WorldWideScience

Sample records for plasmodium gene family

  1. Genome-scale comparison of expanded gene families in Plasmodium ovale wallikeri and Plasmodium ovale curtisi with Plasmodium malariae and with other Plasmodium species.

    Science.gov (United States)

    Ansari, Hifzur Rahman; Templeton, Thomas J; Subudhi, Amit Kumar; Ramaprasad, Abhinay; Tang, Jianxia; Lu, Feng; Naeem, Raeece; Hashish, Yasmeen; Oguike, Mary C; Benavente, Ernest Diez; Clark, Taane G; Sutherland, Colin J; Barnwell, John W; Culleton, Richard; Cao, Jun; Pain, Arnab

    2016-10-01

    Malaria in humans is caused by six species of Plasmodium parasites, of which the nuclear genome sequences for the two Plasmodium ovale spp., P. ovale curtisi and P. ovale wallikeri, and Plasmodium malariae have not yet been analyzed. Here we present an analysis of the nuclear genome sequences of these three parasites, and describe gene family expansions therein. Plasmodium ovale curtisi and P. ovale wallikeri are genetically distinct but morphologically indistinguishable and have sympatric ranges through the tropics of Africa, Asia and Oceania. Both P. ovale spp. show expansion of the surfin variant gene family, and an amplification of the Plasmodium interspersed repeat (pir) superfamily which results in an approximately 30% increase in genome size. For comparison, we have also analyzed the draft nuclear genome of P. malariae, a malaria parasite causing mild malaria symptoms with a quartan life cycle, long-term chronic infections, and wide geographic distribution. Plasmodium malariae shows only a moderate level of expansion of pir genes, and unique expansions of a highly diverged transmembrane protein family with over 550 members and the gamete P25/27 gene family. The observed diversity in the P. ovale wallikeri and P. ovale curtisi surface antigens, combined with their phylogenetic separation, supports consideration that the two parasites be given species status. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  2. Genome-scale comparison of expanded gene families in Plasmodium ovale wallikeri and Plasmodium ovale curtisi with Plasmodium malariae and with other Plasmodium species

    KAUST Repository

    Ansari, Hifzur Rahman; Templeton, Thomas J.; Subudhi, Amit; Ramaprasad, Abhinay; Tang, Jianxia; Lu, Feng; Naeem, Raeece; Hashish, Yasmeen; Oguike, Mary C.; Benavente, Ernest Diez; Clark, Taane G.; Sutherland, Colin J.; Barnwell, John W.; Culleton, Richard; Cao, Jun; Pain, Arnab

    2016-01-01

    Malaria in humans is caused by six species of Plasmodium parasites, of which the nuclear genome sequences for the two Plasmodium ovale spp., P. ovale curtisi and P. ovale wallikeri, and Plasmodium malariae have not yet been analyzed. Here we present an analysis of the nuclear genome sequences of these three parasites, and describe gene family expansions therein. Plasmodium ovale curtisi and P. ovale wallikeri are genetically distinct but morphologically indistinguishable and have sympatric ranges through the tropics of Africa, Asia and Oceania. Both P. ovale spp. show expansion of the surfin variant gene family, and an amplification of the Plasmodium interspersed repeat (pir) superfamily which results in an approximately 30% increase in genome size. For comparison, we have also analyzed the draft nuclear genome of P. malariae, a malaria parasite causing mild malaria symptoms with a quartan life cycle, long-term chronic infections, and wide geographic distribution. Plasmodium malariae shows only a moderate level of expansion of pir genes, and unique expansions of a highly diverged transmembrane protein family with over 550 members and the gamete P25/27 gene family. The observed diversity in the P. ovale wallikeri and P. ovale curtisi surface antigens, combined with their phylogenetic separation, supports consideration that the two parasites be given species status.

  3. Genome-scale comparison of expanded gene families in Plasmodium ovale wallikeri and Plasmodium ovale curtisi with Plasmodium malariae and with other Plasmodium species

    KAUST Repository

    Ansari, Hifzur Rahman

    2016-07-05

    Malaria in humans is caused by six species of Plasmodium parasites, of which the nuclear genome sequences for the two Plasmodium ovale spp., P. ovale curtisi and P. ovale wallikeri, and Plasmodium malariae have not yet been analyzed. Here we present an analysis of the nuclear genome sequences of these three parasites, and describe gene family expansions therein. Plasmodium ovale curtisi and P. ovale wallikeri are genetically distinct but morphologically indistinguishable and have sympatric ranges through the tropics of Africa, Asia and Oceania. Both P. ovale spp. show expansion of the surfin variant gene family, and an amplification of the Plasmodium interspersed repeat (pir) superfamily which results in an approximately 30% increase in genome size. For comparison, we have also analyzed the draft nuclear genome of P. malariae, a malaria parasite causing mild malaria symptoms with a quartan life cycle, long-term chronic infections, and wide geographic distribution. Plasmodium malariae shows only a moderate level of expansion of pir genes, and unique expansions of a highly diverged transmembrane protein family with over 550 members and the gamete P25/27 gene family. The observed diversity in the P. ovale wallikeri and P. ovale curtisi surface antigens, combined with their phylogenetic separation, supports consideration that the two parasites be given species status.

  4. Translational repression of the cpw-wpc gene family in the malaria parasite Plasmodium

    KAUST Repository

    Rao, Pavitra N.

    2016-06-14

    The technical challenges of working with the sexual stages of the malaria parasite Plasmodium have hindered the characterization of sexual stage antigens in the quest for a successful malaria transmission-blocking vaccine. One such predicted and largely uncharacterized group of sexual stage candidate antigens is the CPW-WPC family of proteins. CPW-WPC proteins are named for a characteristic domain that contains two conserved motifs, CPxxW and WPC. Conserved across Apicomplexa, this family is also present earlier in the Alveolata in the free-living, non-parasitophorous, photosynthetic chromerids, Chromera and Vitrella. In P. falciparum and P. berghei blood stage parasites the transcripts of all nine cpw-wpc genes have been detected in gametocytes. RNA immunoprecipitation followed by reverse transcriptase-PCR reveals all P. berghei cpw-wpc transcripts to be bound by the translational repressors DOZI and CITH, and thus are likely under translational control prior to transmission from the rodent host to the mosquito vector in P. berghei. The GFP tagging of two endogenous P. berghei genes confirmed translational silencing in the gametocyte and translation in ookinetes. Establishing a luciferase transgene assay we show that the 3′ untranslated region of PF3D7_1331400 controls protein expression of this reporter in P. falciparum gametocytes. Our analyses suggest that cpw-wpc genes are translationally silenced in gametocytes across Plasmodium spp. and activated during ookinete formation and thus may have a role in transmission to the mosquito.

  5. Translational repression of the cpw-wpc gene family in the malaria parasite Plasmodium

    KAUST Repository

    Rao, Pavitra N.; Santos, Jorge M.; Pain, Arnab; Templeton, Thomas J.; Mair, Gunnar R.

    2016-01-01

    The technical challenges of working with the sexual stages of the malaria parasite Plasmodium have hindered the characterization of sexual stage antigens in the quest for a successful malaria transmission-blocking vaccine. One such predicted and largely uncharacterized group of sexual stage candidate antigens is the CPW-WPC family of proteins. CPW-WPC proteins are named for a characteristic domain that contains two conserved motifs, CPxxW and WPC. Conserved across Apicomplexa, this family is also present earlier in the Alveolata in the free-living, non-parasitophorous, photosynthetic chromerids, Chromera and Vitrella. In P. falciparum and P. berghei blood stage parasites the transcripts of all nine cpw-wpc genes have been detected in gametocytes. RNA immunoprecipitation followed by reverse transcriptase-PCR reveals all P. berghei cpw-wpc transcripts to be bound by the translational repressors DOZI and CITH, and thus are likely under translational control prior to transmission from the rodent host to the mosquito vector in P. berghei. The GFP tagging of two endogenous P. berghei genes confirmed translational silencing in the gametocyte and translation in ookinetes. Establishing a luciferase transgene assay we show that the 3′ untranslated region of PF3D7_1331400 controls protein expression of this reporter in P. falciparum gametocytes. Our analyses suggest that cpw-wpc genes are translationally silenced in gametocytes across Plasmodium spp. and activated during ookinete formation and thus may have a role in transmission to the mosquito.

  6. The MB2 gene family of Plasmodium species has a unique combination of S1 and GTP-binding domains

    Directory of Open Access Journals (Sweden)

    Ogunjumo Oluwasanmi

    2004-06-01

    Full Text Available Abstract Background Identification and characterization of novel Plasmodium gene families is necessary for developing new anti-malarial therapeutics. The products of the Plasmodium falciparum gene, MB2, were shown previously to have a stage-specific pattern of subcellular localization and proteolytic processing. Results Genes homologous to MB2 were identified in five additional parasite species, P. knowlesi, P. gallinaceum, P. berghei, P. yoelii, and P. chabaudi. Sequence comparisons among the MB2 gene products reveal amino acid conservation of structural features, including putative S1 and GTP-binding domains, and putative signal peptides and nuclear localization signals. Conclusions The combination of domains is unique to this gene family and indicates that MB2 genes comprise a novel family and therefore may be a good target for drug development.

  7. The MB2 gene family of Plasmodium species has a unique combination of S1 and GTP-binding domains

    Science.gov (United States)

    Romero, Lisa C; Nguyen, Thanh V; Deville, Benoit; Ogunjumo, Oluwasanmi; James, Anthony A

    2004-01-01

    Background Identification and characterization of novel Plasmodium gene families is necessary for developing new anti-malarial therapeutics. The products of the Plasmodium falciparum gene, MB2, were shown previously to have a stage-specific pattern of subcellular localization and proteolytic processing. Results Genes homologous to MB2 were identified in five additional parasite species, P. knowlesi, P. gallinaceum, P. berghei, P. yoelii, and P. chabaudi. Sequence comparisons among the MB2 gene products reveal amino acid conservation of structural features, including putative S1 and GTP-binding domains, and putative signal peptides and nuclear localization signals. Conclusions The combination of domains is unique to this gene family and indicates that MB2 genes comprise a novel family and therefore may be a good target for drug development. PMID:15222903

  8. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS

    Directory of Open Access Journals (Sweden)

    Lawton Jennifer

    2012-03-01

    Full Text Available Abstract Background The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required. Results The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages. Conclusions In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family

  9. Genome-Wide Identification of the Target Genes of AP2-O, a Plasmodium AP2-Family Transcription Factor.

    Directory of Open Access Journals (Sweden)

    Izumi Kaneko

    2015-05-01

    Full Text Available Stage-specific transcription is a fundamental biological process in the life cycle of the Plasmodium parasite. Proteins containing the AP2 DNA-binding domain are responsible for stage-specific transcriptional regulation and belong to the only known family of transcription factors in Plasmodium parasites. Comprehensive identification of their target genes will advance our understanding of the molecular basis of stage-specific transcriptional regulation and stage-specific parasite development. AP2-O is an AP2 family transcription factor that is expressed in the mosquito midgut-invading stage, called the ookinete, and is essential for normal morphogenesis of this stage. In this study, we identified the genome-wide target genes of AP2-O by chromatin immunoprecipitation-sequencing and elucidate how this AP2 family transcription factor contributes to the formation of this motile stage. The analysis revealed that AP2-O binds specifically to the upstream genomic regions of more than 500 genes, suggesting that approximately 10% of the parasite genome is directly regulated by AP2-O. These genes are involved in distinct biological processes such as morphogenesis, locomotion, midgut penetration, protection against mosquito immunity and preparation for subsequent oocyst development. This direct and global regulation by AP2-O provides a model for gene regulation in Plasmodium parasites and may explain how these parasites manage to control their complex life cycle using a small number of sequence-specific AP2 transcription factors.

  10. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS)

    KAUST Repository

    Lawton, Jennifer

    2012-03-29

    Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein

  11. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS)

    KAUST Repository

    Lawton, Jennifer; Brugat, Thibaut; Yan, Yam Xue; Reid, Adam James; Bö hme, Ulrike; Otto, Thomas Dan; Pain, Arnab; Jackson, Andrew; Berriman, Matthew; Cunningham, Deirdre; Preiser, Peter; Langhorne, Jean

    2012-01-01

    Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein

  12. Absence of erythrocyte sequestration and lack of multicopy gene family expression in Plasmodium falciparum from a splenectomized malaria patient.

    Directory of Open Access Journals (Sweden)

    Anna Bachmann

    Full Text Available BACKGROUND: To avoid spleen-dependent killing mechanisms parasite-infected erythrocytes (IE of Plasmodium falciparum malaria patients have the capacity to bind to endothelial receptors. This binding also known as sequestration, is mediated by parasite proteins, which are targeted to the erythrocyte surface. Candidate proteins are those encoded by P. falciparum multicopy gene families, such as var, rif, stevor or PfMC-2TM. However, a direct in vivo proof of IE sequestration and expression of multicopy gene families is still lacking. Here, we report on the analysis of IE from a black African immigrant, who received the diagnosis of a malignant lymphoproliferative disorder and subsequently underwent splenectomy. Three weeks after surgery, the patient experienced clinical falciparum malaria with high parasitemia and circulating developmental parasite stages usually sequestered to the vascular endothelium such as late trophozoites, schizonts or immature gametocytes. METHODOLOGY/PRINCIPAL FINDINGS: Initially, when isolated from the patient, the infected erythrocytes were incapable to bind to various endothelial receptors in vitro. Moreover, the parasites failed to express the multicopy gene families var, A-type rif and stevor but expression of B-type rif and PfMC-2TM genes were detected. In the course of in vitro cultivation, the parasites started to express all investigated multicopy gene families and concomitantly developed the ability to adhere to endothelial receptors such as CD36 and ICAM-1, respectively. CONCLUSION/SIGNIFICANCE: This case strongly supports the hypothesis that parasite surface proteins such as PfEMP1, A-type RIFIN or STEVOR are involved in interactions of infected erythrocytes with endothelial receptors mediating sequestration of mature asexual and immature sexual stages of P. falciparum. In contrast, multicopy gene families coding for B-type RIFIN and PfMC-2TM proteins may not be involved in sequestration, as these genes were

  13. DNA secondary structures are associated with recombination in major Plasmodium falciparum variable surface antigen gene families

    DEFF Research Database (Denmark)

    Sander, Adam F.; Lavstsen, Thomas; Rask, Thomas Salhøj

    2014-01-01

    falciparum-erythrocyte membrane protein 1 class on the infected erythrocyte surface. Recombination clearly generates var diversity, but the nature and control of the genetic exchanges involved remain unclear. By experimental and bioinformatic identification of recombination events and genome...... of recombination during DNA replication in P. falciparum sexual stages, and that these DSS-regulated genetic exchanges generate functional and diverse P. falciparum adhesion antigens. DSS-induced recombination may represent a common mechanism for optimizing the evolvability of virulence gene families in pathogens....

  14. Combinatorial gene regulation in Plasmodium falciparum.

    NARCIS (Netherlands)

    Noort, V. van; Huynen, M.A.

    2006-01-01

    The malaria parasite Plasmodium falciparum has a complicated life cycle with large variations in its gene expression pattern, but it contains relatively few specific transcriptional regulators. To elucidate this paradox, we identified regulatory sequences, using an approach that integrates the

  15. Gene copy number variation throughout the Plasmodium falciparum genome

    Directory of Open Access Journals (Sweden)

    Stewart Lindsay B

    2009-08-01

    Full Text Available Abstract Background Gene copy number variation (CNV is responsible for several important phenotypes of the malaria parasite Plasmodium falciparum, including drug resistance, loss of infected erythrocyte cytoadherence and alteration of receptor usage for erythrocyte invasion. Despite the known effects of CNV, little is known about its extent throughout the genome. Results We performed a whole-genome survey of CNV genes in P. falciparum using comparative genome hybridisation of a diverse set of 16 laboratory culture-adapted isolates to a custom designed high density Affymetrix GeneChip array. Overall, 186 genes showed hybridisation signals consistent with deletion or amplification in one or more isolate. There is a strong association of CNV with gene length, genomic location, and low orthology to genes in other Plasmodium species. Sub-telomeric regions of all chromosomes are strongly associated with CNV genes independent from members of previously described multigene families. However, ~40% of CNV genes were located in more central regions of the chromosomes. Among the previously undescribed CNV genes, several that are of potential phenotypic relevance are identified. Conclusion CNV represents a major form of genetic variation within the P. falciparum genome; the distribution of gene features indicates the involvement of highly non-random mutational and selective processes. Additional studies should be directed at examining CNV in natural parasite populations to extend conclusions to clinical settings.

  16. Preferential transcription of conserved rif genes in two phenotypically distinct Plasmodium falciparum parasite lines

    DEFF Research Database (Denmark)

    Wang, Christian W; Magistrado, Pamela A; Nielsen, Morten A

    2009-01-01

    transcribed in the VAR2CSA-expressing parasite line. In addition, two rif genes were found transcribed at early and late intra-erythrocyte stages independently of var gene transcription. Rif genes are organised in groups and inter-genomic conserved gene families, suggesting that RIFIN sub-groups may have......Plasmodium falciparum variant surface antigens (VSA) are targets of protective immunity to malaria. Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) and repetitive interspersed family (RIFIN) proteins are encoded by the two variable multigene families, var and rif genes, respectively...... novel rif gene groups, rifA1 and rifA2, containing inter-genomic conserved rif genes, were identified. All rifA1 genes were orientated head-to-head with a neighbouring Group A var gene whereas rifA2 was present in all parasite genomes as a single copy gene with a unique 5' untranslated region. Rif...

  17. Chromosome Gene Orientation Inversion Networks (GOINs) of Plasmodium Proteome.

    Science.gov (United States)

    Quevedo-Tumailli, Viviana F; Ortega-Tenezaca, Bernabé; González-Díaz, Humbert

    2018-03-02

    The spatial distribution of genes in chromosomes seems not to be random. For instance, only 10% of genes are transcribed from bidirectional promoters in humans, and many more are organized into larger clusters. This raises intriguing questions previously asked by different authors. We would like to add a few more questions in this context, related to gene orientation inversions. Does gene orientation (inversion) follow a random pattern? Is it relevant to biological activity somehow? We define a new kind of network coined as the gene orientation inversion network (GOIN). GOIN's complex network encodes short- and long-range patterns of inversion of the orientation of pairs of gene in the chromosome. We selected Plasmodium falciparum as a case of study due to the high relevance of this parasite to public health (causal agent of malaria). We constructed here for the first time all of the GOINs for the genome of this parasite. These networks have an average of 383 nodes (genes in one chromosome) and 1314 links (pairs of gene with inverse orientation). We calculated node centralities and other parameters of these networks. These numerical parameters were used to study different properties of gene inversion patterns, for example, distribution, local communities, similarity to Erdös-Rényi random networks, randomness, and so on. We find clues that seem to indicate that gene orientation inversion does not follow a random pattern. We noted that some gene communities in the GOINs tend to group genes encoding for RIFIN-related proteins in the proteome of the parasite. RIFIN-like proteins are a second family of clonally variant proteins expressed on the surface of red cells infected with Plasmodium falciparum. Consequently, we used these centralities as input of machine learning (ML) models to predict the RIFIN-like activity of 5365 proteins in the proteome of Plasmodium sp. The best linear ML model found discriminates RIFIN-like from other proteins with sensitivity and

  18. Genetic variations in genes involved in heparan sulphate biosynthesis are associated with Plasmodium falciparum parasitaemia: a familial study in Burkina Faso

    Directory of Open Access Journals (Sweden)

    Atkinson Alexandre

    2012-04-01

    Full Text Available Abstract Background There is accumulating evidence that host heparan sulphate proteoglycans play an important role in the life cycle of Plasmodium through their heparan sulphate chains, suggesting that genetic variations in genes involved in heparan sulphate biosynthesis may influence parasitaemia. Interestingly, Hs3st3a1 and Hs3st3b1 encoding enzymes involved in the biosynthesis of heparan sulphate are located within a chromosomal region linked to Plasmodium chabaudi parasitaemia in mice. This suggests that HS3ST3A1 and HS3ST3B1 may influence P. falciparum parasitaemia in humans. Methods Polymorphisms within HS3ST3A1 and HS3ST3B1 were identified in 270 individuals belonging to 44 pedigrees and living in Burkina Faso. Linkage and association between parasitaemia and the polymorphisms were assessed with MERLIN and FBAT. A genetic interaction analysis was also conducted based on the PGMDR approach. Results Linkage between P. falciparum parasitaemia and the chromosomal region containing HS3ST3A1 and HS3ST3B1 was detected on the basis of the 20 SNPs identified. In addition, rs28470223 located within the promoter of HS3ST3A1 was associated with P. falciparum parasitaemia, whereas the PGMDR analysis revealed a genetic interaction between HS3ST3A1 and HS3ST3B1. Seventy-three significant multi-locus models were identified after correcting for multiple tests; 37 significant multi-locus models included rs28470223, whereas 38 multi-locus models contained at least one mis-sense mutation within HS3ST3B1. Conclusion Genetic variants of HS3ST3A1 and HS3ST3B1 are associated with P. falciparum parasitaemia. This suggests that those variants alter both the function of heparan sulphate proteoglycans and P. falciparum parasitaemia.

  19. Molecular identification of the chitinase genes in Plasmodium relictum.

    Science.gov (United States)

    Garcia-Longoria, Luz; Hellgren, Olof; Bensch, Staffan

    2014-06-18

    Malaria parasites need to synthesize chitinase in order to go through the peritrophic membrane, which is created around the mosquito midgut, to complete its life cycle. In mammalian malaria species, the chitinase gene comprises either a large or a short copy. In the avian malaria parasites Plasmodium gallinaceum both copies are present, suggesting that a gene duplication in the ancestor to these extant species preceded the loss of either the long or the short copy in Plasmodium parasites of mammals. Plasmodium gallinaceum is not the most widespread and harmful parasite of birds. This study is the first to search for and identify the chitinase gene in one of the most prevalent avian malaria parasites, Plasmodium relictum. Both copies of P. gallinaceum chitinase were used as reference sequences for primer design. Different sequences of Plasmodium spp. were used to build the phylogenetic tree of chitinase gene. The gene encoding for chitinase was identified in isolates of two mitochondrial lineages of P. relictum (SGS1 and GRW4). The chitinase found in these two lineages consists both of the long (PrCHT1) and the short (PrCHT2) copy. The genetic differences found in the long copy of the chitinase gene between SGS1 and GRW4 were higher than the difference observed for the cytochrome b gene. The identification of both copies in P. relictum sheds light on the phylogenetic relationship of the chitinase gene in the genus Plasmodium. Due to its high variability, the chitinase gene could be used to study the genetic population structure in isolates from different host species and geographic regions.

  20. The Plasmodium PHIST and RESA-Like Protein Families of Human and Rodent Malaria Parasites

    Science.gov (United States)

    Moreira, Cristina K.; Naissant, Bernina; Coppi, Alida; Bennett, Brandy L.; Aime, Elena; Franke-Fayard, Blandine; Janse, Chris J.; Coppens, Isabelle; Sinnis, Photini; Templeton, Thomas J.

    2016-01-01

    The phist gene family has members identified across the Plasmodium genus, defined by the presence of a domain of roughly 150 amino acids having conserved aromatic residues and an all alpha-helical structure. The family is highly amplified in P. falciparum, with 65 predicted genes in the genome of the 3D7 isolate. In contrast, in the rodent malaria parasite P. berghei 3 genes are identified, one of which is an apparent pseudogene. Transcripts of the P. berghei phist genes are predominant in schizonts, whereas in P. falciparum transcript profiles span different asexual blood stages and gametocytes. We pursued targeted disruption of P. berghei phist genes in order to characterize a simplistic model for the expanded phist gene repertoire in P. falciparum. Unsuccessful attempts to disrupt P. berghei PBANKA_114540 suggest that this phist gene is essential, while knockout of phist PBANKA_122900 shows an apparent normal progression and non-essential function throughout the life cycle. Epitope-tagging of P. falciparum and P. berghei phist genes confirmed protein export to the erythrocyte cytoplasm and localization with a punctate pattern. Three P. berghei PEXEL/HT-positive exported proteins exhibit at least partial co-localization, in support of a common vesicular compartment in the cytoplasm of erythrocytes infected with rodent malaria parasites. PMID:27022937

  1. Rapid changes in transcription profiles of the Plasmodium yoelii yir multigene family in clonal populations: lack of epigenetic memory?

    Directory of Open Access Journals (Sweden)

    Deirdre Cunningham

    Full Text Available The pir multigene family, found in the genomes of Plasmodium vivax, P. knowlesi and the rodent malaria species, encode variant antigens that could be targets of the immune response. Individual parasites of the rodent malaria Plasmodium yoelii, selected by micromanipulation, transcribe only 1 to 3 different pir (yir suggesting tight transcriptional control at the level of individual cells. Using microarray and quantitative RT-PCR, we show that despite this very restricted transcription in a single cell, many yir genes are transcribed throughout the intra-erythrocytic asexual cycle. The timing and level of transcription differs between genes, with some being more highly transcribed in ring and trophozoite stages, whereas others are more highly transcribed in schizonts. Infection of immunodeficient mice with single infected erythrocytes results in populations of parasites each with transcriptional profiles different from that of the parent parasite population and from each other. This drift away from the original 'set' of transcribed genes does not appear to follow a preset pattern and "epigenetic memory" of the yir transcribed in the parent parasite can be rapidly lost. Thus, regulation of pir gene transcription may be different from that of the well-characterised multigene family, var, of Plasmodium falciparum.

  2. Gene disruption reveals a dispensable role for plasmepsin VII in the Plasmodium berghei life cycle.

    Science.gov (United States)

    Mastan, Babu S; Kumari, Anchala; Gupta, Dinesh; Mishra, Satish; Kumar, Kota Arun

    2014-06-01

    Plasmepsins (PM), aspartic proteases of Plasmodium, comprises a family of ten proteins that perform critical functions in Plasmodium life cycle. Except VII and VIII, functions of the remaining plasmepsin members have been well characterized. Here, we have generated a mutant parasite lacking PM VII in Plasmodium berghei using reverse genetics approach. Systematic comparison of growth kinetics and infection in both mosquito and vertebrate host revealed that PM VII depleted mutants exhibited no defects in development and progressed normally throughout the parasite life cycle. These studies suggest a dispensable role for PM VII in Plasmodium berghei life cycle. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Population structuring of multi-copy, antigen-encoding genes in Plasmodium falciparum

    Science.gov (United States)

    Artzy-Randrup, Yael; Rorick, Mary M; Day, Karen; Chen, Donald; Dobson, Andrew P; Pascual, Mercedes

    2012-01-01

    The coexistence of multiple independently circulating strains in pathogen populations that undergo sexual recombination is a central question of epidemiology with profound implications for control. An agent-based model is developed that extends earlier ‘strain theory’ by addressing the var gene family of Plasmodium falciparum. The model explicitly considers the extensive diversity of multi-copy genes that undergo antigenic variation via sequential, mutually exclusive expression. It tracks the dynamics of all unique var repertoires in a population of hosts, and shows that even under high levels of sexual recombination, strain competition mediated through cross-immunity structures the parasite population into a subset of coexisting dominant repertoires of var genes whose degree of antigenic overlap depends on transmission intensity. Empirical comparison of patterns of genetic variation at antigenic and neutral sites supports this role for immune selection in structuring parasite diversity. DOI: http://dx.doi.org/10.7554/eLife.00093.001 PMID:23251784

  4. Antisense long noncoding RNAs regulate var gene activation in the malaria parasite Plasmodium falciparum.

    Science.gov (United States)

    Amit-Avraham, Inbar; Pozner, Guy; Eshar, Shiri; Fastman, Yair; Kolevzon, Netanel; Yavin, Eylon; Dzikowski, Ron

    2015-03-03

    The virulence of Plasmodium falciparum, the causative agent of the deadliest form of human malaria, is attributed to its ability to evade human immunity through antigenic variation. These parasites alternate between expression of variable antigens, encoded by members of a multicopy gene family named var. Immune evasion through antigenic variation depends on tight regulation of var gene expression, ensuring that only a single var gene is expressed at a time while the rest of the family is maintained transcriptionally silent. Understanding how a single gene is chosen for activation is critical for understanding mutually exclusive expression but remains a mystery. Here, we show that antisense long noncoding RNAs (lncRNAs) initiating from var introns are associated with the single active var gene at the time in the cell cycle when the single var upstream promoter is active. We demonstrate that these antisense transcripts are incorporated into chromatin, and that expression of these antisense lncRNAs in trans triggers activation of a silent var gene in a sequence- and dose-dependent manner. On the other hand, interference with these lncRNAs using complement peptide nucleic acid molecules down-regulated the active var gene, erased the epigenetic memory, and induced expression switching. Altogether, our data provide evidence that these antisense lncRNAs play a key role in regulating var gene activation and mutually exclusive expression.

  5. Activation and clustering of a Plasmodium falciparum var gene are affected by subtelomeric sequences.

    Science.gov (United States)

    Duffy, Michael F; Tang, Jingyi; Sumardy, Fransisca; Nguyen, Hanh H T; Selvarajah, Shamista A; Josling, Gabrielle A; Day, Karen P; Petter, Michaela; Brown, Graham V

    2017-01-01

    The Plasmodium falciparum var multigene family encodes the cytoadhesive, variant antigen PfEMP1. P. falciparum antigenic variation and cytoadhesion specificity are controlled by epigenetic switching between the single, or few, simultaneously expressed var genes. Most var genes are maintained in perinuclear clusters of heterochromatic telomeres. The active var gene(s) occupy a single, perinuclear var expression site. It is unresolved whether the var expression site forms in situ at a telomeric cluster or whether it is an extant compartment to which single chromosomes travel, thus controlling var switching. Here we show that transcription of a var gene did not require decreased colocalisation with clusters of telomeres, supporting var expression site formation in situ. However following recombination within adjacent subtelomeric sequences, the same var gene was persistently activated and did colocalise less with telomeric clusters. Thus, participation in stable, heterochromatic, telomere clusters and var switching are independent but are both affected by subtelomeric sequences. The var expression site colocalised with the euchromatic mark H3K27ac to a greater extent than it did with heterochromatic H3K9me3. H3K27ac was enriched within the active var gene promoter even when the var gene was transiently repressed in mature parasites and thus H3K27ac may contribute to var gene epigenetic memory. © 2016 Federation of European Biochemical Societies.

  6. Three members of the 6-cys protein family of Plasmodium play a role in gamete fertility.

    NARCIS (Netherlands)

    Dijk, M.R. van; Schaijk, B.C.L. van; Khan, S.M.; Dooren, M.W. van; Ramesar, J.; Kaczanowski, S.; Gemert, G.J.A. van; Kroeze, H.; Stunnenberg, H.G.; Eling, W.M.C.; Sauerwein, R.W.; Waters, A.P.; Janse, C.J.

    2010-01-01

    The process of fertilization is critically dependent on the mutual recognition of gametes and in Plasmodium, the male gamete surface protein P48/45 is vital to this process. This protein belongs to a family of 10 structurally related proteins, the so called 6-cys family. To identify the role of

  7. Generation of antigenic diversity in Plasmodium falciparum by structured rearrangement of Var genes during mitosis.

    Directory of Open Access Journals (Sweden)

    Antoine Claessens

    2014-12-01

    Full Text Available The most polymorphic gene family in P. falciparum is the ∼60 var genes distributed across parasite chromosomes, both in the subtelomeres and in internal regions. They encode hypervariable surface proteins known as P. falciparum erythrocyte membrane protein 1 (PfEMP1 that are critical for pathogenesis and immune evasion in Plasmodium falciparum. How var gene sequence diversity is generated is not currently completely understood. To address this, we constructed large clone trees and performed whole genome sequence analysis to study the generation of novel var gene sequences in asexually replicating parasites. While single nucleotide polymorphisms (SNPs were scattered across the genome, structural variants (deletions, duplications, translocations were focused in and around var genes, with considerable variation in frequency between strains. Analysis of more than 100 recombination events involving var exon 1 revealed that the average nucleotide sequence identity of two recombining exons was only 63% (range: 52.7-72.4% yet the crossovers were error-free and occurred in such a way that the resulting sequence was in frame and domain architecture was preserved. Var exon 1, which encodes the immunologically exposed part of the protein, recombined in up to 0.2% of infected erythrocytes in vitro per life cycle. The high rate of var exon 1 recombination indicates that millions of new antigenic structures could potentially be generated each day in a single infected individual. We propose a model whereby var gene sequence polymorphism is mainly generated during the asexual part of the life cycle.

  8. Generation of antigenic diversity in Plasmodium falciparum by structured rearrangement of Var genes during mitosis.

    Science.gov (United States)

    Claessens, Antoine; Hamilton, William L; Kekre, Mihir; Otto, Thomas D; Faizullabhoy, Adnan; Rayner, Julian C; Kwiatkowski, Dominic

    2014-12-01

    The most polymorphic gene family in P. falciparum is the ∼60 var genes distributed across parasite chromosomes, both in the subtelomeres and in internal regions. They encode hypervariable surface proteins known as P. falciparum erythrocyte membrane protein 1 (PfEMP1) that are critical for pathogenesis and immune evasion in Plasmodium falciparum. How var gene sequence diversity is generated is not currently completely understood. To address this, we constructed large clone trees and performed whole genome sequence analysis to study the generation of novel var gene sequences in asexually replicating parasites. While single nucleotide polymorphisms (SNPs) were scattered across the genome, structural variants (deletions, duplications, translocations) were focused in and around var genes, with considerable variation in frequency between strains. Analysis of more than 100 recombination events involving var exon 1 revealed that the average nucleotide sequence identity of two recombining exons was only 63% (range: 52.7-72.4%) yet the crossovers were error-free and occurred in such a way that the resulting sequence was in frame and domain architecture was preserved. Var exon 1, which encodes the immunologically exposed part of the protein, recombined in up to 0.2% of infected erythrocytes in vitro per life cycle. The high rate of var exon 1 recombination indicates that millions of new antigenic structures could potentially be generated each day in a single infected individual. We propose a model whereby var gene sequence polymorphism is mainly generated during the asexual part of the life cycle.

  9. Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes

    Directory of Open Access Journals (Sweden)

    Rowe J

    2009-08-01

    Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.

  10. Cloning of the Repertoire of Individual Plasmodium falciparum var Genes Using Transformation Associated Recombination (TAR)

    Science.gov (United States)

    Schmid, Christoph D.; Bühlmann, Tobias; Louis, Edward J.; Beck, Hans-Peter

    2011-01-01

    One of the major virulence factors of the malaria causing parasite is the Plasmodium falciparum encoded erythrocyte membrane protein 1 (PfEMP1). It is translocated to It the membrane of infected erythrocytes and expressed from approximately 60 var genes in a mutually exclusive manner. Switching of var genes allows the parasite to alter functional and antigenic properties of infected erythrocytes, to escape the immune defense and to establish chronic infections. We have developed an efficient method for isolating VAR genes from telomeric and other genome locations by adapting transformation-associated recombination (TAR) cloning, which can then be analyzed and sequenced. For this purpose, three plasmids each containing a homologous sequence representing the upstream regions of the group A, B, and C var genes and a sequence homologous to the conserved acidic terminal segment (ATS) of var genes were generated. Co-transfection with P. falciparum strain ITG2F6 genomic DNA in yeast cells yielded 200 TAR clones. The relative frequencies of clones from each group were not biased. Clones were screened by PCR, as well as Southern blotting, which revealed clones missed by PCR due to sequence mismatches with the primers. Selected clones were transformed into E. coli and further analyzed by RFLP and end sequencing. Physical analysis of 36 clones revealed 27 distinct types potentially representing 50% of the var gene repertoire. Three clones were selected for sequencing and assembled into single var gene containing contigs. This study demonstrates that it is possible to rapidly obtain the repertoire of var genes from P. falciparum within a single set of cloning experiments. This technique can be applied to individual isolates which will provide a detailed picture of the diversity of var genes in the field. This is a powerful tool to overcome the obstacles with cloning and assembly of multi-gene families by simultaneously cloning each member. PMID:21408186

  11. Mitotic evolution of Plasmodium falciparum shows a stable core genome but recombination in antigen families.

    Directory of Open Access Journals (Sweden)

    Selina E R Bopp

    Full Text Available Malaria parasites elude eradication attempts both within the human host and across nations. At the individual level, parasites evade the host immune responses through antigenic variation. At the global level, parasites escape drug pressure through single nucleotide variants and gene copy amplification events conferring drug resistance. Despite their importance to global health, the rates at which these genomic alterations emerge have not been determined. We studied the complete genomes of different Plasmodium falciparum clones that had been propagated asexually over one year in the presence and absence of drug pressure. A combination of whole-genome microarray analysis and next-generation deep resequencing (totaling 14 terabases revealed a stable core genome with only 38 novel single nucleotide variants appearing in seventeen evolved clones (avg. 5.4 per clone. In clones exposed to atovaquone, we found cytochrome b mutations as well as an amplification event encompassing the P. falciparum multidrug resistance associated protein (mrp1 on chromosome 1. We observed 18 large-scale (>1 kb on average deletions of telomere-proximal regions encoding multigene families, involved in immune evasion (9.5×10(-6 structural variants per base pair per generation. Six of these deletions were associated with chromosomal crossovers generated during mitosis. We found only minor differences in rates between genetically distinct strains and between parasites cultured in the presence or absence of drug. Using these derived mutation rates for P. falciparum (1.0-9.7×10(-9 mutations per base pair per generation, we can now model the frequency at which drug or immune resistance alleles will emerge under a well-defined set of assumptions. Further, the detection of mitotic recombination events in var gene families illustrates how multigene families can arise and change over time in P. falciparum. These results will help improve our understanding of how P. falciparum

  12. Mitotic Evolution of Plasmodium falciparum Shows a Stable Core Genome but Recombination in Antigen Families

    Science.gov (United States)

    Bopp, Selina E. R.; Manary, Micah J.; Bright, A. Taylor; Johnston, Geoffrey L.; Dharia, Neekesh V.; Luna, Fabio L.; McCormack, Susan; Plouffe, David; McNamara, Case W.; Walker, John R.; Fidock, David A.; Denchi, Eros Lazzerini; Winzeler, Elizabeth A.

    2013-01-01

    Malaria parasites elude eradication attempts both within the human host and across nations. At the individual level, parasites evade the host immune responses through antigenic variation. At the global level, parasites escape drug pressure through single nucleotide variants and gene copy amplification events conferring drug resistance. Despite their importance to global health, the rates at which these genomic alterations emerge have not been determined. We studied the complete genomes of different Plasmodium falciparum clones that had been propagated asexually over one year in the presence and absence of drug pressure. A combination of whole-genome microarray analysis and next-generation deep resequencing (totaling 14 terabases) revealed a stable core genome with only 38 novel single nucleotide variants appearing in seventeen evolved clones (avg. 5.4 per clone). In clones exposed to atovaquone, we found cytochrome b mutations as well as an amplification event encompassing the P. falciparum multidrug resistance associated protein (mrp1) on chromosome 1. We observed 18 large-scale (>1 kb on average) deletions of telomere-proximal regions encoding multigene families, involved in immune evasion (9.5×10−6 structural variants per base pair per generation). Six of these deletions were associated with chromosomal crossovers generated during mitosis. We found only minor differences in rates between genetically distinct strains and between parasites cultured in the presence or absence of drug. Using these derived mutation rates for P. falciparum (1.0–9.7×10−9 mutations per base pair per generation), we can now model the frequency at which drug or immune resistance alleles will emerge under a well-defined set of assumptions. Further, the detection of mitotic recombination events in var gene families illustrates how multigene families can arise and change over time in P. falciparum. These results will help improve our understanding of how P. falciparum evolves to

  13. Evidence of strain structure in Plasmodium falciparum var gene repertoires in children from Gabon, West Africa.

    Science.gov (United States)

    Day, Karen P; Artzy-Randrup, Yael; Tiedje, Kathryn E; Rougeron, Virginie; Chen, Donald S; Rask, Thomas S; Rorick, Mary M; Migot-Nabias, Florence; Deloron, Philippe; Luty, Adrian J F; Pascual, Mercedes

    2017-05-16

    Existing theory on competition for hosts between pathogen strains has proposed that immune selection can lead to the maintenance of strain structure consisting of discrete, weakly overlapping antigenic repertoires. This prediction of strain theory has conceptual overlap with fundamental ideas in ecology on niche partitioning and limiting similarity between coexisting species in an ecosystem, which oppose the hypothesis of neutral coexistence. For Plasmodium falciparum , strain theory has been specifically proposed in relation to the major surface antigen of the blood stage, known as Pf EMP1 and encoded by the multicopy multigene family known as the var genes. Deep sampling of the DBLα domain of var genes in the local population of Bakoumba, West Africa, was completed to define whether patterns of repertoire overlap support a role of immune selection under the opposing force of high outcrossing, a characteristic of areas of intense malaria transmission. Using a 454 high-throughput sequencing protocol, we report extremely high diversity of the DBLα domain and a large parasite population with DBLα repertoires structured into nonrandom patterns of overlap. Such population structure, significant for the high diversity of var genes that compose it at a local level, supports the existence of "strains" characterized by distinct var gene repertoires. Nonneutral, frequency-dependent competition would be at play and could underlie these patterns. With a computational experiment that simulates an intervention similar to mass drug administration, we argue that the observed repertoire structure matters for the antigenic var diversity of the parasite population remaining after intervention.

  14. A Knockout Screen of ApiAP2 Genes Reveals Networks of Interacting Transcriptional Regulators Controlling the Plasmodium Life Cycle.

    Science.gov (United States)

    Modrzynska, Katarzyna; Pfander, Claudia; Chappell, Lia; Yu, Lu; Suarez, Catherine; Dundas, Kirsten; Gomes, Ana Rita; Goulding, David; Rayner, Julian C; Choudhary, Jyoti; Billker, Oliver

    2017-01-11

    A family of apicomplexa-specific proteins containing AP2 DNA-binding domains (ApiAP2s) was identified in malaria parasites. This family includes sequence-specific transcription factors that are key regulators of development. However, functions for the majority of ApiAP2 genes remain unknown. Here, a systematic knockout screen in Plasmodium berghei identified ten ApiAP2 genes that were essential for mosquito transmission: four were critical for the formation of infectious ookinetes, and three were required for sporogony. We describe non-essential functions for AP2-O and AP2-SP proteins in blood stages, and identify AP2-G2 as a repressor active in both asexual and sexual stages. Comparative transcriptomics across mutants and developmental stages revealed clusters of co-regulated genes with shared cis promoter elements, whose expression can be controlled positively or negatively by different ApiAP2 factors. We propose that stage-specific interactions between ApiAP2 proteins on partly overlapping sets of target genes generate the complex transcriptional network that controls the Plasmodium life cycle. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  15. Heterogeneous genetic diversity pattern in Plasmodium vivax genes encoding merozoite surface proteins (MSP) -7E, -7F and -7L.

    Science.gov (United States)

    Garzón-Ospina, Diego; Forero-Rodríguez, Johanna; Patarroyo, Manuel A

    2014-12-13

    The msp-7 gene has become differentially expanded in the Plasmodium genus; Plasmodium vivax has the highest copy number of this gene, several of which encode antigenic proteins in merozoites. DNA sequences from thirty-six Colombian clinical isolates from P. vivax (pv) msp-7E, -7F and -7L genes were analysed for characterizing and studying the genetic diversity of these pvmsp-7 members which are expressed during the intra-erythrocyte stage; natural selection signals producing the variation pattern so observed were evaluated. The pvmsp-7E gene was highly polymorphic compared to pvmsp-7F and pvmsp-7L which were seen to have limited genetic diversity; pvmsp-7E polymorphism was seen to have been maintained by different types of positive selection. Even though these copies seemed to be species-specific duplications, a search in the Plasmodium cynomolgi genome (P. vivax sister taxon) showed that both species shared the whole msp-7 repertoire. This led to exploring the long-term effect of natural selection by comparing the orthologous sequences which led to finding signatures for lineage-specific positive selection. The results confirmed that the P. vivax msp-7 family has a heterogeneous genetic diversity pattern; some members are highly conserved whilst others are highly diverse. The results suggested that the 3'-end of these genes encode MSP-7 proteins' functional region whilst the central region of pvmsp-7E has evolved rapidly. The lineage-specific positive selection signals found suggested that mutations occurring in msp-7s genes during host switch may have succeeded in adapting the ancestral P. vivax parasite population to humans.

  16. Plasmodium falciparum transcriptome analysis reveals pregnancy malaria associated gene expression

    DEFF Research Database (Denmark)

    Tuikue Ndam, Nicaise; Bischoff, Emmanuel; Proux, Caroline

    2008-01-01

    BACKGROUND: Pregnancy-associated malaria (PAM) causing maternal anemia and low birth weight is among the multiple manifestations of Plasmodium falciparum malaria. Infected erythrocytes (iEs) can acquire various adhesive properties that mediate the clinical severity of malaria. Recent advances...

  17. The Caenorhabditis chemoreceptor gene families

    Directory of Open Access Journals (Sweden)

    Robertson Hugh M

    2008-10-01

    Full Text Available Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Conclusion Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.

  18. The Caenorhabditis chemoreceptor gene families.

    Science.gov (United States)

    Thomas, James H; Robertson, Hugh M

    2008-10-06

    Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.

  19. The effects of a partitioned var gene repertoire of Plasmodium falciparum on antigenic diversity and the acquisition of clinical immunity

    Directory of Open Access Journals (Sweden)

    Arinaminpathy Nimalan

    2008-01-01

    Full Text Available Abstract Background The human malaria parasite Plasmodium falciparum exploits antigenic diversity and within-host antigenic variation to evade the host's immune system. Of particular importance are the highly polymorphic var genes that encode the family of cell surface antigens PfEMP1 (Plasmodium falciparum Erythrocyte Membrane Protein 1. It has recently been shown that in spite of their extreme diversity, however, these genes fall into distinct groups according to chromosomal location or sequence similarity, and that recombination may be confined within these groups. Methods This study presents a mathematical analysis of how recombination hierarchies affect diversity, and, by using simple stochastic simulations, investigates how intra- and inter-genic diversity influence the rate at which individuals acquire clinical immunity. Results The analysis demonstrates that the partitioning of the var gene repertoire has a limiting effect on the total diversity attainable through recombination and that the limiting effect is strongly influenced by the respective sizes of each of the partitions. Furthermore, by associating expression of one of the groups with severe malaria it is demonstrated how a small number of infections can be sufficient to protect against disease despite a seemingly limitless number of possible non-identical repertoires. Conclusion Recombination hierarchies within the var gene repertoire of P. falciparum have a severe effect on strain diversity and the process of acquiring immunity against clinical malaria. Future studies will show how the existence of these recombining groups can offer an evolutionary advantage in spite of their restriction on diversity.

  20. Correction to: Polymorphisms in chloroquine resistance-associated genes in Plasmodium vivax in Ethiopia.

    Science.gov (United States)

    Golassa, Lemu; Erko, Berhanu; Baliraine, Frederick N; Aseffa, Abraham; Swedberg, Göte

    2018-05-02

    After publication of the original article [1], it came to the authors' attention that the primers mentioned in Table 1 for the amplification of the pvcrt-o gene of Plasmodium vivax are not the ones actually used for the experiments. The correct primers and PCR product size are as below.

  1. Gene cluster statistics with gene families.

    Science.gov (United States)

    Raghupathy, Narayanan; Durand, Dannie

    2009-05-01

    Identifying genomic regions that descended from a common ancestor is important for understanding the function and evolution of genomes. In distantly related genomes, clusters of homologous gene pairs are evidence of candidate homologous regions. Demonstrating the statistical significance of such "gene clusters" is an essential component of comparative genomic analyses. However, currently there are no practical statistical tests for gene clusters that model the influence of the number of homologs in each gene family on cluster significance. In this work, we demonstrate empirically that failure to incorporate gene family size in gene cluster statistics results in overestimation of significance, leading to incorrect conclusions. We further present novel analytical methods for estimating gene cluster significance that take gene family size into account. Our methods do not require complete genome data and are suitable for testing individual clusters found in local regions, such as contigs in an unfinished assembly. We consider pairs of regions drawn from the same genome (paralogous clusters), as well as regions drawn from two different genomes (orthologous clusters). Determining cluster significance under general models of gene family size is computationally intractable. By assuming that all gene families are of equal size, we obtain analytical expressions that allow fast approximation of cluster probabilities. We evaluate the accuracy of this approximation by comparing the resulting gene cluster probabilities with cluster probabilities obtained by simulating a realistic, power-law distributed model of gene family size, with parameters inferred from genomic data. Surprisingly, despite the simplicity of the underlying assumption, our method accurately approximates the true cluster probabilities. It slightly overestimates these probabilities, yielding a conservative test. We present additional simulation results indicating the best choice of parameter values for data

  2. Erythrocyte remodeling in Plasmodium berghei infection: the contribution of SEP family members.

    Science.gov (United States)

    Currà, Chiara; Pace, Tomasino; Franke-Fayard, Blandine M D; Picci, Leonardo; Bertuccini, Lucia; Ponzi, Marta

    2012-03-01

    The malaria parasite Plasmodium largely modifies the infected erythrocyte through the export of proteins to multiple sites within the host cell. This remodeling is crucial for pathology and translocation of virulence factors to the erythrocyte surface. In this study, we investigated localization and export of small exported proteins/early transcribed membrane proteins (SEP/ETRAMPs), conserved within Plasmodium genus. This protein family is characterized by a predicted signal peptide, a short lysine-rich stretch, an internal transmembrane domain and a highly charged C-terminal region of variable length. We show here that members of the rodent Plasmodium berghei family are components of the parasitophorous vacuole membrane (PVM), which surrounds the parasite throughout the erythrocytic cycle. During P. berghei development, vesicle-like structures containing these proteins detach from the PVM en route to the host cytosol. These SEP-containing vesicles remain associated with the infected erythrocyte ghosts most probably anchored to the membrane skeleton. Transgenic lines expressing the green fluorescent protein appended to different portions of sep-coding region allowed us to define motifs required for protein export. The highly charged terminal region appears to be involved in protein-protein interactions. © 2011 John Wiley & Sons A/S.

  3. Remarkable stability in patterns of blood-stage gene expression during episodes of non-lethal Plasmodium yoelii malaria.

    Science.gov (United States)

    Cernetich-Ott, Amy; Daly, Thomas M; Vaidya, Akhil B; Bergman, Lawrence W; Burns, James M

    2012-08-06

    Microarray studies using in vitro cultures of synchronized, blood-stage Plasmodium falciparum malaria parasites have revealed a 'just-in-time' cascade of gene expression with some indication that these transcriptional patterns remain stable even in the presence of external stressors. However, direct analysis of transcription in P. falciparum blood-stage parasites obtained from the blood of infected patients suggests that parasite gene expression may be modulated by factors present in the in vivo environment of the host. The aim of this study was to examine changes in gene expression of the rodent malaria parasite, Plasmodium yoelii 17X, while varying the in vivo setting of replication. Using P. yoelii 17X parasites replicating in vivo, differential gene expression in parasites isolated from individual mice, from independent infections, during ascending, peak and descending parasitaemia and in the presence and absence of host antibody responses was examined using P. yoelii DNA microarrays. A genome-wide analysis to identify coordinated changes in groups of genes associated with specific biological pathways was a primary focus, although an analysis of the expression patterns of two multi-gene families in P. yoelii, the yir and pyst-a families, was also completed. Across experimental conditions, transcription was surprisingly stable with little evidence for distinct transcriptional states or for consistent changes in specific pathways. Differential gene expression was greatest when comparing differences due to parasite load and/or host cell availability. However, the number of differentially expressed genes was generally low. Of genes that were differentially expressed, many involved biologically diverse pathways. There was little to no differential expression of members of the yir and pyst-a multigene families that encode polymorphic proteins associated with the membrane of infected erythrocytes. However, a relatively large number of these genes were expressed during

  4. Limited cross-reactivity among domains of the Plasmodium falciparum clone 3D7 erythrocyte membrane protein 1 family

    DEFF Research Database (Denmark)

    Joergensen, Louise; Turner, Louise; Magistrado, Pamela

    2006-01-01

    The var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family is responsible for antigenic variation and sequestration of infected erythrocytes during malaria. We have previously grouped the 60 PfEMP1 variants of P. falciparum clone 3D7 into groups A and B/A (category A......) and groups B, B/C, and C (category non-A). Expression of category A molecules is associated with severe malaria, and that of category non-A molecules is associated with uncomplicated malaria and asymptomatic infection. Here we assessed cross-reactivity among 60 different recombinant PfEMP1 domains derived...... from clone 3D7 by using a competition enzyme-linked immunosorbent assay and a pool of plasma from 63 malaria-exposed Tanzanian individuals. We conclude that naturally acquired antibodies are largely directed toward epitopes varying between different domains with a few, mainly category A, domains...

  5. Sporozoite Route of Infection Influences In Vitro var Gene Transcription of Plasmodium falciparum Parasites From Controlled Human Infections.

    Science.gov (United States)

    Dimonte, Sandra; Bruske, Ellen I; Hass, Johanna; Supan, Christian; Salazar, Carmen L; Held, Jana; Tschan, Serena; Esen, Meral; Flötenmeyer, Matthias; Koch, Iris; Berger, Jürgen; Bachmann, Anna; Sim, Betty K L; Hoffman, Stephen L; Kremsner, Peter G; Mordmüller, Benjamin; Frank, Matthias

    2016-09-15

    Antigenic variation in Plasmodium falciparum is mediated by the multicopy var gene family. Each parasite possesses about 60 var genes, and switching between active var loci results in antigenic variation. In the current study, the effect of mosquito and host passage on in vitro var gene transcription was investigated. Thirty malaria-naive individuals were inoculated by intradermal or intravenous injection with cryopreserved, isogenic NF54 P. falciparum sporozoites (PfSPZ) generated from 1 premosquito culture. Microscopic parasitemia developed in 22 individuals, and 21 in vitro cultures were established. The var gene transcript levels were determined in early and late postpatient cultures and in the premosquito culture. At the early time point, all cultures preferentially transcribed 8 subtelomeric var genes. Intradermal infections had higher var gene transcript levels than intravenous infections and a significantly longer intrahost replication time (P = .03). At the late time point, 9 subtelomeric and 8 central var genes were transcribed at the same levels in almost all cultures. Premosquito and late postpatient cultures transcribed the same subtelomeric and central var genes, except for var2csa  The duration of intrahost replication influences in vitro var gene transcript patterns. Differences between premosquito and postpatient cultures decrease with prolonged in vitro growth. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  6. A systematic analysis of the early transcribed membrane protein family throughout the life cycle of Plasmodium yoelii.

    Science.gov (United States)

    MacKellar, Drew C; Vaughan, Ashley M; Aly, Ahmed S I; DeLeon, Sasha; Kappe, Stefan H I

    2011-11-01

    The early transcribed membrane proteins (ETRAMPs) are a family of small, highly charged transmembrane proteins unique to malaria parasites. Some members of the ETRAMP family have been localized to the parasitophorous vacuole membrane that separates the intracellular parasite from the host cell and thus presumably have a role in host-parasite interactions. Although it was previously shown that two ETRAMPs are critical for rodent malaria parasite liver-stage development, the importance of most ETRAMPs during the parasite life cycle remains unknown. Here, we comprehensively identify nine new etramps in the genome of the rodent malaria parasite Plasmodium yoelii, and elucidate their conservation in other malaria parasites. etramp expression profiles are diverse throughout the parasite life cycle as measured by RT-PCR. Epitope tagging of two ETRAMPs demonstrates protein expression in blood and liver stages, and reveals differences in both their timing of expression and their subcellular localization. Gene targeting studies of each of the nine uncharacterized etramps show that two are refractory to deletion and thus likely essential for blood-stage replication. Seven etramps are not essential for any life cycle stage. Systematic characterization of the members of the ETRAMP family reveals the diversity in importance of each family member at the interface between host and parasite throughout the developmental cycle of the malaria parasite. © 2011 Blackwell Publishing Ltd.

  7. Characterization of the repertoire diversity of the Plasmodium falciparum stevor multigene family in laboratory and field isolates

    Directory of Open Access Journals (Sweden)

    Holder Anthony A

    2009-06-01

    Full Text Available Abstract Background The evasion of host immune response by the human malaria parasite Plasmodium falciparum has been linked to expression of a range of variable antigens on the infected erythrocyte surface. Several genes are potentially involved in this process with the var, rif and stevor multigene families being the most likely candidates and coding for rapidly evolving proteins. The high sequence diversity of proteins encoded by these gene families may have evolved as an immune evasion strategy that enables the parasite to establish long lasting chronic infections. Previous findings have shown that the hypervariable region (HVR of STEVOR has significant sequence diversity both within as well as across different P. falciparum lines. However, these studies did not address whether or not there are ancestral stevor that can be found in different parasites. Methods DNA and RNA sequences analysis as well as phylogenetic approaches were used to analyse the stevor sequence repertoire and diversity in laboratory lines and Kilifi (Kenya fresh isolates. Results Conserved stevor genes were identified in different P. falciparum isolates from different global locations. Consistent with previous studies, the HVR of the stevor gene family was found to be highly divergent both within and between isolates. Importantly phylogenetic analysis shows some clustering of stevor sequences both within a single parasite clone as well as across different parasite isolates. Conclusion This indicates that the ancestral P. falciparum parasite genome already contained multiple stevor genes that have subsequently diversified further within the different P. falciparum populations. It also confirms that STEVOR is under strong selection pressure.

  8. MADIBA: A web server toolkit for biological interpretation of Plasmodium and plant gene clusters

    Directory of Open Access Journals (Sweden)

    Louw Abraham I

    2008-02-01

    Full Text Available Abstract Background Microarray technology makes it possible to identify changes in gene expression of an organism, under various conditions. Data mining is thus essential for deducing significant biological information such as the identification of new biological mechanisms or putative drug targets. While many algorithms and software have been developed for analysing gene expression, the extraction of relevant information from experimental data is still a substantial challenge, requiring significant time and skill. Description MADIBA (MicroArray Data Interface for Biological Annotation facilitates the assignment of biological meaning to gene expression clusters by automating the post-processing stage. A relational database has been designed to store the data from gene to pathway for Plasmodium, rice and Arabidopsis. Tools within the web interface allow rapid analyses for the identification of the Gene Ontology terms relevant to each cluster; visualising the metabolic pathways where the genes are implicated, their genomic localisations, putative common transcriptional regulatory elements in the upstream sequences, and an analysis specific to the organism being studied. Conclusion MADIBA is an integrated, online tool that will assist researchers in interpreting their results and understand the meaning of the co-expression of a cluster of genes. Functionality of MADIBA was validated by analysing a number of gene clusters from several published experiments – expression profiling of the Plasmodium life cycle, and salt stress treatments of Arabidopsis and rice. In most of the cases, the same conclusions found by the authors were quickly and easily obtained after analysing the gene clusters with MADIBA.

  9. Plasmodium falciparum var Gene Silencing Is Determined by cis DNA Elements That Form Stable and Heritable Interactions ▿

    Science.gov (United States)

    Swamy, Lakshmi; Amulic, Borko; Deitsch, Kirk W.

    2011-01-01

    Antigenic variation in the human malaria parasite Plasmodium falciparum depends on the transcriptional regulation of the var gene family. In each individual parasite, mRNA is expressed exclusively from 1 var gene out of ∼60, while the rest of the genes are transcriptionally silenced. Both modifications to chromatin structure and DNA regulatory elements associated with each var gene have been implicated in the organization and maintenance of the silent state. Whether silencing is established at the level of entire chromosomal regions via heterochromatin spreading or at the level of individual var promoters through the action of a silencing element within each var intron has been debated. Here, we consider both possibilities, using clonal parasite lines carrying chromosomally integrated transgenes. We confirm a previous finding that the loss of an adjacent var intron results in var promoter activation and further show that transcriptional activation of a var promoter within a cluster does not affect the transcriptional activity of neighboring var promoters. Our results provide more evidence for the hypothesis that var genes are primarily silenced at the level of an individual gene, rather than by heterochromatin spreading. We also tested the intrinsic directionality of an intron's silencing effect on upstream or downstream var promoters. We found that an intron is capable of silencing in either direction and that, once established, a var promoter-intron pair is stably maintained through many generations, suggesting a possible role in epigenetic memory. This study provides insights into the regulation of endogenous var gene clusters. PMID:21317310

  10. Polymorphisms in Plasmodium falciparum chloroquine resistance transporter and multidrug resistance 1 genes

    DEFF Research Database (Denmark)

    Venkatesan, Meera; Gadalla, Nahla B; Stepniewska, Kasia

    2014-01-01

    Adequate clinical and parasitologic cure by artemisinin combination therapies relies on the artemisinin component and the partner drug. Polymorphisms in the Plasmodium falciparum chloroquine resistance transporter (pfcrt) and P. falciparum multidrug resistance 1 (pfmdr1) genes are associated...... with decreased sensitivity to amodiaquine and lumefantrine, but effects of these polymorphisms on therapeutic responses to artesunate-amodiaquine (ASAQ) and artemether-lumefantrine (AL) have not been clearly defined. Individual patient data from 31 clinical trials were harmonized and pooled by using standardized...

  11. Nuclear pores and perinuclear expression sites of var and ribosomal DNA genes correspond to physically distinct regions in Plasmodium falciparum.

    Science.gov (United States)

    Guizetti, Julien; Martins, Rafael Miyazawa; Guadagnini, Stéphanie; Claes, Aurélie; Scherf, Artur

    2013-05-01

    The human malaria parasite Plasmodium falciparum modifies the erythrocyte it infects by exporting variant proteins to the host cell surface. The var gene family that codes for a large, variant adhesive surface protein called P. falciparum erythrocyte membrane protein 1 (PfEMP1) plays a particular role in this process, which is linked to pathogenesis and immune evasion. A single member of this gene family is highly transcribed while the other 59 members remain silenced. Importantly, var gene transcription occurs at a spatially restricted, but yet undefined, perinuclear site that is distinct from repressed var gene clusters. To advance our understanding of monoallelic expression, we investigated whether nuclear pores associate with the var gene expression site. To this end, we studied the nuclear pore organization during the asexual blood stage using a specific antibody directed against a subunit of the nuclear pore, P. falciparum Nup116 (PfNup116). Ring and schizont stage parasites showed highly polarized nuclear pore foci, whereas in trophozoite stage nuclear pores redistributed over the entire nuclear surface. Colocalization studies of var transcripts and anti-PfNup116 antibodies showed clear dissociation between nuclear pores and the var gene expression site in ring stage. Similar results were obtained for another differentially transcribed perinuclear gene family, the ribosomal DNA units. Furthermore, we show that in the poised state, the var gene locus is not physically linked to nuclear pores. Our results indicate that P. falciparum does form compartments of high transcriptional activity at the nuclear periphery which are, unlike the case in yeast, devoid of nuclear pores.

  12. Possible association of the Plasmodium falciparum T1526C resa2 gene mutation with severe malaria

    Directory of Open Access Journals (Sweden)

    Durand Rémy

    2012-04-01

    Full Text Available Abstract Background Plasmodium falciparum exports proteins that remodel the erythrocyte membrane. One such protein, called Pf155/RESA (RESA1 contributes to parasite fitness, optimizing parasite survival during febrile episodes. Resa1 gene is a member of a small family comprising three highly related genes. Preliminary evidence led to a search for clues indicating the involvement of RESA2 protein in the pathophysiology of malaria. In the present study, cDNA sequence of resa2 gene was obtained from two different strains. The proportion of P. falciparum isolates having a non-stop T1526C mutation in resa2 gene was evaluated and the association of this genotype with severity of malaria was investigated. Methods Resa2 cDNAs of two different strains (a patient isolate and K1 culture adapted strain was obtained by RT-PCR and DNA sequencing was performed to confirm its gene structure. The proportion of isolates having a T1526C mutation was evaluated using a PCR-RFLP methodology on groups of severe malaria and uncomplicated patients recruited in 1991–1994 in Senegal and in 2009 in Benin. Results A unique ORF with an internal translation stop was found in the patient isolate (Genbank access number : JN183870, while the K1 strain harboured the T1526C mutation (Genbank access number : JN183869 which affects the internal stop codon and restores a full length coding sequence. About 14% of isolates obtained from Senegal and Benin harboured mutant T1526C parasites. Some isolates had both wild and mutant resa alleles. The analysis excluding those mixed isolates showed that the resa2 T1526C mutation was found more frequently in severe malaria cases than in uncomplicated cases (p = 0.008. The association of the presence of the mutant allele and parasitaemia >4% was shown in multivariate analysis (p = 0.03 in the group of Beninese children. Conclusions All T1526C mutant parasites theoretically have the ability to give rise to a full-length RESA2 protein

  13. Erasing the Epigenetic Memory and Beginning to Switch—The Onset of Antigenic Switching of var Genes in Plasmodium falciparum

    Science.gov (United States)

    Fastman, Yair; Noble, Robert; Recker, Mario; Dzikowski, Ron

    2012-01-01

    Antigenic variation in Plasmodium falciparum is regulated by transcriptional switches among members of the var gene family, each expressed in a mutually exclusive manner and encoding a different variant of the surface antigens collectively named PfEMP1. Antigenic switching starts when the first merozoites egress from the liver and begin their asexual proliferation within red blood cells. By erasing the epigenetic memory we created parasites with no var background, similar to merozoites that egress from the liver where no var gene is expressed. Creating a null-var background enabled us to investigate the onset of antigenic switches at the early phase of infection. At the onset of switching, var transcription pattern is heterogeneous with numerous genes transcribed at low levels including upsA vars, a subtype that was implicated in severe malaria, which are rarely activated in growing cultures. Analysis of subsequent in vitro switches shows that the probability of a gene to turn on or off is not associated with its chromosomal position or promoter type per se but on intrinsic properties of each gene. We concluded that var switching is determined by gene specific associated switch rates rather than general promoter type or locus associated switch rates. In addition, we show that fine tuned reduction in var transcription increases their switch rate, indicating that transcriptional perturbation can alter antigenic switching. PMID:22461905

  14. Plasmodium falciparum associated with severe childhood malaria preferentially expresses PfEMP1 encoded by group A var genes

    DEFF Research Database (Denmark)

    Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah

    2004-01-01

    Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in noni...... genes, such as PFD1235w/MAL7P1.1, appear to be involved in the pathogenesis of severe disease and are thus attractive candidates for a vaccine against life-threatening P. falciparum malaria....

  15. Three members of the 6-cys protein family of Plasmodium play a role in gamete fertility.

    Directory of Open Access Journals (Sweden)

    Melissa R van Dijk

    2010-04-01

    Full Text Available The process of fertilization is critically dependent on the mutual recognition of gametes and in Plasmodium, the male gamete surface protein P48/45 is vital to this process. This protein belongs to a family of 10 structurally related proteins, the so called 6-cys family. To identify the role of additional members of this family in Plasmodium fertilisation, we performed genetic and functional analysis on the five members of the 6-cys family that are transcribed during the gametocyte stage of P. berghei. This analysis revealed that in addition to P48/45, two members (P230 and P47 also play an essential role in the process of parasite fertilization. Mating studies between parasites lacking P230, P48/45 or P47 demonstrate that P230, like P48/45, is a male fertility factor, consistent with the previous demonstration of a protein complex containing both P48/45 and P230. In contrast, disruption of P47 results in a strong reduction of female fertility, while males remain unaffected. Further analysis revealed that gametes of mutants lacking expression of p48/45 or p230 or p47 are unable to either recognise or attach to each other. Disruption of the paralog of p230, p230p, also specifically expressed in gametocytes, had no observable effect on fertilization. These results indicate that the P. berghei 6-cys family contains a number of proteins that are either male or female specific ligands that play an important role in gamete recognition and/or attachment. The implications of low levels of fertilisation that exist even in the absence of these proteins, indicating alternative pathways of fertilisation, as well as positive selection acting on these proteins, are discussed in the context of targeting these proteins as transmission blocking vaccine candidates.

  16. Mosquito Passage Dramatically Changes var Gene Expression in Controlled Human Plasmodium falciparum Infections.

    Science.gov (United States)

    Bachmann, Anna; Petter, Michaela; Krumkamp, Ralf; Esen, Meral; Held, Jana; Scholz, Judith A M; Li, Tao; Sim, B Kim Lee; Hoffman, Stephen L; Kremsner, Peter G; Mordmüller, Benjamin; Duffy, Michael F; Tannich, Egbert

    2016-04-01

    Virulence of the most deadly malaria parasite Plasmodium falciparum is linked to the variant surface antigen PfEMP1, which is encoded by about 60 var genes per parasite genome. Although the expression of particular variants has been associated with different clinical outcomes, little is known about var gene expression at the onset of infection. By analyzing controlled human malaria infections via quantitative real-time PCR, we show that parasite populations from 18 volunteers expressed virtually identical transcript patterns that were dominated by the subtelomeric var gene group B and, to a lesser extent, group A. Furthermore, major changes in composition and frequency of var gene transcripts were detected between the parental parasite culture that was used to infect mosquitoes and Plasmodia recovered from infected volunteers, suggesting that P. falciparum resets its var gene expression during mosquito passage and starts with the broad expression of a specific subset of var genes when entering the human blood phase.

  17. The Caenorhabditis chemoreceptor gene families

    OpenAIRE

    Robertson Hugh M; Thomas James H

    2008-01-01

    Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-...

  18. Comparative genomics in Chlamydomonas and Plasmodium identifies an ancient nuclear envelope protein family essential for sexual reproduction in protists, fungi, plants, and vertebrates.

    Science.gov (United States)

    Ning, Jue; Otto, Thomas D; Pfander, Claudia; Schwach, Frank; Brochet, Mathieu; Bushell, Ellen; Goulding, David; Sanders, Mandy; Lefebvre, Paul A; Pei, Jimin; Grishin, Nick V; Vanderlaan, Gary; Billker, Oliver; Snell, William J

    2013-05-15

    Fertilization is a crucial yet poorly characterized event in eukaryotes. Our previous discovery that the broadly conserved protein HAP2 (GCS1) functioned in gamete membrane fusion in the unicellular green alga Chlamydomonas and the malaria pathogen Plasmodium led us to exploit the rare biological phenomenon of isogamy in Chlamydomonas in a comparative transcriptomics strategy to uncover additional conserved sexual reproduction genes. All previously identified Chlamydomonas fertilization-essential genes fell into related clusters based on their expression patterns. Out of several conserved genes in a minus gamete cluster, we focused on Cre06.g280600, an ortholog of the fertilization-related Arabidopsis GEX1. Gene disruption, cell biological, and immunolocalization studies show that CrGEX1 functions in nuclear fusion in Chlamydomonas. Moreover, CrGEX1 and its Plasmodium ortholog, PBANKA_113980, are essential for production of viable meiotic progeny in both organisms and thus for mosquito transmission of malaria. Remarkably, we discovered that the genes are members of a large, previously unrecognized family whose first-characterized member, KAR5, is essential for nuclear fusion during yeast sexual reproduction. Our comparative transcriptomics approach provides a new resource for studying sexual development and demonstrates that exploiting the data can lead to the discovery of novel biology that is conserved across distant taxa.

  19. Global sequence diversity of the lactate dehydrogenase gene in Plasmodium falciparum.

    Science.gov (United States)

    Simpalipan, Phumin; Pattaradilokrat, Sittiporn; Harnyuttanakorn, Pongchai

    2018-01-09

    Antigen-detecting rapid diagnostic tests (RDTs) have been recommended by the World Health Organization for use in remote areas to improve malaria case management. Lactate dehydrogenase (LDH) of Plasmodium falciparum is one of the main parasite antigens employed by various commercial RDTs. It has been hypothesized that the poor detection of LDH-based RDTs is attributed in part to the sequence diversity of the gene. To test this, the present study aimed to investigate the genetic diversity of the P. falciparum ldh gene in Thailand and to construct the map of LDH sequence diversity in P. falciparum populations worldwide. The ldh gene was sequenced for 50 P. falciparum isolates in Thailand and compared with hundreds of sequences from P. falciparum populations worldwide. Several indices of molecular variation were calculated, including the proportion of polymorphic sites, the average nucleotide diversity index (π), and the haplotype diversity index (H). Tests of positive selection and neutrality tests were performed to determine signatures of natural selection on the gene. Mean genetic distance within and between species of Plasmodium ldh was analysed to infer evolutionary relationships. Nucleotide sequences of P. falciparum ldh could be classified into 9 alleles, encoding 5 isoforms of LDH. L1a was the most common allelic type and was distributed in P. falciparum populations worldwide. Plasmodium falciparum ldh sequences were highly conserved, with haplotype and nucleotide diversity values of 0.203 and 0.0004, respectively. The extremely low genetic diversity was maintained by purifying selection, likely due to functional constraints. Phylogenetic analysis inferred the close genetic relationship of P. falciparum to malaria parasites of great apes, rather than to other human malaria parasites. This study revealed the global genetic variation of the ldh gene in P. falciparum, providing knowledge for improving detection of LDH-based RDTs and supporting the candidacy of

  20. A molecular epidemiological study of var gene diversity to characterize the reservoir of Plasmodium falciparum in humans in Africa.

    Directory of Open Access Journals (Sweden)

    Donald S Chen

    2011-02-01

    Full Text Available The reservoir of Plasmodium infection in humans has traditionally been defined by blood slide positivity. This study was designed to characterize the local reservoir of infection in relation to the diverse var genes that encode the major surface antigen of Plasmodium falciparum blood stages and underlie the parasite's ability to establish chronic infection and transmit from human to mosquito.We investigated the molecular epidemiology of the var multigene family at local sites in Gabon, Senegal and Kenya which differ in parasite prevalence and transmission intensity. 1839 distinct var gene types were defined by sequencing DBLα domains in the three sites. Only 76 (4.1% var types were found in more than one population indicating spatial heterogeneity in var types across the African continent. The majority of var types appeared only once in the population sample. Non-parametric statistical estimators predict in each population at minimum five to seven thousand distinct var types. Similar diversity of var types was seen in sites with different parasite prevalences.Var population genomics provides new insights into the epidemiology of P. falciparum in Africa where malaria has never been conquered. In particular, we have described the extensive reservoir of infection in local African sites and discovered a unique var population structure that can facilitate superinfection through minimal overlap in var repertoires among parasite genomes. Our findings show that var typing as a molecular surveillance system defines the extent of genetic complexity in the reservoir of infection to complement measures of malaria prevalence. The observed small scale spatial diversity of var genes suggests that var genetics could greatly inform current malaria mapping approaches and predict complex malaria population dynamics due to the import of var types to areas where no widespread pre-existing immunity in the population exists.

  1. A Molecular Epidemiological Study of var Gene Diversity to Characterize the Reservoir of Plasmodium falciparum in Humans in Africa

    Science.gov (United States)

    Leliwa-Sytek, Aleksandra; Smith, Terry-Ann; Peterson, Ingrid; Brown, Stuart M.; Migot-Nabias, Florence; Deloron, Philippe; Kortok, Moses M.; Marsh, Kevin; Daily, Johanna P.; Ndiaye, Daouda; Sarr, Ousmane; Mboup, Souleymane; Day, Karen P.

    2011-01-01

    Background The reservoir of Plasmodium infection in humans has traditionally been defined by blood slide positivity. This study was designed to characterize the local reservoir of infection in relation to the diverse var genes that encode the major surface antigen of Plasmodium falciparum blood stages and underlie the parasite's ability to establish chronic infection and transmit from human to mosquito. Methodology/Principal Findings We investigated the molecular epidemiology of the var multigene family at local sites in Gabon, Senegal and Kenya which differ in parasite prevalence and transmission intensity. 1839 distinct var gene types were defined by sequencing DBLα domains in the three sites. Only 76 (4.1%) var types were found in more than one population indicating spatial heterogeneity in var types across the African continent. The majority of var types appeared only once in the population sample. Non-parametric statistical estimators predict in each population at minimum five to seven thousand distinct var types. Similar diversity of var types was seen in sites with different parasite prevalences. Conclusions/Significance Var population genomics provides new insights into the epidemiology of P. falciparum in Africa where malaria has never been conquered. In particular, we have described the extensive reservoir of infection in local African sites and discovered a unique var population structure that can facilitate superinfection through minimal overlap in var repertoires among parasite genomes. Our findings show that var typing as a molecular surveillance system defines the extent of genetic complexity in the reservoir of infection to complement measures of malaria prevalence. The observed small scale spatial diversity of var genes suggests that var genetics could greatly inform current malaria mapping approaches and predict complex malaria population dynamics due to the import of var types to areas where no widespread pre-existing immunity in the population

  2. PfSETvs methylation of histone H3K36 represses virulence genes in Plasmodium falciparum

    DEFF Research Database (Denmark)

    Jiang, Lubin; Mu, Jianbing; Zhang, Qingfeng

    2013-01-01

    The variant antigen Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1), which is expressed on the surface of P. falciparum-infected red blood cells, is a critical virulence factor for malaria. Each parasite has 60 antigenically distinct var genes that each code for a different PfEMP1...... parasite nuclei and their expression as proteins on the surface of individual infected red blood cells. PfSETvs-dependent H3K36me3 is present along the entire gene body, including the transcription start site, to silence var genes. With low occupancy of PfSETvs at both the transcription start site of var...... protein. During infection the clonal parasite population expresses only one gene at a time before switching to the expression of a new variant antigen as an immune-evasion mechanism to avoid the host antibody response. The mechanism by which 59 of the 60 var genes are silenced remains largely unknown...

  3. Expression profiling of Plasmodium berghei HSP70 genes for generation of bright red fluorescent parasites.

    Directory of Open Access Journals (Sweden)

    Marion Hliscs

    Full Text Available Live cell imaging of recombinant malarial parasites encoding fluorescent probes provides critical insights into parasite-host interactions and life cycle progression. In this study, we generated a red fluorescent line of the murine malarial parasite Plasmodium berghei. To allow constitutive and abundant expression of the mCherry protein we profiled expression of all members of the P. berghei heat shock protein 70 (HSP70 family. We identified PbHSP70/1, an invariant ortholog of Plasmodium falciparum HSP70-1, as the protein with the highest expression levels during Plasmodium blood, mosquito, and liver infection. Stable allelic insertion of a mCherry expression cassette into the PbHsp70/1 locus created constitutive red fluorescent P. berghei lines, termed Pbred. We show that these parasites can be used for live imaging of infected host cells and organs, including hepatocytes, erythrocytes, and whole Anopheles mosquitoes. Quantification of the fluorescence intensity of several Pbred parasite stages revealed significantly enhanced signal intensities in comparison to GFP expressed under the control of the constitutive EF1alpha promoter. We propose that systematic transcript profiling permits generation of reporter parasites, such as the Pbred lines described herein.

  4. Genome-Wide Comparative Gene Family Classification

    Science.gov (United States)

    Frech, Christian; Chen, Nansheng

    2010-01-01

    Correct classification of genes into gene families is important for understanding gene function and evolution. Although gene families of many species have been resolved both computationally and experimentally with high accuracy, gene family classification in most newly sequenced genomes has not been done with the same high standard. This project has been designed to develop a strategy to effectively and accurately classify gene families across genomes. We first examine and compare the performance of computer programs developed for automated gene family classification. We demonstrate that some programs, including the hierarchical average-linkage clustering algorithm MC-UPGMA and the popular Markov clustering algorithm TRIBE-MCL, can reconstruct manual curation of gene families accurately. However, their performance is highly sensitive to parameter setting, i.e. different gene families require different program parameters for correct resolution. To circumvent the problem of parameterization, we have developed a comparative strategy for gene family classification. This strategy takes advantage of existing curated gene families of reference species to find suitable parameters for classifying genes in related genomes. To demonstrate the effectiveness of this novel strategy, we use TRIBE-MCL to classify chemosensory and ABC transporter gene families in C. elegans and its four sister species. We conclude that fully automated programs can establish biologically accurate gene families if parameterized accordingly. Comparative gene family classification finds optimal parameters automatically, thus allowing rapid insights into gene families of newly sequenced species. PMID:20976221

  5. Genetic diversity in the merozoite surface protein 1 and 2 genes of Plasmodium falciparum from the Artibonite Valley of Haiti.

    Science.gov (United States)

    Londono-Renteria, Berlin; Eisele, Thomas P; Keating, Joseph; Bennett, Adam; Krogstad, Donald J

    2012-01-01

    Describing genetic diversity of the Plasmodium falciparum parasite provides important information about the local epidemiology of malaria. In this study, we examined the genetic diversity of P. falciparum isolates from the Artibonite Valley in Haiti using the allelic families of merozoite surface protein 1 and 2 genes (msp-1 and msp-2). The majority of study subjects infected with P. falciparum had a single parasite genotype (56% for msp-1 and 69% for msp-2: n=79); 9 distinct msp-1 genotypes were identified by size differences on agarose gels. K1 was the most polymorphic allelic family with 5 genotypes (amplicons from 100 to 300 base pairs [bp]); RO33 was the least polymorphic, with a single genotype (120-bp). Although both msp-2 alleles (3D7/IC1, FC27) had similar number of genotypes (n=4), 3D7/IC1 was more frequent (85% vs. 26%). All samples were screened for the presence of the K76T mutation on the P. falciparum chloroquine resistance transporter (pfcrt) gene with 10 of 79 samples positive. Of the 2 (out of 10) samples from individuals follow-up for 21 days, P. falciparum parasites were present through day 7 after treatment with chloroquine. No parasites were found on day 21. Our results suggest that the level of genetic diversity is low in this area of Haiti, which is consistent with an area of low transmission. Copyright © 2011 Elsevier B.V. All rights reserved.

  6. Genetic diversity of three surface protein genes in Plasmodium malariae from three Asian countries.

    Science.gov (United States)

    Srisutham, Suttipat; Saralamba, Naowarat; Sriprawat, Kanlaya; Mayxay, Mayfong; Smithuis, Frank; Nosten, Francois; Pukrittayakamee, Sasithon; Day, Nicholas P J; Dondorp, Arjen M; Imwong, Mallika

    2018-01-11

    Genetic diversity of the three important antigenic proteins, namely thrombospondin-related anonymous protein (TRAP), apical membrane antigen 1 (AMA1), and 6-cysteine protein (P48/45), all of which are found in various developmental stages of Plasmodium parasites is crucial for targeted vaccine development. While studies related to the genetic diversity of these proteins are available for Plasmodium falciparum and Plasmodium vivax, barely enough information exists regarding Plasmodium malariae. The present study aims to demonstrate the genetic variations existing among these three genes in P. malariae by analysing their diversity at nucleotide and protein levels. Three surface protein genes were isolated from 45 samples collected in Thailand (N = 33), Myanmar (N = 8), and Lao PDR (N = 4), using conventional polymerase chain reaction (PCR) assay. Then, the PCR products were sequenced and analysed using BioEdit, MEGA6, and DnaSP programs. The average pairwise nucleotide diversities (π) of P. malariae trap, ama1, and p48/45 were 0.00169, 0.00413, and 0.00029, respectively. The haplotype diversities (Hd) of P. malariae trap, ama1, and p48/45 were 0.919, 0.946, and 0.130, respectively. Most of the nucleotide substitutions were non-synonymous, which indicated that the genetic variations of these genes were maintained by positive diversifying selection, thus, suggesting their role as a potential target of protective immune response. Amino acid substitutions of P. malariae TRAP, AMA1, and P48/45 could be categorized to 17, 20, and 2 unique amino-acid variants, respectively. For further vaccine development, carboxyl terminal of P48/45 would be a good candidate according to conserved amino acid at low genetic diversity (π = 0.2-0.3). High mutational diversity was observed in P. malariae trap and ama1 as compared to p48/45 in P. malariae samples isolated from Thailand, Myanmar, and Lao PDR. Taken together, these results suggest that P48/45 might be a good vaccine

  7. UDP-galactose and acetyl-CoA transporters as Plasmodium multidrug resistance genes.

    Science.gov (United States)

    Lim, Michelle Yi-Xiu; LaMonte, Gregory; Lee, Marcus C S; Reimer, Christin; Tan, Bee Huat; Corey, Victoria; Tjahjadi, Bianca F; Chua, Adeline; Nachon, Marie; Wintjens, René; Gedeck, Peter; Malleret, Benoit; Renia, Laurent; Bonamy, Ghislain M C; Ho, Paul Chi-Lui; Yeung, Bryan K S; Chow, Eric D; Lim, Liting; Fidock, David A; Diagana, Thierry T; Winzeler, Elizabeth A; Bifani, Pablo

    2016-09-19

    A molecular understanding of drug resistance mechanisms enables surveillance of the effectiveness of new antimicrobial therapies during development and deployment in the field. We used conventional drug resistance selection as well as a regime of limiting dilution at early stages of drug treatment to probe two antimalarial imidazolopiperazines, KAF156 and GNF179. The latter approach permits the isolation of low-fitness mutants that might otherwise be out-competed during selection. Whole-genome sequencing of 24 independently derived resistant Plasmodium falciparum clones revealed four parasites with mutations in the known cyclic amine resistance locus (pfcarl) and a further 20 with mutations in two previously unreported P. falciparum drug resistance genes, an acetyl-CoA transporter (pfact) and a UDP-galactose transporter (pfugt). Mutations were validated both in vitro by CRISPR editing in P. falciparum and in vivo by evolution of resistant Plasmodium berghei mutants. Both PfACT and PfUGT were localized to the endoplasmic reticulum by fluorescence microscopy. As mutations in pfact and pfugt conveyed resistance against additional unrelated chemical scaffolds, these genes are probably involved in broad mechanisms of antimalarial drug resistance.

  8. A re-assessment of gene-tag classification approaches for describing var gene expression patterns during human Plasmodium falciparum malaria parasite infections.

    Science.gov (United States)

    Githinji, George; Bull, Peter C

    2017-01-01

    PfEMP1 are variant parasite antigens that are inserted on the surface of Plasmodium falciparum infected erythrocytes (IE). Through interactions with various host molecules, PfEMP1 mediate IE sequestration in tissues and play a key role in the pathology of severe malaria. PfEMP1 is encoded by a diverse multi-gene family called var . Previous studies have shown that that expression of specific subsets of var genes are associated with low levels of host immunity and severe malaria. However, in most clinical studies to date, full-length var gene sequences were unavailable and various approaches have been used to make comparisons between var gene expression profiles in different parasite isolates using limited information. Several studies have relied on the classification of a 300 - 500 base-pair "DBLα tag" region in the DBLα domain located at the 5' end of most var genes. We assessed the relationship between various DBLα tag classification methods, and sequence features that are only fully assessable through full-length var gene sequences. We compared these different sequence features in full-length var gene from six fully sequenced laboratory isolates. These comparisons show that despite a long history of recombination,   DBLα sequence tag classification can provide functional information on important features of full-length var genes. Notably, a specific subset of DBLα tags previously defined as "group A-like" is associated with CIDRα1 domains proposed to bind to endothelial protein C receptor. This analysis helps to bring together different sources of data that have been used to assess var gene expression in clinical parasite isolates.

  9. Transcription status of vaccine candidate genes of Plasmodium falciparum during the hepatic phase of its life cycle.

    NARCIS (Netherlands)

    Bodescot, M.; Silvie, O.; Siau, A.; Refour, P.; Pino, P.; Franetich, J.F.; Hannoun, L.; Sauerwein, R.W.; Mazier, D.

    2004-01-01

    The CSP, EMP2/MESA, MSP2, MSP3, MSP5, RAP1, RAP2, RESA1, SERA1 and SSP2/TRAP genes of Plasmodium falciparum are vaccine candidates. The hepatic phase of the infection is of major interest due to the protection induced by immunization with radiation-attenuated sporozoites. We therefore performed

  10. NSR-seq transcriptional profiling enables identification of a gene signature of Plasmodium falciparum parasites infecting children

    OpenAIRE

    Vignali, Marissa; Armour, Christopher D.; Chen, Jingyang; Morrison, Robert; Castle, John C.; Biery, Matthew C.; Bouzek, Heather; Moon, Wonjong; Babak, Tomas; Fried, Michal; Raymond, Christopher K.; Duffy, Patrick E.

    2011-01-01

    Malaria caused by Plasmodium falciparum results in approximately 1 million annual deaths worldwide, with young children and pregnant mothers at highest risk. Disease severity might be related to parasite virulence factors, but expression profiling studies of parasites to test this hypothesis have been hindered by extensive sequence variation in putative virulence genes and a prep...

  11. Population genomics of the immune evasion (var genes of Plasmodium falciparum.

    Directory of Open Access Journals (Sweden)

    Alyssa E Barry

    2007-03-01

    Full Text Available Var genes encode the major surface antigen (PfEMP1 of the blood stages of the human malaria parasite Plasmodium falciparum. Differential expression of up to 60 diverse var genes in each parasite genome underlies immune evasion. We compared the diversity of the DBLalpha domain of var genes sampled from 30 parasite isolates from a malaria endemic area of Papua New Guinea (PNG and 59 from widespread geographic origins (global. Overall, we obtained over 8,000 quality-controlled DBLalpha sequences. Within our sampling frame, the global population had a total of 895 distinct DBLalpha "types" and negligible overlap among repertoires. This indicated that var gene diversity on a global scale is so immense that many genomes would need to be sequenced to capture its true extent. In contrast, we found a much lower diversity in PNG of 185 DBLalpha types, with an average of approximately 7% overlap among repertoires. While we identify marked geographic structuring, nearly 40% of types identified in PNG were also found in samples from different countries showing a cosmopolitan distribution for much of the diversity. We also present evidence to suggest that recombination plays a key role in maintaining the unprecedented levels of polymorphism found in these immune evasion genes. This population genomic framework provides a cost effective molecular epidemiological tool to rapidly explore the geographic diversity of var genes.

  12. Isolation and Characterization of Vaccine Candidate Genes Including CSP and MSP1 in Plasmodium yoelii.

    Science.gov (United States)

    Kim, Seon-Hee; Bae, Young-An; Seoh, Ju-Young; Yang, Hyun-Jong

    2017-06-01

    Malaria is an infectious disease affecting humans, which is transmitted by the bite of Anopheles mosquitoes harboring sporozoites of parasitic protozoans belonging to the genus Plasmodium . Despite past achievements to control the protozoan disease, malaria still remains a significant health threat up to now. In this study, we cloned and characterized the full-unit Plasmodium yoelii genes encoding merozoite surface protein 1 (MSP1), circumsporozoite protein (CSP), and Duffy-binding protein (DBP), each of which can be applied for investigations to obtain potent protective vaccines in the rodent malaria model, due to their specific expression patterns during the parasite life cycle. Recombinant fragments corresponding to the middle and C-terminal regions of PyMSP1 and PyCSP, respectively, displayed strong reactivity against P. yoelii -infected mice sera. Specific native antigens invoking strong humoral immune response during the primary and secondary infections of P. yoelii were also abundantly detected in experimental ICR mice. The low or negligible parasitemia observed in the secondary infected mice was likely to result from the neutralizing action of the protective antibodies. Identification of these antigenic proteins might provide the necessary information and means to characterize additional vaccine candidate antigens, selected solely on their ability to produce the protective antibodies.

  13. Variable number of tandem repeats of 9 Plasmodium vivax genes among Southeast Asian isolates.

    Science.gov (United States)

    Wang, Bo; Nyunt, Myat Htut; Yun, Seung-Gyu; Lu, Feng; Cheng, Yang; Han, Jin-Hee; Ha, Kwon-Soo; Park, Won Sun; Hong, Seok-Ho; Lim, Chae-Seung; Cao, Jun; Sattabongkot, Jetsumon; Kyaw, Myat Phone; Cui, Liwang; Han, Eun-Taek

    2017-06-01

    The variable number of tandem repeats (VNTRs) provides valuable information about both the functional and evolutionary aspects of genetic diversity. Comparative analysis of 3 Plasmodium falciparum genomes has shown that more than 9% of its open reading frames (ORFs) harbor VNTRs. Although microsatellites and VNTR genes of P. vivax were reported, the VNTR polymorphism of genes has not been examined widely. In this study, 230 P. vivax genes were analyzed for VNTRs by SERV, and 33 kinds of TR deletions or insertions from 29 P. vivax genes (12.6%) were found. Of these, 9 VNTR fragments from 8 P. vivax genes were used for PCR amplification and sequence analysis to examine the genetic diversity among 134 isolates from four Southeast Asian countries (China, Republic of Korea, Thailand, and Myanmar) with different malaria endemicity. We confirmed the existence of extensive polymorphism of VNTR fragments in field isolates. This detection provides several suitable markers for analysis of the molecular epidemiology of P. vivax field isolates. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Transcription of the var genes from a freshly-obtained field isolate of Plasmodium falciparum shows more variable switching patterns than long laboratory-adapted isolates.

    Science.gov (United States)

    Ye, Run; Zhang, Dongmei; Chen, Biaobang; Zhu, Yongqiang; Zhang, Yilong; Wang, Shengyue; Pan, Weiqing

    2015-02-07

    Antigenic variation in Plasmodium falciparum involves switching among multicopy var gene family and is responsible for immune evasion and the maintenance of chronic infections. Current understanding of var gene expression and switching patterns comes from experiments conducted on long laboratory-adapted strains, with little known about their wild counterparts. Genome sequencing was used to obtain 50 var genes from a parasite isolated from the China-Myanmar border. Four clones with different dominant var genes were cultured in vitro in replicates for 50 generations. Transcription of the individual var gene was detected by real-time PCR and then the switching process was analysed. The expression of multicopy var genes is mutually exclusive in clones of a wild P. falciparum isolate. The activation of distinct primary dominant var genes leads to different and favoured switching patterns in the four clones. The on/off rates of individual var genes are variable and the choice of subsequent dominant var genes are random, which results in the different switching patterns among replicates of each clonal wild P. falciparum isolate with near identical initial transcription profiles. This study suggests that the switching patterns of var genes are abundant, which consist of both conserved and random parts.

  15. Directional gene expression and antisense transcripts in sexual and asexual stages of Plasmodium falciparum

    Directory of Open Access Journals (Sweden)

    López-Barragán María J

    2011-11-01

    Full Text Available Abstract Background It has been shown that nearly a quarter of the initial predicted gene models in the Plasmodium falciparum genome contain errors. Although there have been efforts to obtain complete cDNA sequences to correct the errors, the coverage of cDNA sequences on the predicted genes is still incomplete, and many gene models for those expressed in sexual or mosquito stages have not been validated. Antisense transcripts have widely been reported in P. falciparum; however, the extent and pattern of antisense transcripts in different developmental stages remain largely unknown. Results We have sequenced seven bidirectional libraries from ring, early and late trophozoite, schizont, gametocyte II, gametocyte V, and ookinete, and four strand-specific libraries from late trophozoite, schizont, gametocyte II, and gametocyte V of the 3D7 parasites. Alignment of the cDNA sequences to the 3D7 reference genome revealed stage-specific antisense transcripts and novel intron-exon splicing junctions. Sequencing of strand-specific cDNA libraries suggested that more genes are expressed in one direction in gametocyte than in schizont. Alternatively spliced genes, antisense transcripts, and stage-specific expressed genes were also characterized. Conclusions It is necessary to continue to sequence cDNA from different developmental stages, particularly those of non-erythrocytic stages. The presence of antisense transcripts in some gametocyte and ookinete genes suggests that these antisense RNA may play an important role in gene expression regulation and parasite development. Future gene expression studies should make use of directional cDNA libraries. Antisense transcripts may partly explain the observed discrepancy between levels of mRNA and protein expression.

  16. Targeted disruption of a ring-infected erythrocyte surface antigen (RESA)-like export protein gene in Plasmodium falciparum confers stable chondroitin 4-sulfate cytoadherence capacity

    DEFF Research Database (Denmark)

    Goel, Suchi; Muthusamy, Arivalagan; Miao, Jun

    2014-01-01

    The Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family proteins mediate the adherence of infected erythrocytes to microvascular endothelia of various organs, including the placenta, thereby contributing to cerebral, placental, and other severe malaria pathogenesis. Several paras...

  17. A Cas9 transgenic Plasmodium yoelii parasite for efficient gene editing.

    Science.gov (United States)

    Qian, Pengge; Wang, Xu; Yang, Zhenke; Li, Zhenkui; Gao, Han; Su, Xin-Zhuan; Cui, Huiting; Yuan, Jing

    2018-06-01

    The RNA-guided endonuclease Cas9 has applied as an efficient gene-editing method in malaria parasite Plasmodium. However, the size (4.2 kb) of the commonly used Cas9 from Streptococcus pyogenes (SpCas9) limits its utility for genome editing in the parasites only introduced with cas9 plasmid. To establish the endogenous and constitutive expression of Cas9 protein in the rodent malaria parasite P. yoelii, we replaced the coding region of an endogenous gene sera1 with the intact SpCas9 coding sequence using the CRISPR/Cas9-mediated genome editing method, generating the cas9-knockin parasite (PyCas9ki) of the rodent malaria parasite P. yoelii. The resulted PyCas9ki parasite displays normal progression during the whole life cycle and possesses the Cas9 protein expression in asexual blood stage. By introducing the plasmid (pYCs) containing only sgRNA and homologous template elements, we successfully achieved both deletion and tagging modifications for different endogenous genes in the genome of PyCas9ki parasite. This cas9-knockin PyCas9ki parasite provides a new platform facilitating gene functions study in the rodent malaria parasite P. yoelii. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. Plasmodium chabaudi chabaudi malaria parasites can develop stable resistance to atovaquone with a mutation in the cytochrome b gene

    Directory of Open Access Journals (Sweden)

    Alves Ana C

    2010-05-01

    Full Text Available Abstract Background Plasmodium falciparum, has developed resistance to many of the drugs in use. The recommended treatment policy is now to use drug combinations. The atovaquone-proguanil (AP drug combination, is one of the treatment and prophylaxis options. Atovaquone (ATQ exerts its action by inhibiting plasmodial mitochondria electron transport at the level of the cytochrome bc1 complex. Plasmodium falciparum in vitro resistance to ATQ has been associated with specific point mutations in the region spanning codons 271-284 of the cytochrome b gene. ATQ -resistant Plasmodium yoelii and Plasmodium berghei lines have been obtained and resistant lines have amino acid mutations in their CYT b protein sequences. Plasmodium chabaudi model for studying drug-responses and drug-resistance selection is a very useful rodent malaria model but no ATQ resistant parasites have been reported so far. The aim of this study was to determine the ATQ sensitivity of the P. chabaudi clones, to select a resistant parasite line and to perform genotypic characterization of the cytb gene of these clones. Methods To select for ATQ resistance, Plasmodium. chabaudi chabaudi clones were exposed to gradually increasing concentrations of ATQ during several consecutive passages in mice. Plasmodium chabaudi cytb gene was amplified and sequenced. Results ATQ resistance was selected from the clone AS-3CQ. In order to confirm whether an heritable genetic mutation underlies the response of AS-ATQ to ATQ, the stability of the drug resistance phenotype in this clone was evaluated by measuring drug responses after (i multiple blood passages in the absence of the drug, (ii freeze/thawing of parasites in liquid nitrogen and (iii transmission through a mosquito host, Anopheles stephensi. ATQ resistance phenotype of the drug-selected parasite clone kept unaltered. Therefore, ATQ resistance in clone AS-ATQ is genetically encoded. The Minimum Curative Dose of AS-ATQ showed a six

  19. Comparative Plasmodium gene overexpression reveals distinct perturbation of sporozoite transmission by profilin.

    Science.gov (United States)

    Sato, Yuko; Hliscs, Marion; Dunst, Josefine; Goosmann, Christian; Brinkmann, Volker; Montagna, Georgina N; Matuschewski, Kai

    2016-07-15

    Plasmodium relies on actin-based motility to migrate from the site of infection and invade target cells. Using a substrate-dependent gliding locomotion, sporozoites are able to move at fast speed (1-3 μm/s). This motility relies on a minimal set of actin regulatory proteins and occurs in the absence of detectable filamentous actin (F-actin). Here we report an overexpression strategy to investigate whether perturbations of F-actin steady-state levels affect gliding locomotion and host invasion. We selected two vital Plasmodium berghei G-actin-binding proteins, C-CAP and profilin, in combination with three stage-specific promoters and mapped the phenotypes afforded by overexpression in all three extracellular motile stages. We show that in merozoites and ookinetes, additional expression does not impair life cycle progression. In marked contrast, overexpression of C-CAP and profilin in sporozoites impairs circular gliding motility and salivary gland invasion. The propensity for productive motility correlates with actin accumulation at the parasite tip, as revealed by combinations of an actin-stabilizing drug and transgenic parasites. Strong expression of profilin, but not C-CAP, resulted in complete life cycle arrest. Comparative overexpression is an alternative experimental genetic strategy to study essential genes and reveals effects of regulatory imbalances that are not uncovered from deletion-mutant phenotyping. © 2016 Sato et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  20. Plasmodium falciparum isolates from Angola show the StctVMNT haplotype in the pfcrt gene

    Science.gov (United States)

    2010-01-01

    Background Effective treatment remains a mainstay of malaria control, but it is unfortunately strongly compromised by drug resistance, particularly in Plasmodium falciparum, the most important human malaria parasite. Although P. falciparum chemoresistance is well recognized all over the world, limited data are available on the distribution and prevalence of pfcrt and pfmdr1 haplotypes that mediate resistance to commonly used drugs and that show distinct geographic differences. Methods Plasmodium falciparum-infected blood samples collected in 2007 at four municipalities of Luanda, Angola, were genotyped using PCR and direct DNA sequencing. Single nucleotide polymorphisms in the P. falciparum pfcrt and pfmdr1 genes were assessed and haplotype prevalences were determined. Results and Discussion The most prevalent pfcrt haplotype was StctVMNT (representing amino acids at codons 72-76). This result was unexpected, since the StctVMNT haplotype has previously been seen mainly in parasites from South America and India. The CVIET, CVMNT and CVINT drug-resistance haplotypes were also found, and one previously undescribed haplotype (CVMDT) was detected. Regarding pfmdr1, the most prevalent haplotype was YEYSNVD (representing amino acids at codons 86, 130, 184, 1034, 1042, 1109 and 1246). Wild haplotypes for pfcrt and pfmdr1 were uncommon; 3% of field isolates harbored wild type pfcrt (CVMNK), whereas 21% had wild type pfmdr1 (NEYSNVD). The observed predominance of the StctVMNT haplotype in Angola could be a result of frequent travel between Brazil and Angola citizens in the context of selective pressure of heavy CQ use. Conclusions The high prevalence of the pfcrt SVMNT haplotype and the pfmdr1 86Y mutation confirm high-level chloroquine resistance and might suggest reduced efficacy of amodiaquine in Angola. Further studies must be encouraged to examine the in vitro sensitivity of pfcrt SVMNT parasites to artesunate and amodiaquine for better conclusive data. PMID:20565881

  1. Transgenic mosquitoes expressing a phospholipase A(2 gene have a fitness advantage when fed Plasmodium falciparum-infected blood.

    Directory of Open Access Journals (Sweden)

    Ryan C Smith

    Full Text Available Genetically modified mosquitoes have been proposed as an alternative strategy to reduce the heavy burden of malaria. In recent years, several proof-of-principle experiments have been performed that validate the idea that mosquitoes can be genetically modified to become refractory to malaria parasite development.We have created two transgenic lines of Anophelesstephensi, a natural vector of Plasmodium falciparum, which constitutively secrete a catalytically inactive phospholipase A2 (mPLA2 into the midgut lumen to interfere with Plasmodium ookinete invasion. Our experiments show that both transgenic lines expressing mPLA2 significantly impair the development of rodent malaria parasites, but only one line impairs the development of human malaria parasites. In addition, when fed on malaria-infected blood, mosquitoes from both transgenic lines are more fecund than non-transgenic mosquitoes. Consistent with these observations, cage experiments with mixed populations of transgenic and non-transgenic mosquitoes show that the percentage of transgenic mosquitoes increases when maintained on Plasmodium-infected blood.Our results suggest that the expression of an anti-Plasmodium effector gene gives transgenic mosquitoes a fitness advantage when fed malaria-infected blood. These findings have important implications for future applications of transgenic mosquito technology in malaria control.

  2. Disruption of a Plasmodium falciparum gene linked to male sexual development causes early arrest in gametocytogenesis.

    Science.gov (United States)

    Furuya, Tetsuya; Mu, Jianbing; Hayton, Karen; Liu, Anna; Duan, Junhui; Nkrumah, Louis; Joy, Deirdre A; Fidock, David A; Fujioka, Hisashi; Vaidya, Akhil B; Wellems, Thomas E; Su, Xin-zhuan

    2005-11-15

    A male gametocyte defect in the Plasmodium falciparum Dd2 parasite was previously discovered through the observation that all progeny clones in a Dd2 x HB3 genetic cross were the result of fertilization events between Dd2 female and HB3 male gametes. A determinant linked to the defect in Dd2 was subsequently mapped to an 800-kb segment on chromosome 12. Here, we report further mapping of the determinant to an 82-kb region and the identification of a candidate gene, P. falciparum male development gene 1 (pfmdv-1), that is expressed at a lower level in Dd2 compared with the wild-type normal male gametocyte-producing ancestor W2. Pfmdv-1 protein is sexual-stage specific and is located on the gametocyte plasma membrane, parasitophorous vacuole membrane, and the membranes of cleft-like structures within the erythrocyte. Disruption of pfmdv-1 results in a dramatic reduction in mature gametocytes, especially functional male gametocytes, with the majority of sexually committed parasites developmentally arrested at stage I. The pfmdv-1-knockout parasites show disturbed membrane structures, particularly multimembrane vesicles/tubes that likely derive from deformed cleft-like structures. Mosquito infectivity of the knockout parasites was also greatly reduced but not completely lost. The results suggest that pfmdv-1 plays a key role in gametocyte membrane formation and integrity.

  3. Genetic diversity of the merozoite surface protein-3 gene in Plasmodium falciparum populations in Thailand.

    Science.gov (United States)

    Pattaradilokrat, Sittiporn; Sawaswong, Vorthon; Simpalipan, Phumin; Kaewthamasorn, Morakot; Siripoon, Napaporn; Harnyuttanakorn, Pongchai

    2016-10-21

    An effective malaria vaccine is an urgently needed tool to fight against human malaria, the most deadly parasitic disease of humans. One promising candidate is the merozoite surface protein-3 (MSP-3) of Plasmodium falciparum. This antigenic protein, encoded by the merozoite surface protein (msp-3) gene, is polymorphic and classified according to size into the two allelic types of K1 and 3D7. A recent study revealed that both the K1 and 3D7 alleles co-circulated within P. falciparum populations in Thailand, but the extent of the sequence diversity and variation within each allelic type remains largely unknown. The msp-3 gene was sequenced from 59 P. falciparum samples collected from five endemic areas (Mae Hong Son, Kanchanaburi, Ranong, Trat and Ubon Ratchathani) in Thailand and analysed for nucleotide sequence diversity, haplotype diversity and deduced amino acid sequence diversity. The gene was also subject to population genetic analysis (F st ) and neutrality tests (Tajima's D, Fu and Li D* and Fu and Li' F* tests) to determine any signature of selection. The sequence analyses revealed eight unique DNA haplotypes and seven amino acid sequence variants, with a haplotype and nucleotide diversity of 0.828 and 0.049, respectively. Neutrality tests indicated that the polymorphism detected in the alanine heptad repeat region of MSP-3 was maintained by positive diversifying selection, suggesting its role as a potential target of protective immune responses and supporting its role as a vaccine candidate. Comparison of MSP-3 variants among parasite populations in Thailand, India and Nigeria also inferred a close genetic relationship between P. falciparum populations in Asia. This study revealed the extent of the msp-3 gene diversity in P. falciparum in Thailand, providing the fundamental basis for the better design of future blood stage malaria vaccines against P. falciparum.

  4. TOLLIP gene variant is associated with Plasmodium vivax malaria in the Brazilian Amazon.

    Science.gov (United States)

    Brasil, Larissa W; Barbosa, Laila R A; de Araujo, Felipe J; da Costa, Allyson G; da Silva, Luan D O; Pinheiro, Suzana K; de Almeida, Anne C G; Kuhn, Andrea; Vitor-Silva, Sheila; de Melo, Gisely C; Monteiro, Wuelton M; de Lacerda, Marcus V G; Ramasawmy, Rajendranath

    2017-03-13

    Toll-interacting protein is a negative regulator in the TLR signaling cascade, particularly by impeding the TLR2 and, TLR4 pathway. Recently, TOLLIP was shown to regulate human TLR signaling pathways. Two common TOLLIP polymorphisms (rs5743899 and rs3750920) were reported to be influencing IL-6, TNF and IL-10 expression. In this study, TOLLIP variants were investigated to their relation to Plasmodium vivax malaria in the Brazilian Amazon. This cohort study was performed in the municipalities of Careiro and, Manaus, in Western Brazilian Amazon. A total of 319 patients with P. vivax malaria and, 263 healthy controls with no previous history of malaria were included in the study. Genomic DNA was extracted from blood collected on filter paper, using the QIAamp ® DNA Mini Kit, according to the manufacturer's suggested protocol. The rs5743899 and rs3750920 polymorphisms of the TOLLIP gene were typed by PCR-RFLP. Homozygous individuals for the rs3750920 T allele gene had twice the risk of developing malaria when compared to individuals homozygous for the C allele (OR 2.0 [95% CI 1.23-3.07]; p = 0.004). In the dominant model, carriers the C allele indicates protection to malaria, carriers of the C allele were compared to individuals with the T allele, and the difference is highly significant (OR 0.52 [95% CI 0.37-0.76]; p = 0.0006). The linkage disequilibrium between the two polymorphisms was weak (r 2  = 0.037; D' = 0.27). These findings suggest that genes involved in the TLRs-pathway may be involved in malaria susceptibility. The association of the TOLLIP rs3750920 T allele with susceptibility to malaria further provides evidence that genetic variations in immune response genes may predispose individuals to malaria.

  5. The ETRAMP family member SEP2 is expressed throughout Plasmodium berghei life cycle and is released during sporozoite gliding motility.

    Science.gov (United States)

    Currà, Chiara; Di Luca, Marco; Picci, Leonardo; de Sousa Silva Gomes dos Santos, Carina; Siden-Kiamos, Inga; Pace, Tomasino; Ponzi, Marta

    2013-01-01

    The early transcribed membrane proteins ETRAMPs belong to a family of small, transmembrane molecules unique to Plasmodium parasite, which share a signal peptide followed by a short lysine-rich stretch, a transmembrane domain and a variable, highly charged C-terminal region. ETRAMPs are usually expressed in a stage-specific manner. In the blood stages they localize to the parasitophorous vacuole membrane and, in described cases, to vesicle-like structures exported to the host erythrocyte cytosol. Two family members of the rodent parasite Plasmodium berghei, uis3 and uis4, localize to secretory organelles of sporozoites and to the parasitophorous membrane vacuole of the liver stages. By the use of specific antibodies and the generation of transgenic lines, we showed that the P. berghei ETRAMP family member SEP2 is abundantly expressed in gametocytes as well as in mosquito and liver stages. In intracellular parasite stages, SEP2 is routed to the parasitophorous vacuole membrane while, in invasive ookinete and sporozoite stages, it localizes to the parasite surface. To date SEP2 is the only ETRAMP protein detected throughout the parasite life cycle. Furthermore, SEP2 is also released during gliding motility of salivary gland sporozoites. A limited number of proteins are known to be involved in this key function and the best characterized, the CSP and TRAP, are both promising transmission-blocking candidates. Our results suggest that ETRAMP members may be viewed as new potential candidates for malaria control.

  6. Positive Selection of Plasmodium falciparum Parasites With Multiple var2csa-Type PfEMP1 Genes During the Course of Infection in Pregnant Women

    Science.gov (United States)

    Salanti, Ali; Lavstsen, Thomas; Nielsen, Morten A.; Theander, Thor G.; Leke, Rose G. F.; Lo, Yeung Y.; Bobbili, Naveen; Arnot, David E.; Taylor, Diane W.

    2011-01-01

    Placental malaria infections are caused by Plasmodium falciparum–infected red blood cells sequestering in the placenta by binding to chondroitin sulfate A, mediated by VAR2CSA, a variant of the PfEMP1 family of adhesion antigens. Recent studies have shown that many P. falciparum genomes have multiple genes coding for different VAR2CSA proteins, and parasites with >1 var2csa gene appear to be more common in pregnant women with placental malaria than in nonpregnant individuals. We present evidence that, in pregnant women, parasites containing multiple var2csa-type genes possess a selective advantage over parasites with a single var2csa gene. Accumulation of parasites with multiple copies of the var2csa gene during the course of pregnancy was also correlated with the development of antibodies involved in blocking VAR2CSA adhesion. The data suggest that multiplicity of var2csa-type genes enables P. falciparum parasites to persist for a longer period of time during placental infections, probably because of their greater capacity for antigenic variation and evasion of variant-specific immune responses. PMID:21592998

  7. Mutations in Plasmodium falciparum K13 propeller gene from Bangladesh (2009-2013).

    Science.gov (United States)

    Mohon, Abu Naser; Alam, Mohammad Shafiul; Bayih, Abebe Genetu; Folefoc, Asongna; Shahinas, Dea; Haque, Rashidul; Pillai, Dylan R

    2014-11-18

    Bangladesh is a malaria hypo-endemic country sharing borders with India and Myanmar. Artemisinin combination therapy (ACT) remains successful in Bangladesh. An increase of artemisinin-resistant malaria parasites on the Thai-Cambodia and Thai-Myanmar borders is worrisome. K13 propeller gene (PF3D7_1343700 or PF13_0238) mutations have been linked to both in vitro artemisinin resistance and in vivo slow parasite clearance rates. This group undertook to evaluate if mutations seen in Cambodia have emerged in Bangladesh where ACT use is now standard for a decade. Samples were obtained from Plasmodium falciparum-infected malaria patients from Upazila health complexes (UHC) between 2009 and 2013 in seven endemic districts of Bangladesh. These districts included Khagrachari (Matiranga UHC), Rangamati (Rajasthali UHC), Cox's Bazar (Ramu and Ukhia UHC), Bandarban (Lama UHC), Mymensingh (Haluaghat UHC), Netrokona (Durgapur and Kalmakanda UHC), and Moulvibazar (Sreemangal and Kamalganj UHC). Out of 296 microscopically positive P. falciparum samples, 271 (91.6%) were confirmed as mono-infections by both real-time PCR and nested PCR. The K13 propeller gene from 253 (93.4%) samples was sequenced bi-directionally. One non-synonymous mutation (A578S) was found in Bangladeshi clinical isolates. The A578S mutation was confirmed and lies adjacent to the C580Y mutation, the major mutation causing delayed parasite clearance in Cambodia. Based on computational modeling A578S should have a significant effect on tertiary structure of the protein. The data suggest that P. falciparum in Bangladesh remains free of the C580Y mutation linked to delayed parasite clearance. However, the mutation A578S is present and based on structural analysis could affect K13 gene function. Further in vivo clinical studies are required to validate the effect of this mutation.

  8. Expressed var gene repertoire and variant surface antigen diversity in a shrinking Plasmodium falciparum population.

    Science.gov (United States)

    Carlos, Bianca C; Fotoran, Wesley L; Menezes, Maria J; Cabral, Fernanda J; Bastos, Marcele F; Costa, Fabio T M; Sousa-Neto, Jayme A; Ribolla, Paulo E M; Wunderlich, Gerhard; Ferreira, Marcelo U

    2016-11-01

    The var gene-encoded erythrocyte membrane protein-1 of Plasmodium falciparum (PfEMP-1) is the main variant surface antigen (VSA) expressed on infected erythrocytes. The rate at which antibody responses to VSA expressed by circulating parasites are acquired depends on the size of the local VSA repertoire and the frequency of exposure to new VSA. Because parasites from areas with declining malaria endemicity, such as the Amazon, typically express a restricted PfEMP-1 repertoire, we hypothesized that Amazonians would rapidly acquire antibodies to most locally circulating VSA. Consistent with our expectations, the analysis of 5878 sequence tags expressed by 10 local P. falciparum samples revealed little PfEMP-1 DBL1α domain diversity. Among the most commonly expressed DBL1α types, 45% were shared by two or more independent parasite lines. Nevertheless, Amazonians displayed major gaps in their repertoire of anti-VSA antibodies, although the breadth of anti-VSA antibody responses correlated positively with their cumulative exposure to malaria. We found little antibody cross-reactivity even when testing VSA from related parasites expressing the same dominant DBL1α types. We conclude that variant-specific immunity to P. falciparum VSAs develops slowly despite the relatively restricted PfEMP-1 repertoire found in low-endemicity settings. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Mefloquine resistance in Plasmodium falciparum and increased pfmdr1 gene copy number.

    Science.gov (United States)

    Price, Ric N; Uhlemann, Anne-Catrin; Brockman, Alan; McGready, Rose; Ashley, Elizabeth; Phaipun, Lucy; Patel, Rina; Laing, Kenneth; Looareesuwan, Sornchai; White, Nicholas J; Nosten, François; Krishna, Sanjeev

    The borders of Thailand harbour the world's most multidrug resistant Plasmodium falciparum parasites. In 1984 mefloquine was introduced as treatment for uncomplicated falciparum malaria, but substantial resistance developed within 6 years. A combination of artesunate with mefloquine now cures more than 95% of acute infections. For both treatment regimens, the underlying mechanisms of resistance are not known. The relation between polymorphisms in the P falciparum multidrug resistant gene 1 (pfmdr1) and the in-vitro and in-vivo responses to mefloquine were assessed in 618 samples from patients with falciparum malaria studied prospectively over 12 years. pfmdr1 copy number was assessed by a robust real-time PCR assay. Single nucleotide polymorphisms of pfmdr1, P falciparum chloroquine resistance transporter gene (pfcrt) and P falciparum Ca2+ ATPase gene (pfATP6) were assessed by PCR-restriction fragment length polymorphism. Increased copy number of pfmdr1 was the most important determinant of in-vitro and in-vivo resistance to mefloquine, and also to reduced artesunate sensitivity in vitro. In a Cox regression model with control for known confounders, increased pfmdr1 copy number was associated with an attributable hazard ratio (AHR) for treatment failure of 6.3 (95% CI 2.9-13.8, p<0.001) after mefloquine monotherapy and 5.4 (2.0-14.6, p=0.001) after artesunate-mefloquine therapy. Single nucleotide polymorphisms in pfmdr1 were associated with increased mefloquine susceptibility in vitro, but not in vivo. Amplification in pfmdr1 is the main cause of resistance to mefloquine in falciparum malaria. Multidrug resistant P falciparum malaria is common in southeast Asia, but difficult to identify and treat. Genes that encode parasite transport proteins maybe involved in export of drugs and so cause resistance. In this study we show that increase in copy number of pfmdr1, a gene encoding a parasite transport protein, is the best overall predictor of treatment failure with

  10. Partial Sequence Analysis of Merozoite Surface Proteine-3α Gene in Plasmodium vivax Isolates from Malarious Areas of Iran

    Directory of Open Access Journals (Sweden)

    H Mirhendi

    2008-12-01

    Full Text Available Background: Approximately 85-90% of malaria infections in Iran are attributed to Plasmodium vivax, while little is known about the genetic of the parasite and its strain types in this region. This study was designed and performed for describing genetic characteristics of Plasmodium vivax population of Iran based on the merozoite surface protein-3α gene sequence. Methods: Through a descriptive study we analyzed partial P. vivax merozoite surface protein-3α gene sequences from 17 clinical P. vivax isolates collected from malarious areas of Iran. Genomic DNA was extracted by Q1Aamp® DNA blood mini kit, amplified through nested PCR for a partial nucleotide sequence of PvMSP-3 gene in P. vivax. PCR-amplified products were sequenced with an ABI Prism Perkin-Elmer 310 sequencer machine and the data were analyzed with clustal W software. Results: Analysis of PvMSP-3 gene sequences demonstrated extensive polymorphisms, but the sequence identity between isolates of same types was relatively high. We identified specific insertions and deletions for the types A, B and C variants of P. vivax in our isolates. In phylogenetic comparison of geographically separated isolates, there was not a significant geo­graphical branching of the parasite populations. Conclusion: The highly polymorphic nature of isolates suggests that more investigations of the PvMSP-3 gene are needed to explore its vaccine potential.

  11. Homology blocks of Plasmodium falciparum var genes and clinically distinct forms of severe malaria in a local population.

    Science.gov (United States)

    Rorick, Mary M; Rask, Thomas S; Baskerville, Edward B; Day, Karen P; Pascual, Mercedes

    2013-11-06

    The primary target of the human immune response to the malaria parasite Plasmodium falciparum, P. falciparum erythrocyte membrane protein 1 (PfEMP1), is encoded by the members of the hyper-diverse var gene family. The parasite exhibits antigenic variation via mutually exclusive expression (switching) of the ~60 var genes within its genome. It is thought that different variants exhibit different host endothelial binding preferences that in turn result in different manifestations of disease. Var sequences comprise ancient sequence fragments, termed homology blocks (HBs), that recombine at exceedingly high rates. We use HBs to define distinct var types within a local population. We then reanalyze a dataset that contains clinical and var expression data to investigate whether the HBs allow for a description of sequence diversity corresponding to biological function, such that it improves our ability to predict disease phenotype from parasite genetics. We find that even a generic set of HBs, which are defined for a small number of non-local parasites: capture the majority of local sequence diversity; improve our ability to predict disease severity from parasite genetics; and reveal a previously hypothesized yet previously unobserved parasite genetic basis for two forms of severe disease. We find that the expression rates of some HBs correlate more strongly with severe disease phenotypes than the expression rates of classic var DBLα tag types, and principal components of HB expression rate profiles further improve genotype-phenotype models. More specifically, within the large Kenyan dataset that is the focus of this study, we observe that HB expression differs significantly for severe versus mild disease, and for rosetting versus impaired consciousness associated severe disease. The analysis of a second much smaller dataset from Mali suggests that these HB-phenotype associations are consistent across geographically distant populations, since we find evidence suggesting

  12. Dynamic epigenetic regulation of gene expression during the life cycle of malaria parasite Plasmodium falciparum.

    Directory of Open Access Journals (Sweden)

    Archna P Gupta

    2013-02-01

    Full Text Available Epigenetic mechanisms are emerging as one of the major factors of the dynamics of gene expression in the human malaria parasite, Plasmodium falciparum. To elucidate the role of chromatin remodeling in transcriptional regulation associated with the progression of the P. falciparum intraerythrocytic development cycle (IDC, we mapped the temporal pattern of chromosomal association with histone H3 and H4 modifications using ChIP-on-chip. Here, we have generated a broad integrative epigenomic map of twelve histone modifications during the P. falciparum IDC including H4K5ac, H4K8ac, H4K12ac, H4K16ac, H3K9ac, H3K14ac, H3K56ac, H4K20me1, H4K20me3, H3K4me3, H3K79me3 and H4R3me2. While some modifications were found to be associated with the vast majority of the genome and their occupancy was constant, others showed more specific and highly dynamic distribution. Importantly, eight modifications displaying tight correlations with transcript levels showed differential affinity to distinct genomic regions with H4K8ac occupying predominantly promoter regions while others occurred at the 5' ends of coding sequences. The promoter occupancy of H4K8ac remained unchanged when ectopically inserted at a different locus, indicating the presence of specific DNA elements that recruit histone modifying enzymes regardless of their broad chromatin environment. In addition, we showed the presence of multivalent domains on the genome carrying more than one histone mark, highlighting the importance of combinatorial effects on transcription. Overall, our work portrays a substantial association between chromosomal locations of various epigenetic markers, transcriptional activity and global stage-specific transitions in the epigenome.

  13. Dynamic epigenetic regulation of gene expression during the life cycle of malaria parasite Plasmodium falciparum.

    Science.gov (United States)

    Gupta, Archna P; Chin, Wai Hoe; Zhu, Lei; Mok, Sachel; Luah, Yen-Hoon; Lim, Eng-How; Bozdech, Zbynek

    2013-02-01

    Epigenetic mechanisms are emerging as one of the major factors of the dynamics of gene expression in the human malaria parasite, Plasmodium falciparum. To elucidate the role of chromatin remodeling in transcriptional regulation associated with the progression of the P. falciparum intraerythrocytic development cycle (IDC), we mapped the temporal pattern of chromosomal association with histone H3 and H4 modifications using ChIP-on-chip. Here, we have generated a broad integrative epigenomic map of twelve histone modifications during the P. falciparum IDC including H4K5ac, H4K8ac, H4K12ac, H4K16ac, H3K9ac, H3K14ac, H3K56ac, H4K20me1, H4K20me3, H3K4me3, H3K79me3 and H4R3me2. While some modifications were found to be associated with the vast majority of the genome and their occupancy was constant, others showed more specific and highly dynamic distribution. Importantly, eight modifications displaying tight correlations with transcript levels showed differential affinity to distinct genomic regions with H4K8ac occupying predominantly promoter regions while others occurred at the 5' ends of coding sequences. The promoter occupancy of H4K8ac remained unchanged when ectopically inserted at a different locus, indicating the presence of specific DNA elements that recruit histone modifying enzymes regardless of their broad chromatin environment. In addition, we showed the presence of multivalent domains on the genome carrying more than one histone mark, highlighting the importance of combinatorial effects on transcription. Overall, our work portrays a substantial association between chromosomal locations of various epigenetic markers, transcriptional activity and global stage-specific transitions in the epigenome.

  14. Independent Origin and Global Distribution of Distinct Plasmodium vivax Duffy Binding Protein Gene Duplications.

    Directory of Open Access Journals (Sweden)

    Jessica B Hostetler

    2016-10-01

    Full Text Available Plasmodium vivax causes the majority of malaria episodes outside Africa, but remains a relatively understudied pathogen. The pathology of P. vivax infection depends critically on the parasite's ability to recognize and invade human erythrocytes. This invasion process involves an interaction between P. vivax Duffy Binding Protein (PvDBP in merozoites and the Duffy antigen receptor for chemokines (DARC on the erythrocyte surface. Whole-genome sequencing of clinical isolates recently established that some P. vivax genomes contain two copies of the PvDBP gene. The frequency of this duplication is particularly high in Madagascar, where there is also evidence for P. vivax infection in DARC-negative individuals. The functional significance and global prevalence of this duplication, and whether there are other copy number variations at the PvDBP locus, is unknown.Using whole-genome sequencing and PCR to study the PvDBP locus in P. vivax clinical isolates, we found that PvDBP duplication is widespread in Cambodia. The boundaries of the Cambodian PvDBP duplication differ from those previously identified in Madagascar, meaning that current molecular assays were unable to detect it. The Cambodian PvDBP duplication did not associate with parasite density or DARC genotype, and ranged in prevalence from 20% to 38% over four annual transmission seasons in Cambodia. This duplication was also present in P. vivax isolates from Brazil and Ethiopia, but not India.PvDBP duplications are much more widespread and complex than previously thought, and at least two distinct duplications are circulating globally. The same duplication boundaries were identified in parasites from three continents, and were found at high prevalence in human populations where DARC-negativity is essentially absent. It is therefore unlikely that PvDBP duplication is associated with infection of DARC-negative individuals, but functional tests will be required to confirm this hypothesis.

  15. Genetic diversity and natural selection of Plasmodium knowlesi merozoite surface protein 1 paralog gene in Malaysia.

    Science.gov (United States)

    Ahmed, Md Atique; Fauzi, Muh; Han, Eun-Taek

    2018-03-14

    Human infections due to the monkey malaria parasite Plasmodium knowlesi is on the rise in most Southeast Asian countries specifically Malaysia. The C-terminal 19 kDa domain of PvMSP1P is a potential vaccine candidate, however, no study has been conducted in the orthologous gene of P. knowlesi. This study investigates level of polymorphisms, haplotypes and natural selection of full-length pkmsp1p in clinical samples from Malaysia. A total of 36 full-length pkmsp1p sequences along with the reference H-strain and 40 C-terminal pkmsp1p sequences from clinical isolates of Malaysia were downloaded from published genomes. Genetic diversity, polymorphism, haplotype and natural selection were determined using DnaSP 5.10 and MEGA 5.0 software. Genealogical relationships were determined using haplotype network tree in NETWORK software v5.0. Population genetic differentiation index (F ST ) and population structure of parasite was determined using Arlequin v3.5 and STRUCTURE v2.3.4 software. Comparison of 36 full-length pkmsp1p sequences along with the H-strain identified 339 SNPs (175 non-synonymous and 164 synonymous substitutions). The nucleotide diversity across the full-length gene was low compared to its ortholog pvmsp1p. The nucleotide diversity was higher toward the N-terminal domains (pkmsp1p-83 and 30) compared to the C-terminal domains (pkmsp1p-38, 33 and 19). Phylogenetic analysis of full-length genes identified 2 distinct clusters of P. knowlesi from Malaysian Borneo. The 40 pkmsp1p-19 sequences showed low polymorphisms with 16 polymorphisms leading to 18 haplotypes. In total there were 10 synonymous and 6 non-synonymous substitutions and 12 cysteine residues were intact within the two EGF domains. Evidence of strong purifying selection was observed within the full-length sequences as well in all the domains. Shared haplotypes of 40 pkmsp1p-19 were identified within Malaysian Borneo haplotypes. This study is the first to report on the genetic diversity and natural

  16. The A581G Mutation in the Gene Encoding Plasmodium falciparum Dihydropteroate Synthetase Reduces the Effectiveness of Sulfadoxine-Pyrimethamine Preventive Therapy in Malawian Pregnant Women

    NARCIS (Netherlands)

    Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.

    2015-01-01

    Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased

  17. Gene disruption of Plasmodium falciparum p52 results in attenuation of malaria liver stage development in cultured primary human hepatocytes.

    Directory of Open Access Journals (Sweden)

    Ben C L van Schaijk

    Full Text Available Difficulties with inducing sterile and long lasting protective immunity against malaria with subunit vaccines has renewed interest in vaccinations with attenuated Plasmodium parasites. Immunizations with sporozoites that are attenuated by radiation (RAS can induce strong protective immunity both in humans and rodent models of malaria. Recently, in rodent parasites it has been shown that through the deletion of a single gene, sporozoites can also become attenuated in liver stage development and, importantly, immunization with these sporozoites results in immune responses identical to RAS. The promise of vaccination using these genetically attenuated sporozoites (GAS depends on translating the results in rodent malaria models to human malaria. In this study, we perform the first essential step in this transition by disrupting, p52, in P. falciparum an ortholog of the rodent parasite gene, p36p, which we had previously shown can confer long lasting protective immunity in mice. These P. falciparum P52 deficient sporozoites demonstrate gliding motility, cell traversal and an invasion rate into primary human hepatocytes in vitro that is comparable to wild type sporozoites. However, inside the host hepatocyte development is arrested very soon after invasion. This study reveals, for the first time, that disrupting the equivalent gene in both P. falciparum and rodent malaria Plasmodium species generates parasites that become similarly arrested during liver stage development and these results pave the way for further development of GAS for human use.

  18. Genetic diversity of the msp-1, msp-2, and glurp genes of Plasmodium falciparum isolates along the Thai-Myanmar borders.

    Science.gov (United States)

    Congpuong, Kanungnit; Sukaram, Rungniran; Prompan, Yuparat; Dornae, Aibteesam

    2014-08-01

    To study the genetic diversity at the msp-1, msp-2, and glurp genes of Plasmodium falciparum (P. falciparum) isolates from 3 endemic areas in Thailand: Tak, Kanchanaburi and Ranong provinces. A total of 144 P. falciparum isolates collected prior to treatment during January, 2012 to June, 2013 were genotyped. DNA was extracted; allele frequency and diversity of msp-1, msp-2, and glurp genes were investigated by nested polymerase chain reaction. P. falciparum isolates in this study had high rate of multiple genotypes infection (96.5%) with an overall mean multiplicity of infection of 3.21. The distribution of allelic families of msp-1 was significantly different among isolates from Tak, Kanchanaburi, and Ranong but not for the msp-2. K1 and MAD20 were the predominant allelic families at the msp-1 gene, whereas alleles belonging to 3D7 were more frequent at the msp-2 gene. The glurp gene had the least diverse alleles. Population structure of P. falciparum isolates from Tak and Ranong was quite similar as revealed by the presence of similar proportions of MAD20 and K1 alleles at msp-1 loci, 3D7 and FC27 alleles at msp-2 loci as well as comparable mean MOI. Isolates from Kanchanaburi had different structures; the most prevalent alleles were K1 and RO33. The present study shows that P. falciparum isolates from Tak and Ranong provinces had similar allelic pattern of msp-1 and msp-2 and diversity but different from Kanchanaburi isolates. These allelic variant profiles are valuable baseline data for future epidemiological study of malaria transmission and for continued monitoring of polymorphisms associated with antimalarial drug resistance in these areas.

  19. From In Vivo to In Vitro: Dynamic Analysis of Plasmodium falciparum var Gene Expression Patterns of Patient Isolates during Adaptation to Culture

    Science.gov (United States)

    Huang, Yufu; Xue, Xiangyang; Yan, He; Sun, Xiaodong; Wang, Jian; McCutchan, Thomas F.; Pan, Weiqing

    2011-01-01

    Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1), encoded by the var gene family, plays a crucial role in disease virulence through its involvement in binding to various host cellular receptors during infection. Growing evidence suggests that differential expression of the various var subgroups may be involved in parasite virulence. To further explore this issue, we have collected isolates from symptomatic patients in south China-Myanmar border, and characterized their sequence diversity and transcription profiles over time of var gene family, and cytoadherence properties from the time of their initial collection and extending through a two month period of adaptation to culture. Initially, we established a highly diverse, DBLα (4 cysteines) subtype-enriched, but unique local repertoire of var-DBL1α sequences by cDNA cloning and sequencing. Next we observed a rapid transcriptional decline of upsA- and upsB-subtype var genes at ring stage through qRT-PCR assays, and a switching event from initial ICAM-I binding to the CD36-binding activity during the first week of adaptive cultivation in vitro. Moreover, predominant transcription of upsA var genes was observed to be correlated with those isolates that showed a higher parasitemia at the time of collection and the ICAM-1-binding phenotype in culture. Taken together, these data indicate that the initial stage of adaptive process in vitro significantly influences the transcription of virulence-related var subtypes and expression of PfEMP1 variants. Further, the specific upregulation of the upsA var genes is likely linked to the rapid propagation of the parasite during natural infection due to the A-type PfEMP1 variant-mediated growth advantages. PMID:21674009

  20. Gene expression changes in the salivary glands of Anopheles coluzzii elicited by Plasmodium berghei infection

    Czech Academy of Sciences Publication Activity Database

    Pinheiro-Silva, R.; Borges, L.; Coelho, L.P.; Cabezas-Cruz, A.; Valdés, James J.; do Rosário, V.; de la Fuente, J.; Domingos, A.

    2015-01-01

    Roč. 8, SEP 23 2015 (2015), s. 485 ISSN 1756-3305 Institutional support: RVO:60077344 Keywords : Anopheles coluzzii * Salivary glands * Plasmodium berghei * Sporozoite * RNA-seq * Glucose transporter * RNAi Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.234, year: 2015

  1. The ACBP gene family in Rhodnius prolixus

    DEFF Research Database (Denmark)

    Majerowicz, David; Hannibal-Bach, Hans K; Castro, Rodolfo S C

    2016-01-01

    The acyl-CoA-binding proteins (ACBP) constitute a family of conserved proteins that bind acyl-CoA with high affinity and protect it from hydrolysis. Thus, ACBPs may have essential roles in basal cellular lipid metabolism. The genome of the insect Rhodnius prolixus encodes five ACBP genes similar...

  2. Temperature shift and host cell contact up-regulate sporozoite expression of Plasmodium falciparum genes involved in hepatocyte infection.

    Directory of Open Access Journals (Sweden)

    Anthony Siau

    Full Text Available Plasmodium sporozoites are deposited in the skin by Anopheles mosquitoes. They then find their way to the liver, where they specifically invade hepatocytes in which they develop to yield merozoites infective to red blood cells. Relatively little is known of the molecular interactions during these initial obligatory phases of the infection. Recent data suggested that many of the inoculated sporozoites invade hepatocytes an hour or more after the infective bite. We hypothesised that this pre-invasive period in the mammalian host prepares sporozoites for successful hepatocyte infection. Therefore, the genes whose expression becomes modified prior to hepatocyte invasion would be those likely to code for proteins implicated in the subsequent events of invasion and development. We have used P. falciparum sporozoites and their natural host cells, primary human hepatocytes, in in vitro co-culture system as a model for the pre-invasive period. We first established that under co-culture conditions, sporozoites maintain infectivity for an hour or more, in contrast to a drastic loss in infectivity when hepatocytes were not included. Thus, a differential transcriptome of salivary gland sporozoites versus sporozoites co-cultured with hepatocytes was established using a pan-genomic P. falciparum microarray. The expression of 532 genes was found to have been up-regulated following co-culture. A fifth of these genes had no orthologues in the genomes of Plasmodium species used in rodent models of malaria. Quantitative RT-PCR analysis of a selection of 21 genes confirmed the reliability of the microarray data. Time-course analysis further indicated two patterns of up-regulation following sporozoite co-culture, one transient and the other sustained, suggesting roles in hepatocyte invasion and liver stage development, respectively. This was supported by functional studies of four hitherto uncharacterized proteins of which two were shown to be sporozoite surface

  3. Genetic polymorphisms in Plasmodium falciparum chloroquine resistance genes, pfcrt and pfmdr1, in North Sulawesi, Indonesia

    OpenAIRE

    Reteng, Patrick; Vrisca, Visia; Sukarno, Inka; Djarkoni, Ilham Habib; Kalangi, Jane Angela; Jacobs, George Eduardo; Runtuwene, Lucky Ronald; Eshita, Yuki; Maeda, Ryuichiro; Suzuki, Yutaka; Mongan, Arthur Elia; Warouw, Sarah Maria; Yamagishi, Junya; Tuda, Josef

    2017-01-01

    Background Malaria still poses one of the major threats to human health. Development of effective antimalarial drugs has decreased this threat; however, the emergence of drug-resistant Plasmodium falciparum, a cause of Malaria, is disconcerting. The antimalarial drug chloroquine has been effectively used, but resistant parasites have spread worldwide. Interestingly, the withdrawal of the drug reportedly leads to an increased population of susceptible parasites in some cases. We examined the p...

  4. The Eucalyptus terpene synthase gene family.

    Science.gov (United States)

    Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J

    2015-06-11

    Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.

  5. Phylogeography of var gene repertoires reveals fine-scale geospatial clustering of Plasmodium falciparum populations in a highly endemic area.

    Science.gov (United States)

    Tessema, Sofonias K; Monk, Stephanie L; Schultz, Mark B; Tavul, Livingstone; Reeder, John C; Siba, Peter M; Mueller, Ivo; Barry, Alyssa E

    2015-01-01

    Plasmodium falciparum malaria is a major global health problem that is being targeted for progressive elimination. Knowledge of local disease transmission patterns in endemic countries is critical to these elimination efforts. To investigate fine-scale patterns of malaria transmission, we have compared repertoires of rapidly evolving var genes in a highly endemic area. A total of 3680 high-quality DBLα-sequences were obtained from 68 P. falciparum isolates from ten villages spread over two distinct catchment areas on the north coast of Papua New Guinea (PNG). Modelling of the extent of var gene diversity in the two parasite populations predicts more than twice as many var gene alleles circulating within each catchment (Mugil = 906; Wosera = 1094) than previously recognized in PNG (Amele = 369). In addition, there were limited levels of var gene sharing between populations, consistent with local parasite population structure. Phylogeographic analyses demonstrate that while neutrally evolving microsatellite markers identified population structure only at the catchment level, var gene repertoires reveal further fine-scale geospatial clustering of parasite isolates. The clustering of parasite isolates by village in Mugil, but not in Wosera was consistent with the physical and cultural isolation of the human populations in the two catchments. The study highlights the microheterogeneity of P. falciparum transmission in highly endemic areas and demonstrates the potential of var genes as markers of local patterns of parasite population structure. © 2014 John Wiley & Sons Ltd.

  6. The human protein disulfide isomerase gene family

    Directory of Open Access Journals (Sweden)

    Galligan James J

    2012-07-01

    Full Text Available Abstract Enzyme-mediated disulfide bond formation is a highly conserved process affecting over one-third of all eukaryotic proteins. The enzymes primarily responsible for facilitating thiol-disulfide exchange are members of an expanding family of proteins known as protein disulfide isomerases (PDIs. These proteins are part of a larger superfamily of proteins known as the thioredoxin protein family (TRX. As members of the PDI family of proteins, all proteins contain a TRX-like structural domain and are predominantly expressed in the endoplasmic reticulum. Subcellular localization and the presence of a TRX domain, however, comprise the short list of distinguishing features required for gene family classification. To date, the PDI gene family contains 21 members, varying in domain composition, molecular weight, tissue expression, and cellular processing. Given their vital role in protein-folding, loss of PDI activity has been associated with the pathogenesis of numerous disease states, most commonly related to the unfolded protein response (UPR. Over the past decade, UPR has become a very attractive therapeutic target for multiple pathologies including Alzheimer disease, Parkinson disease, alcoholic and non-alcoholic liver disease, and type-2 diabetes. Understanding the mechanisms of protein-folding, specifically thiol-disulfide exchange, may lead to development of a novel class of therapeutics that would help alleviate a wide range of diseases by targeting the UPR.

  7. Genetic diversity of plasmodium vivax merozoite surface protein-3alpha (Pvmsp-3alpha) gene in Jhapa District of Nepal

    DEFF Research Database (Denmark)

    Adhikari, Madhav; Ranjitkar, Samir; Schousboe, Mette Leth

    2012-01-01

    In Nepal, Plasmodium vivax accounts for approximately 80-90% of the malaria cases, but limited studies have been conducted on the genetic diversity of this parasite population. This study was carried out to determine the genetic diversity of P. vivax population sampled from subjects living...... in an endemic area of Jhapa District by analyzing the polymorphic merozoite surface protein-3alpha (Pvmsp-3alpha) gene by using PCR-restriction fragment length polymorphism. Three distinct genotypes were obtained from 96 samples; type A: 40 (71%), type B: 7 (13%), and type C: 9 (16%) which could be categorized...... into 13 allelic patterns: A1-A9, B1, B2, C1 and C2. These results indicated a high genetic diversity within the studied P. vivax population. As the transmission rate of malaria is low in Nepal, the diversity is most likely due to migration of people between the malaria endemic regions, either within...

  8. Distribution pattern of Plasmodium falciparum chloroquine transporter (pfcrt) gene haplotypes in Sri Lanka 1996-2006

    DEFF Research Database (Denmark)

    Zhang, Jenny J; Senaratne, Tharanga N; Daniels, Rachel

    2011-01-01

    Abstract. Widespread antimalarial resistance has been a barrier to malaria elimination efforts in Sri Lanka. Analysis of genetic markers in historic parasites may uncover trends in the spread of resistance. We examined the frequency of Plasmodium falciparum chloroquine transporter (pfcrt; codons 72......-76) haplotypes in Sri Lanka in 1996-1998 and 2004-2006 using a high-resolution melting assay. Among 59 samples from 1996 to 1998, we detected the SVMNT (86%), CVMNK (10%), and CVIET (2%) haplotypes, with a positive trend in SVMNT and a negative trend in CVMNK frequency (P = 0.004) over time. Among 24 samples...

  9. Survey of chloroquine-resistant mutations in the Plasmodium falciparum pfcrt and pfmdr-1 genes in Hadhramout, Yemen.

    Science.gov (United States)

    Bamaga, Omar A A; Mahdy, Mohammed A K; Lim, Yvonne A L

    2015-09-01

    Malaria is still a major public health problem in Yemen. More than 95% of the malaria cases are due to Plasmodium ‎falciparum‎. Recently in Yemen, the antimalarial treatment policy was changed from chloroquine (CQ) to artemisinin combination therapy (ACTs). However, CQ is still available and prescribed in the Yemeni market. The persistence of CQ resistance will be prolonged if the shift to ACT and the simultaneous withdrawal of CQ are not rigorously implemented. The aim of the current survey is to detect chloroquine-resistant mutations in P. falciparum chloroquine-resistance transporter (pfcrt) and P. falciparum multi-drug resistance-1 (pfmdr1) genes. These data will be important for future monitoring and assessment of antimalarial drug policy in Yemen. Blood specimens were collected from 735 individuals from different districts of the Hadhramout province, Yemen by house-to-house visit. Mutation-specific nested polymerase chain reaction (PCR) and restriction fragment length polymorphism (PCR-RFLP) methods were used to investigate the mutations in the pfmdr1(codons 86 and 1246) and pfcrt (codons 76, 271, 326, 356 and 371) genes. The overall prevalence of pfcrt mutations at codons 76, 271, 326 and 371 were 50.4%, 58.7%, 54.3% and 44.9%, respectively. All isolates had wild-type pfcrt 356 allele. The majority of pfmdr1 86 alleles (83.3%) and all pfmdr1 1246 alleles were wild type. There was no association between pfcrt mutations and symptomatology, gender and age groups. In conclusion, point mutations in codons 76, 271, 326 and 371 of pfcrt of P. falciparum are high suggesting a sustained high CQ resistance even after 4 years of shifting to ACTs. These findings warrant complete withdrawal of CQ use from the Yemeni market for P. falciparum and careful usage of CQ for treating Plasmodium vivax. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Variant Exported Blood-Stage Proteins Encoded by Plasmodium Multigene Families Are Expressed in Liver Stages Where They Are Exported into the Parasitophorous Vacuole.

    Directory of Open Access Journals (Sweden)

    Aurélie Fougère

    2016-11-01

    Full Text Available Many variant proteins encoded by Plasmodium-specific multigene families are exported into red blood cells (RBC. P. falciparum-specific variant proteins encoded by the var, stevor and rifin multigene families are exported onto the surface of infected red blood cells (iRBC and mediate interactions between iRBC and host cells resulting in tissue sequestration and rosetting. However, the precise function of most other Plasmodium multigene families encoding exported proteins is unknown. To understand the role of RBC-exported proteins of rodent malaria parasites (RMP we analysed the expression and cellular location by fluorescent-tagging of members of the pir, fam-a and fam-b multigene families. Furthermore, we performed phylogenetic analyses of the fam-a and fam-b multigene families, which indicate that both families have a history of functional differentiation unique to RMP. We demonstrate for all three families that expression of family members in iRBC is not mutually exclusive. Most tagged proteins were transported into the iRBC cytoplasm but not onto the iRBC plasma membrane, indicating that they are unlikely to play a direct role in iRBC-host cell interactions. Unexpectedly, most family members are also expressed during the liver stage, where they are transported into the parasitophorous vacuole. This suggests that these protein families promote parasite development in both the liver and blood, either by supporting parasite development within hepatocytes and erythrocytes and/or by manipulating the host immune response. Indeed, in the case of Fam-A, which have a steroidogenic acute regulatory-related lipid transfer (START domain, we found that several family members can transfer phosphatidylcholine in vitro. These observations indicate that these proteins may transport (host phosphatidylcholine for membrane synthesis. This is the first demonstration of a biological function of any exported variant protein family of rodent malaria parasites.

  11. Dlx homeobox gene family expression in osteoclasts.

    Science.gov (United States)

    Lézot, F; Thomas, B L; Blin-Wakkach, C; Castaneda, B; Bolanos, A; Hotton, D; Sharpe, P T; Heymann, D; Carles, G F; Grigoriadis, A E; Berdal, A

    2010-06-01

    Skeletal growth and homeostasis require the finely orchestrated secretion of mineralized tissue matrices by highly specialized cells, balanced with their degradation by osteoclasts. Time- and site-specific expression of Dlx and Msx homeobox genes in the cells secreting these matrices have been identified as important elements in the regulation of skeletal morphology. Such specific expression patterns have also been reported in osteoclasts for Msx genes. The aim of the present study was to establish the expression patterns of Dlx genes in osteoclasts and identify their function in regulating skeletal morphology. The expression patterns of all Dlx genes were examined during the whole osteoclastogenesis using different in vitro models. The results revealed that Dlx1 and Dlx2 are the only Dlx family members with a possible function in osteoclastogenesis as well as in mature osteoclasts. Dlx5 and Dlx6 were detected in the cultures but appear to be markers of monocytes and their derivatives. In vivo, Dlx2 expression in osteoclasts was examined using a Dlx2/LacZ transgenic mouse. Dlx2 is expressed in a subpopulation of osteoclasts in association with tooth, brain, nerve, and bone marrow volumetric growths. Altogether the present data suggest a role for Dlx2 in regulation of skeletal morphogenesis via functions within osteoclasts. (c) 2010 Wiley-Liss, Inc.

  12. Quantitative real-time PCR analysis of Anopheles dirus TEP1 and NOS during Plasmodium berghei infection, using three reference genes

    Directory of Open Access Journals (Sweden)

    Jonathan W.K. Liew

    2017-07-01

    Full Text Available Quantitative reverse transcription PCR (qRT-PCR has been an integral part of characterizing the immunity of Anopheles mosquitoes towards Plasmodium invasion. Two anti-Plasmodium factors of Anopheles, thioester-containing protein 1 (TEP1 and nitric oxide synthase (NOS, play a role in the refractoriness of Anopheles towards Plasmodium infection and are generally expressed during infection. However, these are less studied in Anopheles dirus, a dominant malaria vector in Southeast Asia. Furthermore, most studies used a single reference gene for normalization during gene expression analysis without proper validation. This may lead to erroneous quantification of expression levels. Therefore, the present study characterized and investigated the expression profiles of TEP1 and NOS of Anopheles dirus during P. berghei infection. Prior to that, the elongation factor 1-alpha (EF1, actin 1 (Act and ribosomal protein S7 (S7 genes were validated for their suitability as a set of reference genes. TEP1 and NOS expressions in An. dirus were found to be significantly induced after P. berghei infection.

  13. Bioenergetics-based modeling of Plasmodium falciparum metabolism reveals its essential genes, nutritional requirements, and thermodynamic bottlenecks

    Science.gov (United States)

    Chiappino-Pepe, Anush; Ataman, Meriç

    2017-01-01

    Novel antimalarial therapies are urgently needed for the fight against drug-resistant parasites. The metabolism of malaria parasites in infected cells is an attractive source of drug targets but is rather complex. Computational methods can handle this complexity and allow integrative analyses of cell metabolism. In this study, we present a genome-scale metabolic model (iPfa) of the deadliest malaria parasite, Plasmodium falciparum, and its thermodynamics-based flux analysis (TFA). Using previous absolute concentration data of the intraerythrocytic parasite, we applied TFA to iPfa and predicted up to 63 essential genes and 26 essential pairs of genes. Of the 63 genes, 35 have been experimentally validated and reported in the literature, and 28 have not been experimentally tested and include previously hypothesized or novel predictions of essential metabolic capabilities. Without metabolomics data, four of the genes would have been incorrectly predicted to be non-essential. TFA also indicated that substrate channeling should exist in two metabolic pathways to ensure the thermodynamic feasibility of the flux. Finally, analysis of the metabolic capabilities of P. falciparum led to the identification of both the minimal nutritional requirements and the genes that can become indispensable upon substrate inaccessibility. This model provides novel insight into the metabolic needs and capabilities of the malaria parasite and highlights metabolites and pathways that should be measured and characterized to identify potential thermodynamic bottlenecks and substrate channeling. The hypotheses presented seek to guide experimental studies to facilitate a better understanding of the parasite metabolism and the identification of targets for more efficient intervention. PMID:28333921

  14. Identification of putative regulatory motifs in the upstream regions of co-expressed functional groups of genes in Plasmodium falciparum

    Directory of Open Access Journals (Sweden)

    Joshi NV

    2009-01-01

    Full Text Available Abstract Background Regulation of gene expression in Plasmodium falciparum (Pf remains poorly understood. While over half the genes are estimated to be regulated at the transcriptional level, few regulatory motifs and transcription regulators have been found. Results The study seeks to identify putative regulatory motifs in the upstream regions of 13 functional groups of genes expressed in the intraerythrocytic developmental cycle of Pf. Three motif-discovery programs were used for the purpose, and motifs were searched for only on the gene coding strand. Four motifs – the 'G-rich', the 'C-rich', the 'TGTG' and the 'CACA' motifs – were identified, and zero to all four of these occur in the 13 sets of upstream regions. The 'CACA motif' was absent in functional groups expressed during the ring to early trophozoite transition. For functional groups expressed in each transition, the motifs tended to be similar. Upstream motifs in some functional groups showed 'positional conservation' by occurring at similar positions relative to the translational start site (TLS; this increases their significance as regulatory motifs. In the ribonucleotide synthesis, mitochondrial, proteasome and organellar translation machinery genes, G-rich, C-rich, CACA and TGTG motifs, respectively, occur with striking positional conservation. In the organellar translation machinery group, G-rich motifs occur close to the TLS. The same motifs were sometimes identified for multiple functional groups; differences in location and abundance of the motifs appear to ensure different modes of action. Conclusion The identification of positionally conserved over-represented upstream motifs throws light on putative regulatory elements for transcription in Pf.

  15. Bioenergetics-based modeling of Plasmodium falciparum metabolism reveals its essential genes, nutritional requirements, and thermodynamic bottlenecks.

    Directory of Open Access Journals (Sweden)

    Anush Chiappino-Pepe

    2017-03-01

    Full Text Available Novel antimalarial therapies are urgently needed for the fight against drug-resistant parasites. The metabolism of malaria parasites in infected cells is an attractive source of drug targets but is rather complex. Computational methods can handle this complexity and allow integrative analyses of cell metabolism. In this study, we present a genome-scale metabolic model (iPfa of the deadliest malaria parasite, Plasmodium falciparum, and its thermodynamics-based flux analysis (TFA. Using previous absolute concentration data of the intraerythrocytic parasite, we applied TFA to iPfa and predicted up to 63 essential genes and 26 essential pairs of genes. Of the 63 genes, 35 have been experimentally validated and reported in the literature, and 28 have not been experimentally tested and include previously hypothesized or novel predictions of essential metabolic capabilities. Without metabolomics data, four of the genes would have been incorrectly predicted to be non-essential. TFA also indicated that substrate channeling should exist in two metabolic pathways to ensure the thermodynamic feasibility of the flux. Finally, analysis of the metabolic capabilities of P. falciparum led to the identification of both the minimal nutritional requirements and the genes that can become indispensable upon substrate inaccessibility. This model provides novel insight into the metabolic needs and capabilities of the malaria parasite and highlights metabolites and pathways that should be measured and characterized to identify potential thermodynamic bottlenecks and substrate channeling. The hypotheses presented seek to guide experimental studies to facilitate a better understanding of the parasite metabolism and the identification of targets for more efficient intervention.

  16. NSR-seq transcriptional profiling enables identification of a gene signature of Plasmodium falciparum parasites infecting children

    Science.gov (United States)

    Vignali, Marissa; Armour, Christopher D.; Chen, Jingyang; Morrison, Robert; Castle, John C.; Biery, Matthew C.; Bouzek, Heather; Moon, Wonjong; Babak, Tomas; Fried, Michal; Raymond, Christopher K.; Duffy, Patrick E.

    2011-01-01

    Malaria caused by Plasmodium falciparum results in approximately 1 million annual deaths worldwide, with young children and pregnant mothers at highest risk. Disease severity might be related to parasite virulence factors, but expression profiling studies of parasites to test this hypothesis have been hindered by extensive sequence variation in putative virulence genes and a preponderance of host RNA in clinical samples. We report here the application of RNA sequencing to clinical isolates of P. falciparum, using not-so-random (NSR) primers to successfully exclude human ribosomal RNA and globin transcripts and enrich for parasite transcripts. Using NSR-seq, we confirmed earlier microarray studies showing upregulation of a distinct subset of genes in parasites infecting pregnant women, including that encoding the well-established pregnancy malaria vaccine candidate var2csa. We also describe a subset of parasite transcripts that distinguished parasites infecting children from those infecting pregnant women and confirmed this observation using quantitative real-time PCR and mass spectrometry proteomic analyses. Based on their putative functional properties, we propose that these proteins could have a role in childhood malaria pathogenesis. Our study provides proof of principle that NSR-seq represents an approach that can be used to study clinical isolates of parasites causing severe malaria syndromes as well other blood-borne pathogens and blood-related diseases. PMID:21317536

  17. NSR-seq transcriptional profiling enables identification of a gene signature of Plasmodium falciparum parasites infecting children.

    Science.gov (United States)

    Vignali, Marissa; Armour, Christopher D; Chen, Jingyang; Morrison, Robert; Castle, John C; Biery, Matthew C; Bouzek, Heather; Moon, Wonjong; Babak, Tomas; Fried, Michal; Raymond, Christopher K; Duffy, Patrick E

    2011-03-01

    Malaria caused by Plasmodium falciparum results in approximately 1 million annual deaths worldwide, with young children and pregnant mothers at highest risk. Disease severity might be related to parasite virulence factors, but expression profiling studies of parasites to test this hypothesis have been hindered by extensive sequence variation in putative virulence genes and a preponderance of host RNA in clinical samples. We report here the application of RNA sequencing to clinical isolates of P. falciparum, using not-so-random (NSR) primers to successfully exclude human ribosomal RNA and globin transcripts and enrich for parasite transcripts. Using NSR-seq, we confirmed earlier microarray studies showing upregulation of a distinct subset of genes in parasites infecting pregnant women, including that encoding the well-established pregnancy malaria vaccine candidate var2csa. We also describe a subset of parasite transcripts that distinguished parasites infecting children from those infecting pregnant women and confirmed this observation using quantitative real-time PCR and mass spectrometry proteomic analyses. Based on their putative functional properties, we propose that these proteins could have a role in childhood malaria pathogenesis. Our study provides proof of principle that NSR-seq represents an approach that can be used to study clinical isolates of parasites causing severe malaria syndromes as well other blood-borne pathogens and blood-related diseases.

  18. Analysis of Polymorphisms in the Merozoite Surface Protein-3a Gene and Two Microsatellite Loci in Sri Lankan Plasmodium vivax: Evidence of Population Substructure in Sri Lanka

    DEFF Research Database (Denmark)

    Schousboe, Mette L; Rajakaruna, Rupika S; Amerasinghe, Priyanie H

    2011-01-01

    Abstract. The geographical distribution of genetic variation in Plasmodium vivax samples (N = 386) from nine districts across Sri Lanka is described using three markers; the P. vivax merozoite surface protein-3a (Pvmsp-3a) gene, and the two microsatellites m1501 and m3502. At Pvmsp-3a, 11 alleles....... The results show evidence of high genetic diversity and possible population substructure of P. vivax populations in Sri Lanka....

  19. Selection of Plasmodium falciparum Multidrug Resistance Gene 1 Alleles in Asexual Stages and Gametocytes by Artemether-Lumefantrine in Nigerian Children with Uncomplicated Falciparum Malaria ▿

    OpenAIRE

    Happi, C. T.; Gbotosho, G. O.; Folarin, O. A.; Sowunmi, A.; Hudson, T.; O'Neil, M.; Milhous, W.; Wirth, D. F.; Oduola, A. M. J.

    2008-01-01

    We assessed Plasmodium falciparum mdr1 (Pfmdr1) gene polymorphisms and copy numbers as well as P. falciparum Ca2+ ATPase (PfATPase6) gene polymorphisms in 90 Nigerian children presenting with uncomplicated falciparum malaria and enrolled in a study of the efficacy of artemether-lumefantrine (AL). The nested PCR-restriction fragment length polymorphism and the quantitative real-time PCR methodologies were used to determine the alleles of the Pfmdr1 and PfATPase6 genes and the Pfmdr1 copy numbe...

  20. Status of dhps and dhfr genes of Plasmodium falciparum in Colombia before artemisinin based treatment policy Estado de los genes dhps y dhfr de Plasmodium falciparum en Colombia antes de la recomendación de tratamiento basado en artemisinina

    Directory of Open Access Journals (Sweden)

    Andrés Villa

    2012-03-01

    Full Text Available Introduction: Surveillance of the genetic characteristics of dhps and dhfr can be useful to outline guidelines for application of intermittent preventive therapy in Northwest Colombia and to define the future use of antifolates in artemisinin-based combination therapy schemes. Objective: To evaluate the frequency of mutations in dhps and dhfr and to characterize parasite populations using msp-1, msp-2 and glurp in historic samples before artemisinin-based therapy was implemented in the country. Methods: A controlled clinical study was carried out on randomly selected Plasmodium falciparum infected volunteers of Northwest Colombia (Turbo and Zaragoza. A sample size of 25 subjects per region was calculated. Treatment efficacy to antifolates was assessed. Molecular analyses included P. falciparum genotypes by msp-1, msp-2 and glurp and evaluation of the status of codons 16, 51, 59, 108 and 164 of dhfr and 436, 437, 540, 581 and 613 of dhps. Results: In total 78 subjects were recruited. A maximum number of 4 genotypes were detected by msp-1, msp-2 and glurp. Codons 16, 59 and 164 of the dhfr gene exhibited the wild-type form, while codons 51 and 108 were mutant. In the dhps gene, the mutant 437 glycine was detected in 85% on day 0, while codons 436, 540, 581 and 613 were wild-type. Conclusions: Plasmodium falciparum populations were very homogeneous in this region of Colombia, and the triple mutants of dhfr and dhps Asn108, Ile51 and Gly437 were predominant in clinical isolates.Introducción. La vigilancia de las características genéticas de dhps y dhfr puede utilizarse para delinear guías de aplicación de terapia preventiva intermitente en el nordeste de Colombia y para definir el uso futuro de los antifolatos en esquemas terapéuticos basados en artemisinina. Objetivo. Evaluar la frecuencia de mutaciones en dhps y dhfr, y caracterizar las poblaciones parasitarias usando msp-1, msp-2 y glurp, en muestras históricas obtenidas antes de la

  1. Comparative genome analysis of PHB gene family reveals deep evolutionary origins and diverse gene function.

    Science.gov (United States)

    Di, Chao; Xu, Wenying; Su, Zhen; Yuan, Joshua S

    2010-10-07

    PHB (Prohibitin) gene family is involved in a variety of functions important for different biological processes. PHB genes are ubiquitously present in divergent species from prokaryotes to eukaryotes. Human PHB genes have been found to be associated with various diseases. Recent studies by our group and others have shown diverse function of PHB genes in plants for development, senescence, defence, and others. Despite the importance of the PHB gene family, no comprehensive gene family analysis has been carried to evaluate the relatedness of PHB genes across different species. In order to better guide the gene function analysis and understand the evolution of the PHB gene family, we therefore carried out the comparative genome analysis of the PHB genes across different kingdoms. The relatedness, motif distribution, and intron/exon distribution all indicated that PHB genes is a relatively conserved gene family. The PHB genes can be classified into 5 classes and each class have a very deep evolutionary origin. The PHB genes within the class maintained the same motif patterns during the evolution. With Arabidopsis as the model species, we found that PHB gene intron/exon structure and domains are also conserved during the evolution. Despite being a conserved gene family, various gene duplication events led to the expansion of the PHB genes. Both segmental and tandem gene duplication were involved in Arabidopsis PHB gene family expansion. However, segmental duplication is predominant in Arabidopsis. Moreover, most of the duplicated genes experienced neofunctionalization. The results highlighted that PHB genes might be involved in important functions so that the duplicated genes are under the evolutionary pressure to derive new function. PHB gene family is a conserved gene family and accounts for diverse but important biological functions based on the similar molecular mechanisms. The highly diverse biological function indicated that more research needs to be carried out

  2. The role of retrotransposons in gene family expansions: insights from the mouse Abp gene family.

    Science.gov (United States)

    Janoušek, Václav; Karn, Robert C; Laukaitis, Christina M

    2013-05-29

    Retrotransposons have been suggested to provide a substrate for non-allelic homologous recombination (NAHR) and thereby promote gene family expansion. Their precise role, however, is controversial. Here we ask whether retrotransposons contributed to the recent expansions of the Androgen-binding protein (Abp) gene families that occurred independently in the mouse and rat genomes. Using dot plot analysis, we found that the most recent duplication in the Abp region of the mouse genome is flanked by L1Md_T elements. Analysis of the sequence of these elements revealed breakpoints that are the relicts of the recombination that caused the duplication, confirming that the duplication arose as a result of NAHR using L1 elements as substrates. L1 and ERVII retrotransposons are considerably denser in the Abp regions than in one Mb flanking regions, while other repeat types are depleted in the Abp regions compared to flanking regions. L1 retrotransposons preferentially accumulated in the Abp gene regions after lineage separation and roughly followed the pattern of Abp gene expansion. By contrast, the proportion of shared vs. lineage-specific ERVII repeats in the Abp region resembles the rest of the genome. We confirmed the role of L1 repeats in Abp gene duplication with the identification of recombinant L1Md_T elements at the edges of the most recent mouse Abp gene duplication. High densities of L1 and ERVII repeats were found in the Abp gene region with abrupt transitions at the region boundaries, suggesting that their higher densities are tightly associated with Abp gene duplication. We observed that the major accumulation of L1 elements occurred after the split of the mouse and rat lineages and that there is a striking overlap between the timing of L1 accumulation and expansion of the Abp gene family in the mouse genome. Establishing a link between the accumulation of L1 elements and the expansion of the Abp gene family and identification of an NAHR-related breakpoint in

  3. Allelic Diversity and Geographical Distribution of the Gene Encoding Plasmodium falciparum Merozoite Surface Protein-3 in Thailand.

    Science.gov (United States)

    Sawaswong, Vorthon; Simpalipan, Phumin; Siripoon, Napaporn; Harnyuttanakorn, Pongchai; Pattaradilokrat, Sittiporn

    2015-04-01

    Merozoite surface proteins (MSPs) of malaria parasites play critical roles during the erythrocyte invasion and so are potential candidates for malaria vaccine development. However, because MSPs are often under strong immune selection, they can exhibit extensive genetic diversity. The gene encoding the merozoite surface protein-3 (MSP-3) of Plasmodium falciparum displays 2 allelic types, K1 and 3D7. In Thailand, the allelic frequency of the P. falciparum msp-3 gene was evaluated in a single P. falciparum population in Tak at the Thailand and Myanmar border. However, no study has yet looked at the extent of genetic diversity of the msp-3 gene in P. falciparum populations in other localities. Here, we genotyped the msp-3 alleles of 63 P. falciparum samples collected from 5 geographical populations along the borders of Thailand with 3 neighboring countries (Myanmar, Laos, and Cambodia). Our study indicated that the K1 and 3D7 alleles coexisted, but at different proportions in different Thai P. falciparum populations. K1 was more prevalent in populations at the Thailand-Myanmar and Thailand-Cambodia borders, whilst 3D7 was more prevalent at the Thailand-Laos border. Global analysis of the msp-3 allele frequencies revealed that proportions of K1 and 3D7 alleles of msp-3 also varied in different continents, suggesting the divergence of malaria parasite populations. In conclusion, the variation in the msp-3 allelic patterns of P. falciparum in Thailand provides fundamental knowledge for inferring the P. falciparum population structure and for the best design of msp-3 based malaria vaccines.

  4. Genetic diversity of plasmodium vivax merozoite surface protein-3alpha (Pvmsp-3alpha) gene in Jhapa District of Nepal.

    Science.gov (United States)

    Adhikari, Madhav; Ranjitkar, Samir; Schousboe, Mette Leth; Alifrangis, Michael; Imwong, Mallika; Bhatta, Dwij Raj; Banjara, Megha Raj

    2012-03-01

    In Nepal, Plasmodium vivax accounts for approximately 80-90% of the malaria cases, but limited studies have been conducted on the genetic diversity of this parasite population. This study was carried out to determine the genetic diversity of P. vivax population sampled from subjects living in an endemic area of Jhapa District by analyzing the polymorphic merozoite surface protein-3alpha (Pvmsp-3alpha) gene by using PCR-restriction fragment length polymorphism. Three distinct genotypes were obtained from 96 samples; type A: 40 (71%), type B: 7 (13%), and type C: 9 (16%) which could be categorized into 13 allelic patterns: A1-A9, B1, B2, C1 and C2. These results indicated a high genetic diversity within the studied P. vivax population. As the transmission rate of malaria is low in Nepal, the diversity is most likely due to migration of people between the malaria endemic regions, either within the country or between Nepal and India. Similar prevalence of the three genotypes of Pvmsp-3alpha between the two countries likely supports the latter explanation.

  5. Multiple genetic origins of histidine-rich protein 2 gene deletion in Plasmodium falciparum parasites from Peru

    Science.gov (United States)

    Akinyi, Sheila; Hayden, Tonya; Gamboa, Dionicia; Torres, Katherine; Bendezu, Jorge; Abdallah, Joseph F.; Griffing, Sean M.; Quezada, Wilmer Marquiño; Arrospide, Nancy; De Oliveira, Alexandre Macedo; Lucas, Carmen; Magill, Alan J.; Bacon, David J.; Barnwell, John W.; Udhayakumar, Venkatachalam

    2013-01-01

    The majority of malaria rapid diagnostic tests (RDTs) detect Plasmodium falciparum histidine-rich protein 2 (PfHRP2), encoded by the pfhrp2 gene. Recently, P. falciparum isolates from Peru were found to lack pfhrp2 leading to false-negative RDT results. We hypothesized that pfhrp2-deleted parasites in Peru derived from a single genetic event. We evaluated the parasite population structure and pfhrp2 haplotype of samples collected between 1998 and 2005 using seven neutral and seven chromosome 8 microsatellite markers, respectively. Five distinct pfhrp2 haplotypes, corresponding to five neutral microsatellite-based clonal lineages, were detected in 1998-2001; pfhrp2 deletions occurred within four haplotypes. In 2003-2005, outcrossing among the parasite lineages resulted in eight population clusters that inherited the five pfhrp2 haplotypes seen previously and a new haplotype; pfhrp2 deletions occurred within four of these haplotypes. These findings indicate that the genetic origin of pfhrp2 deletion in Peru was not a single event, but likely occurred multiple times. PMID:24077522

  6. Prevalence of Dihydrofolate reductase gene mutations in Plasmodium falciparum isolate from pregnant women in Nigeria

    Directory of Open Access Journals (Sweden)

    Olusola Ojurongbe

    2011-12-01

    Full Text Available We assessed the prevalence of Plasmodium falciparum and the frequency of the dhfr triple mutation that is associated with antifolate drug resistance among P. falciparumisolates obtained from pregnant women in Ilorin, Nigeria. The study included 179 women in the second and third trimester of pregnancy who have been exposed to intermittent preventive treatment in pregnancy (IPTp with sulfadoxinepyrimethamine. Thick and thin blood films and PCR were used for malaria parasite detection. Blood group and hemoglobin concentration were also determined. Mutations in P. falciparum dhfr were analyzed by sequencing DNA obtained from blood spots on filter paper. Prevalence of P. falciparum in the population (PCR corrected was 44.1% (79/179 with 66.7% and 33.3% in the second and third trimester, respectively. Primigravide (51.3% were more infected than multigravide (48.7% but the difference was not statistically significant. Women in blood group A had the highest P. falciparum malaria infection (30.8%. The mean hemoglobin concentration was lower among those infected with malaria parasite. Also, more women with the malaria parasite (38.4% had anemia compare to those without (21.4%. The prevalence of the P. falciparum dhfr mutant alleles was 64.1%, 61.5%, 38.5%, and 12.8% for I51, R59, N108 and T108, respectively. None of the samples had the L164 mutation. The combined triple dhfr mutation (51 + 59 + 108 in the population was 17.9% (7 of 39. Also, the prevalence of the triple mutant alleles was not significantly associated to the number of doses of SP taken by the women. These findings highlight the need for a regular assessment of IPTp/SP efficacy, and evaluation of possible alternative drugs.

  7. The SPINK gene family and celiac disease susceptibility

    NARCIS (Netherlands)

    Wapenaar, M.C.; Monsuur, A.J.; Poell, J.; Slot, R. van 't; Meijer, J.W.R.; Meijer, G.A.; Mulder, C.J.; Mearin, M.L.; Wijmenga, C.

    2007-01-01

    The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was

  8. The SPINK gene family and celiac disease susceptibility

    NARCIS (Netherlands)

    Wapenaar, Martin C.; Monsuur, Alienke J.; Poell, Jos; Slot, Ruben Van 't; Meijer, Jos W. R.; Meijer, Gerrit A.; Mulder, Chris J.; Mearin, Maria Luisa; Wijmenga, Cisca

    The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was

  9. Malaria resistance genes are associated with the levels of IgG subclasses directed against Plasmodium falciparum blood-stage antigens in Burkina Faso

    Directory of Open Access Journals (Sweden)

    Afridi Sarwat

    2012-09-01

    Full Text Available Abstract Background HBB, IL4, IL12, TNF, LTA, NCR3 and FCGR2A polymorphisms have been associated with malaria resistance in humans, whereas cytophilic immunoglobulin G (IgG antibodies are thought to play a critical role in immune protection against asexual blood stages of the parasite. Furthermore, HBB, IL4, TNF, and FCGR2A have been associated with both malaria resistance and IgG levels. This suggests that some malaria resistance genes influence the levels of IgG subclass antibodies. Methods In this study, the effect of HBB, IL4, IL12, TNF, LTA, NCR3 and FCGR2A polymorphisms on the levels of IgG responses against Plasmodium falciparum blood-stage extract was investigated in 220 individuals living in Burkina Faso. The Pearson’s correlation coefficient among IgG subclasses was determined. A family-based approach was used to assess the association of polymorphisms with anti-P. falciparum IgG, IgG1, IgG2, IgG3 and IgG4 levels. Results After applying a multiple test correction, several polymorphisms were associated with IgG subclass or IgG levels. There was an association of i haemoglobin C with IgG levels; ii the FcγRIIa H/R131 with IgG2 and IgG3 levels; iii TNF-863 with IgG3 levels; iv TNF-857 with IgG levels; and, v TNF1304 with IgG3, IgG4, and IgG levels. Conclusion Taken together, the results support the hypothesis that some polymorphisms affect malaria resistance through their effect on the acquired immune response, and pave the way towards further comprehension of genetic control of an individual’s humoral response against malaria.

  10. Large-scale survey for novel genotypes of Plasmodium falciparum chloroquine-resistance gene pfcrt

    Directory of Open Access Journals (Sweden)

    Takahashi Nobuyuki

    2012-03-01

    Full Text Available Abstract Background In Plasmodium falciparum, resistance to chloroquine (CQ is conferred by a K to T mutation at amino acid position 76 (K76T in the P. falciparum CQ transporter (PfCRT. To date, at least 15 pfcrt genotypes, which are represented by combinations of five amino acids at positions 72-76, have been described in field isolates from various endemic regions. To identify novel mutant pfcrt genotypes and to reveal the genetic relatedness of pfcrt genotypes, a large-scale survey over a wide geographic area was performed. Methods Sequences for exon 2 in pfcrt, including known polymorphic sites at amino acid positions 72, 74, 75 and 76, were obtained from 256 P. falciparum isolates collected from eight endemic countries in Asia (Bangladesh, Cambodia, Lao P.D.R., the Philippines and Thailand, Melanesia (Papua New Guinea and Vanuatu and Africa (Ghana. A haplotype network was constructed based on six microsatellite markers located -29 kb to 24 kb from pfcrt in order to examine the genetic relatedness among mutant pfcrt genotypes. Results In addition to wild type (CVMNK at positions 72-76, four mutant pfcrt were identified; CVIET, CVIDT, SVMNT and CVMNT (mutated amino acids underlined. Haplotype network revealed that there were only three mutant pfcrt lineages, originating in Indochina, Philippines and Melanesia. Importantly, the Indochina lineage contained two mutant pfcrt genotypes, CVIET (n = 95 and CVIDT (n = 14, indicating that CVIDT shares a common origin with CVIET. Similarly, one major haplotype in the Melanesian lineage contained two pfcrt genotypes; SVMNT (n = 71 and CVMNT (n = 3. In Africa, all mutant pfcrt genotypes were the CVIET of the Indochina lineage, probably resulting from the intercontinental migration of CQ resistance from Southeast Asia. Conclusions The number of CQ-mutant lineages observed in this study was identical to that found in previous studies. This supports the hypothesis that the emergence of novel CQ resistance

  11. Differences in gene transcriptomic pattern of Plasmodium falciparum in children with cerebral malaria and asymptomatic carriers

    DEFF Research Database (Denmark)

    Almelli, Talleh; Nuel, Grégory; Bischoff, Emmanuel

    2014-01-01

    . In this study, we analyzed the transcriptomes of isolates obtained from asymptomatic carriers and patients with uncomplicated or cerebral malaria. We also investigated the transcriptomes of 3D7 clone and 3D7-Lib that expresses severe malaria associated-variant surface antigen. Our findings revealed a specific...... up-regulation of genes involved in pathogenesis, adhesion to host cell, and erythrocyte aggregation in parasites from patients with cerebral malaria and 3D7-Lib, compared to parasites from asymptomatic carriers and 3D7, respectively. However, we did not find any significant difference between...... and their neighboring rif genes in 3D7-lib. Therefore, more investigations are needed to analyze the effective role of these genes during malaria infection to provide with new knowledge on malaria pathology. In addition, concomitant regulation of genes within the chromosomal neighborhood suggests a common mechanism...

  12. Melatonin-Induced Temporal Up-Regulation of Gene Expression Related to Ubiquitin/Proteasome System (UPS in the Human Malaria Parasite Plasmodium falciparum

    Directory of Open Access Journals (Sweden)

    Fernanda C. Koyama

    2014-12-01

    Full Text Available There is an increasing understanding that melatonin and the ubiquitin/ proteasome system (UPS interact to regulate multiple cellular functions. Post-translational modifications such as ubiquitination are important modulators of signaling processes, cell cycle and many other cellular functions. Previously, we reported a melatonin-induced upregulation of gene expression related to ubiquitin/proteasome system (UPS in Plasmodium falciparum, the human malaria parasite, and that P. falciparum protein kinase 7 influences this process. This implies a role of melatonin, an indolamine, in modulating intraerythrocytic development of the parasite. In this report we demonstrate by qPCR analysis, that melatonin induces gene upregulation in nine out of fourteen genes of the UPS, consisting of the same set of genes previously reported, between 4 to 5 h after melatonin treatment. We demonstrate that melatonin causes a temporally controlled gene expression of UPS members.

  13. Genetic diversity and natural selection of Plasmodium vivax multi-drug resistant gene (pvmdr1) in Mesoamerica.

    Science.gov (United States)

    González-Cerón, Lilia; Montoya, Alberto; Corzo-Gómez, Josselin C; Cerritos, Rene; Santillán, Frida; Sandoval, Marco A

    2017-07-01

    The Plasmodium vivax multidrug resistant 1 gene (pvmdr1) codes for a transmembrane protein of the parasite's digestive vacuole. It is likely that the pvmdr1 gene mutations occur at different sites by convergent evolution. In here, the genetic variation of pvmdr1 at three sites of the Mesoamerican region was studied. Since 1950s, malarious patients of those areas have been treated only with chloroquine and primaquine. Blood samples from patients infected with P. vivax were obtained in southern Mexico (SMX), in the Northwest (NIC-NW) and in the northeast (NIC-NE) of Nicaragua. Genomic DNA was obtained and fragments of pvmdr1 were amplified and sequenced. The nucleotide and amino acid changes as well as the haplotype frequency in pvmdr1 were determined per strain and per geographic site. The sequences of pvmdr1 obtained from the studied regions were compared with homologous sequences from the GenBank database to explore the P. vivax genetic structure. In 141 parasites, eight nucleotide changes (two changes were synonymous and other six were nonsynonymous) were detected in 1536 bp. The PvMDR1 amino acid changes Y976F, F1076FL were predominant in endemic parasites from NIC-NE and outbreak parasites in NIC-NW but absent in SMX. Thirteen haplotypes were resolved, and found to be closely related, but their frequency at each geographic site was different (P = 0.0001). The pvmdr1 codons 925-1083 gene fragment showed higher genetic and haplotype diversity in parasites from NIC-NE than the other areas outside Latin America. The haplotype networks suggested local diversification of pvmdr1 and no significant departure from neutrality. The F ST values were low to moderate regionally, but high between NIC-NE or NIC-NW and other regions inside and outside Latin America. The pvmdr1 gene might have diversified recently at regional level. In the absence of significant natural, genetic drift might have caused differential pvmdr1 haplotype frequencies at different geographic sites

  14. Analyzing Plasmodium falciparum erythrocyte membrane protein 1 gene expression by a next generation sequencing based method

    DEFF Research Database (Denmark)

    Jespersen, Jakob S.; Petersen, Bent; Seguin-Orlando, Andaine

    2013-01-01

    at identifying PfEMP1 features associated with high virulence. Here we present the first effective method for sequence analysis of var genes expressed in field samples: a sequential PCR and next generation sequencing based technique applied on expressed var sequence tags and subsequently on long range PCR......, encoded by ~60 highly variable 'var' genes per haploid genome. PfEMP1 is exported to the surface of infected erythrocytes and is thought to be fundamental to immune evasion by adhesion to host and parasite factors. The highly variable nature has constituted a roadblock in var expression studies aimed...

  15. Msx homeobox gene family and craniofacial development.

    Science.gov (United States)

    Alappat, Sylvia; Zhang, Zun Yi; Chen, Yi Ping

    2003-12-01

    Vertebrate Msx genes are unlinked, homeobox-containing genes that bear homology to the Drosophila muscle segment homeobox gene. These genes are expressed at multiple sites of tissue-tissue interactions during vertebrate embryonic development. Inductive interactions mediated by the Msx genes are essential for normal craniofacial, limb and ectodermal organ morphogenesis, and are also essential to survival in mice, as manifested by the phenotypic abnormalities shown in knockout mice and in humans. This review summarizes studies on the expression, regulation, and functional analysis of Msx genes that bear relevance to craniofacial development in humans and mice. Key words: Msx genes, craniofacial, tooth, cleft palate, suture, development, transcription factor, signaling molecule.

  16. Geographic structuring of the Plasmodium falciparum sarco(endoplasmic reticulum Ca2+ ATPase (PfSERCA gene diversity.

    Directory of Open Access Journals (Sweden)

    Ronan Jambou

    Full Text Available Artemisinin, a thapsigargin-like sesquiterpene has been shown to inhibit the Plasmodium falciparum sarco/endoplasmic reticulum calcium-ATPase PfSERCA. To collect baseline pfserca sequence information before field deployment of Artemisinin-based Combination therapies that may select mutant parasites, we conducted a sequence analysis of 100 isolates from multiple sites in Africa, Asia and South America. Coding sequence diversity was large, with 29 mutated codons, including 32 SNPs (average of one SNP/115 bp, of which 19 were novel mutations. Most SNP detected in this study were clustered within a region in the cytosolic head of the protein. The PfSERCA functional domains were very well conserved, with non synonymous mutations located outside the functional domains, except for the S769N mutation associated in French Guiana with elevated IC(50 for artemether. The S769N mutation is located close to the hinge of the headpiece, which in other species modulates calcium affinity and in consequence efficacy of inhibitors, possibly linking calcium homeostasis to drug resistance. Genetic diversity was highest in Senegal, Brazil and French Guiana, and few mutations were identified in Asia. Population genetic analysis was conducted for a partial fragment of the gene encompassing nucleotide coordinates 87-2862 (unambiguous sequence available for 96 isolates. This supported a geographic clustering, with a separation between Old and New World samples and one dominant ancestral haplotype. Genetic drift alone cannot explain the observed polymorphism, suggesting that other evolutionary mechanisms are operating. One possible contributor could be the frequency of haemoglobinopathies that are associated with calcium dysregulation in the erythrocyte.

  17. Recurrent APC gene mutations in Polish FAP families

    Directory of Open Access Journals (Sweden)

    Pławski Andrzej

    2007-12-01

    Full Text Available Abstract The molecular diagnostics of genetically conditioned disorders is based on the identification of the mutations in the predisposing genes. Hereditary cancer disorders of the gastrointestinal tracts are caused by mutations of the tumour suppressor genes or the DNA repair genes. Occurrence of recurrent mutation allows improvement of molecular diagnostics. The mutation spectrum in the genes causing hereditary forms of colorectal cancers in the Polish population was previously described. In the present work an estimation of the frequency of the recurrent mutations of the APC gene was performed. Eight types of mutations occurred in 19.4% of our FAP families and these constitute 43% of all Polish diagnosed families.

  18. Occurrence of the Southeast Asian/South American SVMNT haplotype of the chloroquine-resistance transporter gene in Plasmodium falciparum in Tanzania

    DEFF Research Database (Denmark)

    Alifrangis, Michael; Dalgaard, Michael B; Lusingu, John P

    2006-01-01

    Two main haplotypes, CVIET and SVMNT, of the Plasmodium falciparum chloroquine-resistance transporter gene (Pfcrt) are linked to 4-aminoquinoline resistance. The CVIET haplotype has been reported in most malaria-endemic regions, whereas the SVMNT haplotype has only been found outside Africa. We...... investigated Pfcrt haplotype frequencies in Korogwe District, Tanzania, in 2003 and 2004. The SVMNT haplotype was not detected in 2003 but was found in 19% of infected individuals in 2004. Amodiaquine use has increased in the region. The introduction and high prevalence of the SVMNT haplotype may reflect...... this and may raise concern regarding the use of amodiaquine in artemisinin-based combination therapies in Africa....

  19. Mutations in Plasmodium falciparum K13 propeller gene from Bangladesh (2009–2013)

    OpenAIRE

    Mohon, Abu Naser; Alam, Mohammad Shafiul; Bayih, Abebe Genetu; Folefoc, Asongna; Shahinas, Dea; Haque, Rashidul; Pillai, Dylan R

    2014-01-01

    Background Bangladesh is a malaria hypo-endemic country sharing borders with India and Myanmar. Artemisinin combination therapy (ACT) remains successful in Bangladesh. An increase of artemisinin-resistant malaria parasites on the Thai-Cambodia and Thai-Myanmar borders is worrisome. K13 propeller gene (PF3D7_1343700 or PF13_0238) mutations have been linked to both in vitro artemisinin resistance and in vivo slow parasite clearance rates. This group undertook to evaluate if mutations seen in Ca...

  20. The Plasmodium falciparum transcriptome in severe malaria reveals altered expression of genes involved in important processes including surface antigen–encoding var genes

    Science.gov (United States)

    Tonkin-Hill, Gerry Q.; Trianty, Leily; Noviyanti, Rintis; Nguyen, Hanh H. T.; Sebayang, Boni F.; Lampah, Daniel A.; Marfurt, Jutta; Cobbold, Simon A.; Rambhatla, Janavi S.; McConville, Malcolm J.; Rogerson, Stephen J.; Brown, Graham V.; Day, Karen P.; Price, Ric N.; Anstey, Nicholas M.

    2018-01-01

    Within the human host, the malaria parasite Plasmodium falciparum is exposed to multiple selection pressures. The host environment changes dramatically in severe malaria, but the extent to which the parasite responds to—or is selected by—this environment remains unclear. From previous studies, the parasites that cause severe malaria appear to increase expression of a restricted but poorly defined subset of the PfEMP1 variant, surface antigens. PfEMP1s are major targets of protective immunity. Here, we used RNA sequencing (RNAseq) to analyse gene expression in 44 parasite isolates that caused severe and uncomplicated malaria in Papuan patients. The transcriptomes of 19 parasite isolates associated with severe malaria indicated that these parasites had decreased glycolysis without activation of compensatory pathways; altered chromatin structure and probably transcriptional regulation through decreased histone methylation; reduced surface expression of PfEMP1; and down-regulated expression of multiple chaperone proteins. Our RNAseq also identified novel associations between disease severity and PfEMP1 transcripts, domains, and smaller sequence segments and also confirmed all previously reported associations between expressed PfEMP1 sequences and severe disease. These findings will inform efforts to identify vaccine targets for severe malaria and also indicate how parasites adapt to—or are selected by—the host environment in severe malaria. PMID:29529020

  1. Interferon induced IFIT family genes in host antiviral defense.

    Science.gov (United States)

    Zhou, Xiang; Michal, Jennifer J; Zhang, Lifan; Ding, Bo; Lunney, Joan K; Liu, Bang; Jiang, Zhihua

    2013-01-01

    Secretion of interferons (IFNs) from virus-infected cells is a hallmark of host antiviral immunity and in fact, IFNs exert their antiviral activities through the induction of antiviral proteins. The IFN-induced protein with tetratricopeptide repeats (IFITs) family is among hundreds of IFN-stimulated genes. This family contains a cluster of duplicated loci. Most mammals have IFIT1, IFIT2, IFIT3 and IFIT5; however, bird, marsupial, frog and fish have only IFIT5. Regardless of species, IFIT5 is always adjacent to SLC16A12. IFIT family genes are predominantly induced by type I and type III interferons and are regulated by the pattern recognition and the JAK-STAT signaling pathway. IFIT family proteins are involved in many processes in response to viral infection. However, some viruses can escape the antiviral functions of the IFIT family by suppressing IFIT family genes expression or methylation of 5' cap of viral molecules. In addition, the variants of IFIT family genes could significantly influence the outcome of hepatitis C virus (HCV) therapy. We believe that our current review provides a comprehensive picture for the community to understand the structure and function of IFIT family genes in response to pathogens in human, as well as in animals.

  2. Plasmodium immunomics.

    Science.gov (United States)

    Doolan, Denise L

    2011-01-01

    The Plasmodium parasite, the causative agent of malaria, is an excellent model for immunomic-based approaches to vaccine development. The Plasmodium parasite has a complex life cycle with multiple stages and stage-specific expression of ∼5300 putative proteins. No malaria vaccine has yet been licensed. Many believe that an effective vaccine will need to target several antigens and multiple stages, and will require the generation of both antibody and cellular immune responses. Vaccine efforts to date have been stage-specific and based on only a very limited number of proteins representing Plasmodium parasite life cycle with immune responses implicated in parasite elimination and control. Immunomic approaches which enable the selection of the best possible targets by prioritising antigens according to clinically relevant criteria may overcome the problem of poorly immunogenic, poorly protective vaccines that has plagued malaria vaccine developers for the past 25 years. Herein, current progress and perspectives regarding Plasmodium immunomics are reviewed. Copyright © 2010 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

  3. The ALMT Gene Family Performs Multiple Functions in Plants

    Directory of Open Access Journals (Sweden)

    Jie Liu

    2018-02-01

    Full Text Available The aluminium activated malate transporter (ALMT gene family is named after the first member of the family identified in wheat (Triticum aestivum L.. The product of this gene controls resistance to aluminium (Al toxicity. ALMT genes encode transmembrane proteins that function as anion channels and perform multiple functions involving the transport of organic anions (e.g., carboxylates and inorganic anions in cells. They share a PF11744 domain and are classified in the Fusaric acid resistance protein-like superfamily, CL0307. The proteins typically have five to seven transmembrane regions in the N-terminal half and a long hydrophillic C-terminal tail but predictions of secondary structure vary. Although widely spread in plants, relatively little information is available on the roles performed by other members of this family. In this review, we summarized functions of ALMT gene families, including Al resistance, stomatal function, mineral nutrition, microbe interactions, fruit acidity, light response and seed development.

  4. Evaluation of Gene-Based Family-Based Methods to Detect Novel Genes Associated With Familial Late Onset Alzheimer Disease

    Directory of Open Access Journals (Sweden)

    Maria V. Fernández

    2018-04-01

    Full Text Available Gene-based tests to study the combined effect of rare variants on a particular phenotype have been widely developed for case-control studies, but their evolution and adaptation for family-based studies, especially studies of complex incomplete families, has been slower. In this study, we have performed a practical examination of all the latest gene-based methods available for family-based study designs using both simulated and real datasets. We examined the performance of several collapsing, variance-component, and transmission disequilibrium tests across eight different software packages and 22 models utilizing a cohort of 285 families (N = 1,235 with late-onset Alzheimer disease (LOAD. After a thorough examination of each of these tests, we propose a methodological approach to identify, with high confidence, genes associated with the tested phenotype and we provide recommendations to select the best software and model for family-based gene-based analyses. Additionally, in our dataset, we identified PTK2B, a GWAS candidate gene for sporadic AD, along with six novel genes (CHRD, CLCN2, HDLBP, CPAMD8, NLRP9, and MAS1L as candidate genes for familial LOAD.

  5. Molecular evolution of the major chemosensory gene families in insects.

    Science.gov (United States)

    Sánchez-Gracia, A; Vieira, F G; Rozas, J

    2009-09-01

    Chemoreception is a crucial biological process that is essential for the survival of animals. In insects, olfaction allows the organism to recognise volatile cues that allow the detection of food, predators and mates, whereas the sense of taste commonly allows the discrimination of soluble stimulants that elicit feeding behaviours and can also initiate innate sexual and reproductive responses. The most important proteins involved in the recognition of chemical cues comprise moderately sized multigene families. These families include odorant-binding proteins (OBPs) and chemosensory proteins (CSPs), which are involved in peripheral olfactory processing, and the chemoreceptor superfamily formed by the olfactory receptor (OR) and gustatory receptor (GR) families. Here, we review some recent evolutionary genomic studies of chemosensory gene families using the data from fully sequenced insect genomes, especially from the 12 newly available Drosophila genomes. Overall, the results clearly support the birth-and-death model as the major mechanism of evolution in these gene families. Namely, new members arise by tandem gene duplication, progressively diverge in sequence and function, and can eventually be lost from the genome by a deletion or pseudogenisation event. Adaptive changes fostered by environmental shifts are also observed in the evolution of chemosensory families in insects and likely involve reproductive, ecological or behavioural traits. Consequently, the current size of these gene families is mainly a result of random gene gain and loss events. This dynamic process may represent a major source of genetic variation, providing opportunities for FUTURE specific adaptations.

  6. Genomewide analysis of TCP transcription factor gene family in ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 93; Issue 3. Genomewide ... Teosinte branched1/cycloidea/proliferating cell factor1 (TCP) proteins are a large family of transcriptional regulators in angiosperms. They are ... To the best of our knowledge, this is the first study of a genomewide analysis of apple TCP gene family.

  7. Identification of metalloprotease gene families in sugarcane

    Directory of Open Access Journals (Sweden)

    O.H.P. Ramos

    2001-12-01

    Full Text Available Metalloproteases play a key role in many physiological processes in mammals such as cell migration, tissue remodeling and processing of growth factors. They have also been identified as important factors in the patho-physiology of a number of human diseases, including cancer and hypertension. Many bacterial pathogens rely on proteases in order to infect the host. Several classes of metalloproteases have been described in humans, bacteria, snake venoms and insects. However, the presence and characterization of plant metalloproteases have rarely been described in the literature. In our research, we searched the sugarcane expressed sequence tag (SUCEST DNA library in order to identify, by homology with sequences deposited in other databases, metalloprotease gene families expressed under different conditions. Protein sequences from Arabidopsis thaliana and Glycine max were used to search the SUCEST data bank. Conserved regions corresponding to different metalloprotease domains and sequence motifs were identified in the reads to characterize each group of enzymes. At least four classes of sugarcane metalloproteases have been identified, i.e. matrix metalloproteases, zincins, inverzincins, and ATP-dependent metalloproteases. Each enzyme class was analyzed for its expression in different conditions and tissues.Metaloproteases exercem papéis importantes em muitos processos fisiológicos em mamíferos tais como migração celular, remodelamento tecidual e processamento de fatores de crescimento. Estas enzimas estão envolvidas também na pato-fisiologia de um grande número de doenças humanas como hipertensão e câncer. Muitas bactérias patogênicas dependem de proteases para infectar o hospedeiro. Diversas classes de metaloproteases foram descritas em seres humanos, bactérias, venenos de serpentes e insetos. No entanto, a presença e a caracterização de metaloproteases em plantas estão pouco descritas na literatura. Neste trabalho, foi

  8. Genome organization and expression of the rat ACBP gene family

    DEFF Research Database (Denmark)

    Mandrup, S; Andreasen, P H; Knudsen, J

    1993-01-01

    pool former. We have molecularly cloned and characterized the rat ACBP gene family which comprises one expressed and four processed pseudogenes. One of these was shown to exist in two allelic forms. A comprehensive computer-aided analysis of the promoter region of the expressed ACBP gene revealed...

  9. APC gene mutations and extraintestinal phenotype of familial adenomatous polyposis

    NARCIS (Netherlands)

    Giardiello, F. M.; Petersen, G. M.; Piantadosi, S.; Gruber, S. B.; Traboulsi, E. I.; Offerhaus, G. J.; Muro, K.; Krush, A. J.; Booker, S. V.; Luce, M. C.; Laken, S. J.; Kinzler, K. W.; Vogelstein, B.; Hamilton, S. R.

    1997-01-01

    Familial adenomatous polyposis (FAP) is caused by germline mutation of the adenomatous polyposis coli (APC) gene on chromosome 5q. This study assessed genotype-phenotype correlations for extraintestinal lesions in FAP. Mutations of the APC gene were compared with the occurrence of seven

  10. Host-parasite interaction: selective Pv-fam-a family proteins of Plasmodium vivax bind to a restricted number of human erythrocyte receptors.

    Science.gov (United States)

    Zeeshan, Mohammad; Tyagi, Rupesh Kumar; Tyagi, Kriti; Alam, Mohd Shoeb; Sharma, Yagya Dutta

    2015-04-01

    Plasmodium vivax synthesizes the largest number of 36 tryptophan-rich proteins belonging to the Pv-fam-a family. These parasite proteins need to be characterized for their biological function because tryptophan-rich proteins from other Plasmodium species have been proposed as vaccine candidates. Recombinant P. vivax tryptophan-rich antigens (PvTRAgs) were used to determine their erythrocyte-binding activity by a cell-based enzyme-linked immunosorbent assay, flow cytometry, and a rosetting assay. Only 4 (PvTRAg26.3, PvTRAg34, PvTRAg36, and PvTRAg36.6) of 21 PvTRAgs bind to host erythrocytes. The cross-competition data indicated that PvTRAg36 and PvTRAg34 share their erythrocyte receptors with previously described proteins PvTRAg38 and PvTRAg33.5, respectively. On the other hand, PvTRAg26.3 and PvTRAg36.6 cross-compete with each other and not with any other PvTRAg, indicating that these 2 proteins bind to the same but yet another set of erythrocyte receptor(s). Together, 10 of 36 PvTRAgs possess erythrocyte-binding activity in which each protein recognizes >1 erythrocyte receptor. Further, each erythrocyte receptor is shared by >1 PvTRAg. This redundancy may be useful for the parasite to invade red blood cells and cause disease pathogenesis, and it can be exploited to develop therapeutics against P. vivax malaria. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  11. A bioinformatic survey of RNA-binding proteins in Plasmodium.

    Science.gov (United States)

    Reddy, B P Niranjan; Shrestha, Sony; Hart, Kevin J; Liang, Xiaoying; Kemirembe, Karen; Cui, Liwang; Lindner, Scott E

    2015-11-02

    The malaria parasites in the genus Plasmodium have a very complicated life cycle involving an invertebrate vector and a vertebrate host. RNA-binding proteins (RBPs) are critical factors involved in every aspect of the development of these parasites. However, very few RBPs have been functionally characterized to date in the human parasite Plasmodium falciparum. Using different bioinformatic methods and tools we searched P. falciparum genome to list and annotate RBPs. A representative 3D models for each of the RBD domain identified in P. falciparum was created using I-TESSAR and SWISS-MODEL. Microarray and RNAseq data analysis pertaining PfRBPs was performed using MeV software. Finally, Cytoscape was used to create protein-protein interaction network for CITH-Dozi and Caf1-CCR4-Not complexes. We report the identification of 189 putative RBP genes belonging to 13 different families in Plasmodium, which comprise 3.5% of all annotated genes. Almost 90% (169/189) of these genes belong to six prominent RBP classes, namely RNA recognition motifs, DEAD/H-box RNA helicases, K homology, Zinc finger, Puf and Alba gene families. Interestingly, almost all of the identified RNA-binding helicases and KH genes have cognate homologs in model species, suggesting their evolutionary conservation. Exploration of the existing P. falciparum blood-stage transcriptomes revealed that most RBPs have peak mRNA expression levels early during the intraerythrocytic development cycle, which taper off in later stages. Nearly 27% of RBPs have elevated expression in gametocytes, while 47 and 24% have elevated mRNA expression in ookinete and asexual stages. Comparative interactome analyses using human and Plasmodium protein-protein interaction datasets suggest extensive conservation of the PfCITH/PfDOZI and PfCaf1-CCR4-NOT complexes. The Plasmodium parasites possess a large number of putative RBPs belonging to most of RBP families identified so far, suggesting the presence of extensive post

  12. The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Baumgarten Andrew

    2004-06-01

    Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.

  13. Plasmodium falciparum var genes expressed in children with severe malaria encode CIDRα1 domains

    DEFF Research Database (Denmark)

    Jespersen, Jakob S.; Wang, Christian W.; Mkumbaye, Sixbert I.

    2016-01-01

    Most severe Plasmodium falciparum infections are experienced by young children. Severe symptoms are precipitated by vascular sequestration of parasites expressing a particular subset of the polymorphic P. falciparum erythrocyte membrane protein 1 (PfEMP1) adhesion molecules. Parasites binding hum...... the hypothesis that the CIDRα1-EPCR interaction is key to the pathogenesis of severe malaria and strengthen the rationale for pursuing a vaccine or adjunctive treatment aiming at inhibiting or reducing the damaging effects of this interaction....

  14. Plasmodium P-Type Cyclin CYC3 Modulates Endomitotic Growth during Oocyst Development in Mosquitoes.

    Science.gov (United States)

    Roques, Magali; Wall, Richard J; Douglass, Alexander P; Ramaprasad, Abhinay; Ferguson, David J P; Kaindama, Mbinda L; Brusini, Lorenzo; Joshi, Nimitray; Rchiad, Zineb; Brady, Declan; Guttery, David S; Wheatley, Sally P; Yamano, Hiroyuki; Holder, Anthony A; Pain, Arnab; Wickstead, Bill; Tewari, Rita

    2015-11-01

    Cell-cycle progression and cell division in eukaryotes are governed in part by the cyclin family and their regulation of cyclin-dependent kinases (CDKs). Cyclins are very well characterised in model systems such as yeast and human cells, but surprisingly little is known about their number and role in Plasmodium, the unicellular protozoan parasite that causes malaria. Malaria parasite cell division and proliferation differs from that of many eukaryotes. During its life cycle it undergoes two types of mitosis: endomitosis in asexual stages and an extremely rapid mitotic process during male gametogenesis. Both schizogony (producing merozoites) in host liver and red blood cells, and sporogony (producing sporozoites) in the mosquito vector, are endomitotic with repeated nuclear replication, without chromosome condensation, before cell division. The role of specific cyclins during Plasmodium cell proliferation was unknown. We show here that the Plasmodium genome contains only three cyclin genes, representing an unusual repertoire of cyclin classes. Expression and reverse genetic analyses of the single Plant (P)-type cyclin, CYC3, in the rodent malaria parasite, Plasmodium berghei, revealed a cytoplasmic and nuclear location of the GFP-tagged protein throughout the lifecycle. Deletion of cyc3 resulted in defects in size, number and growth of oocysts, with abnormalities in budding and sporozoite formation. Furthermore, global transcript analysis of the cyc3-deleted and wild type parasites at gametocyte and ookinete stages identified differentially expressed genes required for signalling, invasion and oocyst development. Collectively these data suggest that cyc3 modulates oocyst endomitotic development in Plasmodium berghei.

  15. Plasmodium P-Type Cyclin CYC3 Modulates Endomitotic Growth during Oocyst Development in Mosquitoes

    KAUST Repository

    Roques, Magali; Wall, Richard J.; Douglass, Alexander P.; Ramaprasad, Abhinay; Ferguson, David J. P.; Kaindama, Mbinda L.; Brusini, Lorenzo; Joshi, Nimitray; Rchiad, ‍ Zineb; Brady, Declan; Guttery, David S.; Wheatley, Sally P.; Yamano, Hiroyuki; Holder, Anthony A.; Pain, Arnab; Wickstead, Bill; Tewari, Rita

    2015-01-01

    Cell-cycle progression and cell division in eukaryotes are governed in part by the cyclin family and their regulation of cyclin-dependent kinases (CDKs). Cyclins are very well characterised in model systems such as yeast and human cells, but surprisingly little is known about their number and role in Plasmodium, the unicellular protozoan parasite that causes malaria. Malaria parasite cell division and proliferation differs from that of many eukaryotes. During its life cycle it undergoes two types of mitosis: endomitosis in asexual stages and an extremely rapid mitotic process during male gametogenesis. Both schizogony (producing merozoites) in host liver and red blood cells, and sporogony (producing sporozoites) in the mosquito vector, are endomitotic with repeated nuclear replication, without chromosome condensation, before cell division. The role of specific cyclins during Plasmodium cell proliferation was unknown. We show here that the Plasmodium genome contains only three cyclin genes, representing an unusual repertoire of cyclin classes. Expression and reverse genetic analyses of the single Plant (P)-type cyclin, CYC3, in the rodent malaria parasite, Plasmodium berghei, revealed a cytoplasmic and nuclear location of the GFP-tagged protein throughout the lifecycle. Deletion of cyc3 resulted in defects in size, number and growth of oocysts, with abnormalities in budding and sporozoite formation. Furthermore, global transcript analysis of the cyc3-deleted and wild type parasites at gametocyte and ookinete stages identified differentially expressed genes required for signalling, invasion and oocyst development. Collectively these data suggest that cyc3 modulates oocyst endomitotic development in Plasmodium berghei.

  16. Plasmodium P-Type Cyclin CYC3 Modulates Endomitotic Growth during Oocyst Development in Mosquitoes

    KAUST Repository

    Roques, Magali

    2015-11-13

    Cell-cycle progression and cell division in eukaryotes are governed in part by the cyclin family and their regulation of cyclin-dependent kinases (CDKs). Cyclins are very well characterised in model systems such as yeast and human cells, but surprisingly little is known about their number and role in Plasmodium, the unicellular protozoan parasite that causes malaria. Malaria parasite cell division and proliferation differs from that of many eukaryotes. During its life cycle it undergoes two types of mitosis: endomitosis in asexual stages and an extremely rapid mitotic process during male gametogenesis. Both schizogony (producing merozoites) in host liver and red blood cells, and sporogony (producing sporozoites) in the mosquito vector, are endomitotic with repeated nuclear replication, without chromosome condensation, before cell division. The role of specific cyclins during Plasmodium cell proliferation was unknown. We show here that the Plasmodium genome contains only three cyclin genes, representing an unusual repertoire of cyclin classes. Expression and reverse genetic analyses of the single Plant (P)-type cyclin, CYC3, in the rodent malaria parasite, Plasmodium berghei, revealed a cytoplasmic and nuclear location of the GFP-tagged protein throughout the lifecycle. Deletion of cyc3 resulted in defects in size, number and growth of oocysts, with abnormalities in budding and sporozoite formation. Furthermore, global transcript analysis of the cyc3-deleted and wild type parasites at gametocyte and ookinete stages identified differentially expressed genes required for signalling, invasion and oocyst development. Collectively these data suggest that cyc3 modulates oocyst endomitotic development in Plasmodium berghei.

  17. Neutral polymorphisms in putative housekeeping genes and tandem repeats unravels the population genetics and evolutionary history of Plasmodium vivax in India.

    Directory of Open Access Journals (Sweden)

    Surendra K Prajapati

    Full Text Available The evolutionary history and age of Plasmodium vivax has been inferred as both recent and ancient by several studies, mainly using mitochondrial genome diversity. Here we address the age of P. vivax on the Indian subcontinent using selectively neutral housekeeping genes and tandem repeat loci. Analysis of ten housekeeping genes revealed a substantial number of SNPs (n = 75 from 100 P. vivax isolates collected from five geographical regions of India. Neutrality tests showed a majority of the housekeeping genes were selectively neutral, confirming the suitability of housekeeping genes for inferring the evolutionary history of P. vivax. In addition, a genetic differentiation test using housekeeping gene polymorphism data showed a lack of geographical structuring between the five regions of India. The coalescence analysis of the time to the most recent common ancestor estimate yielded an ancient TMRCA (232,228 to 303,030 years and long-term population history (79,235 to 104,008 of extant P. vivax on the Indian subcontinent. Analysis of 18 tandem repeat loci polymorphisms showed substantial allelic diversity and heterozygosity per locus, and analysis of potential bottlenecks revealed the signature of a stable P. vivax population, further corroborating our ancient age estimates. For the first time we report a comparable evolutionary history of P. vivax inferred by nuclear genetic markers (putative housekeeping genes to that inferred from mitochondrial genome diversity.

  18. Neutral polymorphisms in putative housekeeping genes and tandem repeats unravels the population genetics and evolutionary history of Plasmodium vivax in India.

    Science.gov (United States)

    Prajapati, Surendra K; Joshi, Hema; Carlton, Jane M; Rizvi, M Alam

    2013-01-01

    The evolutionary history and age of Plasmodium vivax has been inferred as both recent and ancient by several studies, mainly using mitochondrial genome diversity. Here we address the age of P. vivax on the Indian subcontinent using selectively neutral housekeeping genes and tandem repeat loci. Analysis of ten housekeeping genes revealed a substantial number of SNPs (n = 75) from 100 P. vivax isolates collected from five geographical regions of India. Neutrality tests showed a majority of the housekeeping genes were selectively neutral, confirming the suitability of housekeeping genes for inferring the evolutionary history of P. vivax. In addition, a genetic differentiation test using housekeeping gene polymorphism data showed a lack of geographical structuring between the five regions of India. The coalescence analysis of the time to the most recent common ancestor estimate yielded an ancient TMRCA (232,228 to 303,030 years) and long-term population history (79,235 to 104,008) of extant P. vivax on the Indian subcontinent. Analysis of 18 tandem repeat loci polymorphisms showed substantial allelic diversity and heterozygosity per locus, and analysis of potential bottlenecks revealed the signature of a stable P. vivax population, further corroborating our ancient age estimates. For the first time we report a comparable evolutionary history of P. vivax inferred by nuclear genetic markers (putative housekeeping genes) to that inferred from mitochondrial genome diversity.

  19. Selection of Plasmodium falciparum Multidrug Resistance Gene 1 Alleles in Asexual Stages and Gametocytes by Artemether-Lumefantrine in Nigerian Children with Uncomplicated Falciparum Malaria ▿

    Science.gov (United States)

    Happi, C. T.; Gbotosho, G. O.; Folarin, O. A.; Sowunmi, A.; Hudson, T.; O'Neil, M.; Milhous, W.; Wirth, D. F.; Oduola, A. M. J.

    2009-01-01

    We assessed Plasmodium falciparum mdr1 (Pfmdr1) gene polymorphisms and copy numbers as well as P. falciparum Ca2+ ATPase (PfATPase6) gene polymorphisms in 90 Nigerian children presenting with uncomplicated falciparum malaria and enrolled in a study of the efficacy of artemether-lumefantrine (AL). The nested PCR-restriction fragment length polymorphism and the quantitative real-time PCR methodologies were used to determine the alleles of the Pfmdr1 and PfATPase6 genes and the Pfmdr1 copy number variation, respectively, in patients samples collected prior to treatment and at the reoccurrence of parasites during a 42-day follow-up. The Pfmdr1 haplotype 86N-184F-1246D was significantly associated (P copy of the Pfmdr1 gene and the wild-type allele (L89) at codon 89 of the PfATPase6 gene. These findings suggest that polymorphisms in the Pfmdr1 gene are under AL selection pressure. Pfmdr1 polymorphisms may result in reduction in the therapeutic efficacy of this newly adopted combination treatment for uncomplicated falciparum malaria in Saharan countries of Africa. PMID:19075074

  20. Selection of Plasmodium falciparum multidrug resistance gene 1 alleles in asexual stages and gametocytes by artemether-lumefantrine in Nigerian children with uncomplicated falciparum malaria.

    Science.gov (United States)

    Happi, C T; Gbotosho, G O; Folarin, O A; Sowunmi, A; Hudson, T; O'Neil, M; Milhous, W; Wirth, D F; Oduola, A M J

    2009-03-01

    We assessed Plasmodium falciparum mdr1 (Pfmdr1) gene polymorphisms and copy numbers as well as P. falciparum Ca(2+) ATPase (PfATPase6) gene polymorphisms in 90 Nigerian children presenting with uncomplicated falciparum malaria and enrolled in a study of the efficacy of artemether-lumefantrine (AL). The nested PCR-restriction fragment length polymorphism and the quantitative real-time PCR methodologies were used to determine the alleles of the Pfmdr1 and PfATPase6 genes and the Pfmdr1 copy number variation, respectively, in patients samples collected prior to treatment and at the reoccurrence of parasites during a 42-day follow-up. The Pfmdr1 haplotype 86N-184F-1246D was significantly associated (P copy of the Pfmdr1 gene and the wild-type allele (L89) at codon 89 of the PfATPase6 gene. These findings suggest that polymorphisms in the Pfmdr1 gene are under AL selection pressure. Pfmdr1 polymorphisms may result in reduction in the therapeutic efficacy of this newly adopted combination treatment for uncomplicated falciparum malaria in Saharan countries of Africa.

  1. Evolution of the YABBY gene family in seed plants.

    Science.gov (United States)

    Finet, Cédric; Floyd, Sandra K; Conway, Stephanie J; Zhong, Bojian; Scutt, Charles P; Bowman, John L

    2016-01-01

    Members of the YABBY gene family of transcription factors in angiosperms have been shown to be involved in the initiation of outgrowth of the lamina, the maintenance of polarity, and establishment of the leaf margin. Although most of the dorsal-ventral polarity genes in seed plants have homologs in non-spermatophyte lineages, the presence of YABBY genes is restricted to seed plants. To gain insight into the origin and diversification of this gene family, we reconstructed the evolutionary history of YABBY gene lineages in seed plants. Our findings suggest that either one or two YABBY genes were present in the last common ancestor of extant seed plants. We also examined the expression of YABBY genes in the gymnosperms Ephedra distachya (Gnetales), Ginkgo biloba (Ginkgoales), and Pseudotsuga menziesii (Coniferales). Our data indicate that some YABBY genes are expressed in a polar (abaxial) manner in leaves and female cones in gymnosperms. We propose that YABBY genes already acted as polarity genes in the last common ancestor of extant seed plants. © 2016 Wiley Periodicals, Inc.

  2. Molecular Evolution of the Glycosyltransferase 6 Gene Family in Primates

    Directory of Open Access Journals (Sweden)

    Eliane Evanovich

    2016-01-01

    Full Text Available Glycosyltransferase 6 gene family includes ABO, Ggta1, iGb3S, and GBGT1 genes and by three putative genes restricted to mammals, GT6m6, GTm6, and GT6m7, only the latter is found in primates. GT6 genes may encode functional and nonfunctional proteins. Ggta1 and GBGT1 genes, for instance, are pseudogenes in catarrhine primates, while iGb3S gene is only inactive in human, bonobo, and chimpanzee. Even inactivated, these genes tend to be conversed in primates. As some of the GT6 genes are related to the susceptibility or resistance to parasites, we investigated (i the selective pressure on the GT6 paralogs genes in primates; (ii the basis of the conservation of iGb3S in human, chimpanzee, and bonobo; and (iii the functional potential of the GBGT1 and GT6m7 in catarrhines. We observed that the purifying selection is prevalent and these genes have a low diversity, though ABO and Ggta1 genes have some sites under positive selection. GT6m7, a putative gene associated with aggressive periodontitis, may have regulatory function, but experimental studies are needed to assess its function. The evolutionary conservation of iGb3S in humans, chimpanzee, and bonobo seems to be the result of proximity to genes with important biological functions.

  3. In Vitro Variant Surface Antigen Expression in Plasmodium falciparum Parasites from a Semi-Immune Individual Is Not Correlated with Var Gene Transcription

    Science.gov (United States)

    Tschan, Serena; Flötenmeyer, Matthias; Koch, Iris; Berger, Jürgen; Kremsner, Peter; Frank, Matthias

    2016-01-01

    Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) is considered to be the main variant surface antigen (VSA) of Plasmodium falciparum and is mainly localized on electron-dense knobs in the membrane of the infected erythrocyte. Switches in PfEMP1 expression provide the basis for antigenic variation and are thought to be critical for parasite persistence during chronic infections. Recently, strain transcending anti-PfEMP1 immunity has been shown to develop early in life, challenging the role of PfEMP1 in antigenic variation during chronic infections. In this work we investigate how P. falciparum achieves persistence during a chronic asymptomatic infection. The infected individual (MOA) was parasitemic for 42 days and multilocus var gene genotyping showed persistence of the same parasite population throughout the infection. Parasites from the beginning of the infection were adapted to tissue culture and cloned by limiting dilution. Flow cytometry using convalescent serum detected a variable surface recognition signal on isogenic clonal parasites. Quantitative real-time PCR with a field isolate specific var gene primer set showed that the surface recognition signal was not correlated with transcription of individual var genes. Strain transcending anti-PfEMP1 immunity of the convalescent serum was demonstrated with CD36 selected and PfEMP1 knock-down NF54 clones. In contrast, knock-down of PfEMP1 did not have an effect on the antibody recognition signal in MOA clones. Trypsinisation of the membrane surface proteins abolished the surface recognition signal and immune electron microscopy revealed that antibodies from the convalescent serum bound to membrane areas without knobs and with knobs. Together the data indicate that PfEMP1 is not the main variable surface antigen during a chronic infection and suggest a role for trypsin sensitive non-PfEMP1 VSAs for parasite persistence in chronic infections. PMID:27907004

  4. Discovering regulatory motifs in the Plasmodium genome using comparative genomics

    OpenAIRE

    Wu, Jie; Sieglaff, Douglas H.; Gervin, Joshua; Xie, Xiaohui S.

    2008-01-01

    Motivation: Understanding gene regulation in Plasmodium, the causative agent of malaria, is an important step in deciphering its complex life cycle as well as leading to possible new targets for therapeutic applications. Very little is known about gene regulation in Plasmodium, and in particular, few regulatory elements have been identified. Such discovery has been significantly hampered by the high A-T content of some of the genomes of Plasmodium species, as well as the challenge in associat...

  5. msh/Msx gene family in neural development.

    Science.gov (United States)

    Ramos, Casto; Robert, Benoît

    2005-11-01

    The involvement of Msx homeobox genes in skull and tooth formation has received a great deal of attention. Recent studies also indicate a role for the msh/Msx gene family in development of the nervous system. In this article, we discuss the functions of these transcription factors in neural-tissue organogenesis. We will deal mainly with the interactions of the Drosophila muscle segment homeobox (msh) gene with other homeobox genes and the repressive cascade that leads to neuroectoderm patterning; the role of Msx genes in neural-crest induction, focusing especially on the differences between lower and higher vertebrates; their implication in patterning of the vertebrate neural tube, particularly in diencephalon midline formation. Finally, we will examine the distinct activities of Msx1, Msx2 and Msx3 genes during neurogenesis, taking into account their relationships with signalling molecules such as BMP.

  6. The sieve element occlusion gene family in dicotyledonous plants.

    Science.gov (United States)

    Ernst, Antonia M; Rüping, Boris; Jekat, Stephan B; Nordzieke, Steffen; Reineke, Anna R; Müller, Boje; Bornberg-Bauer, Erich; Prüfer, Dirk; Noll, Gundula A

    2011-01-01

    Sieve element occlusion (SEO) genes encoding forisome subunits have been identified in Medicago truncatula and other legumes. Forisomes are structural phloem proteins uniquely found in Fabaceae sieve elements. They undergo a reversible conformational change after wounding, from a condensed to a dispersed state, thereby blocking sieve tube translocation and preventing the loss of photoassimilates. Recently, we identified SEO genes in several non-Fabaceae plants (lacking forisomes) and concluded that they most probably encode conventional non-forisome P-proteins. Molecular and phylogenetic analysis of the SEO gene family has identified domains that are characteristic for SEO proteins. Here, we extended our phylogenetic analysis by including additional SEO genes from several diverse species based on recently published genomic data. Our results strengthen the original assumption that SEO genes seem to be widespread in dicotyledonous angiosperms, and further underline the divergent evolution of SEO genes within the Fabaceae.

  7. Island-wide diversity in single nucleotide polymorphisms of the Plasmodium vivax dihydrofolate reductase and dihydropteroate synthetase genes in Sri Lanka

    DEFF Research Database (Denmark)

    Schousboe, Mette L; Rajakaruna, Rupika S; Salanti, Ali

    2007-01-01

    into the level of drug pressure caused by SP use and presumably other antifolate drugs. In Sri Lanka, chloroquine (CQ) with primaquine (PQ) and SP with PQ is used as first and second line treatment, respectively, against uncomplicated Plasmodium falciparum and/or P. vivax infections. CQ/PQ is still efficacious...... against P. vivax infections, thus SP is rarely used and it is assumed that the prevalence of SNPs related to P. vivax SP resistance is low. However, this has not been assessed in Sri Lanka as in most other parts of Asia. This study describes the prevalence and distribution of SNPs related to P. vivax SP...... and 383, 553 and 585 of the Pvdhps gene by applying PCR followed by a hybridization step using sequence specific oligonucleotide probes (SSOPs) in an ELISA format. RESULTS: In the study period, the government of Sri Lanka recorded 2,149 P. vivax cases from the nine districts out of which, 454 (21...

  8. Evolution of the vertebrate insulin receptor substrate (Irs) gene family.

    Science.gov (United States)

    Al-Salam, Ahmad; Irwin, David M

    2017-06-23

    Insulin receptor substrate (Irs) proteins are essential for insulin signaling as they allow downstream effectors to dock with, and be activated by, the insulin receptor. A family of four Irs proteins have been identified in mice, however the gene for one of these, IRS3, has been pseudogenized in humans. While it is known that the Irs gene family originated in vertebrates, it is not known when it originated and which members are most closely related to each other. A better understanding of the evolution of Irs genes and proteins should provide insight into the regulation of metabolism by insulin. Multiple genes for Irs proteins were identified in a wide variety of vertebrate species. Phylogenetic and genomic neighborhood analyses indicate that this gene family originated very early in vertebrae evolution. Most Irs genes were duplicated and retained in fish after the fish-specific genome duplication. Irs genes have been lost of various lineages, including Irs3 in primates and birds and Irs1 in most fish. Irs3 and Irs4 experienced an episode of more rapid protein sequence evolution on the ancestral mammalian lineage. Comparisons of the conservation of the proteins sequences among Irs paralogs show that domains involved in binding to the plasma membrane and insulin receptors are most strongly conserved, while divergence has occurred in sequences involved in interacting with downstream effector proteins. The Irs gene family originated very early in vertebrate evolution, likely through genome duplications, and in parallel with duplications of other components of the insulin signaling pathway, including insulin and the insulin receptor. While the N-terminal sequences of these proteins are conserved among the paralogs, changes in the C-terminal sequences likely allowed changes in biological function.

  9. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    International Nuclear Information System (INIS)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-01-01

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society

  10. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    Energy Technology Data Exchange (ETDEWEB)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-09-18

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.

  11. In-depth comparative analysis of malaria parasite genomes reveals protein-coding genes linked to human disease in Plasmodium falciparum genome.

    Science.gov (United States)

    Liu, Xuewu; Wang, Yuanyuan; Liang, Jiao; Wang, Luojun; Qin, Na; Zhao, Ya; Zhao, Gang

    2018-05-02

    Plasmodium falciparum is the most virulent malaria parasite capable of parasitizing human erythrocytes. The identification of genes related to this capability can enhance our understanding of the molecular mechanisms underlying human malaria and lead to the development of new therapeutic strategies for malaria control. With the availability of several malaria parasite genome sequences, performing computational analysis is now a practical strategy to identify genes contributing to this disease. Here, we developed and used a virtual genome method to assign 33,314 genes from three human malaria parasites, namely, P. falciparum, P. knowlesi and P. vivax, and three rodent malaria parasites, namely, P. berghei, P. chabaudi and P. yoelii, to 4605 clusters. Each cluster consisted of genes whose protein sequences were significantly similar and was considered as a virtual gene. Comparing the enriched values of all clusters in human malaria parasites with those in rodent malaria parasites revealed 115 P. falciparum genes putatively responsible for parasitizing human erythrocytes. These genes are mainly located in the chromosome internal regions and participate in many biological processes, including membrane protein trafficking and thiamine biosynthesis. Meanwhile, 289 P. berghei genes were included in the rodent parasite-enriched clusters. Most are located in subtelomeric regions and encode erythrocyte surface proteins. Comparing cluster values in P. falciparum with those in P. vivax and P. knowlesi revealed 493 candidate genes linked to virulence. Some of them encode proteins present on the erythrocyte surface and participate in cytoadhesion, virulence factor trafficking, or erythrocyte invasion, but many genes with unknown function were also identified. Cerebral malaria is characterized by accumulation of infected erythrocytes at trophozoite stage in brain microvascular. To discover cerebral malaria-related genes, fast Fourier transformation (FFT) was introduced to extract

  12. Robust inducible Cre recombinase activity in the human malaria parasite Plasmodium falciparum enables efficient gene deletion within a single asexual erythrocytic growth cycle.

    Science.gov (United States)

    Collins, Christine R; Das, Sujaan; Wong, Eleanor H; Andenmatten, Nicole; Stallmach, Robert; Hackett, Fiona; Herman, Jean-Paul; Müller, Sylke; Meissner, Markus; Blackman, Michael J

    2013-05-01

    Asexual blood stages of the malaria parasite, which cause all the pathology associated with malaria, can readily be genetically modified by homologous recombination, enabling the functional study of parasite genes that are not essential in this part of the life cycle. However, no widely applicable method for conditional mutagenesis of essential asexual blood-stage malarial genes is available, hindering their functional analysis. We report the application of the DiCre conditional recombinase system to Plasmodium falciparum, the causative agent of the most dangerous form of malaria. We show that DiCre can be used to obtain rapid, highly regulated site-specific recombination in P. falciparum, capable of excising loxP-flanked sequences from a genomic locus with close to 100% efficiency within the time-span of a single erythrocytic growth cycle. DiCre-mediated deletion of the SERA5 3' UTR failed to reduce expression of the gene due to the existence of alternative cryptic polyadenylation sites within the modified locus. However, we successfully used the system to recycle the most widely used drug resistance marker for P. falciparum, human dihydrofolate reductase, in the process producing constitutively DiCre-expressing P. falciparum clones that have broad utility for the functional analysis of essential asexual blood-stage parasite genes. © 2013 John Wiley & Sons Ltd.

  13. Human heavy-chain variable region gene family nonrandomly rearranged in familial chronic lymphocytic leukemia

    International Nuclear Information System (INIS)

    Shen, A.; Humphries, C.; Tucker, P.; Blattner, F.

    1987-01-01

    The authors have identified a family of human immunoglobulin heavy-chain variable-region (V/sub H/) genes, one member of which is rearranged in two affected members of a family in which the father and four of five siblings developed chronic lymphocytic leukemia. Cloning and sequencing of the rearranged V/sub H/ genes from leukemic lymphocytes of three affected siblings showed that two siblings had rearranged V/sub H/ genes (V/sub H/TS1 and V/sub H/WS1) that were 90% homologous. The corresponding germ-line gene, V/sub H/251, was found to part of a small (four gene) V/sub H/ gene family, which they term V/sub H/V. The DNA sequence homology to V/sub H/WS1 (95%) and V/sub H/TS1 (88%) and identical restriction sites on the 5' side of V/sub H/ confirm that rearrangement of V/sub H/251 followed by somatic mutation produced the identical V/sub H/ gene rearrangements in the two siblings. V/sub H/TS1 is not a functional V/sub H/ gene; a functional V/sub H/ rearrangement was found on the other chromosome of this patient. The other two siblings had different V/sub H/ gene rearrangements. All used different diversity genes. Mechanisms proposed for nonrandom selection of a single V/sub H/ gene include developmental regulation of this V/sub H/ gene rearrangement or selection of a subpopulation of B cells in which this V/sub H/ has been rearranged

  14. Small Mutations of the DMD Gene in Taiwanese Families

    Directory of Open Access Journals (Sweden)

    Hsiao-Lin Hwa

    2008-06-01

    Conclusion: Most identified mutations either led to a predictable premature stop codon or resulted in splicing defects, which caused defective function of dystrophin. Our findings extend the mutation spectrum of the DMD gene. Molecular characterization of the affected families is important for genetic counseling and prenatal diagnosis.

  15. Genetic diversity of bitter taste receptor gene family in Sichuan

    Indian Academy of Sciences (India)

    Genetic diversity of bitter taste receptor gene family in Sichuan domestic and Tibetan chicken populations. YUAN SU DIYAN LI UMA GAUR YAN WANG NAN WU BINLONG CHEN HONGXIAN XU HUADONG YIN YAODONG HU QING ZHU. RESEARCH ARTICLE Volume 95 Issue 3 September 2016 pp 675-681 ...

  16. Genomewide analysis of TCP transcription factor gene family in ...

    Indian Academy of Sciences (India)

    2014-12-09

    Dec 9, 2014 ... study of a genomewide analysis of apple TCP gene family. These results provide .... synthesize the first-strand cDNA using the PrimeScript First. Strand cDNA ..... only detected in the stem, leaf and fruit (figure 8). When.

  17. Identification of the trehalose-6-phosphate synthase gene family in ...

    Indian Academy of Sciences (India)

    2015-03-04

    Mar 4, 2015 ... stress, however, our study mainly analysed the TPS gene family under freezing conditions in winter wheat .... size the first-strand cDNA using the Fermentas RevertAid ..... In the stem of Dongnongdongmai 1, TaTPS1, 2, 3, 4, 8,.

  18. Gene family size conservation is a good indicator of evolutionary rates.

    Science.gov (United States)

    Chen, Feng-Chi; Chen, Chiuan-Jung; Li, Wen-Hsiung; Chuang, Trees-Juen

    2010-08-01

    The evolution of duplicate genes has been a topic of broad interest. Here, we propose that the conservation of gene family size is a good indicator of the rate of sequence evolution and some other biological properties. By comparing the human-chimpanzee-macaque orthologous gene families with and without family size conservation, we demonstrate that genes with family size conservation evolve more slowly than those without family size conservation. Our results further demonstrate that both family expansion and contraction events may accelerate gene evolution, resulting in elevated evolutionary rates in the genes without family size conservation. In addition, we show that the duplicate genes with family size conservation evolve significantly more slowly than those without family size conservation. Interestingly, the median evolutionary rate of singletons falls in between those of the above two types of duplicate gene families. Our results thus suggest that the controversy on whether duplicate genes evolve more slowly than singletons can be resolved when family size conservation is taken into consideration. Furthermore, we also observe that duplicate genes with family size conservation have the highest level of gene expression/expression breadth, the highest proportion of essential genes, and the lowest gene compactness, followed by singletons and then by duplicate genes without family size conservation. Such a trend accords well with our observations of evolutionary rates. Our results thus point to the importance of family size conservation in the evolution of duplicate genes.

  19. Evolution of the MAGUK protein gene family in premetazoan lineages

    Directory of Open Access Journals (Sweden)

    Ruiz-Trillo Iñaki

    2010-04-01

    Full Text Available Abstract Background Cell-to-cell communication is a key process in multicellular organisms. In multicellular animals, scaffolding proteins belonging to the family of membrane-associated guanylate kinases (MAGUK are involved in the regulation and formation of cell junctions. These MAGUK proteins were believed to be exclusive to Metazoa. However, a MAGUK gene was recently identified in an EST survey of Capsaspora owczarzaki, an unicellular organism that branches off near the metazoan clade. To further investigate the evolutionary history of MAGUK, we have undertook a broader search for this gene family using available genomic sequences of different opisthokont taxa. Results Our survey and phylogenetic analyses show that MAGUK proteins are present not only in Metazoa, but also in the choanoflagellate Monosiga brevicollis and in the protist Capsaspora owczarzaki. However, MAGUKs are absent from fungi, amoebozoans or any other eukaryote. The repertoire of MAGUKs in Placozoa and eumetazoan taxa (Cnidaria + Bilateria is quite similar, except for one class that is missing in Trichoplax, while Porifera have a simpler MAGUK repertoire. However, Vertebrata have undergone several independent duplications and exhibit two exclusive MAGUK classes. Three different MAGUK types are found in both M. brevicollis and C. owczarzaki: DLG, MPP and MAGI. Furthermore, M. brevicollis has suffered a lineage-specific diversification. Conclusions The diversification of the MAGUK protein gene family occurred, most probably, prior to the divergence between Metazoa+choanoflagellates and the Capsaspora+Ministeria clade. A MAGI-like, a DLG-like, and a MPP-like ancestral genes were already present in the unicellular ancestor of Metazoa, and new gene members have been incorporated through metazoan evolution within two major periods, one before the sponge-eumetazoan split and another within the vertebrate lineage. Moreover, choanoflagellates have suffered an independent MAGUK

  20. PlantTribes: a gene and gene family resource for comparative genomics in plants

    OpenAIRE

    Wall, P. Kerr; Leebens-Mack, Jim; Müller, Kai F.; Field, Dawn; Altman, Naomi S.; dePamphilis, Claude W.

    2007-01-01

    The PlantTribes database (http://fgp.huck.psu.edu/tribe.html) is a plant gene family database based on the inferred proteomes of five sequenced plant species: Arabidopsis thaliana, Carica papaya, Medicago truncatula, Oryza sativa and Populus trichocarpa. We used the graph-based clustering algorithm MCL [Van Dongen (Technical Report INS-R0010 2000) and Enright et al. (Nucleic Acids Res. 2002; 30: 1575–1584)] to classify all of these species’ protein-coding genes into putative gene families, ca...

  1. Characterization of the MLO gene family in Rosaceae and gene expression analysis in Malus domestica.

    Science.gov (United States)

    Pessina, Stefano; Pavan, Stefano; Catalano, Domenico; Gallotta, Alessandra; Visser, Richard G F; Bai, Yuling; Malnoy, Mickael; Schouten, Henk J

    2014-07-22

    Powdery mildew (PM) is a major fungal disease of thousands of plant species, including many cultivated Rosaceae. PM pathogenesis is associated with up-regulation of MLO genes during early stages of infection, causing down-regulation of plant defense pathways. Specific members of the MLO gene family act as PM-susceptibility genes, as their loss-of-function mutations grant durable and broad-spectrum resistance. We carried out a genome-wide characterization of the MLO gene family in apple, peach and strawberry, and we isolated apricot MLO homologs through a PCR-approach. Evolutionary relationships between MLO homologs were studied and syntenic blocks constructed. Homologs that are candidates for being PM susceptibility genes were inferred by phylogenetic relationships with functionally characterized MLO genes and, in apple, by monitoring their expression following inoculation with the PM causal pathogen Podosphaera leucotricha. Genomic tools available for Rosaceae were exploited in order to characterize the MLO gene family. Candidate MLO susceptibility genes were identified. In follow-up studies it can be investigated whether silencing or a loss-of-function mutations in one or more of these candidate genes leads to PM resistance.

  2. Early evolution of the LIM homeobox gene family

    Energy Technology Data Exchange (ETDEWEB)

    Srivastava, Mansi; Larroux, Claire; Lu, Daniel R; Mohanty, Kareshma; Chapman, Jarrod; Degnan, Bernard M; Rokhsar, Daniel S

    2010-01-01

    LIM homeobox (Lhx) transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons) indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In Nematostella, Lhx gene expression is correlated with neural

  3. Early evolution of the LIM homeobox gene family

    Directory of Open Access Journals (Sweden)

    Degnan Bernard M

    2010-01-01

    Full Text Available Abstract Background LIM homeobox (Lhx transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. Results We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. Conclusions The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In

  4. Functional Identification of the Plasmodium Centromere and Generation of a Plasmodium Artificial Chromosome

    OpenAIRE

    Iwanaga, Shiroh; Khan, Shahid M.; Kaneko, Izumi; Christodoulou, Zoe; Newbold, Chris; Yuda, Masao; Janse, Chris J.; Waters, Andrew P.

    2010-01-01

    Summary The artificial chromosome represents a useful tool for gene transfer, both as cloning vectors and in chromosome biology research. To generate a Plasmodium artificial chromosome (PAC), we had to first functionally identify and characterize the parasite's centromere. A putative centromere (pbcen5) was cloned from chromosome 5 of the rodent parasite P. berghei based on a Plasmodium gene-synteny map. Plasmids containing pbcen5 were stably maintained in parasites during a blood-stage infec...

  5. Plant ion channels: gene families, physiology, and functional genomics analyses.

    Science.gov (United States)

    Ward, John M; Mäser, Pascal; Schroeder, Julian I

    2009-01-01

    Distinct potassium, anion, and calcium channels in the plasma membrane and vacuolar membrane of plant cells have been identified and characterized by patch clamping. Primarily owing to advances in Arabidopsis genetics and genomics, and yeast functional complementation, many of the corresponding genes have been identified. Recent advances in our understanding of ion channel genes that mediate signal transduction and ion transport are discussed here. Some plant ion channels, for example, ALMT and SLAC anion channel subunits, are unique. The majority of plant ion channel families exhibit homology to animal genes; such families include both hyperpolarization- and depolarization-activated Shaker-type potassium channels, CLC chloride transporters/channels, cyclic nucleotide-gated channels, and ionotropic glutamate receptor homologs. These plant ion channels offer unique opportunities to analyze the structural mechanisms and functions of ion channels. Here we review gene families of selected plant ion channel classes and discuss unique structure-function aspects and their physiological roles in plant cell signaling and transport.

  6. Chromosomal evolution of the PKD1 gene family in primates

    Directory of Open Access Journals (Sweden)

    Krawczak Michael

    2008-09-01

    Full Text Available Abstract Background The autosomal dominant polycystic kidney disease (ADPKD is mostly caused by mutations in the PKD1 (polycystic kidney disease 1 gene located in 16p13.3. Moreover, there are six pseudogenes of PKD1 that are located proximal to the master gene in 16p13.1. In contrast, no pseudogene could be detected in the mouse genome, only a single copy gene on chromosome 17. The question arises how the human situation originated phylogenetically. To address this question we applied comparative FISH-mapping of a human PKD1-containing genomic BAC clone and a PKD1-cDNA clone to chromosomes of a variety of primate species and the dog as a non-primate outgroup species. Results Comparative FISH with the PKD1-cDNA clone clearly shows that in all primate species studied distinct single signals map in subtelomeric chromosomal positions orthologous to the short arm of human chromosome 16 harbouring the master PKD1 gene. Only in human and African great apes, but not in orangutan, FISH with both BAC and cDNA clones reveals additional signal clusters located proximal of and clearly separated from the PKD1 master genes indicating the chromosomal position of PKD1 pseudogenes in 16p of these species, respectively. Indeed, this is in accordance with sequencing data in human, chimpanzee and orangutan. Apart from the master PKD1 gene, six pseudogenes are identified in both, human and chimpanzee, while only a single-copy gene is present in the whole-genome sequence of orangutan. The phylogenetic reconstruction of the PKD1-tree reveals that all human pseudogenes are closely related to the human PKD1 gene, and all chimpanzee pseudogenes are closely related to the chimpanzee PKD1 gene. However, our statistical analyses provide strong indication that gene conversion events may have occurred within the PKD1 family members of human and chimpanzee, respectively. Conclusion PKD1 must have undergone amplification very recently in hominid evolution. Duplicative

  7. PfEMP1 – A Parasite Protein Family of Key Importance in Plasmodium falciparum Malaria Immunity and Pathogenesis

    DEFF Research Database (Denmark)

    Hviid, Lars; Jensen, Anja T R

    2015-01-01

    to be a central element in the pathogenesis of the disease. It is mediated by the interaction of parasite ligands on the erythrocyte surface and a range of host receptor molecules in many organs and tissues. Among several proteins and protein families implicated in this process, the P. falciparum erythrocyte...... membrane protein 1 (PfEMP1) family of high-molecular weight and highly variable antigens appears to be the most prominent. In this chapter, we aim to provide a systematic overview of the current knowledge about these proteins, their structure, their function, how they are presented on the erythrocyte...

  8. The claudin gene family: expression in normal and neoplastic tissues

    International Nuclear Information System (INIS)

    Hewitt, Kyle J; Agarwal, Rachana; Morin, Patrice J

    2006-01-01

    The claudin (CLDN) genes encode a family of proteins important in tight junction formation and function. Recently, it has become apparent that CLDN gene expression is frequently altered in several human cancers. However, the exact patterns of CLDN expression in various cancers is unknown, as only a limited number of CLDN genes have been investigated in a few tumors. We identified all the human CLDN genes from Genbank and we used the large public SAGE database to ascertain the gene expression of all 21 CLDN in 266 normal and neoplastic tissues. Using real-time RT-PCR, we also surveyed a subset of 13 CLDN genes in 24 normal and 24 neoplastic tissues. We show that claudins represent a family of highly related proteins, with claudin-16, and -23 being the most different from the others. From in silico analysis and RT-PCR data, we find that most claudin genes appear decreased in cancer, while CLDN3, CLDN4, and CLDN7 are elevated in several malignancies such as those originating from the pancreas, bladder, thyroid, fallopian tubes, ovary, stomach, colon, breast, uterus, and the prostate. Interestingly, CLDN5 is highly expressed in vascular endothelial cells, providing a possible target for antiangiogenic therapy. CLDN18 might represent a biomarker for gastric cancer. Our study confirms previously known CLDN gene expression patterns and identifies new ones, which may have applications in the detection, prognosis and therapy of several human cancers. In particular we identify several malignancies that express CLDN3 and CLDN4. These cancers may represent ideal candidates for a novel therapy being developed based on CPE, a toxin that specifically binds claudin-3 and claudin-4

  9. A comprehensive family-based replication study of schizophrenia genes

    DEFF Research Database (Denmark)

    Aberg, Karolina A; Liu, Youfang; Bukszár, Jozsef

    2013-01-01

     768 control subjects from 6 databases and, after quality control 6298 individuals (including 3286 cases) from 1811 nuclear families. MAIN OUTCOMES AND MEASURES Case-control status for SCZ. RESULTS Replication results showed a highly significant enrichment of SNPs with small P values. Of the SNPs...... in an independent family-based replication study that, after quality control, consisted of 8107 SNPs. SETTING Linkage meta-analysis, brain transcriptome meta-analysis, candidate gene database, OMIM, relevant mouse studies, and expression quantitative trait locus databases. PATIENTS We included 11 185 cases and 10...

  10. Prevalence of pfhrp2 and/or pfhrp3 Gene Deletion in Plasmodium falciparum Population in Eight Highly Endemic States in India.

    Directory of Open Access Journals (Sweden)

    Praveen Kumar Bharti

    Full Text Available Plasmodium falciparum encoded histidine rich protein (HRP2 based malaria rapid diagnostic tests (RDTs are used in India. Deletion of pfhrp2 and pfhrp3 genes contributes to false negative test results, and large numbers of such deletions have been reported from South America, highlighting the importance of surveillance to detect such deletions.This is the first prospective field study carried out at 16 sites located in eight endemic states of India to assess the performance of PfHRP2 based RDT kits used in the national malaria control programme. In this study, microscopically confirmed P. falciparum but RDT negative samples were assessed for presence of pfhrp2, pfhrp3, and their flanking genes using PCR.Among 1521 microscopically positive P. falciparum samples screened, 50 were negative by HRP2 based RDT test. Molecular testing was carried out using these 50 RDT negative samples by assuming that 1471 RDT positive samples carried pfhrp2 gene. It was found that 2.4% (36/1521 and 1.8% (27/1521 of samples were negative for pfhrp2 and pfhrp3 genes, respectively. However, the frequency of pfhrp2 deletions varied between the sites ranging from 0-25% (2.4, 95% CI; 1.6-3.3. The frequency of both pfhrp2 and pfhrp3 gene deletion varied from 0-8% (1.6, 95% CI; 1.0-2.4.This study provides evidence for low level presence of pfhrp2 and pfhrp3 deleted P. falciparum parasites in different endemic regions of India, and periodic surveillance is warranted for reliable use of PfHRP2 based RDTs.

  11. In vitro atovaquone/proguanil susceptibility and characterization of the cytochrome b gene of Plasmodium falciparum from different endemic regions of Thailand

    Directory of Open Access Journals (Sweden)

    Mungthin Mathirut

    2008-01-01

    Full Text Available Abstract Background The emergence of Plasmodium falciparum resistant to most currently used antimalarial drugs is the major problem in malaria control along the Thai-Myanmar and Thai-Cambodia borders. Although artemisinin-based combination therapy has been recommended for the treatment of multidrug-resistant falciparum malaria, these combinations are not available for some people, such as travelers from North America. A fixed-dose combination of atovaquone and proguanil (Malarone has been proved to be effective for the treatment and prophylaxis of malaria which is already approved by countries in North America and Europe. Determination of the phenotypes and genotypes related to atovaquone/proguanil response in Thai isolates of P. falciparum will be useful for rationale drug use. The main purpose of this study was to explore the in vitro atovaquone/proguanil susceptibility of recently adapted Thai isolates of P. falciparum. Genotypic characterization of the cytb gene of these isolates was also determined since it has been reported that point mutations, particularly codon 268 in the cytochrome b gene (cytb have been linked to atovaquone/proguanil treatment failure. Methods Eighty three P. falciparum isolates collected during 1998 to 2005 from four different multidrug resistance areas of Thailand were determined for the in vitro atovaquone/proguanil susceptibilities using radioisotopic assay. Mutations in the cytb gene were determined by PCR-RFLP and sequence analysis. Results The mean atovaquone and proguanil IC50 was 3.4 nM and 36.5 μM, respectively. All 83 Thai isolates were atovaquone sensitive. None of the 83 isolates contained the mutations at codon 268 of the cytb gene. DNA sequencing of the cytb gene of 20 parasite isolates showed no other mutations. Conclusion In agreement with a recent efficacy study of atovaquone/proguanil, the present information indicates that atovaquone/proguanil can be one of the drugs of choice for the treatment

  12. Massive expansion of the calpain gene family in unicellular eukaryotes

    Directory of Open Access Journals (Sweden)

    Zhao Sen

    2012-09-01

    Full Text Available Abstract Background Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists. Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Results Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. Conclusions The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes.

  13. Massive expansion of the calpain gene family in unicellular eukaryotes.

    Science.gov (United States)

    Zhao, Sen; Liang, Zhe; Demko, Viktor; Wilson, Robert; Johansen, Wenche; Olsen, Odd-Arne; Shalchian-Tabrizi, Kamran

    2012-09-29

    Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists). Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes.

  14. NDP gene mutations in 14 French families with Norrie disease.

    Science.gov (United States)

    Royer, Ghislaine; Hanein, Sylvain; Raclin, Valérie; Gigarel, Nadine; Rozet, Jean-Michel; Munnich, Arnold; Steffann, Julie; Dufier, Jean-Louis; Kaplan, Josseline; Bonnefont, Jean-Paul

    2003-12-01

    Norrie disease is a rare X-inked recessive condition characterized by congenital blindness and occasionally deafness and mental retardation in males. This disease has been ascribed to mutations in the NDP gene on chromosome Xp11.1. Previous investigations of the NDP gene have identified largely sixty disease-causing sequence variants. Here, we report on ten different NDP gene allelic variants in fourteen of a series of 21 families fulfilling inclusion criteria. Two alterations were intragenic deletions and eight were nucleotide substitutions or splicing variants, six of them being hitherto unreported, namely c.112C>T (p.Arg38Cys), c.129C>G (p.His43Gln), c.133G>A (p.Val45Met), c.268C>T (p.Arg90Cys), c.382T>C (p.Cys128Arg), c.23479-1G>C (unknown). No NDP gene sequence variant was found in seven of the 21 families. This observation raises the issue of misdiagnosis, phenocopies, or existence of other X-linked or autosomal genes, the mutations of which would mimic the Norrie disease phenotype. Copyright 2003 Wiley-Liss, Inc.

  15. Leiomodins: larger members of the tropomodulin (Tmod) gene family

    Science.gov (United States)

    Conley, C. A.; Fritz-Six, K. L.; Almenar-Queralt, A.; Fowler, V. M.

    2001-01-01

    The 64-kDa autoantigen D1 or 1D, first identified as a potential autoantigen in Graves' disease, is similar to the tropomodulin (Tmod) family of actin filament pointed end-capping proteins. A novel gene with significant similarity to the 64-kDa human autoantigen D1 has been cloned from both humans and mice, and the genomic sequences of both genes have been identified. These genes form a subfamily closely related to the Tmods and are here named the Leiomodins (Lmods). Both Lmod genes display a conserved intron-exon structure, as do three Tmod genes, but the intron-exon structure of the Lmods and the Tmods is divergent. mRNA expression analysis indicates that the gene formerly known as the 64-kDa autoantigen D1 is most highly expressed in a variety of human tissues that contain smooth muscle, earning it the name smooth muscle Leiomodin (SM-Lmod; HGMW-approved symbol LMOD1). Transcripts encoding the novel Lmod gene are present exclusively in fetal and adult heart and adult skeletal muscle, and it is here named cardiac Leiomodin (C-Lmod; HGMW-approved symbol LMOD2). Human C-Lmod is located near the hypertrophic cardiomyopathy locus CMH6 on human chromosome 7q3, potentially implicating it in this disease. Our data demonstrate that the Lmods are evolutionarily related and display tissue-specific patterns of expression distinct from, but overlapping with, the expression of Tmod isoforms. Copyright 2001 Academic Press.

  16. Identification of a rare point mutation at C-terminus of merozoite surface antigen-1 gene of Plasmodium falciparum in eastern Indian isolates.

    Science.gov (United States)

    Raj, Dipak Kumar; Das, Bibhu Ranjan; Dash, A P; Supakar, Prakash C

    2004-01-01

    Merozoite surface antigen-1 (MSA-1) of Plasmodium falciparum is highly immunogenic in human. Several studies suggest that MSA-1 protein is an effective target for a protective immune response. Attempt has been made to find new point mutations by analyzing 244 bp [codon 1655(R) to 1735 (I)] relatively conserved C-terminus region of MSA-1 gene in 125 isolates. This region contains two EGF like domains, which are involved in generating protective immune response in human. Point mutations in this region are very much important in view of vaccine development. Searching of mutational hot spots in MSA-1 protein by sequencing method in a representative number of isolates is quite critical and expensive. Therefore, in this study slot blot and PCR-SSCP method have been used to find out new mutations in the individual isolates showing alterations in the mobility of DNA fragment. Sequencing of the altered bands from the SSCP gel shows a rare non-synonymous point mutation in 7 (5.6%) of the 125 isolates at amino acid position 1704 of MSA-1 gene where isoleucine is replaced by valine.

  17. Avian Plasmodium in Eastern Austrian mosquitoes.

    Science.gov (United States)

    Schoener, Ellen; Uebleis, Sarah Susanne; Butter, Julia; Nawratil, Michaela; Cuk, Claudia; Flechl, Eva; Kothmayer, Michael; Obwaller, Adelheid G; Zechmeister, Thomas; Rubel, Franz; Lebl, Karin; Zittra, Carina; Fuehrer, Hans-Peter

    2017-09-29

    Insect vectors, namely mosquitoes (Diptera: Culicidae), are compulsory for malaria parasites (Plasmodium spp.) to complete their life cycle. Despite this, little is known about vector competence of different mosquito species for the transmission of avian malaria parasites. In this study, nested PCR was used to determine Plasmodium spp. occurrence in pools of whole individuals, as well as the diversity of mitochondrial cytochrome b gene sequences in wild-caught mosquitoes sampled across Eastern Austria in 2013-2015. A total of 45,749 mosquitoes in 2628 pools were collected, of which 169 pools (6.43%) comprising 9 mosquito species were positive for avian Plasmodium, with the majority of positives in mosquitoes of Culex pipiens s.l./Culex torrentium. Six different avian Plasmodium lineages were found, the most common were Plasmodium vaughani SYAT05, Plasmodium sp. Linn1 and Plasmodium relictum SGS1. In 2014, mosquitoes of the Culex pipiens complex were genetically identified and Culex pipiens f. pipiens presented with the highest number of avian Plasmodium positives (n = 37; 16.74%). Despite this, the minimum infection rate (MIR) was highest in Culex torrentium (5.36%) and Culex pipiens f. pipiens/f. molestus hybrids (5.26%). During 2014 and 2015, seasonal and annual changes in Plasmodium lineage distribution were also observed. In both years P. vaughani SYAT05 dominated at the beginning of the sampling period to be replaced later in the year by P. relictum SGS1 (2014) and Plasmodium sp. Linn1 (2015). This is the first large-scale study of avian Plasmodium parasites in Austrian mosquitoes. These results are of special interest, because molecular identification of the taxa of the Cx. pipiens complex and Cx. torrentium enabled the determination of Plasmodium prevalence in the different mosquito taxa and hybrids of this complex. Since pools of whole insects were used, it is not possible to assert any vector competence in any of the examined mosquitoes, but the results

  18. Evolutionary history of chordate PAX genes: dynamics of change in a complex gene family.

    Directory of Open Access Journals (Sweden)

    Vanessa Rodrigues Paixão-Côrtes

    Full Text Available Paired box (PAX genes are transcription factors that play important roles in embryonic development. Although the PAX gene family occurs in animals only, it is widely distributed. Among the vertebrates, its 9 genes appear to be the product of complete duplication of an original set of 4 genes, followed by an additional partial duplication. Although some studies of PAX genes have been conducted, no comprehensive survey of these genes across the entire taxonomic unit has yet been attempted. In this study, we conducted a detailed comparison of PAX sequences from 188 chordates, which revealed restricted variation. The absence of PAX4 and PAX8 among some species of reptiles and birds was notable; however, all 9 genes were present in all 74 mammalian genomes investigated. A search for signatures of selection indicated that all genes are subject to purifying selection, with a possible constraint relaxation in PAX4, PAX7, and PAX8. This result indicates asymmetric evolution of PAX family genes, which can be associated with the emergence of adaptive novelties in the chordate evolutionary trajectory.

  19. The nitrate transporter (NRT gene family in poplar.

    Directory of Open Access Journals (Sweden)

    Hua Bai

    Full Text Available Nitrate is an important nutrient required for plant growth. It also acts as a signal regulating plant development. Nitrate is actively taken up and transported by nitrate transporters (NRT, which form a large family with many members and distinct functions. In contrast to Arabidopsis and rice there is little information about the NRT family in woody plants such as Populus. In this study, a comprehensive analysis of the Populus NRT family was performed. Sixty-eight PtNRT1/PTR, 6 PtNRT2, and 5 PtNRT3 genes were identified in the P. trichocarpa genome. Phylogenetic analysis confirmed that the genes of the NRT family are divided into three clades: NRT1/PTR with four subclades, NRT2, and NRT3. Topological analysis indicated that all members of PtNRT1/PTR and PtNRT2 have 8 to 12 trans-membrane domains, whereas the PtNRT3 proteins have no or up to two trans-membrane domains. Four PtNRT3 members were predicted as secreted proteins. Microarray analyses revealed tissue-specific expression patterns of PtNRT genes with distinct clusters of NRTs for roots, for the elongation zone of the apical stem segment and the developing xylem and a further cluster for leaves, bark and wood. A comparison of different poplar species (P. trichocarpa, P. tremula, P. euphratica, P. fremontii x P. angustifolia, and P. x canescens showed that the tissue-specific patterns of the NRT genes varied to some extent with species. Bioinformatic analysis of putative cis-regulatory elements in the promoter regions of PtNRT family retrieved motifs suggesting the regulation of the NRT genes by N metabolism, by energy and carbon metabolism, and by phytohormones and stress. Multivariate analysis suggested that the combination and abundance of motifs in distinct promoters may lead to tissue-specificity. Our genome wide analysis of the PtNRT genes provides a valuable basis for functional analysis towards understanding the role of nitrate transporters for tree growth.

  20. Histidine-rich protein 2 (pfhrp2) and pfhrp3 gene deletions in Plasmodium falciparum isolates from select sites in Brazil and Bolivia.

    Science.gov (United States)

    Rachid Viana, Giselle Maria; Akinyi Okoth, Sheila; Silva-Flannery, Luciana; Lima Barbosa, Danielle Regina; Macedo de Oliveira, Alexandre; Goldman, Ira F; Morton, Lindsay C; Huber, Curtis; Anez, Arletta; Dantas Machado, Ricardo Luiz; Aranha Camargo, Luís Marcelo; Costa Negreiros do Valle, Suiane; Marins Póvoa, Marinete; Udhayakumar, Venkatachalam; Barnwell, John W

    2017-01-01

    More than 80% of available malaria rapid diagnostic tests (RDTs) are based on the detection of histidine-rich protein-2 (PfHRP2) for diagnosis of Plasmodium falciparum malaria. Recent studies have shown the genes that code for this protein and its paralog, histidine-rich protein-3 (PfHRP3), are absent in parasites from the Peruvian Amazon Basin. Lack of PfHRP2 protein through deletion of the pfhrp2 gene leads to false-negative RDT results for P. falciparum. We have evaluated the extent of pfhrp2 and pfhrp3 gene deletions in a convenience sample of 198 isolates from six sites in three states across the Brazilian Amazon Basin (Acre, Rondonia and Para) and 25 isolates from two sites in Bolivia collected at different times between 2010 and 2012. Pfhrp2 and pfhrp3 gene and their flanking genes on chromosomes 7 and 13, respectively, were amplified from 198 blood specimens collected in Brazil. In Brazil, the isolates collected in Acre state, located in the western part of the Brazilian Amazon, had the highest percentage of deletions for pfhrp2 25 (31.2%) of 79, while among those collected in Rondonia, the prevalence of pfhrp2 gene deletion was only 3.3% (2 out of 60 patients). In isolates from Para state, all parasites were pfhrp2-positive. In contrast, we detected high proportions of isolates from all 3 states that were pfhrp3-negative ranging from 18.3% (11 out of 60 samples) to 50.9% (30 out of 59 samples). In Bolivia, only one of 25 samples (4%) tested had deleted pfhrp2 gene, while 68% (17 out of 25 samples) were pfhrp3-negative. Among the isolates tested, P. falciparum pfhrp2 gene deletions were present mainly in those from Acre State in the Brazilian Amazon. These results indicate it is important to reconsider the use of PfHRP2-based RDTs in the western region of the Brazilian Amazon and to implement appropriate surveillance systems to monitor pfhrp2 gene deletions in this and other parts of the Amazon region.

  1. Diverse roles of ERECTA family genes in plant development.

    Science.gov (United States)

    Shpak, Elena D

    2013-12-01

    Multiple receptor-like kinases (RLKs) enable intercellular communication that coordinates growth and development of plant tissues. ERECTA family receptors (ERfs) are an ancient family of leucine-rich repeat RLKs that in Arabidopsis consists of three genes: ERECTA, ERL1, and ERL2. ERfs sense secreted cysteine-rich peptides from the EPF/EPFL family and transmit the signal through a MAP kinase cascade. This review discusses the functions of ERfs in stomata development, in regulation of longitudinal growth of aboveground organs, during reproductive development, and in the shoot apical meristem. In addition the role of ERECTA in plant responses to biotic and abiotic factors is examined. Elena D. Shpak (Corresponding author). © 2013 Institute of Botany, Chinese Academy of Sciences.

  2. Molecular study of the perforin gene in familial hematological malignancies

    Directory of Open Access Journals (Sweden)

    El Abed Rim

    2011-09-01

    Full Text Available Abstract Perforin gene (PRF1 mutations have been identified in some patients diagnosed with the familial form of hemophagocytic lymphohistiocytosis (HLH and in patients with lymphoma. The aim of the present study was to determine whether patients with a familial aggregation of hematological malignancies harbor germline perforin gene mutations. For this purpose, 81 unrelated families from Tunisia and France with aggregated hematological malignancies were investigated. The variants detected in the PRF1 coding region amounted to 3.7% (3/81. Two of the three variants identified were previously described: the p.Ala91Val pathogenic mutation and the p.Asn252Ser polymorphism. A new p.Ala 211Val missense substitution was identified in two related Tunisian patients. In order to assess the pathogenicity of this new variation, bioinformatic tools were used to predict its effects on the perforin protein structure and at the mRNA level. The segregation of the mutant allele was studied in the family of interest and a control population was screened. The fact that this variant was not found to occur in 200 control chromosomes suggests that it may be pathogenic. However, overexpression of mutated PRF1 in rat basophilic leukemia cells did not affect the lytic function of perforin differently from the wild type protein.

  3. Bioinformatics Analysis of MAPKKK Family Genes in Medicago truncatula

    Directory of Open Access Journals (Sweden)

    Wei Li

    2016-04-01

    Full Text Available Mitogen‐activated protein kinase kinase kinase (MAPKKK is a component of the MAPK cascade pathway that plays an important role in plant growth, development, and response to abiotic stress, the functions of which have been well characterized in several plant species, such as Arabidopsis, rice, and maize. In this study, we performed genome‐wide and systemic bioinformatics analysis of MAPKKK family genes in Medicago truncatula. In total, there were 73 MAPKKK family members identified by search of homologs, and they were classified into three subfamilies, MEKK, ZIK, and RAF. Based on the genomic duplication function, 72 MtMAPKKK genes were located throughout all chromosomes, but they cluster in different chromosomes. Using microarray data and high‐throughput sequencing‐data, we assessed their expression profiles in growth and development processes; these results provided evidence for exploring their important functions in developmental regulation, especially in the nodulation process. Furthermore, we investigated their expression in abiotic stresses by RNA‐seq, which confirmed their critical roles in signal transduction and regulation processes under stress. In summary, our genome‐wide, systemic characterization and expressional analysis of MtMAPKKK genes will provide insights that will be useful for characterizing the molecular functions of these genes in M. truncatula.

  4. Repair of DNA damage in the human metallothionein gene family

    International Nuclear Information System (INIS)

    Leadon, S.A.; Snowden, M.M.

    1987-01-01

    In order to distinguish enhanced repair of a sequence due to its transcriptional activity from enhanced repair due to chromatin alterations brought about by integration of a sequence into the genome, we have investigated the repair of damage both in endogenous genes and in cell lines that contain an integrated gene with an inducible promoter. The endogenous genes we are studying are the metallothioneins (MTs), a multigene family in man consisting of about 10-12 members. Cultured cells were exposed to 10-J/m 2 uv light and allowed to repair in the presence of bromodeoxyuridine. The DNA was then isolated, digested with Eco RI, and fully hybrid density DNA made by semiconservative synthesis was separated from unreplicated DNA by centrifugation in CsCl density gradients. Unreplicated, parental-density DNA was then reacted with a monoclonal antibody against bromouracil. 1 ref., 1 fig., 1 tab

  5. Genetic diversity of Plasmodium vivax and Plasmodium falciparum in Honduras.

    Science.gov (United States)

    Lopez, Ana Cecilia; Ortiz, Andres; Coello, Jorge; Sosa-Ochoa, Wilfredo; Torres, Rosa E Mejia; Banegas, Engels I; Jovel, Irina; Fontecha, Gustavo A

    2012-11-26

    Understanding the population structure of Plasmodium species through genetic diversity studies can assist in the design of more effective malaria control strategies, particularly in vaccine development. Central America is an area where malaria is a public health problem, but little is known about the genetic diversity of the parasite's circulating species. This study aimed to investigate the allelic frequency and molecular diversity of five surface antigens in field isolates from Honduras. Five molecular markers were analysed to determine the genotypes of Plasmodium vivax and Plasmodium falciparum from endemic areas in Honduras. Genetic diversity of ama-1, msp-1 and csp was investigated for P. vivax, and msp-1 and msp-2 for P. falciparum. Allelic frequencies were calculated and sequence analysis performed. A high genetic diversity was observed within Plasmodium isolates from Honduras. A different number of genotypes were elucidated: 41 (n = 77) for pvama-1; 23 (n = 84) for pvcsp; and 23 (n = 35) for pfmsp-1. Pvcsp sequences showed VK210 as the only subtype present in Honduran isolates. Pvmsp-1 (F2) was the most polymorphic marker for P. vivax isolates while pvama-1 was least variable. All three allelic families described for pfmsp-1 (n = 30) block 2 (K1, MAD20, and RO33), and both allelic families described for the central domain of pfmsp-2 (n = 11) (3D7 and FC27) were detected. However, K1 and 3D7 allelic families were predominant. All markers were randomly distributed across the country and no geographic correlation was found. To date, this is the most complete report on molecular characterization of P. vivax and P. falciparum field isolates in Honduras with regards to genetic diversity. These results indicate that P. vivax and P. falciparum parasite populations are highly diverse in Honduras despite the low level of transmission.

  6. Polymorphism in the interferon-{alpha} gene family

    Energy Technology Data Exchange (ETDEWEB)

    Golovleva, I.; Lundgren, E.; Beckman, L. [Univ. of Umea (Sweden); Kandefer-Szerszen, M. [Maria Curie-Sklodowska Univ., Lublin (Poland)

    1996-09-01

    A pronounced genetic polymorphism of the interferon type I gene family has been assumed on the basis of RFLP analysis of the genomic region as well as the large number of sequences published compared to the number of loci. However, IFNA2 is the only locus that has been carefully analyzed concerning gene frequency, and only naturally occurring rare alleles have been found. We have extended the studies on a variation of expressed sequences by studying the IFNA1, IFNA2, IFNA10, IFNA13, IFNA14, and IFNA17 genes. Genomic white-blood-cell DNA from a population sample of blood donors and from a family material were screened by single-nucleotide primer extension (allele-specific primer extension) of PCR fragments. Because of sequence similarities, in some cases {open_quotes}nested{close_quotes} PCR was used, and, when applicable, restriction analysis or control sequencing was performed. All individuals carried the interferon-{alpha} 1 and interferon-{alpha} 13 variants but not the LeIF D variant. At the IFNA2 and IFNA14 loci only one sequence variant was found, while in the IFNA10 and IFNA17 groups two alleles were detected in each group. The IFNA10 and IFNA17 alleles segregated in families and showed a close fit to the Hardy-Weinberg equilibrium. There was a significant linkage disequilibrium between IFNA10 and IFNA17 alleles. The fact that the extent of genetic polymorphism was lower than expected suggests that a majority of the previously described gene sequences represent nonpolymorphic rare mutants that may have arisen in tumor cell lines. 44 refs., 4 figs., 4 tabs.

  7. Genetic diversity of the Plasmodium falciparum apical membrane antigen I gene in parasite population from the China-Myanmar border area.

    Science.gov (United States)

    Zhu, Xiaotong; Zhao, Zhenjun; Feng, Yonghui; Li, Peipei; Liu, Fei; Liu, Jun; Yang, Zhaoqing; Yan, Guiyun; Fan, Qi; Cao, Yaming; Cui, Liwang

    2016-04-01

    To investigate the genetic diversity of the Plasmodium falciparum apical membrane antigen 1 (PfAMA1) gene in Southeast Asia, we determined PfAMA1 sequences from 135 field isolates collected from the China-Myanmar border area and compared them with 956 publically available PfAMA1 sequences from seven global P. falciparum populations. This analysis revealed high genetic diversity of PfAMA1 in global P. falciparum populations with a total of 229 haplotypes identified. The genetic diversity of PfAMA1 gene from the China-Myanmar border is not evenly distributed in the different domains of this gene. Sequence diversity in PfAMA1 from the China-Myanmar border is lower than that observed in Thai, African and Oceanian populations, but higher than that in the South American population. This appeared to correlate well with the levels of endemicity of different malaria-endemic regions, where hyperendemic regions favor genetic cross of the parasite isolates and generation of higher genetic diversity. Neutrality tests show significant departure from neutrality in the entire ectodomain and Domain I of PfAMA1 in the China-Myanmar border parasite population. We found evidence supporting a substantial continent-wise genetic structure among P. falciparum populations, with the highest genetic differentiation detected between the China-Myanmar border and the South American populations. Whereas no alleles were unique to a specific region, there were considerable geographical differences in major alleles and their frequencies, highlighting further necessity to include more PfAMA1 alleles in vaccine designs. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Gene screening in a Chinese family with Marfan syndrome

    Directory of Open Access Journals (Sweden)

    Wen-Jiao Xia

    2016-05-01

    Full Text Available AIM:To analyze the causative gene mutation for Marfan syndrome(MFSwith autosomal dominant hereditary in a Chinese family in Liaoning Province,China. METHODS: Venous blood was collected and candidate gene was selected to design primers according to the clinical phenotype. With genomic polymerase chain reaction(PCRperformed, the coding exons and their flanking intron in sequences of candidate gene were sequenced,DNA fragments separated by agarose gel electrophoresis and direct sequencing method was used to determine the pathogenic gene.RESULTS:Phenotype of the proband was presented as ectopic lentis. Sequencing of the coding regions of FBN1 gene showed the presence of a heterozygous A→G transversion at nucleotide 640 in the 7 exon of FBN1 and the missense mutation made for Glycine into Serine(G214S. CONCLUSION:A heterozygous mutation of FBN1 c.A640G(p.G214Sis responsible for the Marfan syndrome in the four generation Chinese pedigree.

  9. Artemisinin resistance marker of Plasmodium falciparum in Osogbo ...

    African Journals Online (AJOL)

    Artemisinin derivatives constitute a key component of the present-day treatment for Plasmodium falciparum malaria. Resistance with artemisinins is generally associated with S769N point mutation in the sarco-endoplasmic reticulumdependant ATPase6 (SERCA ATPase6) gene of Plasmodium falciparum, few studies have ...

  10. Falciparum malaria in the north of Laos: the occurrence and implications of the Plasmodium falciparum chloroquine resistance transporter (pfcrt) gene haplotype SVMNT

    DEFF Research Database (Denmark)

    Dittrich, Sabine; Alifrangis, Michael; Stohrer, Jörg M

    2005-01-01

    the SVMNT haplotype. METHOD: Eighty-eight samples from an area with reported in vivo Chloroquine and in vitro Amodiaquine-resistance were screened for the K76T mutation and their Pfcrt-haplotype (c72-76) using a new SSOP-ELISA. RESULTS: Hundred percent of the analysed samples showed the K76T mutation which......OBJECTIVE: The Pfcrt-gene encodes a transmembrane protein located in the Plasmodium falciparum digestive vacuole. Chloroquine resistant (CQR) strains of African and Southeast Asian origin carry the Pfcrt-haplotype (c72-76) CVIET, whereas most South American and Papua New Guinean CQR stains carry...... is highly associated with in vivo drug failure. This very high rate of a CQR-marker is alarming in an area were CQ is still used as first line drug. The distribution of the three main Pfcrt-haplotypes was as follows: 68% CVIET, 31% SVMNT, 0% CVMNT. CONCLUSIONS: These data show, for the first time, the South...

  11. Chloroquine efficacy for Plasmodium vivax in Myanmar in populations with high genetic diversity and moderate parasite gene flow.

    Science.gov (United States)

    Htun, Myo Win; Mon, Nan Cho Nwe; Aye, Khin Myo; Hlaing, Chan Myae; Kyaw, Myat Phone; Handayuni, Irene; Trimarsanto, Hidayat; Bustos, Dorina; Ringwald, Pascal; Price, Ric N; Auburn, Sarah; Thriemer, Kamala

    2017-07-10

    Plasmodium vivax malaria remains a major public health burden in Myanmar. Resistance to chloroquine (CQ), the first-line treatment for P. vivax, has been reported in the country and has potential to undermine local control efforts. Patients over 6 years of age with uncomplicated P. vivax mono-infection were enrolled into clinical efficacy studies in Myawaddy in 2014 and Kawthoung in 2012. Study participants received a standard dose of CQ (25 mg/kg over 3 days) followed by weekly review until day 28. Pvmdr1 copy number (CN) and microsatellite diversity were assessed on samples from the patients enrolled in the clinical study and additional cross-sectional surveys undertaken in Myawaddy and Shwegyin in 2012. A total of 85 patients were enrolled in the CQ clinical studies, 25 in Myawaddy and 60 in Kawthoung. One patient in Myawaddy (1.2%) had an early treatment failure and two patients (2.3%) in Kawthoung presented with late treatment failures on day 28. The day 28 efficacy was 92.0% (95% CI 71.6-97.9) in Myawaddy and 98.3% (95% CI 88.7-99.8) in Kawthoung. By day 2, 92.2% (23/25) in Myawaddy and 85.0% (51/60) in Kawthoung were aparasitaemic. Genotyping and pvmdr1 CN assessment was undertaken on 43, 52 and 46 clinical isolates from Myawaddy, Kawthoung and Shwegyin respectively. Pvmdr1 amplification was observed in 3.2% (1/31) of isolates in Myawaddy, 0% (0/49) in Kawthoung and 2.5% (1/40) in Shwegyin. Diversity was high in all sites (H E 0.855-0.876), with low inter-population differentiation (F ST 0.016-0.026, P Myanmar, particularly given the potential connectivity between parasite population at different sites.

  12. The Tomato Terpene Synthase Gene Family1[W][OA

    Science.gov (United States)

    Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran

    2011-01-01

    Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655

  13. Amelogenesis Imperfecta: 1 Family, 2 Phenotypes, and 2 Mutated Genes.

    Science.gov (United States)

    Prasad, M K; Laouina, S; El Alloussi, M; Dollfus, H; Bloch-Zupan, A

    2016-12-01

    Amelogenesis imperfecta (AI) is a clinically and genetically heterogeneous group of diseases characterized by enamel defects. The authors have identified a large consanguineous Moroccan family segregating different clinical subtypes of hypoplastic and hypomineralized AI in different individuals within the family. Using targeted next-generation sequencing, the authors identified a novel heterozygous nonsense mutation in COL17A1 (c.1873C>T, p.R625*) segregating with hypoplastic AI and a novel homozygous 8-bp deletion in C4orf26 (c.39_46del, p.Cys14Glyfs*18) segregating with hypomineralized-hypoplastic AI in this family. This study highlights the phenotypic and genotypic heterogeneity of AI that can exist even within a single consanguineous family. Furthermore, the identification of novel mutations in COL17A1 and C4orf26 and their correlation with distinct AI phenotypes can contribute to a better understanding of the pathophysiology of AI and the contribution of these genes to amelogenesis. © International & American Associations for Dental Research 2016.

  14. Rapid selection of Plasmodium falciparum chloroquine resistance transporter gene and multidrug resistance gene-1 haplotypes associated with past chloroquine and present artemether-lumefantrine use in Inhambane District, southern Mozambique

    DEFF Research Database (Denmark)

    Thomsen, Thomas T; Madsen, Laura B; Hansson, Helle H

    2013-01-01

    Chloroquine (CQ) use in Mozambique was stopped in 2002 and artemether-lumefantrine (AL) was implemented in 2008. In light of no use of CQ and extensive use of AL, we determined the frequency of molecular markers of Plasmodium falciparum drug resistance/tolerance to CQ and AL in persons living...... in Linga-Linga, an isolated peninsula and in Furvela village, which is located 8 km inland. The P. falciparum chloroquine resistance transporter gene CVMNK wild type increased in frequency from 43.9% in 2009 to 66.4% in 2010 (P = 0.001), and combined P. falciparum multidrug resistance gene 1 N86-184F-D1246...... haplotype increased significantly between years (P = 0.039). The combination of P. falciparum chloroquine resistance transporter gene CVMNK and P. falciparum multidrug resistance gene NFD increased from 24.3% (2009) to 45.3% in (2010, P = 0.017). The rapid changes observed may largely be caused by decreased...

  15. Lack of gender-specific antibody recognition of products from domains of a var gene implicated in pregnancy-associated Plasmodium falciparum malaria

    DEFF Research Database (Denmark)

    Jensen, Anja T R; Zornig, Hanne D; Buhmann, Caecilie

    2003-01-01

    Gender-specific and parity-dependent acquired antibody recognition is characteristic of variant surface antigens (VSA) expressed by chondroitin sulfate A (CSA)-adherent Plasmodium falciparum involved in pregnancy-associated malaria (PAM). However, antibody recognition of recombinant products...

  16. Differential expression pattern of UBX family genes in Caenorhabditis elegans

    International Nuclear Information System (INIS)

    Yamauchi, Seiji; Sasagawa, Yohei; Ogura, Teru; Yamanaka, Kunitoshi

    2007-01-01

    UBX (ubiquitin regulatory X)-containing proteins belong to an evolutionary conserved protein family and determine the specificity of p97/VCP/Cdc48p function by binding as its adaptors. Caenorhabditis elegans was found to possess six UBX-containing proteins, named UBXN-1 to -6. However, no general or specific function of them has been revealed. During the course of understanding not only their function but also specified function of p97, we investigated spatial and temporal expression patterns of six ubxn genes in this study. Transcript analyses showed that the expression pattern of each ubxn gene was different throughout worm's development and may show potential developmental dynamics in their function, especially ubxn-5 was expressed specifically in the spermatogenic germline, suggesting a crucial role in spermatogenesis. In addition, as ubxn-4 expression was induced by ER stress, it would function as an ERAD factor in C. elegans. In vivo expression analysis by using GFP translational fusion constructs revealed that six ubxn genes show distinct expression patterns. These results altogether demonstrate that the expression of all six ubxn genes of C. elegans is differently regulated

  17. The roles of gene duplication, gene conversion and positive selection in rodent Esp and Mup pheromone gene families with comparison to the Abp family.

    Science.gov (United States)

    Karn, Robert C; Laukaitis, Christina M

    2012-01-01

    Three proteinaceous pheromone families, the androgen-binding proteins (ABPs), the exocrine-gland secreting peptides (ESPs) and the major urinary proteins (MUPs) are encoded by large gene families in the genomes of Mus musculus and Rattus norvegicus. We studied the evolutionary histories of the Mup and Esp genes and compared them with what is known about the Abp genes. Apparently gene conversion has played little if any role in the expansion of the mouse Class A and Class B Mup genes and pseudogenes, and the rat Mups. By contrast, we found evidence of extensive gene conversion in many Esp genes although not in all of them. Our studies of selection identified at least two amino acid sites in β-sheets as having evolved under positive selection in the mouse Class A and Class B MUPs and in rat MUPs. We show that selection may have acted on the ESPs by determining K(a)/K(s) for Exon 3 sequences with and without the converted sequence segment. While it appears that purifying selection acted on the ESP signal peptides, the secreted portions of the ESPs probably have undergone much more rapid evolution. When the inner gene converted fragment sequences were removed, eleven Esp paralogs were present in two or more pairs with K(a)/K(s) >1.0 and thus we propose that positive selection is detectable by this means in at least some mouse Esp paralogs. We compare and contrast the evolutionary histories of all three mouse pheromone gene families in light of their proposed functions in mouse communication.

  18. The A581G Mutation in the Gene Encoding Plasmodium falciparum Dihydropteroate Synthetase Reduces the Effectiveness of Sulfadoxine-Pyrimethamine Preventive Therapy in Malawian Pregnant Women.

    Science.gov (United States)

    Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E; Thwai, Kyaw L; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O

    2015-06-15

    The A581 G: mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased placental inflammation and decreased infant birth weight among women receiving intermittent preventive treatment with sulfadoxine-pyrimethamine (IPTp-SP) during pregnancy. Between 2009 and 2011, delivering women without human immunodeficiency virus infection were enrolled in an observational study of IPTp-SP effectiveness in Malawi. Parasites were detected by polymerase chain reaction (PCR); positive samples were sequenced to genotype the dhfr and dhps loci. The presence of K540 E: in dhps was used as a marker for the quintuple mutant. Samples from 1809 women were analyzed by PCR; 220 (12%) were positive for P. falciparum. A total of 202 specimens were genotyped at codon 581 of dhps; 17 (8.4%) harbored the sextuple mutant. The sextuple mutant was associated with higher risks of patent infection in peripheral blood (adjusted prevalence ratio [aPR], 2.76; 95% confidence interval [CI], 1.82-4.18) and placental blood (aPR 3.28; 95% CI, 1.88-5.78) and higher parasite densities. Recent SP use was not associated with increased parasite densities or placental pathology overall and among women with parasites carrying dhps A581 G: . IPTp-SP failed to inhibit parasite growth but did not exacerbate pathology among women infected with sextuple-mutant parasites. New interventions to prevent malaria during pregnancy are needed urgently. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  19. Global Analysis of miRNA Gene Clusters and Gene Families Reveals Dynamic and Coordinated Expression

    Directory of Open Access Journals (Sweden)

    Li Guo

    2014-01-01

    Full Text Available To further understand the potential expression relationships of miRNAs in miRNA gene clusters and gene families, a global analysis was performed in 4 paired tumor (breast cancer and adjacent normal tissue samples using deep sequencing datasets. The compositions of miRNA gene clusters and families are not random, and clustered and homologous miRNAs may have close relationships with overlapped miRNA species. Members in the miRNA group always had various expression levels, and even some showed larger expression divergence. Despite the dynamic expression as well as individual difference, these miRNAs always indicated consistent or similar deregulation patterns. The consistent deregulation expression may contribute to dynamic and coordinated interaction between different miRNAs in regulatory network. Further, we found that those clustered or homologous miRNAs that were also identified as sense and antisense miRNAs showed larger expression divergence. miRNA gene clusters and families indicated important biological roles, and the specific distribution and expression further enrich and ensure the flexible and robust regulatory network.

  20. Molecular modelling of calcium dependent protein kinase 4 (CDPK4) from Plasmodium falciparum

    CSIR Research Space (South Africa)

    Tsekoa, Tsepo L

    2009-10-01

    Full Text Available eukaryotic protein kinases (ePKs) as defined in model organisms. A novel family of phylogenetically distinct ePK-related genes in P. falciparum has been identified. These kinases (up to 20 in number [2], designated the FIKK family due to a conserved amino...]. The protein kinase complement of Plasmodium falciparum, the main infectious agent of lethal malaria in humans, has been analysed in detail [2, 3]. These analyses revealed that the P. falciparum kinome comprises as many as 65 sequences related to typical...

  1. Differential roles of TGIF family genes in mammalian reproduction

    Directory of Open Access Journals (Sweden)

    Renfree Marilyn B

    2011-09-01

    Full Text Available Abstract Background TG-interacting factors (TGIFs belong to a family of TALE-homeodomain proteins including TGIF1, TGIF2 and TGIFLX/Y in human. Both TGIF1 and TGIF2 act as transcription factors repressing TGF-β signalling. Human TGIFLX and its orthologue, Tex1 in the mouse, are X-linked genes that are only expressed in the adult testis. TGIF2 arose from TGIF1 by duplication, whereas TGIFLX arose by retrotransposition to the X-chromosome. These genes have not been characterised in any non-eutherian mammals. We therefore studied the TGIF family in the tammar wallaby (a marsupial mammal to investigate their roles in reproduction and how and when these genes may have evolved their functions and chromosomal locations. Results Both TGIF1 and TGIF2 were present in the tammar genome on autosomes but TGIFLX was absent. Tammar TGIF1 shared a similar expression pattern during embryogenesis, sexual differentiation and in adult tissues to that of TGIF1 in eutherian mammals, suggesting it has been functionally conserved. Tammar TGIF2 was ubiquitously expressed throughout early development as in the human and mouse, but in the adult, it was expressed only in the gonads and spleen, more like the expression pattern of human TGIFLX and mouse Tex1. Tammar TGIF2 mRNA was specifically detected in round and elongated spermatids. There was no mRNA detected in mature spermatozoa. TGIF2 protein was specifically located in the cytoplasm of spermatids, and in the residual body and the mid-piece of the mature sperm tail. These data suggest that tammar TGIF2 may participate in spermiogenesis, like TGIFLX does in eutherians. TGIF2 was detected for the first time in the ovary with mRNA produced in the granulosa and theca cells, suggesting it may also play a role in folliculogenesis. Conclusions The restricted and very similar expression of tammar TGIF2 to X-linked paralogues in eutherians suggests that the evolution of TGIF1, TGIF2 and TGIFLX in eutherians was accompanied by

  2. Deletion of Plasmodium falciparum Histidine-Rich Protein 2 (pfhrp2) and Histidine-Rich Protein 3 (pfhrp3) Genes in Colombian Parasites.

    Science.gov (United States)

    Murillo Solano, Claribel; Akinyi Okoth, Sheila; Abdallah, Joseph F; Pava, Zuleima; Dorado, Erika; Incardona, Sandra; Huber, Curtis S; Macedo de Oliveira, Alexandre; Bell, David; Udhayakumar, Venkatachalam; Barnwell, John W

    2015-01-01

    A number of studies have analyzed the performance of malaria rapid diagnostic tests (RDTs) in Colombia with discrepancies in performance being attributed to a combination of factors such as parasite levels, interpretation of RDT results and/or the handling and storage of RDT kits. However, some of the inconsistencies observed with results from Plasmodium falciparum histidine-rich protein 2 (PfHRP2)-based RDTs could also be explained by the deletion of the gene that encodes the protein, pfhrp2, and its structural homolog, pfhrp3, in some parasite isolates. Given that pfhrp2- and pfhrp3-negative P. falciparum isolates have been detected in the neighboring Peruvian and Brazilian Amazon regions, we hypothesized that parasites with deletions of pfhrp2 and pfhrp3 may also be present in Colombia. In this study we tested 100 historical samples collected between 1999 and 2009 from six Departments in Colombia for the presence of pfhrp2, pfhrp3 and their flanking genes. Seven neutral microsatellites were also used to determine the genetic background of these parasites. In total 18 of 100 parasite isolates were found to have deleted pfhrp2, a majority of which (14 of 18) were collected from Amazonas Department, which borders Peru and Brazil. pfhrp3 deletions were found in 52 of the 100 samples collected from all regions of the country. pfhrp2 flanking genes PF3D7_0831900 and PF3D7_0831700 were deleted in 22 of 100 and in 1 of 100 samples, respectively. pfhrp3 flanking genes PF3D7_1372100 and PF3D7_1372400 were missing in 55 of 100 and in 57 of 100 samples. Structure analysis of microsatellite data indicated that Colombian samples tested in this study belonged to four clusters and they segregated mostly based on their geographic region. Most of the pfhrp2-deleted parasites were assigned to a single cluster and originated from Amazonas Department although a few pfhrp2-negative parasites originated from the other three clusters. The presence of a high proportion of pfhrp2

  3. Analysis of the WUSCHEL-RELATED HOMEOBOX gene family in Pinus pinaster: New insights into the gene family evolution.

    Science.gov (United States)

    Alvarez, José M; Bueno, Natalia; Cañas, Rafael A; Avila, Concepción; Cánovas, Francisco M; Ordás, Ricardo J

    2018-02-01

    WUSCHEL-RELATED HOMEOBOX (WOX) genes are key players controlling stem cells in plants and can be divided into three clades according to the time of their appearance during plant evolution. Our knowledge of stem cell function in vascular plants other than angiosperms is limited, they separated from gymnosperms ca 300 million years ago and their patterning during embryogenesis differs significantly. For this reason, we have used the model gymnosperm Pinus pinaster to identify WOX genes and perform a thorough analysis of their gene expression patterns. Using transcriptomic data from a comprehensive range of tissues and stages of development we have shown three major outcomes: that the P. pinaster genome encodes at least fourteen members of the WOX family spanning all the major clades, that the genome of gymnosperms contains a WOX gene with no homologues in angiosperms representing a transitional stage between intermediate- and WUS-clade proteins, and that we can detect discrete WUS and WOX5 transcripts for the first time in a gymnosperm. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  4. Identification of ALK as the Major Familial Neuroblastoma Predisposition Gene

    Science.gov (United States)

    Mossë, Yalë P; Laudenslager, Marci; Longo, Luca; Cole, Kristina A; Wood, Andrew; Attiyeh, Edward F; Laquaglia, Michael J; Sennett, Rachel; Lynch, Jill E; Perri, Patrizia; Laureys, Geneviève; Speleman, Frank; Hakonarson, Hakon; Torkamani, Ali; Schork, Nicholas J; Brodeur, Garrett M; Tonini, Gian Paolo; Rappaport, Eric; Devoto, Marcella; Maris, John M

    2009-01-01

    SUMMARY Survival rates for the childhood cancer neuroblastoma have not substantively improved despite dramatic escalation in chemotherapy intensity. Like most human cancers, this embryonal malignancy can be inherited, but the genetic etiology of familial and sporadically occurring neuroblastoma was largely unknown. Here we show that germline mutations in the anaplastic lymphoma kinase gene (ALK) explain the majority of hereditary neuroblastomas, and that activating mutations can also be somatically acquired. We first identified a significant linkage signal at the short arm of chromosome 2 (maximum nonparametric LOD=4.23 at rs1344063) using a whole-genome scan in neuroblastoma pedigrees. Resequencing of regional candidate genes identified three separate missense mutations in the tyrosine kinase domain of ALK (G1128A, R1192P and R1275Q) that segregated with the disease in eight separate families. Examination of 491 sporadically occurring human neuroblastoma samples showed that the ALK locus was gained in 22.8%, and highly amplified in an additional 3.3%, and that these aberrations were highly associated with death from disease (P=0.0003). Resequencing of 194 high-risk neuroblastoma samples showed somatically acquired mutations within the tyrosine kinase domain in 12.4%. Nine of the ten mutations map to critical regions of the kinase domain and were predicted to be oncogenic drivers with high probability. Mutations resulted in constitutive phosphorylation consistent with activation, and targeted knockdown of ALK mRNA resulted in profound growth inhibition of 4 of 4 cell lines harboring mutant or amplified ALK, as well as 2 of 6 wild type for ALK. Our results demonstrate that heritable mutations of ALK are the major cause of familial neuroblastoma, and that germline or acquired activation of this cell surface kinase is a tractable therapeutic target for this lethal pediatric malignancy. PMID:18724359

  5. Plasmodium P-Type Cyclin CYC3 Modulates Endomitotic Growth during Oocyst Development in Mosquitoes

    Science.gov (United States)

    Ferguson, David J. P.; Kaindama, Mbinda L.; Brusini, Lorenzo; Joshi, Nimitray; Rchiad, Zineb; Brady, Declan; Guttery, David S.; Wheatley, Sally P.; Yamano, Hiroyuki; Holder, Anthony A.; Pain, Arnab; Wickstead, Bill; Tewari, Rita

    2015-01-01

    Cell-cycle progression and cell division in eukaryotes are governed in part by the cyclin family and their regulation of cyclin-dependent kinases (CDKs). Cyclins are very well characterised in model systems such as yeast and human cells, but surprisingly little is known about their number and role in Plasmodium, the unicellular protozoan parasite that causes malaria. Malaria parasite cell division and proliferation differs from that of many eukaryotes. During its life cycle it undergoes two types of mitosis: endomitosis in asexual stages and an extremely rapid mitotic process during male gametogenesis. Both schizogony (producing merozoites) in host liver and red blood cells, and sporogony (producing sporozoites) in the mosquito vector, are endomitotic with repeated nuclear replication, without chromosome condensation, before cell division. The role of specific cyclins during Plasmodium cell proliferation was unknown. We show here that the Plasmodium genome contains only three cyclin genes, representing an unusual repertoire of cyclin classes. Expression and reverse genetic analyses of the single Plant (P)-type cyclin, CYC3, in the rodent malaria parasite, Plasmodium berghei, revealed a cytoplasmic and nuclear location of the GFP-tagged protein throughout the lifecycle. Deletion of cyc3 resulted in defects in size, number and growth of oocysts, with abnormalities in budding and sporozoite formation. Furthermore, global transcript analysis of the cyc3-deleted and wild type parasites at gametocyte and ookinete stages identified differentially expressed genes required for signalling, invasion and oocyst development. Collectively these data suggest that cyc3 modulates oocyst endomitotic development in Plasmodium berghei. PMID:26565797

  6. Functional annotation and pathway analysis of genes differentially expressed in different stages of Plasmodium falciparum using RNA-Seq Data

    Directory of Open Access Journals (Sweden)

    Sanjay Kumar Singh

    2017-12-01

    Full Text Available Plasmodium falciparum, the deadly protozoan parasite, causes malaria. Malaria remains one of the deadliest infectious diseases in the world. The RNA-Seq data sets were downloaded from NCBI Short Read Archive under accession number SRP009370 for our analysis. Differentially expressed genes (DEGs between Ring (R and early trophozoite (ET, late trophozoite (LT, schizont (Sc, gametocyte stages (GII, gametocyte stages (GV, ookinete (Oo stages are 2442, 2796, 2935, 2807, 2180, 2895 respectively. There are total 4594 unique DEGs in the samples. DAVID was used to categorize enriched biological themes in the list of DEGs. It can be seen that main functions related to GO term ‘Biological Process’ are antigenic variation, pathogenesis, single organismal cell-cell adhesion, GO term ‘Cellular Component’ are host cell plasma membrane, infected host cell surface knob and GO term ‘Molecular Function’ are cell adhesion molecule binding, ATP-dependent RNA helicase activity. We found that PF3D7_1000400, PF3D7_1000600, PF3D7_0900500, PF3D7_0901500, PF3D7_0937400 were most up regulated and PF3D7_0632800, PF3D7_0711700, PF3D7_0712400, PF3D7_0712600, PF3D7_0712900, PF3D7_0808600 and PF3D7_0808700 were most down regulated genes involved in antigenic variation. Also PF3D7_0930300 was most up-regulated in Sc, LT and Oo stages and PF3D7_0936500 was most up-regulated in GV stage and PF3D7_0632800, PF3D7_0711700, PF3D7_0712400, PF3D7_0712600, PF3D7_0712900, PF3D7_0808600, PF3D7_0808700 were most down regulated genes involved in pathogenesis. A total of 300 pathways were predicted using KAAS server. Majority of the DEGs were found to be associated with important biological pathways such as metabolic pathways, biosynthesis of secondary metabolites, ribosome, spliceosome, biosynthesis of antibiotics, purine metabolism.

  7. Fine-scale genetic characterization of Plasmodium falciparum ...

    Indian Academy of Sciences (India)

    RESEARCH ARTICLE. Fine-scale genetic characterization of Plasmodium falciparum .... Materials and methods. The DNA ... the order and location of genes (as per the PlasmoDB data resources, available at ... There is currently an. Figure 5.

  8. Molecular evolution of the polyamine oxidase gene family in Metazoa

    Directory of Open Access Journals (Sweden)

    Polticelli Fabio

    2012-06-01

    Full Text Available Abstract Background Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO and acetylpolyamine oxidase (APAO, specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO, it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. Results We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported

  9. A simple, high-throughput method to detect Plasmodium falciparum single nucleotide polymorphisms in the dihydrofolate reductase, dihydropteroate synthase, and P. falciparum chloroquine resistance transporter genes using polymerase chain reaction- and enzyme-linked immunosorbent

    DEFF Research Database (Denmark)

    Alifrangis, Michael; Enosse, Sonia; Pearce, Richard

    2005-01-01

    Single nucleotide polymorphisms (SNPs) in the Plasmodium falciparum dihydrofolate reductase (dhfr), and dihydropteroate synthetase (dhps), and chloroquine resistance transporter (Pfcrt) genes are used as molecular markers of P. falciparum resistance to sulfadoxine/pyrimethamine and chloroquine....... However, to be a practical tool in the surveillance of drug resistance, simpler methods for high-throughput haplotyping are warranted. Here we describe a quick and simple technique that detects dhfr, dhps, and Pfcrt SNPs using polymerase chain reaction (PCR)- and enzyme-linked immunosorbent assay (ELISA...

  10. Computational identification of signalling pathways in Plasmodium falciparum.

    Science.gov (United States)

    Oyelade, Jelili; Ewejobi, Itunu; Brors, Benedikt; Eils, Roland; Adebiyi, Ezekiel

    2011-06-01

    Malaria is one of the world's most common and serious diseases causing death of about 3 million people each year. Its most severe occurrence is caused by the protozoan Plasmodium falciparum. Reports have shown that the resistance of the parasite to existing drugs is increasing. Therefore, there is a huge and urgent need to discover and validate new drug or vaccine targets to enable the development of new treatments for malaria. The ability to discover these drug or vaccine targets can only be enhanced from our deep understanding of the detailed biology of the parasite, for example how cells function and how proteins organize into modules such as metabolic, regulatory and signal transduction pathways. It has been noted that the knowledge of signalling transduction pathways in Plasmodium is fundamental to aid the design of new strategies against malaria. This work uses a linear-time algorithm for finding paths in a network under modified biologically motivated constraints. We predicted several important signalling transduction pathways in Plasmodium falciparum. We have predicted a viable signalling pathway characterized in terms of the genes responsible that may be the PfPKB pathway recently elucidated in Plasmodium falciparum. We obtained from the FIKK family, a signal transduction pathway that ends up on a chloroquine resistance marker protein, which indicates that interference with FIKK proteins might reverse Plasmodium falciparum from resistant to sensitive phenotype. We also proposed a hypothesis that showed the FIKK proteins in this pathway as enabling the resistance parasite to have a mechanism for releasing chloroquine (via an efflux process). Furthermore, we also predicted a signalling pathway that may have been responsible for signalling the start of the invasion process of Red Blood Cell (RBC) by the merozoites. It has been noted that the understanding of this pathway will give insight into the parasite virulence and will facilitate rational vaccine design

  11. The implication of dihydrofolate reductase and dihydropteroate synthetase gene mutations in modification of Plasmodium falciparum characteristics

    DEFF Research Database (Denmark)

    A-Elbasit, Ishraga E; Alifrangis, Michael; Khalil, Insaf F

    2007-01-01

    the effects of dhfr/dhps mutations on parasite characteristics other than SP resistance. METHOD: Parasite infections obtained from 153 Sudanese patients with uncomplicated falciparum malaria treated with SP or SP + chloroquine, were successfully genotyped at nine codons in the dhfr/dhps genes by PCR...... grades: wild-types (grade 0; frequency, 0.03) and infections with MOM grades of 1 to 5, with the following cumulative frequency; 0.97, 0.931, 0.866, 0.719, 0.121, respectively. There was no significant association between the MOM and SP response. Importantly, immunity, using age as a surrogate marker...

  12. Genomewide analysis of MATE-type gene family in maize reveals ...

    Indian Academy of Sciences (India)

    Huasheng Zhu and Jiandong Wu contributed equally to this work. As a group of secondary active transporters, the MATE gene family consists of multiple genes that widely exist in ..... Roots of the stress-treated plants were collected at 0,.

  13. TreeFam: a curated database of phylogenetic trees of animal gene families

    DEFF Research Database (Denmark)

    Li, Heng; Coghlan, Avril; Ruan, Jue

    2006-01-01

    TreeFam is a database of phylogenetic trees of gene families found in animals. It aims to develop a curated resource that presents the accurate evolutionary history of all animal gene families, as well as reliable ortholog and paralog assignments. Curated families are being added progressively......, based on seed alignments and trees in a similar fashion to Pfam. Release 1.1 of TreeFam contains curated trees for 690 families and automatically generated trees for another 11 646 families. These represent over 128 000 genes from nine fully sequenced animal genomes and over 45 000 other animal proteins...

  14. Analysis of polymorphisms in Plasmodium falciparum genes related to drug resistance: a survey over four decades under different treatment policies in Brazil.

    Science.gov (United States)

    Inoue, Juliana; Lopes, Dinora; do Rosário, Virgílio; Machado, Marta; Hristov, Angélica D; Lima, Giselle Fmc; Costa-Nascimento, Maria J; Segurado, Aluísio C; Di Santi, Silvia M

    2014-09-19

    Anti-malarial resistance in Plasmodium falciparum remains an obstacle for malaria control. Resistance-associated genes were analysed in Brazilian samples over four decades to evaluate the impact of different treatment regimens on the parasite genetic profile. Samples were collected on filter paper from patients infected in the Amazon region from 1984 to 2011. DNA was extracted with Chelex® 100 and monoinfection confirmed by PCR. SNPs in the pfcrt, pfmdr1, pfdhfr and pfdhps genes were assessed by PCR-RFLP. The pfmdr1 copy number was estimated using real time quantitative PCR with SYBR® Green. Parasite response was assessed ex vivo with seven concentrations of each anti-malarial. Patients were treated according to Brazilian guidelines: quinine plus tetracycline or mefloquine in period 1 and ACT in period 2. All 96 samples presented the pfcrt 76T mutant throughout the assessed periods. In addition, all isolates showed ex vivo chloroquine resistance. The pfmdr1 86Y was detected in 1.5% of samples in period 1, and in 25% in period 2. All samples presented the pfmdr1 1246Y. The analysis of pfmdr1 copy number showed amplification in 37.3% in period 1 and in 42% in period 2. Mutations in pfdhfr were shown as follows: 51I in all samples in period 1 and in 81.2% in period 2; 59R in 6.4% in period 2. The pfdhfr 108N and the pfdhps 437G were seen in all samples along time; the pfdhps 540E in 93.7% in period 1 and in 75% in period 2. The 76T mutation associated to chloroquine resistance is still present in the parasite population, although this anti-malarial was withdrawn from the chemotherapy of P. falciparum in Brazil in the mid-1980s. All isolates assayed ex vivo for chloroquine showed resistant phenotype and 76T. No association was observed between pfmdr1 mutations and resistance to quinine, mefloquine and artemisinin derivatives. Additionally, the pfdhfr 108N mutation was detected in all samples throughout the evaluated periods, demonstrating fixation of the mutant

  15. Plasmodium falciparum Plasmodium helical interspersed subtelomeric proteins contribute to cytoadherence and anchor P. falciparum erythrocyte membrane protein 1 to the host cell cytoskeleton

    DEFF Research Database (Denmark)

    Oberli, Alexander; Zurbrügg, Laura; Rusch, Sebastian

    2016-01-01

    is anchored to the cytoskeleton, and the Plasmodium helical interspersed subtelomeric (PHIST) gene family plays a role in many host cell modifications including binding the intracellular domain of PfEMP1. Here, we show that conditional reduction of the PHIST protein PFE1605w strongly reduces adhesion...... interacts with both the intracellular segment of PfEMP1 and with cytoskeletal components. This is the first report of a PHIST protein interacting with key molecules of the cytoadherence complex and the host cytoskeleton, and this functional role seems to play an essential role in the pathology of P...

  16. Identification of a novel gene family that includes the interferon-inducible human genes 6–16 and ISG12

    Directory of Open Access Journals (Sweden)

    Parker Nadeene

    2004-01-01

    Full Text Available Abstract Background The human 6–16 and ISG12 genes are transcriptionally upregulated in a variety of cell types in response to type I interferon (IFN. The predicted products of these genes are small (12.9 and 11.5 kDa respectively, hydrophobic proteins that share 36% overall amino acid identity. Gene disruption and over-expression studies have so far failed to reveal any biochemical or cellular roles for these proteins. Results We have used in silico analyses to identify a novel family of genes (the ISG12 gene family related to both the human 6–16 and ISG12 genes. Each ISG12 family member codes for a small hydrophobic protein containing a conserved ~80 amino-acid motif (the ISG12 motif. So far we have detected 46 family members in 25 organisms, ranging from unicellular eukaryotes to humans. Humans have four ISG12 genes: the 6–16 gene at chromosome 1p35 and three genes (ISG12(a, ISG12(b and ISG12(c clustered at chromosome 14q32. Mice have three family members (ISG12(a, ISG12(b1 and ISG12(b2 clustered at chromosome 12F1 (syntenic with human chromosome 14q32. There does not appear to be a murine 6–16 gene. On the basis of phylogenetic analyses, genomic organisation and intron-alignments we suggest that this family has arisen through divergent inter- and intra-chromosomal gene duplication events. The transcripts from human and mouse genes are detectable, all but two (human ISG12(b and ISG12(c being upregulated in response to type I IFN in the cell lines tested. Conclusions Members of the eukaryotic ISG12 gene family encode a small hydrophobic protein with at least one copy of a newly defined motif of ~80 amino-acids (the ISG12 motif. In higher eukaryotes, many of the genes have acquired a responsiveness to type I IFN during evolution suggesting that a role in resisting cellular or environmental stress may be a unifying property of all family members. Analysis of gene-function in higher eukaryotes is complicated by the possibility of

  17. Cytokinin Regulation of Gene Expression in the AHP Gene Family in Arabidopsis thaliana

    Czech Academy of Sciences Publication Activity Database

    Hradilová, Jana; Malbeck, Jiří; Brzobohatý, Břetislav

    2007-01-01

    Roč. 26, č. 3 (2007), s. 229-244 ISSN 0721-7595 R&D Projects: GA MŠk LN00A081; GA MŠk 1M06030; GA MŠk(CZ) LC06034; GA AV ČR(CZ) IAA600380507; GA AV ČR IAA600040612 Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50040702 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : gene expression * AHP gene family * cytokinin signal transduction Subject RIV: EF - Botanics Impact factor: 2.220, year: 2007

  18. Identification and expression profiling analysis of TCP family genes involved in growth and development in maize.

    Science.gov (United States)

    Chai, Wenbo; Jiang, Pengfei; Huang, Guoyu; Jiang, Haiyang; Li, Xiaoyu

    2017-10-01

    The TCP family is a group of plant-specific transcription factors. TCP genes encode proteins harboring bHLH structure, which is implicated in DNA binding and protein-protein interactions and known as the TCP domain. TCP genes play important roles in plant development and have been evolutionarily and functionally elaborated in various plants, however, no overall phylogenetic analysis or expression profiling of TCP genes in Zea mays has been reported. In the present study, a systematic analysis of molecular evolution and functional prediction of TCP family genes in maize ( Z . mays L.) has been conducted. We performed a genome-wide survey of TCP genes in maize, revealing the gene structure, chromosomal location and phylogenetic relationship of family members. Microsynteny between grass species and tissue-specific expression profiles were also investigated. In total, 29 TCP genes were identified in the maize genome, unevenly distributed on the 10 maize chromosomes. Additionally, ZmTCP genes were categorized into nine classes based on phylogeny and purifying selection may largely be responsible for maintaining the functions of maize TCP genes. What's more, microsynteny analysis suggested that TCP genes have been conserved during evolution. Finally, expression analysis revealed that most TCP genes are expressed in the stem and ear, which suggests that ZmTCP genes influence stem and ear growth. This result is consistent with the previous finding that maize TCP genes represses the growth of axillary organs and enables the formation of female inflorescences. Altogether, this study presents a thorough overview of TCP family in maize and provides a new perspective on the evolution of this gene family. The results also indicate that TCP family genes may be involved in development stage in plant growing conditions. Additionally, our results will be useful for further functional analysis of the TCP gene family in maize.

  19. Molecular cloning of RBCS genes in Selaginella and the evolution of the rbcS gene family

    Directory of Open Access Journals (Sweden)

    Wang Bo

    2015-01-01

    Full Text Available Rubisco small subunits (RBCS are encoded by a nuclear rbcS multigene family in higher plants and green algae. However, owing to the lack of rbcS sequences in lycophytes, the characteristics of rbcS genes in lycophytes is unclear. Recently, the complete genome sequence of the lycophyte Selaginella moellendorffii provided the first insight into the rbcS gene family in lycophytes. To understand further the characteristics of rbcS genes in other Selaginella, the full length of rbcS genes (rbcS1 and rbcS2 from two other Selaginella species were isolated. Both rbcS1 and rbcS2 genes shared more than 97% identity among three Selaginella species. RBCS proteins from Selaginella contained the Pfam RBCS domain F00101, which was a major domain of other plant RBCS proteins. To explore the evolution of the rbcS gene family across Selaginella and other plants, we identified and performed comparative analysis of the rbcS gene family among 16 model plants based on a genome-wide analysis. The results showed that (i two rbcS genes were obtained in Selaginella, which is the second fewest number of rbcS genes among the 16 representative plants; (ii an expansion of rbcS genes occurred in the moss Physcomitrella patens; (iii only RBCS proteins from angiosperms contained the Pfam PF12338 domains, and (iv a pattern of concerted evolution existed in the rbcS gene family. Our study provides new insights into the evolution of the rbcS gene family in Selaginella and other plants.

  20. Molecular characterization of edestin gene family in Cannabis sativa L.

    Science.gov (United States)

    Docimo, Teresa; Caruso, Immacolata; Ponzoni, Elena; Mattana, Monica; Galasso, Incoronata

    2014-11-01

    Globulins are the predominant class of seed storage proteins in a wide variety of plants. In many plant species globulins are present in several isoforms encoded by gene families. The major seed storage protein of Cannabis sativa L. is the globulin edestin, widely known for its nutritional potential. In this work, we report the isolation of seven cDNAs encoding for edestin from the C. sativa variety Carmagnola. Southern blot hybridization is in agreement with the number of identified edestin genes. All seven sequences showed the characteristic globulin features, but they result to be divergent members/forms of two edestin types. According to their sequence similarity four forms named CsEde1A, CsEde1B, CsEde1C, CsEde1D have been assigned to the edestin type 1 and the three forms CsEde2A, CsEde2B, CsEde2C to the edestin type 2. Analysis of the coding sequences revealed a high percentage of similarity (98-99%) among the different forms belonging to the same type, which decreased significantly to approximately 64% between the forms belonging to different types. Quantitative RT-PCR analysis revealed that both edestin types are expressed in developing hemp seeds and the amount of CsEde1 was 4.44 ± 0.10 higher than CsEde2. Both edestin types exhibited a high percentage of arginine (11-12%), but CsEde2 resulted particularly rich in methionine residues (2.36%) respect to CsEde1 (0.82%). The amino acid composition determined in CsEde1 and CsEde2 types suggests that these seed proteins can be used to improve the nutritional quality of plant food-stuffs. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  1. IL4 gene polymorphism and previous malaria experiences manipulate anti-Plasmodium falciparum antibody isotype profiles in complicated and uncomplicated malaria

    Directory of Open Access Journals (Sweden)

    Kalambaheti Thareerat

    2009-12-01

    Full Text Available Abstract Background The IL4-590 gene polymorphism has been shown to be associated with elevated levels of anti-Plasmodium falciparum IgG antibodies and parasite intensity in the malaria protected Fulani of West Africa. This study aimed to investigate the possible impact of IL4-590C/T polymorphism on anti-P. falciparum IgG subclasses and IgE antibodies levels and the alteration of malaria severity in complicated and uncomplicated malaria patients with or without previous malaria experiences. Methods Anti-P.falciparum IgG subclasses and IgE antibodies in plasma of complicated and uncomplicated malaria patients with or without previous malaria experiences were analysed using ELISA. IL4-590 polymorphisms were genotyped using RFLP-PCR. Statistical analyses of the IgG subclass levels were done by Oneway ANOVA. Genotype differences were tested by Chi-squared test. Results The IL4-590T allele was significantly associated with anti-P. falciparum IgG3 antibody levels in patients with complicated (P = 0.031, but not with uncomplicated malaria (P = 0.622. Complicated malaria patients with previous malaria experiences carrying IL4-590TT genotype had significantly lower levels of anti-P. falciparum IgG3 (P = 0.0156, while uncomplicated malaria patients with previous malaria experiences carrying the same genotype had significantly higher levels (P = 0.0206 compared to their IL4-590 counterparts. The different anti-P. falciparum IgG1 and IgG3 levels among IL4 genotypes were observed. Complicated malaria patients with previous malaria experiences tended to have lower IgG3 levels in individuals carrying TT when compared to CT genotypes (P = 0.075. In contrast, complicated malaria patients without previous malaria experiences carrying CC genotype had significantly higher anti-P. falciparum IgG1 than those carrying either CT or TT genotypes (P = 0.004, P = 0.002, respectively. Conclusion The results suggest that IL4-590C or T alleles participated differently in the

  2. The IQD gene family in soybean: structure, phylogeny, evolution and expression.

    Directory of Open Access Journals (Sweden)

    Lin Feng

    Full Text Available Members of the plant-specific IQ67-domain (IQD protein family are involved in plant development and the basal defense response. Although systematic characterization of this family has been carried out in Arabidopsis, tomato (Solanum lycopersicum, Brachypodium distachyon and rice (Oryza sativa, systematic analysis and expression profiling of this gene family in soybean (Glycine max have not previously been reported. In this study, we identified and structurally characterized IQD genes in the soybean genome. A complete set of 67 soybean IQD genes (GmIQD1-67 was identified using Blast search tools, and the genes were clustered into four subfamilies (IQD I-IV based on phylogeny. These soybean IQD genes are distributed unevenly across all 20 chromosomes, with 30 segmental duplication events, suggesting that segmental duplication has played a major role in the expansion of the soybean IQD gene family. Analysis of the Ka/Ks ratios showed that the duplicated genes of the GmIQD family primarily underwent purifying selection. Microsynteny was detected in most pairs: genes in clade 1-3 might be present in genome regions that were inverted, expanded or contracted after the divergence; most gene pairs in clade 4 showed high conservation with little rearrangement among these gene-residing regions. Of the soybean IQD genes examined, six were most highly expressed in young leaves, six in flowers, one in roots and two in nodules. Our qRT-PCR analysis of 24 soybean IQD III genes confirmed that these genes are regulated by MeJA stress. Our findings present a comprehensive overview of the soybean IQD gene family and provide insights into the evolution of this family. In addition, this work lays a solid foundation for further experiments aimed at determining the biological functions of soybean IQD genes in growth and development.

  3. Diagnostic Yield of Sequencing Familial Hypercholesterolemia Genes in Severe Hypercholesterolemia

    Science.gov (United States)

    Khera, Amit V.; Won, Hong-Hee; Peloso, Gina M.; Lawson, Kim S.; Bartz, Traci M.; Deng, Xuan; van Leeuwen, Elisabeth M.; Natarajan, Pradeep; Emdin, Connor A.; Bick, Alexander G.; Morrison, Alanna C.; Brody, Jennifer A.; Gupta, Namrata; Nomura, Akihiro; Kessler, Thorsten; Duga, Stefano; Bis, Joshua C.; van Duijn, Cornelia M.; Cupples, L. Adrienne; Psaty, Bruce; Rader, Daniel J.; Danesh, John; Schunkert, Heribert; McPherson, Ruth; Farrall, Martin; Watkins, Hugh; Lander, Eric; Wilson, James G.; Correa, Adolfo; Boerwinkle, Eric; Merlini, Piera Angelica; Ardissino, Diego; Saleheen, Danish; Gabriel, Stacey; Kathiresan, Sekar

    2017-01-01

    Background About 7% of US adults have severe hypercholesterolemia (untreated LDL cholesterol ≥190 mg/dl). Such high LDL levels may be due to familial hypercholesterolemia (FH), a condition caused by a single mutation in any of three genes. Lifelong elevations in LDL cholesterol in FH mutation carriers may confer CAD risk beyond that captured by a single LDL cholesterol measurement. Objectives Assess the prevalence of a FH mutation among those with severe hypercholesterolemia and determine whether CAD risk varies according to mutation status beyond the observed LDL cholesterol. Methods Three genes causative for FH (LDLR, APOB, PCSK9) were sequenced in 26,025 participants from 7 case-control studies (5,540 CAD cases, 8,577 CAD-free controls) and 5 prospective cohort studies (11,908 participants). FH mutations included loss-of-function variants in LDLR, missense mutations in LDLR predicted to be damaging, and variants linked to FH in ClinVar, a clinical genetics database. Results Among 8,577 CAD-free control participants, 430 had LDL cholesterol ≥190 mg/dl; of these, only eight (1.9%) carried a FH mutation. Similarly, among 11,908 participants from 5 prospective cohorts, 956 had LDL cholesterol ≥190 mg/dl and of these, only 16 (1.7%) carried a FH mutation. Within any stratum of observed LDL cholesterol, risk of CAD was higher among FH mutation carriers when compared with non-carriers. When compared to a reference group with LDL cholesterol <130 mg/dl and no mutation, participants with LDL cholesterol ≥190 mg/dl and no FH mutation had six-fold higher risk for CAD (OR 6.0; 95%CI 5.2–6.9) whereas those with LDL cholesterol ≥190 mg/dl as well as a FH mutation demonstrated twenty-two fold increased risk (OR 22.3; 95%CI 10.7–53.2). Conclusions Among individuals with LDL cholesterol ≥190 mg/dl, gene sequencing identified a FH mutation in <2%. However, for any given observed LDL cholesterol, FH mutation carriers are at substantially increased risk for CAD

  4. of Plasmodium cynomolgi

    African Journals Online (AJOL)

    SERVER

    2007-11-19

    Nov 19, 2007 ... AMA-1 sequences implies a conserved function for this molecule across different species of. Plasmodium. ... knowledge of detailed structural organization is crucial in ... sional (3D) structure of a protein are of great assistance.

  5. Search for intracranial aneurysm susceptibility gene(s using Finnish families

    Directory of Open Access Journals (Sweden)

    Ryynänen Markku

    2002-08-01

    Full Text Available Abstract Background Cerebrovascular disease is the third leading cause of death in the United States, and about one-fourth of cerebrovascular deaths are attributed to ruptured intracranial aneurysms (IA. Epidemiological evidence suggests that IAs cluster in families, and are therefore probably genetic. Identification of individuals at risk for developing IAs by genetic tests will allow concentration of diagnostic imaging on high-risk individuals. We used model-free linkage analysis based on allele sharing with a two-stage design for a genome-wide scan to identify chromosomal regions that may harbor IA loci. Methods We previously estimated sibling relative risk in the Finnish population at between 9 and 16, and proceeded with a genome-wide scan for loci predisposing to IA. In 85 Finnish families with two or more affected members, 48 affected sibling pairs (ASPs were available for our genetic study. Power calculations indicated that 48 ASPs were adequate to identify chromosomal regions likely to harbor predisposing genes and that a liberal stage I lod score threshold of 0.8 provided a reasonable balance between detection of false positive regions and failure to detect real loci with moderate effect. Results Seven chromosomal regions exceeded the stage I lod score threshold of 0.8 and five exceeded 1.0. The most significant region, on chromosome 19q, had a maximum multipoint lod score (MLS of 2.6. Conclusions Our study provides evidence for the locations of genes predisposing to IA. Further studies are necessary to elucidate the genes and their role in the pathophysiology of IA, and to design genetic tests.

  6. Fast and simple protein-alignment-guided assembly of orthologous gene families from microbiome sequencing reads.

    Science.gov (United States)

    Huson, Daniel H; Tappu, Rewati; Bazinet, Adam L; Xie, Chao; Cummings, Michael P; Nieselt, Kay; Williams, Rohan

    2017-01-25

    Microbiome sequencing projects typically collect tens of millions of short reads per sample. Depending on the goals of the project, the short reads can either be subjected to direct sequence analysis or be assembled into longer contigs. The assembly of whole genomes from metagenomic sequencing reads is a very difficult problem. However, for some questions, only specific genes of interest need to be assembled. This is then a gene-centric assembly where the goal is to assemble reads into contigs for a family of orthologous genes. We present a new method for performing gene-centric assembly, called protein-alignment-guided assembly, and provide an implementation in our metagenome analysis tool MEGAN. Genes are assembled on the fly, based on the alignment of all reads against a protein reference database such as NCBI-nr. Specifically, the user selects a gene family based on a classification such as KEGG and all reads binned to that gene family are assembled. Using published synthetic community metagenome sequencing reads and a set of 41 gene families, we show that the performance of this approach compares favorably with that of full-featured assemblers and that of a recently published HMM-based gene-centric assembler, both in terms of the number of reference genes detected and of the percentage of reference sequence covered. Protein-alignment-guided assembly of orthologous gene families complements whole-metagenome assembly in a new and very useful way.

  7. The Plasmodium serine-type SERA proteases display distinct expression patterns and non-essential in vivo roles during life cycle progression of the malaria parasite.

    Science.gov (United States)

    Putrianti, Elyzana D; Schmidt-Christensen, Anja; Arnold, Iris; Heussler, Volker T; Matuschewski, Kai; Silvie, Olivier

    2010-06-01

    Parasite proteases play key roles in several fundamental steps of the Plasmodium life cycle, including haemoglobin degradation, host cell invasion and parasite egress. Plasmodium exit from infected host cells appears to be mediated by a class of papain-like cysteine proteases called 'serine repeat antigens' (SERAs). A SERA subfamily, represented by Plasmodium falciparum SERA5, contains an atypical active site serine residue instead of a catalytic cysteine. Members of this SERAser subfamily are abundantly expressed in asexual blood stages, rendering them attractive drug and vaccine targets. In this study, we show by antibody localization and in vivo fluorescent tagging with the red fluorescent protein mCherry that the two P. berghei serine-type family members, PbSERA1 and PbSERA2, display differential expression towards the final stages of merozoite formation. Via targeted gene replacement, we generated single and double gene knockouts of the P. berghei SERAser genes. These loss-of-function lines progressed normally through the parasite life cycle, suggesting a specialized, non-vital role for serine-type SERAs in vivo. Parasites lacking PbSERAser showed increased expression of the cysteine-type PbSERA3. Compensatory mechanisms between distinct SERA subfamilies may thus explain the absence of phenotypical defect in SERAser disruptants, and challenge the suitability to develop potent antimalarial drugs based on specific inhibitors of Plasmodium serine-type SERAs.

  8. Regulation of antigenic variation in Plasmodium falciparum: censoring freedom of expression?

    Science.gov (United States)

    Duffy, Michael F; Reeder, John C; Brown, Graham V

    2003-03-01

    Plasmodium falciparum employs a strategy of clonal antigenic variation to evade the host immune response during the intraerythrocytic stage of its life cycle. The major variant parasite molecule is the P. falciparum erythrocyte membrane protein (PfEMP)1, which is encoded by the var multigene family. The parasite switches between different PfEMP1 molecules through regulation of var transcription. Recent studies have shed considerable light on this process, but much remains unknown. However, striking parallels between transcriptional control of var and genes in other organisms provide direction for future studies.

  9. Molecular analysis of the NDP gene in two families with Norrie disease.

    Science.gov (United States)

    Rivera-Vega, M Refugio; Chiñas-Lopez, Silvet; Vaca, Ana Luisa Jimenez; Arenas-Sordo, M Luz; Kofman-Alfaro, Susana; Messina-Baas, Olga; Cuevas-Covarrubias, Sergio Alberto

    2005-04-01

    To describe the molecular defects in the Norrie disease protein (NDP) gene in two families with Norrie disease (ND). We analysed two families with ND at molecular level through polymerase chain reaction, DNA sequence analysis and GeneScan. Two molecular defects found in the NDP gene were: a missense mutation (265C > G) within codon 97 that resulted in the interchange of arginine by proline, and a partial deletion in the untranslated 3' region of exon 3 of the NDP gene. Clinical findings were more severe in the family that presented the partial deletion. We also diagnosed the carrier status of one daughter through GeneScan; this method proved to be a useful tool for establishing female carriers of ND. Here we report two novel mutations in the NDP gene in Mexican patients and propose that GeneScan is a viable mean of establishing ND carrier status.

  10. FGF: A web tool for Fishing Gene Family in a whole genome database

    DEFF Research Database (Denmark)

    Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong

    2007-01-01

    to efficiently search for and identify gene families. The FGF output displays the results as visual phylogenetic trees including information on gene structure, chromosome position, duplication fate and selective pressure. It is particularly useful to identify pseudogenes and detect changes in gene structure. FGF...

  11. FGF: A web tool for Fishing Gene Family in a whole genome database

    DEFF Research Database (Denmark)

    Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong

    2007-01-01

    Gene duplication is an important process in evolution. The availability of genome sequences of a number of organisms has made it possible to conduct comprehensive searches for duplicated genes enabling informative studies of their evolution. We have established the FGF (Fishing Gene Family) progr...... is freely available on a web server at http://fgf.genomics.org.cn/...

  12. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    Science.gov (United States)

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  13. Gender in childhood obesity: family environment, hormones, and genes.

    Science.gov (United States)

    Wisniewski, Amy B; Chernausek, Steven D

    2009-01-01

    The prevalence of obesity among children in the United States represents a pool of latent morbidity. Though the prevalence of obesity has increased in both boys and girls, the causes and consequences differ between the sexes. Thus, interventions proposed to treat and prevent childhood obesity will need to account for these differences. This review examines gender differences in the presentation of obesity in children and describes environmental, hormonal, and genetic factors that contribute to observed gender differences. A search of peer-reviewed, published literature was performed with PubMed for articles published from January 1974 through October 2008. Search terms used were obesity, sex, gender, hormones, family environment, body composition, adiposity, and genes. Studies of children aged 0 to 18 years were included, and only articles published in English were reviewed for consideration. Articles that illustrated gender differences in either the presentation or underlying mechanisms of obesity in children were reviewed for content, and their bibliographies were used to identify other relevant literature. Gender differences in childhood obesity have been understudied partially because of how we define the categories of overweight and obesity. Close examination of studies revealed that gender differences were common, both before and during puberty. Boys and girls differ in body composition, patterns of weight gain, hormone biology, and the susceptibility to certain social, ethnic, genetic, and environmental factors. Our understanding of how gender differences in pediatric populations relate to the pathogenesis of obesity and the subsequent development of associated comorbid states is critical to developing and implementing both therapeutic and preventive interventions.

  14. Extensive lineage-specific gene duplication and evolution of the spiggin multi-gene family in stickleback

    Directory of Open Access Journals (Sweden)

    Nishida Mutsumi

    2007-11-01

    Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.

  15. Gene Structures, Evolution and Transcriptional Profiling of the WRKY Gene Family in Castor Bean (Ricinus communis L.).

    Science.gov (United States)

    Zou, Zhi; Yang, Lifu; Wang, Danhua; Huang, Qixing; Mo, Yeyong; Xie, Guishui

    2016-01-01

    WRKY proteins comprise one of the largest transcription factor families in plants and form key regulators of many plant processes. This study presents the characterization of 58 WRKY genes from the castor bean (Ricinus communis L., Euphorbiaceae) genome. Compared with the automatic genome annotation, one more WRKY-encoding locus was identified and 20 out of the 57 predicted gene models were manually corrected. All RcWRKY genes were shown to contain at least one intron in their coding sequences. According to the structural features of the present WRKY domains, the identified RcWRKY genes were assigned to three previously defined groups (I-III). Although castor bean underwent no recent whole-genome duplication event like physic nut (Jatropha curcas L., Euphorbiaceae), comparative genomics analysis indicated that one gene loss, one intron loss and one recent proximal duplication occurred in the RcWRKY gene family. The expression of all 58 RcWRKY genes was supported by ESTs and/or RNA sequencing reads derived from roots, leaves, flowers, seeds and endosperms. Further global expression profiles with RNA sequencing data revealed diverse expression patterns among various tissues. Results obtained from this study not only provide valuable information for future functional analysis and utilization of the castor bean WRKY genes, but also provide a useful reference to investigate the gene family expansion and evolution in Euphorbiaceus plants.

  16. Undefined familial colorectal cancer and the role of pleiotropism in cancer susceptibility genes.

    Science.gov (United States)

    Dobbins, Sara E; Broderick, Peter; Chubb, Daniel; Kinnersley, Ben; Sherborne, Amy L; Houlston, Richard S

    2016-10-01

    Although family history is a major risk factor for colorectal cancer (CRC) a genetic diagnosis cannot be obtained in over 50 % of familial cases when screened for known CRC cancer susceptibility genes. The genetics of undefined-familial CRC is complex and recent studies have implied additional clinically actionable mutations for CRC in susceptibility genes for other cancers. To clarify the contribution of non-CRC susceptibility genes to undefined-familial CRC we conducted a mutational screen of 114 cancer susceptibility genes in 847 patients with early-onset undefined-familial CRC and 1609 controls by analysing high-coverage exome sequencing data. We implemented American College of Medical Genetics and Genomics standards and guidelines for assigning pathogenicity to variants. Globally across all 114 cancer susceptibility genes no statistically significant enrichment of likely pathogenic variants was shown (6.7 % cases 57/847, 5.3 % controls 85/1609; P = 0.15). Moreover there was no significant enrichment of mutations in genes such as TP53 or BRCA2 which have been proposed for clinical testing in CRC. In conclusion, while we identified genes that may be considered interesting candidates as determinants of CRC risk warranting further research, there is currently scant evidence to support a role for genes other than those responsible for established CRC syndromes in the clinical management of familial CRC.

  17. Construction of a system for heterologous production of carbonic anhydrase from Plasmodium falciparum in Pichia pastoris

    OpenAIRE

    Gullberg, Erik

    2008-01-01

    Malaria is one of the biggest current global health problems, and with the increasing occurance of drug resistant Plasmodium falciparum strains, there is an urgent need for new antimalarial drugs. Given the important role of carbonic anhydrase in Plasmodium falciparum (PfCA), it is a potential novel drug target. Heterologous expression of malaria proteins is problematic due to the unusual codon usage of the Plasmodium genome, so to overcome this problem a synthetic PfCA gene was designed, opt...

  18. Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants.

    Science.gov (United States)

    Rawal, H C; Singh, N K; Sharma, T R

    2013-01-01

    Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL) and peroxidase A (POX A) enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula), fruits (Vitis vinifera), cereals (Sorghum bicolor, Zea mays, and Oryza sativa), trees (Populus trichocarpa), and model dicot (Arabidopsis thaliana) and monocot (Brachypodium distachyon) species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.

  19. Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants

    Directory of Open Access Journals (Sweden)

    H. C. Rawal

    2013-01-01

    Full Text Available Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL and peroxidase A (POX A enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula, fruits (Vitis vinifera, cereals (Sorghum bicolor, Zea mays, and Oryza sativa, trees (Populus trichocarpa, and model dicot (Arabidopsis thaliana and monocot (Brachypodium distachyon species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.

  20. Transcriptional profiling of the human fibrillin/LTBP gene family, key regulators of mesenchymal cell functions

    DEFF Research Database (Denmark)

    Davis, Margaret R.; Andersson, Robin; Severin, Jessica

    2014-01-01

    in the structure of the extracellular matrix and controlling the bioavailability of TGFβ family members. Genes encoding these proteins show differential expression in mesenchymal cell types which synthesize the extracellular matrix. We have investigated the promoter regions of the seven gene family members using...... of the family members were expressed in a range of mesenchymal and other cell types, often associated with use of alternative promoters or transcription start sites within a promoter in different cell types. FBN3 was the lowest expressed gene, and was found only in embryonic and fetal tissues. The different...

  1. Identification of a novel Gig2 gene family specific to non-amniote vertebrates.

    Directory of Open Access Journals (Sweden)

    Yi-Bing Zhang

    Full Text Available Gig2 (grass carp reovirus (GCRV-induced gene 2 is first identified as a novel fish interferon (IFN-stimulated gene (ISG. Overexpression of a zebrafish Gig2 gene can protect cultured fish cells from virus infection. In the present study, we identify a novel gene family that is comprised of genes homologous to the previously characterized Gig2. EST/GSS search and in silico cloning identify 190 Gig2 homologous genes in 51 vertebrate species ranged from lampreys to amphibians. Further large-scale search of vertebrate and invertebrate genome databases indicate that Gig2 gene family is specific to non-amniotes including lampreys, sharks/rays, ray-finned fishes and amphibians. Phylogenetic analysis and synteny analysis reveal lineage-specific expansion of Gig2 gene family and also provide valuable evidence for the fish-specific genome duplication (FSGD hypothesis. Although Gig2 family proteins exhibit no significant sequence similarity to any known proteins, a typical Gig2 protein appears to consist of two conserved parts: an N-terminus that bears very low homology to the catalytic domains of poly(ADP-ribose polymerases (PARPs, and a novel C-terminal domain that is unique to this gene family. Expression profiling of zebrafish Gig2 family genes shows that some duplicate pairs have diverged in function via acquisition of novel spatial and/or temporal expression under stresses. The specificity of this gene family to non-amniotes might contribute to a large extent to distinct physiology in non-amniote vertebrates.

  2. A comprehensive survey of the Plasmodium life cycle by genomic, transcriptomic, and proteomic analyses.

    Science.gov (United States)

    Hall, Neil; Karras, Marianna; Raine, J Dale; Carlton, Jane M; Kooij, Taco W A; Berriman, Matthew; Florens, Laurence; Janssen, Christoph S; Pain, Arnab; Christophides, Georges K; James, Keith; Rutherford, Kim; Harris, Barbara; Harris, David; Churcher, Carol; Quail, Michael A; Ormond, Doug; Doggett, Jon; Trueman, Holly E; Mendoza, Jacqui; Bidwell, Shelby L; Rajandream, Marie-Adele; Carucci, Daniel J; Yates, John R; Kafatos, Fotis C; Janse, Chris J; Barrell, Bart; Turner, C Michael R; Waters, Andrew P; Sinden, Robert E

    2005-01-07

    Plasmodium berghei and Plasmodium chabaudi are widely used model malaria species. Comparison of their genomes, integrated with proteomic and microarray data, with the genomes of Plasmodium falciparum and Plasmodium yoelii revealed a conserved core of 4500 Plasmodium genes in the central regions of the 14 chromosomes and highlighted genes evolving rapidly because of stage-specific selective pressures. Four strategies for gene expression are apparent during the parasites' life cycle: (i) housekeeping; (ii) host-related; (iii) strategy-specific related to invasion, asexual replication, and sexual development; and (iv) stage-specific. We observed posttranscriptional gene silencing through translational repression of messenger RNA during sexual development, and a 47-base 3' untranslated region motif is implicated in this process.

  3. Saltatory Evolution of the Ectodermal Neural Cortex Gene Family at the Vertebrate Origin

    Science.gov (United States)

    Feiner, Nathalie; Murakami, Yasunori; Breithut, Lisa; Mazan, Sylvie; Meyer, Axel; Kuraku, Shigehiro

    2013-01-01

    The ectodermal neural cortex (ENC) gene family, whose members are implicated in neurogenesis, is part of the kelch repeat superfamily. To date, ENC genes have been identified only in osteichthyans, although other kelch repeat-containing genes are prevalent throughout bilaterians. The lack of elaborate molecular phylogenetic analysis with exhaustive taxon sampling has obscured the possible link of the establishment of this gene family with vertebrate novelties. In this study, we identified ENC homologs in diverse vertebrates by means of database mining and polymerase chain reaction screens. Our analysis revealed that the ENC3 ortholog was lost in the basal eutherian lineage through single-gene deletion and that the triplication between ENC1, -2, and -3 occurred early in vertebrate evolution. Including our original data on the catshark and the zebrafish, our comparison revealed high conservation of the pleiotropic expression pattern of ENC1 and shuffling of expression domains between ENC1, -2, and -3. Compared with many other gene families including developmental key regulators, the ENC gene family is unique in that conventional molecular phylogenetic inference could identify no obvious invertebrate ortholog. This suggests a composite nature of the vertebrate-specific gene repertoire, consisting not only of de novo genes introduced at the vertebrate origin but also of long-standing genes with no apparent invertebrate orthologs. Some of the latter, including the ENC gene family, may be too rapidly evolving to provide sufficient phylogenetic signals marking orthology to their invertebrate counterparts. Such gene families that experienced saltatory evolution likely remain to be explored and might also have contributed to phenotypic evolution of vertebrates. PMID:23843192

  4. Identification of a novel and unique transcription factor in the intraerythrocytic stage of Plasmodium falciparum.

    Directory of Open Access Journals (Sweden)

    Kanako Komaki-Yasuda

    Full Text Available The mechanisms of stage-specific gene regulation in the malaria parasite Plasmodium falciparum are largely unclear, with only a small number of specific regulatory transcription factors (AP2 family having been identified. In particular, the transcription factors that function in the intraerythrocytic stage remain to be elucidated. Previously, as a model case for stage-specific transcription in the P. falciparum intraerythrocytic stage, we analyzed the transcriptional regulation of pf1-cys-prx, a trophozoite/schizont-specific gene, and suggested that some nuclear factors bind specifically to the cis-element of pf1-cys-prx and enhance transcription. In the present study, we purified nuclear factors from parasite nuclear extract by 5 steps of chromatography, and identified a factor termed PREBP. PREBP is not included in the AP2 family, and is a novel protein with four K-homology (KH domains. The KH domain is known to be found in RNA-binding or single-stranded DNA-binding proteins. PREBP is well conserved in Plasmodium species and partially conserved in phylum Apicomplexa. To evaluate the effects of PREBP overexpression, we used a transient overexpression and luciferase assay combined approach. Overexpression of PREBP markedly enhanced luciferase expression under the control of the pf1-cys-prx cis-element. These results provide the first evidence of a novel transcription factor that activates the gene expression in the malaria parasite intraerythrocytic stage. These findings enhance our understanding of the evolution of specific transcription machinery in Plasmodium and other eukaryotes.

  5. CRDB: database of chemosensory receptor gene families in vertebrate.

    Directory of Open Access Journals (Sweden)

    Dong Dong

    Full Text Available Chemosensory receptors (CR are crucial for animals to sense the environmental changes and survive on earth. The emergence of whole-genome sequences provides us an opportunity to identify the entire CR gene repertoires. To completely gain more insight into the evolution of CR genes in vertebrates, we identified the nearly all CR genes in 25 vertebrates using homology-based approaches. Among these CR gene repertoires, nearly half of them were identified for the first time in those previously uncharacterized species, such as the guinea pig, giant panda and elephant, etc. Consistent with previous findings, we found that the numbers of CR genes vary extensively among different species, suggesting an extreme form of 'birth-and-death' evolution. For the purpose of facilitating CR gene analysis, we constructed a database with the goals to provide a resource for CR genes annotation and a web tool for exploring their evolutionary patterns. Besides a search engine for the gene extraction from a specific chromosome region, an easy-to-use phylogenetic analysis tool was also provided to facilitate online phylogeny study of CR genes. Our work can provide a rigorous platform for further study on the evolution of CR genes in vertebrates.

  6. Targeted Deletion of a Plasmodium Site-2 Protease Impairs Life Cycle Progression in the Mammalian Host.

    Science.gov (United States)

    Koussis, Konstantinos; Goulielmaki, Evi; Chalari, Anna; Withers-Martinez, Chrislaine; Siden-Kiamos, Inga; Matuschewski, Kai; Loukeris, Thanasis G

    2017-01-01

    Site-2 proteases (S2P) belong to the M50 family of metalloproteases, which typically perform essential roles by mediating activation of membrane-bound transcription factors through regulated intramembrane proteolysis (RIP). Protease-dependent liberation of dormant transcription factors triggers diverse cellular responses, such as sterol regulation, Notch signalling and the unfolded protein response. Plasmodium parasites rely on regulated proteolysis for controlling essential pathways throughout the life cycle. In this study we examine the Plasmodium-encoded S2P in a murine malaria model and show that it is expressed in all stages of Plasmodium development. Localisation studies by endogenous gene tagging revealed that in all invasive stages the protein is in close proximity to the nucleus. Ablation of PbS2P by reverse genetics leads to reduced growth rates during liver and blood infection and, hence, virulence attenuation. Strikingly, absence of PbS2P was compatible with parasite life cycle progression in the mosquito and mammalian hosts under physiological conditions, suggesting redundant or dispensable roles in vivo.

  7. Targeted Deletion of a Plasmodium Site-2 Protease Impairs Life Cycle Progression in the Mammalian Host.

    Directory of Open Access Journals (Sweden)

    Konstantinos Koussis

    Full Text Available Site-2 proteases (S2P belong to the M50 family of metalloproteases, which typically perform essential roles by mediating activation of membrane-bound transcription factors through regulated intramembrane proteolysis (RIP. Protease-dependent liberation of dormant transcription factors triggers diverse cellular responses, such as sterol regulation, Notch signalling and the unfolded protein response. Plasmodium parasites rely on regulated proteolysis for controlling essential pathways throughout the life cycle. In this study we examine the Plasmodium-encoded S2P in a murine malaria model and show that it is expressed in all stages of Plasmodium development. Localisation studies by endogenous gene tagging revealed that in all invasive stages the protein is in close proximity to the nucleus. Ablation of PbS2P by reverse genetics leads to reduced growth rates during liver and blood infection and, hence, virulence attenuation. Strikingly, absence of PbS2P was compatible with parasite life cycle progression in the mosquito and mammalian hosts under physiological conditions, suggesting redundant or dispensable roles in vivo.

  8. A shared promoter region suggests a common ancestor for the human VCX/Y, SPANX, and CSAG gene families and the murine CYPT family

    DEFF Research Database (Denmark)

    Hansen, Martin A; Nielsen, John E; Retelska, Dorota

    2008-01-01

    , sequences corresponding to the shared promoter region of the CYPT family were identified at 39 loci. Most loci were located immediately upstream of genes belonging to the VCX/Y, SPANX, or CSAG gene families. Sequence comparison of the loci revealed a conserved CYPT promoter-like (CPL) element featuring TATA...... cell types. The genomic regions harboring the gene families were rich in direct and inverted segmental duplications (SD), which may facilitate gene conversion and rapid evolution. The conserved CPL and the common expression profiles suggest that the human VCX/Y, SPANX, and CSAG2 gene families together......Many testis-specific genes from the sex chromosomes are subject to rapid evolution, which can make it difficult to identify murine genes in the human genome. The murine CYPT gene family includes 15 members, but orthologs were undetectable in the human genome. However, using refined homology search...

  9. A Patient With Desmoid Tumors and Familial FAP Having Frame Shift Mutation of the APC Gene

    Directory of Open Access Journals (Sweden)

    Sanambar Sadighi

    2017-02-01

    Full Text Available Desmoids tumors, characterized by monoclonal proliferation of myofibroblasts, could occur in 5-10% of patients with familial adenomatous polyposis (FAP as an extra-colonic manifestation of the disease. FAP can develop when there is a germ-line mutation in the adenomatous polyposis coli gene. Although mild or attenuated FAP may follow mutations in 5΄ extreme of the gene, it is more likely that 3΄ extreme mutations haveamore severe manifestation of thedisease. A 28-year-old woman was admitted to the Cancer Institute of Iran with an abdominal painful mass. She had strong family history of FAP and underwent prophylactic total colectomy. Pre-operative CT scans revealed a large mass. Microscopic observation showed diffuse fibroblast cell infiltration of the adjacent tissue structures. Peripheral blood DNA extraction followed by adenomatous polyposis coli gene exon by exon sequencing was performed to investigate the mutation in adenomatous polyposis coli gene. Analysis of DNA sequencing demonstrated a mutation of 4 bpdeletions at codon 1309-1310 of the exon 16 of adenomatous polyposis coli gene sequence which was repeated in 3 members of the family. Some of them had desmoid tumor without classical FAP history. Even when there is no familial history of adenomatous polyposis, the adenomatous polyposis coli gene mutation should be investigated in cases of familial desmoids tumors for a suitable prevention. The 3΄ extreme of the adenomatous polyposis coli gene is still the best likely location in such families.

  10. Repeat-associated plasticity in the Helicobacter pylori RD gene family.

    Science.gov (United States)

    Shak, Joshua R; Dick, Jonathan J; Meinersmann, Richard J; Perez-Perez, Guillermo I; Blaser, Martin J

    2009-11-01

    The bacterium Helicobacter pylori is remarkable for its ability to persist in the human stomach for decades without provoking sterilizing immunity. Since repetitive DNA can facilitate adaptive genomic flexibility via increased recombination, insertion, and deletion, we searched the genomes of two H. pylori strains for nucleotide repeats. We discovered a family of genes with extensive repetitive DNA that we have termed the H. pylori RD gene family. Each gene of this family is composed of a conserved 3' region, a variable mid-region encoding 7 and 11 amino acid repeats, and a 5' region containing one of two possible alleles. Analysis of five complete genome sequences and PCR genotyping of 42 H. pylori strains revealed extensive variation between strains in the number, location, and arrangement of RD genes. Furthermore, examination of multiple strains isolated from a single subject's stomach revealed intrahost variation in repeat number and composition. Despite prior evidence that the protein products of this gene family are expressed at the bacterial cell surface, enzyme-linked immunosorbent assay and immunoblot studies revealed no consistent seroreactivity to a recombinant RD protein by H. pylori-positive hosts. The pattern of repeats uncovered in the RD gene family appears to reflect slipped-strand mispairing or domain duplication, allowing for redundancy and subsequent diversity in genotype and phenotype. This novel family of hypervariable genes with conserved, repetitive, and allelic domains may represent an important locus for understanding H. pylori persistence in its natural host.

  11. Ancient signals: comparative genomics of plant MAPK and MAPKK gene families

    DEFF Research Database (Denmark)

    Hamel, Louis-Philippe; Nicole, Marie-Claude; Sritubtim, Somrudee

    2006-01-01

    MAPK signal transduction modules play crucial roles in regulating many biological processes in plants, and their components are encoded by highly conserved genes. The recent availability of genome sequences for rice and poplar now makes it possible to examine how well the previously described...... Arabidopsis MAPK and MAPKK gene family structures represent the broader evolutionary situation in plants, and analysis of gene expression data for MPK and MKK genes in all three species allows further refinement of those families, based on functionality. The Arabidopsis MAPK nomenclature appears sufficiently...

  12. Ultra Large Gene Families: A Matter of Adaptation or Genomic Parasites?

    Directory of Open Access Journals (Sweden)

    Philipp H. Schiffer

    2016-08-01

    Full Text Available Gene duplication is an important mechanism of molecular evolution. It offers a fast track to modification, diversification, redundancy or rescue of gene function. However, duplication may also be neutral or (slightly deleterious, and often ends in pseudo-geneisation. Here, we investigate the phylogenetic distribution of ultra large gene families on long and short evolutionary time scales. In particular, we focus on a family of NACHT-domain and leucine-rich-repeat-containing (NLR-genes, which we previously found in large numbers to occupy one chromosome arm of the zebrafish genome. We were interested to see whether such a tight clustering is characteristic for ultra large gene families. Our data reconfirm that most gene family inflations are lineage-specific, but we can only identify very few gene clusters. Based on our observations we hypothesise that, beyond a certain size threshold, ultra large gene families continue to proliferate in a mechanism we term “run-away evolution”. This process might ultimately lead to the failure of genomic integrity and drive species to extinction.

  13. Evolution of the defensin-like gene family in grass genomes

    Indian Academy of Sciences (India)

    that the DEFL gene family is subjected to purifying selection. However, sliding window analysis .... sorghum from DOE-JGI Community Sequencing Program ..... This work was supported by the National Key Technologies Re- search and ...

  14. Complexity of rice Hsp100 gene family: lessons from rice genome ...

    Indian Academy of Sciences (India)

    Madhu Sudhan

    2007-03-29

    Mar 29, 2007 ... Chaperonins are a class of molecular chaperones found in prokaryotes and in the ... Keywords. Chaperone, gene family, Hsp100, Oryza sativa ..... Sculpting the proteome with AAA+ proteases and disassembly machines; Cell ...

  15. Exclusion of known gene for enamel development in two Brazilian families with amelogenesis imperfecta.

    Science.gov (United States)

    Santos, Maria C L G; Hart, P Suzanne; Ramaswami, Mukundhan; Kanno, Cláudia M; Hart, Thomas C; Line, Sergio R P

    2007-01-31

    Amelogenesis imperfecta (AI) is a genetically heterogeneous group of diseases that result in defective development of tooth enamel. Mutations in several enamel proteins and proteinases have been associated with AI. The object of this study was to evaluate evidence of etiology for the six major candidate gene loci in two Brazilian families with AI. Genomic DNA was obtained from family members and all exons and exon-intron boundaries of the ENAM, AMBN, AMELX, MMP20, KLK4 and Amelotin gene were amplified and sequenced. Each family was also evaluated for linkage to chromosome regions known to contain genes important in enamel development. The present study indicates that the AI in these two families is not caused by any of the known loci for AI or any of the major candidate genes proposed in the literature. These findings indicate extensive genetic heterogeneity for non-syndromic AI.

  16. A family with X-linked anophthalmia: exclusion of SOX3 as a candidate gene.

    Science.gov (United States)

    Slavotinek, Anne; Lee, Stephen S; Hamilton, Steven P

    2005-10-01

    We report on a four-generation family with X-linked anophthalmia in four affected males and show that this family has LOD scores consistent with linkage to Xq27, the third family reported to be linked to the ANOP1 locus. We sequenced the SOX3 gene at Xq27 as a candidate gene for the X-linked anophthalmia based on the high homology of this gene to SOX2, a gene previously mutated in bilateral anophthlamia. However, no amino acid sequence alterations were identified in SOX3. We have improved the definition of the phenotype in males with anophthalmia linked to the ANOP1 locus, as microcephaly, ocular colobomas, and severe renal malformations have not been described in families linked to ANOP1. (c) 2005 Wiley-Liss, Inc.

  17. "It's good to know": experiences of gene identification and result disclosure in familial epilepsies.

    Science.gov (United States)

    Vears, Danya F; Dunn, Karen L; Wake, Samantha A; Scheffer, Ingrid E

    2015-05-01

    Recognition of the role of genetics in the epilepsies has increased dramatically, impacting on clinical practice across many epilepsy syndromes. There is limited research investigating the impact of gene identification on individuals and families with epilepsy. While research has focused on the impact of delivering genetic information to families at the time of diagnosis in genetic diseases more broadly, little is known about how genetic results in epileptic diseases influences people's lives many years after it has been conveyed. This study used qualitative methods to explore the experience of receiving a genetic result in people with familial epilepsy. Interviews were conducted with individuals with familial epilepsies in whom the underlying genetic mutation had been identified. Recorded interviews underwent thematic analysis. 20 individuals from three families with different epilepsy syndromes and causative genes were interviewed. Multiple generations within families were studied. The mean time from receiving the genetic result prior to interview was 10.9 years (range 5-14 years). Three major themes were identified: 1) living with epilepsy: an individual's experience of the severity of epilepsy in their family influenced their view. 2) Clinical utility of the test: participants expressed varying reactions to receiving a genetic result. While for some it provided helpful information and relief, others were not surprised by the finding given the familial context. Some valued the use of genetic information for reproductive decision-making, particularly in the setting of severely affected family members. While altruistic reasons for participating in genetic research were discussed, participants emphasised the benefit of participation to them and their families. 3) 'Talking about the family genes': individuals reported poor communication between family members about their epilepsy and its genetic implications. The results provide important insights into the family

  18. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    Science.gov (United States)

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  19. Gene-Environment Interplay, Family Relationships, and Child Adjustment

    Science.gov (United States)

    Horwitz, Briana N.; Neiderhiser, Jenae M.

    2011-01-01

    This paper reviews behavioral genetic research from the past decade that has moved beyond simply studying the independent influences of genes and environments. The studies considered in this review have instead focused on understanding gene-environment interplay, including genotype-environment correlation (rGE) and genotype x environment…

  20. Identification and analysis of YELLOW protein family genes in the silkworm, Bombyx mori

    Directory of Open Access Journals (Sweden)

    Yi Yong-Zhu

    2006-08-01

    Full Text Available Abstract Background The major royal jelly proteins/yellow (MRJP/YELLOW family possesses several physiological and chemical functions in the development of Apis mellifera and Drosophila melanogaster. Each protein of the family has a conserved domain named MRJP. However, there is no report of MRJP/YELLOW family proteins in the Lepidoptera. Results Using the YELLOW protein sequence in Drosophila melanogaster to BLAST silkworm EST database, we found a gene family composed of seven members with a conserved MRJP domain each and named it YELLOW protein family of Bombyx mori. We completed the cDNA sequences with RACE method. The protein of each member possesses a MRJP domain and a putative cleavable signal peptide consisting of a hydrophobic sequence. In view of genetic evolution, the whole Bm YELLOW protein family composes a monophyletic group, which is distinctly separate from Drosophila melanogaster and Apis mellifera. We then showed the tissue expression profiles of Bm YELLOW protein family genes by RT-PCR. Conclusion A Bombyx mori YELLOW protein family is found to be composed of at least seven members. The low homogeneity and unique pattern of gene expression by each member among the family ensure us to prophesy that the members of Bm YELLOW protein family would play some important physiological functions in silkworm development.

  1. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    OpenAIRE

    Hu, H.; Haas, S.A.; Chelly, J.; Van Esch, H.; Raynaud, M.; de Brouwer, A.P.M.; Weinert, S.; Froyen, G.; Frints, S.G.M.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of ...

  2. Distinct Gene Expression Signatures in Lynch Syndrome and Familial Colorectal Cancer Type X

    DEFF Research Database (Denmark)

    Valentin, Mev; Therkildsen, Christina; Veerla, Srinivas

    2013-01-01

    Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects.......Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects....

  3. Novel genetic variants in miR-191 gene and familial ovarian cancer

    International Nuclear Information System (INIS)

    Shen, Jie; DiCioccio, Richard; Odunsi, Kunle; Lele, Shashikant B; Zhao, Hua

    2010-01-01

    Half of the familial aggregation of ovarian cancer can't be explained by any known risk genes, suggesting the existence of other genetic risk factors. Some of these unknown factors may not be traditional protein encoding genes. MicroRNA (miRNA) plays a critical role in tumorigenesis, but it is still unknown if variants in miRNA genes lead to predisposition to cancer. Considering the fact that miRNA regulates a number of tumor suppressor genes (TSGs) and oncogenes, genetic variations in miRNA genes could affect the levels of expression of TSGs or oncogenes and, thereby, cancer risk. To test this hypothesis in familial ovarian cancer, we screened for genetic variants in thirty selected miRNA genes, which are predicted to regulate key ovarian cancer genes and are reported to be misexpressed in ovarian tumor tissues, in eighty-three patients with familial ovarian cancer. All of the patients are non-carriers of any known BRCA1/2 or mismatch repair (MMR) gene mutations. Seven novel genetic variants were observed in four primary or precursor miRNA genes. Among them, three rare variants were found in the precursor or primary precursor of the miR-191 gene. In functional assays, the one variant located in the precursor of miR-191 resulted in conformational changes in the predicted secondary structures, and consequently altered the expression of mature miR-191. In further analysis, we found that this particular variant exists in five family members who had ovarian cancer. Our findings suggest that there are novel genetic variants in miRNA genes, and those certain genetic variants in miRNA genes can affect the expression of mature miRNAs and, consequently, might alter the regulation of TSGs or oncogenes. Additionally, the variant might be potentially associated with the development of familial ovarian cancer

  4. Plasmodium and mononuclear phagocytes.

    Science.gov (United States)

    Mac-Daniel, Laura; Ménard, Robert

    2015-01-01

    Plasmodium, the causative agent of malaria, initially multiplies inside liver cells and then in successive cycles inside erythrocytes, causing the symptoms of the disease. In this review, we discuss interactions between the extracellular and intracellular forms of the Plasmodium parasite and innate immune cells in the mammalian host, with a special emphasis on mononuclear phagocytes. We overview here what is known about the innate immune cells that interact with parasites, mechanisms used by the parasite to evade them, and the protective or detrimental contribution of these interactions on parasite progression through its life cycle and pathology in the host. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. a photoreceptor gene mutation in an indigenous black african family

    African Journals Online (AJOL)

    MUTATION IN AN INDIGENOUS. BLACK AFRICAN FAMILY WITH. RETINITIS PIGMENTOSA. IDENTIFIED USING A RAPID. SCREENING APPROACH FOR. COMMON RHODOPSIN. MUTATIONS. JGreenberg, T Franz, R Goliath, R Ramesar. Hereditary retinal degenerations may be subdivided into those affecting ...

  6. [Analysis of the NDP gene in a Chinese family with X-linked recessive Norrie disease].

    Science.gov (United States)

    Mei, Libin; Huang, Yanru; Pan, Qian; Liang, Desheng; Wu, Lingqian

    2015-05-01

    The purpose of the current research was to investigate the NDP (Norrie disease protein) gene in one Chinese family with Norrie disease (ND) and to characterize the related clinical features. Clinical data of the proband and his family members were collected. Complete ophthalmic examinations were carried out on the proband. Genomic DNA was extracted from peripheral blood leukocytes of 35 family members. Molecular analysis of the NDP gene was performed by polymerase chain reaction and direct sequencing of all exons and flanking regions. A hemizygous NDP missense mutation c.362G > A (p.Arg121Gln) in exon 3 was identified in the affected members, but not in any of the unaffected family individuals. The missense mutation c.362G > A in NDP is responsible for the Norrie disease in this family. This discovery will help provide the family members with accurate and reliable genetic counseling and prenatal diagnosis.

  7. Identification of the WRKY gene family and functional analysis of two genes in Caragana intermedia.

    Science.gov (United States)

    Wan, Yongqing; Mao, Mingzhu; Wan, Dongli; Yang, Qi; Yang, Feiyun; Mandlaa; Li, Guojing; Wang, Ruigang

    2018-02-09

    WRKY transcription factors, one of the largest families of transcriptional regulators in plants, play important roles in plant development and various stress responses. The WRKYs of Caragana intermedia are still not well characterized, although many WRKYs have been identified in various plant species. We identified 53 CiWRKY genes from C. intermedia transcriptome data, 28 of which exhibited complete open reading frames (ORFs). These CiWRKYs were divided into three groups via phylogenetic analysis according to their WRKY domains and zinc finger motifs. Conserved domain analysis showed that the CiWRKY proteins contain a highly conserved WRKYGQK motif and two variant motifs (WRKYGKK and WKKYEEK). The subcellular localization of CiWRKY26 and CiWRKY28-1 indicated that these two proteins localized exclusively to nuclei, supporting their role as transcription factors. The expression patterns of the 28 CiWRKYs with complete ORFs were examined through quantitative real-time PCR (qRT-PCR) in various tissues and under different abiotic stresses (drought, cold, salt, high-pH and abscisic acid (ABA)). The results showed that each CiWRKY responded to at least one stress treatment. Furthermore, overexpression of CiWRKY75-1 and CiWRKY40-4 in Arabidopsis thaliana suppressed the drought stress tolerance of the plants and delayed leaf senescence, respectively. Fifty-three CiWRKY genes from the C. intermedia transcriptome were identified and divided into three groups via phylogenetic analysis. The expression patterns of the 28 CiWRKYs under different abiotic stresses suggested that each CiWRKY responded to at least one stress treatment. Overexpression of CiWRKY75-1 and CiWRKY40-4 suppressed the drought stress tolerance of Arabidopsis and delayed leaf senescence, respectively. These results provide a basis for the molecular mechanism through which CiWRKYs mediate stress tolerance.

  8. Identification of a novel FBN1 gene mutation in a large Pakistani family with Marfan syndrome

    NARCIS (Netherlands)

    Micheal, S.; Khan, M.I.; Akhtar, F.; Weiss, M.M.; Islam, F.; Ali, M.; Qamar, R.; Maugeri, A.; Hollander, A.I. den

    2012-01-01

    PURPOSE: To describe a novel mutation in the fibrillin-1 (FBN1) gene in a large Pakistani family with autosomal dominant Marfan syndrome (MFS). METHODS: Blood samples were collected of 11 family members affected with Marfan syndrome, and DNA was isolated by phenol-extraction. The coding exons of

  9. The evolution and diversity of a low complexity vaccine candidate, merozoite surface protein 9 (MSP-9), in Plasmodium vivax and closely related species.

    Science.gov (United States)

    Chenet, Stella M; Pacheco, M Andreína; Bacon, David J; Collins, William E; Barnwell, John W; Escalante, Ananias A

    2013-12-01

    The merozoite surface protein-9 (MSP-9) has been considered a target for an anti-malarial vaccine since it is one of many proteins involved in the erythrocyte invasion, a critical step in the parasite life cycle. Orthologs encoding this antigen have been found in all known species of Plasmodium parasitic to primates. In order to characterize and investigate the extent and maintenance of MSP-9 genetic diversity, we analyzed DNA sequences of the following malaria parasite species: Plasmodium falciparum, Plasmodium reichenowi, Plasmodium chabaudi, Plasmodium yoelii, Plasmodium berghei, Plasmodium coatneyi, Plasmodium gonderi, Plasmodium knowlesi, Plasmodium inui, Plasmodium simiovale, Plasmodium fieldi, Plasmodium cynomolgi and Plasmodium vivax and evaluated the signature of natural selection in all MSP-9 orthologs. Our findings suggest that the gene encoding MSP-9 is under purifying selection in P. vivax and closely related species. We further explored how selection affected different regions of MSP-9 by comparing the polymorphisms in P. vivax and P. falciparum, and found contrasting patterns between these two species that suggest differences in functional constraints. This observation implies that the MSP-9 orthologs in human parasites may interact differently with the host immune response. Thus, studies carried out in one species cannot be directly translated into the other. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. The SOD gene family in tomato: identification, phylogenetic relationships and expression patterns

    Directory of Open Access Journals (Sweden)

    kun feng

    2016-08-01

    Full Text Available Superoxide dismutases (SODs are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L. is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants.

  11. Genome-Wide Identification and Analysis of the TIFY Gene Family in Grape

    Science.gov (United States)

    Zhang, Yucheng; Gao, Min; Singer, Stacy D.; Fei, Zhangjun; Wang, Hua; Wang, Xiping

    2012-01-01

    Background The TIFY gene family constitutes a plant-specific group of genes with a broad range of functions. This family encodes four subfamilies of proteins, including ZML, TIFY, PPD and JASMONATE ZIM-Domain (JAZ) proteins. JAZ proteins are targets of the SCFCOI1 complex, and function as negative regulators in the JA signaling pathway. Recently, it has been reported in both Arabidopsis and rice that TIFY genes, and especially JAZ genes, may be involved in plant defense against insect feeding, wounding, pathogens and abiotic stresses. Nonetheless, knowledge concerning the specific expression patterns and evolutionary history of plant TIFY family members is limited, especially in a woody species such as grape. Methodology/Principal Findings A total of two TIFY, four ZML, two PPD and 11 JAZ genes were identified in the Vitis vinifera genome. Phylogenetic analysis of TIFY protein sequences from grape, Arabidopsis and rice indicated that the grape TIFY proteins are more closely related to those of Arabidopsis than those of rice. Both segmental and tandem duplication events have been major contributors to the expansion of the grape TIFY family. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologues of several grape TIFY genes were found in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of lineages that led to grape and Arabidopsis. Analyses of microarray and quantitative real-time RT-PCR expression data revealed that grape TIFY genes are not a major player in the defense against biotrophic pathogens or viruses. However, many of these genes were responsive to JA and ABA, but not SA or ET. Conclusion The genome-wide identification, evolutionary and expression analyses of grape TIFY genes should facilitate further research of this gene family and provide new insights regarding their evolutionary history and regulatory control. PMID:22984514

  12. Natural killer cell receptor genes in the family Equidae: not only Ly49.

    Directory of Open Access Journals (Sweden)

    Jan Futas

    Full Text Available Natural killer (NK cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for

  13. Natural Killer Cell Receptor Genes in the Family Equidae: Not only Ly49

    Science.gov (United States)

    Futas, Jan; Horin, Petr

    2013-01-01

    Natural killer (NK) cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR) and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR) represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA) and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM) domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for evolutionary biology of

  14. carboxylate synthase gene family in Arabidopsis, rice, grapevine

    African Journals Online (AJOL)

    Yomi

    2012-01-16

    Jan 16, 2012 ... evolutionary relationships of ACS genes in the four plant species. Chromosomal .... classification was consistent with the report from. Jakubowicz et al. ..... Analysis of the genome sequence of the flowering plant Arabidopsis ...

  15. Different apoptotic responses to Plasmodium chabaudi malaria in ...

    African Journals Online (AJOL)

    hope&shola

    2010-11-08

    Nov 8, 2010 ... The purpose of this study is to determine whether the apoptotic responses to Plasmodium chabaudi malaria in spleen and liver via mRNA expression of three genes involved in apoptosis (Bax, Bcl-2 and. Caspase-3) are similar or not and to detect if these genes could be a good marker for apoptosis due to.

  16. Fine-scale genetic characterization of Plasmodium falciparum

    Indian Academy of Sciences (India)

    We have initiated such a study and presented herewith the results from the in silico understanding of a seventh chromosomal region of the malarial parasite Plasmodium falciparum encompassing the antigenic var genes (coding pfemp1) and the drug-resistant gene pfcrt located at a specified region of the chromosome 7.

  17. Identification of pathogenic gene variants in small families with intellectually disabled siblings by exome sequencing.

    Science.gov (United States)

    Schuurs-Hoeijmakers, Janneke H M; Vulto-van Silfhout, Anneke T; Vissers, Lisenka E L M; van de Vondervoort, Ilse I G M; van Bon, Bregje W M; de Ligt, Joep; Gilissen, Christian; Hehir-Kwa, Jayne Y; Neveling, Kornelia; del Rosario, Marisol; Hira, Gausiya; Reitano, Santina; Vitello, Aurelio; Failla, Pinella; Greco, Donatella; Fichera, Marco; Galesi, Ornella; Kleefstra, Tjitske; Greally, Marie T; Ockeloen, Charlotte W; Willemsen, Marjolein H; Bongers, Ernie M H F; Janssen, Irene M; Pfundt, Rolph; Veltman, Joris A; Romano, Corrado; Willemsen, Michèl A; van Bokhoven, Hans; Brunner, Han G; de Vries, Bert B A; de Brouwer, Arjan P M

    2013-12-01

    Intellectual disability (ID) is a common neurodevelopmental disorder affecting 1-3% of the general population. Mutations in more than 10% of all human genes are considered to be involved in this disorder, although the majority of these genes are still unknown. We investigated 19 small non-consanguineous families with two to five affected siblings in order to identify pathogenic gene variants in known, novel and potential ID candidate genes. Non-consanguineous families have been largely ignored in gene identification studies as small family size precludes prior mapping of the genetic defect. Using exome sequencing, we identified pathogenic mutations in three genes, DDHD2, SLC6A8, and SLC9A6, of which the latter two have previously been implicated in X-linked ID phenotypes. In addition, we identified potentially pathogenic mutations in BCORL1 on the X-chromosome and in MCM3AP, PTPRT, SYNE1, and ZNF528 on autosomes. We show that potentially pathogenic gene variants can be identified in small, non-consanguineous families with as few as two affected siblings, thus emphasising their value in the identification of syndromic and non-syndromic ID genes.

  18. New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands

    NARCIS (Netherlands)

    Florijn, Ralph J.; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J. J. M.; Mannens, Marcel M. A. M.; Tijmes, Nel; Brooks, Simon P.; Hardcastle, Alison J.; Bergen, Arthur A. B.

    2006-01-01

    Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the

  19. Germline heterozygous variants in genes associated with familial hemophagocytic lymphohistiocytosis as a cause of increased bleeding

    DEFF Research Database (Denmark)

    Fager Ferrari, Marcus; Leinoe, Eva; Rossing, Maria

    2018-01-01

    Familial hemophagocytic lymphohistiocytosis (FHL) is caused by biallelic variants in genes regulating granule secretion in cytotoxic lymphocytes. In FHL3-5, the affected genes UNC13D, STX11 and STXBP2 have further been shown to regulate the secretion of platelet granules, giving rise to compromised...

  20. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    NARCIS (Netherlands)

    Hu, H; Haas, S.A.; Chelly, J.; Esch, H. Van; Raynaud, M.; Brouwer, A.P. de; Weinert, S.; Froyen, G.; Frints, S.G.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.; Jensen, C.; Hambrock, M.; Fischer, U.; Langnick, C.; Feldkamp, M.; Wissink-Lindhout, W.; Lebrun, N.; Castelnau, L.; Rucci, J.; Montjean, R.; Dorseuil, O.; Billuart, P.; Stuhlmann, T.; Shaw, M.; Corbett, M.A.; Gardner, A.; Willis-Owen, S.; Tan, C.; Friend, K.L.; Belet, S.; Roozendaal, K.E. van; Jimenez-Pocquet, M.; Moizard, M.P.; Ronce, N.; Sun, R.; O'Keeffe, S.; Chenna, R.; Bommel, A. van; Goke, J.; Hackett, A.; Field, M.; Christie, L.; Boyle, J.; Haan, E.; Nelson, J.; Turner, G.; Baynam, G.; Gillessen-Kaesbach, G.; Muller, U.; Steinberger, D.; Budny, B.; Badura-Stronka, M.; Latos-Bielenska, A.; Ousager, L.B.; Wieacker, P.; Rodriguez Criado, G.; Bondeson, M.L.; Anneren, G.; Dufke, A.; Cohen, M.; Maldergem, L. Van; Vincent-Delorme, C.; Echenne, B.; Simon-Bouy, B.; Kleefstra, T.; Willemsen, M.H.; Fryns, J.P.; Devriendt, K.; Ullmann, R.; Vingron, M.; Wrogemann, K.; Wienker, T.F.; Tzschach, A.; Bokhoven, H. van; Gecz, J.; Jentsch, T.J.; Chen, W.; Ropers, H.H.; Kalscheuer, V.M.

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or

  1. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    DEFF Research Database (Denmark)

    Hu, H; Haas, S A; Chelly, J

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes...

  2. Linkage studies and mutation analysis of the PDEB gene in 23 families with Leber congenital amaurosis

    DEFF Research Database (Denmark)

    Riess, O; Weber, B; Nørremølle, Anne

    1992-01-01

    as to whether mutations in the human PDEB gene might cause LCA. We have previously cloned and characterized the human homologue of the mouse Pdeb gene and have mapped it to chromosome 4p16.3. In this study, a total of 23 LCA families of various ethnic backgrounds have been investigated. Linkage analysis using...

  3. Expressional and Biochemical Characterization of Rice Disease Resistance Gene Xa3/Xa26 Family

    Institute of Scientific and Technical Information of China (English)

    Songjie Xu; Yinglong Cao; Xianghua Li; Shiping Wang

    2007-01-01

    The rice (Oryza sativa L.) Xa3/Xa26 gene, conferring race-specific resistance to bacterial blight disease and encoding a leucine-rich repeat (LRR) receptor kinase-like protein, belongs to a multigene family consisting of tandem clustered homologous genes, colocalizing with several uncharacterized genes for resistance to bacterial blight or fungal blast. To provide more information on the expressional and biochemical characteristics of the Xa3/Xa26 family, we analyzed the family members. Four Xa3/Xa26 family members in the indica rice variety Teqing, which carries a bacterial blight resistance gene with a chromosomal location tightly linked to Xa3/Xa26, and five Xa3/Xa26 family members in the japonica rice variety Nipponbare, which carries at least one uncharacterized blast resistance gene, were constitutively expressed in leaf tissue. The result suggests that some of the family members may be candidates of these uncharacterized resistance genes. At least five putative N-glycosylation sites in the LRR domain of XA3/XA26 protein are not glycosylated. The XA3/XA26 and its family members MRKa and MRKc all possess the consensus sequences of paired cysteines, which putatively function in dimerization of the receptor proteins for signal transduction, immediately before the first LRR and immediately after the last LRR. However, no homo-dimer between the XA3/XA26 molecules or hetero-dimer between XA3/XA26 and MRKa or MRKc were formed, indicating that XA3/XA26 protein might function either as a monomer or a hetero-dimer formed with other protein outside of the XA3/XA26 family. These results provide valuable information for further extensive investigation into this multiple protein family.

  4. A three-genome phylogeny of malaria parasites (Plasmodium and closely related genera): evolution of life-history traits and host switches.

    Science.gov (United States)

    Martinsen, Ellen S; Perkins, Susan L; Schall, Jos J

    2008-04-01

    Phylogenetic analysis of genomic data allows insights into the evolutionary history of pathogens, especially the events leading to host switching and diversification, as well as alterations of the life cycle (life-history traits). Hundreds, perhaps thousands, of malaria parasite species exploit squamate reptiles, birds, and mammals as vertebrate hosts as well as many genera of dipteran vectors, but the evolutionary and ecological events that led to this diversification and success remain unresolved. For a century, systematic parasitologists classified malaria parasites into genera based on morphology, life cycle, and vertebrate and insect host taxa. Molecular systematic studies based on single genes challenged the phylogenetic significance of these characters, but several significant nodes were not well supported. We recovered the first well resolved large phylogeny of Plasmodium and related haemosporidian parasites using sequence data for four genes from the parasites' three genomes by combining all data, correcting for variable rates of substitution by gene and site, and using both Bayesian and maximum parsimony analyses. Major clades are associated with vector shifts into different dipteran families, with other characters used in traditional parasitological studies, such as morphology and life-history traits, having variable phylogenetic significance. The common parasites of birds now placed into the genus Haemoproteus are found in two divergent clades, and the genus Plasmodium is paraphyletic with respect to Hepatocystis, a group of species with very different life history and morphology. The Plasmodium of mammal hosts form a well supported clade (including Plasmodium falciparum, the most important human malaria parasite), and this clade is associated with specialization to Anopheles mosquito vectors. The Plasmodium of birds and squamate reptiles all fall within a single clade, with evidence for repeated switching between birds and squamate hosts.

  5. Plasmodium falciparum malaria

    African Journals Online (AJOL)

    Durrheim, Karen Barnes. Objectives. To assess the therapeutic efficacy of sulfadoxine- pyrimethamine (SP) after 5 years of use as first-line treatment of uncomplicated Plasmodium falciparum malaria, and thus guide the selection of artemisinin-based combination therapy in Mpumalanga, South Africa. Design. An open-label ...

  6. The importance of melanoma inhibitory activity gene family in the tumor progression of oral cancer.

    Science.gov (United States)

    Sasahira, Tomonori; Bosserhoff, Anja Katrin; Kirita, Tadaaki

    2018-05-01

    Oral squamous cell carcinoma has a high potential for locoregional invasion and nodal metastasis. Consequently, early detection of such malignancies is of immense importance. The melanoma inhibitory activity (MIA) gene family comprises MIA, MIA2, transport and Golgi organization protein 1 (TANGO), and otoraplin (OTOR). These members of the MIA gene family have a highly conserved Src homology 3 (SH3)-like structure. Although the molecules of this family share 34-45% amino acid homology and 47-59% cDNA sequence homology, those members, excluding OTOR, play different tumor-associated functions. MIA has a pivotal role in the progression and metastasis of melanoma; MIA2 and TANGO have been suggested to possess tumor-suppressive functions; and OTOR is uniquely expressed in cochlea of the inner ear. Therefore, the definite functions of the MIA gene family in cancer cells remain unclear. Since the members of the MIA gene family are secreted proteins, these molecules might be useful tumor markers that can be detected in the body fluids, including serum and saliva. In this review, we described the molecular biological functions of the MIA gene family in oral cancer. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

  7. Duplications and losses in gene families of rust pathogens highlight putative effectors

    Directory of Open Access Journals (Sweden)

    Amanda L. Pendleton

    2014-06-01

    Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  8. Duplications and losses in gene families of rust pathogens highlight putative effectors.

    Science.gov (United States)

    Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M

    2014-01-01

    Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  9. Common mutations identified in the MLH1 gene in familial Lynch syndrome

    Directory of Open Access Journals (Sweden)

    Jisha Elias

    2017-12-01

    In this study we identified three families with Lynch syndrome from a rural cancer center in western India (KCHRC, Goraj, Gujarat, where 70-75 CRC patients are seen annually. DNA isolated from the blood of consented family members of all three families (8-10 members/family was subjected to NGS sequencing methods on an Illumina HiSeq 4000 platform. We identified unique mutations in the MLH1 gene in all three HNPCC family members. Two of the three unrelated families shared a common mutation (154delA and 156delA. Total 8 members of a family were identified as carriers for 156delA mutation of which 5 members were unaffected while 3 were affected (age of onset: 1 member <30yrs & 2 were>40yr. The family with 154delA mutation showed 2 affected members (>40yr carrying the mutations.LYS618DEL mutation found in 8 members of the third family showed that both affected and unaffected carried the mutation. Thus the common mutations identified in the MLH1 gene in two unrelated families had a high risk for lynch syndrome especially above the age of 40.

  10. Understanding the mechanisms of ATPase beta family genes for cellular thermotolerance in crossbred bulls.

    Science.gov (United States)

    Deb, Rajib; Sajjanar, Basavaraj; Singh, Umesh; Alex, Rani; Raja, T V; Alyethodi, Rafeeque R; Kumar, Sushil; Sengar, Gyanendra; Sharma, Sheetal; Singh, Rani; Prakash, B

    2015-12-01

    Na+/K+-ATPase is an integral membrane protein composed of a large catalytic subunit (alpha), a smaller glycoprotein subunit (beta), and gamma subunit. The beta subunit is essential for ion recognition as well as maintenance of the membrane integrity. Present study was aimed to analyze the expression pattern of ATPase beta subunit genes (ATPase B1, ATPase B2, and ATPase B3) among the crossbred bulls under different ambient temperatures (20-44 °C). The present study was also aimed to look into the relationship of HSP70 with the ATPase beta family genes. Our results demonstrated that among beta family genes, transcript abundance of ATPase B1 and ATPase B2 is significantly (P ATPase Β1, ATPase B2, and ATPase B3 is highly correlated (P ATPase beta family genes for cellular thermotolerance in cattle.

  11. Genome-Wide Analysis of the RNA Helicase Gene Family in Gossypium raimondii

    Directory of Open Access Journals (Sweden)

    Jie Chen

    2014-03-01

    Full Text Available The RNA helicases, which help to unwind stable RNA duplexes, and have important roles in RNA metabolism, belong to a class of motor proteins that play important roles in plant development and responses to stress. Although this family of genes has been the subject of systematic investigation in Arabidopsis, rice, and tomato, it has not yet been characterized in cotton. In this study, we identified 161 putative RNA helicase genes in the genome of the diploid cotton species Gossypium raimondii. We classified these genes into three subfamilies, based on the presence of either a DEAD-box (51 genes, DEAH-box (52 genes, or DExD/H-box (58 genes in their coding regions. Chromosome location analysis showed that the genes that encode RNA helicases are distributed across all 13 chromosomes of G. raimondii. Syntenic analysis revealed that 62 of the 161 G. raimondii helicase genes (38.5% are within the identified syntenic blocks. Sixty-six (40.99% helicase genes from G. raimondii have one or several putative orthologs in tomato. Additionally, GrDEADs have more conserved gene structures and more simple domains than GrDEAHs and GrDExD/Hs. Transcriptome sequencing data demonstrated that many of these helicases, especially GrDEADs, are highly expressed at the fiber initiation stage and in mature leaves. To our knowledge, this is the first report of a genome-wide analysis of the RNA helicase gene family in cotton.

  12. Chromosome End Repair and Genome Stability in Plasmodium falciparum.

    Science.gov (United States)

    Calhoun, Susannah F; Reed, Jake; Alexander, Noah; Mason, Christopher E; Deitsch, Kirk W; Kirkman, Laura A

    2017-08-08

    The human malaria parasite Plasmodium falciparum replicates within circulating red blood cells, where it is subjected to conditions that frequently cause DNA damage. The repair of DNA double-stranded breaks (DSBs) is thought to rely almost exclusively on homologous recombination (HR), due to a lack of efficient nonhomologous end joining. However, given that the parasite is haploid during this stage of its life cycle, the mechanisms involved in maintaining genome stability are poorly understood. Of particular interest are the subtelomeric regions of the chromosomes, which contain the majority of the multicopy variant antigen-encoding genes responsible for virulence and disease severity. Here, we show that parasites utilize a competitive balance between de novo telomere addition, also called "telomere healing," and HR to stabilize chromosome ends. Products of both repair pathways were observed in response to DSBs that occurred spontaneously during routine in vitro culture or resulted from experimentally induced DSBs, demonstrating that both pathways are active in repairing DSBs within subtelomeric regions and that the pathway utilized was determined by the DNA sequences immediately surrounding the break. In combination, these two repair pathways enable parasites to efficiently maintain chromosome stability while also contributing to the generation of genetic diversity. IMPORTANCE Malaria is a major global health threat, causing approximately 430,000 deaths annually. This mosquito-transmitted disease is caused by Plasmodium parasites, with infection with the species Plasmodium falciparum being the most lethal. Mechanisms underlying DNA repair and maintenance of genome integrity in P. falciparum are not well understood and represent a gap in our understanding of how parasites survive the hostile environment of their vertebrate and insect hosts. Our work examines DNA repair in real time by using single-molecule real-time (SMRT) sequencing focused on the subtelomeric

  13. Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.

    Directory of Open Access Journals (Sweden)

    Petar Petrov

    Full Text Available "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.

  14. Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.

    Science.gov (United States)

    Petrov, Petar; Syrjänen, Riikka; Smith, Jacqueline; Gutowska, Maria Weronika; Uchida, Tatsuya; Vainio, Olli; Burt, David W

    2015-01-01

    "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.

  15. Enamelin/ameloblastin gene polymorphisms in autosomal amelogenesis imperfecta among Syrian families.

    Science.gov (United States)

    Dashash, Mayssoon; Bazrafshani, Mohamed Riza; Poulton, Kay; Jaber, Saaed; Naeem, Emad; Blinkhorn, Anthony Stevenson

    2011-02-01

      This study was undertaken to investigate whether a single G deletion within a series of seven G residues (codon 196) at the exon 9-intron 9 boundary of the enamelin gene ENAM and a tri-nucleotide deletion at codon 180 in exon 7 (GGA vs deletion) of ameloblastin gene AMBN could have a role in autosomal amelogenesis imperfecta among affected Syrian families.   A new technique - size-dependent, deletion screening - was developed to detect nucleotide deletion in ENAM and AMBN genes. Twelve Syrian families with autosomal-dominant or -recessive amelogenesis imperfecta were included.   A homozygous/heterozygous mutation in the ENAM gene (152/152, 152/153) was identified in affected members of three families with autosomal-dominant amelogenesis imperfecta and one family with autosomal-recessive amelogenesis imperfecta. A heterozygous mutation (222/225) in the AMBN gene was identified. However, no disease causing mutations was found. The present findings provide useful information for the implication of ENAM gene polymorphism in autosomal-dominant/-recessive amelogenesis imperfecta.   Further investigations are required to identify other genes responsible for the various clinical phenotypes. © 2010 Blackwell Publishing Asia Pty Ltd.

  16. Transcriptomic and phylogenetic analysis of Culex pipiens quinquefasciatus for three detoxification gene families

    Directory of Open Access Journals (Sweden)

    Yan Liangzhen

    2012-11-01

    Full Text Available Abstract Background The genomes of three major mosquito vectors of human diseases, Anopheles gambiae, Aedes aegypti, and Culex pipiens quinquefasciatus, have been previously sequenced. C. p. quinquefasciatus has the largest number of predicted protein-coding genes, which partially results from the expansion of three detoxification gene families: cytochrome P450 monooxygenases (P450, glutathione S-transferases (GST, and carboxyl/cholinesterases (CCE. However, unlike An. gambiae and Ae. aegypti, which have large amounts of gene expression data, C. p. quinquefasciatus has limited transcriptomic resources. Knowledge of complete gene expression information is very important for the exploration of the functions of genes involved in specific biological processes. In the present study, the three detoxification gene families of C. p. quinquefasciatus were analyzed for phylogenetic classification and compared with those of three other dipteran insects. Gene expression during various developmental stages and the differential expression responsible for parathion resistance were profiled using the digital gene expression (DGE technique. Results A total of 302 detoxification genes were found in C. p. quinquefasciatus, including 71 CCE, 196 P450, and 35 cytosolic GST genes. Compared with three other dipteran species, gene expansion in Culex mainly occurred in the CCE and P450 families, where the genes of α-esterases, juvenile hormone esterases, and CYP325 of the CYP4 subfamily showed the most pronounced expansion on the genome. For the five DGE libraries, 3.5-3.8 million raw tags were generated and mapped to 13314 reference genes. Among 302 detoxification genes, 225 (75% were detected for expression in at least one DGE library. One fourth of the CCE and P450 genes were detected uniquely in one stage, indicating potential developmentally regulated expression. A total of 1511 genes showed different expression levels between a parathion-resistant and a

  17. Identification and description of three families with familial Alzheimer disease that segregate variants in the SORL1 gene.

    Science.gov (United States)

    Thonberg, Håkan; Chiang, Huei-Hsin; Lilius, Lena; Forsell, Charlotte; Lindström, Anna-Karin; Johansson, Charlotte; Björkström, Jenny; Thordardottir, Steinunn; Sleegers, Kristel; Van Broeckhoven, Christine; Rönnbäck, Annica; Graff, Caroline

    2017-06-09

    Alzheimer disease (AD) is a progressive neurodegenerative disorder and the most common form of dementia. The majority of AD cases are sporadic, while up to 5% are families with an early onset AD (EOAD). Mutations in one of the three genes: amyloid beta precursor protein (APP), presenilin 1 (PSEN1) or presenilin 2 (PSEN2) can be disease causing. However, most EOAD families do not carry mutations in any of these three genes, and candidate genes, such as the sortilin-related receptor 1 (SORL1), have been suggested to be potentially causative. To identify AD causative variants, we performed whole-exome sequencing on five individuals from a family with EOAD and a missense variant, p.Arg1303Cys (c.3907C > T) was identified in SORL1 which segregated with disease and was further characterized with immunohistochemistry on two post mortem autopsy cases from the same family. In a targeted re-sequencing effort on independent index patients from 35 EOAD-families, a second SORL1 variant, c.3050-2A > G, was found which segregated with the disease in 3 affected and was absent in one unaffected family member. The c.3050-2A > G variant is located two nucleotides upstream of exon 22 and was shown to cause exon 22 skipping, resulting in a deletion of amino acids Gly1017- Glu1074 of SORL1. Furthermore, a third SORL1 variant, c.5195G > C, recently identified in a Swedish case control cohort included in the European Early-Onset Dementia (EU EOD) consortium study, was detected in two affected siblings in a third family with familial EOAD. The finding of three SORL1-variants that segregate with disease in three separate families with EOAD supports the involvement of SORL1 in AD pathology. The cause of these rare monogenic forms of EOAD has proven difficult to find and the use of exome and genome sequencing may be a successful route to target them.

  18. Diverse expression of sucrose transporter gene family in Zea mays

    Indian Academy of Sciences (India)

    2015-03-04

    Mar 4, 2015 ... In this study, we identified four sucrose transporter genes. (ZmSUT1 .... strand synthesis was done with forward and reverse primers designed at .... Qazi H. A., Paranjpe S. and Bhargava S. 2012 Stem sugar accu- mulation in ...

  19. Gene Panel Testing in Epileptic Encephalopathies and Familial Epilepsies

    DEFF Research Database (Denmark)

    Møller, Rikke S.; Larsen, Line H.G.; Johannesen, Katrine M.

    2016-01-01

    -causing variant in 49 (23%) of the 216 patients. The variants were found in 19 different genes including SCN1A, STXBP1, CDKL5, SCN2A, SCN8A, GABRA1, KCNA2, and STX1B. Patients with neonatal-onset epilepsies had the highest rate of positive findings (57%). The overall yield for patients with EEs was 32%, compared...

  20. Gene Panel Testing in Epileptic Encephalopathies and Familial Epilepsies

    DEFF Research Database (Denmark)

    Møller, Rikke S; Larsen, Line H G; Johannesen, Katrine M

    2016-01-01

    In recent years, several genes have been causally associated with epilepsy. However, making a genetic diagnosis in a patient can still be difficult, since extensive phenotypic and genetic heterogeneity has been observed in many monogenic epilepsies. This study aimed to analyze the genetic basis o...

  1. Genetic diversity of bitter taste receptor gene family in Sichuan ...

    Indian Academy of Sciences (India)

    Previous research had revealed that chicken has only three bitter taste receptor genes (Tas2r1, ... Journal of Genetics, DOI 10.1007/s12041-016-0684-4, Vol. ..... between red-winged blackbirds and European starlings. ... Academic Press,.

  2. The zebrafish progranulin gene family and antisense transcripts

    Directory of Open Access Journals (Sweden)

    Baranowski David

    2005-11-01

    Full Text Available Abstract Background Progranulin is an epithelial tissue growth factor (also known as proepithelin, acrogranin and PC-cell-derived growth factor that has been implicated in development, wound healing and in the progression of many cancers. The single mammalian progranulin gene encodes a glycoprotein precursor consisting of seven and one half tandemly repeated non-identical copies of the cystine-rich granulin motif. A genome-wide duplication event hypothesized to have occurred at the base of the teleost radiation predicts that mammalian progranulin may be represented by two co-orthologues in zebrafish. Results The cDNAs encoding two zebrafish granulin precursors, progranulins-A and -B, were characterized and found to contain 10 and 9 copies of the granulin motif respectively. The cDNAs and genes encoding the two forms of granulin, progranulins-1 and -2, were also cloned and sequenced. Both latter peptides were found to be encoded by precursors with a simplified architecture consisting of one and one half copies of the granulin motif. A cDNA encoding a chimeric progranulin which likely arises through the mechanism of trans-splicing between grn1 and grn2 was also characterized. A non-coding RNA gene with antisense complementarity to both grn1 and grn2 was identified which may have functional implications with respect to gene dosage, as well as in restricting the formation of the chimeric form of progranulin. Chromosomal localization of the four progranulin (grn genes reveals syntenic conservation for grna only, suggesting that it is the true orthologue of mammalian grn. RT-PCR and whole-mount in situ hybridization analysis of zebrafish grns during development reveals that combined expression of grna and grnb, but not grn1 and grn2, recapitulate many of the expression patterns observed for the murine counterpart. This includes maternal deposition, widespread central nervous system distribution and specific localization within the epithelial

  3. Translational Control in Plasmodium and Toxoplasma Parasites

    Science.gov (United States)

    Joyce, Bradley R.; Sullivan, William J.; Nussenzweig, Victor

    2013-01-01

    The life cycles of apicomplexan parasites such as Plasmodium spp. and Toxoplasma gondii are complex, consisting of proliferative and latent stages within multiple hosts. Dramatic transformations take place during the cycles, and they demand precise control of gene expression at all levels, including translation. This review focuses on the mechanisms that regulate translational control in Plasmodium and Toxoplasma, with a particular emphasis on the phosphorylation of the α subunit of eukaryotic translation initiation factor 2 (eIF2α). Phosphorylation of eIF2α (eIF2α∼P) is a conserved mechanism that eukaryotic cells use to repress global protein synthesis while enhancing gene-specific translation of a subset of mRNAs. Elevated levels of eIF2α∼P have been observed during latent stages in both Toxoplasma and Plasmodium, indicating that translational control plays a role in maintaining dormancy. Parasite-specific eIF2α kinases and phosphatases are also required for proper developmental transitions and adaptation to cellular stresses encountered during the life cycle. Identification of small-molecule inhibitors of apicomplexan eIF2α kinases may selectively interfere with parasite translational control and lead to the development of new therapies to treat malaria and toxoplasmosis. PMID:23243065

  4. Translational control in Plasmodium and toxoplasma parasites.

    Science.gov (United States)

    Zhang, Min; Joyce, Bradley R; Sullivan, William J; Nussenzweig, Victor

    2013-02-01

    The life cycles of apicomplexan parasites such as Plasmodium spp. and Toxoplasma gondii are complex, consisting of proliferative and latent stages within multiple hosts. Dramatic transformations take place during the cycles, and they demand precise control of gene expression at all levels, including translation. This review focuses on the mechanisms that regulate translational control in Plasmodium and Toxoplasma, with a particular emphasis on the phosphorylation of the α subunit of eukaryotic translation initiation factor 2 (eIF2α). Phosphorylation of eIF2α (eIF2α∼P) is a conserved mechanism that eukaryotic cells use to repress global protein synthesis while enhancing gene-specific translation of a subset of mRNAs. Elevated levels of eIF2α∼P have been observed during latent stages in both Toxoplasma and Plasmodium, indicating that translational control plays a role in maintaining dormancy. Parasite-specific eIF2α kinases and phosphatases are also required for proper developmental transitions and adaptation to cellular stresses encountered during the life cycle. Identification of small-molecule inhibitors of apicomplexan eIF2α kinases may selectively interfere with parasite translational control and lead to the development of new therapies to treat malaria and toxoplasmosis.

  5. The SULTR gene family in maize (Zea mays L.): Gene cloning and expression analyses under sulfate starvation and abiotic stress.

    Science.gov (United States)

    Huang, Qin; Wang, Meiping; Xia, Zongliang

    2018-01-01

    Sulfur is an essential macronutrient required for plant growth, development and stress responses. The family of sulfate transporters (SULTRs) mediates the uptake and translocation of sulfate in higher plants. However, basic knowledge of the SULTR gene family in maize (Zea mays L.) is scarce. In this study, a genome-wide bioinformatic analysis of SULTR genes in maize was conducted, and the developmental expression patterns of the genes and their responses to sulfate starvation and abiotic stress were further investigated. The ZmSULTR family includes eight putative members in the maize genome and is clustered into four groups in the phylogenetic tree. These genes displayed differential expression patterns in various organs of maize. For example, expression of ZmSULTR1;1 and ZmSULTR4;1 was high in roots, and transcript levels of ZmSULTR3;1 and ZmSULTR3;3 were high in shoots. Expression of ZmSULTR1;2, ZmSULTR2;1, ZmSULTR3;3, and ZmSULTR4;1 was high in flowers. Also, these eight genes showed differential responses to sulfate deprivation in roots and shoots of maize seedlings. Transcript levels of ZmSULTR1;1, ZmSULTR1;2, and ZmSULTR3;4 were significantly increased in roots during 12-day-sulfate starvation stress, while ZmSULTR3;3 and ZmSULTR3;5 only showed an early response pattern in shoots. In addition, dynamic transcriptional changes determined via qPCR revealed differential expression profiles of these eight ZmSULTR genes in response to environmental stresses such as salt, drought, and heat stresses. Notably, all the genes, except for ZmSULTR3;3, were induced by drought and heat stresses. However, a few genes were induced by salt stress. Physiological determination showed that two important thiol-containing compounds, cysteine and glutathione, increased significantly under these abiotic stresses. The results suggest that members of the SULTR family might function in adaptations to sulfur deficiency stress and adverse growing environments. This study will lay a

  6. Genome-Wide Analysis of the Aquaporin Gene Family in Chickpea (Cicer arietinum L.).

    Science.gov (United States)

    Deokar, Amit A; Tar'an, Bunyamin

    2016-01-01

    Aquaporins (AQPs) are essential membrane proteins that play critical role in the transport of water and many other solutes across cell membranes. In this study, a comprehensive genome-wide analysis identified 40 AQP genes in chickpea ( Cicer arietinum L.). A complete overview of the chickpea AQP (CaAQP) gene family is presented, including their chromosomal locations, gene structure, phylogeny, gene duplication, conserved functional motifs, gene expression, and conserved promoter motifs. To understand AQP's evolution, a comparative analysis of chickpea AQPs with AQP orthologs from soybean, Medicago, common bean, and Arabidopsis was performed. The chickpea AQP genes were found on all of the chickpea chromosomes, except chromosome 7, with a maximum of six genes on chromosome 6, and a minimum of one gene on chromosome 5. Gene duplication analysis indicated that the expansion of chickpea AQP gene family might have been due to segmental and tandem duplications. CaAQPs were grouped into four subfamilies including 15 NOD26-like intrinsic proteins (NIPs), 13 tonoplast intrinsic proteins (TIPs), eight plasma membrane intrinsic proteins (PIPs), and four small basic intrinsic proteins (SIPs) based on sequence similarities and phylogenetic position. Gene structure analysis revealed a highly conserved exon-intron pattern within CaAQP subfamilies supporting the CaAQP family classification. Functional prediction based on conserved Ar/R selectivity filters, Froger's residues, and specificity-determining positions suggested wide differences in substrate specificity among the subfamilies of CaAQPs. Expression analysis of the AQP genes indicated that some of the genes are tissue-specific, whereas few other AQP genes showed differential expression in response to biotic and abiotic stresses. Promoter profiling of CaAQP genes for conserved cis -acting regulatory elements revealed enrichment of cis -elements involved in circadian control, light response, defense and stress responsiveness

  7. Genome-wide evolutionary characterization and expression analyses of WRKY family genes in Brachypodium distachyon.

    Science.gov (United States)

    Wen, Feng; Zhu, Hong; Li, Peng; Jiang, Min; Mao, Wenqing; Ong, Chermaine; Chu, Zhaoqing

    2014-06-01

    Members of plant WRKY gene family are ancient transcription factors that function in plant growth and development and respond to biotic and abiotic stresses. In our present study, we have investigated WRKY family genes in Brachypodium distachyon, a new model plant of family Poaceae. We identified a total of 86 WRKY genes from B. distachyon and explored their chromosomal distribution and evolution, domain alignment, promoter cis-elements, and expression profiles. Combining the analysis of phylogenetic tree of BdWRKY genes and the result of expression profiling, results showed that most of clustered gene pairs had higher similarities in the WRKY domain, suggesting that they might be functionally redundant. Neighbour-joining analysis of 301 WRKY domains from Oryza sativa, Arabidopsis thaliana, and B. distachyon suggested that BdWRKY domains are evolutionarily more closely related to O. sativa WRKY domains than those of A. thaliana. Moreover, tissue-specific expression profile of BdWRKY genes and their responses to phytohormones and several biotic or abiotic stresses were analysed by quantitative real-time PCR. The results showed that the expression of BdWRKY genes was rapidly regulated by stresses and phytohormones, and there was a strong correlation between promoter cis-elements and the phytohormones-induced BdWRKY gene expression. © The Author 2014. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  8. Targeted sequencing of established and candidate colorectal cancer genes in the Colon Cancer Family Registry Cohort.

    Science.gov (United States)

    Raskin, Leon; Guo, Yan; Du, Liping; Clendenning, Mark; Rosty, Christophe; Lindor, Noralane M; Gruber, Stephen B; Buchanan, Daniel D

    2017-11-07

    The underlying genetic cause of colorectal cancer (CRC) can be identified for 5-10% of all cases, while at least 20% of CRC cases are thought to be due to inherited genetic factors. Screening for highly penetrant mutations in genes associated with Mendelian cancer syndromes using next-generation sequencing (NGS) can be prohibitively expensive for studies requiring large samples sizes. The aim of the study was to identify rare single nucleotide variants and small indels in 40 established or candidate CRC susceptibility genes in 1,046 familial CRC cases (including both MSS and MSI-H tumor subtypes) and 1,006 unrelated controls from the Colon Cancer Family Registry Cohort using a robust and cost-effective DNA pooling NGS strategy. We identified 264 variants in 38 genes that were observed only in cases, comprising either very rare (minor allele frequency cancer susceptibility genes BAP1, CDH1, CHEK2, ENG, and MSH3 . For the candidate CRC genes, we identified likely pathogenic variants in the helicase domain of POLQ and in the LRIG1 , SH2B3 , and NOS1 genes and present their clinicopathological characteristics. Using a DNA pooling NGS strategy, we identified novel germline mutations in established CRC susceptibility genes in familial CRC cases. Further studies are required to support the role of POLQ , LRIG1 , SH2B3 and NOS1 as CRC susceptibility genes.

  9. Genome-wide analysis of the WRKY gene family in physic nut (Jatropha curcas L.).

    Science.gov (United States)

    Xiong, Wangdan; Xu, Xueqin; Zhang, Lin; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

    2013-07-25

    The WRKY proteins, which contain highly conserved WRKYGQK amino acid sequences and zinc-finger-like motifs, constitute a large family of transcription factors in plants. They participate in diverse physiological and developmental processes. WRKY genes have been identified and characterized in a number of plant species. We identified a total of 58 WRKY genes (JcWRKY) in the genome of the physic nut (Jatropha curcas L.). On the basis of their conserved WRKY domain sequences, all of the JcWRKY proteins could be assigned to one of the previously defined groups, I-III. Phylogenetic analysis of JcWRKY genes with Arabidopsis and rice WRKY genes, and separately with castor bean WRKY genes, revealed no evidence of recent gene duplication in JcWRKY gene family. Analysis of transcript abundance of JcWRKY gene products were tested in different tissues under normal growth condition. In addition, 47 WRKY genes responded to at least one abiotic stress (drought, salinity, phosphate starvation and nitrogen starvation) in individual tissues (leaf, root and/or shoot cortex). Our study provides a useful reference data set as the basis for cloning and functional analysis of physic nut WRKY genes. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. Genome-wide investigation and transcriptome analysis of the WRKY gene family in Gossypium.

    Science.gov (United States)

    Ding, Mingquan; Chen, Jiadong; Jiang, Yurong; Lin, Lifeng; Cao, YueFen; Wang, Minhua; Zhang, Yuting; Rong, Junkang; Ye, Wuwei

    2015-02-01

    WRKY transcription factors play important roles in various stress responses in diverse plant species. In cotton, this family has not been well studied, especially in relation to fiber development. Here, the genomes and transcriptomes of Gossypium raimondii and Gossypium arboreum were investigated to identify fiber development related WRKY genes. This represents the first comprehensive comparative study of WRKY transcription factors in both diploid A and D cotton species. In total, 112 G. raimondii and 109 G. arboreum WRKY genes were identified. No significant gene structure or domain alterations were detected between the two species, but many SNPs distributed unequally in exon and intron regions. Physical mapping revealed that the WRKY genes in G. arboreum were not located in the corresponding chromosomes of G. raimondii, suggesting great chromosome rearrangement in the diploid cotton genomes. The cotton WRKY genes, especially subgroups I and II, have expanded through multiple whole genome duplications and tandem duplications compared with other plant species. Sequence comparison showed many functionally divergent sites between WRKY subgroups, while the genes within each group are under strong purifying selection. Transcriptome analysis suggested that many WRKY genes participate in specific fiber development processes such as fiber initiation, elongation and maturation with different expression patterns between species. Complex WRKY gene expression such as differential Dt and At allelic gene expression in G. hirsutum and alternative splicing events were also observed in both diploid and tetraploid cottons during fiber development process. In conclusion, this study provides important information on the evolution and function of WRKY gene family in cotton species.

  11. Gene mapping in an anophthalmic pedigree of a consanguineous Pakistani family opened new horizons for research

    Directory of Open Access Journals (Sweden)

    Saleha S

    2016-06-01

    Full Text Available Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family.

  12. Gene mapping in an anophthalmic pedigree of a consanguineous Pakistani family opened new horizons for research

    Science.gov (United States)

    Ajmal, M; Zafar, S; Hameed, A

    2016-01-01

    ABSTRACT Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR) markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family. PMID:27785411

  13. Gene Environment Interactions and Predictors of Colorectal Cancer in Family-Based, Multi-Ethnic Groups.

    Science.gov (United States)

    Shiao, S Pamela K; Grayson, James; Yu, Chong Ho; Wasek, Brandi; Bottiglieri, Teodoro

    2018-02-16

    For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene-environment interactions and predictors of colorectal cancer (CRC) by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black). We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls ( p relation to gene-environment interactions in the prevention of CRC.

  14. Aux/IAA Gene Family in Plants: Molecular Structure, Regulation, and Function

    Directory of Open Access Journals (Sweden)

    Jie Luo

    2018-01-01

    Full Text Available Auxin plays a crucial role in the diverse cellular and developmental responses of plants across their lifespan. Plants can quickly sense and respond to changes in auxin levels, and these responses involve several major classes of auxin-responsive genes, including the Auxin/Indole-3-Acetic Acid (Aux/IAA family, the auxin response factor (ARF family, small auxin upregulated RNA (SAUR, and the auxin-responsive Gretchen Hagen3 (GH3 family. Aux/IAA proteins are short-lived nuclear proteins comprising several highly conserved domains that are encoded by the auxin early response gene family. These proteins have specific domains that interact with ARFs and inhibit the transcription of genes activated by ARFs. Molecular studies have revealed that Aux/IAA family members can form diverse dimers with ARFs to regulate genes in various ways. Functional analyses of Aux/IAA family members have indicated that they have various roles in plant development, such as root development, shoot growth, and fruit ripening. In this review, recently discovered details regarding the molecular characteristics, regulation, and protein–protein interactions of the Aux/IAA proteins are discussed. These details provide new insights into the molecular basis of the Aux/IAA protein functions in plant developmental processes.

  15. Dichotomy in the NRT gene families of dicots and grass species.

    Directory of Open Access Journals (Sweden)

    Darren Plett

    Full Text Available A large proportion of the nitrate (NO(3(- acquired by plants from soil is actively transported via members of the NRT families of NO(3(- transporters. In Arabidopsis, the NRT1 family has eight functionally characterised members and predominantly comprises low-affinity transporters; the NRT2 family contains seven members which appear to be high-affinity transporters; and there are two NRT3 (NAR2 family members which are known to participate in high-affinity transport. A modified reciprocal best hit (RBH approach was used to identify putative orthologues of the Arabidopsis NRT genes in the four fully sequenced grass genomes (maize, rice, sorghum, Brachypodium. We also included the poplar genome in our analysis to establish whether differences between Arabidopsis and the grasses may be generally applicable to monocots and dicots. Our analysis reveals fundamental differences between Arabidopsis and the grass species in the gene number and family structure of all three families of NRT transporters. All grass species possessed additional NRT1.1 orthologues and appear to lack NRT1.6/NRT1.7 orthologues. There is significant separation in the NRT2 phylogenetic tree between NRT2 genes from dicots and grass species. This indicates that determination of function of NRT2 genes in grass species will not be possible in cereals based simply on sequence homology to functionally characterised Arabidopsis NRT2 genes and that proper functional analysis will be required. Arabidopsis has a unique NRT3.2 gene which may be a fusion of the NRT3.1 and NRT3.2 genes present in all other species examined here. This work provides a framework for future analysis of NO(3(- transporters and NO(3(- transport in grass crop species.

  16. The role of IL-4 gene 70 bp VNTR and ACE gene I/D variants in Familial Mediterranean fever.

    Science.gov (United States)

    Yigit, Serbülent; Tural, Sengul; Tekcan, Akın; Tasliyurt, Turker; Inanir, Ahmet; Uzunkaya, Süheyla; Kismali, Gorkem

    2014-05-01

    Familial Mediterranean fever (FMF) is characterized by recurrent attacks of fever and inflammation in the peritoneum, synovium, or pleura, accompanied by pain. It is an autosomal recessive disease caused by mutations in the MEFV (MEditerranean FeVer) gene. Patients with similar genotypes exhibit phenotypic diversity. As a result, the variations in different genes could be responsible for the clinical findings of this disease. In previous studies genes encoding Angiotensin-Converting Enzyme (ACE) and IL-4 (Interleukin-4) were found to be associated with rheumatologic and autoimmune diseases. In the present study we hypothesized whether ACE I/D or IL-4 70 bp variable tandem repeats (VNTR) genes are associated with FMF and its clinical findings in Turkish patients. Genomic DNA obtained from 670 persons (339 patients with FMF and 331 healthy controls) was used in the study. Genotypes for an ACE gene I/D polymorphism and IL-4 gene 70 bp VNTR were determined by polymerase chain reaction with specific primers. To our knowledge, this is the first study examining ACE gene I/D polymorphism and IL-4 gene 70 bp VNTR polymorphism in FMF patients. As a result, there was a statistically significant difference between the groups with respect to genotype distribution (pACE gene DD genotype was associated with an increased risk in FMF [pACE genotype frequencies according to the clinical characteristics, we found a statistically significant association between DD+ID genotype and fever (p=0.04). In addition IL-4 gene P1P1 genotype was associated with FMF (pACE gene and P1 allele or P1P1 genotype of IL-4 gene may be important molecular markers for susceptibility of FMF. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. [PAX3 gene mutation analysis for two Waardenburg syndrome type Ⅰ families and their prenatal diagnosis].

    Science.gov (United States)

    Bai, Y; Liu, N; Kong, X D; Yan, J; Qin, Z B; Wang, B

    2016-12-07

    Objective: To analyze the mutations of PAX3 gene in two Waardenburg syndrome type Ⅰ (WS1) pedigrees and make prenatal diagnosis for the high-risk 18-week-old fetus. Methods: PAX3 gene was first analyzed by Sanger sequencing and multiplex ligation-dependent probe amplification(MLPA) for detecting pathogenic mutation of the probands of the two pedigrees. The mutations were confirmed by MLPA and Sanger in parents and unrelated healthy individuals.Prenatal genetic diagnosis for the high-risk fetus was performed by amniotic fluid cell after genotyping. Results: A heterozygous PAX3 gene gross deletion (E7 deletion) was identified in all patients from WS1-01 family, and not found in 20 healthy individuals.Prenatal diagnosis in WS1-01 family indicated that the fetus was normal. Molecular studies identified a novel deletion mutation c. 1385_1386delCT within the PAX3 gene in all affected WS1-02 family members, but in none of the unaffected relatives and 200 healthy individuals. Conclusions: PAX3 gene mutation is etiological for two WS1 families. Sanger sequencing plus MLPA is effective and accurate for making gene diagnosis and prenatal diagnosis.

  18. Distribution of mutations in the PEX gene in families with X-linked hypophosphataemic rickets (HYP).

    Science.gov (United States)

    Rowe, P S; Oudet, C L; Francis, F; Sinding, C; Pannetier, S; Econs, M J; Strom, T M; Meitinger, T; Garabedian, M; David, A; Macher, M A; Questiaux, E; Popowska, E; Pronicka, E; Read, A P; Mokrzycki, A; Glorieux, F H; Drezner, M K; Hanauer, A; Lehrach, H; Goulding, J N; O'Riordan, J L

    1997-04-01

    Mutations in the PEX gene at Xp22.1 (phosphate-regulating gene with homologies to endopeptidases, on the X-chromosome), are responsible for X-linked hypophosphataemic rickets (HYP). Homology of PEX to the M13 family of Zn2+ metallopeptidases which include neprilysin (NEP) as prototype, has raised important questions regarding PEX function at the molecular level. The aim of this study was to analyse 99 HYP families for PEX gene mutations, and to correlate predicted changes in the protein structure with Zn2+ metallopeptidase gene function. Primers flanking 22 characterised exons were used to amplify DNA by PCR, and SSCP was then used to screen for mutations. Deletions, insertions, nonsense mutations, stop codons and splice mutations occurred in 83% of families screened for in all 22 exons, and 51% of a separate set of families screened in 17 PEX gene exons. Missense mutations in four regions of the gene were informative regarding function, with one mutation in the Zn2+-binding site predicted to alter substrate enzyme interaction and catalysis. Computer analysis of the remaining mutations predicted changes in secondary structure, N-glycosylation, protein phosphorylation and catalytic site molecular structure. The wide range of mutations that align with regions required for protease activity in NEP suggests that PEX also functions as a protease, and may act by processing factor(s) involved in bone mineral metabolism.

  19. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  20. Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes

    Science.gov (United States)

    Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.

    2003-01-01

    Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650

  1. The Mycobacterium leprae antigen 85 complex gene family: identification of the genes for the 85A, 85C, and related MPT51 proteins

    NARCIS (Netherlands)

    Rinke de Wit, T. F.; Bekelie, S.; Osland, A.; Wieles, B.; Janson, A. A.; Thole, J. E.

    1993-01-01

    The genes for two novel members (designated 85A and 85C) of the Mycobacterium leprae antigen 85 complex family of proteins and the gene for the closely related M. leprae MPT51 protein were isolated. The complete DNA sequence of the M. leprae 85C gene and partial sequences of the 85A and MPT51 genes

  2. Analysis of factor VIII gene inversions in 164 unrelated hemophilia A families

    Energy Technology Data Exchange (ETDEWEB)

    Vnencak-Jones, L.; Phillips, J.A. III; Janco, R.L. [Vanderbilt Univ. School of Medicine, Nashville, TN (United States)] [and others

    1994-09-01

    Hemophilia A is an X-linked recessive disease with variable phenotype and both heterogeneous and wide spread mutations in the factor VIII (F8) gene. As a result, diagnostic carrier or prenatal testing often relies upon laborious DNA linkage analysis. Recently, inversion mutations resulting from an intrachromosomal recombination between DNA sequences in one of two A genes {approximately}500 kb upstream from the F8 gene and a homologous A gene in intron 22 of the F8 gene were identified and found in 45% of severe hemophiliacs. We have analyzed banked DNA collected since 1986 from affected males or obligate carrier females representing 164 unrelated hemophilia A families. The disease was sporadic in 37%, familial in 54% and in 10% of families incomplete information was given. A unique deletion was identified in 1/164, a normal pattern was observed in 110/164 (67%), and 53/164 (32%) families had inversion mutations with 43/53 (81%) involving the distal A gene (R3 pattern) and 10/53 (19%) involving the proximal A gene (R2 pattern). While 19% of all rearrangements were R2, in 35 families with severe disease (< 1% VIII:C activity) all 16 rearrangements seen were R3. In 18 families with the R3 pattern and known activities, 16 (89%) had levels < 1%, with the remaining 2 families having {le} 2.4% activity. Further, 18 referrals specifically noted the production of inhibitors and 8/18 (45%) had the R3 pattern. Our findings demonstrate that the R3 inversion mutation patterns is (1) only seen with VIII:C activity levels of {le} 2.4%, (2) seen in 46% of families with severe hemophilia, (3) seen in 45% of hemophiliacs known to have inhibitors, (4) not correlated with sporadic or familial disease and (5) not in disequilibrium with the Bcl I or Taq I intron 18 or ST14 polymorphisms. Finally, in families positive for an inversion mutation, direct testing offers a highly accurate and less expensive alternative to DNA linkage analysis.

  3. Mutation analysis of pre-mRNA splicing genes in Chinese families with retinitis pigmentosa

    Science.gov (United States)

    Pan, Xinyuan; Chen, Xue; Liu, Xiaoxing; Gao, Xiang; Kang, Xiaoli; Xu, Qihua; Chen, Xuejuan; Zhao, Kanxing; Zhang, Xiumei; Chu, Qiaomei; Wang, Xiuying

    2014-01-01

    Purpose Seven genes involved in precursor mRNA (pre-mRNA) splicing have been implicated in autosomal dominant retinitis pigmentosa (adRP). We sought to detect mutations in all seven genes in Chinese families with RP, to characterize the relevant phenotypes, and to evaluate the prevalence of mutations in splicing genes in patients with adRP. Methods Six unrelated families from our adRP cohort (42 families) and two additional families with RP with uncertain inheritance mode were clinically characterized in the present study. Targeted sequence capture with next-generation massively parallel sequencing (NGS) was performed to screen mutations in 189 genes including all seven pre-mRNA splicing genes associated with adRP. Variants detected with NGS were filtered with bioinformatics analyses, validated with Sanger sequencing, and prioritized with pathogenicity analysis. Results Mutations in pre-mRNA splicing genes were identified in three individual families including one novel frameshift mutation in PRPF31 (p.Leu366fs*1) and two known mutations in SNRNP200 (p.Arg681His and p.Ser1087Leu). The patients carrying SNRNP200 p.R681H showed rapid disease progression, and the family carrying p.S1087L presented earlier onset ages and more severe phenotypes compared to another previously reported family with p.S1087L. In five other families, we identified mutations in other RP-related genes, including RP1 p. Ser781* (novel), RP2 p.Gln65* (novel) and p.Ile137del (novel), IMPDH1 p.Asp311Asn (recurrent), and RHO p.Pro347Leu (recurrent). Conclusions Mutations in splicing genes identified in the present and our previous study account for 9.5% in our adRP cohort, indicating the important role of pre-mRNA splicing deficiency in the etiology of adRP. Mutations in the same splicing gene, or even the same mutation, could correlate with different phenotypic severities, complicating the genotype–phenotype correlation and clinical prognosis. PMID:24940031

  4. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    Directory of Open Access Journals (Sweden)

    Tran Lan T

    2012-08-01

    Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic

  5. Genome-wide identification of the SWEET gene family in wheat.

    Science.gov (United States)

    Gao, Yue; Wang, Zi Yuan; Kumar, Vikranth; Xu, Xiao Feng; Yuan, De Peng; Zhu, Xiao Feng; Li, Tian Ya; Jia, Baolei; Xuan, Yuan Hu

    2018-02-05

    The SWEET (sugars will eventually be exported transporter) family is a newly characterized group of sugar transporters. In plants, the key roles of SWEETs in phloem transport, nectar secretion, pollen nutrition, stress tolerance, and plant-pathogen interactions have been identified. SWEET family genes have been characterized in many plant species, but a comprehensive analysis of SWEET members has not yet been performed in wheat. Here, 59 wheat SWEETs (hereafter TaSWEETs) were identified through homology searches. Analyses of phylogenetic relationships, numbers of transmembrane helices (TMHs), gene structures, and motifs showed that TaSWEETs carrying 3-7 TMHs could be classified into four clades with 10 different types of motifs. Examination of the expression patterns of 18 SWEET genes revealed that a few are tissue-specific while most are ubiquitously expressed. In addition, the stem rust-mediated expression patterns of SWEET genes were monitored using a stem rust-susceptible cultivar, 'Little Club' (LC). The resulting data showed that the expression of five out of the 18 SWEETs tested was induced following inoculation. In conclusion, we provide the first comprehensive analysis of the wheat SWEET gene family. Information regarding the phylogenetic relationships, gene structures, and expression profiles of SWEET genes in different tissues and following stem rust disease inoculation will be useful in identifying the potential roles of SWEETs in specific developmental and pathogenic processes. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Evolutionary Pattern and Regulation Analysis to Support Why Diversity Functions Existed within PPAR Gene Family Members

    Directory of Open Access Journals (Sweden)

    Tianyu Zhou

    2015-01-01

    Full Text Available Peroxisome proliferators-activated receptor (PPAR gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3′ UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3′ UTR are essential for PPARs evolution and diversity functions acquired.

  7. Evolutionary Pattern and Regulation Analysis to Support Why Diversity Functions Existed within PPAR Gene Family Members.

    Science.gov (United States)

    Zhou, Tianyu; Yan, Xiping; Wang, Guosong; Liu, Hehe; Gan, Xiang; Zhang, Tao; Wang, Jiwen; Li, Liang

    2015-01-01

    Peroxisome proliferators-activated receptor (PPAR) gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors) domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors) are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3' UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3' UTR are essential for PPARs evolution and diversity functions acquired.

  8. Evolutionary mechanisms driving the evolution of a large polydnavirus gene family coding for protein tyrosine phosphatases

    Directory of Open Access Journals (Sweden)

    Serbielle Céline

    2012-12-01

    Full Text Available Abstract Background Gene duplications have been proposed to be the main mechanism involved in genome evolution and in acquisition of new functions. Polydnaviruses (PDVs, symbiotic viruses associated with parasitoid wasps, are ideal model systems to study mechanisms of gene duplications given that PDV genomes consist of virulence genes organized into multigene families. In these systems the viral genome is integrated in a wasp chromosome as a provirus and virus particles containing circular double-stranded DNA are injected into the parasitoids’ hosts and are essential for parasitism success. The viral virulence factors, organized in gene families, are required collectively to induce host immune suppression and developmental arrest. The gene family which encodes protein tyrosine phosphatases (PTPs has undergone spectacular expansion in several PDV genomes with up to 42 genes. Results Here, we present strong indications that PTP gene family expansion occurred via classical mechanisms: by duplication of large segments of the chromosomally integrated form of the virus sequences (segmental duplication, by tandem duplications within this form and by dispersed duplications. We also propose a novel duplication mechanism specific to PDVs that involves viral circle reintegration into the wasp genome. The PTP copies produced were shown to undergo conservative evolution along with episodes of adaptive evolution. In particular recently produced copies have undergone positive selection in sites most likely involved in defining substrate selectivity. Conclusion The results provide evidence about the dynamic nature of polydnavirus proviral genomes. Classical and PDV-specific duplication mechanisms have been involved in the production of new gene copies. Selection pressures associated with antagonistic interactions with parasitized hosts have shaped these genes used to manipulate lepidopteran physiology with evidence for positive selection involved in

  9. Identification and characterization of NF-YB family genes in tung tree.

    Science.gov (United States)

    Yang, Susu; Wang, Yangdong; Yin, Hengfu; Guo, Haobo; Gao, Ming; Zhu, Huiping; Chen, Yicun

    2015-12-01

    The NF-YB transcription factor gene family encodes a subunit of the CCAAT box-binding factor (CBF), a highly conserved trimeric activator that strongly binds to the CCAAT box promoter element. Studies on model plants have shown that NF-YB proteins participate in important developmental and physiological processes, but little is known about NF-YB proteins in trees. Here, we identified seven NF-YB transcription factor-encoding genes in Vernicia fordii, an important oilseed tree in China. A phylogenetic analysis separated the genes into two groups; non-LEC1 type (VfNF-YB1, 5, 7, 9, 11, 13) and LEC1-type (VfNF-YB 14). A gene structure analysis showed that VfNF-YB 5 has three introns and the other genes have no introns. The seven VfNF-YB sequences contain highly conserved domains, a disordered region at the N terminus, and two long helix structures at the C terminus. Phylogenetic analyses showed that VfNF-YB family genes are highly homologous to GmNF-YB genes, and many of them are closely related to functionally characterized NF-YBs. In expression analyses of various tissues (root, stem, leaf, and kernel) and the root during pathogen infection, VfNF-YB1, 5, and 11 were dominantly expressed in kernels, and VfNF-YB7 and 9 were expressed only in the root. Different VfNF-YB family genes showed different responses to pathogen infection, suggesting that they play different roles in the pathogen response. Together, these findings represent the first extensive evaluation of the NF-YB family in tung tree and provide a foundation for dissecting the functions of VfNF-YB genes in seed development, stress adaption, fatty acid synthesis, and pathogen response.

  10. AtTZF gene family localizes to cytoplasmic foci

    OpenAIRE

    Pomeranz, Marcelo; Lin, Pei-Chi; Finer, John; Jang, Jyan-Chyun

    2010-01-01

    In eukaryotes, mRNA turnover and translational repression represent important regulatory steps in gene expression. Curiously, when under cellular stresses, factors involved in these processes aggregate into cytoplasmic foci known as Processing bodies (P-bodies) and Stress Granules (SGs). In animals, CCCH Tandem Zinc Finger (TZF) proteins play important roles in mRNA decay within P-bodies. TTP, a P-body localized mammalian TZF, can bind to the 3'UTRs of mRNAs containing AU-rich elements (AREs)...

  11. A mutation in the Norrie disease gene (NDP) associated with X-linked familial exudative vitreoretinopathy.

    Science.gov (United States)

    Chen, Z Y; Battinelli, E M; Fielder, A; Bundey, S; Sims, K; Breakefield, X O; Craig, I W

    1993-10-01

    Familial exudative vitreoretinopathy (FEVR) is a hereditary disorder characterized by an abnormality of the peripheral retina. Both autosomal dominant (adFEVR) and X-linked (XLFEVR) forms have been described, but the biochemical defect(s) underlying the symptoms are unknown. Molecular analysis of the Norrie gene locus (NDP) in a four generation FEVR family (shown previously to exhibit linkage to the X-chromosome markers DXS228 and MAOA (Xp11.4-p11.3)) reveals a missense mutation in the highly conserved region of the NDP gene, which caused a neutral amino acid substitution (Leu124Phe), was detected in all of the affected males, but not in the unaffected family members, nor in normal controls. The observations suggest that phenotypes of both XLFEVR and Norrie disease can result from mutations in the same gene.

  12. [Mutation analysis of FGFR3 gene in a family featuring hereditary dwarfism].

    Science.gov (United States)

    Zhang, Qiong; Jiang, Hai-ou; Quan, Qing-li; Li, Jun; He, Ting; Huang, Xue-shuang

    2011-12-01

    To investigate the clinical symptoms and potential mutation in FGFR3 gene for a family featuring hereditary dwarfism in order to attain diagnosis and provide prenatal diagnosis. Five patients and two unaffected relatives from the family, in addition with 100 healthy controls, were recruited. Genome DNA was extracted. Exons 10 and 13 of the FGFR3 gene were amplified using polymerase chain reaction (PCR). PCR products were sequenced in both directions. All patients had similar features including short stature, short limbs, lumbar hyperlordosis but normal craniofacial features. A heterozygous mutation G1620T (N540K) was identified in the cDNA from all patients but not in the unaffected relatives and 100 control subjects. A heterozygous G380R mutation was excluded. The hereditary dwarfism featured by this family has been caused by hypochondroplasia (HCH) due to a N540K mutation in the FGFR3 gene.

  13. Phylogenetic analysis of the MS4A and TMEM176 gene families.

    Directory of Open Access Journals (Sweden)

    Jonathan Zuccolo

    2010-02-01

    Full Text Available The MS4A gene family in humans includes CD20 (MS4A1, FcRbeta (MS4A2, Htm4 (MS4A3, and at least 13 other syntenic genes encoding membrane proteins, most having characteristic tetraspanning topology. Expression of MS4A genes is variable in tissues throughout the body; however, several are limited to cells in the hematopoietic system where they have known roles in immune cell functions. Genes in the small TMEM176 group share significant sequence similarity with MS4A genes and there is evidence of immune function of at least one of the encoded proteins. In this study, we examined the evolutionary history of the MS4A/TMEM176 families as well as tissue expression of the phylogenetically earliest members, in order to investigate their possible origins in immune cells.Orthologs of human MS4A genes were found only in mammals; however, MS4A gene homologs were found in most jawed vertebrates. TMEM176 genes were found only in mammals and bony fish. Several unusual MS4A genes having 2 or more tandem MS4A sequences were identified in the chicken (Gallus gallus and early mammals (opossum, Monodelphis domestica and platypus, Ornithorhyncus anatinus. A large number of highly conserved MS4A and TMEM176 genes was found in zebrafish (Danio rerio. The most primitive organism identified to have MS4A genes was spiny dogfish (Squalus acanthus. Tissue expression of MS4A genes in S. acanthias and D. rerio showed no evidence of expression restricted to the hematopoietic system.Our findings suggest that MS4A genes first appeared in cartilaginous fish with expression outside of the immune system, and have since diversified in many species into their modern forms with expression and function in both immune and nonimmune cells.

  14. Phylogenetic Analysis of the MS4A and TMEM176 Gene Families

    Science.gov (United States)

    Zuccolo, Jonathan; Bau, Jeremy; Childs, Sarah J.; Goss, Greg G.; Sensen, Christoph W.; Deans, Julie P.

    2010-01-01

    Background The MS4A gene family in humans includes CD20 (MS4A1), FcRβ (MS4A2), Htm4 (MS4A3), and at least 13 other syntenic genes encoding membrane proteins, most having characteristic tetraspanning topology. Expression of MS4A genes is variable in tissues throughout the body; however, several are limited to cells in the hematopoietic system where they have known roles in immune cell functions. Genes in the small TMEM176 group share significant sequence similarity with MS4A genes and there is evidence of immune function of at least one of the encoded proteins. In this study, we examined the evolutionary history of the MS4A/TMEM176 families as well as tissue expression of the phylogenetically earliest members, in order to investigate their possible origins in immune cells. Principal Findings Orthologs of human MS4A genes were found only in mammals; however, MS4A gene homologs were found in most jawed vertebrates. TMEM176 genes were found only in mammals and bony fish. Several unusual MS4A genes having 2 or more tandem MS4A sequences were identified in the chicken (Gallus gallus) and early mammals (opossum, Monodelphis domestica and platypus, Ornithorhyncus anatinus). A large number of highly conserved MS4A and TMEM176 genes was found in zebrafish (Danio rerio). The most primitive organism identified to have MS4A genes was spiny dogfish (Squalus acanthus). Tissue expression of MS4A genes in S. acanthias and D. rerio showed no evidence of expression restricted to the hematopoietic system. Conclusions/Significance Our findings suggest that MS4A genes first appeared in cartilaginous fish with expression outside of the immune system, and have since diversified in many species into their modern forms with expression and function in both immune and nonimmune cells. PMID:20186339

  15. Characterization of the bovine pregnancy-associated glycoprotein gene family – analysis of gene sequences, regulatory regions within the promoter and expression of selected genes

    Directory of Open Access Journals (Sweden)

    Walker Angela M

    2009-04-01

    Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed

  16. Genome-wide identification and characterization of WRKY gene family in Salix suchowensis.

    Science.gov (United States)

    Bi, Changwei; Xu, Yiqing; Ye, Qiaolin; Yin, Tongming; Ye, Ning

    2016-01-01

    WRKY proteins are the zinc finger transcription factors that were first identified in plants. They can specifically interact with the W-box, which can be found in the promoter region of a large number of plant target genes, to regulate the expressions of downstream target genes. They also participate in diverse physiological and growing processes in plants. Prior to this study, a plenty of WRKY genes have been identified and characterized in herbaceous species, but there is no large-scale study of WRKY genes in willow. With the whole genome sequencing of Salix suchowensis, we have the opportunity to conduct the genome-wide research for willow WRKY gene family. In this study, we identified 85 WRKY genes in the willow genome and renamed them from SsWRKY1 to SsWRKY85 on the basis of their specific distributions on chromosomes. Due to their diverse structural features, the 85 willow WRKY genes could be further classified into three main groups (group I-III), with five subgroups (IIa-IIe) in group II. With the multiple sequence alignment and the manual search, we found three variations of the WRKYGQK heptapeptide: WRKYGRK, WKKYGQK and WRKYGKK, and four variations of the normal zinc finger motif, which might execute some new biological functions. In addition, the SsWRKY genes from the same subgroup share the similar exon-intron structures and conserved motif domains. Further studies of SsWRKY genes revealed that segmental duplication events (SDs) played a more prominent role in the expansion of SsWRKY genes. Distinct expression profiles of SsWRKY genes with RNA sequencing data revealed that diverse expression patterns among five tissues, including tender roots, young leaves, vegetative buds, non-lignified stems and barks. With the analyses of WRKY gene family in willow, it is not only beneficial to complete the functional and annotation information of WRKY genes family in woody plants, but also provide important references to investigate the expansion and evolution of

  17. Diagnosing CADASIL using MRI: evidence from families with known mutations of Notch 3 gene

    International Nuclear Information System (INIS)

    Chawda, S.J.; Lange, R.P.J. de; St-Clair, D.; Hourihan, M.D.; Halpin, S.F.S.

    2000-01-01

    Clinical data and MRI findings are presented on 18 subjects from two families with neuropathologically confirmed CADASIL. DNA analysis revealed mutations in exon 4 of Notch 3 gene in both families. All family members with mutations in Notch 3 gene had extensive abnormalities on MRI, principally lesions in the white matter of the frontal lobes and in the external capsules. Of several family members in whom a diagnosis of CADASIL was suspected on the basis of minor symptoms, one had MRI changes consistent with CADASIL; none of these cases carried a mutation in the Notch 3 gene. MRI and clinical features that may alert the radiologist to the diagnosis of CADASIL are reviewed. However, a wide differential diagnosis exists for the MRI appearances of CADASIL, including multiple sclerosis and small-vessel disease secondary to hypertension. The definitive diagnosis cannot be made on MRI alone and requires additional evidence, where available, from a positive family history and by screening DNA for mutations of Notch 3 gene. (orig.)

  18. New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands.

    Science.gov (United States)

    Florijn, Ralph J; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J J M; Mannens, Marcel M A M; Tijmes, Nel; Brooks, Simon P; Hardcastle, Alison J; Bergen, Arthur A B

    2006-09-01

    Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the Netherlands, by dHPLC and direct sequencing. We identified an unique mutation in each family. Three out of these four mutations were not reported before. We report here the first splice site sequence alteration mutation and three protein truncating mutations. Our results suggest that X-linked cataract and NHS are allelic disorders.

  19. Positive selection of Plasmodium falciparum parasites with multiple var2csa-type PfEMP1 genes during the course of infection in pregnant women

    DEFF Research Database (Denmark)

    Sander, Adam F; Salanti, Ali; Lavstsen, Thomas

    2011-01-01

    multiple genes coding for different VAR2CSA proteins, and parasites with >1 var2csa gene appear to be more common in pregnant women with placental malaria than in nonpregnant individuals. We present evidence that, in pregnant women, parasites containing multiple var2csa-type genes possess a selective...... advantage over parasites with a single var2csa gene. Accumulation of parasites with multiple copies of the var2csa gene during the course of pregnancy was also correlated with the development of antibodies involved in blocking VAR2CSA adhesion. The data suggest that multiplicity of var2csa-type genes...

  20. Evaluation of the norrie disease gene in a family with incontinentia pigmenti.

    Science.gov (United States)

    Shastry, B S; Trese, M T

    2000-01-01

    Incontinentia pigmenti (IP) is an ectodermal multisystem disorder which can affect dental, ocular, cardiac and neurologic structures. The ocular changes of IP can have a very similar appearance to the retinal detachment of X-linked familial exudative vitreoretinopathy, which has been shown to be caused by the mutations in the Norrie disease gene. Therefore, it is of interest to determine whether similar mutations in the gene can account for the retinal pathology in patients with IP. To test our hypothesis, we have analyzed the entire Norrie disease gene for a family with IP, by single strand conformational polymorphism followed by DNA sequencing. The sequencing data revealed no disease-specific sequence alterations. These data suggest that ocular findings of IP are perhaps associated with different genes and there is no direct relationship between the genotype and phenotype. Copyright 2000 S. Karger AG, Basel

  1. Evolutionary relationship and structural characterization of the EPF/EPFL gene family.

    Directory of Open Access Journals (Sweden)

    Naoki Takata

    Full Text Available EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.

  2. Evolutionary relationship and structural characterization of the EPF/EPFL gene family.

    Science.gov (United States)

    Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu

    2013-01-01

    EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.

  3. Positive selection in the SLC11A1 gene in the family Equidae

    DEFF Research Database (Denmark)

    Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan

    2016-01-01

    Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes...... a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans...... and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence...

  4. Chimpanzee malaria parasites related to Plasmodium ovale in Africa.

    Directory of Open Access Journals (Sweden)

    Linda Duval

    Full Text Available Since the 1970's, the diversity of Plasmodium parasites in African great apes has been neglected. Surprisingly, P. reichenowi, a chimpanzee parasite, is the only such parasite to have been molecularly characterized. This parasite is closely phylogenetically related to P. falciparum, the principal cause of the greatest malaria burden in humans. Studies of malaria parasites from anthropoid primates may provide relevant phylogenetic information, improving our understanding of the origin and evolutionary history of human malaria species. In this study, we screened 130 DNA samples from chimpanzees (Pan troglodytes and gorillas (Gorilla gorilla from Cameroon for Plasmodium infection, using cytochrome b molecular tools. Two chimpanzees from the subspecies Pan t. troglodytes presented single infections with Plasmodium strains molecularly related to the human malaria parasite P. ovale. These chimpanzee parasites and 13 human strains of P. ovale originated from a various sites in Africa and Asia were characterized using cytochrome b and cytochrome c oxidase 1 mitochondrial partial genes and nuclear ldh partial gene. Consistent with previous findings, two genetically distinct types of P. ovale, classical and variant, were observed in the human population from a variety of geographical locations. One chimpanzee Plasmodium strain was genetically identical, on all three markers tested, to variant P. ovale type. The other chimpanzee Plasmodium strain was different from P. ovale strains isolated from humans. This study provides the first evidence of possibility of natural cross-species exchange of P. ovale between humans and chimpanzees of the subspecies Pan t. troglodytes.

  5. Genome-wide identification and characterization of the SBP-box gene family in Petunia.

    Science.gov (United States)

    Zhou, Qin; Zhang, Sisi; Chen, Feng; Liu, Baojun; Wu, Lan; Li, Fei; Zhang, Jiaqi; Bao, Manzhu; Liu, Guofeng

    2018-03-12

    SQUAMOSA PROMOTER BINDING PROTEIN (SBP)-box genes encode a family of plant-specific transcription factors (TFs) that play important roles in many growth and development processes including phase transition, leaf initiation, shoot and inflorescence branching, fruit development and ripening etc. The SBP-box gene family has been identified and characterized in many species, but has not been well studied in Petunia, an important ornamental genus. We identified 21 putative SPL genes of Petunia axillaris and P. inflata from the reference genome of P. axillaris N and P. inflata S6, respectively, which were supported by the transcriptome data. For further confirmation, all the 21 genes were also cloned from P. hybrida line W115 (Mitchel diploid). Phylogenetic analysis based on the highly conserved SBP domains arranged PhSPLs in eight groups, analogous to those from Arabidopsis and tomato. Furthermore, the Petunia SPL genes had similar exon-intron structure and the deduced proteins contained very similar conserved motifs within the same subgroup. Out of 21 PhSPL genes, fourteen were predicted to be potential targets of PhmiR156/157, and the putative miR156/157 response elements (MREs) were located in the coding region of group IV, V, VII and VIII genes, but in the 3'-UTR regions of group VI genes. SPL genes were also identified from another two wild Petunia species, P. integrifolia and P. exserta, based on their transcriptome databases to investigate the origin of PhSPLs. Phylogenetic analysis and multiple alignments of the coding sequences of PhSPLs and their orthologs from wild species indicated that PhSPLs were originated mainly from P. axillaris. qRT-PCR analysis demonstrated differential spatiotemperal expression patterns of PhSPL genes in petunia and many were expressed predominantly in the axillary buds and/or inflorescences. In addition, overexpression of PhSPL9a and PhSPL9b in Arabidopsis suggested that these genes play a conserved role in promoting the vegetative

  6. Phylogenetic analysis of the expansion of the MATH-BTB gene family in the grasses.

    Science.gov (United States)

    Juranić, Martina; Dresselhaus, Thomas

    2014-01-01

    MATH-BTB proteins are known to act as substrate-specific adaptors of cullin3 (CUL3)-based ubiquitin E3 ligases to target protein for ubiquitination. In a previous study we reported the presence of 31 MATH-BTB genes in the maize genome and determined the regulatory role of the MATH-BTB protein MAB1 during meiosis to mitosis transition. In contrast to maize, there are only 6 homologous genes in the model plant Arabidopsis, while this family has largely expanded in grasses. Here, we report a phylogenetic analysis of the MATH-BTB gene family in 9 land plant species including various mosses, eudicots, and grasses. We extend a previous classification of the plant MATH-BTB family and additionally arrange the expanded group into 5 grass-specific clades. Synteny studies indicate that expansion occurred to a large extent due to local gene duplications. Expression studies of 3 closely related MATH-BTB genes in maize (MAB1-3) indicate highly specific expression pattern. In summary, this work provides a solid base for further studies comparing genetic and functional information of the MATH-BTB family especially in the grasses.

  7. [Study of gene mutation and pathogenetic mechanism for a family with Waardenburg syndrome].

    Science.gov (United States)

    Chen, Hongsheng; Liao, Xinbin; Liu, Yalan; He, Chufeng; Zhang, Hua; Jiang, Lu; Feng, Yong; Mei, Lingyun

    2017-08-10

    To explore the pathogenetic mechanism of a family affected with Waardenburg syndrome. Clinical data of the family was collected. Potential mutation of the MITF, SOX10 and SNAI2 genes were screened. Plasmids for wild type (WT) and mutant MITF proteins were constructed to determine their exogenous expression and subcellular distribution by Western blotting and immunofluorescence assay, respectively. A heterozygous c.763C>T (p.R255X) mutation was detected in exon 8 of the MITF gene in the proband and all other patients from the family. No pathological mutation of the SOX10 and SNAI2 genes was detected. The DNA sequences of plasmids of MITF wild and mutant MITF R255X were confirmed. Both proteins were detected with the expected size. WT MITF protein only localized in the nucleus, whereas R255X protein showed aberrant localization in the nucleus as well as the cytoplasm. The c.763C>T mutation of the MITF gene probably underlies the disease in this family. The mutation can affect the subcellular distribution of MITF proteins in vitro, which may shed light on the molecular mechanism of Waardenburg syndrome caused by mutations of the MITF gene.

  8. Prevalence of variations in melanoma susceptibility genes among Slovenian melanoma families

    Directory of Open Access Journals (Sweden)

    Besic Nikola

    2008-09-01

    Full Text Available Abstract Background Two high-risk genes have been implicated in the development of CM (cutaneous melanoma. Germline mutations of the CDKN2A gene are found in CDK4 gene reported to date. Beside those high penetrance genes, certain allelic variants of the MC1R gene modify the risk of developing the disease. The aims of our study were: to determine the prevalence of germline CDKN2A mutations and variants in members of families with familial CM and in patients with multiple primary CM; to search for possible CDK4 mutations, and to determine the frequency of variations in the MC1R gene. Methods From January 2001 until January 2007, 64 individuals were included in the study. The group included 28 patients and 7 healthy relatives belonging to 25 families, 26 patients with multiple primary tumors and 3 children with CM. Additionally 54 healthy individuals were included as a control group. Mutations and variants of the melanoma susceptibility genes were identified by direct sequencing. Results Seven families with CDKN2A mutations were discovered (7/25 or 28.0%. The L94Q mutation found in one family had not been previously reported in other populations. The D84N variant, with possible biological impact, was discovered in the case of patient without family history but with multiple primary CM. Only one mutation carrier was found in the control group. Further analysis revealed that c.540C>T heterozygous carriers were more common in the group of CM patients and their healthy relatives (11/64 vs. 2/54. One p14ARF variant was discovered in the control group and no mutations of the CDK4 gene were found. Most frequently found variants of the MC1R gene were T314T, V60L, V92M, R151C, R160W and R163Q with frequencies slightly higher in the group of patients and their relatives than in the group of controls, but the difference was statistically insignificant. Conclusion The present study has shown high prevalence of p16INK4A mutations in Slovenian population of

  9. Comprehensive identification and expression analysis of Hsp90s gene family in Solanum lycopersicum.

    Science.gov (United States)

    Zai, W S; Miao, L X; Xiong, Z L; Zhang, H L; Ma, Y R; Li, Y L; Chen, Y B; Ye, S G

    2015-07-14

    Heat shock protein 90 (Hsp90) is a protein produced by plants in response to adverse environmental stresses. In this study, we identified and analyzed Hsp90 gene family members using a bioinformatic method based on genomic data from tomato (Solanum lycopersicum L.). The results illustrated that tomato contains at least 7 Hsp90 genes distributed on 6 chromosomes; protein lengths ranged from 267-794 amino acids. Intron numbers ranged from 2-19 in the genes. The phylogenetic tree revealed that Hsp90 genes in tomato (Solanum lycopersicum L.), rice (Oryza sativa L.), and Arabidopsis (Arabidopsis thaliana L.) could be divided into 5 groups, which included 3 pairs of orthologous genes and 4 pairs of paralogous genes. Expression analysis of RNA-sequence data showed that the Hsp90-1 gene was specifically expressed in mature fruits, while Hsp90-5 and Hsp90-6 showed opposite expression patterns in various tissues of cultivated and wild tomatoes. The expression levels of the Hsp90-1, Hsp90-2, and Hsp90- 3 genes in various tissues of cultivated tomatoes were high, while both the expression levels of genes Hsp90-3 and Hsp90-4 were low. Additionally, quantitative real-time polymerase chain reaction showed that these genes were involved in the responses to yellow leaf curl virus in tomato plant leaves. Our results provide a foundation for identifying the function of the Hsp90 gene in tomato.

  10. Characterization of Soybean WRKY Gene Family and Identification of Soybean WRKY Genes that Promote Resistance to Soybean Cyst Nematode.

    Science.gov (United States)

    Yang, Yan; Zhou, Yuan; Chi, Yingjun; Fan, Baofang; Chen, Zhixiang

    2017-12-19

    WRKY proteins are a superfamily of plant transcription factors with important roles in plants. WRKY proteins have been extensively analyzed in plant species including Arabidopsis and rice. Here we report characterization of soybean WRKY gene family and their functional analysis in resistance to soybean cyst nematode (SCN), the most important soybean pathogen. Through search of the soybean genome, we identified 174 genes encoding WRKY proteins that can be classified into seven groups as established in other plants. WRKY variants including a WRKY-related protein unique to legumes have also been identified. Expression analysis reveals both diverse expression patterns in different soybean tissues and preferential expression of specific WRKY groups in certain tissues. Furthermore, a large number of soybean WRKY genes were responsive to salicylic acid. To identify soybean WRKY genes that promote soybean resistance to SCN, we first screened soybean WRKY genes for enhancing SCN resistance when over-expressed in transgenic soybean hairy roots. To confirm the results, we transformed five WRKY genes into a SCN-susceptible soybean cultivar and generated transgenic soybean lines. Transgenic soybean lines overexpressing three WRKY transgenes displayed increased resistance to SCN. Thus, WRKY genes could be explored to develop new soybean cultivars with enhanced resistance to SCN.

  11. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes.

    Science.gov (United States)

    Hu, H; Haas, S A; Chelly, J; Van Esch, H; Raynaud, M; de Brouwer, A P M; Weinert, S; Froyen, G; Frints, S G M; Laumonnier, F; Zemojtel, T; Love, M I; Richard, H; Emde, A-K; Bienek, M; Jensen, C; Hambrock, M; Fischer, U; Langnick, C; Feldkamp, M; Wissink-Lindhout, W; Lebrun, N; Castelnau, L; Rucci, J; Montjean, R; Dorseuil, O; Billuart, P; Stuhlmann, T; Shaw, M; Corbett, M A; Gardner, A; Willis-Owen, S; Tan, C; Friend, K L; Belet, S; van Roozendaal, K E P; Jimenez-Pocquet, M; Moizard, M-P; Ronce, N; Sun, R; O'Keeffe, S; Chenna, R; van Bömmel, A; Göke, J; Hackett, A; Field, M; Christie, L; Boyle, J; Haan, E; Nelson, J; Turner, G; Baynam, G; Gillessen-Kaesbach, G; Müller, U; Steinberger, D; Budny, B; Badura-Stronka, M; Latos-Bieleńska, A; Ousager, L B; Wieacker, P; Rodríguez Criado, G; Bondeson, M-L; Annerén, G; Dufke, A; Cohen, M; Van Maldergem, L; Vincent-Delorme, C; Echenne, B; Simon-Bouy, B; Kleefstra, T; Willemsen, M; Fryns, J-P; Devriendt, K; Ullmann, R; Vingron, M; Wrogemann, K; Wienker, T F; Tzschach, A; van Bokhoven, H; Gecz, J; Jentsch, T J; Chen, W; Ropers, H-H; Kalscheuer, V M

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of these males were previously tested negative for copy number variations and for mutations in a subset of known XLID genes by Sanger sequencing. In total, 745 X-chromosomal genes were screened. After stringent filtering, a total of 1297 non-recurrent exonic variants remained for prioritization. Co-segregation analysis of potential clinically relevant changes revealed that 80 families (20%) carried pathogenic variants in established XLID genes. In 19 families, we detected likely causative protein truncating and missense variants in 7 novel and validated XLID genes (CLCN4, CNKSR2, FRMPD4, KLHL15, LAS1L, RLIM and USP27X) and potentially deleterious variants in 2 novel candidate XLID genes (CDK16 and TAF1). We show that the CLCN4 and CNKSR2 variants impair protein functions as indicated by electrophysiological studies and altered differentiation of cultured primary neurons from Clcn4(-/-) mice or after mRNA knock-down. The newly identified and candidate XLID proteins belong to pathways and networks with established roles in cognitive function and intellectual disability in particular. We suggest that systematic sequencing of all X-chromosomal genes in a cohort of patients with genetic evidence for X-chromosome locus involvement may resolve up to 58% of Fragile X-negative cases.

  12. New mutation of the MPZ gene in a family with the Dejerine-Sottas disease phenotype.

    Science.gov (United States)

    Floroskufi, Paraskewi; Panas, Marios; Karadima, Georgia; Vassilopoulos, Demetris

    2007-05-01

    Charcot-Marie-Tooth disease type 1B is associated with mutations in the myelin protein zero gene. In the present study a new myelin protein zero gene mutation (c.89T>C,Ile30Thr) was detected in a family with the Dejerine-Sottas disease phenotype. The results support the hypothesis that severe, early-onset neuropathy may be related to either an alteration of a conserved amino acid or a disruption of the tertiary structure of myelin protein zero.

  13. Genome-wide analysis of the GRAS gene family in Prunus mume.

    Science.gov (United States)

    Lu, Jiuxing; Wang, Tao; Xu, Zongda; Sun, Lidan; Zhang, Qixiang

    2015-02-01

    Prunus mume is an ornamental flower and fruit tree in Rosaceae. We investigated the GRAS gene family to improve the breeding and cultivation of P. mume and other Rosaceae fruit trees. The GRAS gene family encodes transcriptional regulators that have diverse functions in plant growth and development, such as gibberellin and phytochrome A signal transduction, root radial patterning, and axillary meristem formation and gametogenesis in the P. mume genome. Despite the important roles of these genes in plant growth regulation, no findings on the GRAS genes of P. mume have been reported. In this study, we discerned phylogenetic relationships of P. mume GRAS genes, and their locations, structures in the genome and expression levels of different tissues. Out of 46 identified GRAS genes, 45 were located on the 8 P. mume chromosomes. Phylogenetic results showed that these genes could be classified into 11 groups. We found that Group X was P. mume-specific, and three genes of Group IX clustered with the rice-specific gene Os4. We speculated that these genes existed before the divergence of dicotyledons and monocotyledons and were lost in Arabidopsis. Tissue expression analysis indicated that 13 genes showed high expression levels in roots, stems, leaves, flowers and fruits, and were related to plant growth and development. Functional analysis of 24 GRAS genes and an orthologous relationship analysis indicated that many functioned during plant growth and flower and fruit development. Our bioinformatics analysis provides valuable information to improve the economic, agronomic and ecological benefits of P. mume and other Rosaceae fruit trees.

  14. Genome-wide analysis of the WRKY gene family in cotton.

    Science.gov (United States)

    Dou, Lingling; Zhang, Xiaohong; Pang, Chaoyou; Song, Meizhen; Wei, Hengling; Fan, Shuli; Yu, Shuxun

    2014-12-01

    WRKY proteins are major transcription factors involved in regulating plant growth and development. Although many studies have focused on the functional identification of WRKY genes, our knowledge concerning many areas of WRKY gene biology is limited. For example, in cotton, the phylogenetic characteristics, global expression patterns, molecular mechanisms regulating expression, and target genes/pathways of WRKY genes are poorly characterized. Therefore, in this study, we present a genome-wide analysis of the WRKY gene family in cotton (Gossypium raimondii and Gossypium hirsutum). We identified 116 WRKY genes in G. raimondii from the completed genome sequence, and we cloned 102 WRKY genes in G. hirsutum. Chromosomal location analysis indicated that WRKY genes in G. raimondii evolved mainly from segmental duplication followed by tandem amplifications. Phylogenetic analysis of alga, bryophyte, lycophyta, monocot and eudicot WRKY domains revealed family member expansion with increasing complexity of the plant body. Microarray, expression profiling and qRT-PCR data revealed that WRKY genes in G. hirsutum may regulate the development of fibers, anthers, tissues (roots, stems, leaves and embryos), and are involved in the response to stresses. Expression analysis showed that most group II and III GhWRKY genes are highly expressed under diverse stresses. Group I members, representing the ancestral form, seem to be insensitive to abiotic stress, with low expression divergence. Our results indicate that cotton WRKY genes might have evolved by adaptive duplication, leading to sensitivity to diverse stresses. This study provides fundamental information to inform further analysis and understanding of WRKY gene functions in cotton species.

  15. Expression of Plasmodium falciparum erythrocyte membrane protein 1 in experimentally infected humans

    DEFF Research Database (Denmark)

    Lavstsen, Thomas; Magistrado, Pamela; Hermsen, Cornelus C

    2005-01-01

    -encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family, which is expressed on the surface of infected erythrocytes where it mediates binding to endothelial receptors. Thus, severe malaria may be caused by parasites expressing PfEMP1 variants that afford parasites optimal sequestration...... in immunologically naive individuals and high effective multiplication rates. METHODS: var gene transcription was analysed using real time PCR and PfEMP1 expression by western blots as well as immune plasma recognition of parasite cultures established from non-immune volunteers shortly after infection with NF54...... compared to parasites expressing other var genes. The differential expression of PfEMP1 was confirmed at the protein level by immunoblot analysis. In addition, serological typing showed that immune sera more often recognized second and third generation parasites than first generation parasites. CONCLUSION...

  16. Genome-wide screening identifies Plasmodium chabaudi-induced modifications of DNA methylation status of Tlr1 and Tlr6 gene promoters in liver, but not spleen, of female C57BL/6 mice.

    Science.gov (United States)

    Al-Quraishy, Saleh; Dkhil, Mohamed A; Abdel-Baki, Abdel Azeem S; Delic, Denis; Santourlidis, Simeon; Wunderlich, Frank

    2013-11-01

    Epigenetic reprogramming of host genes via DNA methylation is increasingly recognized as critical for the outcome of diverse infectious diseases, but information for malaria is not yet available. Here, we investigate the effect of blood-stage malaria of Plasmodium chabaudi on the DNA methylation status of host gene promoters on a genome-wide scale using methylated DNA immunoprecipitation and Nimblegen microarrays containing 2,000 bp oligonucleotide features that were split into -1,500 to -500 bp Ups promoters and -500 to +500 bp Cor promoters, relative to the transcription site, for evaluation of differential DNA methylation. Gene expression was analyzed by Agilent and Affymetrix microarray technology. Challenging of female C57BL/6 mice with 10(6) P. chabaudi-infected erythrocytes resulted in a self-healing outcome of infections with peak parasitemia on day 8 p.i. These infections induced organ-specific modifications of DNA methylation of gene promoters. Among the 17,354 features on Nimblegen arrays, only seven gene promoters were identified to be hypermethylated in the spleen, whereas the liver exhibited 109 hyper- and 67 hypomethylated promoters at peak parasitemia in comparison with non-infected mice. Among the identified genes with differentially methylated Cor-promoters, only the 7 genes Pigr, Ncf1, Klkb1, Emr1, Ndufb11, and Tlr6 in the liver and Apol6 in the spleen were detected to have significantly changed their expression. Remarkably, the Cor promoter of the toll-like receptor Tlr6 became hypomethylated and Tlr6 expression increased by 3.4-fold during infection. Concomitantly, the Ups promoter of the Tlr1 was hypermethylated, but Tlr1 expression also increased by 11.3-fold. TLR6 and TLR1 are known as auxillary receptors to form heterodimers with TLR2 in plasma membranes of macrophages, which recognize different pathogen-associated molecular patterns (PAMPs), as, e.g., intact 3-acyl and sn-2-lyso-acyl glycosylphosphatidylinositols of P. falciparum

  17. Genome-wide survey and characterization of the WRKY gene family in Populus trichocarpa.

    Science.gov (United States)

    He, Hongsheng; Dong, Qing; Shao, Yuanhua; Jiang, Haiyang; Zhu, Suwen; Cheng, Beijiu; Xiang, Yan

    2012-07-01

    WRKY transcription factors participate in diverse physiological and developmental processes in plants. They have highly conserved WRKYGQK amino acid sequences in their N-termini, followed by the novel zinc-finger-like motifs, Cys₂His₂ or Cys₂HisCys. To date, numerous WRKY genes have been identified and characterized in a number of herbaceous species. Survey and characterization of WRKY genes in a ligneous species would facilitate a better understanding of the evolutionary processes and functions of this gene family. In this study, 104 poplar WRKY genes (PtWRKY) were identified in the latest poplar genome sequence. According to their structural features, the predicted members were divided into the previously defined groups I-III, as described in rice. In addition, chromosomal localization of the genes demonstrated that there might be WRKY gene hot spots in 2.3 Mb regions on chromosome 14. Furthermore, approximately 83% (86 out of 104) WRKY genes participated in gene duplication events, including 69% (29 out of 42) gene pairs which exhibited segmental duplication. Using semi-quantitative RT-PCR, the expression patterns of subgroup III genes were investigated under different stresses [cold, drought, salinity and salicylic acid (SA)]. The data revealed that these genes presented different expression levels in response to various stress conditions. Expression analysis exhibited PtWRKY76 gene induced markedly in 0.1 mM SA or 25% PEG-6000 treatment. The results presented here provide a fundamental clue for cloning specific function genes in further studies and applications. This study identified 104 poplar WRKY genes and demonstrated WRKY gene hot spots on chromosome 14. Furthermore, semi-quantitative RT-PCR showed variable stress responses in subgroup III.

  18. Targeted disruption of py235ebp-1: Invasion of erythrocytes by Plasmodium yoelii using an alternative py235 erythrocyte binding protein

    KAUST Repository

    Ogun, Solabomi A.

    2011-02-17

    Plasmodium yoelii YM asexual blood stage parasites express multiple members of the py235 gene family, part of the super-family of genes including those coding for Plasmodium vivax reticulocyte binding proteins and Plasmodium falciparum RH proteins. We previously identified a Py235 erythrocyte binding protein (Py235EBP-1, encoded by the PY01365 gene) that is recognized by protective mAb 25.77. Proteins recognized by a second protective mAb 25.37 have been identified by mass spectrometry and are encoded by two genes, PY01185 and PY05995/PY03534. We deleted the PY01365 gene and examined the phenotype. The expression of the members of the py235 family in both the WT and gene deletion parasites was measured by quantitative RT-PCR and RNA-Seq. py235ebp-1 expression was undetectable in the knockout parasite, but transcription of other members of the family was essentially unaffected. The knockout parasites continued to react with mAb 25.77; and the 25.77-binding proteins in these parasites were the PY01185 and PY05995/PY03534 products. The PY01185 product was also identified as erythrocyte binding. There was no clear change in erythrocyte invasion profile suggesting that the PY01185 gene product (designated PY235EBP-2) is able to fulfill the role of EBP-1 by serving as an invasion ligand although the molecular details of its interaction with erythrocytes have not been examined. The PY01365, PY01185, and PY05995/PY03534 genes are part of a distinct subset of the py235 family. In P. falciparum, the RH protein genes are under epigenetic control and expression correlates with binding to distinct erythrocyte receptors and specific invasion pathways, whereas in P. yoelii YM all the genes are expressed and deletion of one does not result in upregulation of another. We propose that simultaneous expression of multiple Py235 ligands enables invasion of a wide range of host erythrocytes even in the presence of antibodies to one or more of the proteins and that this functional

  19. Targeted disruption of py235ebp-1: Invasion of erythrocytes by Plasmodium yoelii using an alternative py235 erythrocyte binding protein

    KAUST Repository

    Ogun, Solabomi A.; Tewari, Rita; Otto, Thomas D.; Howell, Steven A.; Knuepfer, Ellen; Cunningham, Deirdre A.; Xu, Zhengyao; Pain, Arnab; Holder, Anthony A.

    2011-01-01

    Plasmodium yoelii YM asexual blood stage parasites express multiple members of the py235 gene family, part of the super-family of genes including those coding for Plasmodium vivax reticulocyte binding proteins and Plasmodium falciparum RH proteins. We previously identified a Py235 erythrocyte binding protein (Py235EBP-1, encoded by the PY01365 gene) that is recognized by protective mAb 25.77. Proteins recognized by a second protective mAb 25.37 have been identified by mass spectrometry and are encoded by two genes, PY01185 and PY05995/PY03534. We deleted the PY01365 gene and examined the phenotype. The expression of the members of the py235 family in both the WT and gene deletion parasites was measured by quantitative RT-PCR and RNA-Seq. py235ebp-1 expression was undetectable in the knockout parasite, but transcription of other members of the family was essentially unaffected. The knockout parasites continued to react with mAb 25.77; and the 25.77-binding proteins in these parasites were the PY01185 and PY05995/PY03534 products. The PY01185 product was also identified as erythrocyte binding. There was no clear change in erythrocyte invasion profile suggesting that the PY01185 gene product (designated PY235EBP-2) is able to fulfill the role of EBP-1 by serving as an invasion ligand although the molecular details of its interaction with erythrocytes have not been examined. The PY01365, PY01185, and PY05995/PY03534 genes are part of a distinct subset of the py235 family. In P. falciparum, the RH protein genes are under epigenetic control and expression correlates with binding to distinct erythrocyte receptors and specific invasion pathways, whereas in P. yoelii YM all the genes are expressed and deletion of one does not result in upregulation of another. We propose that simultaneous expression of multiple Py235 ligands enables invasion of a wide range of host erythrocytes even in the presence of antibodies to one or more of the proteins and that this functional

  20. Targeted disruption of py235ebp-1: invasion of erythrocytes by Plasmodium yoelii using an alternative Py235 erythrocyte binding protein.

    Directory of Open Access Journals (Sweden)

    Solabomi A Ogun

    2011-02-01

    Full Text Available Plasmodium yoelii YM asexual blood stage parasites express multiple members of the py235 gene family, part of the super-family of genes including those coding for Plasmodium vivax reticulocyte binding proteins and Plasmodium falciparum RH proteins. We previously identified a Py235 erythrocyte binding protein (Py235EBP-1, encoded by the PY01365 gene that is recognized by protective mAb 25.77. Proteins recognized by a second protective mAb 25.37 have been identified by mass spectrometry and are encoded by two genes, PY01185 and PY05995/PY03534. We deleted the PY01365 gene and examined the phenotype. The expression of the members of the py235 family in both the WT and gene deletion parasites was measured by quantitative RT-PCR and RNA-Seq. py235ebp-1 expression was undetectable in the knockout parasite, but transcription of other members of the family was essentially unaffected. The knockout parasites continued to react with mAb 25.77; and the 25.77-binding proteins in these parasites were the PY01185 and PY05995/PY03534 products. The PY01185 product was also identified as erythrocyte binding. There was no clear change in erythrocyte invasion profile suggesting that the PY01185 gene product (designated PY235EBP-2 is able to fulfill the role of EBP-1 by serving as an invasion ligand although the molecular details of its interaction with erythrocytes have not been examined. The PY01365, PY01185, and PY05995/PY03534 genes are part of a distinct subset of the py235 family. In P. falciparum, the RH protein genes are under epigenetic control and expression correlates with binding to distinct erythrocyte receptors and specific invasion pathways, whereas in P. yoelii YM all the genes are expressed and deletion of one does not result in upregulation of another. We propose that simultaneous expression of multiple Py235 ligands enables invasion of a wide range of host erythrocytes even in the presence of antibodies to one or more of the proteins and that this

  1. Diversification and evolution of the SDG gene family in Brassica rapa after the whole genome triplication.

    Science.gov (United States)

    Dong, Heng; Liu, Dandan; Han, Tianyu; Zhao, Yuxue; Sun, Ji; Lin, Sue; Cao, Jiashu; Chen, Zhong-Hua; Huang, Li

    2015-11-24

    Histone lysine methylation, controlled by the SET Domain Group (SDG) gene family, is part of the histone code that regulates chromatin function and epigenetic control of gene expression. Analyzing the SDG gene family in Brassica rapa for their gene structure, domain architecture, subcellular localization, rate of molecular evolution and gene expression pattern revealed common occurrences of subfunctionalization and neofunctionalization in BrSDGs. In comparison with Arabidopsis thaliana, the BrSDG gene family was found to be more divergent than AtSDGs, which might partly explain the rich variety of morphotypes in B. rapa. In addition, a new evolutionary pattern of the four main groups of SDGs was presented, in which the Trx group and the SUVR subgroup evolved faster than the E(z), Ash groups and the SUVH subgroup. These differences in evolutionary rate among the four main groups of SDGs are perhaps due to the complexity and variability of the regions that bind with biomacromolecules, which guide SDGs to their target loci.

  2. [Genome-wide identification and bioinformatic analysis of PPR gene family in tomato].

    Science.gov (United States)

    Ding, Anming; Li, Ling; Qu, Xu; Sun, Tingting; Chen, Yaqiong; Zong, Peng; Li, Zunqiang; Gong, Daping; Sun, Yuhe

    2014-01-01

    Pentatricopeptide repeats (PPRs) genes constitute one of the largest gene families in plants, which play a broad and essential role in plant growth and development. In this study, the protein sequences annotated by the tomato (S. lycopersicum L.) genome project were screened with the Pfam PPR sequences. A total of 471 putative PPR-encoding genes were identified. Based on the motifs defined in A. thaliana L., protein structure and conserved sequences for each tomato motif were analyzed. We also analyzed phylogenetic relationship, subcellular localization, expression and GO analysis of the identified gene sequences. Our results demonstrate that tomato PPR gene family contains two subfamilies, P and PLS, each accounting for half of the family. PLS subfamily can be divided into four subclasses i.e., PLS, E, E+ and DYW. Each subclass of sequences forms a clade in the phylogenetic tree. The PPR motifs were found highly conserved among plants. The tomato PPR genes were distributed over 12 chromosomes and most of them lack introns. The majority of PPR proteins harbor mitochondrial or chloroplast localization sequences, whereas GO analysis showed that most PPR proteins participate in RNA-related biological processes.

  3. Rapid expansion of the protein disulfide isomerase gene family facilitates the folding of venom peptides

    DEFF Research Database (Denmark)

    Safavi-Hemami, Helena; Li, Qing; Jackson, Ronneshia L.

    2016-01-01

    Formation of correct disulfide bonds in the endoplasmic reticulum is a crucial step for folding proteins destined for secretion. Protein disulfide isomerases (PDIs) play a central role in this process. We report a previously unidentified, hypervariable family of PDIs that represents the most...... diverse gene family of oxidoreductases described in a single genus to date. These enzymes are highly expressed specifically in the venom glands of predatory cone snails, animals that synthesize a remarkably diverse set of cysteine-rich peptide toxins (conotoxins). Enzymes in this PDI family, termed...

  4. The nuclear IκB family of proteins controls gene regulation and immune homeostasis.

    Science.gov (United States)

    MaruYama, Takashi

    2015-10-01

    The inhibitory IκB family of proteins is subdivided into two groups based on protein localization in the cytoplasm or in the nucleus. These proteins interact with NF-κB, a major transcription factor regulating the expression of many inflammatory cytokines, by modulating its transcriptional activity. However, nuclear IκB family proteins not only interact with NF-κB to change its transcriptional activity, but they also bind to chromatin and control gene expression. This review provides an overview of nuclear IκB family proteins and their role in immune homeostasis. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Sub-grouping of Plasmodium falciparum 3D7 var genes based on sequence analysis of coding and non-coding regions

    DEFF Research Database (Denmark)

    Lavstsen, Thomas; Salanti, Ali; Jensen, Anja T R

    2003-01-01

    and organization of the 3D7 PfEMP1 repertoire was investigated on the basis of the complete genome sequence. METHODS: Using two tree-building methods we analysed the coding and non-coding sequences of 3D7 var and rif genes as well as var genes of other parasite strains. RESULTS: var genes can be sub...

  6. Comparative genomic analysis of the WRKY III gene family in populus, grape, arabidopsis and rice.

    Science.gov (United States)

    Wang, Yiyi; Feng, Lin; Zhu, Yuxin; Li, Yuan; Yan, Hanwei; Xiang, Yan

    2015-09-08

    WRKY III genes have significant functions in regulating plant development and resistance. In plant, WRKY gene family has been studied in many species, however, there still lack a comprehensive analysis of WRKY III genes in the woody plant species poplar, three representative lineages of flowering plant species are incorporated in most analyses: Arabidopsis (a model plant for annual herbaceous dicots), grape (one model plant for perennial dicots) and Oryza sativa (a model plant for monocots). In this study, we identified 10, 6, 13 and 28 WRKY III genes in the genomes of Populus trichocarpa, grape (Vitis vinifera), Arabidopsis thaliana and rice (Oryza sativa), respectively. Phylogenetic analysis revealed that the WRKY III proteins could be divided into four clades. By microsynteny analysis, we found that the duplicated regions were more conserved between poplar and grape than Arabidopsis or rice. We dated their duplications by Ks analysis of Populus WRKY III genes and demonstrated that all the blocks were formed after the divergence of monocots and dicots. Strong purifying selection has played a key role in the maintenance of WRKY III genes in Populus. Tissue expression analysis of the WRKY III genes in Populus revealed that five were most highly expressed in the xylem. We also performed quantitative real-time reverse transcription PCR analysis of WRKY III genes in Populus treated with salicylic acid, abscisic acid and polyethylene glycol to explore their stress-related expression patterns. This study highlighted the duplication and diversification of the WRKY III gene family in Populus and provided a comprehensive analysis of this gene family in the Populus genome. Our results indicated that the majority of WRKY III genes of Populus was expanded by large-scale gene duplication. The expression pattern of PtrWRKYIII gene identified that these genes play important roles in the xylem during poplar growth and development, and may play crucial role in defense to drought

  7. Gene Environment Interactions and Predictors of Colorectal Cancer in Family-Based, Multi-Ethnic Groups

    Directory of Open Access Journals (Sweden)

    S. Pamela K. Shiao

    2018-02-01

    Full Text Available For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene–environment interactions and predictors of colorectal cancer (CRC by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black. We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls (p < 0.05, on MTHFR C677T, MTR A2756G, MTRR A66G, and DHFR 19 bp except MTHFR A1298C. Four racial groups presented different polymorphism rates for four genes (all p < 0.05 except MTHFR A1298C. Following the ensemble method, the most influential factors were identified, and the best predictive models were generated by using the generalized regression models, with Akaike’s information criterion and leave-one-out cross validation methods. Body mass index (BMI and gender were consistent predictors of CRC for both models when individual genes versus total polymorphism counts were used, and alcohol use was interactive with BMI status. Body mass index status was also interactive with both gender and MTHFR C677T gene polymorphism, and the exposure to environmental pollutants was an additional predictor. These results point to the important roles of environmental and modifiable factors in relation to gene–environment interactions in the prevention of CRC.

  8. Genome-wide identification and expression analysis of the WRKY gene family in cassava

    Directory of Open Access Journals (Sweden)

    Yunxie eWei

    2016-02-01

    Full Text Available The WRKY family, a large family of transcription factors (TFs found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta. In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing 3 exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.

  9. Genome-Wide Identification and Expression Analysis of the WRKY Gene Family in Cassava.

    Science.gov (United States)

    Wei, Yunxie; Shi, Haitao; Xia, Zhiqiang; Tie, Weiwei; Ding, Zehong; Yan, Yan; Wang, Wenquan; Hu, Wei; Li, Kaimian

    2016-01-01

    The WRKY family, a large family of transcription factors (TFs) found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta). In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing three exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.

  10. Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Qing-lin [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Xu, Jia [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Zhang, Zeng [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); He, Jin-wei [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Lu, Lian-song [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Fu, Wen-zhen [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Zhang, Zhen-lin, E-mail: zzl2002@medmail.com.cn [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China)

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. Black-Right-Pointing-Pointer We identified three novel PHEX gene mutations in four unrelated families with XLH. Black-Right-Pointing-Pointer We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. Black-Right-Pointing-Pointer We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.

  11. Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

    International Nuclear Information System (INIS)

    Kang, Qing-lin; Xu, Jia; Zhang, Zeng; He, Jin-wei; Lu, Lian-song; Fu, Wen-zhen; Zhang, Zhen-lin

    2012-01-01

    Highlights: ► In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. ► We identified three novel PHEX gene mutations in four unrelated families with XLH. ► We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. ► We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.

  12. Comprehensive Genomic Identification and Expression Analysis of the Phosphate Transporter (PHT) Gene Family in Apple.

    Science.gov (United States)

    Sun, Tingting; Li, Mingjun; Shao, Yun; Yu, Lingyan; Ma, Fengwang

    2017-01-01

    Elemental phosphorus (Pi) is essential to plant growth and development. The family of phosphate transporters (PHTs) mediates the uptake and translocation of Pi inside the plants. Members include five sub-cellular phosphate transporters that play different roles in Pi uptake and transport. We searched the Genome Database for Rosaceae and identified five clusters of phosphate transporters in apple ( Malus domestica ), including 37 putative genes. The MdPHT1 family contains 14 genes while MdPHT2 has two, MdPHT3 has seven, MdPHT4 has 11, and MdPHT5 has three. Our overview of this gene family focused on structure, chromosomal distribution and localization, phylogenies, and motifs. These genes displayed differential expression patterns in various tissues. For example, expression was high for MdPHT1;12, MdPHT3;6 , and MdPHT3;7 in the roots, and was also increased in response to low-phosphorus conditions. In contrast, MdPHT4;1, MdPHT4;4 , and MdPHT4;10 were expressed only in the leaves while transcript levels of MdPHT1;4, MdPHT1;12 , and MdPHT5;3 were highest in flowers. In general, these 37 genes were regulated significantly in either roots or leaves in response to the imposition of phosphorus and/or drought stress. The results suggest that members of the PHT family function in plant adaptations to adverse growing environments. Our study will lay a foundation for better understanding the PHT family evolution and exploring genes of interest for genetic improvement in apple.

  13. Novel mutations in Norrie disease gene in Japanese patients with Norrie disease and familial exudative vitreoretinopathy.

    Science.gov (United States)

    Kondo, Hiroyuki; Qin, Minghui; Kusaka, Shunji; Tahira, Tomoko; Hasebe, Haruyuki; Hayashi, Hideyuki; Uchio, Eiichi; Hayashi, Kenshi

    2007-03-01

    To search for mutations in the Norrie disease gene (NDP) in Japanese patients with familial exudative vitreoretinopathy (FEVR) and Norrie disease (ND) and to delineate the mutation-associated clinical features. Direct sequencing after polymerase chain reaction of all exons of the NDP gene was performed on blood collected from 62 probands (31 familial and 31 simplex) with FEVR, from 3 probands with ND, and from some of their family members. The clinical symptoms and signs in the patients with mutations were assessed. X-inactivation in the female carriers was examined in three FEVR families by using leukocyte DNA. Four novel mutations-I18K, K54N, R115L, and IVS2-1G-->A-and one reported mutation, R97P, in the NDP gene were identified in six families. The severity of vitreoretinopathy varied among these patients. Three probands with either K54N or R115L had typical features of FEVR, whereas the proband with R97P had those of ND. Families with IVS2-1G-->A exhibited either ND or FEVR characteristics. A proband with I18K presented with significant phenotypic heterogeneity between the two eyes. In addition, affected female carriers in a family harboring the K54N mutation presented with different degrees of vascular abnormalities in the periphery of the retina. X-inactivation profiles indicated that the skewing was not significantly different between affected and unaffected women. These observations indicate that mutations of the NDP gene can cause ND and 6% of FEVR cases in the Japanese population. The X-inactivation assay with leukocytes may not be predictive of the presence of a mutation in affected female carriers.

  14. Evidence for in vitro and in vivo expression of the conserved VAR3 (type 3) plasmodium falciparum erythrocyte membrane protein 1

    DEFF Research Database (Denmark)

    Wang, Christian W; Lavstsen, Thomas; Bengtsson, Dominique C

    2012-01-01

    ABSTRACT: BACKGROUND: Members of the Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) adhesion antigen family are major contributors to the pathogenesis of P. falciparum malaria infections. The PfEMP1-encoding var genes are among the most diverse sequences in nature, but three genes......, var1, var2csa and var3 are found conserved in most parasite genomes. The most severe forms of malaria disease are caused by parasites expressing a subset of antigenically conserved PfEMP1 variants. Thus the ubiquitous and conserved VAR3 PfEMP1 is of particular interest to the research field. Evidence...... of VAR3 expression on the infected erythrocyte surface has never been presented, and var3 genes have been proposed to be transcribed and expressed differently from the rest of the var gene family members. METHODS: In this study, parasites expressing VAR3 PfEMP1 were generated using anti-VAR3 antibodies...

  15. Genomic sequence and organization of two members of a human lectin gene family

    International Nuclear Information System (INIS)

    Gitt, M.A.; Barondes, S.H.

    1991-01-01

    The authors have isolated and sequenced the genomic DNA encoding a human dimeric soluble lactose-binding lectin. The gene has four exons, and its upstream region contains sequences that suggest control by glucocorticoids, heat (environmental) shock, metals, and other factors. They have also isolated and sequenced three exons of the gene encoding another human putative lectin, the existence of which was first indicated by isolation of its cDNA. Comparisons suggest a general pattern of genomic organization of members of this lectin gene family

  16. Evolutionary Relationship and Structural Characterization of the EPF/EPFL Gene Family

    OpenAIRE

    Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu

    2013-01-01

    EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that...

  17. Exome sequencing of Pakistani consanguineous families identifies 30 novel candidate genes for recessive intellectual disability.

    Science.gov (United States)

    Riazuddin, S; Hussain, M; Razzaq, A; Iqbal, Z; Shahzad, M; Polla, D L; Song, Y; van Beusekom, E; Khan, A A; Tomas-Roca, L; Rashid, M; Zahoor, M Y; Wissink-Lindhout, W M; Basra, M A R; Ansar, M; Agha, Z; van Heeswijk, K; Rasheed, F; Van de Vorst, M; Veltman, J A; Gilissen, C; Akram, J; Kleefstra, T; Assir, M Z; Grozeva, D; Carss, K; Raymond, F L; O'Connor, T D; Riazuddin, S A; Khan, S N; Ahmed, Z M; de Brouwer, A P M; van Bokhoven, H; Riazuddin, S

    2017-11-01

    Intellectual disability (ID) is a clinically and genetically heterogeneous disorder, affecting 1-3% of the general population. Although research into the genetic causes of ID has recently gained momentum, identification of pathogenic mutations that cause autosomal recessive ID (ARID) has lagged behind, predominantly due to non-availability of sizeable families. Here we present the results of exome sequencing in 121 large consanguineous Pakistani ID families. In 60 families, we identified homozygous or compound heterozygous DNA variants in a single gene, 30 affecting reported ID genes and 30 affecting novel candidate ID genes. Potential pathogenicity of these alleles was supported by co-segregation with the phenotype, low frequency in control populations and the application of stringent bioinformatics analyses. In another eight families segregation of multiple pathogenic variants was observed, affecting 19 genes that were either known or are novel candidates for ID. Transcriptome profiles of normal human brain tissues showed that the novel candidate ID genes formed a network significantly enriched for transcriptional co-expression (P<0.0001) in the frontal cortex during fetal development and in the temporal-parietal and sub-cortex during infancy through adulthood. In addition, proteins encoded by 12 novel ID genes directly interact with previously reported ID proteins in six known pathways essential for cognitive function (P<0.0001). These results suggest that disruptions of temporal parietal and sub-cortical neurogenesis during infancy are critical to the pathophysiology of ID. These findings further expand the existing repertoire of genes involved in ARID, and provide new insights into the molecular mechanisms and the transcriptome map of ID.

  18. Whole genome duplications and expansion of the vertebrate GATA transcription factor gene family

    Directory of Open Access Journals (Sweden)

    Bowerman Bruce

    2009-08-01

    Full Text Available Abstract Background GATA transcription factors influence many developmental processes, including the specification of embryonic germ layers. The GATA gene family has significantly expanded in many animal lineages: whereas diverse cnidarians have only one GATA transcription factor, six GATA genes have been identified in many vertebrates, five in many insects, and eleven to thirteen in Caenorhabditis nematodes. All bilaterian animal genomes have at least one member each of two classes, GATA123 and GATA456. Results We have identified one GATA123 gene and one GATA456 gene from the genomic sequence of two invertebrate deuterostomes, a cephalochordate (Branchiostoma floridae and a hemichordate (Saccoglossus kowalevskii. We also have confirmed the presence of six GATA genes in all vertebrate genomes, as well as additional GATA genes in teleost fish. Analyses of conserved sequence motifs and of changes to the exon-intron structure, and molecular phylogenetic analyses of these deuterostome GATA genes support their origin from two ancestral deuterostome genes, one GATA 123 and one GATA456. Comparison of the conserved genomic organization across vertebrates identified eighteen paralogous gene families linked to multiple vertebrate GATA genes (GATA paralogons, providing the strongest evidence yet for expansion of vertebrate GATA gene families via genome duplication events. Conclusion From our analysis, we infer the evolutionary birth order and relationships among vertebrate GATA transcription factors, and define their expansion via multiple rounds of whole genome duplication events. As the genomes of four independent invertebrate deuterostome lineages contain single copy GATA123 and GATA456 genes, we infer that the 0R (pre-genome duplication invertebrate deuterostome ancestor also had two GATA genes, one of each class. Synteny analyses identify duplications of paralogous chromosomal regions (paralogons, from single ancestral vertebrate GATA123 and GATA456

  19. Gene Structures, Evolution, Classification and Expression Profiles of the Aquaporin Gene Family in Castor Bean (Ricinus communis L..

    Directory of Open Access Journals (Sweden)

    Zhi Zou

    Full Text Available Aquaporins (AQPs are a class of integral membrane proteins that facilitate the passive transport of water and other small solutes across biological membranes. Castor bean (Ricinus communis L., Euphobiaceae, an important non-edible oilseed crop, is widely cultivated for industrial, medicinal and cosmetic purposes. Its recently available genome provides an opportunity to analyze specific gene families. In this study, a total of 37 full-length AQP genes were identified from the castor bean genome, which were assigned to five subfamilies, including 10 plasma membrane intrinsic proteins (PIPs, 9 tonoplast intrinsic proteins (TIPs, 8 NOD26-like intrinsic proteins (NIPs, 6 X intrinsic proteins (XIPs and 4 small basic intrinsic proteins (SIPs on the basis of sequence similarities. Functional prediction based on the analysis of the aromatic/arginine (ar/R selectivity filter, Froger's positions and specificity-determining positions (SDPs showed a remarkable difference in substrate specificity among subfamilies. Homology analysis supported the expression of all 37 RcAQP genes in at least one of examined tissues, e.g., root, leaf, flower, seed and endosperm. Furthermore, global expression profiles with deep transcriptome sequencing data revealed diverse expression patterns among various tissues. The current study presents the first genome-wide analysis of the AQP gene family in castor bean. Results obtained from this study provide valuable information for future functional analysis and utilization.

  20. Childhood temperament: passive gene-environment correlation, gene-environment interaction, and the hidden importance of the family environment.

    Science.gov (United States)

    Lemery-Chalfant, Kathryn; Kao, Karen; Swann, Gregory; Goldsmith, H Hill

    2013-02-01

    Biological parents pass on genotypes to their children, as well as provide home environments that correlate with their genotypes; thus, the association between the home environment and children's temperament can be genetically (i.e., passive gene-environment correlation) or environmentally mediated. Furthermore, family environments may suppress or facilitate the heritability of children's temperament (i.e., gene-environment interaction). The sample comprised 807 twin pairs (mean age = 7.93 years) from the longitudinal Wisconsin Twin Project. Important passive gene-environment correlations emerged, such that home environments were less chaotic for children with high effortful control, and this association was genetically mediated. Children with high extraversion/surgency experienced more chaotic home environments, and this correlation was also genetically mediated. In addition, heritability of children's temperament was moderated by home environments, such that effortful control and extraversion/surgency were more heritable in chaotic homes, and negative affectivity was more heritable under crowded or unsafe home conditions. Modeling multiple types of gene-environment interplay uncovered the complex role of genetic factors and the hidden importance of the family environment for children's temperament and development more generally.

  1. Members of the barley NAC transcription factor gene family show differential co-regulation with senescence-associated genes during senescence of flag leaves

    DEFF Research Database (Denmark)

    Christiansen, Michael W; Gregersen, Per L.

    2014-01-01

    -expressed with members of the NAC gene family. In conclusion, a list of up to 15 NAC genes from barley that are strong candidates for being regulatory factors of importance for senescence and biotic stress-related traits affecting the productivity of cereal crop plants has been generated. Furthermore, a list of 71...... in the NAC transcription factor family during senescence of barley flag leaves was studied. Several members of the NAC transcription factor gene family were up-regulated during senescence in a microarray experiment, together with a large range of senescence-associated genes, reflecting the coordinated...... activation of degradation processes in senescing barley leaf tissues. This picture was confirmed in a detailed quantitative reverse transcription–PCR (qRT–PCR) experiment, which also showed distinct gene expression patterns for different members of the NAC gene family, suggesting a group of ~15 out of the 47...

  2. Increased pfmdr1 gene copy number and the decline in pfcrt and pfmdr1 resistance alleles in Ghanaian Plasmodium falciparum isolates after the change of anti-malarial drug treatment policy.

    Science.gov (United States)

    Duah, Nancy O; Matrevi, Sena A; de Souza, Dziedzom K; Binnah, Daniel D; Tamakloe, Mary M; Opoku, Vera S; Onwona, Christiana O; Narh, Charles A; Quashie, Neils B; Abuaku, Benjamin; Duplessis, Christopher; Kronmann, Karl C; Koram, Kwadwo A

    2013-10-30

    With the introduction of artemisinin-based combination therapy (ACT) in 2005, monitoring of anti-malarial drug efficacy, which includes the use of molecular tools to detect known genetic markers of parasite resistance, is important for first-hand information on the changes in parasite susceptibility to drugs in Ghana. This study investigated the Plasmodium falciparum multidrug resistance gene (pfmdr1) copy number, mutations and the chloroquine resistance transporter gene (pfcrt) mutations in Ghanaian isolates collected in seven years to detect the trends in prevalence of mutations. Archived filter paper blood blots collected from children aged below five years with uncomplicated malaria in 2003-2010 at sentinel sites were used. Using quantitative real-time polymerase chain reaction (qRT-PCR), 756 samples were assessed for pfmdr1 gene copy number. PCR and restriction fragment length polymorphism (RFLP) were used to detect alleles of pfmdr1 86 in 1,102 samples, pfmdr1 184, 1034, 1042 and 1246 in 832 samples and pfcrt 76 in 1,063 samples. Merozoite surface protein 2 (msp2) genotyping was done to select monoclonal infections for copy number analysis. The percentage of isolates with increased pfmdr1 copy number were 4, 27, 9, and 18% for 2003-04, 2005-06, 2007-08 and 2010, respectively. Significant increasing trends for prevalence of pfmdr1 N86 (×(2) = 96.31, p resistance has been reported. The decreasing trend in the prevalence of chloroquine resistance markers after change of treatment policy presents the possibility for future introduction of chloroquine as prophylaxis for malaria risk groups such as children and pregnant women in Ghana.

  3. Dhfr and dhps mutations in Plasmodium falciparum isolates in ...

    African Journals Online (AJOL)

    Sulfadoxine-pyrimethamine (SP), the current first line antimalarial drug in Tanzania, is compromised by evolution and spread of mutations in the parasite's dhfr and dhps genes. In the present study we established the baseline frequencies of Plasmodium falciparum dihydrofolate reductase (pfdhfr) and dihydropteroate ...

  4. Genome-wide analysis of the GRAS gene family in physic nut (Jatropha curcas L.).

    Science.gov (United States)

    Wu, Z Y; Wu, P Z; Chen, Y P; Li, M R; Wu, G J; Jiang, H W

    2015-12-29

    GRAS proteins play vital roles in plant growth and development. Physic nut (Jatropha curcas L.) was found to have a total of 48 GRAS family members (JcGRAS), 15 more than those found in Arabidopsis. The JcGRAS genes were divided into 12 subfamilies or 15 ancient monophyletic lineages based on the phylogenetic analysis of GRAS proteins from both flowering and lower plants. The functions of GRAS genes in 9 subfamilies have been reported previously for several plants, while the genes in the remaining 3 subfamilies were of unknown function; we named the latter families U1 to U3. No member of U3 subfamily is present in Arabidopsis and Poaceae species according to public genome sequence data. In comparison with the number of GRAS genes in Arabidopsis, more were detected in physic nut, resulting from the retention of many ancient GRAS subfamilies and the formation of tandem repeats during evolution. No evidence of recent duplication among JcGRAS genes was observed in physic nut. Based on digital gene expression data, 21 of the 48 genes exhibited differential expression in four tissues analyzed. Two members of subfamily U3 were expressed only in buds and flowers, implying that they may play specific roles. Our results provide valuable resources for future studies on the functions of GRAS proteins in physic nut.

  5. Characterization and expression of the cytochrome P450 gene family in diamondback moth, Plutella xylostella (L.).

    Science.gov (United States)

    Yu, Liying; Tang, Weiqi; He, Weiyi; Ma, Xiaoli; Vasseur, Liette; Baxter, Simon W; Yang, Guang; Huang, Shiguo; Song, Fengqin; You, Minsheng

    2015-03-10

    Cytochrome P450 monooxygenases are present in almost all organisms and can play vital roles in hormone regulation, metabolism of xenobiotics and in biosynthesis or inactivation of endogenous compounds. In the present study, a genome-wide approach was used to identify and analyze the P450 gene family of diamondback moth, Plutella xylostella, a destructive worldwide pest of cruciferous crops. We identified 85 putative cytochrome P450 genes from the P. xylostella genome, including 84 functional genes and 1 pseudogene. These genes were classified into 26 families and 52 subfamilies. A phylogenetic tree constructed with three additional insect species shows extensive gene expansions of P. xylostella P450 genes from clans 3 and 4. Gene expression of cytochrome P450s was quantified across multiple developmental stages (egg, larva, pupa and adult) and tissues (head and midgut) using P. xylostella strains susceptible or resistant to insecticides chlorpyrifos and fiprinol. Expression of the lepidopteran specific CYP367s predominantly occurred in head tissue suggesting a role in either olfaction or detoxification. CYP340s with abundant transposable elements and relatively high expression in the midgut probably contribute to the detoxification of insecticides or plant toxins in P. xylostella. This study will facilitate future functional studies of the P. xylostella P450s in detoxification.

  6. Positive selection in the SLC11A1 gene in the family Equidae.

    Science.gov (United States)

    Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan; Orlando, Ludovic; Horin, Petr

    2016-05-01

    Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence identity across the family. Single nucleotide polymorphisms (SNPs) were found in the coding and noncoding regions of the gene. Seven codon sites were identified to be under strong purifying selection. Codons located in three regions, including the glycosylated extracellular loop, were shown to be under diversifying selection. A 3-bp indel resulting in a deletion of the amino acid 321 in the predicted protein was observed in all horses, while it has been maintained in all other equid species. This codon comprised in an N-glycosylation site was found to be under positive selection. Interspecific variation in the presence of predicted N-glycosylation sites was observed.

  7. Identification of Candidate Gene Variants in Korean MODY Families by Whole-Exome Sequencing.

    Science.gov (United States)

    Shim, Ye Jee; Kim, Jung Eun; Hwang, Su-Kyeong; Choi, Bong Seok; Choi, Byung Ho; Cho, Eun-Mi; Jang, Kyoung Mi; Ko, Cheol Woo

    2015-01-01

    To date, 13 genes causing maturity-onset diabetes of the young (MODY) have been identified. However, there is a big discrepancy in the genetic locus between Asian and Caucasian patients with MODY. Thus, we conducted whole-exome sequencing in Korean MODY families to identify causative gene variants. Six MODY probands and their family members were included. Variants in the dbSNP135 and TIARA databases for Koreans and the variants with minor allele frequencies >0.5% of the 1000 Genomes database were excluded. We selected only the functional variants (gain of stop codon, frameshifts and nonsynonymous single-nucleotide variants) and conducted a case-control comparison in the family members. The selected variants were scanned for the previously introduced gene set implicated in glucose metabolism. Three variants c.620C>T:p.Thr207Ile in PTPRD, c.559C>G:p.Gln187Glu in SYT9, and c.1526T>G:p.Val509Gly in WFS1 were respectively identified in 3 families. We could not find any disease-causative alleles of known MODY 1-13 genes. Based on the predictive program, Thr207Ile in PTPRD was considered pathogenic. Whole-exome sequencing is a valuable method for the genetic diagnosis of MODY. Further evaluation is necessary about the role of PTPRD, SYT9 and WFS1 in normal insulin release from pancreatic beta cells. © 2015 S. Karger AG, Basel.

  8. Novel glucokinase gene mutation in the first Macedonian family tested for MODY.

    Science.gov (United States)

    Kocova, M; Elblova, L; Pruhova, S; Lebl, J; Dusatkova, P

    2017-08-01

    We present a boy with mild hyperglycemia detected during an upper respiratory infection. Novel splicing mutation in the intron 1 of the GCK gene (c.45+1G>A) was detected, and was subsequently confirmed in his father. This is the first case of genetically confirmed Macedonian family with MODY. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. [The mutation analysis of PAH gene and prenatal diagnosis in classical phenylketonuria family].

    Science.gov (United States)

    Yan, Yousheng; Hao, Shengju; Yao, Fengxia; Sun, Qingmei; Zheng, Lei; Zhang, Qinghua; Zhang, Chuan; Yang, Tao; Huang, Shangzhi

    2014-12-01

    To characterize the mutation spectrum of phenylalanine hydroxylase (PAH) gene and perform prenatal diagnosis for families with classical phenylketonuria. By stratified sequencing, mutations were detected in the exons and flaking introns of PAH gene of 44 families with classical phenylketonuria. 47 fetuses were diagnosed by combined sequencing with linkage analysis of three common short tandem repeats (STR) (PAH-STR, PAH-26 and PAH-32) in the PAH gene. Thirty-one types of mutations were identified. A total of 84 mutations were identified in 88 alleles (95.45%), in which the most common mutation have been R243Q (21.59%), EX6-96A>G (6.82%), IVS4-1G>A (5.86%) and IVS7+2T>A (5.86%). Most mutations were found in exons 3, 5, 6, 7, 11 and 12. The polymorphism information content (PIC) of these three STR markers was 0.71 (PAH-STR), 0.48 (PAH-26) and 0.40 (PAH-32), respectively. Prenatal diagnosis was performed successfully with the combined method in 47 fetuses of 44 classical phenylketonuria families. Among them, 11 (23.4%) were diagnosed as affected, 24 (51.1%) as carriers, and 12 (25.5%) as unaffected. Prenatal diagnosis can be achieved efficiently and accurately by stratified sequencing of PAH gene and linkage analysis of STR for classical phenylketonuria families.

  10. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  11. The role of retrotransposons in gene family expansions in the human and mouse genomes

    Czech Academy of Sciences Publication Activity Database

    Janoušek, Václav; Laukaitis, C. M.; Yanchukov, Alexey; Karn, R. C.

    2016-01-01

    Roč. 8, č. 9 (2016), s. 2632-2650 ISSN 1759-6653 R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 Keywords : gene families * transposable elements * retrotransposons * LINE * LTR * SINE Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.979, year: 2016

  12. Identification of the 14-3-3 gene family in Rafflesia cantleyi

    Science.gov (United States)

    Rosli, Khadijah; Wan, Kiew-Lian

    2018-04-01

    Rafflesia is known to be the largest flower in the world. Due to its size and appearance, it is considered to be very unique. Little is known about the molecular biology of this rare parasitic flowering plant as it is very difficult to locate and has a short life-span as a flower. Physiological activities in plants are regulated by signalling regulators such as the members of the 14-3-3 gene family. The number of members of this gene family varies in plants and there are thirteen known members in Arabidopsis thaliana. Their role is to bind to phosphorylated targets to complete signal transduction processes. Sequence comparison using BLAST of transcriptome data from three different Rafflesia cantleyi floral bud stages against the Swissprot database revealed 27 transcripts annotated as members of this gene family. All of the transcripts were expressed during floral bud stage 1 (S1) while 14 and four transcripts were expressed during floral bud stages 2 (S2) and 3 (S3), respectively. Significant downregulation was recorded for six and nine transcripts at S1 vs. S2 and S2 vs. S3 respectively. This gene family may play a critical role as signalling regulators during the development of Rafflesia floral bud.

  13. [Analysis of USH2A gene mutation in a Chinese family affected with Usher syndrome].

    Science.gov (United States)

    Li, Pengcheng; Liu, Fei; Zhang, Mingchang; Wang, Qiufen; Liu, Mugen

    2015-08-01

    To investigate the disease-causing mutation in a Chinese family affected with Usher syndrome type II. All of the 11 members from the family underwent comprehensive ophthalmologic examination and hearing test, and their genomic DNA were isolated from venous leukocytes. PCR and direct sequencing of USH2A gene were performed for the proband. Wild type and mutant type minigene vectors containing exon 42, intron 42 and exon 43 of the USH2A gene were constructed and transfected into Hela cells by lipofectamine reagent. Reverse transcription (RT)-PCR was carried out to verify the splicing of the minigenes. Pedigree analysis and clinical diagnosis indicated that the patients have suffered from autosomal recessive Usher syndrome type II. DNA sequencing has detected a homozygous c.8559-2A>G mutation of the USH2A gene in the proband, which has co-segregated with the disease in the family. The mutation has affected a conserved splice site in intron 42, which has led to inactivation of the splice site. Minigene experiment has confirmed the retaining of intron 42 in mature mRNA. The c.8559-2A>G mutation in the USH2A gene probably underlies the Usher syndrome type II in this family. The splice site mutation has resulted in abnormal splicing of USH2A pre-mRNA.

  14. [Gene mutation analysis and prenatal diagnosis of a family with Bartter syndrome].

    Science.gov (United States)

    Li, Long; Ma, Na; Li, Xiu-Rong; Gong, Fei; DU, Juan

    2016-08-01

    To investigate the mutation of related genes and prenatal diagnosis of a family with Bartter syndrome (BS). The high-throughput capture sequencing technique and PCR-Sanger sequencing were used to detect pathogenic genes in the proband of this family and analyze the whole family at the genomic level. After the genetic cause was clarified, the amniotic fluid was collected from the proband's mother who was pregnant for 5 months for prenatal diagnosis. The proband carried compound heterozygous mutations of c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene; c.88C>T(p.Arg30*) had been reported as a pathogenic mutation, and c.968+2T>A was a new mutation. Pedigree analysis showed that the two mutations were inherited from the mother and father, respectively. Prenatal diagnosis showed that the fetus did not inherit the mutations from parents and had no mutations at the two loci. The follow-up visit confirmed that the infant was in a healthy state, which proved the accuracy of genetic diagnosis and prenatal diagnosis. The compound heterozygous mutations c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene are the cause of BS in the proband, and prenatal diagnosis can prevent the risk of recurrence of BS in this family.

  15. A novel AVP gene mutation in a Turkish family with neurohypophyseal diabetes insipidus.

    Science.gov (United States)

    Ilhan, M; Tiryakioglu, N O; Karaman, O; Coskunpinar, E; Yildiz, R S; Turgut, S; Tiryakioglu, D; Toprak, H; Tasan, E

    2016-03-01

    Familial neurohypophyseal diabetes insipidus (FNDI) is a rare, autosomal dominant, inherited disorder which is characterized by severe polydipsia and polyuria generally presenting in early childhood. In the present study, we aimed to analyze the AVP gene in a Turkish family with FNDI. Four patients with neurohypophyseal diabetes insipidus and ten healthy members of the family were studied. Diabetes insipidus was diagnosed by the water deprivation test in affected family members. Mutation analysis was performed by sequencing the whole coding region of AVP-NPII gene using DNA isolated from peripheral blood samples. Urine osmolality was low (C in all patients. c.-3A>C mutation in 5'UTR of AVP gene in this family might lead to the truncation of signal peptide, aggregation of AVP in the cytoplasm instead of targeting in the endoplasmic reticulum, thereby could disrupt AVP secretion without causing neuronal cytotoxicity, which might explain the presence of bright spot. The predicted effect of this mutation should be investigated by further in vitro molecular studies.

  16. Familial Dilated Cardiomyopathy Caused by a Novel Frameshift in the BAG3 Gene.

    Directory of Open Access Journals (Sweden)

    Rocio Toro

    Full Text Available Dilated cardiomyopathy, a major cause of chronic heart failure and cardiac transplantation, is characterized by left ventricular or biventricular heart dilatation. In nearly 50% of cases the pathology is inherited, and more than 60 genes have been reported as disease-causing. However, in 30% of familial cases the mutation remains unidentified even after comprehensive genetic analysis. This study clinically and genetically assessed a large Spanish family affected by dilated cardiomyopathy to search for novel variations.Our study included a total of 100 family members. Clinical assessment was performed in alive, and genetic analysis was also performed in alive and 1 deceased relative. Genetic screening included resequencing of 55 genes associated with sudden cardiac death, and Sanger sequencing of main disease-associated genes. Genetic analysis identified a frame-shift variation in BAG3 (p.H243Tfr*64 in 32 patients. Genotype-phenotype correlation identified substantial heterogeneity in disease expression. Of 32 genetic carriers (one deceased, 21 relatives were clinically affected, and 10 were asymptomatic. Seventeen of the symptomatic genetic carriers exhibited proto-diastolic septal knock by echocardiographic assessment.We report p.H243Tfr*64_BAG3 as a novel pathogenic variation responsible for familial dilated cardiomyopathy. This variation correlates with a more severe phenotype of the disease, mainly in younger individuals. Genetic analysis in families, even asymptomatic individuals, enables early identification of individuals at risk and allows implementation of preventive measures.

  17. The SKP1-like gene family of Arabidopsis exhibits a high degree of differential gene expression and gene product interaction during development.

    Directory of Open Access Journals (Sweden)

    Mohammad H Dezfulian

    Full Text Available The Arabidopsis thaliana genome encodes several families of polypeptides that are known or predicted to participate in the formation of the SCF-class of E3-ubiquitin ligase complexes. One such gene family encodes the Skp1-like class of polypeptide subunits, where 21 genes have been identified and are known to be expressed in Arabidopsis. Phylogenetic analysis based on deduced polypeptide sequence organizes the family of ASK proteins into 7 clades. The complexity of the ASK gene family, together with the close structural similarity among its members raises the prospect of significant functional redundancy among select paralogs. We have assessed the potential for functional redundancy within the ASK gene family by analyzing an expanded set of criteria that define redundancy with higher resolution. The criteria used include quantitative expression of locus-specific transcripts using qRT-PCR, assessment of the sub-cellular localization of individual ASK:YFP auto-fluorescent fusion proteins expressed in vivo as well as the in planta assessment of individual ASK-F-Box protein interactions using bimolecular fluorescent complementation techniques in combination with confocal imagery in live cells. The results indicate significant functional divergence of steady state transcript abundance and protein-protein interaction specificity involving ASK proteins in a pattern that is poorly predicted by sequence-based phylogeny. The information emerging from this and related studies will prove important for defining the functional intersection of expression, localization and gene product interaction that better predicts the formation of discrete SCF complexes, as a prelude to investigating their molecular mode of action.

  18. Positioning the expanded akirin gene family of Atlantic salmon within the transcriptional networks of myogenesis

    International Nuclear Information System (INIS)

    Macqueen, Daniel J.; Bower, Neil I.; Johnston, Ian A.

    2010-01-01

    Research highlights: → The expanded akirin gene family of Atlantic salmon was characterised. → akirin paralogues are regulated between mono- and multi-nucleated muscle cells. → akirin paralogues positioned within known genetic networks controlling myogenesis. → Co-expression of akirin paralogues is evident across cell types/during myogenesis. → Selection has likely maintained common regulatory elements among akirin paralogues. -- Abstract: Vertebrate akirin genes usually form a family with one-to-three members that regulate gene expression during the innate immune response, carcinogenesis and myogenesis. We recently established that an expanded family of eight akirin genes is conserved across salmonid fish. Here, we measured mRNA levels of the akirin family of Atlantic salmon (Salmo salar L.) during the differentiation of primary myoblasts cultured from fast-skeletal muscle. Using hierarchical clustering and correlation, the data was positioned into a network of expression profiles including twenty further genes that regulate myogenesis. akirin1(2b) was not significantly regulated during the maturation of the cell culture. akirin2(1a) and 2(1b), along with IGF-II and several igfbps, were most highly expressed in mononuclear cells, then significantly and constitutively downregulated as differentiation proceeded and myotubes formed/matured. Conversely, akirin1(1a), 1(1b), 1(2a), 2(2a) and 2(2b) were expressed at lowest levels when mononuclear cells dominated the culture and highest levels when confluent layers of myotubes were evident. However, akirin1(2a) and 2(2a) were first upregulated earlier than akirin1(1a), 1(1b) and 2(2b), when rates of myoblast proliferation were highest. Interestingly, akirin1(1b), 1(2a), 2(2a) and 2(2b) formed part of a module of co-expressed genes involved in muscle differentiation, including myod1a, myog, mef2a, 14-3-3β and 14-3-3γ. All akirin paralogues were expressed ubiquitously across ten tissues, although mRNA levels

  19. Positioning the expanded akirin gene family of Atlantic salmon within the transcriptional networks of myogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Macqueen, Daniel J., E-mail: djm59@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom); Bower, Neil I., E-mail: nib@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom); Johnston, Ian A., E-mail: iaj@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom)

    2010-10-01

    Research highlights: {yields} The expanded akirin gene family of Atlantic salmon was characterised. {yields} akirin paralogues are regulated between mono- and multi-nucleated muscle cells. {yields} akirin paralogues positioned within known genetic networks controlling myogenesis. {yields} Co-expression of akirin paralogues is evident across cell types/during myogenesis. {yields} Selection has likely maintained common regulatory elements among akirin paralogues. -- Abstract: Vertebrate akirin genes usually form a family with one-to-three members that regulate gene expression during the innate immune response, carcinogenesis and myogenesis. We recently established that an expanded family of eight akirin genes is conserved across salmonid fish. Here, we measured mRNA levels of the akirin family of Atlantic salmon (Salmo salar L.) during the differentiation of primary myoblasts cultured from fast-skeletal muscle. Using hierarchical clustering and correlation, the data was positioned into a network of expression profiles including twenty further genes that regulate myogenesis. akirin1(2b) was not significantly regulated during the maturation of the cell culture. akirin2(1a) and 2(1b), along with IGF-II and several igfbps, were most highly expressed in mononuclear cells, then significantly and constitutively downregulated as differentiation proceeded and myotubes formed/matured. Conversely, akirin1(1a), 1(1b), 1(2a), 2(2a) and 2(2b) were expressed at lowest levels when mononuclear cells dominated the culture and highest levels when confluent layers of myotubes were evident. However, akirin1(2a) and 2(2a) were first upregulated earlier than akirin1(1a), 1(1b) and 2(2b), when rates of myoblast proliferation were highest. Interestingly, akirin1(1b), 1(2a), 2(2a) and 2(2b) formed part of a module of co-expressed genes involved in muscle differentiation, including myod1a, myog, mef2a, 14-3-3{beta} and 14-3-3{gamma}. All akirin paralogues were expressed ubiquitously across ten

  20. Genome-Wide Identification and Expression Analysis of WRKY Gene Family in Capsicum annuum L.

    Science.gov (United States)

    Diao, Wei-Ping; Snyder, John C; Wang, Shu-Bin; Liu, Jin-Bing; Pan, Bao-Gui; Guo, Guang-Jun; Wei, Ge

    2016-01-01

    The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators with members regulating multiple biological processes, especially in regulating defense against biotic and abiotic stresses. However, little information is available about WRKYs in pepper (Capsicum annuum L.). The recent release of completely assembled genome sequences of pepper allowed us to perform a genome-wide investigation for pepper WRKY proteins. In the present study, a total of 71 WRKY genes were identified in the pepper genome. According to structural features of their encoded proteins, the pepper WRKY genes (CaWRKY) were classified into three main groups, with the second group further divided into five subgroups. Genome mapping analysis revealed that CaWRKY were enriched on four chromosomes, especially on chromosome 1, and 15.5% of the family members were tandemly duplicated genes. A phylogenetic tree was constructed depending on WRKY domain' sequences derived from pepper and Arabidopsis. The expression of 21 selected CaWRKY genes in response to seven different biotic and abiotic stresses (salt, heat shock, drought, Phytophtora capsici, SA, MeJA, and ABA) was evaluated by quantitative RT-PCR; Some CaWRKYs were highly expressed and up-regulated by stress treatment. Our results will provide a platform for functional identification and molecular breeding studies of WRKY genes in pepper.

  1. Embryonic expression of zebrafish MiT family genes tfe3b, tfeb, and tfec.

    Science.gov (United States)

    Lister, James A; Lane, Brandon M; Nguyen, Anhthu; Lunney, Katherine

    2011-11-01

    The MiT family comprises four genes in mammals: Mitf, Tfe3, Tfeb, and Tfec, which encode transcription factors of the basic-helix-loop-helix/leucine zipper class. Mitf is well-known for its essential role in the development of melanocytes, however the functions of the other members of this family, and of interactions between them, are less well understood. We have now characterized the complete set of MiT genes from zebrafish, which totals six instead of four. The zebrafish genome contain two mitf (mitfa and mitfb), two tfe3 (tfe3a and tfe3b), and single tfeb and tfec genes; this distribution is shared with other teleosts. We present here the sequence and embryonic expression patterns for the zebrafish tfe3b, tfeb, and tfec genes, and identify a new isoform of tfe3a. These findings will assist in elucidating the roles of the MiT gene family over the course of vertebrate evolution. Copyright © 2011 Wiley-Liss, Inc.

  2. Characterization of vNr-13, the first alphaherpesvirus gene of the bcl-2 family

    International Nuclear Information System (INIS)

    Aouacheria, Abdel; Banyai, Michelle; Rigal, Dominique; Schmidt, Carl J.; Gillet, Germain

    2003-01-01

    The Bcl-2 family, including antiapoptotic and proapoptotic members, plays key regulating roles in programmed cell death. We report the characterization of a new member of the bcl-2 family, encoded by herpesvirus of turkeys (HVT). The product of this gene shares 80% homology with Nr-13, an apoptosis inhibitor, which is overexpressed in avian cells transformed by the v-src oncogene. This new gene, that we propose to call vnr-13, is the first member of the bcl-2 family to be isolated among α-herpesviruses. Results from cells expressing the HVT-vnr-13 gene product show that the encoded protein inhibits apoptosis and also reduces the rate of cellular proliferation. Contrary to all bcl-2 homologues found in γ-herpesvirus, which are intronless, vnr-13 has the same organization as the cellular nr-13 gene. Hence, the HVT vnr-13 gene may have been acquired from a reverse transcriptase product of an unspliced precursor RNA, or via direct recombination with the host chromosomal DNA

  3. The Vitis vinifera sugar transporter gene family: phylogenetic overview and macroarray expression profiling

    Directory of Open Access Journals (Sweden)

    Atanassova Rossitza

    2010-11-01

    Full Text Available Abstract Background In higher plants, sugars are not only nutrients but also important signal molecules. They are distributed through the plant via sugar transporters, which are involved not only in sugar long-distance transport via the loading and the unloading of the conducting complex, but also in sugar allocation into source and sink cells. The availability of the recently released grapevine genome sequence offers the opportunity to identify sucrose and monosaccharide transporter gene families in a woody species and to compare them with those of the herbaceous Arabidopsis thaliana using a phylogenetic analysis. Results In grapevine, one of the most economically important fruit crop in the world, it appeared that sucrose and monosaccharide transporter genes are present in 4 and 59 loci, respectively and that the monosaccharide transporter family can be divided into 7 subfamilies. Phylogenetic analysis of protein sequences has indicated that orthologs exist between Vitis and Arabidospis. A search for cis-regulatory elements in the promoter sequences of the most characterized transporter gene families (sucrose, hexoses and polyols transporters, has revealed that some of them might probably be regulated by sugars. To profile several genes simultaneously, we created a macroarray bearing cDNA fragments specific to 20 sugar transporter genes. This macroarray analysis has revealed that two hexose (VvHT1, VvHT3, one polyol (VvPMT5 and one sucrose (VvSUC27 transporter genes, are highly expressed in most vegetative organs. The expression of one hexose transporter (VvHT2 and two tonoplastic monosaccharide transporter (VvTMT1, VvTMT2 genes are regulated during berry development. Finally, three putative hexose transporter genes show a preferential organ specificity being highly expressed in seeds (VvHT3, VvHT5, in roots (VvHT2 or in mature leaves (VvHT5. Conclusions This study provides an exhaustive survey of sugar transporter genes in Vitis vinifera and

  4. Genomic Organization, Phylogenetic Comparison and Differential Expression of the SBP-Box Family Genes in Grape

    Science.gov (United States)

    Hou, Hongmin; Li, Jun; Gao, Min; Singer, Stacy D.; Wang, Hao; Mao, Linyong; Fei, Zhangjun; Wang, Xiping

    2013-01-01

    Background The SBP-box gene family is specific to plants and encodes a class of zinc finger-containing transcription factors with a broad range of functions. Although SBP-box genes have been identified in numerous plants including green algae, moss, silver birch, snapdragon, Arabidopsis, rice and maize, there is little information concerning SBP-box genes, or the corresponding miR156/157, function in grapevine. Methodology/Principal Findings Eighteen SBP-box gene family members were identified in Vitis vinifera, twelve of which bore sequences that were complementary to miRNA156/157. Phylogenetic reconstruction demonstrated that plant SBP-domain proteins could be classified into seven subgroups, with the V. vinifera SBP-domain proteins being more closely related to SBP-domain proteins from dicotyledonous angiosperms than those from monocotyledonous angiosperms. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologs of several grape SBP genes were found in corresponding syntenic blocks of Arabidopsis. Expression analysis of the grape SBP-box genes in various organs and at different stages of fruit development in V. quinquangularis ‘Shang-24’ revealed distinct spatiotemporal patterns. While the majority of the grape SBP-box genes lacking a miR156/157 target site were expressed ubiquitously and constitutively, most genes bearing a miR156/157 target site exhibited distinct expression patterns, possibly due to the inhibitory role of the microRNA. Furthermore, microarray data mining and quantitative real-time RT-PCR analysis identified several grape SBP-box genes that are potentially involved in the defense against biotic and abiotic stresses. Conclusion The results presented here provide a further understanding of SBP-box gene function in plants, and yields additional insights into the mechanism of stress management in grape, which may have important implications for the future success of this crop. PMID:23527172

  5. Genome-wide Identification and Expression Analysis of the CDPK Gene Family in Grape, Vitis spp.

    Science.gov (United States)

    Zhang, Kai; Han, Yong-Tao; Zhao, Feng-Li; Hu, Yang; Gao, Yu-Rong; Ma, Yan-Fei; Zheng, Yi; Wang, Yue-Jin; Wen, Ying-Qiang

    2015-06-30

    Calcium-dependent protein kinases (CDPKs) play vital roles in plant growth and development, biotic and abiotic stress responses, and hormone signaling. Little is known about the CDPK gene family in grapevine. In this study, we performed a genome-wide analysis of the 12X grape genome (Vitis vinifera) and identified nineteen CDPK genes. Comparison of the structures of grape CDPK genes allowed us to examine their functional conservation and differentiation. Segmentally duplicated grape CDPK genes showed high structural conservation and contributed to gene family expansion. Additional comparisons between grape and Arabidopsis thaliana demonstrated that several grape CDPK genes occured in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of grapevine and Arabidopsis. Phylogenetic analysis divided the grape CDPK genes into four groups. Furthermore, we examined the expression of the corresponding nineteen homologous CDPK genes in the Chinese wild grape (Vitis pseudoreticulata) under various conditions, including biotic stress, abiotic stress, and hormone treatments. The expression profiles derived from reverse transcription and quantitative PCR suggested that a large number of VpCDPKs responded to various stimuli on the transcriptional level, indicating their versatile roles in the responses to biotic and abiotic stresses. Moreover, we examined the subcellular localization of VpCDPKs by transiently expressing six VpCDPK-GFP fusion proteins in Arabidopsis mesophyll protoplasts; this revealed high variability consistent with potential functional differences. Taken as a whole, our data provide significant insights into the evolution and function of grape CDPKs and a framework for future investigation of grape CDPK genes.

  6. Phylogenetic relationships among Perissodactyla: secretoglobin 1A1 gene duplication and triplication in the Equidae family.

    Science.gov (United States)

    Côté, Olivier; Viel, Laurent; Bienzle, Dorothee

    2013-12-01

    Secretoglobin family 1A member 1 (SCGB 1A1) is a small anti-inflammatory and immunomodulatory protein that is abundantly secreted in airway surface fluids. We recently reported the existence of three distinct SCGB1A1 genes in the domestic horse genome as opposed to the single gene copy consensus present in other mammals. The origin of SCGB1A1 gene triplication and the evolutionary relationship of the three genes amongst Equidae family members are unknown. For this study, SCGB1A1 genomic data were collected from various Equus individuals including E. caballus, E. przewalskii, E. asinus, E. grevyi, and E. quagga. Three SCGB1A1 genes in E. przewalskii, two SCGB1A1 genes in E. asinus, and a single SCGB1A1 gene in E. grevyi and E. quagga were identified. Sequence analysis revealed that the non-synonymous nucleotide substitutions between the different equid genes coded for 17 amino acid changes. Most of these changes localized to the SCGB 1A1 central cavity that binds hydrophobic ligands, suggesting that this area of SCGB 1A1 evolved to accommodate diverse molecular interactions. Three-dimensional modeling of the proteins revealed that the size of the SCGB 1A1 central cavity is larger than that of SCGB 1A1A. Altogether, these findings suggest that evolution of the SCGB1A1 gene may parallel the separation of caballine and non-caballine species amongst Equidae, and may indicate an expansion of function for SCGB1A1 gene products. Copyright © 2013 Elsevier Inc. All rights reserved.

  7. Genome-wide analysis of WRKY gene family in Cucumis sativus.

    Science.gov (United States)

    Ling, Jian; Jiang, Weijie; Zhang, Ying; Yu, Hongjun; Mao, Zhenchuan; Gu, Xingfang; Huang, Sanwen; Xie, Bingyan

    2011-09-28

    WRKY proteins are a large family of transcriptional regulators in higher plant. They are involved in many biological processes, such as plant development, metabolism, and responses to biotic and abiotic stresses. Prior to the present study, only one full-length cucumber WRKY protein had been reported. The recent publication of the draft genome sequence of cucumber allowed us to conduct a genome-wide search for cucumber WRKY proteins, and to compare these positively identified proteins with their homologs in model plants, such as Arabidopsis. We identified a total of 55 WRKY genes in the cucumber genome. According to structural features of their encoded proteins, the cucumber WRKY (CsWRKY) genes were classified into three groups (group 1-3). Analysis of expression profiles of CsWRKY genes indicated that 48 WRKY genes display differential expression either in their transcript abundance or in their expression patterns under normal growth conditions, and 23 WRKY genes were differentially expressed in response to at least one abiotic stresses (cold, drought or salinity). The expression profile of stress-inducible CsWRKY genes were correlated with those of their putative Arabidopsis WRKY (AtWRKY) orthologs, except for the group 3 WRKY genes. Interestingly, duplicated group 3 AtWRKY genes appear to have been under positive selection pressure during evolution. In contrast, there was no evidence of recent gene duplication or positive selection pressure among CsWRKY group 3 genes, which may have led to the expressional divergence of group 3 orthologs. Fifty-five WRKY genes were identified in cucumber and the structure of their encoded proteins, their expression, and their evolution were examined. Considering that there has been extensive expansion of group 3 WRKY genes in angiosperms, the occurrence of different evolutionary events could explain the functional divergence of these genes.

  8. Sulfur restriction extends fission yeast chronological lifespan through Ecl1 family genes by downregulation of ribosome.

    Science.gov (United States)

    Ohtsuka, Hokuto; Takinami, Masahiro; Shimasaki, Takafumi; Hibi, Takahide; Murakami, Hiroshi; Aiba, Hirofumi

    2017-07-01

    Nutritional restrictions such as calorie restrictions are known to increase the lifespan of various organisms. Here, we found that a restriction of sulfur extended the chronological lifespan (CLS) of the fission yeast Schizosaccharomyces pombe. The restriction decreased cellular size, RNA content, and ribosomal proteins and increased sporulation rate. These responses depended on Ecl1 family genes, the overexpression of which results in the extension of CLS. We also showed that the Zip1 transcription factor results in the sulfur restriction-dependent expression of the ecl1 + gene. We demonstrated that a decrease in ribosomal activity results in the extension of CLS. Based on these observations, we propose that sulfur restriction extends CLS through Ecl1 family genes in a ribosomal activity-dependent manner. © 2017 John Wiley & Sons Ltd.

  9. Genome-wide identification and characterization of WRKY gene family in peanut

    Directory of Open Access Journals (Sweden)

    Hui eSong

    2016-04-01

    Full Text Available WRKY, an important transcription factor family, is widely distributed in the plant kingdom. Many reports focused on analysis of phylogenetic relationship and biological function of WRKY protein at the whole genome level in different plant species. However, little is known about WRKY proteins in the genome of Arachis species and their response to salicylic acid (SA and jasmonic acid (JA treatment. In this study, we identified 77 and 75 WRKY proteins from the two wild ancestral diploid genomes of cultivated tetraploid peanut, Arachis duranensis and Arachis ipaënsis, using bioinformatics approaches. Most peanut WRKY coding genes were located on A. duranensis chromosome A6 and A. ipaënsis chromosome B3, while the least number of WRKY genes was found in chromosome 9. The WRKY orthologous gene pairs in A. duranensis and A. ipaënsis chromosomes were highly syntenic. Our analysis indicated that segmental duplication events played a major role in AdWRKY and AiWRKY genes, and strong purifying selection was observed in gene duplication pairs. Furthermore, we translate the knowledge gained from the genome-wide analysis result of wild ancestral peanut to cultivated peanut to reveal that gene activities of specific cultivated peanut WRKY gene were changed due to SA and JA treatment. Peanut WRKY7, 8 and 13 genes were down-regulated, whereas WRKY1 and 12 genes were up-regulated with SA and JA treatment. These results could provide valuable information for peanut improvement.

  10. Genome-Wide Identification and Characterization of WRKY Gene Family in Peanut.

    Science.gov (United States)

    Song, Hui; Wang, Pengfei; Lin, Jer-Young; Zhao, Chuanzhi; Bi, Yuping; Wang, Xingjun

    2016-01-01

    WRKY, an important transcription factor family, is widely distributed in the plant kingdom. Many reports focused on analysis of phylogenetic relationship and biological function of WRKY protein at the whole genome level in different plant species. However, little is known about WRKY proteins in the genome of Arachis species and their response to salicylic acid (SA) and jasmonic acid (JA) treatment. In this study, we identified 77 and 75 WRKY proteins from the two wild ancestral diploid genomes of cultivated tetraploid peanut, Arachis duranensis and Arachis ipaënsis, using bioinformatics approaches. Most peanut WRKY coding genes were located on A. duranensis chromosome A6 and A. ipaënsis chromosome B3, while the least number of WRKY genes was found in chromosome 9. The WRKY orthologous gene pairs in A. duranensis and A. ipaënsis chromosomes were highly syntenic. Our analysis indicated that segmental duplication events played a major role in AdWRKY and AiWRKY genes, and strong purifying selection was observed in gene duplication pairs. Furthermore, we translate the knowledge gained from the genome-wide analysis result of wild ancestral peanut to cultivated peanut to reveal that gene activities of specific cultivated peanut WRKY gene were changed due to SA and JA treatment. Peanut WRKY7, 8 and 13 genes were down-regulated, whereas WRKY1 and 12 genes were up-regulated with SA and JA treatment. These results could provide valuable information for peanut improvement.

  11. Runx family genes in a cartilaginous fish, the elephant shark (Callorhinchus milii.

    Directory of Open Access Journals (Sweden)

    Giselle Sek Suan Nah

    Full Text Available The Runx family genes encode transcription factors that play key roles in hematopoiesis, skeletogenesis and neurogenesis and are often implicated in diseases. We describe here the cloning and characterization of Runx1, Runx2, Runx3 and Runxb genes in the elephant shark (Callorhinchus milii, a member of Chondrichthyes, the oldest living group of jawed vertebrates. Through the use of alternative promoters and/or alternative splicing, each of the elephant shark Runx genes expresses multiple isoforms similar to their orthologs in human and other bony vertebrates. The expression profiles of elephant shark Runx genes are similar to those of mammalian Runx genes. The syntenic blocks of genes at the elephant shark Runx gene loci are highly conserved in human, but represented by shorter conserved blocks in zebrafish indicating a higher degree of rearrangements in this teleost fish. Analysis of promoter regions revealed conservation of binding sites for transcription factors, including two tandem binding sites for Runx that are totally conserved in the distal promoter regions of elephant shark Runx1-3. Several conserved noncoding elements (CNEs, which are putative cis-regulatory elements, and miRNA binding sites were identified in the elephant shark and human Runx gene loci. Some of these CNEs and miRNA binding sites are absent in teleost fishes such as zebrafish and fugu. In summary, our analysis reveals that the genomic organization and expression profiles of Runx genes were already complex in the common ancestor of jawed vertebrates.

  12. Plasmodium Sporozoite Biology.

    Science.gov (United States)

    Frischknecht, Friedrich; Matuschewski, Kai

    2017-05-01

    Plasmodium sporozoite transmission is a critical population bottleneck in parasite life-cycle progression and, hence, a target for prophylactic drugs and vaccines. The recent progress of a candidate antisporozoite subunit vaccine formulation to licensure highlights the importance of sporozoite transmission intervention in the malaria control portfolio. Sporozoites colonize mosquito salivary glands, migrate through the skin, penetrate blood vessels, breach the liver sinusoid, and invade hepatocytes. Understanding the molecular and cellular mechanisms that mediate the remarkable sporozoite journey in the invertebrate vector and the vertebrate host can inform evidence-based next-generation drug development programs and immune intervention strategies. Copyright © 2017 Cold Spring Harbor Laboratory Press; all rights reserved.

  13. A family of related proteins is encoded by the major Drosophila heat shock gene family

    International Nuclear Information System (INIS)

    Wadsworth, S.C.

    1982-01-01

    At least four proteins of 70,000 to 75,000 molecular weight (70-75K) were synthesized from mRNA which hybridized with a cloned heat shock gene previously shown to be localized to the 87A and 87C heat shock puff sites. These in vitro-synthesized proteins were indistinguishable from in vivo-synthesized heat shock-induced proteins when analyzed on sodium dodecyl sulfate-polyacrylamide gels. A comparison of the pattern of this group of proteins synthesized in vivo during a 5-min pulse or during continuous labeling indicates that the 72-75K proteins are probably not kinetic precursors to the major 70K heat shock protein. Partial digestion products generated with V8 protease indicated that the 70-75K heat shock proteins are closely related, but that there are clear differences between them. The partial digestion patterns obtained from heat shock proteins from the Kc cell line and from the Oregon R strain of Drosophila melanogaster are very similar. Genetic analysis of the patterns of 70-75K heat shock protein synthesis indicated that the genes encoding at least two of the three 72-75K heat shock proteins are located outside of the major 87A and 87C puff sites

  14. Plasmodium knowlesi Skeleton-Binding Protein 1 Localizes to the 'Sinton and Mulligan' Stipplings in the Cytoplasm of Monkey and Human Erythrocytes.

    Science.gov (United States)

    Lucky, Amuza Byaruhanga; Sakaguchi, Miako; Katakai, Yuko; Kawai, Satoru; Yahata, Kazuhide; Templeton, Thomas J; Kaneko, Osamu

    2016-01-01

    The malaria parasite, Plasmodium, exports protein products to the infected erythrocyte to introduce modifications necessary for the establishment of nutrient acquisition and surface display of host interaction ligands. Erythrocyte remodeling impacts parasite virulence and disease pathology and is well documented for the human malaria parasite Plasmodium falciparum, but has been less described for other Plasmodium species. For P. falciparum, the exported protein skeleton-binding protein 1 (PfSBP1) is involved in the trafficking of erythrocyte surface ligands and localized to membranous structures within the infected erythrocyte, termed Maurer's clefts. In this study, we analyzed SBP1 orthologs across the Plasmodium genus by BLAST analysis and conserved gene synteny, which were also recently described by de Niz et al. (2016). To evaluate the localization of an SBP1 ortholog, we utilized the zoonotic malaria parasite, Plasmodium knowlesi. Immunofluorescence assay of transgenic P. knowlesi parasites expressing epitope-tagged recombinant PkSBP1 revealed a punctate staining pattern reminiscent of Maurer's clefts, following infection of either monkey or human erythrocytes. The recombinant PkSBP1-positive puncta co-localized with Giemsa-stained structures, known as 'Sinton and Mulligan' stipplings. Immunoelectron microscopy also showed that recombinant PkSBP1 localizes within or on the membranous structures akin to the Maurer's clefts. The recombinant PkSBP1 expressed in P. falciparum-infected erythrocytes co-localized with PfSBP1 at the Maurer's clefts, indicating an analogous trafficking pattern. A member of the P. knowlesi 2TM protein family was also expressed and localized to membranous structures in infected monkey erythrocytes. These results suggest that the trafficking machinery and induced erythrocyte cellular structures of P. knowlesi are similar following infection of both monkey and human erythrocytes, and are conserved with P. falciparum.

  15. Plasmodium knowlesi Skeleton-Binding Protein 1 Localizes to the ‘Sinton and Mulligan’ Stipplings in the Cytoplasm of Monkey and Human Erythrocytes

    Science.gov (United States)

    Lucky, Amuza Byaruhanga; Sakaguchi, Miako; Katakai, Yuko; Kawai, Satoru; Yahata, Kazuhide; Templeton, Thomas J.

    2016-01-01

    The malaria parasite, Plasmodium, exports protein products to the infected erythrocyte to introduce modifications necessary for the establishment of nutrient acquisition and surface display of host interaction ligands. Erythrocyte remodeling impacts parasite virulence and disease pathology and is well documented for the human malaria parasite Plasmodium falciparum, but has been less described for other Plasmodium species. For P. falciparum, the exported protein skeleton-binding protein 1 (PfSBP1) is involved in the trafficking of erythrocyte surface ligands and localized to membranous structures within the infected erythrocyte, termed Maurer's clefts. In this study, we analyzed SBP1 orthologs across the Plasmodium genus by BLAST analysis and conserved gene synteny, which were also recently described by de Niz et al. (2016). To evaluate the localization of an SBP1 ortholog, we utilized the zoonotic malaria parasite, Plasmodium knowlesi. Immunofluorescence assay of transgenic P. knowlesi parasites expressing epitope-tagged recombinant PkSBP1 revealed a punctate staining pattern reminiscent of Maurer's clefts, following infection of either monkey or human erythrocytes. The recombinant PkSBP1-positive puncta co-localized with Giemsa-stained structures, known as ‘Sinton and Mulligan’ stipplings. Immunoelectron microscopy also showed that recombinant PkSBP1 localizes within or on the membranous structures akin to the Maurer's clefts. The recombinant PkSBP1 expressed in P. falciparum-infected erythrocytes co-localized with PfSBP1 at the Maurer's clefts, indicating an analogous trafficking pattern. A member of the P. knowlesi 2TM protein family was also expressed and localized to membranous structures in infected monkey erythrocytes. These results suggest that the trafficking machinery and induced erythrocyte cellular structures of P. knowlesi are similar following infection of both monkey and human erythrocytes, and are conserved with P. falciparum. PMID:27732628

  16. Differential evolution of members of the rhomboid gene family with conservative and divergent patterns.

    Science.gov (United States)

    Li, Qi; Zhang, Ning; Zhang, Liangsheng; Ma, Hong

    2015-04-01

    Rhomboid proteins are intramembrane serine proteases that are involved in a plethora of biological functions, but the evolutionary history of the rhomboid gene family is not clear. We performed a comprehensive molecular evolutionary analysis of the rhomboid gene family and also investigated the organization and sequence features of plant rhomboids in different subfamilies. Our results showed that eukaryotic rhomboids could be divided into five subfamilies (RhoA-RhoD and PARL). Most orthology groups appeared to be conserved only as single or low-copy genes in all lineages in RhoB-RhoD and PARL, whereas RhoA genes underwent several duplication events, resulting in multiple gene copies. These duplication events were due to whole genome duplications in plants and animals and the duplicates might have experienced functional divergence. We also identified a novel group of plant rhomboid (RhoB1) that might have lost their enzymatic activity; their existence suggests that they might have evolved new mechanisms. Plant and animal rhomboids have similar evolutionary patterns. In addition, there are mutations affecting key active sites in RBL8, RBL9 and one of the Brassicaceae PARL duplicates. This study delineates a possible evolutionary scheme for intramembrane proteins and illustrates distinct fates and a mechanism of evolution of gene duplicates. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

  17. Identification and molecular characterization of the nicotianamine synthase gene family in bread wheat.

    Science.gov (United States)

    Bonneau, Julien; Baumann, Ute; Beasley, Jesse; Li, Yuan; Johnson, Alexander A T

    2016-12-01

    Nicotianamine (NA) is a non-protein amino acid involved in fundamental aspects of metal uptake, transport and homeostasis in all plants and constitutes the biosynthetic precursor of mugineic acid family phytosiderophores (MAs) in graminaceous plant species. Nicotianamine synthase (NAS) genes, which encode enzymes that synthesize NA from S-adenosyl-L-methionine (SAM), are differentially regulated by iron (Fe) status in most plant species and plant genomes have been found to contain anywhere from 1 to 9 NAS genes. This study describes the identification of 21 NAS genes in the hexaploid bread wheat (Triticum aestivum L.) genome and their phylogenetic classification into two distinct clades. The TaNAS genes are highly expressed during germination, seedling growth and reproductive development. Fourteen of the clade I NAS genes were up-regulated in root tissues under conditions of Fe deficiency. Protein sequence analyses revealed the presence of endocytosis motifs in all of the wheat NAS proteins as well as chloroplast, mitochondrial and secretory transit peptide signals in four proteins. These results greatly expand our knowledge of NAS gene families in graminaceous plant species as well as the genetics underlying Fe nutrition in bread wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  18. A novel ATP1A2 gene mutation in an Irish familial hemiplegic migraine kindred.

    LENUS (Irish Health Repository)

    Fernandez, Desiree M

    2012-02-03

    OBJECTIVE: We studied a large Irish Caucasian pedigree with familial hemiplegic migraine (FHM) with the aim of finding the causative gene mutation. BACKGROUND: FHM is a rare autosomal-dominant subtype of migraine with aura, which is linked to 4 loci on chromosomes 19p13, 1q23, 2q24, and 1q31. The mutations responsible for hemiplegic migraine have been described in the CACNA1A gene (chromosome 19p13), ATP1A2 gene (chromosome 1q23), and SCN1A gene (chromosome 2q24). METHODS: We performed linkage analyses in this family for chromosome 1q23 and performed mutation analysis of the ATP1A2 gene. RESULTS: Linkage to the FHM2 locus on chromosome 1 was demonstrated. Mutation screening of the ATP1A2 gene revealed a G to C substitution in exon 22 resulting in a novel protein variant, D999H, which co-segregates with FHM within this pedigree and is absent in 50 unaffected individuals. This residue is also highly conserved across species. CONCLUSIONS: We propose that D999H is a novel FHM ATP1A2 mutation.

  19. Genome-wide analysis of the MYB gene family in physic nut (Jatropha curcas L.).

    Science.gov (United States)

    Zhou, Changpin; Chen, Yanbo; Wu, Zhenying; Lu, Wenjia; Han, Jinli; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

    2015-11-01

    The MYB proteins comprise one of the largest transcription factor families in plants, and play key roles in regulatory networks controlling development, metabolism, and stress responses. A total of 125 MYB genes (JcMYB) have been identified in the physic nut (Jatropha curcas L.) genome, including 120 2R-type MYB, 4 3R-MYB, and 1 4R-MYB genes. Based on exon-intron arrangement of MYBs from both lower (Physcomitrella patens) and higher (physic nut, Arabidopsis, and rice) plants, we can classify plant MYB genes into ten groups (MI-X), except for MIX genes which are nonexistent in higher plants. We also observed that MVIII genes may be one of the most ancient MYB types which consist of both R2R3- and 3R-MYB genes. Most MYB genes (76.8% in physic nut) belong to the MI group which can be divided into 34 subgroups. The JcMYB genes were nonrandomly distributed on its 11 linkage groups (LGs). The expansion of MYB genes across several subgroups was observed and resulted from genome triplication of ancient dicotyledons and from both ancient and recent tandem duplication events in the physic nut genome. The expression patterns of several MYB duplicates in the physic nut showed differences in four tissues (root, stem, leaf, and seed), and 34 MYB genes responded to at least one abiotic stressor (drought, salinity, phosphate starvation, and nitrogen starvation) in leaves and/or roots based on the data analysis of digital gene expression tags. Overexpression of the JcMYB001 gene in Arabidopsis increased its sensitivity to drought and salinity stresses. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. NHS Gene Mutations in Ashkenazi Jewish Families with Nance-Horan Syndrome.

    Science.gov (United States)

    Shoshany, Nadav; Avni, Isaac; Morad, Yair; Weiner, Chen; Einan-Lifshitz, Adi; Pras, Eran

    2017-09-01

    To describe ocular and extraocular abnormalities in two Ashkenazi Jewish families with infantile cataract and X-linked inheritance, and to identify their underlying mutations. Seven affected members were recruited. Medical history, clinical findings, and biometric measurements were recorded. Mutation analysis of the Nance-Horan syndrome (NHS) gene was performed by direct sequencing of polymerase chain reaction-amplified exons. An unusual anterior Y-sutural cataract was documented in the affected male proband. Other clinical features among examined patients included microcorneas, long and narrow faces, and current or previous dental anomalies. A nonsense mutation was identified in each family, including a previously described 742 C>T, p.(Arg248*) mutation in Family A, and a novel mutation 2915 C>A, p.(Ser972*) in Family B. Our study expands the repertoire of NHS mutations and the related phenotype, including newly described anterior Y-sutural cataract and dental findings.

  1. Molecular analysis of the Duchenne muscular dystrophy gene in Spanish individuals: Deletion detection and familial diagnosis

    Energy Technology Data Exchange (ETDEWEB)

    Patino, A.; Garcia-Delgado, M.; Narbona, J. [Univ. of Navarra, Pamplona (Spain)

    1995-11-06

    Deletion studies were performed in 26 Duchenne muscular dystrophy (DMD) patients through amplification of nine different exons by multiplex polymerase chain reaction (PCR). DNA from paraffin-embedded muscle biopsies was analyzed in 12 of the 26 patients studied. Optimization of this technique is of great utility because it enables analysis of material stored in pathology archives. PCR deletion detection, useful in DMD-affected boys, is problematic in determining the carrier state in female relatives. For this reason, to perform familial linkage diagnosis, we made use of a dinucleotide repeat polymorphism (STRP, or short tandem repeat polymorphism) located in intron 49 of the gene. We designed a new pair of primers that enabled the detection of 22 different alleles in relatives in the 14 DMD families studied. The use of this marker allowed familial diagnosis in 11 of the 14 DMD families and detection of de novo deletions in 3 of the probands. 8 refs., 5 figs., 2 tabs.

  2. The evolutionary history of the SAL1 gene family in eutherian mammals

    Directory of Open Access Journals (Sweden)

    Callebaut Isabelle

    2011-05-01

    Full Text Available Abstract Background SAL1 (salivary lipocalin is a member of the OBP (Odorant Binding Protein family and is involved in chemical sexual communication in pig. SAL1 and its relatives may be involved in pheromone and olfactory receptor binding and in pre-mating behaviour. The evolutionary history and the selective pressures acting on SAL1 and its orthologous genes have not yet been exhaustively described. The aim of the present work was to study the evolution of these genes, to elucidate the role of selective pressures in their evolution and the consequences for their functions. Results Here, we present the evolutionary history of SAL1 gene and its orthologous genes in mammals. We found that (1 SAL1 and its related genes arose in eutherian mammals with lineage-specific duplications in rodents, horse and cow and are lost in human, mouse lemur, bushbaby and orangutan, (2 the evolution of duplicated genes of horse, rat, mouse and guinea pig is driven by concerted evolution with extensive gene conversion events in mouse and guinea pig and by positive selection mainly acting on paralogous genes in horse and guinea pig, (3 positive selection was detected for amino acids involved in pheromone binding and amino acids putatively involved in olfactory receptor binding, (4 positive selection was also found for lineage, indicating a species-specific strategy for amino acid selection. Conclusions This work provides new insights into the evolutionary history of SAL1 and its orthologs. On one hand, some genes are subject to concerted evolution and to an increase in dosage, suggesting the need for homogeneity of sequence and function in certain species. On the other hand, positive selection plays a role in the diversification of the functions of the family and in lineage, suggesting adaptive evolution, with possible consequences for speciation and for the reinforcement of prezygotic barriers.

  3. Unequal rates of Y chromosome gene divergence during speciation of the family Ursidae.

    Science.gov (United States)

    Nakagome, Shigeki; Pecon-Slattery, Jill; Masuda, Ryuichi

    2008-07-01

    Evolution of the bear family Ursidae is well investigated in terms of morphological, paleontological, and genetic features. However, several phylogenetic ambiguities occur within the subfamily Ursinae (the family Ursidae excluding the giant panda and spectacled bear), which may correlate with behavioral traits of female philopatry and male-biased dispersal which form the basis of the observed matriarchal population structure in these species. In the process of bear evolution, we investigate the premise that such behavioral traits may be reflected in patterns of variation among genes with different modes of inheritance: matrilineal mitochondrial DNA (mtDNA), patrilineal Y chromosome, biparentally inherited autosomes, and the X chromosome. In the present study, we sequenced 3 Y-linked genes (3,453 bp) and 4 X-linked genes (4,960 bp) and reanalyzed previously published sequences from autosome genes (2,347 bp) in ursid species to investigate differences in evolutionary rates associated with patterns of inheritance. The results describe topological incongruence between sex-linked genes and autosome genes and between nuclear DNA and mtDNA. In more ancestral branches within the bear phylogeny, Y-linked genes evolved faster than autosome and X-linked genes, consistent with expectations based on male-driven evolution. However, this pattern changes among branches leading to each species within the lineage of Ursinae whereby the evolutionary rates of Y-linked genes have fewer than expected substitutions. This inconsistency between more recent nodes of the bear phylogeny with more ancestral nodes may reflect the influences of sex-biased dispersal as well as molecular evolutionary characteristics of the Y chromosome, and stochastic events in species natural history, and phylogeography unique to ursine bears.

  4. Gene amplification as a cause of inherited thyroxine-binding globulin excess in two Japanese families

    Energy Technology Data Exchange (ETDEWEB)

    Mori, Yuichi; Miura, Yoshitaka; Saito, Hidehiko [Toyota Memorial Hospital (Japan)] [and others

    1995-12-01

    T{sub 4}-binding globulin (TBG) is the major thyroid hormone transport protein in man. Inherited abnormalities in the level of serum TBG have been classified as partial deficiency, complete deficiency, and excess. Sequencing analysis of the TBG gene, located on Xq21-22, has uncovered the molecular defects causing partial and complete deficiency. However, the mechanism leading to inherited TBG excess remains unknown. In this study, two Japanese families,