body dualism, and the consequent undervaluation of physical and emotional wellbeing. We also show that John Dewey’s proposals were, in fact, more radical than those of the feminists of the day. Indeed, democracy has to be understood as a way of life that affects every dimension of experience, and is crucial to the personal and social growth that enables the unjust social inequalities between men and women to be overcome.
British energy policy and the market for coal - minutes of evidence - Tuesday 1 December 1992
Energy Technology Data Exchange (ETDEWEB)
1992-12-01
The Committee set up to examine UK energy policy and the market for coal (particularly British Coal's place in that market), examined evidence from: Mr David Porter, Mr Neil Bryson, Mr Fergus Wiggin and Mr John Macadam (Association of Independent Electricity Producers); Mr John Collins, Mr John Wybrew, Dr Chris Fay and Mr Ian Wybrew-Bond (Shell UK Ltd); Sir James McKinnon and Mr Greg McGregor (Office of Gas Supply (OFGAS)). Aspects covered include consequences of British Coal's pit closure programme, UK natural gas reserves, and the effects of increased demand for natural gas due to the 'dash for gas' (i.e. generating electricity from natural gas rather than coal).
Incorporating travel-time reliability into the congestion management process : a primer.
2015-02-01
This primer explains the value of incorporating travel-time reliability into the Congestion Management Process (CMP) : and identifies the most current tools available to assist with this effort. It draws from applied research and best practices : fro...
John Hejduk ja tema Wall House 2 = John Hejduk and his Wall House 2 / Vilen Künnapu
Künnapu, Vilen, 1948-
2010-01-01
Ameerika arhitekt John Hejdukist ja tema mõjust 20. sajandi lõpukümnendite arhitektuurimõttele. Ka 1973. aastal projekteeritud eramust Wall House 2, mis valmis alles 2001. aastal Groningenis. Kommentaar Soome arhitektuuriprofessor Juhani Pallasmaalt
Sousa, Ana Beatriz Silva; de Mattos Pimenta Vidal, Cristina; Leme-Kraus, Ariene Arcas; de Carvalho Panzeri Pires-de-Souza, Fernanda; Bedran-Russo, Ana K.
2016-01-01
Objective To evaluate the effect of experimental primers (chlorhexidine, enriched mixture of proanthocyanidins and doxycycline) on the adhesive properties and gelatinolytic activity at dentin-resin interfaces of occlusal Class I restorations. Methods The inactivation of enzymes by the experimental primers was assessed by fluorescence assay and gelatin zymography. To assess the adhesive properties, occlusal Class I cavities were prepared in sound human molars, etched with phosphoric acid and restored with one of the primers and an etch-and-rinse adhesive system (Adper Single Bond Plus - 3M ESPE). After the restorative procedures, the specimens were divided into two subgroups (n = 6) consisting of storage in incubation buffer or axial cyclic loading at 50 N and 1,000,000 cycles. Then, the sectioned and sliced specimens were assigned to in situ zymography assay and microtensile bond strength (TBS) test. Results Fluorescence assay and gelatin zymography revealed that the experimental primers inactivated rMMPs. In situ zymography (2-way ANOVA, Tukey, p 0.05). Significance The use of experimental primers impaired the enzymatic activity at the dentin-adhesive interface after cyclic loading and the activity of rMMPs. Cyclic loading did not have a significant effect on the bond strength. PMID:27524231
Memorial—John A. Washington II, M.D.▿
2010-01-01
John A. Washington II, M.D., former Head of Clinical Microbiology at the Mayo Clinic from 1972 to 1986 and Chairman of the Department of Microbiology at the Cleveland Clinic from 1986 to 1992, died on 5 September 2010 at the age of 74. John was an internationally recognized, widely respected leader in the disciplines of clinical microbiology and infectious diseases, authoring more than 450 scientific articles, books, and book chapters and training scores of pathology residents and clinical mi...
Efficient One-Step Fusion PCR Based on Dual-Asymmetric Primers and Two-Step Annealing
DEFF Research Database (Denmark)
Liu, Yilan; Chen, Jinjin; Thygesen, Anders
2018-01-01
Gene splicing by fusion PCR is a versatile and widely used methodology, especially in synthetic biology. We here describe a rapid method for splicing two fragments by one-round fusion PCR with a dual-asymmetric primers and two-step annealing (ODT) method. During the process, the asymmetric...... intermediate fragments were generated in the early stage. Thereafter, they were hybridized in the subsequent cycles to serve as template for the target full-length product. The process parameters such as primer ratio, elongation temperature and cycle numbers were optimized. In addition, the fusion products...
John Smith - eesti kunstnik / Ants Juske
Juske, Ants, 1956-2016
2006-01-01
Marko Mäetamme ja Kaido Ole kollektiivsest loomingust, mida esitatakse John Smithi autorinime all, mõnda ka salapärase J. Smithi nn. biograafiast. Illustratsiooniks J. Smith'i "Jumalate maailm I (fragment). Õli, lõuend, 2002. Erakogu
Coy, Mary
2010-01-01
In their 2005 exhibit of John Biggers' work, the New Orleans Museum of Art described it as being inspired by "African art and culture, the injustices of a segregated United States, the stoic women in his own family, and the heroes of everyday survival." In this article, the author describes how her students reinterpreted Biggers' work.…
El primer encuentro del padre con el bebé prematuro en la Unidad de Cuidados Intensivos Neonatales
Directory of Open Access Journals (Sweden)
Fernanda Martins Castro
2015-06-01
Full Text Available Objetivo: Describir el primer encuentro del padre con el hijo en la Unidad de Cuidados Intensivos Neonatales (UCIN y analizar el significado de este momento en la perspectiva de los padres. Método: estudio cualitativo, con ocho padres de niños prematuros, a través de entrevistas semi-estructuradas. Los datos se analizaron a través del análisis temático. Resultados: Surgieron tres núcleos temáticos: "primer encuentro con hijo prematuro: sentimientos paternales y emociones", "construcción de la relación entre los profesionales y los padres de los recién nacidos a partir del primer encuentro" y reconocimiento de la paternidad en el contexto de la UCIN. Conclusión: El primer encuentro del padre con su hijo en la UCIN provoca sentimientos y sorpresa, dolor, incertidumbre, alegría y esperanza. El equipo de salud debe estar preparado para brindar apoyo emocional, información y establecer una comunicación efectiva desde la primera visita.
Teaching Thermal Hydraulics and Numerical Methods: An Introductory Control Volume Primer
International Nuclear Information System (INIS)
D. S. Lucas
2004-01-01
A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com
Comparison of Self-Etch Primers with Conventional Acid Etching System on Orthodontic Brackets
Zope, Amit; Zope-Khalekar, Yogita; Chitko, Shrikant S.; Kerudi, Veerendra V.; Patil, Harshal Ashok; Jaltare, Pratik; Dolas, Siddhesh G
2016-01-01
Introduction The self-etching primer system consists of etchant and primer dispersed in a single unit. The etching and priming are merged as a single step leading to fewer stages in bonding procedure and reduction in the number of steps that also reduces the chance of introduction of error, resulting in saving time for the clinician. It also results in smaller extent of enamel decalcification. Aim To compare the Shear Bond Strength (SBS) of orthodontic bracket bonded with Self-Etch Primers (SEP) and conventional acid etching system and to study the surface appearance of teeth after debonding; etching with conventional acid etch and self-etch priming, using stereomicroscope. Materials and Methods Five Groups (n=20) were created randomly from a total of 100 extracted premolars. In a control Group A, etching of enamel was done with 37% phosphoric acid and bonding of stainless steel brackets with Transbond XT (3M Unitek, Monrovia, California). Enamel conditioning in left over four Groups was done with self-etching primers and adhesives as follows: Group B-Transbond Plus (3M Unitek), Group C Xeno V+ (Dentsply), Group D-G-Bond (GC), Group E-One-Coat (Coltene). The Adhesive Remnant Index (ARI) score was also evaluated. Additionally, the surface roughness using profilometer were observed. Results Mean SBS of Group A was 18.26±7.5MPa, Group B was 10.93±4.02MPa, Group C was 6.88±2.91MPa while of Group D was 7.78±4.13MPa and Group E was 10.39±5.22MPa respectively. In conventional group ARI scores shows that over half of the adhesive was remaining on the surface of tooth (score 1 to 3). In self-etching primer groups ARI scores show that there was no or minor amount of adhesive remaining on the surface of tooth (score 4 and 5). SEP produces a lesser surface roughness on the enamel than conventional etching. However, statistical analysis shows significant correlation (pbracket bonding after enamel conditioning with any of the SEPs tested. The SEPs used in Groups C (Xeno V
Ongkowidjaja, F.; Soegiharto, B. M.; Purbiati, M.
2017-08-01
The shear bond strength (SBS) can be increased by removing protein pellicles from the enamel surface by deproteinization using 5.25% sodium hypochlorite (NaOCl). The SBS of a self-etch primer is lower than that of a total etch primer; nonetheless, it prevents white spot lesions. This study aimed to assess the SBS of the Anyetch (AE) total etch primer and FL-Bond II Shofu (FL) self-etch primer after enamel deproteinization using 5.25% NaOCl. Forty eight human maxillary first premolars were extracted, cleaned, and divided into four groups. In group A, brackets were bonded to the enamel without deproteinization before etching (A1: 10 teeth using total etch primer (AE); A2: 10 teeth using self-etch primer (FL)). In group B, brackets were bonded to the enamel after deproteinization with 5.25% NaOCl before etching (B1: 10 teeth using total etch primer (AE); B2: 10 teeth using self-etch primer (FL)). Brackets were bonded using Transbond XT, stored in artificial saliva for 24 h at 37°C, mounted on acrylic cylinders, and debonded using a Shimadzu AG-5000 universal testing machine. There were no significant differences in SBS between the total etch (AE) groups (p > 0.05) and between the self-etch (FL) groups (p > 0.05). There were significant differences in SBS between groups A and B. The mean SBS for groups A1, A2, B1, and B2 was 12.91±3.99, 4.46±2.47, 13.06±3.66, and 3.62±2.36 MPa, respectively. Deproteinization using NaOCl did not affect the SBS of the total etch primer (AE) group; it reduced the SBS of the self-etch primer (FL) group, but not with a statistically significant difference.
John Holt Stanway: Gone to Texas
Bryan, J.
2008-01-01
John Holt Stanway (1799Ð1872) was an amateur astronomer who lived in Manchester, England until 1845. He was in contact with the English Ôgrand amateurÕ astronomer, William Henry Smyth, who supported him for Fellowship of the Royal Astronomical Society and evidently advised him on how to build and equip an observatory. Apparently, Stanway had an observatory at Chorlton-cum-Hardy in 1837. In 1845, Stanway left for the United States in response to serious business problems. En route, he met Ashbel Smith, a representative of the government of the Republic of Texas, who convinced Stanway to go to Texas. There he changed his name to John H. Smythe Stanley and settled in Houston, where he re-established his observatory. He became a commercial photographer and wrote about astronomy and other scientific subjects in Houston newspapers until his death in 1872.
A Primer on Observational Measurement.
Girard, Jeffrey M; Cohn, Jeffrey F
2016-08-01
Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.
Directory of Open Access Journals (Sweden)
Julio J. Masquijo
2014-10-01
Full Text Available Introducción: si bien el crecimiento prenatal y posnatal del pie ha sido documentado hace varios años, el crecimiento longitudinal del primer metatarsiano en particular no ha sido estudiado previamente. El objetivo del estudio es determinar el patrón de crecimiento longitudinal posnatal de este hueso y compararlo con el del pie y los huesos largos del miembro inferior. Materiales y Métodos: mediante una búsqueda informatizada, se identificaron pacientes <18 años de edad con radiografías informadas como “normal” por el radiólogo. Se analizó una muestra de 886 pacientes divididos en 18 grupos según la edad (0-11 meses, 1 año, 2 años, etc. y el sexo. El análisis de las imágenes se realizó con un software de imágenes Kodak Carestream PACS. Resultados: el largo promedio en el primer grupo fue de 19,91 mm (3,20; 15,22-25,62. El largo promedio en el último grupo fue de 66,13 mm (5,33; 52,50-77,18. La tasa de crecimiento anual fue de 2,71 mm. La edad promedio al momento del cierre de la fisis fue de 14.85 años (± 1.64 para los varones y 14.77 años (± 3.63 para las niñas. Conclusión: el crecimiento del primer metatarsiano acompaña el crecimiento longitudinal del pie, pero no el de los huesos largos del miembro inferior. Las curvas de crecimiento del primer metatarsiano descritas en este artículo pueden ser aplicadas en patologías que afectan el desarrollo del pie o que requieren cirugía de corrección sobre el primer metatarsiano, o se las puede emplear como estándar de referencia en futuros estudios.
77 FR 2317 - Captain John Smith Chesapeake National Historic Trail Advisory Council
2012-01-17
... DEPARTMENT OF THE INTERIOR National Park Service Captain John Smith Chesapeake National Historic... that the Advisory Committee on the Captain John Smith Chesapeake National Historic Trail will hold a... Columbia,'' tracing the 1607-1609 voyages of Captain John Smith to chart the land and waterways of the...
76 FR 26767 - Captain John Smith Chesapeake National Historic Trail Advisory Council
2011-05-09
... DEPARTMENT OF THE INTERIOR National Park Service Captain John Smith Chesapeake National Historic... that the Advisory Committee on the Captain John Smith Chesapeake National Historic Trail will hold a...-1609 voyages of Captain John Smith to chart the land and waterways of the Chesapeake Bay. This meeting...
77 FR 12324 - Captain John Smith Chesapeake National Historic Trail Advisory Council
2012-02-29
... DEPARTMENT OF THE INTERIOR National Park Service Captain John Smith Chesapeake National Historic... that the Advisory Committee on the Captain John Smith Chesapeake National Historic Trail will hold a...-1609 voyages of Captain John Smith to chart the land and waterways of the Chesapeake Bay. This meeting...
76 FR 52691 - Captain John Smith Chesapeake National Historic Trail Advisory Council
2011-08-23
... DEPARTMENT OF THE INTERIOR National Park Service Captain John Smith Chesapeake National Historic... that the Advisory Committee on the Captain John Smith Chesapeake National Historic Trail will hold a...-1609 voyages of Captain John Smith to chart the land and waterways of the Chesapeake Bay. This meeting...
Lopes, Denilce Meneses; de Oliveira Campos, Lúcio Antônio; Salomão, Tânia Maria Fernandes; Tavares, Mara Garcia
2010-04-01
Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.
Gonzalez-Martinez, Alejandro; Rodriguez-Sanchez, Alejandro; Rodelas, Belén; Abbas, Ben A; Martinez-Toledo, Maria Victoria; van Loosdrecht, Mark C M; Osorio, F; Gonzalez-Lopez, Jesus
2015-01-01
Identification of anaerobic ammonium oxidizing (anammox) bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing) of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON) and three full-scale bioreactors (anammox, CANON, and DEMON), was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature). The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C) and hence a range of annealing temperatures of 44-49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.
Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki
2011-03-01
The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Douglas de Almeida Pereira
2015-09-01
Full Text Available Primer pairs that access microsatellite loci, initially constructed through the genome of Passiflora edulis Sims flavicarpa and P. alata, were tested concerning their ability to access microsatellite loci in ‘somnus’ passion fruit tree (P. setacea individuals. Seven out of the thirty one primer pairs tested were able to access DNA polymorphism in the genome of this wild Passiflora species, by evaluating six natural populations, located in a transition area between the biomes Caatinga and Cerrado, in the state of Bahia, Brazil. The number of alleles/loci was small, oscillating from 1 to 4. The average heterozygosity observed per locus in all populations ranged from 0.13 to 0.40. There was transference of heterologous microsatellite primer pairs from the Passiflora genus to ‘somnus’ passion fruit tree, constituting a new set of primers that access random co-dominant locus in this species, useful for conservationist purposes and pre-improvement of ‘somnus’ passion fruit tree.
Kaminsky, James S.
2010-01-01
It is argued here that understanding John Dewey's thought as that of a prodigal liberal or a fellow traveller does not capture the complexity of his work. It is also important to recognise the portion of his work that is "historie morale." In the very best sense it is epic, encapsulating the hopes and dreams of a history of the American people in…
Williams, Jerry L.
2016-01-01
This essay examines the poetry of John Dewey, 101 poems in total. Characteristic of the rhymed and metered poetry of the period, they show a very human side of Dewey. This analysis argues that many of his poems deal with existential themes--love, finitude, and God, for example. On a deeper level these poems are also show connections to Dewey's…
John Deweys kritik af liberal education
DEFF Research Database (Denmark)
Huggler, Jørgen
2017-01-01
The paper deals with John Dewey's aversion against liberal education and his concern about a 'dual track' educational system separating liberal education and vocational education. It investigates the reason why Dewey maintains that the philosophical 'dualisms' culminate in the question on vocation....
Directory of Open Access Journals (Sweden)
Denilce Meneses Lopes
2010-01-01
Full Text Available Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.
MCNPTM criticality primer and training experiences
International Nuclear Information System (INIS)
Briesmeister, J.; Forster, R.A.; Busch, R.
1995-01-01
With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP
Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J
2018-01-16
DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of
La herencia igualitarista de John Rawls
Directory of Open Access Journals (Sweden)
Puyol González, Ángel
2004-12-01
Full Text Available One of the indisputable achievements of John Rawls work has been the revitalisation of the concept of equality in the ethics and political philosophy of the last few years. He has removed it from the monopoly of the ideologies that have had better or worse luck throughout the entire twentieth century and returned it to the analytical and conceptual rigor of philosophy. Moreover, he has done so with the added virtue of harmonising the value of equality with the values of freedom and efficiency, which is an effort that is not always valued with sufficient understanding. There is no doubt about the influence of Rawls theory of justice on current egalitarian thinking that, in some way, has been, and is still being, built -following -or diverging from the wake opened by the philosopher from Harvard. In this article, I analyse the main debates that are going on about Rawlsian egalitarianism and I point out some possible future orientation. In the first place, I set out the two great egalitarian arguments in Rawls work stemming, respectively, from a person's moral conception and the moral arbitrariness of the individual' s social and natural contingencies. Afterwards, I explore the problems of both arguments insisting, on one hand, on the inadequacy of the Kantian moral personality as a foundation for an egalitarian theory and, on the other hand, on the inconsistency of luck egalitarianism as an egalitarian extension of Rawls theory. In third place, I demonstrate that the main egalitarian problem in Rawls work comes from the concept of equality and equity void of solidarity. I conclude, finally, that justice as fairness should be contrasted with justice as fraternity.
Uno de los logros indiscutibles de la obra de John Rawls ha sido la revitalización del concepto de igualdad en la ética y la filosofía política de los últimos años, desmonopolizándolo de las ideologías que han recorrido con mejor o peor fortuna todo el siglo xx y devolvi
Can previous acid etching increase the bond strength of a self-etching primer adhesive to enamel?
Directory of Open Access Journals (Sweden)
Ana Paula Morales Cobra Carvalho
2009-06-01
Full Text Available Because a greater research effort has been directed to analyzing the adhesive effectiveness of self etch primers to dentin, the aim of this study was to evaluate, by microtensile testing, the bond strength to enamel of a composite resin combined with a conventional adhesive system or with a self-etching primer adhesive, used according to its original prescription or used with previous acid etching. Thirty bovine teeth were divided into 3 groups with 10 teeth each (n= 10. In one of the groups, a self-etching primer (Clearfil SE Bond - Kuraray was applied in accordance with the manufacturer's instructions and, in the other, it was applied after previous acid etching. In the third group, a conventional adhesive system (Scotchbond Multipurpose Plus - 3M-ESPE was applied in accordance with the manufacturer's instructions. The results obtained by analysis of variance revealed significant differences between the adhesive systems (F = 22.31. The self-etching primer (Clearfil SE Bond presented lower enamel bond strength values than the conventional adhesive system (Scotchbond Multipurpose Plus (m = 39.70 ± 7.07 MPa both when used according to the original prescription (m = 27.81 ± 2.64 MPa and with previous acid etching (m = 25.08 ± 4.92 MPa.
Controlling Air Pollution; A Primer on Stationary Source Control Techniques.
Corman, Rena
This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…
Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing
2018-05-12
Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.
Commemorating John F. MacDonald and the Art of Being a Mentor.
Jackson, Michael F; Prado, Vania F; Prado, Marco A M
2016-09-01
John F. MacDonald was a close friend and mentor whose life was ended far too soon on April 22, 2014. To those who knew him, John was an endearing blend of fiery Scotsman, compassionate socialist, dedicated family man, and tireless investigator. Those close to him valued his loyalty and friendship, relished his biting wit, and puzzled at his self-deprecating manner. His career spanned a remarkable period of discovery from the early identification of excitatory amino acid, to the molecular cloning and characterization of glutamate receptors and the elucidation of mechanisms responsible for regulating their function. A true pioneer in each of these areas, John's research has had a lasting impact on our understanding of excitatory synaptic transmission and its plasticity. Our intent in commemorating John's work is to focus on some notable discoveries that highlight the impact and innovative aspects of John's work. In doing so, we also wish to highlight just how greatly our understanding of the glutamate transmitter systems has advanced since the late 1970s, when John first launched his independent neuroscience career.
Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis
Kartika Maharani; Andira Larasari; Tiara Aninditha; Yetty Ramli
2015-01-01
Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP) dan metastasis (TM) menyebabkan perbedaan gambaran klinis dan derajat gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek b...
A primer on the mortgage market and mortgage finance
Daniel J. McDonald; Daniel L. Thornton
2008-01-01
This article is a primer on mortgage finance. It discusses the basics of the mortgage market and mortgage finance. In so doing, it provides useful information that can aid individuals in making better mortgage finance decisions. The discussion and the tools are presented within the context of mortgage finance; however, these same principles and tools can be applied to a wide range of financial decisions.
Lee, Ji-Yeon; Ahn, Jaechan; An, Sang In; Park, Jeong-Won
2018-02-01
The aim of this study is to compare the shear bond strengths of ceramic brackets bonded to zirconia surfaces using different zirconia primers and universal adhesive. Fifty zirconia blocks (15 × 15 × 10 mm, Zpex, Tosoh Corporation) were polished with 1,000 grit sand paper and air-abraded with 50 µm Al 2 O 3 for 10 seconds (40 psi). They were divided into 5 groups: control (CO), Metal/Zirconia primer (MZ, Ivoclar Vivadent), Z-PRIME Plus (ZP, Bisco), Zirconia Liner (ZL, Sun Medical), and Scotchbond Universal adhesive (SU, 3M ESPE). Transbond XT Primer (used for CO, MZ, ZP, and ZL) and Transbond XT Paste was used for bracket bonding (Gemini clear ceramic brackets, 3M Unitek). After 24 hours at 37°C storage, specimens underwent 2,000 thermocycles, and then, shear bond strengths were measured (1 mm/min). An adhesive remnant index (ARI) score was calculated. The data were analyzed using one-way analysis of variance and the Bonferroni test ( p = 0.05). Surface treatment with primers resulted in increased shear bond strength. The SU group showed the highest shear bond strength followed by the ZP, ZL, MZ, and CO groups, in that order. The median ARI scores were as follows: CO = 0, MZ = 0, ZP = 0, ZL = 0, and SU = 3 ( p < 0.05). Within this experiment, zirconia primer can increase the shear bond strength of bracket bonding. The highest shear bond strength is observed in SU group, even when no primer is used.
John Dewey, William Wirt and the Gary Schools Plan: A Centennial Reappraisal
Thorburn, Malcolm
2017-01-01
A century on from the height of John Dewey's educational writings and the reputation of the Gary Schools Plan as a model of progressive education, the paper reappraises two key matters: the relationship between John Dewey and William Wirt, the first superintendent of the Gary Schools in Gary Indiana, and the coherence between John Dewey's…
A primer on pseudorandom generators
Goldreich, Oded
2010-01-01
A fresh look at the question of randomness was taken in the theory of computing: A distribution is pseudorandom if it cannot be distinguished from the uniform distribution by any efficient procedure. This paradigm, originally associating efficient procedures with polynomial-time algorithms, has been applied with respect to a variety of natural classes of distinguishing procedures. The resulting theory of pseudorandomness is relevant to science at large and is closely related to central areas of computer science, such as algorithmic design, complexity theory, and cryptography. This primer surveys the theory of pseudorandomness, starting with the general paradigm, and discussing various incarnations while emphasizing the case of general-purpose pseudorandom generators (withstanding any polynomial-time distinguisher). Additional topics include the "derandomization" of arbitrary probabilistic polynomial-time algorithms, pseudorandom generators withstanding space-bounded distinguishers, and several natural notions...
Barenghi, Carlo
2016-01-01
The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .
Making the connection: advancing traffic incident management in transportation planning : a primer.
2013-07-01
"The intent of this primer is to inform and guide traffic incident management (TIM) professionals and transportation planners to initiate and develop collaborative relationships and advance TIM programs through the metropolitan planning process. The ...
3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.
Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong
2008-09-01
We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.
Charles Darwin and John Herschel
Warner, B.
2009-11-01
The influence of John Herschel on the philosophical thoughts of Charles Darwin, both through the former's book, Natural Philosophy, and through their meeting in 1836 at the Cape of Good Hope, is discussed. With Herschel having himself speculated on evolution just a few months before he met Darwin, it is probable that he stimulated at least the beginnings of the latter's lifelong work on the subject.
Sergeant, Martin J; Constantinidou, Chrystala; Cogan, Tristan; Penn, Charles W; Pallen, Mark J
2012-01-01
The analysis of 16S-rDNA sequences to assess the bacterial community composition of a sample is a widely used technique that has increased with the advent of high throughput sequencing. Although considerable effort has been devoted to identifying the most informative region of the 16S gene and the optimal informatics procedures to process the data, little attention has been paid to the PCR step, in particular annealing temperature and primer length. To address this, amplicons derived from 16S-rDNA were generated from chicken caecal content DNA using different annealing temperatures, primers and different DNA extraction procedures. The amplicons were pyrosequenced to determine the optimal protocols for capture of maximum bacterial diversity from a chicken caecal sample. Even at very low annealing temperatures there was little effect on the community structure, although the abundance of some OTUs such as Bifidobacterium increased. Using shorter primers did not reveal any novel OTUs but did change the community profile obtained. Mechanical disruption of the sample by bead beating had a significant effect on the results obtained, as did repeated freezing and thawing. In conclusion, existing primers and standard annealing temperatures captured as much diversity as lower annealing temperatures and shorter primers.
Science Policy: Behind the Scenes
Barnett, Travis
2011-04-01
I served nine weeks as an intern in the House of Representatives Committee on Science and Technology. For the majority of the summer I served in the Research and Science Education Subcommittee, researching, among other things, cyber-enabled learning, cybersecurity, and alternate energy costs. I learned a great deal about the workings of the American government and how to contribute to a professional office environment. During these nine weeks, my personal communication skills were greatly improved. My internship was created and funded by the John and Jane Mather Foundation for the Arts and Sciences, and as the only merit-based science committee intern, I felt a great responsibility to prove my worth in the Committee. It is important to have scientists involved in the policy of our government in order to keep our nation on a progressive track, and to preserve current scientific discoveries for posterity. Immersed in government and science policy, I feel very learned and prepared to participate in these fields.
A Web-Based Adaptive Tutor to Teach PCR Primer Design
van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.
2012-01-01
When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…
Development of specific primers for the detection of HVA1 from ...
African Journals Online (AJOL)
aghomotsegin
2014-01-22
Jan 22, 2014 ... can potentially improve the stress tolerance in plants. (Bajaj et al. ... protein) from barley was engineered in rice (Chandra et al., 2004; Rohila et al., .... US), 400 nM forward and reverse primers, 100 ng of DNA template in 25 µl ...
De neurocirujano a primer ministro de Salud de la Argentina
Directory of Open Access Journals (Sweden)
Karina Inés Ramacciotti
2008-01-01
Full Text Available La trayectoria y los vínculos que entabló Ramón Carrillo con anterioridad a ejercer el cargo de primer secretario de Salud Pública en la Argentina (1946 no han sido objeto de estudio pormenorizado. Así pues en este artículo se analizarán en primer lugar, una serie de cartas de lectores publicadas en La Semana Médica en los primeros años de la década del '40 del siglo XX. Estas notas permiten comprender las disputas internas que se produjeron en la Facultad de Ciencias Médicas al producirse el concurso de Titular de Neurocirugía de la Universidad de Buenos Aires. En segundo lugar, se revisará cómo Carrillo pasa de ocupar este prestigioso cargo académico a convertirse en decano interi- no de la Facultad de Ciencias Médicas. Son las relaciones que anuda durante estos años las que lo posicionan en un escenario político privilegiado para alcanzar un relevante puesto en la administración pública.
A primer on physical-layer network coding
Liew, Soung Chang; Zhang, Shengli
2015-01-01
The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader
Directory of Open Access Journals (Sweden)
Alejandro Gonzalez-Martinez
2015-01-01
Full Text Available Identification of anaerobic ammonium oxidizing (anammox bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON and three full-scale bioreactors (anammox, CANON, and DEMON, was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature. The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C and hence a range of annealing temperatures of 44–49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.
Celebrating the Life and Legacy of Dr. John Hope Franklin
Harris, Robert L., Jr.; Levering-Lewis, David; French, John D.; Wharton, Clifton R., Jr.
2009-01-01
Dr. John Hope Franklin chronicled the experiences of African-Americans like no one before him, forcing America to recognize Black history as American history. His contributions were innumerable and his impact was abiding. In celebration of his life and legacy, the authors profile the celebrated scholar and activist, Dr. John Hope Franklin.
John Napier life, logarithms, and legacy
Havil, Julian
2014-01-01
John Napier (1550–1617) is celebrated today as the man who invented logarithms—an enormous intellectual achievement that would soon lead to the development of their mechanical equivalent in the slide rule: the two would serve humanity as the principal means of calculation until the mid-1970s. Yet, despite Napier’s pioneering efforts, his life and work have not attracted detailed modern scrutiny. John Napier is the first contemporary biography to take an in-depth look at the multiple facets of Napier’s story: his privileged position as the eighth Laird of Merchiston and the son of influential Scottish landowners; his reputation as a magician who dabbled in alchemy; his interest in agriculture; his involvement with a notorious outlaw; his staunch anti-Catholic beliefs; his interactions with such peers as Henry Briggs, Johannes Kepler, and Tycho Brahe; and, most notably, his estimable mathematical legacy. Julian Havil explores Napier’s original development of logarithms, the motivations for his approa...
Great Lakes rivermouths: a primer for managers
Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul
2013-01-01
Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described
Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev
2016-02-09
Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.
Jesus, moral regeneration and crime in the Gospel of John | Ras ...
African Journals Online (AJOL)
A structural and text-immanent approach to the Gospel of John reveals that ... regeneration, is, anthropologically-speaking, according to the rational-choice ... In terms of the explicatio-applicatio model, the intended kerygmatic message of John ...
International Nuclear Information System (INIS)
Stafford, G.H.
1986-01-01
This is the biography of a man obviously much liked and respected. It gives some personal details but is mainly concerned with his scientific work and achievements on major projects. Thus, some background information on those projects is also given as a context to the work of John Adams. The biography is written in sections; early years, the creation of CERN, Adams at CERN 1953-61, Adams and thermonuclear research 1958-69, (which includes his Directorship of the Culham Laboratory), Adams and the Ministry of Technology 1965-66, member for research of the UK Atomic Energy Authority 1966-69, Adams at CERN 1969-84 (as Director General of the SPS, as Executive Director-General of CERN 1979-81 and work at CERN up to 1984). (UK)
Human immunodeficiency virus uses tRNA(Lys,3) as primer for reverse transcription in HeLa-CD4+ cells
Das, A. T.; Koken, S. E.; Essink, B. B.; van Wamel, J. L.; Berkhout, B.
1994-01-01
Significant amounts of different tRNA molecules are present in retroviral particles, but one specific tRNA species functions as primer in reverse transcription. It is generally believed that the HIV-1 virus uses the tRNA(Lys,3) molecule as primer. This is based on sequence complementarity between
Geologic setting of the John Day Country, Grant County, Oregon
Thayer, Thomas P.
1977-01-01
One of the Pacific Northwest's most notable outdoor recreation areas, the "John Day Country" in northeastern Oregon, is named after a native Virginian who was a member of the Astor expedition to the mouth of the Columbia River in 1812. There is little factual information about John Day except that he was born in Culpeper County, Virginia, about 1770. It is known also that in 1810 this tall pioneer "with an elastic step as if he trod on springs" joined John Jacob Astor's overland expedition under Wilson Price Hunt to establish a vast fur-gathering network in the Western States based on a major trading post at the mouth of the Columbia River.
Routes to effective evacuation planning primer series : evacuating populations with special needs.
2009-04-01
Evacuation operations are conducted under the authority of, and based on decisions by, local and state authorities. The purpose of this primer, Evacuating Populations with Special Needs, is to provide local and state emergency managers, government of...
Hume, Benjamin C.C.; Ziegler, Maren; Poulain, Julie; Pochon, Xavier; Romac, Sarah; Boissin, Emilie; de Vargas, Colomban; Planes, Serge; Wincker, Patrick; Voolstra, Christian R.
2018-01-01
The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.
Hume, Benjamin C.C.
2018-05-23
The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.
Rockne, Karl J; Strand, Stuart E
2003-09-01
Type II alpha proteobacteria methanotrophs are capable of a wide range of cometabolic transformations of chlorinated solvents and polycyclic aromatic hydrocarbons (PAHs), and this activity has been exploited in many terrestrial bioremediation systems. However, at present, all known obligately marine methanotrophic isolates are Type I gamma proteobacteria which do not have this activity to the extent of Type II methanotrophs. In previous work in our laboratory, determining the presence of Type II alpha proteobacteria methanotrophs in marine enrichment cultures that co-metabolized PAHs required a more sensitive assay. 16S rDNA PCR primers were designed based on oligonucleotide probes for serine pathway methanotrophs and serine pathway methylotrophs with an approximate amplification fragment size of 870 base pairs. Comparison of the primers using double primer BLAST searches in established nucleotide databases showed potential amplification with all Methylocystis and Methylosinus spp., as well as potential amplification with Methylocella palustrus. DNA from Methylosinus trichosporium OB3b, a Type II methanotroph, amplified with the primers with a fragment size of approximately 850 base pairs, whereas DNA extracted from Methylomonas methanica, a Type I methanotroph, did not. The primers were used to amplify DNA extracted from two marine methanotrophic enrichment cultures: a low nitrogen/low copper enrichment to select for Type II methanotrophs and a high nitrogen/high copper enrichment to select for Type I methanotrophs. Although DNA from both cultures amplified with the PCR primers, amplification was stronger in cultures that were specifically enriched for Type II methanotrophs, suggesting the presence of higher numbers of Type II methanotrophs. These results provide further evidence for the existence of Type II marine methanotrophs, suggesting the possibility of exploiting cometabolic activity in marine systems.
KULTUR PRIMER FIBROBLAS: PENELITIAN PENDAHULUAN
Directory of Open Access Journals (Sweden)
Yuli Kurniawati
2015-05-01
Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well
In Memoriam: Dr. Frank John Fenner
Centers for Disease Control (CDC) Podcasts
This podcast reflects on one of the greatest pioneers in virology, Dr. Frank John Fenner. Dr. Frederick Murphy, a member of EID's editorial board and the Institute of Medicine, and professor of Pathology at the University of Texas Medical Branch in Galveston, shares professional and personal stories of Dr. Frank Fenner.
El último libro de John Strachey
Directory of Open Access Journals (Sweden)
Helcías Martán Góngora
1965-08-01
Full Text Available Fue muy largo el sendero ideológico que hubo de recorrer el inglés John Strachey en la busqueda íntima de una respuesta a su inquirir constante. En su viaje interior escuchó, a la siniestra, también la voz de las sirenas socialistas.
St. John Shallow-water Ground Validation Sites
National Oceanic and Atmospheric Administration, Department of Commerce — Benthic habitat maps of the nearshore marine environment of St. John, U.S. Virgin Islands were created by visual interpretation of remotely sensed imagery. The...
Primer Extension Mutagenesis Powered by Selective Rolling Circle Amplification
Huovinen, Tuomas; Brockmann, Eeva-Christine; Akter, Sultana; Perez-Gamarra, Susan; Ylä-Pelto, Jani; Liu, Yuan; Lamminmäki, Urpo
2012-01-01
Primer extension mutagenesis is a popular tool to create libraries for in vitro evolution experiments. Here we describe a further improvement of the method described by T.A. Kunkel using uracil-containing single-stranded DNA as the template for the primer extension by additional uracil-DNA glycosylase treatment and rolling circle amplification (RCA) steps. It is shown that removal of uracil bases from the template leads to selective amplification of the nascently synthesized circular DNA strand carrying the desired mutations by phi29 DNA polymerase. Selective RCA (sRCA) of the DNA heteroduplex formed in Kunkel's mutagenesis increases the mutagenesis efficiency from 50% close to 100% and the number of transformants 300-fold without notable diversity bias. We also observed that both the mutated and the wild-type DNA were present in at least one third of the cells transformed directly with Kunkel's heteroduplex. In contrast, the cells transformed with sRCA product contained only mutated DNA. In sRCA, the complex cell-based selection for the mutant strand is replaced with the more controllable enzyme-based selection and less DNA is needed for library creation. Construction of a gene library of ten billion members is demonstrated with the described method with 240 nanograms of DNA as starting material. PMID:22355397
Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory
Elkins, Kelly M.
2011-01-01
The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…
Memories of John N. Brady: scientist, mentor and friend
Directory of Open Access Journals (Sweden)
Marriott Susan J
2009-05-01
Full Text Available Abstract Friends and colleagues remember John N. Brady, Ph.D., Chief of the Virus Tumor Biology Section of the Laboratory of Cellular Oncology, who died much too young at the age of 57 on April 27, 2009 of colon cancer. John grew up in Illinois and received his Ph.D. with Dr. Richard Consigli at Kansas State University studying the molecular structure of polyomavirus. In 1984 John came to the National Institutes of Health as a Staff Fellow in the laboratory of Dr. Norman Salzman, Laboratory of Biology of Viruses NIAID, where he was among the first to analyze SV40 transcription using in vitro transcription systems and to analyze regulatory sequences for SV40 late transcription. He then trained with Dr. George Khoury in the Laboratory of Molecular Virology NCI, where he identified SV40 T-antigen as a transcriptional activator protein. His research interests grew to focus on the human retroviruses: human T-cell lymphotropic virus type I (HTLV-I and human immunodeficiency virus (HIV, analyzing how interactions between these viruses and the host cell influence viral gene regulation, viral pathogenesis and viral transformation. His research also impacted the fields of eukaryotic gene regulation and tumor suppressor proteins. John is survived by his wife, Laraine, and two sons, Matt and Kevin.
The influence of fiscal rules on healthcare policy in the United States and the Netherlands.
Schakel, H Christiaan; Jeurissen, Patrick; Glied, Sherry
2017-10-01
Governments use fiscal rules to put a framework and limits on how budgetary challenges are addressed, but the rules themselves are still an understudied area among health policy scholars. For a long time, healthcare held a somewhat separate status because of the reliance on entitlements and dedicated revenue streams. However, the combined forces of advocates for integral decision-making, central budget control and the increasing costs might shift healthcare towards budgetary frameworks that currently apply to other spending categories. In this paper, we study fiscal rules that the US and the Netherlands have adopted since 2010 and their impact on healthcare policy. Our analysis shows that fiscal rules can have an impact on the rationing of healthcare. In the studied timeframe, the rules seem to have more impact on budget outcomes than on the budget process itself. In addition, the convergence of fiscal and program policy objectives seems to be better accomplished in a budgetary system that applies enforceable budget ceilings. Budgeting for health entitlements requires a comprehensive and tailor-made approach and the composition of traditional rules might not fully answer to the complexities of healthcare policy. This paper aims to contribute to that debate and the way we think about healthcare budgeting. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
2008 St. Johns County, FL Countywide Lidar
National Oceanic and Atmospheric Administration, Department of Commerce — Airborne terrestrial LiDAR was collected for St. Johns County, FL. System Parameters/Flight Plan. The LiDAR system acquisition parameters were developed based on a...
John Malkovich ikka oskab / Kätlin Kaldmaa
Kaldmaa, Kätlin, 1970-
2006-01-01
Edinburghi filmifestivalil esilinastus "Colour Me Kubrick" (stsenarist Anthony Frewin, režissöör Brian Cook, peaosas John Malkovich) mehest, kes režissööri eluajal 1996.a. esines Stanley Kubrick'una
Chen, Qianqian; Chen, Xiaoxiang; Zhang, Sichao; Lan, Ke; Lu, Jian; Zhang, Chiyu
2015-01-01
The development of simple, accurate, rapid and cost-effective technologies for mutation detection is crucial to the early diagnosis and prevention of numerous genetic diseases, pharmacogenetics, and drug resistance. Proofreading PCR (PR-PCR) was developed for mutation detection in 1998 but is rarely applied due to its low efficiency in allele discrimination. Here we developed a modified PR-PCR method using a ddNTP-blocked primer and a mixture of DNA polymerases with and without the 3'-5' proofreading function. The ddNTP-blocked primer exhibited the best blocking efficiency to avoid nonspecific primer extension while the mixture of a tiny amount of high-fidelity DNA polymerase with a routine amount of Taq DNA polymerase provided the best discrimination and amplification effects. The modified PR-PCR method is quite capable of detecting various mutation types, including point mutations and insertions/deletions (indels), and allows discrimination amplification when the mismatch is located within the last eight nucleotides from the 3'-end of the ddNTP-blocked primer. The modified PR-PCR has a sensitivity of 1-5 × 102 copies and a selectivity of 5 × 10-5 mutant among 107 copies of wild-type DNA. It showed a 100% accuracy rate in the detection of P72R germ-line mutation in the TP53 gene among 60 clinical blood samples, and a high potential to detect rifampin-resistant mutations at low frequency in Mycobacterium tuberculosis using an adaptor and a fusion-blocked primer. These results suggest that the modified PR-PCR technique is effective in detection of various mutations or polymorphisms as a simple, sensitive and promising approach. PMID:25915410
Sport promotion policies in the European Union: results of a contents analysis.
Christiansen, N V; Kahlmeier, S; Racioppi, F
2014-04-01
Although sport promotion may play an important role in achieving the recommended levels of physical activity for health, until now, there has been no comprehensive assessment of how sport policies in Europe address health. This article aimed at filling this gap by reviewing and analyzing recent national policy developments in the area of sport promotion, with a focus on synergies and discrepancies with the promotion of health-enhancing physical activity. By applying various search methods, 130 documents focusing on sport and physical activity were identified in the World Health Organization (WHO) European Region. An analysis grid covering key indicators was developed for a systematic content analysis of 25 documents, selected according to established criteria. Analysis showed that general recommendations for good policy making were followed, such as establishing general goals, specifying time frame and responsible body for implementation and addressing different target groups. Furthermore, all sport strategies addressed health on an overall level and recognized the importance of Sport for All. However, in several strategies, there was a lack of measurable targets, specified budgets, and evaluation plans. The analysis showed that there is a great opportunity for health and sport sectors to work more closely together in the future, and identified areas where this could take place. © 2012 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Laura Navarro-Sampedro
2012-11-01
Full Text Available Twelve nuclear microsatellite primers (nSSR were developed for the endangered species Abies pinsapo Boiss. to enable the study of gene flow and genetic structure in the remaining distribution areas. Microsatellite primers were developed using next-generation sequencing (454 data from a single Abies pinsapo individual. Primers were applied to thirty individuals from the three extant localities. The number of alleles per locus ranged from one to four. Cross-amplification was tested for other Abies species from the Mediterranean Basin, and most of the loci showed higher polymorphisms in the Mediterranean species than in A. pinsapo. These microsatellite markers provide tools for conservation genetic studies in Abies pinsapo as well other Abies species from the Mediterranean Basin.
Directory of Open Access Journals (Sweden)
Zuiter Afnan
2012-08-01
Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.
We, John Dewey's Audience of Today
da Cunha, Marcus Vinicius
2016-01-01
This article suggests that John Dewey's "Democracy and Education" does not describe education in an existing society, but it conveys a utopia, in the sense coined by Mannheim: utopian thought aims at instigating actions towards the transformation of reality, intending to attain a better world in the future. Today's readers of Dewey (his…
John Dewey on Philosophy and Childhood
Gregory, Maughn; Granger, David
2012-01-01
John Dewey was not a philosopher of education in the now-traditional sense of a doctor of philosophy who examines educational ends, means, and controversies through the disciplinary lenses of epistemology, ethics, and political theory, or of agenda-driven schools such as existentialism, feminism, and critical theory. Rather, Dewey was both an…
Atmintis ir sielvartas John Banville romane „Jūra“
Vaičiulaitytė, Giedrė
2016-01-01
Memory and Grief in John Banville’s Novel “The Sea” John Banville‘s novel The Sea (2005) details the journey of a retired art historian Max while he navigates through his memories and places from his childhood after the untimely death of his wife. Therefore, the focus of this BA paper is revealing the grief within the narrative and unveiling the relationship between memory, place and identity. The meticulous style of narration, attention to smallest details and the narrator‘s emotional detach...
The History of Heart Surgery at The Johns Hopkins Hospital.
Patel, Nishant D; Alejo, Diane E; Cameron, Duke E
2015-01-01
Johns Hopkins has made many lasting contributions to cardiac surgery, including the discovery of heparin and the Blalock-Taussig Shunt, which represents the dawn of modern cardiac surgery. Equally important, Johns Hopkins has trained some of the world's leaders in academic cardiac surgery, and is committed to training the future leaders in our specialty. Copyright © 2015. Published by Elsevier Inc.
Transient Heat Transfer Model for Car Body Primer Curing
D. Zabala; N. Sánchez; J. Pinto
2010-01-01
A transient heat transfer mathematical model for the prediction of temperature distribution in the car body during primer baking has been developed by considering the thermal radiation and convection in the furnace chamber and transient heat conduction governing equations in the car framework. The car cockpit is considered like a structure with six flat plates, four vertical plates representing the car doors and the rear and front panels. The other two flat plates are the...
John Glenn Biomedical Engineering Consortium
Nall, Marsha
2004-01-01
The John Glenn Biomedical Engineering Consortium is an inter-institutional research and technology development, beginning with ten projects in FY02 that are aimed at applying GRC expertise in fluid physics and sensor development with local biomedical expertise to mitigate the risks of space flight on the health, safety, and performance of astronauts. It is anticipated that several new technologies will be developed that are applicable to both medical needs in space and on earth.
Hemorragias obstétricas en el primer y segundo trimestre del embarazo
García Rodríguez, Blanca
2013-01-01
Se aborda el tema de las hemorragias obstétricas en el primer y segundo trimestre del embarazo. Diagnóstico precoz de las mismas, la identificación de factores de riesgo, las causas y el tratamiento terapéutico
Rawlsian Interpretation of Government Activity: The Promotion of Organ Targeted Public Policies
Directory of Open Access Journals (Sweden)
Dalton Franco
2016-12-01
Full Text Available The present study aims to analyze social rights and public policies for the race / ethnicity category. It seeks to interpret the expansion of executive bodies for racial equality through John Rawls. With an institutionalist approach, the reason for the establishment of racial equality bodies in four cities is analyzed. The main explanation for this phenomenon is a set of concordances explained by international conferences and by local initiative associated with progressive political parties. The succession of agreements and of accidents that generated the institutionalization of policies in the cities is treated as a Rawlsian experiment, like overlapping of consensuses.
Abbink, Truus E. M.; Beerens, Nancy; Berkhout, Ben
2004-01-01
Human immunodeficiency virus type 1 uses the tRNA(3)(Lys) molecule as a selective primer for reverse transcription. This primer specificity is imposed by sequence complementarity between the tRNA primer and two motifs in the viral RNA genome: the primer-binding site (PBS) and the primer activation
Takubo, Chikako; Yasuda, Genta; Murayama, Ryosuke; Ogura, Yukari; Tonegawa, Motoka; Kurokawa, Hiroyasu; Miyazaki, Masashi
2010-08-01
We used ultrasonic measurements to monitor the influence of power density and primer application on the polymerization reaction of dual-cured resin cements. The ultrasonic equipment comprised a pulser-receiver, transducers, and an oscilloscope. Resin cements were mixed and inserted into a transparent mould, and specimens were placed on the sample stage, onto which the primer, if used, was also applied. Power densities of 0 (no irradiation), 200, or 600 mW cm(-2) were used for curing. The transit time through the cement disk was divided by the specimen thickness to obtain the longitudinal sound velocity. When resin cements were light-irradiated, each curve displayed an initial plateau of approximately 1,500 m s(-1), which rapidly increased to a second plateau of 2,300-2,900 m s(-1). The rate of sound velocity increase was retarded when the cements were light-irradiated at lower power densities, and increased when the primer was applied. The polymerization behaviour of dual-cured resin cements was therefore shown to be affected by the power density of the curing unit and the application of self-etching primer. (c) 2010 The Authors. Journal compilation (c) 2010 Eur J Oral Sci.
Directory of Open Access Journals (Sweden)
Firuzbakht MM
2011-04-01
Full Text Available "nBackground and Aims: The aim of this study was to evaluate the effect of application of two types of primers over bracket bases on the shear bond strength (SBS and mode of bond failure."nMaterials and Methods: In this study, 75 human premolar teeth were divided into three equal groups. In group 1 (control, after surface preparation of enamel by conventional method (acid etching+primer brackets were bonded with Transbond XT composite. In group 2 (TX, brackets were bonded to enamel same as the first group but Transbond XT primer were used on bracket bases before placement of composite. In group 3 (PL, Transbond plus primer was applied on bracket bases before placement of composite. After 24 h, the SBS test was performed by universal testing machine at crosshead speed of 0.5 mm/min. Then, adhesive remnant index (ARI scores and percentage of cohesive fracture were determined using stereomicroscopy. SBS data were analyzed by one-way ANOVA and Duncan tests. Kruskal-Wallis and Mann-Whitney tests were used to analyze ARI and cohesive fracture results."nResults: There was significant difference in SBS values among the groups (P<0.001. The highest SBS was shown in TX group and the lowest was seen in PL group. There was no significant difference between control and TX groups in ARI scores (P=0.199. No significant difference was found in cohesive fracture values between the groups (P=0.093. Both the control and TX groups showed significant difference in ARI scores and cohesive fracture compared with the PL group in all of the comparisons (P<0.001."nConclusion: Application of Transbond XT primer over bracket base affects the bond strength and failure mode. Transbond XT primer increased the bond strength but Transbond plus primer decreased it.
A finite element primer for beginners the basics
Zohdi, Tarek I
2014-01-01
The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th
Transport phenomena in Newtonian fluids a concise primer
Olsson, Per
2013-01-01
This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum. The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid. Also provided at
John Paul College: The Professional Renewal Journey
Directory of Open Access Journals (Sweden)
Pauline Mundie
2014-09-01
Full Text Available John Paul College, a K-12 School in Queensland, Australia, recognises the centrality of classroom teachers to the ongoing improvement of student outcomes. The college has implemented a multi-tiered professional renewal and assessment process. These changes of emphasis are the result of significant research and subsequent/associated professional discussion and were supported during the EBA decision-making in 2012. The professional renewal process at John Paul College guides teachers through a cycle of goal setting (related to any aspect of teacher practice which aims to improve student learning and achievement; ongoing discussion between the teacher and a mentor which determines actions; directed classroom observations (3 per term and associated pre and post reflection/discussion; leading to application of changed practice toward achieving the criteria of the goals. The principles of the professional renewal program are to: enhance development along accepted school-wide, team and department goals; encourage professional pedagogical reflections and conversations with a colleague/mentor; motivate improved performance and highlight the next steps in a teacher’s development. Through the introduction of professional renewal, attestation and exemplary teacher processes, the leadership and teachers of John Paul College have achieved an appropriate and innovative balance between self-directed, peer supported/directed and college-wide, strategic initiatives. Each member of the teaching team, from graduate to senior leaders are actively engaged in personalised programs of professional growth which is specifically aimed at improved learning and outcomes of the college’s students.
An evaluation of corrosion protection by two epoxy primers on 2219-T87 and 7075-T73 aluminum
Mendrek, M. J.
1992-01-01
A comparison of the corrosion protection provided by two amine epoxy primers was made using salt fog, alternate immersion, and total immersion as exposure media. The study is the result of a request to use an unqualified low volatile organic carbon (VOC) primer (AKZO 463-6-78) in place of the current primer (AKZO 463-6-3) because environmental regulations have eliminated use of the current primer in many states. Primed, scribed samples of 2219-T87 and 7075-T73 aluminum were exposed to 5-percent NaCl salt fog and 3.5-percent NaCl alternate immersion for a period of 90 days. In addition, electrode samples immersed in 3.5-percent NaCl were tested using electrochemical impedance spectroscopy (EIS). The EG&G model 368 ac impedance measurement system was used to monitor changing properties of AKZO 463-6-78 and AKZO 463-6-3 primed 2219-T87 aluminum for a period of 30 days. The response of the corroding system of a frequency scan can be modeled in terms of an equivalent circuit consisting of resistors and capacitors in a specific arrangement. Each resistor/capacitor combination represents physical processes taking place within the electrolyte, at the electrolyte/primer surface, within the coating, and at the coating/substrate surface. Values for the resistors and capacitors are assigned following a nonlinear least squares fit of the data to the equivalent circuit. Changes in the values of equivalent circuit parameters during the 30-day exposure allow assessment of the time to and mechanism of coating breakdown.
Detection of Vibrio harveyi using hemolysin primer in tiger shrimp Penaeus monodon
Directory of Open Access Journals (Sweden)
Irma Suriyani
2015-05-01
Full Text Available ABSTRACT This study was aimed to analyze the sensitivity and ability of primer hemolysin in detecting pathogenetic Vibrio on tiger shrimp post-larvae (PL exposed under different exposure times in media inoculated with Vibrio harveyi. The PL of tiger shrimp were infected with 106 cfu/mL of V. harveyi by immersion method for three, six, 12, 24, 48 and 72 hours. The presence of hemolisin genes was detected by PCR techniques. The electrophoresis detected narrow hemolysin genes after PL were exposed for three and six hours. Clear visible bands of DNA Vibrio were observed for 12 hours of exposure. In contrast, no detected hemolysin gene of Vibrio was observed for PL exposed within 24, 48, and 72 hours. The rapid detection on Vibrio pathogenic for tiger shrimp PL should be conducted within three to 12 hours of exposure. No recommendation in utilizing this rapid detection for tiger shrimp PL exposed beyond 12 hours of V. harveyi. Keywords: specific primer, luminous Vibrio bacteria, pathogenic, PCR method, hemolysin gene ABSTRAK Penelitian ini bertujuan untuk mengetahui kemampuan atau sensitivitas primer hemolisin dalam mendeteksi Vibrio patogen dengan lama pemaparan berbeda. Penelitian ini dilakukan dengan menginfeksikan Vibrio harveyi pada benur udang dengan metode perendaman pada konsentrasi 106 cfu/mL. Pengambilan sampel dilakukan pada waktu tiga, enam, 12, 24, 48, dan 72 jam pascainfeksi. Keberadaan gen hemolisin pada bakteri V. harveyi dideteksi menggunakan teknik polymerase chain reaction (PCR. Hasil elektroforesis memperlihatkan bahwa pada pemaparan tiga dan enam jam keberadaan gen hemolisin dari bakteri Vibrio patogen yang diinfeksikan sudah dapat terdeteksi pada benur walaupun masih terlihat tipis. Pada pemaparan 12 jam terlihat sangat jelas pita-pita DNA dari bakteri patogen. Sedangkan pada pemaparan 24, 48, dan 72 jam sudah tidak terdeteksi lagi gen hemolisin dari bakteri Vibrio. Hal ini diduga disebabkan terjadinya penurunan populasi
DEFF Research Database (Denmark)
Svensson, Palle
Over recent years there has been a tendency to present John Locke as an equalitarian democrat (Ashcraft) and being close to the political views of the levellers (Waldron). This is not a completely new interpretation (Kendall, 1941), but contrasts with the prevalent view presented in textbooks (......, criteria for a democratic process, and the institutions of polyarchy. The conclusion has implications for the relationship between political liberalism and constitutionalism on the one hand and democracy on the other....
International Nuclear Information System (INIS)
Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.
2017-01-01
Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.
Directory of Open Access Journals (Sweden)
Esther Lantero
2017-07-01
Full Text Available Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L. trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control
Energy Technology Data Exchange (ETDEWEB)
Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.
2017-07-01
Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.
Jean Piaget's Debt to John Dewey
Tanner, Daniel
2016-01-01
Jean Piaget became a veritable institution unto himself in education and psychology, largely as the result of his developmental-stage theory advanced over the second quarter of the twentieth century. Not until Piaget was 73 did he make mention of John Dewey's work at Dewey's laboratory school, founded in 1894 at the University of Chicago. But here…
Meadows, Donella H
2008-01-01
In the years following her role as the lead author of the international bestseller, "Limits to Growth"-the first book to show the consequences of unchecked growth on a finite planet- Donella Meadows remained a pioneer of environmental and social analysis until her untimely death in 2001. Meadows' newly released manuscript, "Thinking in Systems", is a concise and crucial book offering insight for problem solving on scales ranging from the personal to the global. Edited by the Sustainability Institute's Diana Wright, this essential primer brings systems thinking out of the realm of computers and equations and into the tangible world, showing readers how to develop the systems-thinking skills that thought leaders across the globe consider critical for 21st-century life. Some of the biggest problems facing the world-war, hunger, poverty, and environmental degradation-are essentially system failures. They cannot be solved by fixing one piece in isolation from the others, because even seemingly minor details have e...
Peran Keluarga dalam Pengelolaan Kasus di Layanan Primer Melalui Five Family Oriented Questions
Directory of Open Access Journals (Sweden)
Retno Asti Werdhani
2017-04-01
Full Text Available Pengelolaan kasus di layanan primer dengan pendekatan kedokteran keluarga memperhatikan potensi keluarga sebagai sumber daya pendukung dan atau penghambat keberhasilan penatalaksanaan pasien. Penelitian ini bertujuan untuk melihat gambaran kasus di layanan primer dan persepsi keluarga mengenai pasien melalui five family oriented question (FFOQ. Pengambilan data dilakukan menggunakan kuesioner pada 162 pasien Puskesmas dan Klinik di DKI Jakarta pada tahun 2015–2016. Kuesioner terdiri atas karakteristik pasien dan 5 pertanyaan terbuka FFOQ. Analisis dilakukan secara kuantitatif dan kualitatif. Hasilnya menunjukkan sebagian besar kasus di layanan primer adalah penyakit non-infeksi (82,7% dengan proporsi usia terbanyak adalah >40 tahun (76,5%. Persepsi pasien dan keluarga tentang penyebab penyakit dan cara mengatasinya masih bervariasi. Orang tua, pasangan, dan anak merupakan anggota keluarga yang paling menguatirkan kondisi pasien. Sebanyak 71,6% responden merasa ada stresor dalam keluarganya. Sumber stresor bervariasi antara lain sosial ekonomi, keluarga, pekerjaan, dan diri sendiri. Dukungan kepada pasien berupa dukungan emosional dan finansial yang diberikan oleh anggota keluarga sesuai kemampuan masing-masing. Disimpulkan keluarga berperan sebagai faktor pendukung dan penghambat dalam pengelolaan kasus di layanan primer untuk menunjang pengelolaan lebih berorientasi kepada pasien dan keluarga. Kata Kunci: five family oriented question, keluarga, layanan primer Family Acts in Cases Management In Primary Care through The Five Family Oriented Question Abstract Family oriented in primary care sees family as supporting resources/inhibiting case management accomplishment. The aim of this study was describing cases in primary care and family perception of the patient through the five family oriented question (FFOQ. Interviews were conducted in 162 patients from public health centers and clinics in DKI Jakarta year 2015–2016. Data were
Bathymetry (2011) for Fish Bay, St. John
National Oceanic and Atmospheric Administration, Department of Commerce — This image represents a LiDAR (Light Detection & Ranging) 0.3x0.3 meter resolution depth surface for Fish Bay, St. John in the U.S. Virgin Islands (USVI). The...
Bathymetry (2011) for Coral Bay, St. John
National Oceanic and Atmospheric Administration, Department of Commerce — This image represents a LiDAR (Light Detection & Ranging) 0.3x0.3 meter resolution depth surface for Coral Bay, St. John in the U.S. Virgin Islands (USVI). The...
The religious tourism in Greece: Case study of Saint John Russian in N. Evia
Directory of Open Access Journals (Sweden)
Aggeliki Chantziantoniou
2017-12-01
Full Text Available The prevailing political and economic conditions both in Greece and around the world determine the general development of all forms of tourism. The development of specific forms of tourism, such as that of religious tourism, gains tremendous interest in the present economic circumstances, as it is a factor in strengthening the national economy and at the same time a legacy for the future with enormous social, cultural and environmental significance. The development of a strategic approach to religious tourism can build on the comparative advantage of our country in this field by creating new tourist sites to attract tourists with intellectual pursuits and special interests. The Prefecture of Evia has a rich range of natural and cultural resources, with particular characteristics of beauty, uniqueness, and authenticity, elements that are required for the design and development of specific forms of tourism. In the case study on religious tourism in Saint John Russian in the Prefecture of Evia, an attempt is being made to explore the contribution of religious tourism tolocaldevelopmentandthepreconditionsforthepromotionofthepilgrimageof SaintJohn Russian to a major destination of religious and cultural interest of international scope. Additionally, an effort is made to highlight the importance of religious tourism as a special form of tourism that contributes to the development of areas hosting religious monuments. Identifying the opportunities and opportunities that exist, exploring its growth prospects and identifying emerging markets, dictates the formulation of policy proposals where combined with the existing specific forms of tourism it will show it as an essential factor in the systematic organization, exploitation and promotion of the Area.
Directory of Open Access Journals (Sweden)
Shrinivas Ashtekar
2016-01-01
Full Text Available Objective: To compare and evaluate the shear bond strength (SBS of lingual brackets, manufactured by three different processes, that is, laser sintering, milling, and casting, bonded with two different adhesive primers. Materials and Methods: One hundred and twenty premolars were selected, and three types of lingual brackets were used, namely, STB (milling, 7th Generation (casting, and lingualmatrix (laser sintering. Forty brackets per system were used half of which were sandblasted while the other half were used as available. Further, these were subdivided and bonded with Transbond XT primer and adhesive and 3M ESPE Primer and Transbond XT adhesive. Customization of STB and 7th Generation was done by Torque Angulation Reference Guide, Lingualmatrix had bases customized by Computer-aided design/computer-aided manufacturing. SBS was tested with universal testing machine and evaluated for adhesive remnant index (ARI. Results: Statistical analysis showed that surface treatment, use of different primers, method of customization influenced the SBS, and ARI suggested that the fracture occurred between composite and bracket interface. Conclusion: Lingualmatrix bracket showed greater SBS as compared to STB and 7th Generation, sandblasting increased SBS. 3M ESPE primer group showed increased SBS as that bonded with Transbond XT primer. The fracture was between the composite bracket interface.
Towards a global antibiotic resistance surveillance system : a primer for a roadmap
Grundmann, Hajo
The need for global data about the scale of antibiotic resistance (ABR) in a geographical explicit and timely manner has been identified by many stakeholders, including the World Health Organization. This primer should help defining the objectives, scale, scope, and structure of possible future
Primer Vector Optimization: Survey of Theory, new Analysis and Applications
Guzman
This paper presents a preliminary study in developing a set of optimization tools for orbit rendezvous, transfer and station keeping. This work is part of a large scale effort undergoing at NASA Goddard Space Flight Center and a.i. solutions, Inc. to build generic methods, which will enable missions with tight fuel budgets. Since no single optimization technique can solve efficiently all existing problems, a library of tools where the user could pick the method most suited for the particular mission is envisioned. The first trajectory optimization technique explored is Lawden's primer vector theory [Ref. 1]. Primer vector theory can be considered as a byproduct of applying Calculus of Variations (COV) techniques to the problem of minimizing the fuel usage of impulsive trajectories. For an n-impulse trajectory, it involves the solution of n-1 two-point boundary value problems. In this paper, we look at some of the different formulations of the primer vector (dependent on the frame employed and on the force model). Also, the applicability of primer vector theory is examined in effort to understand when and why the theory can fail. Specifically, since COV is based on "small variations", singularities in the linearized (variational) equations of motion along the arcs must be taken into account. These singularities are a recurring problem in analyzes that employ "small variations" [Refs. 2, 3]. For example, singularities in the (2-body problem) variational equations along elliptic arcs occur when [Ref. 4], 1) the difference between the initial and final times is a multiple of the reference orbit period, 2) the difference between the initial and final true anomalies are given by k, for k= 0, 1, 2, 3,..., note that this cover the 3) the time of flight is a minimum for the given difference in true anomaly. For the N-body problem, the situation is more complex and is still under investigation. Several examples, such as the initialization of an orbit (ascent trajectory) and
A Conversation with John Nelder
Senn, Stephen
2003-01-01
John Ashworth Nelder was born in 1924 in Dulverton, Somerset, England. He received his secondary education in nearby Tiverton at Blundell's, a "public" [that is to say, privately funded] school that he attended as a day pupil. In 1942, he entered Sidney Sussex College, Cambridge University, to read mathematics. His studies were interrupted after one year by war service and he trained as an RAF navigator in South Africa. He returned to Cambridge in 1946 and complete his studies, graduating a "...
Astronaut John Glenn Enters Friendship 7
1962-01-01
Astronaut John Glenn enters the Mercury spacecraft, Friendship 7, prior to the launch of MA-6 on February 20, 1961 and became the first American who orbited the Earth. The MA-6 mission was the first manned orbital flight boosted by the Mercury-Atlas vehicle, a modified Atlas ICBM (Intercontinental Ballistic Missile), lasted for five hours, and orbited the Earth three times.
John Dewey's Visits to Hawai'i
McEwan, Hunter
2015-01-01
John Dewey visited Hawai'i on three separate occasions. Of all three trips, by far the most important, as far as Dewey's influence on education in Hawai'i is concerned, was in 1899 when he came with his wife, Alice Chipman Dewey, to help launch the University Extension program in Honolulu. The Deweys' second trip was a very brief one--twenty years…
Triazole-linked DNA as a primer surrogate in the synthesis of first-strand cDNA.
Fujino, Tomoko; Yasumoto, Ken-ichi; Yamazaki, Naomi; Hasome, Ai; Sogawa, Kazuhiro; Isobe, Hiroyuki
2011-11-04
A phosphate-eliminated nonnatural oligonucleotide serves as a primer surrogate in reverse transcription reaction of mRNA. Despite of the nonnatural triazole linkages in the surrogate, the reverse transcriptase effectively elongated cDNA sequences on the 3'-downstream of the primer by transcription of the complementary sequence of mRNA. A structure-activity comparison with the reference natural oligonucleotides shows the superior priming activity of the surrogate containing triazole-linkages. The nonnatural linkages also protect the transcribed cDNA from digestion reactions with 5'-exonuclease and enable us to remove noise transcripts of unknown origins. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Aguiar, Violeta Rodrigues; Pattussi, Marcos Pascoal; Celeste, Roger Keller
2017-12-07
It is known that fluoridation has a contextual effect on oral health socioeconomic inequalities, but broad public policies have not been investigated. Thus, the aim of this study was to determine the effects of municipal public policies on oral health across different social strata. This was a cross-sectional study with 7328 12-year-old children and 5445 15-19-year-old adolescents from 177 Brazilian municipalities. Information at municipal level was collated for dental services, educational services, sanitation and water fluoridation. The main individual-level exposure was the disposable equivalent household income. The dichotomous outcomes were as follows: untreated dental caries (≥1 tooth), missing teeth (≥1 tooth) and filled teeth (≥1 tooth). Analyses were carried out using multilevel logistic regression. Interaction terms were tested between individual-level income and policy variables. The prevalence of untreated dental caries, missing and filled teeth was 47.0%, 15.1% and 47.5%, respectively. There was no significant interaction between income and policy indicators. Individuals living in municipalities with no water fluoridation had 1.42 (95% CI: 1.08-1.86) higher odds of having untreated dental caries; the odds ratio (OR) for those in municipalities with less education policies was 1.36 (95% CI: 1.07-1.73); those in municipalities with less sanitation had OR = 1.05 (95% CI: 0.78-1.40); and those in municipalities with less dental care had OR = 1.36 (95% CI: 1.02-1.80). Fluoridation and policies about sanitation, education and dental care were similarly associated with oral health in different social strata. Other policies on social and economic fields may be further explored. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
A primer on polymer nomenclature: Structure-based, sourced-based and trade names
Polymer nomenclature is important because it is part of the language of polymer science and is needed for polymer identification, reference, and documentation. A primer on polymer nomenclature is provided herein for people new to the field or for instructional use. Both structure-based and source-...
Primer registro de Serratospiculum tendo (Nematoda: Diplotriaenidae para el Perú
Directory of Open Access Journals (Sweden)
Luis A. Gomez-Puerta
2014-05-01
Full Text Available Reportamos por primera vez la presencia del nematodo, Serratospiculum tendo Nitzsch, 1819, parasitando los sacos aéreos de un halcón peregrino (Falco peregrinus Tunstall, 1771. Seis nematodos (2 machos y 4 hembras fueron colectados e identificados como S. tendo. El hallazgo de este nematodo constituye el primer registro en el Perú.
PRIMER REGISTRO DEL FLEBOTOMÍNEO BRUMPTOMYIA PINTOI (DIPTERA: PSYCHODIDAE) EN COLOMBIA
BEJARANO EDUAR ELÍAS; DUQUE PATRICIA; VÉLEZ IVÁN DARÍO
2004-01-01
Durante un estudio entomológico de la leishmaniosis realizado en La Macarena,Departamento del Meta, Colombia, se colectó un espécimen macho de Brumptomyiapintoi, el cual constituye el primer registro de la especie para el país. Este flebotomíneofue capturado con un aspirador bucal mientras reposaba en el interior de una cuevade armadillo.
A new set of validated SSR primers for application in mulberry ...
Indian Academy of Sciences (India)
user
2018-01-11
Jan 11, 2018 ... We chose 37 genomic sequences that had high number of di, tri and tetra SSR motifs from ... primers failed to produce any amplification products and ... Sericulture is a cottage industry that employs 8.03 million people across ... The resolving power of the SSR markers ranged from 0.11 (MulSatG100717) to.
Läänemere kallastel / John Allyne Gade ; tõlk. Jonatan Heinap
Gade, John Allyne
2008-01-01
USA erivoliniku John Allyne Gade mälestused 1919. aasta külaskäigust Eestisse. Siin tegutses ta USA valitsuse vahemehena uue Eesti valitsuse, Eesti sõjaväe ning Vene valgete loodearmee vahel. Eestile osutatud teenete eest on ta autasustatud Eesti Vabadusristiga. - Lisa: Eric A. Johnson. John Allyne Gade. Lk. 300-301
Wang, Chaojen; Lin, Yisheng; Lin, Yinghong; Chung, Wenhsin
2013-01-01
Previous investigations demonstrated that Fusarium oxysporum (Fo), which is not pathogenic to cucumbers, could serve as a biological control agent for managing Fusarium wilt of cucumber caused by Fo f. sp. cucumerinum (Foc) in Taiwan. However, thus far it has not been possible to separate the populations of pathogenic Fo from the nonpathogenic isolates that have biological control potential through their morphological characteristics. Although these two populations can be distinguished from one another using a bioassay, the work is laborious and time-consuming. In this study, a fragment of the intergenic spacer (IGS) region of ribosomal DNA from an Fo biological control agent, Fo366, was PCR-amplified with published general primers, FIGS11/FIGS12 and sequenced. A new primer, NPIGS-R, which was designed based on the IGS sequence, was paired with the FIGS11 primer. These primers were then evaluated for their specificity to amplify DNA from nonpathogenic Fo isolates that have biological control potential. The results showed that the modified primer pair, FIGS11/NPIGS-R, amplified a 500-bp DNA fragment from five of seven nonpathogenic Fo isolates. These five Fo isolates delayed symptom development of cucumber Fusarium wilt in greenhouse bioassay tests. Seventy-seven Fo isolates were obtained from the soil and plant tissues and then subjected to amplification using the modified primer pair; six samples showed positive amplification. These six isolates did not cause symptoms on cucumber seedlings when grown in peat moss infested with the isolates and delayed disease development when the same plants were subsequently inoculated with a virulent isolate of Foc. Therefore, the modified primer pair may prove useful for the identification of Fo isolates that are nonpathogenic to cucumber which can potentially act as biocontrol agents for Fusarium wilt of cucumber. PMID:23762289
International Nuclear Information System (INIS)
Kumar, A.V.R.; Nigam, R.K.
1998-01-01
The phase analysis of the rusts generated beneath the primer containing micaceous iron oxide (MIO) and micaceous iron oxide in combination with red lead (RL), zinc phosphate (ZP), basic lead silicochromate (BLSC) and zinc chromate (ZC) has been carried out by Moessbauer spectroscopy at room temperature. The rust beneath the coating obtained after immersion of the painted panel for six months in 3% NaCl, consists mainly of non-stoichiometric magnetite together with small fractions of γ-, α-FeOOH except in the case of panel painted with RL containing MIO showed only a central doublet indicating the formation of γ-FeOOH and SPM α-FeOOH. Non-stoichiometry of magnetite as calculated from the ratio of B/A sites of the peaks of magnetite in the spectrum has been found depending on the nature of anticorrosive pigment present in the primer coating. The order of non-stoichiometry has been found to be in order of ZC > BLSC > ZP > MIO. (author)
Directory of Open Access Journals (Sweden)
Jean Berton
2009-07-01
Full Text Available This article aims to show how far Hogg’s archetypal character, Gil-Martin, influenced Charlotte Brontë’s enigmatic character, St. John, who appears in chapters XXVI to XXXV and is mentioned again in the conclusion of Jane Eyre. Some unexpected words, like “glen”, in a greater Yorkshire area, operate as keywords to a “deep context” study in a neo-contextualist approach. Even though St. John cannot be mistaken for a double of Gil-Martin, a fair number of details tend to prove that James Hogg’s Private Memoirs and Confessions of a Justified Sinner deeply influenced Charlotte Brontë—both pride-driven St. John and Gil-Martin stand for demonic despotism. Yet, if Gil-Martin is a straightforward Gothic illustration of Satan, St. John is a reincarnation of a marble-cold Apollo in a dogma-trapped Calvinist. Brontë’s intention was not so much to denounce noxious excesses in religious beliefs as to set her heroine’s wise independence against nefarious male domination: whereas victimised Robert Wringhim is driven to despair and suicide, self-reliant Jane Eyre escapes from St. John’s grip. In both narratives relationships between men and women are shown as tragically warped by religious behavioural extravagance, but only the female character is granted a positive outcome to serve an optimistic view on life: Robert Wringhim is violently wrung out of the society of men and women, St. John Rivers, from “Marsh End”, blindly drifts away to his death in India, and airy Jane, of “Moor House”, wafts away to anchor to Edward Rochester, the sender of the airwave-born call.
Directory of Open Access Journals (Sweden)
Andrés Alvarado
Full Text Available Transmissible plasmids are responsible for the spread of genetic determinants, such as antibiotic resistance or virulence traits, causing a large ecological and epidemiological impact. Transmissible plasmids, either conjugative or mobilizable, have in common the presence of a relaxase gene. Relaxases were previously classified in six protein families according to their phylogeny. Degenerate primers hybridizing to coding sequences of conserved amino acid motifs were designed to amplify related relaxase genes from γ-Proteobacterial plasmids. Specificity and sensitivity of a selected set of 19 primer pairs were first tested using a collection of 33 reference relaxases, representing the diversity of γ-Proteobacterial plasmids. The validated set was then applied to the analysis of two plasmid collections obtained from clinical isolates. The relaxase screening method, which we call "Degenerate Primer MOB Typing" or DPMT, detected not only most known Inc/Rep groups, but also a plethora of plasmids not previously assigned to any Inc group or Rep-type.
Preparing for Citizenship: Bring Back John Dewey
Pring, Richard
2016-01-01
The paper traces the development of citizenship in the curriculum in England since the 1960s, emerging particularly from the Crick report. It argues for lessons to be learnt from John Dewey's "Democracy and education", the centenary of which is being celebrated this year.
INDUSTRIAL RELATIONS IN THE PERSPECTIVE OF JUSTICE THEORY BY JOHN RAWLS
Directory of Open Access Journals (Sweden)
Ari Hernawan
2014-11-01
Full Text Available Conflict of interest between employee and employer has a complexity since its biopsychology and sosioeconomic in nature. As its implication, it is difficult to create a consensus between two different interest within a legal perspective. Justice theory by John Rawls has answered the respective problem by giving legal priority upon the group of people who have less capacity in sosial and economic. According to John Rawls, law shall give orientation toward marginalized group. In industrial relations, law shall take side upon the employee who are in subordinate position. Pertentangan kepentingan antara pekerja dan pengusaha memiliki kompleksitas karena bersifat biopsikologis dan sosio-ekonomi. Sebagai implikasinya, sulit mempertemukan dua kepentingan yang berbeda tersebut dalam satu rumusan hukum. Teori keadilan dari John Rawls telah menjawab persoalan tersebut dengan memberi prioritas hukum kepada orang-orang yang secara sosial ekonomi kurang beruntung. Hukum menurut John Rawls harus berorientasi kepada kelompok marjinal. Dalam hubungan industrial, hukum harus berpihak kepada pekerja yang berada dalam posisi subordinat.
INDUSTRIAL RELATIONS IN THE PERSPECTIVE OF JUSTICE THEORY BY JOHN RAWLS
Directory of Open Access Journals (Sweden)
Ari Hernawan
2014-11-01
Full Text Available Conflict of interest between employee and employer has a complexity since its biopsychology and sosioeconomic in nature. As its implication, it is difficult to create a consensus between two different interest within a legal perspective. Justice theory by John Rawls has answered the respective problem by giving legal priority upon the group of people who have less capacity in sosial and economic. According to John Rawls, law shall give orientation toward marginalized group. In industrial relations, law shall take side upon the employee who are in subordinate position. Pertentangan kepentingan antara pekerja dan pengusaha memiliki kompleksitas karena bersifat biopsikologis dan sosio-ekonomi. Sebagai implikasinya, sulit mempertemukan dua kepentingan yang berbeda tersebut dalam satu rumusan hukum. Teori keadilan dari John Rawls telah menjawab persoalan tersebut dengan memberi prioritas hukum kepada orang-orang yang secara sosial ekonomi kurang beruntung. Hukum menurut John Rawls harus berorientasi kepada kelompok marjinal. Dalam hubungan industrial, hukum harus berpihak kepada pekerja yang berada dalam posisi subordinat.
John Stuart Mill: utilitarismo e liberalismo = John Stuart Mill: utilitarianism and liberalism
Directory of Open Access Journals (Sweden)
Simões, Mauro Cardoso
2013-01-01
Full Text Available Meu objetivo, neste trabalho, é investigar a compatibilidade das teses utilitaristas e liberais de John Stuart Mill. Apresentarei, inicialmente, os principais críticos da filosofia moral e política de Mill, para os quais o discípulo de Bentham teria abandonado o utilitarismo ou, ainda, não esclarecido suficientemente seu princípio da liberdade, o que o tornaria um pensador assistemático e inconsistente. Minha tese é contrária a tais interpretações, uma vez que sustenta ser Mill consistente. Em seguida, defenderei uma interpretação do princípio da liberdade e da individualidade, procurando demonstrar que seu utilitarismo é compatível com seu liberalismo
Directory of Open Access Journals (Sweden)
Louis Ho
2017-05-01
Full Text Available Cultural policy is predominantly, and practically, considered the sum of a government’s activities with respect to the arts, humanities and heritage. Thus, cultural policy encompasses a much broader range of activities than was traditionally associated with an arts policy. Critical cultural policy studies, then, sees a distinction between ‘explicit’ cultural policies that are manifestly labelled as ‘cultural’, and ‘implicit’ cultural policies that are not labelled as such, but that work to shape cultural experiences. This article considers this explicit/implicit cultural policy distinction through John Urry’s idea of ‘social as mobility’, suggesting that some public policies regarding mobility (such as immigration, international trade and labour policy have led to specific cultural consequences and therefore qualify as implicit cultural policy. Using Hong Kong’s working holiday scheme as a case study, this article explores how an economic policy on temporary immigrant labour involves a deliberate cultural agenda as well as ‘unintentional’ cultural consequences and problematises the fact that cultural policy studies are largely framed by the idea of ‘social as society’.