WorldWideScience

Sample records for plasmid dna fragments

  1. Plasmid P1 replication: negative control by repeated DNA sequences.

    OpenAIRE

    Chattoraj, D; Cordes, K; Abeles, A

    1984-01-01

    The incompatibility locus, incA, of the unit-copy plasmid P1 is contained within a fragment that is essentially a set of nine 19-base-pair repeats. One or more copies of the fragment destabilizes the plasmid when present in trans. Here we show that extra copies of incA interfere with plasmid DNA replication and that a deletion of most of incA increases plasmid copy number. Thus, incA is not essential for replication but is required for its control. When cloned in a high-copy-number vector, pi...

  2. Plasmid DNA Delivery: Nanotopography Matters.

    Science.gov (United States)

    Song, Hao; Yu, Meihua; Lu, Yao; Gu, Zhengying; Yang, Yannan; Zhang, Min; Fu, Jianye; Yu, Chengzhong

    2017-12-20

    Plasmid DNA molecules with unique loop structures have widespread bioapplications, in many cases relying heavily on delivery vehicles to introduce them into cells and achieve their functions. Herein, we demonstrate that control over delicate nanotopography of silica nanoparticles as plasmid DNA vectors has significant impact on the transfection efficacy. For silica nanoparticles with rambutan-, raspberry-, and flower-like morphologies composed of spike-, hemisphere-, and bowl-type subunit nanotopographies, respectively, the rambutan-like nanoparticles with spiky surfaces demonstrate the highest plasmid DNA binding capability and transfection efficacy of 88%, higher than those reported for silica-based nanovectors. Moreover, it is shown that the surface spikes of rambutan nanoparticles provide a continuous open space to bind DNA chains via multivalent interactions and protect the gene molecules sheltered in the spiky layer against nuclease degradation, exhibiting no significant transfection decay. This unique protection feature is in great contrast to a commercial transfection agent with similar transfection performance but poor protection capability against enzymatic cleavage. Our study provides new understandings in the rational design of nonviral vectors for efficient gene delivery.

  3. Large-scale preparation of plasmid DNA.

    Science.gov (United States)

    Heilig, J S; Elbing, K L; Brent, R

    2001-05-01

    Although the need for large quantities of plasmid DNA has diminished as techniques for manipulating small quantities of DNA have improved, occasionally large amounts of high-quality plasmid DNA are desired. This unit describes the preparation of milligram quantities of highly purified plasmid DNA. The first part of the unit describes three methods for preparing crude lysates enriched in plasmid DNA from bacterial cells grown in liquid culture: alkaline lysis, boiling, and Triton lysis. The second part describes four methods for purifying plasmid DNA in such lysates away from contaminating RNA and protein: CsCl/ethidium bromide density gradient centrifugation, polyethylene glycol (PEG) precipitation, anion-exchange chromatography, and size-exclusion chromatography.

  4. DNA fragmentation in spermatozoa

    DEFF Research Database (Denmark)

    Rex, A S; Aagaard, J.; Fedder, J

    2017-01-01

    Sperm DNA Fragmentation has been extensively studied for more than a decade. In the 1940s the uniqueness of the spermatozoa protein complex which stabilizes the DNA was discovered. In the fifties and sixties, the association between unstable chromatin structure and subfertility was investigated....... In the seventies, the impact of induced DNA damage was investigated. In the 1980s the concept of sperm DNA fragmentation as related to infertility was introduced as well as the first DNA fragmentation test: the Sperm Chromatin Structure Assay (SCSA). The terminal deoxynucleotidyl transferase nick end labelling...... (TUNEL) test followed by others was introduced in the nineties. The association between DNA fragmentation in spermatozoa and pregnancy loss has been extensively investigated spurring the need for a therapeutic tool for these patients. This gave rise to an increased interest in the aetiology of DNA damage...

  5. Plasmid fermentation process for DNA immunization applications.

    Science.gov (United States)

    Carnes, Aaron E; Williams, James A

    2014-01-01

    Plasmid DNA for immunization applications must be of the highest purity and quality. The ability of downstream purification to efficiently produce a pure final product is directly influenced by the performance of the upstream fermentation process. While several clinical manufacturing facilities already have validated fermentation processes in place to manufacture plasmid DNA for use in humans, a simple and inexpensive laboratory-scale fermentation process can be valuable for in-house production of plasmid DNA for use in animal efficacy studies. This chapter describes a simple fed-batch fermentation process for producing bacterial cell paste enriched with high-quality plasmid DNA. A constant feeding strategy results in a medium cell density culture with continuously increasing plasmid amplification towards the end of the process. Cell banking and seed culture preparation protocols, which can dramatically influence final product yield and quality, are also described. These protocols are suitable for production of research-grade plasmid DNA at the 100 mg-to-1.5 g scale from a typical 10 L laboratory benchtop fermentor.

  6. Characterization of Erwinia amylovora strains from different host plants using repetitive-sequences PCR analysis, and restriction fragment length polymorphism and short-sequence DNA repeats of plasmid pEA29.

    Science.gov (United States)

    Barionovi, D; Giorgi, S; Stoeger, A R; Ruppitsch, W; Scortichini, M

    2006-05-01

    The three main aims of the study were the assessment of the genetic relationship between a deviating Erwinia amylovora strain isolated from Amelanchier sp. (Maloideae) grown in Canada and other strains from Maloideae and Rosoideae, the investigation of the variability of the PstI fragment of the pEA29 plasmid using restriction fragment length polymorphism (RFLP) analysis and the determination of the number of short-sequence DNA repeats (SSR) by DNA sequence analysis in representative strains. Ninety-three strains obtained from 12 plant genera and different geographical locations were examined by repetitive-sequences PCR using Enterobacterial Repetitive Intergenic Consensus, BOX and Repetitive Extragenic Palindromic primer sets. Upon the unweighted pair group method with arithmetic mean analysis, a deviating strain from Amelanchier sp. was analysed using amplified ribosomal DNA restriction analysis (ARDRA) analysis and the sequencing of the 16S rDNA gene. This strain showed 99% similarity to other E. amylovora strains in the 16S gene and the same banding pattern with ARDRA. The RFLP analysis of pEA29 plasmid using MspI and Sau3A restriction enzymes showed a higher variability than that previously observed and no clear-cut grouping of the strains was possible. The number of SSR units reiterated two to 12 times. The strains obtained from pear orchards showing for the first time symptoms of fire blight had a low number of SSR units. The strains from Maloideae exhibit a wider genetic variability than previously thought. The RFLP analysis of a fragment of the pEA29 plasmid would not seem a reliable method for typing E. amylovora strains. A low number of SSR units was observed with first epidemics of fire blight. The current detection techniques are mainly based on the genetic similarities observed within the strains from the cultivated tree-fruit crops. For a more reliable detection of the fire blight pathogen also in wild and ornamentals Rosaceous plants the genetic

  7. Restriction Fragment Length Polymorphisms of Virulence Plasmids in Rhodococcus equi

    Science.gov (United States)

    Takai, Shinji; Shoda, Masato; Sasaki, Yukako; Tsubaki, Shiro; Fortier, Guillaume; Pronost, Stephane; Rahal, Karim; Becu, Teotimo; Begg, Angela; Browning, Glenn; Nicholson, Vivian M.; Prescott, John F.

    1999-01-01

    Virulent Rhodococcus equi, which is a well-known cause of pyogranulomatous pneumonia in foals, possesses a large plasmid encoding virulence-associated 15- to 17-kDa antigens. Foal and soil isolates from five countries—Argentina, Australia, Canada, France, and Japan—were investigated for the presence of 15- to 17-kDa antigens by colony blotting, using the monoclonal antibody 10G5, and the gene coding for 15- to 17-kDa antigens by PCR. Plasmid DNAs extracted from positive isolates were digested with restriction endonucleases BamHI, EcoRI, EcoT22I, and HindIII, and the digestion patterns that resulted divided the plasmids of virulent isolates into five closely related types. Three of the five types had already been reported in Canadian and Japanese isolates, and the two new types had been found in French and Japanese isolates. Therefore, we tentatively designated these five types 85-kb type I (pREAT701), 85-kb type II (a new type), 87-kb type I (EcoRI and BamHI type 2 [V. M. Nicholson and J. F. Prescott, J. Clin. Microbiol. 35:738–740, 1997]), 87-kb type II (a new type), and 90-kb (pREL1) plasmids. The 85-kb type I plasmid was found in isolates from Argentina, Australia, Canada, and France. Plasmid 87-kb type I was isolated in specimens from Argentina, Canada, and France. The 85-kb type II plasmid appeared in isolates from France. On the other hand, plasmids 87-kb type II and 90-kb were found only in isolates from Japan. These results revealed geographic differences in the distribution of the virulence plasmids found in the five countries and suggested that the restriction fragment length polymorphism of virulence plasmids might be useful to elucidate the molecular epidemiology of virulent R. equi in the world. PMID:10488224

  8. [Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

    Science.gov (United States)

    Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

    1985-11-01

    The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

  9. Comparative assessment of plasmid DNA delivery by encapsulation ...

    African Journals Online (AJOL)

    Tropical Journal of Pharmaceutical Research January 2018; 17 (1): 1-10 ... Purpose: To compare the gene delivery effectiveness of plasmid DNA (pDNA) ..... Intramuscular delivery of DNA ... copolymeric system for gene delivery in complete.

  10. Production and pharmaceutical formulation of plasmid DNA vaccines

    NARCIS (Netherlands)

    van der Heijden, I.

    2013-01-01

    Research leading to the thesis ‘Production and pharmaceutical formulation of plasmid DNA vaccines‘ can be divided into two parts. The first part describes the development of a Good Manufacturing Practice (GMP) compliant plasmid DNA production process of pDNA vaccines for the treatment of Human

  11. Molecular cloning and restriction analysis of EcoRI-fragments of Vicia faba rDNA

    International Nuclear Information System (INIS)

    Yakura, Kimitaka; Tanifuji, Shigeyuki.

    1983-01-01

    EcoRI-fragments of Vicia faba rDNA were cloned in plasmid pBR325. Southern blot hybridization of BamHI-digests of these cloned plasmids and Vicia genomic DNA led to the determination of relative positions of BamHI sites in the rDNA and the physical map that had been tentatively made is corrected. (author)

  12. A rapid method for screening arrayed plasmid cDNA library by PCR

    International Nuclear Information System (INIS)

    Hu Yingchun; Zhang Kaitai; Wu Dechang; Li Gang; Xiang Xiaoqiong

    1999-01-01

    Objective: To develop a PCR-based method for rapid and effective screening of arrayed plasmid cDNA library. Methods: The plasmid cDNA library was arrayed and screened by PCR with a particular set of primers. Results: Four positive clones were obtained through about one week. Conclusion: This method can be applied to screening not only normal cDNA clones, but also cDNA clones-containing small size fragments. This method offers significant advantages over traditional screening method in terms of sensitivity, specificity and efficiency

  13. A one-step miniprep for the isolation of plasmid DNA and lambda phage particles.

    Directory of Open Access Journals (Sweden)

    George Lezin

    Full Text Available Plasmid DNA minipreps are fundamental techniques in molecular biology. Current plasmid DNA minipreps use alkali and the anionic detergent SDS in a three-solution format. In addition, alkali minipreps usually require additional column-based purification steps and cannot isolate other extra-chromosomal elements, such as bacteriophages. Non-ionic detergents (NIDs have been used occasionally as components of multiple-solution plasmid DNA minipreps, but a one-step approach has not been developed. Here, we have established a one-tube, one-solution NID plasmid DNA miniprep, and we show that this approach also isolates bacteriophage lambda particles. NID minipreps are more time-efficient than alkali minipreps, and NID plasmid DNA performs better than alkali DNA in many downstream applications. In fact, NID crude lysate DNA is sufficiently pure to be used in digestion and sequencing reactions. Microscopic analysis showed that the NID procedure fragments E. coli cells into small protoplast-like components, which may, at least in part, explain the effectiveness of this approach. This work demonstrates that one-step NID minipreps are a robust method to generate high quality plasmid DNA, and NID approaches can also isolate bacteriophage lambda particles, outperforming current standard alkali-based minipreps.

  14. Plasmid ColE1 as a Molecular Vehicle for Cloning and Amplification of DNA

    Science.gov (United States)

    Hershfield, Vickers; Boyer, Herbert W.; Yanofsky, Charles; Lovett, Michael A.; Helinski, Donald R.

    1974-01-01

    DNA fragments obtained from EcoRI endonuclease digestion of bacteriophage ϕ80pt190 (trp+) and the plasmid ColE1 were covalently joined with polynucleotide ligase. Transformation of Escherichia coli trp- strains to tryptophan independence with the recombined DNA selected for reconstituted ColE1 plasmids containing the tryptophan operon and the ϕ80 immunity region. Similarly, an EcoRI endonuclease generated fragment of plasmid pSC105 DNA containing the genetic determinant of kanamycin resistance was inserted into the ColE1 plasmid and recovered in E. coli. The plasmids containing the trp operon (ColE1-trp) and the kanamycin resistance gene were maintained under logarithmic growth conditions at a level of 25-30 copies per cell and accumulate to the extent of several hundred copies per cell in the presence of chloramphenicol. Cells carrying the ColE1-trp plasmid determined the production of highly elevated levels of trp operon-specific mRNA and tryptophan biosynthetic enzymes. Images PMID:4610576

  15. Comparative assessment of plasmid DNA delivery by encapsulation ...

    African Journals Online (AJOL)

    Purpose: To compare the gene delivery effectiveness of plasmid DNA (pDNA) encapsulated within poly (D,L-lactide-co-glycolide) (PLGA) nanoparticles with that adsorbed on PLGA nanoparticles. Methods: PLGA nanoparticles were prepared using solvent-evaporation method. To encapsulate pDNA within the particles, ...

  16. Plasmid DNA damage induced by helium atmospheric pressure plasma jet

    Science.gov (United States)

    Han, Xu; Cantrell, William A.; Escobar, Erika E.; Ptasinska, Sylwia

    2014-03-01

    A helium atmospheric pressure plasma jet (APPJ) is applied to induce damage to aqueous plasmid DNA. The resulting fractions of the DNA conformers, which indicate intact molecules or DNA with single- or double-strand breaks, are determined using agarose gel electrophoresis. The DNA strand breaks increase with a decrease in the distance between the APPJ and DNA samples under two working conditions of the plasma source with different parameters of applied electric pulses. The damage level induced in the plasmid DNA is also enhanced with increased plasma irradiation time. The reactive species generated in the APPJ are characterized by optical emission spectra, and their roles in possible DNA damage processes occurring in an aqueous environment are also discussed.

  17. Photoinduced silver nanoparticles/nanorings on plasmid DNA scaffolds.

    Science.gov (United States)

    Liu, Jianhua; Zhang, Xiaoliang; Yu, Mei; Li, Songmei; Zhang, Jindan

    2012-01-23

    Biological scaffolds are being actively explored for the synthesis of nanomaterials with novel structures and unexpected properties. Toroidal plasmid DNA separated from the Bacillus host is applied as a sacrificial mold for the synthesis of silver nanoparticles and nanorings. The photoirradiation method is applied to reduce Ag(I) on the plasmid. The nanoparticles are obtained by varying the concentration of the Ag(I) ion solution and the exposure time of the plasmid-Ag(I) complex under UV light at 254 nm and room temperature. It is found that the plasmid serves not only as a template but also as a reductant to drive the silver nucleation and deposition. The resulting nanoparticles have a face-centered cubic (fcc) crystal structure and 20-30 nm average diameter. The detailed mechanism is discussed, and other metals or alloys could also be synthesized with this method. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Pharmaceutical development of the plasmid DNA vaccine pDERMATT

    NARCIS (Netherlands)

    Quaak, S.G.L.

    2009-01-01

    The discovery of tumor specific antigens and self tolerance mechanisms against these antigens led to the assumption that antigens circulating at sufficient concentration levels could break this self tolerance mechanism and evoke immunological antitumor effects. pDERMATT (plasmid DNA encoding

  19. Effect of Surfactants on Plasmid DNA Stability and Release from ...

    African Journals Online (AJOL)

    Purpose: To evaluate the effect of surfactants on plasmid DNA during preparation and release from polylactic glycolide (PLGA) microspheres. Methods: Various surfactants, both ionic and non-ionic (Span, Tween, Triton X100, cetyltrimethylammonium bromide and sodium dodecyl sulphate), were added during the ...

  20. Rapid and inexpensive method for isolating plasmid DNA

    International Nuclear Information System (INIS)

    Aljanabi, S. M.; Al-Awadi, S. J.; Al-Kazaz, A. A.; Baghdad Univ.

    1997-01-01

    A small-scale and economical method for isolating plasmid DNA from bacteria is described. The method provides DNA of suitable quality for most DNA manipulation techniques. This DNA can be used for restriction endonuclease digestion, southern blot hybridization, nick translation and end labeling of DNA probes, Polymerase Chain Reaction (PCR) -based techniques, transformation, DNA cycle-sequencing, and Chain-termination method for DNA sequencing. The entire procedure is adapted to 1.5 ml microfuge tubes and takes approximately 30 mins. The DNA isolated by this method has the same purity produced by CTAB and cesium chloride precipitation and purification procedures respectively. The two previous methods require many hours to obtain the final product and require the use of very expensive equipment as ultracentrifuge. This method is well suited for the isolation of plasmid DNA from a large number of bacterial samples and in a very short time and low cost in laboratories where chemicals, expensive equipment and finance are limited factors in conducting molecular research. (authors). 11refs. 11refs

  1. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    Complementary DNA-amplified fragment length polymorphism (AFLP-cDNA) analysis of differential gene expression from the xerophyte Ammopiptanthus mongolicus in response to cold, drought and cold together with drought.

  2. Construction and confirmation of the plasmid of human mitochondrial DNA 4977 bp deletion induced by ionizing radiation

    International Nuclear Information System (INIS)

    Chen Xiaosui; Zhou Lijun; Wang Yuxiao; Qu Jia; Feng Jiangbing; Lu Xue; Chen Deqing; Liu Qingjie

    2006-01-01

    Objective: To construct a stable plasmid that spanning deleted human mitochondrial DNA (mtDNA) 4977 bp induced by ionizing radiation and another one for control DNA fragment, in order to use in the human mitochondrial genome study in the future. Methods: The peripheral blood, which had no mtDNA 4977 bp deletion found in previous study, was exposed to 10 Gy 60 Co γ-rays in vitro. The total cell DNA was extracted and PCR was carried out: a nest-PCR of three-round PCR was used for the mtDNA 4977 bp deletion and one- round regular PCR was used for the control ND1 gene. The PCR products were used for transfection by electroporation and the positive clones were obtained after screening. The plasmid DNA was isolated and sequenced after enzymatic digestion and purification. The sequence result was BLASTed with the human mitochondrial genome. Results: The sizes of PCR products for the flanked 4977 bp deletion and the ND1 gene were similar with those predicted according to GeneBank. The sequences for the positive clones were above 99 per cent homologous with the human mitochondrial genome after BLASTed. Conclusion: The plasmids for deleted human mtDNA 4977 bp and control DNA fragment have been constructed successfully, and they could be used in the quality and quantity studies on human mtDNA 4977 bp deletion. (authors)

  3. Proton-induced direct and indirect damage of plasmid DNA

    Czech Academy of Sciences Publication Activity Database

    Vyšín, Luděk; Pachnerová Brabcová, Kateřina; Štěpán, V.; Moretto-Capelle, P.; Bugler, B.; Legube, G.; Cafarelli, P.; Casta, R.; Champeaux, J. P.; Sence, M.; Vlk, M.; Wagner, Richard; Štursa, Jan; Zach, Václav; Incerti, S.; Juha, Libor; Davídková, Marie

    2015-01-01

    Roč. 54, č. 3 (2015), s. 343-352 ISSN 0301-634X R&D Projects: GA ČR GA13-28721S; GA MŠk LD12008; GA MŠk LM2011019 Institutional support: RVO:68378271 ; RVO:61389005 Keywords : proton radiation * DNA plasmid * direct and indirect effects * clustered damage * repair enzymes Subject RIV: BO - Biophysics Impact factor: 1.923, year: 2015

  4. Fragment Length of Circulating Tumor DNA.

    Science.gov (United States)

    Underhill, Hunter R; Kitzman, Jacob O; Hellwig, Sabine; Welker, Noah C; Daza, Riza; Baker, Daniel N; Gligorich, Keith M; Rostomily, Robert C; Bronner, Mary P; Shendure, Jay

    2016-07-01

    Malignant tumors shed DNA into the circulation. The transient half-life of circulating tumor DNA (ctDNA) may afford the opportunity to diagnose, monitor recurrence, and evaluate response to therapy solely through a non-invasive blood draw. However, detecting ctDNA against the normally occurring background of cell-free DNA derived from healthy cells has proven challenging, particularly in non-metastatic solid tumors. In this study, distinct differences in fragment length size between ctDNAs and normal cell-free DNA are defined. Human ctDNA in rat plasma derived from human glioblastoma multiforme stem-like cells in the rat brain and human hepatocellular carcinoma in the rat flank were found to have a shorter principal fragment length than the background rat cell-free DNA (134-144 bp vs. 167 bp, respectively). Subsequently, a similar shift in the fragment length of ctDNA in humans with melanoma and lung cancer was identified compared to healthy controls. Comparison of fragment lengths from cell-free DNA between a melanoma patient and healthy controls found that the BRAF V600E mutant allele occurred more commonly at a shorter fragment length than the fragment length of the wild-type allele (132-145 bp vs. 165 bp, respectively). Moreover, size-selecting for shorter cell-free DNA fragment lengths substantially increased the EGFR T790M mutant allele frequency in human lung cancer. These findings provide compelling evidence that experimental or bioinformatic isolation of a specific subset of fragment lengths from cell-free DNA may improve detection of ctDNA.

  5. DNA repair in bacterial cultures and plasmid DNA exposed to infrared laser for treatment of pain

    International Nuclear Information System (INIS)

    Canuto, K S; Sergio, L P S; Marciano, R S; Guimarães, O R; Polignano, G A C; Geller, M; Fonseca, A S; Paoli, F

    2013-01-01

    Biostimulation of tissues by low intensity lasers has been described on a photobiological basis and clinical protocols are recommended for treatment of various diseases, but their effects on DNA are controversial. The objective of this work was to evaluate effects of low intensity infrared laser exposure on survival and bacterial filamentation in Escherichia coli cultures, and induction of DNA lesions in bacterial plasmids. In E. coli cultures and plasmids exposed to an infrared laser at fluences used to treat pain, bacterial survival and filamentation and DNA lesions in plasmids were evaluated by electrophoretic profile. Data indicate that the infrared laser (i) increases survival of E. coli wild type in 24 h of stationary growth phase, (ii) induces bacterial filamentation, (iii) does not alter topological forms of plasmids and (iv) does not alter the electrophoretic profile of plasmids incubated with exonuclease III or formamidopyrimidine DNA glycosylase. A low intensity infrared laser at the therapeutic fluences used to treat pain can alter survival of E. coli wild type, induce filamentation in bacterial cells, depending on physiologic conditions and DNA repair, and induce DNA lesions other than single or double DNA strand breaks or alkali-labile sites, which are not targeted by exonuclease III or formamidopyrimidine DNA glycosylase. (letter)

  6. Damage of plasmid DNA by high energy ions

    International Nuclear Information System (INIS)

    Michaelidesova, A.; Pachnerova Brabcova, K.; Davidkova, M.

    2018-01-01

    The aim of the study was to determine the degree of direct DNA damage by high-energy ions, which are one of the components of cosmic rays, and therefore the knowledge of the biological effects of these ions is key to long-term space missions with human crew. The pBR322 plasmid containing 4361 base pairs was used in this study. The aqueous solution of plasmid pBR322 was transferred on ice to Japan to the Heavy Ion Medical Accelerator in Chiba, the Research Center for Charged Particle Therapy. Just before the experiment, the droplets of solution of known concentration were applied to the slides and the water was allowed to evaporate to produce dry DNA samples. Half of the slides were irradiated with 290 MeV/u of carbon ions and a dose rate of 20 Gy/min. The other half of the slides were irradiated with helium nuclei of 150 MeV/hr and a dose rate of 12.6 Gy/min. Both sets of slides were irradiated with doses of 0-1,400 Gy with a 200 Gy step. After irradiation, the samples were re-dissolved in distilled water, frozen and transported on ice to the Czech Republic for processing. Samples were analyzed by agarose gel electrophoresis. The plasmid was evaluated separately to determine the degree of radiation induced lesions and further to incubation with enzymes recognizing basal damage. (authors)

  7. Plasmid DNA damage caused by stibine and trimethylstibine

    International Nuclear Information System (INIS)

    Andrewes, Paul; Kitchin, Kirk T.; Wallace, Kathleen

    2004-01-01

    Antimony is classified as 'possibly carcinogenic to humans' and there is also sufficient evidence for antimony carcinogenicity in experimental animals. Stibine is a volatile inorganic antimony compound to which humans can be exposed in occupational settings (e.g., lead-acid battery charging). Because it is highly toxic, stibine is considered a significant health risk; however, its genotoxicity has received little attention. For the work reported here, stibine was generated by sodium borohydride reduction of potassium antimony tartrate. Trimethylstibine is a volatile organometallic antimony compound found commonly in landfill and sewage fermentation gases at concentrations ranging between 0.1 and 100 μg/m 3 . Trimethylstibine is generally considered to pose little environmental or health risk. In the work reported here, trimethylstibine was generated by reduction of trimethylantimony dichloride using either sodium borohydride or the thiol compounds, dithioerythritol (DTE), L-cysteine, and glutathione. Here we report the evaluation of the in vitro genotoxicities of five antimony compounds--potassium antimony tartrate, stibine, potassium hexahydroxyantimonate, trimethylantimony dichloride, and trimethylstibine--using a plasmid DNA-nicking assay. Of these five antimony compounds, only stibine and trimethylstibine were genotoxic (significant nicking to pBR 322 plasmid DNA). We found stibine and trimethylstibine to be about equipotent with trimethylarsine using this plasmid DNA-nicking assay. Reaction of trimethylantimony dichloride with either glutathione or L-cysteine to produce DNA-damaging trimethylstibine was observed with a trimethylantimony dichloride concentration as low as 50 μM and L-cysteine or glutathione concentrations as low as 500 and 200 μM, respectively, for a 24 h incubation

  8. Very low-energy and low-fluence ion beam bombardment of naked plasmid DNA

    International Nuclear Information System (INIS)

    Norarat, R.; Semsang, N.; Anuntalabhochai, S.; Yu, L.D.

    2009-01-01

    Ion beam bombardment of biological organisms has been recently applied to mutation breeding of both agricultural and horticultural plants. In order to explore relevant mechanisms, this study employed low-energy ion beams to bombard naked plasmid DNA. The study aimed at simulation of the final stage of the process of the ion beam bombardment of real cells to check whether and how very low-energy and low-fluence of ions can induce mutation. Argon and nitrogen ions at 5 keV and 2.5 keV respectively bombarded naked plasmid DNA pGFP to very low-fluences, an order of 10 13 ions/cm 2 . Subsequently, DNA states were analyzed using electrophoresis. Results provided evidences that the very low-energy and low-fluence ion bombardment indeed altered the DNA structure from supercoil to short linear fragments through multiple double strand breaks and thus induced mutation, which was confirmed by transfer of the bombarded DNA into bacteria Escherichia coli and subsequent expression of the marker gene.

  9. Chemical and biological consequences of the radioactive decay of iodine-125 in plasmid DNA

    International Nuclear Information System (INIS)

    Linz, U.

    1983-09-01

    The consequences of the decay of iodine-125 incorporated into DNA were studied on a molecular basis. Doubly ( 14 C and 125 I) labelled 5-iodo-2'-deoxycytidine 5'-triphosphate (IdCTP) was synthesized and incorporated enzymatically into the SalI-cutting site of the plasmid pBR 322. Part of the radioiodinated DNA was treated with T4-DNA ligase in order to restore the circular structure of the native plasmid molecule. After 4 months of storage under various conditions the stable end products were analyzed by radio GC, radio HPLC and electron microscopy. The experiments were not only carried out with doubly-labelled DNA but also with solutions of 14 C-labelled DNA containing Na 125 I as internal radiation source. The results clearly indicate that radiolysis alone causes only minor damage. Transmutation of the covalently bound iodine, on the other hand, leads to complete destruction of the labelled nucleotide, giving rise to 14 CO 2 and 14 CO as main products. The production of 14 CO 2 which originates from both the base as well as the sugar component shows a strong solvent effect. The electron microscopy analysis of the DNA reveals that the local effects are always connected with at least one double strand break directly at the site of decay. In addition, one finds DNA double strand breaks in areas which are hundreds of base pairs apart from that site. Under certain circumstances most of the DNA molecules exhibit up to 10 breaks. A comparison between ligase-treated and untreated DNA shows that the configuration of the DNA and the position of the labelled nucleotide play in important role in the extent of the overall damage. It could be demonstrated that there is a linear correlation between gaseous fragmentation products and the number of double strand breaks. (orig./MG) [de

  10. Supramolecular gel electrophoresis of large DNA fragments.

    Science.gov (United States)

    Tazawa, Shohei; Kobayashi, Kazuhiro; Oyoshi, Takanori; Yamanaka, Masamichi

    2017-10-01

    Pulsed-field gel electrophoresis is a frequent technique used to separate exceptionally large DNA fragments. In a typical continuous field electrophoresis, it is challenging to separate DNA fragments larger than 20 kbp because they migrate at a comparable rate. To overcome this challenge, it is necessary to develop a novel matrix for the electrophoresis. Here, we describe the electrophoresis of large DNA fragments up to 166 kbp using a supramolecular gel matrix and a typical continuous field electrophoresis system. C 3 -symmetric tris-urea self-assembled into a supramolecular hydrogel in tris-boric acid-EDTA buffer, a typical buffer for DNA electrophoresis, and the supramolecular hydrogel was used as a matrix for electrophoresis to separate large DNA fragments. Three types of DNA marker, the λ-Hind III digest (2 to 23 kbp), Lambda DNA-Mono Cut Mix (10 to 49 kbp), and Marker 7 GT (10 to 165 kbp), were analyzed in this study. Large DNA fragments of greater than 100 kbp showed distinct mobility using a typical continuous field electrophoresis system. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Preparation of a differentially expressed, full-length cDNA expression library by RecA-mediated triple-strand formation with subtractively enriched cDNA fragments

    NARCIS (Netherlands)

    Hakvoort, T. B.; Spijkers, J. A.; Vermeulen, J. L.; Lamers, W. H.

    1996-01-01

    We have developed a fast and general method to obtain an enriched, full-length cDNA expression library with subtractively enriched cDNA fragments. The procedure relies on RecA-mediated triple-helix formation of single-stranded cDNA fragments with a double-stranded cDNA plasmid library. The complexes

  12. Fragmentation in DNA double-strand breaks

    International Nuclear Information System (INIS)

    Wei Zhiyong; Suzhou Univ., Suzhou; Zhang Lihui; Li Ming; Fan Wo; Xu Yujie

    2005-01-01

    DNA double strand breaks are important lesions induced by irradiations. Random breakage model or quantification supported by this concept is suitable to analyze DNA double strand break data induced by low LET radiation, but deviation from random breakage model is more evident in high LET radiation data analysis. In this work we develop a new method, statistical fragmentation model, to analyze the fragmentation process of DNA double strand breaks. After charged particles enter the biological cell, they produce ionizations along their tracks, and transfer their energies to the cells and break the cellular DNA strands into fragments. The probable distribution of the fragments is obtained under the condition in which the entropy is maximum. Under the approximation E≅E 0 + E 1 l + E 2 l 2 , the distribution functions are obtained as exp(αl + βl 2 ). There are two components, the one proportional to exp(βl 2 ), mainly contributes to the low mass fragment yields, the other component, proportional to exp(αl), decreases slowly as the mass of the fragments increases. Numerical solution of the constraint equations provides parameters α and β. Experimental data, especially when the energy deposition is higher, support the statistical fragmentation model. (authors)

  13. Repair of UV-irradiated plasmid DNA in excision repair deficient mutants of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Ikai, K.; Tano, K.; Ohnishi, T.; Nozu, K.

    1985-01-01

    The repair of UV-irradiated DNA of plasmid YEp13 was studied in the incision defective strains by measurement of cell transformation frequency. In Saccharomyces cerevisiae, rad1,2,3 and 4 mutants could repair UV-damaged plasmid DNA. In Escherichia coli, uvrA mutant was unable to repair UV-damaged plasmid DNA; however, pretreatment of the plasmid with Micrococcus luteus endonuclease increased repair. It was concluded that all the mutations of yeast were probably limited only to the nuclear DNA. (author)

  14. Quantification bias caused by plasmid DNA conformation in quantitative real-time PCR assay.

    Science.gov (United States)

    Lin, Chih-Hui; Chen, Yu-Chieh; Pan, Tzu-Ming

    2011-01-01

    Quantitative real-time PCR (qPCR) is the gold standard for the quantification of specific nucleic acid sequences. However, a serious concern has been revealed in a recent report: supercoiled plasmid standards cause significant over-estimation in qPCR quantification. In this study, we investigated the effect of plasmid DNA conformation on the quantification of DNA and the efficiency of qPCR. Our results suggest that plasmid DNA conformation has significant impact on the accuracy of absolute quantification by qPCR. DNA standard curves shifted significantly among plasmid standards with different DNA conformations. Moreover, the choice of DNA measurement method and plasmid DNA conformation may also contribute to the measurement error of DNA standard curves. Due to the multiple effects of plasmid DNA conformation on the accuracy of qPCR, efforts should be made to assure the highest consistency of plasmid standards for qPCR. Thus, we suggest that the conformation, preparation, quantification, purification, handling, and storage of standard plasmid DNA should be described and defined in the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) to assure the reproducibility and accuracy of qPCR absolute quantification.

  15. Use of Ti plasmid DNA probes for determining tumorigenicity of agrobacterium strains

    International Nuclear Information System (INIS)

    Burr, T.J.; Norelli, J.L.; Katz, B.H.; Bishop, A.L.

    1990-01-01

    Probes consisting of T-DNA genes from the Ti plasmid of Agrobacterium tumefaciens were used for determining tumorigenicity of strains. Two 32 P-labeled probes hybridized with 28 of 28 tumorigenic strains of the pathogen but not with 20 of 22 nontumorigenic strains. One probe, pTHE17, consists of all but the far left portion of the T-DNA of strain C58. Probe SmaI7 consists of SmaI fragment 7 of pTiC58, including onc genes 1, 4, and 6a and most of 2. Another probe, pAL4044, consisting of the vir region of strain Ach-5, hybridized with several nontumorigenic as well as tumorigenic strains. Colony hybridizations were done with 28 tumorigenic and 22 nontumorigenic Agrobacterium strains. About 10 6 CFU of the different tumorigenic strains were detectable with this method. Southern analyses confirmed the presence or absence of Ti plasmids in strains for which tumorigenicity was questioned. Colony hybridization with the T-DNA probes provides a rapid and sensitive means for determining the tumorigenic nature of Agrobacterium strains

  16. Effect of the atmospheric pressure nonequilibrium plasmas on the conformational changes of plasmid DNA

    International Nuclear Information System (INIS)

    Yan Xu; He Guangyuan; Shi Mengjun; Gao Xuan; Li Yin; Ma Fengyun; Yu Men; Wang Changdong; Wang Yuesheng; Yang Guangxiao; Zou Fei; Lu Xinpei; Xiong Qing; Xiong Zilan

    2009-01-01

    The cold atmospheric pressure plasma, which has been widely used for biomedical applications, may potentially affect the conformation of DNA. In this letter, an atmospheric pressure plasma plume is used to investigate its effects on the conformational changes of DNA of plasmid pAHC25. It is found that the plasma plume could cause plasmid DNA topology alteration, resulting in the percentage of the supercoiled plasmid DNA form decreased while that of the open circular and linearized form of plasmid DNA increased as detected by agrose gel electrophoresis. On the other hand, further investigation by using polymerase chain reaction method shows that the atmospheric pressure plasma jet treatments under proper conditions does not affect the genes of the plasmid DNA, which may have potential application in increasing the transformation frequency by genetic engineering.

  17. Plasmid-derived DNA Strand Displacement Gates for Implementing Chemical Reaction Networks.

    Science.gov (United States)

    Chen, Yuan-Jyue; Rao, Sundipta D; Seelig, Georg

    2015-11-25

    DNA nanotechnology requires large amounts of highly pure DNA as an engineering material. Plasmid DNA could meet this need since it is replicated with high fidelity, is readily amplified through bacterial culture and can be stored indefinitely in the form of bacterial glycerol stocks. However, the double-stranded nature of plasmid DNA has so far hindered its efficient use for construction of DNA nanostructures or devices that typically contain single-stranded or branched domains. In recent work, it was found that nicked double stranded DNA (ndsDNA) strand displacement gates could be sourced from plasmid DNA. The following is a protocol that details how these ndsDNA gates can be efficiently encoded in plasmids and can be derived from the plasmids through a small number of enzymatic processing steps. Also given is a protocol for testing ndsDNA gates using fluorescence kinetics measurements. NdsDNA gates can be used to implement arbitrary chemical reaction networks (CRNs) and thus provide a pathway towards the use of the CRN formalism as a prescriptive molecular programming language. To demonstrate this technology, a multi-step reaction cascade with catalytic kinetics is constructed. Further it is shown that plasmid-derived components perform better than identical components assembled from synthetic DNA.

  18. Photoresponsive Bridged Silsesquioxane Nanoparticles with Tunable Morphology for Light-Triggered Plasmid DNA Delivery

    KAUST Repository

    Fatieiev, Yevhen; Croissant, Jonas G.; Alsaiari, Shahad K.; Moosa, Basem; Anjum, Dalaver H.; Khashab, Niveen M.

    2015-01-01

    Bridged silsesquioxane nanocomposites with tunable morphologies incorporating o-nitrophenylene-ammonium bridges are described. The systematic screening of the sol-gel parameters allowed the material to reach the nanoscale –unlike most reported bridged silsesquioxane materials– with controlled dense and hollow structures of 100 to 200 nm. The hybrid composition of silsesquioxanes with 50% of organic content homogenously distributed in the nanomaterials endowed them with photoresponsive properties. Light irradiation was performed to reverse the surface charge of nanoparticles from +46 to -39 mV via the photoreaction of the organic fragments within the particles, as confirmed by spectroscopic monitorings. Furthermore, such NPs were ap-plied for the first time for the on-demand delivery of plasmid DNA in HeLa cancer cells via light actuation.

  19. Photoresponsive Bridged Silsesquioxane Nanoparticles with Tunable Morphology for Light-Triggered Plasmid DNA Delivery

    KAUST Repository

    Fatieiev, Yevhen

    2015-09-25

    Bridged silsesquioxane nanocomposites with tunable morphologies incorporating o-nitrophenylene-ammonium bridges are described. The systematic screening of the sol-gel parameters allowed the material to reach the nanoscale –unlike most reported bridged silsesquioxane materials– with controlled dense and hollow structures of 100 to 200 nm. The hybrid composition of silsesquioxanes with 50% of organic content homogenously distributed in the nanomaterials endowed them with photoresponsive properties. Light irradiation was performed to reverse the surface charge of nanoparticles from +46 to -39 mV via the photoreaction of the organic fragments within the particles, as confirmed by spectroscopic monitorings. Furthermore, such NPs were ap-plied for the first time for the on-demand delivery of plasmid DNA in HeLa cancer cells via light actuation.

  20. Resident enhanced repair: novel repair process action on plasmid DNA transformed into Escherichia coli K-12

    International Nuclear Information System (INIS)

    Strike, P.; Roberts, R.J.

    1982-01-01

    The survival of UV-irradiated DNA of plasmid NTP16 was monitored after its transformation into recipient cells containing an essentially homologous undamaged plasmid, pLV9. The presence of pLV9 resulted in a substantial increase in the fraction of damaged NTP16 molecules which survived in the recipient cells. This enhanced survival requires the host uvrA + and uvrB + gene products, but not the host recA + gene product. The requirement for both homologous DNA and the uvrA + gene products suggests that a novel repair process may act on plasmid DNA. Possible mechanisms for this process are considered

  1. TOL plasmid carriage enhances biofilm formation and increases extracellular DNA content in Pseudomonas putida KT2440

    DEFF Research Database (Denmark)

    D'Alvise, Paul; Sjoholm, O.R.; Yankelevich, T.

    2010-01-01

    laser scanning microscopy. The TOL-carrying strains formed pellicles and thick biofilms, whereas the same strains without the plasmid displayed little adherent growth. Microscopy using fluorescent nucleic acid-specific stains revealed differences in the production of extracellular polymeric substances......: TOL carriage leads to more extracellular DNA (eDNA) in pellicles and biofilms. Pellicles were dissolved by DNase I treatment. Enhanced cell lysis due to plasmid carriage was ruled out as the mechanism for eDNA release. We report, for the first time, that carriage of a conjugative plasmid leads...

  2. 3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

    Science.gov (United States)

    Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

    2008-09-01

    We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

  3. Plasmid DNA damage by heavy ions at spread-out Bragg peak energies

    NARCIS (Netherlands)

    Dang, H. M.; van Goethem, M. J.; van der Graaf, E. R.; Brandenburg, S.; Hoekstra, R.; Schlatholter, T.

    2010-01-01

    Interaction of ionizing radiation with plasmid DNA can lead to formation of single strand breaks, double strand breaks and clustered lesions. We have investigated the response of the synthetic plasmid pBR322 in aqueous solution upon irradiation with (12)C ions under spread-out Bragg peak conditions

  4. Characterization of Plasmid DNA Location within Chitosan/PLGA/pDNA Nanoparticle Complexes Designed for Gene Delivery

    Directory of Open Access Journals (Sweden)

    Hali Bordelon

    2011-01-01

    Full Text Available Poly(D,L-lactide-co-glycolide- (PLGA-chitosan nanoparticles are becoming an increasingly common choice for the delivery of nucleic acids to cells for various genetic manipulation techniques. These particles are biocompatible, with tunable size and surface properties, possessing an overall positive charge that promotes complex formation with negatively charged nucleic acids. This study examines properties of the PLGA-chitosan nanoparticle/plasmid DNA complex after formation. Specifically, the study aims to determine the optimal ratio of plasmid DNA:nanoparticles for nucleic acid delivery purposes and to elucidate the location of the pDNA within these complexes. Such characterization will be necessary for the adoption of these formulations in a clinical setting. The ability of PLGA-chitosan nanoparticles to form complexes with pDNA was evaluated by using the fluorescent intercalating due OliGreen to label free plasmid DNA. By monitoring the fluorescence at different plasmid: nanoparticle ratios, the ideal plasmid:nanoparticle ration for complete complexation of plasmid was determined to be 1:50. Surface-Enhanced Raman Spectroscopy and gel digest studies suggested that even at these optimal complexation ratios, a portion of the plasmid DNA was located on the outer complex surface. This knowledge will facilitate future investigations into the functionality of the system in vitro and in vivo.

  5. Photo-transfection of mouse embryonic stem cells with plasmid DNA using femtosecond laser pulses

    CSIR Research Space (South Africa)

    Thobakgale, Lebogang

    2017-01-01

    Full Text Available This presentation is about the photo-transfection of mouse embryonic stem cells with plasmid DNA using femtosecond laser pulses. It outlines the background on embryonic stem cells (ES) and phototransfection....

  6. Optimizing hyaluronidase dose and plasmid DNA delivery greatly improves gene electrotransfer efficiency in rat skeletal muscle

    DEFF Research Database (Denmark)

    Åkerström, Thorbjörn; Vedel, Kenneth; Needham Andersen, Josefine

    2015-01-01

    Transfection of rat skeletal muscle in vivo is a widely used research model. However, gene electrotransfer protocols have been developed for mice and yield variable results in rats. We investigated whether changes in hyaluronidase pre-treatment and plasmid DNA delivery can improve transfection...... with a homogenous distribution. We also show that transfection was stable over five weeks of regular exercise or inactivity. Our findings show that species-specific plasmid DNA delivery and hyaluronidase pre-treatment greatly improves transfection efficiency in rat skeletal muscle....... efficiency in rat skeletal muscle. We found that pre-treating the muscle with a hyaluronidase dose suitable for rats (0.56. U/g b.w.) prior to plasmid DNA injection increased transfection efficiency by >200% whereas timing of the pre-treatment did not affect efficiency. Uniformly distributing plasmid DNA...

  7. Plasmid DNA Analysis of Pasteurella multocida Serotype B isolated from Haemorrhagic Septicaemia outbreaks in Malaysia

    Directory of Open Access Journals (Sweden)

    Jamal, H.

    2005-01-01

    Full Text Available A total of 150 purified isolates of Pasteurella multocida serotype B were used (Salmah, 2004 for plasmid DNA curing experiment to determine hyaluronidase activity, antibiotic resistance pattern (ARP and mice lethality test (LD50 for their role of pathogenicity. A plasmid curing experiment was carried out by using the intercalating agent; ethidium bromide and rifampicin, where it was found all the plasmids had been cured (plasmidless from Pasteurella multocida. All of these plasmidless isolates maintained their phenotypic characteristics. They showed the same antibiotic resistancepattern as before curing, produced hyaluronidase and possessed lethality activity in mice when injected intraperitoneally(i.p. Based on this observation, the antibiotic resistance, hyaluronidase activity and mice virulence could probably be chromosomal-mediated. Plasmids were detected 100% in all P. multocida isolates with identical profile of 2 plasmids size 3.0 and 5.5 kb. No large plasmids could be detected in all isolates. Since all the isolates appeared to have identicalplasmid profiles, they were subjected to restriction enzyme(RE analysis. From RE analysis results obtained, it can be concluded that the plasmid DNA in serotype B isolates are identical. Only 4 of 32 REs were found to cleave these plasmids with identical restriction fingerprints; BglII, HaeIII, RsaI and SspI. From RE analysis results, it can be concluded that the plasmid DNA isolates are identical. This plasmid might not played any role in pathogenicity of Pasteurella multocida serotype B, however this information is important for the construction of shuttle vectors in genetic studies of the pathogenicity of haemorrhagic septicaemia(HS.

  8. Construction of Biologically Functional Bacterial Plasmids In Vitro

    Science.gov (United States)

    Cohen, Stanley N.; Chang, Annie C. Y.; Boyer, Herbert W.; Helling, Robert B.

    1973-01-01

    The construction of new plasmid DNA species by in vitro joining of restriction endonuclease-generated fragments of separate plasmids is described. Newly constructed plasmids that are inserted into Escherichia coli by transformation are shown to be biologically functional replicons that possess genetic properties and nucleotide base sequences from both of the parent DNA molecules. Functional plasmids can be obtained by reassociation of endonuclease-generated fragments of larger replicons, as well as by joining of plasmid DNA molecules of entirely different origins. Images PMID:4594039

  9. Menadione-induced DNA fragmentation without 8-hydroxy-2'-deoxyguanosine formation in isolated rat hepatocytes

    DEFF Research Database (Denmark)

    Fischer-Nielsen, Anne; Corcoran, George B.; Poulsen, Henrik E.

    1995-01-01

    Farmakologi, frie iltradikaler, menadion, DNA fragmentering, rotteleverceller, oksidativ DNA skade......Farmakologi, frie iltradikaler, menadion, DNA fragmentering, rotteleverceller, oksidativ DNA skade...

  10. Directly Transforming PCR-Amplified DNA Fragments into Plant Cells Is a Versatile System That Facilitates the Transient Expression Assay

    Science.gov (United States)

    Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan

    2013-01-01

    A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells. PMID:23468926

  11. Directly transforming PCR-amplified DNA fragments into plant cells is a versatile system that facilitates the transient expression assay.

    Directory of Open Access Journals (Sweden)

    Yuming Lu

    Full Text Available A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments based transient expression system (PCR-TES for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells.

  12. High efficiency hydrodynamic DNA fragmentation in a bubbling system

    NARCIS (Netherlands)

    Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; Van Den Berg, Albert; Eijkel, Jan C.T.; Shui, Lingling

    2017-01-01

    DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling

  13. Purification of supercoiled DNA of plasmid Col E1 by RPC-5 chromatography

    Energy Technology Data Exchange (ETDEWEB)

    Best, A.N.; Allison, D.P.; Novelli, G.D.

    1981-07-01

    Col E1 DNA can be purified to a high degree by RPC-5 chromatography of a partially purified cell lysate with a very shallow linear NaC1 gradient at pH 7.8. Electron micrographs demonstrated that the purest fractions were composed of 93% supercoiled (form I) DNA and 7% open circular (form II) DNA. The actual chromatography can be accomplished in 13 to 14 h and is designed for the production of several milligrams of plasmid DNA.

  14. Plasmid containing a DNA ligase gene from Haemophilus influenzae

    International Nuclear Information System (INIS)

    McCarthy, D.; Griffin, K.; Setlow, J.K.

    1984-01-01

    A ligase gene from Haemophilus influenzae was cloned into the shuttle vector pDM2. Although the plasmid did not affect X-ray sensitivity, it caused an increase in UV sensitivity of the wild-type but not excision-defective H. influenzae and a decrease in UV sensitivity of the rec-1 mutant. 14 references, 2 figures

  15. Breaks in plasmid DNA strand induced by laser radiation at a wavelength of 193 nm

    International Nuclear Information System (INIS)

    Gurzadyan, G.G.; Shul'te Frolinde, D.

    1996-01-01

    DNA of plasmid pB322 irradiated with laser at a wavelength of 193 nm was treated with an extract containing proteins from E.coli K12 AB1157 (wild-type). The enzymes were found to produce single- and double-strand DNA breaks, which was interpreted as a transformation of a portion of cyclobutane pyrimidine dimers and (6-4) photoproducts into nonrepairable single-strand DNA breaks. The products resulted from ionization of DNA, in particular, single-strand breaks, transform to double-strand breaks. A comparison of these data with the data on survival of plasmid upon transformation of E.coli K12 AB1157 enables one to assess the biological significance of single- and double-strand breaks. The inactivation of the plasmid is mainly determined by the number of directly formed laser-induced single-strand breaks. 26 refs.; 2 figs

  16. Autonomous replication of plasmids bearing monkey DNA origin-enriched sequences

    International Nuclear Information System (INIS)

    Frappier, L.; Zannis-Hadjopoulos, M.

    1987-01-01

    Twelve clones of origin-enriched sequences (ORS) isolated from early replicating monkey (CV-1) DNA were examined for transient episomal replication in transfected CV-1, COS-7, and HeLa cells. Plasmid DNA was isolated at time intervals after transfection and screened by the Dpn I resistance assay or by the bromodeoxyuridine substitution assay to differentiate between input and replicated DNA. The authors have identified four monkey ORS (ORS3, -8, -9, and -12) that can support plasmid replication in mammalian cells. This replication is carried out in a controlled and semiconservative manner characteristic of mammalian replicons. ORS replication was most efficient in HeLa cells. Electron microscopy showed ORS8 and ORS12 plasmids of the correct size with replication bubbles. Using a unique restriction site in ORS12, we have mapped the replication bubble within the monkey DNA sequence

  17. TOL Plasmid Carriage Enhances Biofilm Formation and Increases Extracellular DNA Content in Pseudomonas Putida KT2440

    DEFF Research Database (Denmark)

    Smets, Barth F.; D'Alvise, Paul; Yankelovich, T.

    laser scanning microscopy. The TOL-carrying strains formed pellicles and thick biofilms, whereas the same strains without the plasmid displayed little adherent growth. Microscopy using fluorescent nucleic acid- specific stains (cytox orange, propidium iodide) revealed differences in production...... combined with specific cytostains; release of cytoplasmic material was assayed by a β-glucosidase assay. Enhanced cell lysis due to plasmid carriage was ruled out as the mechanism for eDNA release. We report, for the first time, that carriage of a conjugative plasmid leads to increased biofilm formation...

  18. Heavy ion induced damage to plasmid DNA : plateau region vs. spread out Bragg-peak

    NARCIS (Netherlands)

    Dang, H.M.; van Goethem, M.J.; van der Graaf, E.R.; Brandenburg, S.; Hoekstra, R.A.; Schlathölter, T.A.

    We have investigated the damage of synthetic plasmid pBR322 DNA in dilute aqueous solutions induced by fast carbon ions. The relative contribution of indirect damage and direct damage to the DNA itself is expected to vary with linear energy transfer along the ion track, with the direct damage

  19. Persistence of plasmids, cholera toxin genes, and prophage DNA in classical Vibrio cholerae O1.

    Science.gov (United States)

    Cook, W L; Wachsmuth, K; Johnson, S R; Birkness, K A; Samadi, A R

    1984-07-01

    Plasmid profiles, the location of cholera toxin subunit A genes, and the presence of the defective VcA1 prophage genome in classical Vibrio cholerae isolated from patients in Bangladesh in 1982 were compared with those in older classical strains isolated during the sixth pandemic and with those in selected eltor and nontoxigenic O1 isolates. Classical strains typically had two plasmids (21 and 3 megadaltons), eltor strains typically had no plasmids, and nontoxigenic O1 strains had zero to three plasmids. The old and new isolates of classical V. cholerae had two HindIII chromosomal digest fragments containing cholera toxin subunit A genes, whereas the eltor strains from Eastern countries had one fragment. The eltor strains from areas surrounding the Gulf of Mexico also had two subunit A gene fragments, which were smaller and easily distinguished from the classical pattern. All classical strains had 8 to 10 HindIII fragments containing the defective VcA1 prophage genome; none of the Eastern eltor strains had these genes, and the Gulf Coast eltor strains contained a different array of weakly hybridizing genes. These data suggest that the recent isolates of classical cholera in Bangladesh are closely related to the bacterial strain(s) which caused classical cholera during the sixth pandemic. These data do not support hypotheses that either the eltor or the nontoxigenic O1 strains are precursors of the new classical strains.

  20. The effects of a low-intensity red laser on bacterial growth, filamentation and plasmid DNA

    International Nuclear Information System (INIS)

    Roos, C; Santos, J N; Guimarães, O R; Geller, M; Fonseca, A S; Paoli, F

    2013-01-01

    Exposure of nonphotosynthesizing microorganisms to light could increase cell division in cultures, a phenomenon denominated as biostimulation. However, data concerning the importance of the genetic characteristics of cells on this effect are as yet scarce. The aim of this work was to evaluate the effects of a low-intensity red laser on the growth, filamentation and plasmids in Escherichia coli cells proficient and deficient in DNA repair. E. coli cultures were exposed to a laser (658 nm, 10 mW, 1 and 8 J cm −2 ) to study bacterial growth and filamentation. Also, bacterial cultures hosting pBSK plasmids were exposed to the laser to study DNA topological forms from the electrophoretic profile in agarose gels. Data indicate the low-intensity red laser: (i) had no effect on the growth of E. coli wild type and exonuclease III deficient cells; (ii) induced bacterial filamentation, (iii) led to no alteration in the electrophoretic profile of plasmids from exonuclease III deficient cells, but plasmids from wild type cells were altered. A low-intensity red laser at the low fluences used in phototherapy has no effect on growth, but induces filamentation and alters the topological forms of plasmid DNA in E. coli cultures depending on the DNA repair mechanisms. (paper)

  1. Evaluation of plasmid and genomic DNA calibrants used for the quantification of genetically modified organisms.

    Science.gov (United States)

    Caprioara-Buda, M; Meyer, W; Jeynov, B; Corbisier, P; Trapmann, S; Emons, H

    2012-07-01

    The reliable quantification of genetically modified organisms (GMOs) by real-time PCR requires, besides thoroughly validated quantitative detection methods, sustainable calibration systems. The latter establishes the anchor points for the measured value and the measurement unit, respectively. In this paper, the suitability of two types of DNA calibrants, i.e. plasmid DNA and genomic DNA extracted from plant leaves, for the certification of the GMO content in reference materials as copy number ratio between two targeted DNA sequences was investigated. The PCR efficiencies and coefficients of determination of the calibration curves as well as the measured copy number ratios for three powder certified reference materials (CRMs), namely ERM-BF415e (NK603 maize), ERM-BF425c (356043 soya), and ERM-BF427c (98140 maize), originally certified for their mass fraction of GMO, were compared for both types of calibrants. In all three systems investigated, the PCR efficiencies of plasmid DNA were slightly closer to the PCR efficiencies observed for the genomic DNA extracted from seed powders rather than those of the genomic DNA extracted from leaves. Although the mean DNA copy number ratios for each CRM overlapped within their uncertainties, the DNA copy number ratios were significantly different using the two types of calibrants. Based on these observations, both plasmid and leaf genomic DNA calibrants would be technically suitable as anchor points for the calibration of the real-time PCR methods applied in this study. However, the most suitable approach to establish a sustainable traceability chain is to fix a reference system based on plasmid DNA.

  2. Functionalized tetrapod-like ZnO nanostructures for plasmid DNA purification, polymerase chain reaction and delivery

    International Nuclear Information System (INIS)

    Nie Leng; Gao Lizeng; Yan Xiyun; Wang Taihong

    2007-01-01

    Functionalized tetrapodal ZnO nanostructures are tested in plasmid DNA experiments (1) as a solid-phase adsorbent for plasmid DNA purification (2) as improving reagents in a polymerase chain reaction (PCR) and (3) as novel carriers for gene delivery. The amino-modification, the tetrapod-like shape of the nanostructure and its high biocompatibility all contribute to measurements showing promise for applications. A sol-gel method is used for silica coating and amino-modification. Plasmid DNA is purified through reversible conjugations of amino-modified ZnO tetrapods with DNA. Also, as additional reagents, functionalized tetrapods are shown to improve the amount of PCR product. For transfection, ZnO tetrapods provide some protection against deoxyribonuclease cleavage of plasmid DNA and deliver plasmid DNA into cells with little cytotoxicity

  3. Effect of the caffeine on treated and non-treated plasmid DNA with stannic chloride

    International Nuclear Information System (INIS)

    Moreno, Silvana Ramos F.; Universidade Federal Fluminense, Niteroi, RJ; Mattos, Jose C.P. de; Dantas, Flavio; Araujo, Adriano Caldeira de; Bernardo-Filho, Mario

    2000-01-01

    Caffeine, a methilxantine drug is a component of coffee, tea, stimulants and other drinks. Caffeine inhibits phosphodiesterase leading to intracellular accumulation of cyclic AMP, blocks adenosine receptors, and increases the release of Ca 2+ . We have studied the possible effect of caffeine in DNA plasmid treated or not with stannous chloride (SnCl 2 ). Previous evaluations of the effect of caffeine on the labeling of red blood cells and plasma proteins with technetium-99m have showed a decrease of % ATI in the insoluble fraction of plasma proteins. Samples of DNA were treated with SnCl 2 (0 and 200μg/ml) in 0.8% agarose. SnCl 2 has induced break on DNA and caffeine has not showed effect on the DNA. This indicates that caffeine does not eliminate the oxidant action of SnCl 2 and does not promote break in isolated DNA plasmid. (author)

  4. Protection of vanillin derivative VND3207 on plasmid DNA damage induced by different LET ionizing radiation

    International Nuclear Information System (INIS)

    Xu Huihui; Wang Li; Sui Li; Guan Hua; Wang Yu; Liu Xiaodan; Zhang Shimeng; Xu Qinzhi; Wang Xiao; Zhou Pingkun

    2011-01-01

    Objective: To evaluate the radioprotective effect of vanillin derivative VND3207 on DNA damage induced by different LET ionizing radiation. Methods: The plasmid DNA in liquid was irradiated by 60 Co γ-rays, proton or 7 Li heavy ion with or without VND3207. The conformation changes of plasmid DNA were assessed by agarose gel electrophoresis and the quantification was done using gel imaging system. Results: The DNA damage induced by proton and 7 Li heavy ion was much more serious as compared with that by 60 Co γ-rays, and the vanillin derivative VND3207 could efficiently decrease the DNA damage induced by all three types of irradiation sources, which was expressed as a significantly reduced ratio of open circular form (OC) of plasmid DNA. The radioprotective effect of VND3207 increased with the increasing of drug concentration. The protective efficiencies of 200 μmol/L VND3207 were 85.3% (t =3.70, P=0.033), 73.3% (t=10.58, P=0.017) and 80.4% (t=8.57, P=0.008) on DNA damage induction by 50 Gy of γ-rays, proton and 7 Li heavy ion, respectively. It seemed that the radioprotection of VND3207 was more effective on DNA damage induced by high LET heavy ion than that by proton. Conclusions: VND3207 has a protective effect against the genotoxicity of different LET ionizing radiation, especially for γ-rays and 7 Li heavy ion. (authors)

  5. Ca2+ promoted the low transformation efficiency of plasmid DNA exposed to PAH contaminants.

    Directory of Open Access Journals (Sweden)

    Fuxing Kang

    Full Text Available The effects of interactions between genetic materials and polycyclic aromatic hydrocarbons (PAHs on gene expression in the extracellular environment remain to be elucidated and little information is currently available on the effect of ionic strength on the transformation of plasmid DNA exposed to PAHs. Phenanthrene and pyrene were used as representative PAHs to evaluate the transformation of plasmid DNA after PAH exposure and to determine the role of Ca(2+ during the transformation. Plasmid DNA exposed to the test PAHs demonstrated low transformation efficiency. In the absence of PAHs, the transformation efficiency was 4.7 log units; however, the efficiency decreased to 3.72-3.14 log units with phenanthrene/pyrene exposures of 50 µg · L(-1. The addition of Ca(2+ enhanced the low transformation efficiency of DNA exposed to PAHs. Based on the co-sorption of Ca(2+ and phenanthrene/pyrene by DNA, we employed Fourier-transform infrared spectroscopy (FTIR, X-ray photoelectron spectroscopy (XPS, and mass spectrometry (MS to determine the mechanisms involved in PAH-induced DNA transformation. The observed low transformation efficiency of DNA exposed to either phenanthrene or pyrene can be attributed to a broken hydrogen bond in the double helix caused by planar PAHs. Added Ca(2+ formed strong electrovalent bonds with "-POO(--" groups in the DNA, weakening the interaction between PAHs and DNA based on weak molecular forces. This decreased the damage of PAHs to hydrogen bonds in double-stranded DNA by isolating DNA molecules from PAHs and consequently enhanced the transformation efficiency of DNA exposed to PAH contaminants. The findings provide insight into the effects of anthropogenic trace PAHs on DNA transfer in natural environments.

  6. Cloning Should Be Simple: Escherichia coli DH5α-Mediated Assembly of Multiple DNA Fragments with Short End Homologies

    Science.gov (United States)

    Richardson, Ruth E.; Suzuki, Yo

    2015-01-01

    Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six double-stranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processes associated with most common applications of DNA assembly. We demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work. PMID:26348330

  7. Strand breaks and lethal damage in plasmid DNA subjected to 60CO-γirradiation

    International Nuclear Information System (INIS)

    Klimczak, U.

    1992-01-01

    Experiments with calf thymus DNA subjected to extracellular irradiation yield information on the role of direct and indirect effects in single-strand breakage, if this is evaluated with reference to the scavenger activity in respect of OH radicals. The role of the two processes in the occurrence of double-stand breaks and further damage leading to cell decay has so far remained largely obscure. It was the aim of the study described here to contribute to research in this field by performing in vitro experiments on biologically active DNA. For this purpose, DNA from pBR322 plasmids was irradiated in the presence of OH-radical scavengers. The number of single-strand and double-strand breaks was determined on the basis of the system's ability to eliminate OH radicals. In order to asses the influence of irradiation processes on the biological activity of DNA, investigations were carried out in E. coli for transformations caused by irradiated plasmid DNA. The results were interpreted in the light of theories about inhomogenous reaction kinetics put forward by Mark et al. (1989). It was finally discussed, which of the gamma-irradiation injuries occurring in DNA was to be held responsible for the inactivation of plasmid DNA and which enzymatic processes were additionally at work here. (orig./MG) [de

  8. Improvement of in vivo transfer of plasmid DNA in muscle : Comparison of electroporation versus ultrasound

    NARCIS (Netherlands)

    Kusumanto, Yoka H.; Mulder, Nanno H.; Dam, Wendy A.; Losen, Mario H.; Meijer, Coby; Hospers, Geke A. P.

    Plasmid-based gene delivery to muscle is a treatment strategy for many diseases with potential advantages above viral-based gene delivery methods, however, with a relative low transfection efficiency. We compared two physical methods-electroporation and ultrasound-that facilitate DNA uptake into

  9. Cholesterol-conjugated supramolecular assemblies of low generations polyamidoamine dendrimers for enhanced EGFP plasmid DNA transfection

    Energy Technology Data Exchange (ETDEWEB)

    Golkar, Nasim; Samani, Soliman Mohammadi; Tamaddon, Ali Mohammad, E-mail: amtamadon@gmail.com [Shiraz University of Medical Sciences, Department of Pharmaceutics, School of Pharmacy (Iran, Islamic Republic of)

    2016-05-15

    Aimed to prepare an enhanced gene delivery system with low cytotoxicity and high transfection efficiency, various cholesterol-conjugated derivates of low generation polyamidoamine (PAMAM) dendrimers were prepared. The conjugates were characterized by TNBS assay, FTIR, and {sup 1}H-NMR spectroscopy. Self-assembly of the dendrimer conjugates (G1-Chol, G2-Chol, and G3-Chol) was investigated by pyrene assay. Following formation of the complexes between enhanced green fluorescence protein plasmid and the dendrimer conjugates at various N (primary amine)/P (phosphate) mole ratios, plasmid condensation, biologic stability, cytotoxicity, and protein expression were investigated. The conjugates self-assembled into micellar dispersions with the critical micelle concentration values (<50 µg/ml) depending on the dendrimer generation and cholesterol/amine mole ratio. Cholesterol conjugation resulted in higher resistance of the condensed plasmid DNA in a competition assay with heparin sulfate. Also, the transfection efficiency was determined higher for the cholesterol conjugates than unmodified dendrimers in HepG2 cells, showing the highest for G2-Chol at 40 % degree of cholesterol modification (G2-Chol{sub 40 %}) among various dendrimer generations. Interestingly, such conjugate showed a complete protection of plasmid against serum nucleases. Our results confirmed that the cholesterol conjugation to PAMAM dendrimers of low generations bearing little cytotoxicity improves their several physicochemical and biological characteristics required for an enhanced delivery of plasmid DNA into cells.

  10. Size and Base Composition of RNA in Supercoiled Plasmid DNA

    Science.gov (United States)

    Williams, Peter H.; Boyer, Herbert W.; Helinski, Donald R.

    1973-01-01

    The average size and base composition of the covalently integrated RNA segment in supercoiled ColE1 DNA synthesized in Escherichia coli in the presence of chloramphenicol (CM-ColE1 DNA) have been determined by two independent methods. The two approaches yielded similar results, indicating that the RNA segment in CM-ColE1 DNA contains GMP at the 5′ end and comprises on the average 25 to 26 ribonucleotides with a base composition of 10-11 G, 3 A, 5-6 C, and 6-7 U. PMID:4359488

  11. Sperm DNA fragmentation affects epigenetic feature in human male pronucleus.

    Science.gov (United States)

    Rajabi, H; Mohseni-Kouchesfehani, H; Eslami-Arshaghi, T; Salehi, M

    2018-02-01

    To evaluate whether the sperm DNA fragmentation affects male pronucleus epigenetic factors, semen analysis was performed and DNA fragmentation was assessed by the method of sperm chromatin structure assay (SCSA). Human-mouse interspecies fertilisation was used to create human male pronucleus. Male pronucleus DNA methylation and H4K12 acetylation were evaluated by immunostaining. Results showed a significant positive correlation between the level of sperm DNA fragmentation and DNA methylation in male pronuclei. In other words, an increase in DNA damage caused an upsurge in DNA methylation. In the case of H4K12 acetylation, no correlation was detected between DNA damage and the level of histone acetylation in the normal group, but results for the group in which male pronuclei were derived from sperm cells with DNA fragmentation, increased DNA damage led to a decreased acetylation level. Sperm DNA fragmentation interferes with the active demethylation process and disrupts the insertion of histones into the male chromatin in the male pronucleus, following fertilisation. © 2017 Blackwell Verlag GmbH.

  12. Magnetic bead purification of labeled DNA fragments forhigh-throughput capillary electrophoresis sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Elkin, Christopher; Kapur, Hitesh; Smith, Troy; Humphries, David; Pollard, Martin; Hammon, Nancy; Hawkins, Trevor

    2001-09-15

    We have developed an automated purification method for terminator sequencing products based on a magnetic bead technology. This 384-well protocol generates labeled DNA fragments that are essentially free of contaminates for less than $0.005 per reaction. In comparison to laborious ethanol precipitation protocols, this method increases the phred20 read length by forty bases with various DNA templates such as PCR fragments, Plasmids, Cosmids and RCA products. Our method eliminates centrifugation and is compatible with both the MegaBACE 1000 and ABIPrism 3700 capillary instruments. As of September 2001, this method has produced over 1.6 million samples with 93 percent averaging 620 phred20 bases as part of Joint Genome Institutes Production Process.

  13. A mechanism of gene amplification driven by small DNA fragments.

    Directory of Open Access Journals (Sweden)

    Kuntal Mukherjee

    Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation

  14. Fragmentation of DNA affects the accuracy of the DNA quantitation by the commonly used methods

    Directory of Open Access Journals (Sweden)

    Sedlackova Tatiana

    2013-02-01

    Full Text Available Abstract Background Specific applications and modern technologies, like non-invasive prenatal testing, non-invasive cancer diagnostic and next generation sequencing, are currently in the focus of researchers worldwide. These have common characteristics in use of highly fragmented DNA molecules for analysis. Hence, for the performance of molecular methods, DNA concentration is a crucial parameter; we compared the influence of different levels of DNA fragmentation on the accuracy of DNA concentration measurements. Results In our comparison, the performance of the currently most commonly used methods for DNA concentration measurement (spectrophotometric, fluorometric and qPCR based were tested on artificially fragmented DNA samples. In our comparison, unfragmented and three specifically fragmented DNA samples were used. According to our results, the level of fragmentation did not influence the accuracy of spectrophotometric measurements of DNA concentration, while other methods, fluorometric as well as qPCR-based, were significantly influenced and a decrease in measured concentration was observed with more intensive DNA fragmentation. Conclusions Our study has confirmed that the level of fragmentation of DNA has significant impact on accuracy of DNA concentration measurement with two of three mostly used methods (PicoGreen and qPCR. Only spectrophotometric measurement was not influenced by the level of fragmentation, but sensitivity of this method was lowest among the three tested. Therefore if it is possible the DNA quantification should be performed with use of equally fragmented control DNA.

  15. Amplification of deoxyribonucleic acid (DNA) fragment using two ...

    African Journals Online (AJOL)

    user

    2011-04-11

    Apr 11, 2011 ... polymerases on this method, whether different lengths of. DNA fragments could be amplified by two-step PCR and the difference of DNA product quality produced by the two methods. MATERIALS AND METHODS. PCR template and reagents. Enterobacteria phage lambda DNA (GenBank no: V00636) ...

  16. Persistence of plasmid DNA in different soils | Kandhavelu | African ...

    African Journals Online (AJOL)

    Natural genetic transformation is believed to be the essential mechanism for the attainment of genetic plasticity in many species of bacteria. Dying cells are likely to release naked DNA that may survive for many hours. Although numerous studies have shown that horizontal gene transfer between distantly related genera, but ...

  17. Intrathecal injection of naked plasmid DNA provides long-term expression of secreted proteins.

    Science.gov (United States)

    Hughes, Travis S; Langer, Stephen J; Johnson, Kirk W; Chavez, Raymond A; Watkins, Linda R; Milligan, Erin D; Leinwand, Leslie A

    2009-01-01

    Therapeutic benefit has been reported to result from intrathecal (i.t.) injection of transgene vectors, including naked DNA. However, most studies using naked DNA have measured only the transgene expression of intracellular proteins. Here we demonstrate that i.t. injection of naked DNA can result in long-term expression of secreted proteins. Plasmids expressing either secreted alkaline phosphatase (SEAP) or human interleukin-10 (hIL-10) were injected into the i.t. space in rats, and transgene products were repeatedly measured in the cerebrospinal fluid (CSF). Both SEAP and hIL-10 were maximal at 1 and 2 days after the injection and still detectable at 4 months. The utilization of a plasmid having two features that are hypothesized to increase gene expression (matrix attachment regions (MARs) and lack of CpG dinucleotides) resulted in a significant increase in gene expression. Reinjection of SEAP or hIL-10 plasmids after 4 months significantly increased protein levels at 1 and 14 days after the reinjection. SEAP was uniformly distributed between the DNA delivery site (approximately vertebral level T13) and the lumbar puncture site (L5/L6 inter-vertebral space), was reduced at the cisterna magna, and was detectable, though at much lower levels, in serum. These data suggest that naked DNA has the potential to be used as a therapeutic tool for applications that require long-term release of transgenes into the CSF.

  18. Linkage map of the fragments of herpesvirus papio DNA.

    Science.gov (United States)

    Lee, Y S; Tanaka, A; Lau, R Y; Nonoyama, M; Rabin, H

    1981-01-01

    Herpesvirus papio (HVP), an Epstein-Barr-like virus, causes lymphoblastoid disease in baboons. The physical map of HVP DNA was constructed for the fragments produced by cleavage of HVP DNA with restriction endonucleases EcoRI, HindIII, SalI, and PvuI, which produced 12, 12, 10, and 4 fragments, respectively. The total molecular size of HVP DNA was calculated as close to 110 megadaltons. The following methods were used for construction of the map; (i) fragments near the ends of HVP DNA were identified by treating viral DNA with lambda exonuclease before restriction enzyme digestion; (ii) fragments containing nucleotide sequences in common with fragments from the second enzyme digest of HVP DNA were examined by Southern blot hybridization; and (iii) the location of some fragments was determined by isolating individual fragments from agarose gels and redigesting the isolated fragments with a second restriction enzyme. Terminal heterogeneity and internal repeats were found to be unique features of HVP DNA molecule. One to five repeats of 0.8 megadaltons were found at both terminal ends. Although the repeats of both ends shared a certain degree of homology, it was not determined whether they were identical repeats. The internal repeat sequence of HVP DNA was found in the EcoRI-C region, which extended from 8.4 to 23 megadaltons from the left end of the molecule. The average number of the repeats was calculated to be seven, and the molecular size was determined to be 1.8 megadaltons. Similar unique features have been reported in EBV DNA (D. Given and E. Kieff, J. Virol. 28:524-542, 1978). Images PMID:6261015

  19. Evaluation of the effect of non-B DNA structures on plasmid integrity via accelerated stability studies.

    Science.gov (United States)

    Ribeiro, S C; Monteiro, G A; Prazeres, D M F

    2009-04-01

    Plasmid biopharmaceuticals are a new class of medicines with an enormous potential. Attempts to increase the physical stability of highly purified supercoiled (SC) plasmid DNA in pharmaceutical aqueous solutions have relied on: (i) changing the DNA sequence, (ii) improving manufacturing to reduce deleterious impurities and initial DNA damage, and (iii) controlling the storage medium characteristics. In this work we analyzed the role of secondary structures on the degradation of plasmid molecules. Accelerated stability experiments were performed with SC, open circular (OC) and linear (L) isoforms of three plasmids which differed only in the "single-strandlike" content of their polyadenylation (poly A) signals. We have proved that the presence of more altered or interrupted (non-B) DNA secondary structures did not directly translate into an easier strand scission of the SC isoforms. Rather, those unusual structures imposed a lower degree of SC in the plasmids, leading to an increase in their resistance to thermal degradation. However, this behavior was reversed when the relaxed or L isoforms were tested, in which case the absence of SC rendered the plasmids essentially double-stranded. Overall, this work suggests that plasmid DNA sequence and secondary structures should be taken into account in future investigations of plasmid stability during prolonged storage.

  20. Bacterial natural transformation by highly fragmented and damaged DNA

    DEFF Research Database (Denmark)

    Overballe-Petersen, Søren; Harms, Klaus; Orlando, Ludovic Antoine Alexandre

    2013-01-01

    for microbes, but not as potential substrate for bacterial evolution. Here, we show that fragmented DNA molecules (≥20 bp) that additionally may contain abasic sites, cross-links, or miscoding lesions are acquired by the environmental bacterium Acinetobacter baylyi through natural transformation. With uptake......DNA molecules are continuously released through decomposition of organic matter and are ubiquitous in most environments. Such DNA becomes fragmented and damaged (often DNA is recognized as nutrient source...... of DNA from a 43,000-y-old woolly mammoth bone, we further demonstrate that such natural transformation events include ancient DNA molecules. We find that the DNA recombination is RecA recombinase independent and is directly linked to DNA replication. We show that the adjacent nucleotide variations...

  1. (PCR) for direct cloning of blunt-end DNA fragments

    African Journals Online (AJOL)

    Administrator

    2011-09-19

    Sep 19, 2011 ... Key words: Blunt-end cloning, phosphorylated DNA fragment, dephosphorylated blunt-end vector. INTRODUCTION ... With this method, a lot of steps are saved, which includes restriction .... pBSK-blunt (data not shown).

  2. Tissue-specific Calibration of Real-time PCR Facilitates Absolute Quantification of Plasmid DNA in Biodistribution Studies

    Directory of Open Access Journals (Sweden)

    Joan K Ho

    2016-01-01

    Full Text Available Analysis of the tissue distribution of plasmid DNA after administration of nonviral gene delivery systems is best accomplished using quantitative real-time polymerase chain reaction (qPCR, although published strategies do not allow determination of the absolute mass of plasmid delivered to different tissues. Generally, data is expressed as the mass of plasmid relative to the mass of genomic DNA (gDNA in the sample. This strategy is adequate for comparisons of efficiency of delivery to a single site but it does not allow direct comparison of delivery to multiple tissues, as the mass of gDNA extracted per unit mass of each tissue is different. We show here that by constructing qPCR standard curves for each tissue it is possible to determine the dose of intact plasmid remaining in each tissue, which is a more useful parameter when comparing the fates of different formulations of DNA. We exemplify the use of this tissue-specific qPCR method by comparing the delivery of naked DNA, cationic DNA complexes, and neutral PEGylated DNA complexes after intramuscular injection. Generally, larger masses of intact plasmid were present 24 hours after injection of DNA complexes, and neutral complexes resulted in delivery of a larger mass of intact plasmid to the spleen.

  3. Virus-sized self-assembling lamellar complexes between plasmid DNA and cationic micelles promote gene transfer

    Science.gov (United States)

    Pitard, Bruno; Aguerre, Olivier; Airiau, Marc; Lachagès, Anne-Marie; Boukhnikachvili, Tsiala; Byk, Gérardo; Dubertret, Catherine; Herviou, Christian; Scherman, Daniel; Mayaux, Jean-François; Crouzet, Joël

    1997-01-01

    Gene therapy is based on the vectorization of genes to target cells and their subsequent expression. Cationic amphiphile-mediated delivery of plasmid DNA is the nonviral gene transfer method most often used. We examined the supramolecular structure of lipopolyamine/plasmid DNA complexes under various condensing conditions. Plasmid DNA complexation with lipopolyamine micelles whose mean diameter was 5 nm revealed three domains, depending on the lipopolyamine/plasmid DNA ratio. These domains respectively corresponded to negatively, neutrally, and positively charged complexes. Transmission electron microscopy and x-ray scattering experiments on complexes originating from these three domains showed that although their morphology depends on the lipopolyamine/plasmid DNA ratio, their particle structure consists of ordered domains characterized by even spacing of 80 Å, irrespective of the lipid/DNA ratio. The most active lipopolyamine/DNA complexes for gene transfer were positively charged. They were characterized by fully condensed DNA inside spherical particles (diameter: 50 nm) sandwiched between lipid bilayers. These results show that supercoiled plasmid DNA is able to transform lipopolyamine micelles into a supramolecular organization characterized by ordered lamellar domains. PMID:9405626

  4. Solid lipid nanoparticles mediate non-viral delivery of plasmid DNA to dendritic cells

    Science.gov (United States)

    Penumarthi, Alekhya; Parashar, Deepti; Abraham, Amanda N.; Dekiwadia, Chaitali; Macreadie, Ian; Shukla, Ravi; Smooker, Peter M.

    2017-06-01

    There is an increasing demand for novel DNA vaccine delivery systems, mainly for the non-viral type as they are considered relatively safe. Therefore, solid lipid nanoparticles (SLNs) were investigated for their suitability as a non-viral DNA vaccine delivery system. SLNs were synthesised by a modified solvent-emulsification method in order to study their potential to conjugate with plasmid DNA and deliver them in vitro to dendritic cells using eGFP as the reporter plasmid. The DNA-SLN complexes were characterised by electron microscopy, gel retardation assays and dynamic light scattering. The cytotoxicity assay data supported their biocompatibility and was used to estimate safe threshold concentration resulting in high transfection rate. The transfection efficiency of these complexes in a dendritic cell line was shown to increase significantly compared to plasmid alone, and was comparable to that mediated by lipofectamine. Transmission electron microscopy studies delineated the pathway of cellular uptake. Endosomal escape was observed supporting the mechanism of transfection.

  5. Fluoride enhances transfection activity of carbonate apatite by increasing cytoplasmic stability of plasmid DNA

    International Nuclear Information System (INIS)

    Chowdhury, E.H.

    2011-01-01

    Highlights: → Cytoplasmic stability of plasmid DNA is enhanced by fluoride incorporation into carbonate apatite carrier. → Fluoridated carbonate apatite promotes a robust increase in transgene expression. → Controlled dissolution of fluoridated carbonate apatite in endosomal acidic environment might buffer the endosomes and prevent degradation of the released DNA. -- Abstract: Intracellular delivery of a functional gene or a nucleic acid sequence to specifically knockdown a harmful gene is a potential approach to precisely treat a critical human disease. The intensive efforts in the last few decades led to the development of a number of viral and non-viral synthetic vectors. However, an ideal delivery tool in terms of the safety and efficacy has yet to be established. Recently, we have developed pH-sensing inorganic nanocrystals of carbonate apatite for efficient and cell-targeted delivery of gene and gene-silencing RNA. Here we show that addition of very low level of fluoride to the particle-forming medium facilitates a robust increase in transgene expression following post-incubation of the particles with HeLa cells. Confocal microscopic observation and Southern blotting prove the cytoplasmic existence of plasmid DNA delivered by likely formed fluoridated carbonate apatite particles while degradation of plasmid DNA presumably by cytoplasmic nucleases was noticed following delivery with apatite particles alone. The beneficial role of fluoride in enhancing carbonate apatite-mediated gene expression might be due to the buffering potential of generated fluoridated apatite in endosomal acidic environment, thereby increasing the half-life of delivered plasmid DNA.

  6. Fluoride enhances transfection activity of carbonate apatite by increasing cytoplasmic stability of plasmid DNA

    Energy Technology Data Exchange (ETDEWEB)

    Chowdhury, E.H., E-mail: md.ezharul.hoque@med.monash.edu.my [Jeffrey Cheah School of Medicine and Health Sciences, Monash University Sunway Campus, Jalan Lagoon Selatan, Bandar Sunway, Selangor Darul Ehsan (Malaysia)

    2011-06-17

    Highlights: {yields} Cytoplasmic stability of plasmid DNA is enhanced by fluoride incorporation into carbonate apatite carrier. {yields} Fluoridated carbonate apatite promotes a robust increase in transgene expression. {yields} Controlled dissolution of fluoridated carbonate apatite in endosomal acidic environment might buffer the endosomes and prevent degradation of the released DNA. -- Abstract: Intracellular delivery of a functional gene or a nucleic acid sequence to specifically knockdown a harmful gene is a potential approach to precisely treat a critical human disease. The intensive efforts in the last few decades led to the development of a number of viral and non-viral synthetic vectors. However, an ideal delivery tool in terms of the safety and efficacy has yet to be established. Recently, we have developed pH-sensing inorganic nanocrystals of carbonate apatite for efficient and cell-targeted delivery of gene and gene-silencing RNA. Here we show that addition of very low level of fluoride to the particle-forming medium facilitates a robust increase in transgene expression following post-incubation of the particles with HeLa cells. Confocal microscopic observation and Southern blotting prove the cytoplasmic existence of plasmid DNA delivered by likely formed fluoridated carbonate apatite particles while degradation of plasmid DNA presumably by cytoplasmic nucleases was noticed following delivery with apatite particles alone. The beneficial role of fluoride in enhancing carbonate apatite-mediated gene expression might be due to the buffering potential of generated fluoridated apatite in endosomal acidic environment, thereby increasing the half-life of delivered plasmid DNA.

  7. Absence of ultraviolet-inducible DNA polymerase I-like activity in Escherichia coli strains harbouring R plasmids

    International Nuclear Information System (INIS)

    Upton, C.; Pinney, R.J.

    1981-01-01

    No DNA polymerase I-like activity was found associated with the ultraviolet (u.v.)-protecting plasmids R205, R46 or pKM101 in either uninduced or u.v.-induced wild-type or DNA polymerase I-deficient strains of Escherichia coli. Nor was any plasmid-associated polymerase activity detectable in similar systems containing u.v.-irradiated DNA as template. However, plasmids R205, R46 and pKM 101 still increased survival and mutagenesis of the polymerase I-deficient E. coli strain after u.v. irradiation. (author)

  8. Study on detection of mutation DNA fragment in gastric cancer by restriction endonuclease fingerprinting with capillary electrophoresis.

    Science.gov (United States)

    Wang, Rong; Xie, Hua; Xu, Yue-Bing; Jia, Zheng-Ping; Meng, Xian-Dong; Zhang, Juan-Hong; Ma, Jun; Wang, Juan; Wang, Xian-Hua

    2012-03-01

    The DNA fragment detection focusing technique has further enhanced the sensitivity and information of DNA targets. The DNA fragment detection method was established by capillary electrophoresis with laser-induced fluorescence detection and restriction endonuclease chromatographic fingerprinting (CE-LIF-REF) in our experiment. The silica capillary column was coated with short linear polyarclarylamide (SLPA) using nongel sieving technology. The excision product of various restricted enzymes of DNA fragments was obtained by REF with the molecular biology software Primer Premier 5. The PBR322/BsuRI DNA marker was used to establish the optimization method. The markers were focused electrophoretically and detected by CE-LIF. The results demonstrate that the CE-LIF-REF with SLPA can improve separation, sensitivity and speed of analysis. This technique may be applied to analysis of the excision product of various restricted enzymes of prokaryotic plasmid (pIRES2), eukaryote plasmid (pcDNA3.1) and the PCR product of codon 248 region of gastric cancer tissue. The results suggest that this method could very sensitively separate the excision products of various restricted enzymes at a much better resolution than the traditional agarose electrophoresis. Copyright © 2011 John Wiley & Sons, Ltd.

  9. Dichromatic laser radiation effects on DNA of Escherichia coli and plasmids

    Science.gov (United States)

    Martins, W. A.; Polignano, G. A. C.; Guimarães, O. R.; Geller, M.; Paoli, F.; Fonseca, A. S.

    2015-04-01

    Dichromatic and consecutive laser radiations have attracted increased attention for clinical applications as offering new tools for the treatment of dysfunctional tissues in situations where monochromatic radiation is not effective. This work evaluated the survival, filamentation and morphology of Escherichia coli cells, and the induction of DNA lesions, in plasmid DNA exposed to low-intensity consecutive dichromatic laser radiation. Exponential and stationary wild type and formamidopyrimidine DNA glycosylase/MutM protein deficient E. coli cultures were exposed to consecutive low-intensity dichromatic laser radiation (infrared laser immediately after red laser) to study the survival, filamentation and morphology of bacterial cells. Plasmid DNA samples were exposed to dichromatic radiation to study DNA lesions by electrophoretic profile. Dichromatic laser radiation affects the survival, filamentation and morphology of E. coli cultures depending on the growth phase and the functional repair mechanism of oxidizing lesions in DNA, but does not induce single/double strands breaks or alkali-labile DNA lesions. Results show that low-intensity consecutive dichromatic laser radiation induces biological effects that differ from those induced by monochromatic laser radiation, suggesting that other therapeutic effects could be obtained using dichromatic radiation.

  10. Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

    Science.gov (United States)

    Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

    2014-11-01

    Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates

  11. Design of expanded bed supports for the recovery of plasmid DNA by anion exchange adsorption

    DEFF Research Database (Denmark)

    Theodossiou, Irini; Søndergaard, M.; Thomas, Owen R. T.

    2001-01-01

    In this study we detail the rational design of new chromatographic adsorbents tailored for the capture of plasmid DNA. Features present on current chromatographic supports that can significantly enhance plasmid binding capacity have been identified in packed bed chromatography experiments...... and blueprints for improved expanded bed adsorbents have been put forward. The characterisation and testing of small (20-40 mum) high density (>3.7 g cm(-3)) pellicular expanded bed materials functionalised with various anion exchange structures is presented. In studies with calf thymus DNA, dynamic binding...... capacities of 1.2 and 3.4 mg ml(-1) were recorded for prototype diethylaminoethyl-and polyethylene imine-linked adsorbents which were respectively 25 and 70 fold higher than those of equivalently derivatised commercial expanded bed materials. The prototype polyethylene imine-coupled material exhibited severe...

  12. Sperm DNA fragmentation, recurrent implantation failure and recurrent miscarriage

    Directory of Open Access Journals (Sweden)

    Carol Coughlan

    2015-01-01

    Full Text Available Evidence is increasing that the integrity of sperm DNA may also be related to implantation failure and recurrent miscarriage (RM. To investigate this, the sperm DNA fragmentation in partners of 35 women with recurrent implantation failure (RIF following in vitro fertilization, 16 women diagnosed with RM and seven recent fathers (control were examined. Sperm were examined pre- and post-density centrifugation by the sperm chromatin dispersion (SCD test and the terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL assay. There were no significant differences in the age of either partner or sperm concentration, motility or morphology between three groups. Moreover, there were no obvious differences in sperm DNA fragmentation measured by either test. However, whilst on average sperm DNA fragmentation in all groups was statistically lower in prepared sperm when measured by the SCD test, this was not seen with the results from the TUNEL assay. These results do not support the hypothesis that sperm DNA fragmentation is an important cause of RIF or RM, or that sperm DNA integrity testing has value in such patients. It also highlights significant differences between test methodologies and sperm preparation methods in interpreting the data from sperm DNA fragmentation tests.

  13. Electronic transport in methylated fragments of DNA

    International Nuclear Information System (INIS)

    Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L.; Albuquerque, E. L.; Freire, V. N.; Caetano, E. W. S.; Moura, F. A. B. F. de; Lyra, M. L.

    2015-01-01

    We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics

  14. Electronic transport in methylated fragments of DNA

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L., E-mail: umbertofulco@gmail.com; Albuquerque, E. L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Freire, V. N. [Departamento de Física, Universidade Federal do Ceará, 60455-760 Fortaleza, CE (Brazil); Caetano, E. W. S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531 Fortaleza, CE (Brazil); Moura, F. A. B. F. de; Lyra, M. L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)

    2015-11-16

    We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.

  15. Strand breaks in plasmid DNA following positional changes of Auger-electron-emitting radionuclides

    International Nuclear Information System (INIS)

    Adelstein, S.J.; Kassis, A.I.

    1996-01-01

    The purpose of our studies is to elucidate the kinetics of DNA strand breaks caused by low-energy Auger electron emitters in close proximity to DNA. Previously we have studied the DNA break yields in plasmids after the decay of indium-111 bound to DNA or free in solution. In this work, we compare the DNA break yields in supercoiled DNA of iodine-125 decaying close to DNA following DNA intercalation, minor-groove binding, or surface binding, and at a distance form DNA. Supercoiled DNA, stored at 4 C to accumulate radiation dose from the decay of 125 I, was then resolved by gel electrophoresis into supercoiled, nicked circular, and linear forms, representing undamaged DNA, single-strand breaks, and double-strand breaks respectively. DNA-intercalated or groove-bound 125 I is more effective than surface-bound radionuclide or 125 I free in solution. The hydroxyl radical scavenger DMSO protects against damage by 125 I free in solution but has minimal effect on damage by groove-bound 125 I. (orig.)

  16. Agarose gel electrophoresis for the separation of DNA fragments.

    Science.gov (United States)

    Lee, Pei Yun; Costumbrado, John; Hsu, Chih-Yuan; Kim, Yong Hoon

    2012-04-20

    Agarose gel electrophoresis is the most effective way of separating DNA fragments of varying sizes ranging from 100 bp to 25 kb(1). Agarose is isolated from the seaweed genera Gelidium and Gracilaria, and consists of repeated agarobiose (L- and D-galactose) subunits(2). During gelation, agarose polymers associate non-covalently and form a network of bundles whose pore sizes determine a gel's molecular sieving properties. The use of agarose gel electrophoresis revolutionized the separation of DNA. Prior to the adoption of agarose gels, DNA was primarily separated using sucrose density gradient centrifugation, which only provided an approximation of size. To separate DNA using agarose gel electrophoresis, the DNA is loaded into pre-cast wells in the gel and a current applied. The phosphate backbone of the DNA (and RNA) molecule is negatively charged, therefore when placed in an electric field, DNA fragments will migrate to the positively charged anode. Because DNA has a uniform mass/charge ratio, DNA molecules are separated by size within an agarose gel in a pattern such that the distance traveled is inversely proportional to the log of its molecular weight(3). The leading model for DNA movement through an agarose gel is "biased reptation", whereby the leading edge moves forward and pulls the rest of the molecule along(4). The rate of migration of a DNA molecule through a gel is determined by the following: 1) size of DNA molecule; 2) agarose concentration; 3) DNA conformation(5); 4) voltage applied, 5) presence of ethidium bromide, 6) type of agarose and 7) electrophoresis buffer. After separation, the DNA molecules can be visualized under uv light after staining with an appropriate dye. By following this protocol, students should be able to: Understand the mechanism by which DNA fragments are separated within a gel matrix Understand how conformation of the DNA molecule will determine its mobility through a gel matrix Identify an agarose solution of appropriate

  17. Exponential Megapriming PCR (EMP) Cloning—Seamless DNA Insertion into Any Target Plasmid without Sequence Constraints

    Science.gov (United States)

    Ulrich, Alexander; Andersen, Kasper R.; Schwartz, Thomas U.

    2012-01-01

    We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP) cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF) cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts. PMID:23300917

  18. Exponential megapriming PCR (EMP cloning--seamless DNA insertion into any target plasmid without sequence constraints.

    Directory of Open Access Journals (Sweden)

    Alexander Ulrich

    Full Text Available We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts.

  19. Plasmid DNA loaded chitosan nanoparticles for nasal mucosal immunization against hepatitis B.

    Science.gov (United States)

    Khatri, Kapil; Goyal, Amit K; Gupta, Prem N; Mishra, Neeraj; Vyas, Suresh P

    2008-04-16

    This work investigates the preparation and in vivo efficacy of plasmid DNA loaded chitosan nanoparticles for nasal mucosal immunization against hepatitis B. Chitosan pDNA nanoparticles were prepared using a complex coacervation process. Prepared nanoparticles were characterized for size, shape, surface charge, plasmid loading and ability of nanoparticles to protect DNA against nuclease digestion and for their transfection efficacy. Nasal administration of nanoparticles resulted in serum anti-HBsAg titre that was less compared to that elicited by naked DNA and alum adsorbed HBsAg, but the mice were seroprotective within 2 weeks and the immunoglobulin level was above the clinically protective level. However, intramuscular administration of naked DNA and alum adsorbed HBsAg did not elicit sIgA titre in mucosal secretions that was induced by nasal immunization with chitosan nanoparticles. Similarly, cellular responses (cytokine levels) were poor in case of alum adsorbed HBsAg. Chitosan nanoparticles thus produced humoral (both systemic and mucosal) and cellular immune responses upon nasal administration. The study signifies the potential of chitosan nanoparticles as DNA vaccine carrier and adjuvant for effective immunization through non-invasive nasal route.

  20. High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System.

    Science.gov (United States)

    Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C T; Shui, Lingling

    2017-01-18

    DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1-10 Kbp fragment lengths with a yield of 75.30-91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future.

  1. Isolation/separation of plasmid DNA using hemoglobin modified magnetic nanocomposites as solid-phase adsorbent.

    Science.gov (United States)

    Chen, Xu-Wei; Mao, Quan-Xing; Liu, Jia-Wei; Wang, Jian-Hua

    2012-10-15

    Hemoglobin (Hb) modified magnetic nanocomposites are prepared by immobilization of Hb onto the surface of amino-functionalized Fe(3)O(4)@SiO(2) magnetic nanoparticles via covalent bonding with glutaraldehyde as cross-linker. The obtained nanocomposites are characterized with FT-IR, SEM, XRD and surface charge analysis. A direct solid-phase extraction procedure for the isolation/separation of plasmid DNA using this nanocomposite as a novel adsorbent is thus developed. Some important experimental parameters governing the sorption efficiency, i.e., the pH of sample solution and the ionic strength, are investigated. The Hb modified magnetic nanocomposites provide a sorption capacity of 27.86 mg g(-1) for DNA. By using 2.0mg of the nanocomposites as sorption medium and a suitable acidity of pH 6.1, a sorption efficiency of 93% is achieved for 25 μg mL(-1) of DNA in 1.0 mL of sample solution. Afterwards, the absorbed DNA could be readily recovered by using 1.0 mL of Tris-HCl buffer (pH 8.9, 0.01 mol L(-1)), giving rise to a recovery of ca. 68.3%. The present solid-phased extraction protocol is applied for the isolation of plasmid DNA from Escherichia coli culture, resulting in comparable yield and purity of plasmid DNA with respect to those obtained by using commercial kits. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. Replication of each copy of the yeast 2 micron DNA plasmid occurs during the S phase.

    Science.gov (United States)

    Zakian, V A; Brewer, B J; Fangman, W L

    1979-08-01

    Saccharomyces cerevisiae contains 50-100 copies per cell of a circular plasmid called 2 micron DNA. Replication of this DNA was studied in two ways. The distribution of replication events among 2 micron DNA molecules was examined by density transfer experiments with asynchronous cultures. The data show that 2 micron DNA replication is similar to chromosomal DNA replication: essentially all 2 micron duplexes were of hybrid density at one cell doubling after the density transfer, with the majority having one fully dense strand and one fully light strand. The results show that replication of 2 micron DNA occurs by a semiconservative mechanism where each of the plasmid molecules replicates once each cell cycle. 2 micron DNA is the only known example of a multiple-copy, extrachromosomal DNA in which every molecule replicates in each cell cycle. Quantitative analysis of the data indicates that 2 micron DNA replication is limited to a fraction of the cell cycle. The period in the cell cycle when 2 micron DNA replicates was examined directly with synchronous cell cultures. Synchronization was accomplished by sequentially arresting cells in G1 phase using the yeast pheromone alpha-factor and incubating at the restrictive temperature for a cell cycle (cdc 7) mutant. Replication was monitored by adding 3H-uracil to cells previously labeled with 14C-uracil, and determining the 3H/14C ratio for purified DNA species. 2 micron DNA replication did not occur during the G1 arrest periods. However, the population of 2 micron DNA doubled during the synchronous S phase at the permissive temperature, with most of the replication occurring in the first third of S phase. Our results indicate that a mechanism exists which insures that the origin of replication of each 2 micron DNA molecule is activated each S phase. As with chromosomal DNA, further activation is prevented until the next cell cycle. We propose that the mechanism which controls the replication initiation of each 2 micron DNA

  3. DNA fragments assembly based on nicking enzyme system.

    Directory of Open Access Journals (Sweden)

    Rui-Yan Wang

    Full Text Available A couple of DNA ligation-independent cloning (LIC methods have been reported to meet various requirements in metabolic engineering and synthetic biology. The principle of LIC is the assembly of multiple overlapping DNA fragments by single-stranded (ss DNA overlaps annealing. Here we present a method to generate single-stranded DNA overlaps based on Nicking Endonucleases (NEases for LIC, the method was termed NE-LIC. Factors related to cloning efficiency were optimized in this study. This NE-LIC allows generating 3'-end or 5'-end ss DNA overlaps of various lengths for fragments assembly. We demonstrated that the 10 bp/15 bp overlaps had the highest DNA fragments assembling efficiency, while 5 bp/10 bp overlaps showed the highest efficiency when T4 DNA ligase was added. Its advantage over Sequence and Ligation Independent Cloning (SLIC and Uracil-Specific Excision Reagent (USER was obvious. The mechanism can be applied to many other LIC strategies. Finally, the NEases based LIC (NE-LIC was successfully applied to assemble a pathway of six gene fragments responsible for synthesizing microbial poly-3-hydroxybutyrate (PHB.

  4. Antibacterial effect of cationic porphyrazines and anionic phthalocyanine and their interaction with plasmid DNA

    Science.gov (United States)

    Hassani, Leila; Hakimian, Fatemeh; Safaei, Elham; Fazeli, Zahra

    2013-11-01

    Resistance to antibiotics is a public health issue and identification of new antibacterial agents is one of the most important goals of pharmacological research. Among the novel developed antibacterial agents, porphyrin complexes and their derivatives are ideal candidates for use in medical applications. Phthalocyanines differ from porphyrins by having nitrogen atoms link the individual pyrrol units. The aza analogues of the phthalocyanines (azaPcs) such as tetramethylmetalloporphyrazines are heterocyclic Pc analogues. In this investigation, interaction of an anionic phthalocyanine (Cu(PcTs)) and two cationic tetrapyridinoporphyrazines including [Cu(2,3-tmtppa)]4+ and [Cu(3,4-tmtppa)]4+ complexes with plasmid DNA was studied using spectroscopic and gel electrophoresis methods. In addition, antibacterial effect of the complexes against Gram-positive (Staphylococcus aureus) and Gram-negative (Escherichia coli) bacteria was investigated using dilution test method. The results indicated that both porphyrazines have significant antibacterial properties, but Cu(PcTs) has weak antibacterial effect. Compairing the binding of the phthalocyanine and the porphyrazines to DNA demonstrated that the interaction of cationic porphyrazines is stronger than the anionic phthalocyanine remarkably. The extent of hypochromicity and red shift of absorption spectra indicated preferential intercalation of the two porphyrazine into the base pairs of DNA helix. Gel electrophoresis result implied Cu(2,3-tmtppa) and Cu(3,4-tmtppa) are able to perform cleavage of the plasmid DNA. Consequently, DNA binding and cleavage might be one of the antibacterial mechanisms of the complexes.

  5. Lipofection of plasmid DNA into human mast cell lines using lipid nanoparticles generated by microfluidic mixing.

    Science.gov (United States)

    Duguay, Brett A; Huang, Kate Wei-Chen; Kulka, Marianna

    2018-04-18

    Mast cells are important immune cells that have significant roles in mediating allergy and asthma. Therefore, studying the molecular mechanisms regulating these and other processes in mast cells is important to elucidate. Methods such as lipofection, transduction, and electroporation are often employed to dissect these mechanisms by disrupting gene expression in mast cell lines. However, as with other leukocytes, human mast cells (HMCs) are often refractory to the delivery of plasmids by lipofection. In this study, we investigated the utility of lipid nanoparticles (LNPs) containing the ionizable cationic lipids 1,2-dioleoyloxy-3-dimethylaminopropane, 1,2-dioleyloxy-3-dimethylaminopropane, or 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane for the delivery of plasmid DNA into HMC lines. Herein, we demonstrate for the first time the use of LNPs to achieve significant and reproducible levels of plasmid DNA transfection in HMC-1.2 and laboratory of allergic diseases 2 (LAD2) cells. These levels reached 53.2% and 16.0% in HMC-1.2 and LAD2 cells, respectively; and outperformed Lipofectamine 3000 in both cases. Moreover, cell viability in the transfected cells remained above 65% for all LNP conditions tested. Together, these observations illustrate the efficacy of this technique for mast cell researchers and further support the use of LNPs for nucleic acid delivery into leukocytes. ©2018 Society for Leukocyte Biology.

  6. Real-time Tracking of DNA Fragment Separation by Smartphone.

    Science.gov (United States)

    Tao, Chunxian; Yang, Bo; Li, Zhenqing; Zhang, Dawei; Yamaguchi, Yoshinori

    2017-06-01

    Slab gel electrophoresis (SGE) is the most common method for the separation of DNA fragments; thus, it is broadly applied to the field of biology and others. However, the traditional SGE protocol is quite tedious, and the experiment takes a long time. Moreover, the chemical consumption in SGE experiments is very high. This work proposes a simple method for the separation of DNA fragments based on an SGE chip. The chip is made by an engraving machine. Two plastic sheets are used for the excitation and emission wavelengths of the optical signal. The fluorescence signal of the DNA bands is collected by smartphone. To validate this method, 50, 100, and 1,000 bp DNA ladders were separated. The results demonstrate that a DNA ladder smaller than 5,000 bp can be resolved within 12 min and with high resolution when using this method, indicating that it is an ideal substitute for the traditional SGE method.

  7. Gene Transfer into the Lung by Nanoparticle Dextran-Spermine/Plasmid DNA Complexes

    Directory of Open Access Journals (Sweden)

    Syahril Abdullah

    2010-01-01

    Full Text Available A novel cationic polymer, dextran-spermine (D-SPM, has been found to mediate gene expression in a wide variety of cell lines and in vivo through systemic delivery. Here, we extended the observations by determining the optimal conditions for gene expression of D-SPM/plasmid DNA (D-SPM/pDNA in cell lines and in the lungs of BALB/c mice via instillation delivery. In vitro studies showed that D-SPM could partially protect pDNA from degradation by nuclease and exhibited optimal gene transfer efficiency at D-SPM to pDNA weight-mixing ratio of 12. In the lungs of mice, the levels of gene expression generated by D-SPM/pDNA are highly dependent on the weight-mixing ratio of D-SPM to pDNA, amount of pDNA in the complex, and the assay time postdelivery. Readministration of the complex at day 1 following the first dosing showed no significant effect on the retention and duration of gene expression. The study also showed that there was a clear trend of increasing size of the complexes as the amount of pDNA was increased, where the sizes of the D-SPM/pDNA complexes were within the nanometer range.

  8. Initiation and termination of the bacteriophage phi X174 rolling circle DNA replication in vivo: packaging of plasmid single-stranded DNA into bacteriophage phi X174 coats

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; Weisbeek, P. J.

    1982-01-01

    The bacteriophage phi X174 viral (+) origin when inserted in a plasmid can interact in vivo with the A protein produced by infecting phi X174 phages. A consequence of this interaction is packaging of single-stranded plasmid DNA into preformed phage coats resulting in infective particles (1). This

  9. Electrophoresis examination of strand breaks in plasmid DNA induced by low-energy nitrogen ion irradiation

    International Nuclear Information System (INIS)

    Zhao Yong; Tan Zheng; Du Yanhua; Qiu Guanying

    2003-01-01

    To study the effect on plasmid DNA of heavy ion in the energy range of keV where nuclear stopping interaction becomes more important or even predominant, thin film of plasmid pGEM-3Zf(-) DNA was prepared on aluminum surface and irradiated in vacuum ( -3 Pa) by low-energy nitrogen ions with energy of 30 keV (LET=285 keV/μm) at various fluence ranging from 2 x 10 10 to 8.2 x 10 13 ions/cm 2 . DNA strand breaks were analyzed by neutral electrophoresis followed by quantification with image analysis software. Low-energy nitrogen ion irradiation induced single-, double- and multiple double-strand breaks (DSB) and multiple DSB as the dominating form of DNA damages. Moreover, the linear fluence-response relationship at a low fluence range suggests that DSBs are induced predominantly by single ion track. However, strand break production is limited to a short range in the irradiated samples

  10. Effects of 32 P incorporated in plasmid DNA: strand breaks and mutagenesis

    International Nuclear Information System (INIS)

    Fonseca, Adenilson de S. da; Felzenszwalb, Israel

    1996-01-01

    In order to study the 32 P decay effects in DNA, bacterial plasmid were labeled with different activities of the radioisotope in vivo: 1,2 and 6 x 10 5 Bk/ml of bacterial culture, leading to 1,2 and 6 x 10 3 Bk/μg of nucleic acid or in vitro: 0.7, 1.5 and 3.5 x 10 3 Bk/μg of nucleic acid, stored at -20 deg C and its electroforetic profiles, transformation capacity of wild type and DNA repair. E. coli mutants cells and mutagenesis, were followed during three months. The results achieved in this work suggest that: the decay of the incorporated 32 P in vivo is able to change the pBR322 electroforetic profile, we detected a decrease on the form III (super coiled) and increase on the form II (circular), indicating single strands breaks; the decay incorporated 32 in vitro does not modify the electrophoretic profile of pBR322, suggesting that in some way the effects of the radioactive decay of incorporated 32 P is dependent of the DNA topology, the damages induced by 32 P decay increase mutation frequency in pAC189 plasmids. MRF is increased by a factor of three after 6 t 1/2 of storage, indicating direct or indirect action through mismatch DNA repair pathway. (author)

  11. Mutant DNA quantification by digital PCR can be confounded by heating during DNA fragmentation.

    Science.gov (United States)

    Kang, Qing; Parkin, Brian; Giraldez, Maria D; Tewari, Muneesh

    2016-04-01

    Digital PCR (dPCR) is gaining popularity as a DNA mutation quantification method for clinical specimens. Fragmentation prior to dPCR is required for non-fragmented genomic DNA samples; however, the effect of fragmentation on DNA analysis has not been well-studied. Here we evaluated three fragmentation methods for their effects on dPCR point mutation assay performance. Wild-type (WT) human genomic DNA was fragmented by heating, restriction digestion, or acoustic shearing using a Covaris focused-ultrasonicator. dPCR was then used to determine the limit of blank (LoB) by quantifying observed WT and mutant allele counts of the proto-oncogenes KRAS and BRAF in the WT DNA sample. DNA fragmentation by heating to 95°C, while the simplest and least expensive method, produced a high background mutation frequency for certain KRAS mutations relative to the other methods. This was due to heat-induced mutations, specifically affecting dPCR assays designed to interrogate guanine to adenine (G>A) mutations. Moreover, heat-induced fragmentation overestimated gene copy number, potentially due to denaturation and partition of single-stranded DNA into different droplets. Covaris acoustic shearing and restriction enzyme digestion showed similar LoBs and gene copy number estimates to one another. It should be noted that moderate heating, commonly used in genomic DNA extraction protocols, did not significantly increase observed KRAS mutation counts.

  12. Genotoxic activity of 4,4',5'-trimethylazapsoralen on plasmid DNA.

    Science.gov (United States)

    Lagatolla, C; Dolzani, L; Granzotto, M; Monti-Bragadin, C

    1998-01-01

    The genotoxic activities of 8-methoxypsoralen (8-MOP) and 4,4',5'-trimethylazapsoralen (4,4',5'-TMAP) on plasmid DNA have been compared. In a previous work, 4,4',5'-TMAP, a methyl derivative of a psoralen isoster, had shown potential photochemotherapeutic activity. The mutagenic activity of mono- and bifunctional lesions caused by these compounds was evaluated both after UVA irradiation, which causes the formation of both kinds of lesions, and after a two-step irradiation procedure of the psoralen-plasmid DNA complex, which allowed monoadducts and interstrand crosslinks to be studied separately. Furthermore, we used a procedure that allowed us to evaluate both the mutagenic and recombinogenic activity of the two compounds. Results indicate that the most important difference between 8-MOP and 4,4',5'-TMAP consists in their mode of photoreaction with DNA rather than in their mutagenic potential. In fact, in all of the experimental procedures, 4,4',5'-TMAP shows a lower ability than 8-MOP to generate interstrand crosslinks. However, when comparable toxicity levels are reached, the two compounds show the same mutagenic potentiality.

  13. Aqueous extract of Pinus caribaea inhibits the damage induced by ultraviolet radiations, in plasmid DNA

    Directory of Open Access Journals (Sweden)

    Marioly Vernhes Tamayo

    2017-08-01

    Full Text Available Context: The incidence of solar ultraviolet radiation (UV on Earth has increased due to diminish of the ozone layer. This enviromental agent is highly genotoxic causing numerous damage in DNA molecule. Nowadays there is a growing interest in the search of compounds capable to minimize these effects. In particular, phytocompounds have been tested as excelent candidates for their antigenotoxic properties. Aims: To evaluate the protective effect of the aqueous extract of Pinus caribaea (EPC against the damage induced by the UVB and UVC radiation. Methods: The cell-free plasmid DNA assay was employed. The forms of plasmid were separated electrophoretically in agarose gel. For genotoxic and photoprotective evaluation of P. caribaea, different concentrations of the extract (0.1 – 2.0 mg/mL and exposure times were evaluated. The CPD lesions were detected enzymatically. Additionally, the transmittance of the aqueous extract against 254 nm and 312 nm was measured. Results: None of the concentrations were genotoxic in 30 min of treatment, for superior times a clastogenic effect was observed. The EPC despite inhibiting the activity of the enzyme T4 endo V, impedes photolesions formation in DNA at concentrations ≥ 0.1 mg/mL. Conclusions: The EPC has photoprotective properties, this effect could be related with its antioxidants and absorptives capacities.

  14. Immunization with plasmid DNA encoding the hemagglutinin and the nucleoprotein confers robust protection against a lethal canine distemper virus challenge.

    Science.gov (United States)

    Dahl, Lotte; Jensen, Trine Hammer; Gottschalck, Elisabeth; Karlskov-Mortensen, Peter; Jensen, Tove Dannemann; Nielsen, Line; Andersen, Mads Klindt; Buckland, Robin; Wild, T Fabian; Blixenkrone-Møller, Merete

    2004-09-09

    We have investigated the protective effect of immunization of a highly susceptible natural host of canine distemper virus (CDV) with DNA plasmids encoding the viral nucleoprotein (N) and hemagglutinin (H). The combined intradermal and intramuscular routes of immunization elicited high virus-neutralizing serum antibody titres in mink (Mustela vison). To mimic natural exposure, we also conducted challenge infection by horizontal transmission from infected contact animals. Other groups received a lethal challenge infection by administration to the mucosae of the respiratory tract and into the muscle. One of the mink vaccinated with N plasmid alone developed severe disease after challenge. In contrast, vaccination with the H plasmid together with the N plasmid conferred solid protection against disease and we were unable to detect CDV infection in PBMCs or in different tissues after challenge. Our findings show that DNA immunization by the combined intradermal and intramuscular routes can confer solid protective immunity against naturally transmitted morbillivirus infection and disease.

  15. Effect of thiol pendant conjugates on plasmid DNA binding, release, and stability of polymeric delivery vectors.

    Science.gov (United States)

    Bacalocostantis, Irene; Mane, Viraj P; Kang, Michael S; Goodley, Addison S; Muro, Silvia; Kofinas, Peter

    2012-05-14

    Polymers have attracted much attention as potential gene delivery vectors due to their chemical and structural versatility. However, several challenges associated with polymeric carriers, including low transfection efficiencies, insufficient cargo release, and high cytotoxicity levels have prevented clinical implementation. Strong electrostatic interactions between polymeric carriers and DNA cargo can prohibit complete cargo release within the cell. As a result, cargo DNA never reaches the cell's nucleus where gene expression takes place. In addition, highly charged cationic polymers have been correlated with high cytotoxicity levels, making them unsuitable carriers in vivo. Using poly(allylamine) (PAA) as a model, we investigated how pH-sensitive disulfide cross-linked polymer networks can improve the delivery potential of cationic polymer carriers. To accomplish this, we conjugated thiol-terminated pendant chains onto the primary amines of PAA using 2-iminothiolane, developing three new polymer vectors with 5, 13, or 20% thiol modification. Unmodified PAA and thiol-conjugated polymers were tested for their ability to bind and release plasmid DNA, their capacity to protect genetic cargo from enzymatic degradation, and their potential for endolysosomal escape. Our results demonstrate that polymer-plasmid complexes (polyplexes) formed by the 13% thiolated polymer demonstrate the greatest delivery potential. At high N/P ratios, all thiolated polymers (but not unmodified counterparts) were able to resist decomplexation in the presence of heparin, a negatively charged polysaccharide used to mimic in vivo polyplex-protein interactions. Further, all thiolated polymers exhibited higher buffering capacities than unmodified PAA and, therefore, have a greater potential for endolysosomal escape. However, 5 and 20% thiolated polymers exhibited poor DNA binding-release kinetics, making them unsuitable carriers for gene delivery. The 13% thiolated polymers, on the other hand

  16. Poly(hydroxyethyl methacrylate) based magnetic nanoparticles for plasmid DNA purification from Escherichia coli lysate

    Energy Technology Data Exchange (ETDEWEB)

    Percin, Is Latin-Small-Letter-Dotless-I k [Department of Biology, Hacettepe University, Ankara (Turkey); Karakoc, Veyis [Department of Chemistry, Biochemistry Division, Hacettepe University, Ankara (Turkey); Akgoel, Sinan [Department of Biochemistry, Ege University, Izmir (Turkey); Aksoez, Erol [Department of Biology, Hacettepe University, Ankara (Turkey); Denizli, Adil, E-mail: denizli@hacettepe.edu.tr [Department of Chemistry, Biochemistry Division, Hacettepe University, Ankara (Turkey)

    2012-07-01

    The aim of this study is to prepare poly(hydroxyethyl methacrylate-N-methacryloyl-(L)-histidine) [PHEMAH] magnetic nanoparticles for plasmid DNA (pDNA) purification from Escherichia coli (E. coli) cell lysate. Magnetic nanoparticles were produced by surfactant free emulsion polymerization. mPHEMAH nanoparticles were characterized by elemental analysis, Fourier transform infrared spectroscopy (FTIR), atomic force microscopy (AFM), vibrating sample magnetometer (VSM), electron spin resonance (ESR), thermogravimetric analyses (TGA) and transmission electron microscopy (TEM). Surface area, average particle size and size distribution were also performed. Specific surface area of the mPHEMAH nanoparticles was found to be 1180 m{sup 2}/g. Elemental analysis of MAH for nitrogen was estimated as 0.18 mmol/g polymer. The amount of pDNA adsorbed onto the mPHEMAH nanoparticles first increased and then reached a saturation value at around 1.0 mg/mL of pDNA concentration. Compared with the mPHEMA nanoparticles (50 {mu}g/g polymer), the pDNA adsorption capacity of the mPHEMAH nanoparticles (154 mg/g polymer) was improved significantly due to the MAH incorporation into the polymeric matrix. The maximum pDNA adsorption was achieved at 25 Degree-Sign C. The overall recovery of pDNA was calculated as 92%. The mPHEMAH nanoparticles could be used six times without decreasing the pDNA adsorption capacity significantly. The results indicate that the PHEMAH nanoparticles promise high selectivity for pDNA. - Highlights: Black-Right-Pointing-Pointer Magnetic nanoparticles have several advantages over conventional adsorbents. Black-Right-Pointing-Pointer MAH acted as the pseudospecific ligand, ligand immobilization step was eliminated. Black-Right-Pointing-Pointer pDNA adsorption amount was 154 mg/g. Black-Right-Pointing-Pointer Fifty-fold capacity increase was obtained when compared to conventional matrices.

  17. Poly(hydroxyethyl methacrylate) based magnetic nanoparticles for plasmid DNA purification from Escherichia coli lysate

    International Nuclear Information System (INIS)

    Perçin, Işık; Karakoç, Veyis; Akgöl, Sinan; Aksöz, Erol; Denizli, Adil

    2012-01-01

    The aim of this study is to prepare poly(hydroxyethyl methacrylate-N-methacryloyl-(L)-histidine) [PHEMAH] magnetic nanoparticles for plasmid DNA (pDNA) purification from Escherichia coli (E. coli) cell lysate. Magnetic nanoparticles were produced by surfactant free emulsion polymerization. mPHEMAH nanoparticles were characterized by elemental analysis, Fourier transform infrared spectroscopy (FTIR), atomic force microscopy (AFM), vibrating sample magnetometer (VSM), electron spin resonance (ESR), thermogravimetric analyses (TGA) and transmission electron microscopy (TEM). Surface area, average particle size and size distribution were also performed. Specific surface area of the mPHEMAH nanoparticles was found to be 1180 m 2 /g. Elemental analysis of MAH for nitrogen was estimated as 0.18 mmol/g polymer. The amount of pDNA adsorbed onto the mPHEMAH nanoparticles first increased and then reached a saturation value at around 1.0 mg/mL of pDNA concentration. Compared with the mPHEMA nanoparticles (50 μg/g polymer), the pDNA adsorption capacity of the mPHEMAH nanoparticles (154 mg/g polymer) was improved significantly due to the MAH incorporation into the polymeric matrix. The maximum pDNA adsorption was achieved at 25 °C. The overall recovery of pDNA was calculated as 92%. The mPHEMAH nanoparticles could be used six times without decreasing the pDNA adsorption capacity significantly. The results indicate that the PHEMAH nanoparticles promise high selectivity for pDNA. - Highlights: ► Magnetic nanoparticles have several advantages over conventional adsorbents. ► MAH acted as the pseudospecific ligand, ligand immobilization step was eliminated. ► pDNA adsorption amount was 154 mg/g. ► Fifty-fold capacity increase was obtained when compared to conventional matrices.

  18. Photolysis of phosphodiester bonds in plasmid DNA by high intensity UV laser irradiation

    International Nuclear Information System (INIS)

    Croke, D.T.; Blau, Werner; OhUigin, Colm; Kelly, J.M.; McConnell, D.J.

    1988-01-01

    The cleavage of phosphodiester bonds in DNA exposed to high intensity UV laser pulses in aerated aqueous solution has been investigated using a krypton fluoride excimer laser (248 nm) and bacterial plasmid DNA. The dependence of strand breakage on fluence and intensity has been studied in detail and shows that the process is non-linear with respect to intensity. The relationship between the quantum yield for strand breakage and intensity shows that the strand breakage reaction involves two-photon excitation of DNA bases. The quantum yield rises with intensity from a lower value of 7 x 10 -5 until a maximum value of 4.5 x 10 -4 is attained at intensities of 10 11 W m -2 and above. This value is approximately fifty-fold higher than the quantum yield for strand breakage induced by exposure to low density UV irradiation (254 nm, 12 W m -2 ). DNA sequencing experiments have shown that strand breakage occurs by the specific cleavage of the phosphodiester bond which lies immediately 3' to guanine residues in the DNA, leaving some alkali-labile remnant attached to the terminal phosphate. A mechanism for DNA strand breakage which involves the generation of guanine radical cations is proposed. (author)

  19. Effective plasmid DNA and small interfering RNA delivery to diseased human brain microvascular endothelial cells.

    Science.gov (United States)

    Slanina, H; Schmutzler, M; Christodoulides, M; Kim, K S; Schubert-Unkmeir, A

    2012-01-01

    Expression of exogenous DNA or small interfering RNA (siRNA) in vitro is significantly affected by the particular delivery system utilized. In this study, we evaluated the transfection efficiency of plasmid DNA and siRNA into human brain microvascular endothelial cells (HBMEC) and meningioma cells, which constitute the blood-cerebrospinal fluid barrier, a target of meningitis-causing pathogens. Chemical transfection methods and various lipofection reagents including Lipofectamin™, FuGene™, or jetPRIME®, as well as physical transfection methods and electroporation techniques were applied. To monitor the transfection efficiencies, HBMEC and meningioma cells were transfected with the reporter plasmid pTagGFP2-actin vector, and efficiency of transfection was estimated by fluorescence microscopy and flow cytometry. We established protocols based on electroporation using Cell Line Nucleofector® Kit V with the Amaxa® Nucleofector® II system from Lonza and the Neon® Transfection system from Invitrogen resulting in up to 41 and 82% green fluorescent protein-positive HBMEC, respectively. Optimal transfection solutions, pulse programs and length were evaluated. We furthermore demonstrated that lipofection is an efficient method to transfect meningioma cells with a transfection efficiency of about 81%. Finally, we applied the successful electroporation protocols to deliver synthetic siRNA to HBMEC and analyzed the role of the actin-binding protein cortactin in Neisseria meningitidis pathogenesis. Copyright © 2012 S. Karger AG, Basel.

  20. Plasmid DNA initiates replication of yellow fever vaccine in vitro and elicits virus-specific immune response in mice

    International Nuclear Information System (INIS)

    Tretyakova, Irina; Nickols, Brian; Hidajat, Rachmat; Jokinen, Jenny; Lukashevich, Igor S.; Pushko, Peter

    2014-01-01

    Yellow fever (YF) causes an acute hemorrhagic fever disease in tropical Africa and Latin America. To develop a novel experimental YF vaccine, we applied iDNA infectious clone technology. The iDNA represents plasmid that encodes the full-length RNA genome of 17D vaccine downstream from a cytomegalovirus (CMV) promoter. The vaccine was designed to transcribe the full-length viral RNA and to launch 17D vaccine virus in vitro and in vivo. Transfection with 10 ng of iDNA plasmid was sufficient to start replication of vaccine virus in vitro. Safety of the parental 17D and iDNA-derived 17D viruses was confirmed in AG129 mice deficient in receptors for IFN-α/β/γ. Finally, direct vaccination of BALB/c mice with a single 20 μg dose of iDNA plasmid resulted in seroconversion and elicitation of virus-specific neutralizing antibodies in animals. We conclude that iDNA immunization approach combines characteristics of DNA and attenuated vaccines and represents a promising vaccination strategy for YF. - Highlights: • The iDNA ® platform combines advantages of DNA and live attenuated vaccines. • Yellow fever (YF) 17D vaccine was launched from iDNA plasmid in vitro and in vivo. • Safety of iDNA-generated 17D virus was confirmed in AG129 mice. • BALB/c mice seroconverted after a single-dose vaccination with iDNA. • YF virus-neutralizing response was elicited in iDNA-vaccinated mice

  1. Plasmid DNA initiates replication of yellow fever vaccine in vitro and elicits virus-specific immune response in mice

    Energy Technology Data Exchange (ETDEWEB)

    Tretyakova, Irina; Nickols, Brian; Hidajat, Rachmat [Medigen, Inc., 8420 Gas House Pike, Suite S, Frederick, MD 21701 (United States); Jokinen, Jenny; Lukashevich, Igor S. [Department of Pharmacology and Toxicology, School of Medicine, Center for Predictive Medicine and Emerging Infectious Diseases, University of Louisville, Louisville, KY (United States); Pushko, Peter, E-mail: ppushko@medigen-usa.com [Medigen, Inc., 8420 Gas House Pike, Suite S, Frederick, MD 21701 (United States)

    2014-11-15

    Yellow fever (YF) causes an acute hemorrhagic fever disease in tropical Africa and Latin America. To develop a novel experimental YF vaccine, we applied iDNA infectious clone technology. The iDNA represents plasmid that encodes the full-length RNA genome of 17D vaccine downstream from a cytomegalovirus (CMV) promoter. The vaccine was designed to transcribe the full-length viral RNA and to launch 17D vaccine virus in vitro and in vivo. Transfection with 10 ng of iDNA plasmid was sufficient to start replication of vaccine virus in vitro. Safety of the parental 17D and iDNA-derived 17D viruses was confirmed in AG129 mice deficient in receptors for IFN-α/β/γ. Finally, direct vaccination of BALB/c mice with a single 20 μg dose of iDNA plasmid resulted in seroconversion and elicitation of virus-specific neutralizing antibodies in animals. We conclude that iDNA immunization approach combines characteristics of DNA and attenuated vaccines and represents a promising vaccination strategy for YF. - Highlights: • The iDNA{sup ®} platform combines advantages of DNA and live attenuated vaccines. • Yellow fever (YF) 17D vaccine was launched from iDNA plasmid in vitro and in vivo. • Safety of iDNA-generated 17D virus was confirmed in AG129 mice. • BALB/c mice seroconverted after a single-dose vaccination with iDNA. • YF virus-neutralizing response was elicited in iDNA-vaccinated mice.

  2. Plasmid DNA transfection using magnetite cationic liposomes for construction of multilayered gene-engineered cell sheet.

    Science.gov (United States)

    Ino, Kosuke; Kawasumi, Tamayo; Ito, Akira; Honda, Hiroyuki

    2008-05-01

    Modification of cellular functions by overexpression of genes is being increasingly practiced for tissue engineering. In the present study, we investigated whether transfection efficiency could be enhanced by magnetofection that involves the use of plasmid DNA (pDNA)/magnetite cationic liposomes (MCLs) complexes (pDNA/MCL) and magnetic force. The transfection efficiencies of the magnetofection technique by pDNA/MCL in fibroblasts and keratinocytes using reporter genes were 36- and 10-fold higher, respectively, than those of a lipofection technique by cationic liposomes. Moreover, in vitro construction of three-dimensional (3D) tissues is an important challenge. We recently proposed a novel technique termed "magnetic force-based tissue engineering" (Mag-TE) to produce 3D tissues. Since the fibroblasts after magnetofection incorporated both magnetite nanoparticles and pDNA, we investigated whether multilayered heterotypic cell sheets expressing transgene could be fabricated by Mag-TE. First, the fibroblasts were seeded onto an ultra-low attachment culture plate. When a magnet was placed under the plate, the cells accumulated at the bottom of the culture plate. After 24 h of culture, the transgene-expressing cells formed a multilayered cell sheet-like structure. These results indicated that MCLs are a potent biomanipulation tool for both gene transfer and 3D tissue construction, suggesting that these techniques are useful for tissue engineering. Copyright 2007 Wiley Periodicals, Inc.

  3. Dual recombinant Lactococcus lactis for enhanced delivery of DNA vaccine reporter plasmid pPERDBY.

    Science.gov (United States)

    Yagnik, Bhrugu; Sharma, Drashya; Padh, Harish; Desai, Priti

    2017-04-01

    Food grade Lactococcus lactis has been widely used as an antigen and DNA delivery vehicle. We have previously reported the use of non-invasive L. lactis to deliver the newly constructed immunostimulatory DNA vaccine reporter plasmid, pPERDBY. In the present report, construction of dual recombinant L. lactis expressing internalin A of Listeria monocytogenes and harboring pPERDBY (LL InlA + pPERDBY) to enhance the efficiency of delivery of DNA by L. lactis is outlined. After confirmation and validation of LL InlA + pPERDBY, its DNA delivery potential was compared with previously developed non-invasive r- L. lactis::pPERDBY. The use of invasive L. lactis resulted in around threefold increases in the number of enhanced green fluorescent protein-expressing Caco-2 cells. These findings reinforce the prospective application of invasive strain of L. lactis for delivery of DNA/RNA and antigens. © 2017 The Societies and John Wiley & Sons Australia, Ltd.

  4. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono

    2008-11-01

    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  5. PlasmaDNA: a free, cross-platform plasmid manipulation program for molecular biology laboratories

    Directory of Open Access Journals (Sweden)

    Rainy Jeffrey

    2007-09-01

    Full Text Available Abstract Background Most molecular biology experiments, and the techniques associated with this field of study, involve a great deal of engineering in the form of molecular cloning. Like all forms of engineering, perfect information about the starting material is crucial for successful completion of design and strategies. Results We have generated a program that allows complete in silico simulation of the cloning experiment. Starting with a primary DNA sequence, PlasmaDNA looks for restriction sites, open reading frames, primer annealing sequences, and various common domains. The databases are easily expandable by the user to fit his most common cloning needs. PlasmaDNA can manage and graphically represent multiple sequences at the same time, and keeps in memory the overhangs at the end of the sequences if any. This means that it is possible to virtually digest fragments, to add the digestion products to the project, and to ligate together fragments with compatible ends to generate the new sequences. Polymerase Chain Reaction (PCR fragments can also be virtually generated using the primer database, automatically adding to the fragments any 5' extra sequences present in the primers. Conclusion PlasmaDNA is a program available both on Windows and Apple operating systems, designed to facilitate molecular cloning experiments by building a visual map of the DNA. It then allows the complete planning and simulation of the cloning experiment. It also automatically updates the new sequences generated in the process, which is an important help in practice. The capacity to maintain multiple sequences in the same file can also be used to archive the various steps and strategies involved in the cloning of each construct. The program is freely available for download without charge or restriction.

  6. Enhanced extraction and purification of plasmid DNA from escherichia coli by applying a hybrid magnetic nanocomposite

    Energy Technology Data Exchange (ETDEWEB)

    Silva, R.J. da; Chavez-Guajardo, A.E.; Medina-llamas, J.C.; Alcaraz-Espinoza, J.J.; Melo, C.P. de [Universidade Federal de Pernambuco (UFPE), PE (Brazil)

    2016-07-01

    Full text: Plasmid DNA (pDNA), a special kind of nucleic acid usually found in bacteria, is a small molecule physically distinct from chromosomal DNA that can replicate independently. This genetic material has been used in a wide set of biotechnological methodologies, such as genetic engineering, production of recombinant drugs and gene therapy, among others. In all these applications, the extraction and purification of pDNA appears as a crucial step. In this work, we describe the synthesis of a polyaniline and maghemite (PANI/?-Fe2O3) magnetic nanocomposite (MNC) and its use in a new Escherichia coli (E. coli) pDNA extraction and purification protocol. We have used transmission electron microscopy (TEM), UV-Vis spectroscopy, infrared spectroscopy (FTIR), X-ray diffraction (XRD), dynamic light scattering (DLS) and magnetic measurements to characterize the MNC, which was synthesized through an emulsion polymerization method. The yield, purity and quality of the pDNA extracted by using our proposed MNC protocol were evaluated through UV-Vis, agarose gel electrophoreses and PCR techniques, respectively. After comparing our results to those obtained by use of a commercial kit (Promega Wizard Plus SV Minipreps), we suggest that the novel protocol here proposed appears as a competitive alternative methodology. Not only the purification step can be completed within only 10 min, but the high adsorption capacity of the MNC results in pDNA yields that are almost twice the best values obtained by using the commercial kit. Hence, this new MNC methodology can be of general interest and find widespread use in different types of biomedical applications. (author)

  7. DNA Length Modulates the Affinity of Fragments of Genomic DNA for the Nuclear Matrix In Vitro.

    Science.gov (United States)

    García-Vilchis, David; Aranda-Anzaldo, Armando

    2017-12-01

    Classical observations have shown that during the interphase the chromosomal DNA of metazoans is organized in supercoiled loops attached to a compartment known as the nuclear matrix (NM). Fragments of chromosomal DNA able to bind the isolated NM in vitro are known as matrix associated/attachment/addressed regions or MARs. No specific consensus sequence or motif has been found that may constitute a universal, defining feature of MARs. On the other hand, high-salt resistant DNA-NM interactions in situ define true DNA loop anchorage regions or LARs, that might correspond to a subset of the potential MARs but are not necessarily identical to MARs characterized in vitro, since there are several examples of MARs able to bind the NM in vitro but which are not actually bound to the NM in situ. In the present work we assayed the capacity of two LARs, as well as of shorter fragments within such LARs, for binding to the NM in vitro. Paradoxically the isolated (≈2 kb) LARs cannot bind to the NM in vitro while their shorter (≈300 pb) sub-fragments and other non-related but equally short DNA fragments, bind to the NM in a high-salt resistant fashion. Our results suggest that the ability of a given DNA fragment for binding to the NM in vitro primarily depends on the length of the fragment, suggesting that binding to the NM is modulated by the local topology of the DNA fragment in suspension that it is known to depend on the DNA length. J. Cell. Biochem. 118: 4487-4497, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  8. A comparison of synthetic oligodeoxynucleotides, DNA fragments and AAV-1 for targeted episomal and chromosomal gene repair

    Directory of Open Access Journals (Sweden)

    Leclerc Xavier

    2009-04-01

    Full Text Available Abstract Background Current strategies for gene therapy of inherited diseases consist in adding functional copies of the gene that is defective. An attractive alternative to these approaches would be to correct the endogenous mutated gene in the affected individual. This study presents a quantitative comparison of the repair efficiency using different forms of donor nucleic acids, including synthetic DNA oligonucleotides, double stranded DNA fragments with sizes ranging from 200 to 2200 bp and sequences carried by a recombinant adeno-associated virus (rAAV-1. Evaluation of each gene repair strategy was carried out using two different reporter systems, a mutated eGFP gene or a dual construct with a functional eGFP and an inactive luciferase gene, in several different cell systems. Gene targeting events were scored either following transient co-transfection of reporter plasmids and donor DNAs, or in a system where a reporter construct was stably integrated into the chromosome. Results In both episomal and chromosomal assays, DNA fragments were more efficient at gene repair than oligonucleotides or rAAV-1. Furthermore, the gene targeting frequency could be significantly increased by using DNA repair stimulating drugs such as doxorubicin and phleomycin. Conclusion Our results show that it is possible to obtain repair frequencies of 1% of the transfected cell population under optimized transfection protocols when cells were pretreated with phleomycin using rAAV-1 and dsDNA fragments.

  9. DNA sequence analysis of plasmids from multidrug resistant Salmonella enterica serotype Heidelberg isolates.

    Directory of Open Access Journals (Sweden)

    Jing Han

    Full Text Available Salmonella enterica serovar Heidelberg is among the most detected serovars in swine and poultry, ranks among the top five serotypes associated with human salmonellosis and is disproportionately associated with invasive infections and mortality in humans. Salmonella are known to carry plasmids associated with antimicrobial resistance and virulence. To identify plasmid-associated genes in multidrug resistant S. enterica serovar Heidelberg, antimicrobial resistance plasmids from five isolates were sequenced using the 454 LifeSciences pyrosequencing technology. Four of the isolates contained incompatibility group (Inc A/C multidrug resistance plasmids harboring at least eight antimicrobial resistance genes. Each of these strains also carried a second resistance plasmid including two IncFIB, an IncHI2 and a plasmid lacking an identified Inc group. The fifth isolate contained an IncI1 plasmid, encoding resistance to gentamicin, streptomycin and sulfonamides. Some of the IncA/C plasmids lacked the full concert of transfer genes and yet were able to be conjugally transferred, likely due to the transfer genes carried on the companion plasmids in the strains. Several non-IncA/C resistance plasmids also carried putative virulence genes. When the sequences were compared to previously sequenced plasmids, it was found that while all plasmids demonstrated some similarity to other plasmids, they were unique, often due to differences in mobile genetic elements in the plasmids. Our study suggests that Salmonella Heidelberg isolates harbor plasmids that co-select for antimicrobial resistance and virulence, along with genes that can mediate the transfer of plasmids within and among other bacterial isolates. Prevalence of such plasmids can complicate efforts to control the spread of S. enterica serovar Heidelberg in food animal and human populations.

  10. A combined approach of hollow microneedles and nanocarriers for skin immunization with plasmid DNA encoding ovalbumin

    Directory of Open Access Journals (Sweden)

    Pamornpathomkul B

    2017-01-01

    Full Text Available Boonnada Pamornpathomkul,1 Adisak Wongkajornsilp,2 Wanida Laiwattanapaisal,3 Theerasak Rojanarata,1 Praneet Opanasopit,1 Tanasait Ngawhirunpat1 1Department of Pharmaceutical Technology, Faculty of Pharmacy, Pharmaceutical Development of Green Innovations Group, Silpakorn University, Nakhon Pathom, 2Department of Pharmacology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, 3Department of Clinical Chemistry, Faculty of Allied Health Sciences, Chulalongkorn University, Bangkok, Thailand Abstract: The aim of this study was to investigate the use of different types of microneedles (MNs and nanocarriers for in vitro skin permeation and in vivo immunization of plasmid DNA encoding ovalbumin (pOVA. In vitro skin permeation studies indicated that hollow MNs had a superior enhancing effect on skin permeation compared with solid MN patches, electroporation (EP patches, the combination of MN and EP patches, and untreated skin. Upon using hollow MNs combined with nanocarriers for pOVA delivery, the skin permeation was higher than for the delivery of naked pOVA, as evidenced by the increased amount of pOVA in Franz diffusion cells and immunoglobulin G (IgG antibody responses. When the hollow MNs were used for the delivery of nanocarrier:pOVA complexes into the skin of mice, they induced a stronger IgG immune response than conventional subcutaneous (SC injections. In addition, immunization of mice with the hollow MNs did not induce signs of skin infection or pinpoint bleeding. Accordingly, the hollow MNs combined with a nanocarrier delivery system is a promising approach for delivering pOVA complexes to the skin for promoting successful immunization. Keywords: hollow microneedle, solid microneedle, electroporation, plasmid DNA encoding ovalbumin, skin immunization, nanocarrier

  11. Plasmid DNA is released from nanosized acicular material surface by low molecular weight oligonucleotides: exogenous plasmid acquisition mechanism for penetration intermediates based on the Yoshida effect.

    Science.gov (United States)

    Yoshida, N; Ide, K

    2008-10-01

    When a colloidal solution consisting of nanosized acicular material and bacterial cells is stimulated with sliding friction at the interface between the hydrogel and interface-forming material where the frictional coefficient increases rapidly, the nanosized acicular material accompanying the bacterial cells forms a penetration intermediate. This effect is known as the Yoshida effect in honor of its discoverer. Through the Yoshida effect, a novel property in which penetration intermediates incorporate exogenous plasmid DNA has been identified. This report proposes a possible mechanism for exogenous plasmid acquisition by penetration intermediates in the Yoshida effect. Escherichia coli cells, pUC18, and chrysotile were used as recipient cells, plasmid DNA, and nanosized acicular material, respectively. Even when repeatedly washing the mixture consisting of pUC18 and chrysotile, transformation efficiency by pUC18 was stable. Accordingly, pUC18 adsorbed onto chrysotile was introduced into recipient E. coli cells. At saturation, the amount of pUC18 adsorbed onto chrysotile was 0.8-1.2 microg/mg. To investigate whether pUC18 adsorbed on chrysotile is replicated by polymerase, polymerase chain reaction (PCR) was carried out with the chrysotile. Amplification of the beta-lactamase gene coded in pUC18, which was adsorbed onto chrysotile, was strongly inhibited. This suggests that DNA adsorbed onto chrysotile is not replicated in vivo. When we searched for substances to release pUC18 adsorbed onto chrysotile, we found that a 300-bp single- or double-stranded segment of DNA releases pUC18 from chrysotile. Competitive adsorption onto chrysotile between double-stranded DNA and pUC18 was then examined through the Yoshida effect. The 310- and 603-bp double-stranded nucleotides caused 50% competitive inhibition at the same molar ratio with pUC18. Hence, the adsorbed region of pUC18 is about 300 bp in length. As the culture period for recipient cells increases, transformation

  12. Plasmid DNA initiates replication of yellow fever vaccine in vitro and elicits virus-specific immune response in mice.

    Science.gov (United States)

    Tretyakova, Irina; Nickols, Brian; Hidajat, Rachmat; Jokinen, Jenny; Lukashevich, Igor S; Pushko, Peter

    2014-11-01

    Yellow fever (YF) causes an acute hemorrhagic fever disease in tropical Africa and Latin America. To develop a novel experimental YF vaccine, we applied iDNA infectious clone technology. The iDNA represents plasmid that encodes the full-length RNA genome of 17D vaccine downstream from a cytomegalovirus (CMV) promoter. The vaccine was designed to transcribe the full-length viral RNA and to launch 17D vaccine virus in vitro and in vivo. Transfection with 10 ng of iDNA plasmid was sufficient to start replication of vaccine virus in vitro. Safety of the parental 17D and iDNA-derived 17D viruses was confirmed in AG129 mice deficient in receptors for IFN-α/β/γ. Finally, direct vaccination of BALB/c mice with a single 20 μg dose of iDNA plasmid resulted in seroconversion and elicitation of virus-specific neutralizing antibodies in animals. We conclude that iDNA immunization approach combines characteristics of DNA and attenuated vaccines and represents a promising vaccination strategy for YF. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. [Effect of endonuclease G depletion on plasmid DNA uptake and levels of homologous recombination in hela cells].

    Science.gov (United States)

    Misic, V; El-Mogy, M; Geng, S; Haj-Ahmad, Y

    2016-01-01

    Endonuclease G (EndoG) is a mitochondrial apoptosis regulator that also has roles outside of programmed cell death. It has been implicated as a defence DNase involved in the degradation of exogenous DNA after transfection of mammalian cells and in homologous recombination of viral and endogenous DNA. In this study, we looked at the effect of EndoG depletion on plasmid DNA uptake and the levels of homologous recombination in HeLa cells. We show that the proposed defence role of EndoG against uptake of non-viral DNA vectors does not extend to the cervical carcinoma HeLa cells, as targeting of EndoG expression by RNA interference failed to increase intracellular plasmid DNA levels. However, reducing EndoG levels in HeLa cells resulted in a statistically significant reduction of homologous recombination between two plasmid DNA substrates. These findings suggest that non-viral DNA vectors are also substrates for EndoG in its role in homologous recombination.

  14. Fragmentation of sperm DNA using the TUNEL method.

    Science.gov (United States)

    Chenlo, P H; Curi, S M; Pugliese, M N; Ariagno, J I; Sardi-Segovia, M; Furlan, M J; Repetto, H E; Zeitler, E; Cohen, M; Mendeluk, G R

    2014-11-01

    To establish the validity of the TUNEL assay in determining sperm DNA fragmentation, the relationship between the degree of fragmentation and the seminal parameters and the sample needed to conduct the test. We used semen samples from healthy fertile men (n=33), patients who consulted for infertility with a prescription for the TUNEL assay (n=77) and patients with intracytoplasmic sperm injection failure (n=20), analyzed according to the 2010 WHO. The TUNEL/propidium iodide test was performed by flow cytometry, on baseline and post-swim-up samples. The cutoff value for the TUNEL assay (ROC curves) was 26%, with a sensitivity and specificity of 85% and 89%, respectively. The pre-swim-up and post-swim-up medians of the results from the TUNEL assay showed no significant differences (17.0% vs. 12.9%, respectively). However, 39.1% of the samples showed a difference greater than 15 in absolute value between the results of the baseline and post-swim-up TUNEL assays. The linear correlation study of the morphology, mobility and vitality using the post-swim-up TUNEL assay showed a greater correlation than preselection, with significant results (r: -0.394, P<.0001; r: -0.461, P<.0001; r: -0.526, P<.0001). The TUNEL assay is a valid test for clinical use. DNA fragmentation is a factor independent from traditional semen tests. We found a greater susceptibility to damage generated in the laboratory procedures in the samples with lower quality. The sample of choice for evaluating DNA fragmentation will depend on whether the clinician is treating a natural or assisted fertilization. Copyright © 2014 AEU. Published by Elsevier Espana. All rights reserved.

  15. Process optimisation for anion exchange monolithic chromatography of 4.2kbp plasmid vaccine (pcDNA3F).

    Science.gov (United States)

    Ongkudon, Clarence M; Danquah, Michael K

    2010-10-15

    Anion exchange monolithic chromatography is increasingly becoming a prominent tool for plasmid DNA purification but no generic protocol is available to purify all types of plasmid DNA. In this work, we established a simple framework and used it to specifically purify a plasmid DNA model from a clarified alkaline-lysed plasmid-containing cell lysate. The framework involved optimising ligand functionalisation temperature (30-80°C), mobile phase flow rate (0.1-1.8mL/min), monolith pore size (done by changing the porogen content in the polymerisation reaction by 50-80%), buffer pH (6-10), ionic strength of binding buffer (0.3-0.7M) and buffer gradient elution slope (1-10% buffer B/min). We concluded that preferential pcDNA3F adsorption and optimum resolution could be achieved within the tested conditions by loading the clarified cell lysate into 400nm pore size of monolith in 0.7M NaCl (pH 6) of binding buffer followed by increasing the NaCl concentration to 1.0M at 3%B/min. Copyright © 2010 Elsevier B.V. All rights reserved.

  16. DNA fragmentation and cytotoxicity by recombinant human tumor necrosis factor in L929 fibroblast cells

    International Nuclear Information System (INIS)

    Kosaka, T.; Kuwabara, M.; Koide, F.

    1992-01-01

    Induction of cell DNA fragmentation by treatment of recombinant human Tumor Necrosis Factor alpha (rhTNF alpha) was examined by using mouse L929 cells derived from mouse fibroblast cells. The amount of DNA fragments derived from rhTNF alpha-treated cells, detected by alkaline elution technique, was smaller than that derived from X-irradiated cells. The rhTNF alpha caused the DNA fragmentation depending on its incubation time and concentration. The DNA damage caused by rhTNF alpha treatment correlated with its cytotoxicity. This result suggested that the DNA fragmentation is one of causes of cell death. The treatment with proteinase K of DNA obtained from rhTNF alpha-treated cells did not increase the amount of DNA fragmentation, which indicates that rhTNF alpha causes DNA-fragmentation but not DNA-protein cross-linking

  17. Nondetectability of restriction fragments and independence of DNA fragment sizes within and between loci in RFLP typing of DNA

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, R.; Zhong, Y.; Jin, L. (Univ. of Texas Health Science Center, Houston, TX (United States)); Budowle, B. (FBI Academy, Quantico, VA (United States))

    1994-08-01

    The authors provide experimental evidence showing that, during the restriction-enzyme digestion of DNA samples, some of the HaeIII-digested DNA fragments are small enough to prevent their reliable sizing on a Southern gel. As a result of such nondetectability of DNA fragments, individuals who show a single-band DNA profile at a VNTR locus may not necessarily be true homozygotes. In a population database, when the presence of such nondetectable alleles is ignored, they show that a pseudodependence of alleles within as well as across loci may occur. Using a known statistical method, under the hypothesis of independence of alleles within loci, they derive an efficient estimate of null allele frequency, which may be subsequently used for testing allelic independence within and across loci. The estimates of null allele frequencies, thus derived, are shown to agree with direct experimental data on the frequencies of HaeIII-null alleles. Incorporation of null alleles into the analysis of the forensic VNTR database suggests that the assumptions of allelic independence within and between loci are appropriate. In contrast, a failure to incorporate the occurrence of null alleles would provide a wrong inference regarding the independence of alleles within and between loci. 47 refs., 2 figs., 4 tabs.

  18. Putative DNA-dependent RNA polymerase in Mitochondrial Plasmid of Paramecium caudatum Stock GT704

    Directory of Open Access Journals (Sweden)

    Trina Ekawati Tallei

    2015-10-01

    Full Text Available Mitochondria of Paramecium caudatum stock GT704 has a set of four kinds of linear plasmids with sizes of 8.2, 4.1, 2.8 and 1.4 kb. The plasmids of 8.2 and 2.8 kb exist as dimers consisting of 4.1- and 1.4-kb monomers, respectively. The plasmid 2.8 kb, designated as pGT704-2.8, contains an open reading frame encodes for putative DNA-dependent RNA polymerase (RNAP. This study reveals that this RNAP belongs to superfamily of DNA/RNA polymerase and family of T7/T3 single chain RNA polymerase and those of mitochondrial plasmid of fungi belonging to Basidiomycota and Ascomycota. It is suggested that RNAP of pGT704-2.8 can perform transcription without transcription factor as promoter recognition. Given that only two motifs were found, it could not be ascertained whether this RNAP has a full function independently or integrated with mtDNA in carrying out its function.

  19. Effect of the caffeine on treated and non-treated plasmid DNA with stannic chloride; Efeito da cafeina em DNA plasmidial tratado e nao tratado com cloreto estanoso

    Energy Technology Data Exchange (ETDEWEB)

    Moreno, Silvana Ramos F. [Universidade do Estado, Rio de Janeiro, RJ (Brazil). Inst. de Biologia. Dept. de Biofisica e Biometria]|[Universidade Federal Fluminense, Niteroi, RJ (Brazil). Faculdade de Ciencias Medicas. Curso de Pos-graduacao em Patologia Experimental; Mattos, Jose C.P. de; Dantas, Flavio; Araujo, Adriano Caldeira de; Bernardo-Filho, Mario [Universidade do Estado, Rio de Janeiro, RJ (Brazil). Inst. de Biologia. Dept. de Biofisica e Biometria]. E-mail: bernardo@uerj.br

    2000-07-01

    Caffeine, a methilxantine drug is a component of coffee, tea, stimulants and other drinks. Caffeine inhibits phosphodiesterase leading to intracellular accumulation of cyclic AMP, blocks adenosine receptors, and increases the release of Ca{sup 2+}. We have studied the possible effect of caffeine in DNA plasmid treated or not with stannous chloride (SnCl{sub 2}). Previous evaluations of the effect of caffeine on the labeling of red blood cells and plasma proteins with technetium-99m have showed a decrease of % ATI in the insoluble fraction of plasma proteins. Samples of DNA were treated with SnCl{sub 2} (0 and 200{mu}g/ml) in 0.8% agarose. SnCl{sub 2} has induced break on DNA and caffeine has not showed effect on the DNA. This indicates that caffeine does not eliminate the oxidant action of SnCl{sub 2} and does not promote break in isolated DNA plasmid. (author)

  20. Lipophilic Polycation Vehicles Display High Plasmid DNA Delivery to Multiple Cell Types.

    Science.gov (United States)

    Wu, Yaoying; Smith, Adam E; Reineke, Theresa M

    2017-08-16

    A class of cationic poly(alkylamidoamine)s (PAAAs) containing lipophilic methylene linkers were designed and examined as in vitro plasmid DNA (pDNA) delivery agents. The PAAAs were synthesized via step-growth polymerization between a diamine monomer and each of four different diacid chloride monomers with varying methylene linker lengths, including glutaryl chloride, adipoyl chloride, pimeloyl chloride, and suberoyl chloride, which served to systematically increase the lipophilicity of the polymers. The synthesized polymers successfully complexed with pDNA in reduced serum medium at N/P ratios of 5 and greater, resulting in polyplexes with hydrodynamic diameters of approximately 1 μm. These polyplexes were tested for in vitro transgene expression and cytotoxicity using HDFa (human dermal fibroblast), HeLa (human cervical carcinoma), HMEC (human mammary epithelial), and HUVEC (human umbilical vein endothelial) cells. Interestingly, select PAAA polyplex formulations were found to be more effective than Lipofectamine 2000 at promoting transgene expression (GFP) while maintaining comparable or higher cell viability. Transgene expression was highest in HeLa cells (∼90% for most formulations) and lowest in HDFa cells (up to ∼20%) as measured by GFP fluorescence. In addition, the cytotoxicity of PAAA polyplex formulations was significantly increased as the molecular weight, N/P ratio, and methylene linker length were increased. The PAAA vehicles developed herein provide a new delivery vehicle design strategy of displaying attributes of both polycations and lipids, which show promise as a tunable scaffold for refining the structure-activity-toxicity profiles for future genome editing studies.

  1. Correction of the lack of commutability between plasmid DNA and genomic DNA for quantification of genetically modified organisms using pBSTopas as a model.

    Science.gov (United States)

    Zhang, Li; Wu, Yuhua; Wu, Gang; Cao, Yinglong; Lu, Changming

    2014-10-01

    Plasmid calibrators are increasingly applied for polymerase chain reaction (PCR) analysis of genetically modified organisms (GMOs). To evaluate the commutability between plasmid DNA (pDNA) and genomic DNA (gDNA) as calibrators, a plasmid molecule, pBSTopas, was constructed, harboring a Topas 19/2 event-specific sequence and a partial sequence of the rapeseed reference gene CruA. Assays of the pDNA showed similar limits of detection (five copies for Topas 19/2 and CruA) and quantification (40 copies for Topas 19/2 and 20 for CruA) as those for the gDNA. Comparisons of plasmid and genomic standard curves indicated that the slopes, intercepts, and PCR efficiency for pBSTopas were significantly different from CRM Topas 19/2 gDNA for quantitative analysis of GMOs. Three correction methods were used to calibrate the quantitative analysis of control samples using pDNA as calibrators: model a, or coefficient value a (Cva); model b, or coefficient value b (Cvb); and the novel model c or coefficient formula (Cf). Cva and Cvb gave similar estimated values for the control samples, and the quantitative bias of the low concentration sample exceeded the acceptable range within ±25% in two of the four repeats. Using Cfs to normalize the Ct values of test samples, the estimated values were very close to the reference values (bias -13.27 to 13.05%). In the validation of control samples, model c was more appropriate than Cva or Cvb. The application of Cf allowed pBSTopas to substitute for Topas 19/2 gDNA as a calibrator to accurately quantify the GMO.

  2. Persistence of plasmids, cholera toxin genes, and prophage DNA in classical Vibrio cholerae O1.

    OpenAIRE

    Cook, W L; Wachsmuth, K; Johnson, S R; Birkness, K A; Samadi, A R

    1984-01-01

    Plasmid profiles, the location of cholera toxin subunit A genes, and the presence of the defective VcA1 prophage genome in classical Vibrio cholerae isolated from patients in Bangladesh in 1982 were compared with those in older classical strains isolated during the sixth pandemic and with those in selected eltor and nontoxigenic O1 isolates. Classical strains typically had two plasmids (21 and 3 megadaltons), eltor strains typically had no plasmids, and nontoxigenic O1 strains had zero to thr...

  3. Size effect on transfection and cytotoxicity of nanoscale plasmid DNA/polyethyleneimine complexes for aerosol gene delivery

    Energy Technology Data Exchange (ETDEWEB)

    Hoon Byeon, Jeong, E-mail: jbyeon@purdue.edu [Department of Chemistry, Purdue University, West Lafayette, Indiana 47907 (United States); Kim, Jang-Woo, E-mail: jwkim@hoseo.edu [Department of Digital Display Engineering, Hoseo University, Asan 336-795 (Korea, Republic of)

    2014-02-03

    Nanoscale plasmid DNA (pDNA)/polyethyleneimine (PEI) complexes were fabricated in the aerosol state using a nebulization system consisting of a collison atomizer and a cool-walled diffusion dryer. The aerosol fabricated nanoscale complexes were collected and employed to determine fundamental properties of the complexes, such as size, structure, surface charge, and in vitro gene transfection efficiency and cytotoxicity. The results showed that mass ratio between pDNA and PEI should be optimized to enhance gene transfection efficiency without a significant loss of cell viability. These findings may support practical advancements in the field of nonviral gene delivery.

  4. Integral parametrization of the Kinetics of Crosslink production in plasmid DNA as a function of 8-methoxypsoralen concentration

    Energy Technology Data Exchange (ETDEWEB)

    Vidania, R. de; Paramio, J. M.; Bauluz, C.

    1986-07-01

    In this paper we present results of crosslink production in pBR322 DNA along a wide range of 8-methoxypsoralen (8-MOP) concentration. Experimental data were obtained as DNA renaturation percentages, from the shift in hyperchromicity after a temperature-dependent denaturation-renaturation process. the experimental results showed a three-stage profile when represented as a function of the natural logarithms of 8-MOP concentration. an integral parametrization which allows a simultaneous fit of the three observed stages is presented here. the theoretical values of crosslink production determined from the fit are useful to asses the genotoxicity of psoralen-induced crosslinks in plasmid DNA. (Author) 24 refs.

  5. Integral parametrization of the Kinetics of Crosslink production in plasmid DNA as a function of 8-methoxypsoralen concentration

    International Nuclear Information System (INIS)

    Vidania, R. de; Paramio, J. M.; Bauluz, C.

    1986-01-01

    In this paper we present results of crosslink production in pBR322 DNA along a wide range of 8-methoxypsoralen (8-MOP) concentration. Experimental data were obtained as DNA renaturation percentages, from the shift in hyperchromicity after a temperature-dependent denaturation-renaturation process. the experimental results showed a three-stage profile when represented as a function of the natural logarithms of 8-MOP concentration. an integral parametrization which allows a simultaneous fit of the three observed stages is presented here. the theoretical values of crosslink production determined from the fit are useful to asses the genotoxicity of psoralen-induced crosslinks in plasmid DNA. (Author) 24 refs

  6. Cloning and DNA sequence of the mercuric- and organomercurial-resistance determinants of plasmid pDU1358

    International Nuclear Information System (INIS)

    Griffin, H.G.; Foster, T.J.; Silver, S.; Misra, T.K.

    1987-01-01

    The broad-spectrum mercurial-resistance plasmid pDU1358 was analyzed by cloning the resistance determinants and preparing a physical and genetic map of a 45-kilobase (kb) region of the plasmid that contains two separate mercurial-resistance operons that mapped about 20 kb apart. One encoded narrow-spectrum mercurial resistance to Hg 2+ and a few organomercurials; the other specified broad-spectrum resistance to phenylmercury and additional organomercurials. Each determinant governed mercurial transport functions. Southern DNA x DNA hybridization experiments using gene-specific probes from the plasmid R100 mer operon indicated close homology with the R100 deteminant. The 2153 base pairs of the promoter-distal part of the broad-spectrum Hg 2+ -resistance operon of pDU1358 were sequenced. This region included the 3'-terminal part of the merA gene, merD, unidentified reading frame URF1, and a part of URF2 homologous to previously sequenced determinants of plasmid R100. Between the merA and merD genes, an open reading frame encoding a 212 amino acid polypeptide was identified as the merB gene that determines the enzyme organomercurial lyase that cleaves the C-Hg bond of phenylmercury

  7. DNA damage produced by exposure of supercoiled plasmid DNA to high- and low-LET ionizing radiation: Effects of hydroxyl radical quenchers. DNA breakage, neutrons, OH radicals

    International Nuclear Information System (INIS)

    Peak, J.G.; Ito, T.; Peak, M.J.; Robb, F.T.

    1994-01-01

    A supercoiled plasmid of 7300 base pairs was isolated and exposed in an aqueous environment to 60 Co γ rays and JANUS 0.85 MeV fission-spectrum neutrons. Dose responses for the production of single-strand breaks (SSBs), double-strand breaks (DSBs) and alkali-labile sites (ALSs) were compared with computations made from the conversion of the supercoil to its relaxed and linear forms. The relative biological effectiveness (RBE) for production of SSBs and DSBs was similar to that previously measured in the cellular environment. The RBE for destruction of genetic transforming activity of M13 viral DNA followed that for DNA damage. This is in contrast to the situation for biological effects such as lethality, mutagenesis, and cellular transformation measured in mammalian cells, where the RBE values are reversed. The role of hydroxyl (OH) radical in DNA damage induction by neutrons was investigated by exposure of plasmid in the presence of known quenchers of this species. Of four quenchers tested, all were able to reduce the yields of both SSBs and DSBs. These findings are consistent with a model for SSB and DSB induction by high linear energy transfer that involves OH radical mediation

  8. Explanatory chapter: how plasmid preparation kits work.

    Science.gov (United States)

    Koontz, Laura

    2013-01-01

    To isolate plasmid DNA from bacteria using a commercial plasmid miniprep kit (if interested, compare this protocol with Isolation of plasmid DNA from bacteria). Copyright © 2013 Elsevier Inc. All rights reserved.

  9. Effect of superoxide dismutase supplementation on sperm DNA fragmentation

    Directory of Open Access Journals (Sweden)

    Luciano Negri

    2017-10-01

    Full Text Available Background: antioxidants supplementation improves sperm quality, but few trials have analyzed the effects on sperm DNA fragmentation (SDF. This study compares the effectiveness of SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol in reducing SDF with other antioxidants without SOD, hydroxytyrosol, and carnosol. Materials and methods: men with high SDF at baseline were selected in our clinical database. The patients taken into account had a 2-month control. SDF was measured by Sperm Chromatin Dispersion test (SCD. Untreated men were used as a control group. The remaining subjects received some oral antioxidant supplements (12 different combinations of both hydrophilic and lipophilic antioxidants, with some of them receiving nutritional support with a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol. Results: 118 men were selected for a retrospective study. Mean age 39.3 ± 5.4 years. Fifteen had no treatment, 55 were treated with a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol, and 48 took some antioxidant supplements for 2 months. Clinically, variations of at least 10% in baseline values of classic semen parameters and sperm DNA fragmentation were taken into consideration. Classic seminal parameters did not vary significantly in the three groups, with the exception of viability (p = 0.001. We assessed which of the active substances (no. 19 in different formulations were associated with variations in SDF. In the multivariable analysis of the 7 active substances that passed the univariable analysis, only the SOD molecule appeared to be linked to an improvement in SDF (< 0.0001. In detail, only one patient in the control group showed a spontaneous improvement in SDF (6%, compared to 16/48 (33% of those taking various oral antioxidant supplements, and 31/55 (56% of those taking a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol. Conclusions: SOD

  10. Accumulation of linear mitochondrial DNA fragments in the nucleus shortens the chronological life span of yeast.

    Science.gov (United States)

    Cheng, Xin; Ivessa, Andreas S

    2012-10-01

    Translocation of mitochondrial DNA (mtDNA) fragments to the nucleus and insertion of those fragments into nuclear DNA has been observed in several organisms ranging from yeast to plants and mammals. Disruption of specific nuclear genes by de novo insertions of mtDNA fragments has even been linked to the initiation of several human diseases. Recently, we demonstrated that baker's yeast strains with high rates of mtDNA fragments migrating to the nucleus (yme1-1 mutant) exhibit short chronological life spans (CLS). The yeast CLS is determined by the survival of non-dividing cell populations. Here, we show that lack of the non-homologous-end-joining enzyme DNA ligase IV (DNL4) can rescue the short CLS of the yme1-1 mutant. In fission yeast, DNA ligase IV has been shown to be required for the capture of mtDNA fragments during the repair of double-stranded DNA breaks in nuclear DNA. In further analyses using pulse field gel and 2D gel electrophoresis we demonstrate that linear mtDNA fragments with likely nuclear localization accumulate in the yme1-1 mutant. The accumulation of the linear mtDNA fragments in the yme1-1 mutant is suppressed when Dnl4 is absent. We propose that the linear nuclear mtDNA fragments accelerate the aging process in the yme1-1 mutant cells by possibly affecting nuclear processes including DNA replication, recombination, and repair as well as transcription of nuclear genes. We speculate further that Dnl4 protein has besides its function as a ligase also a role in DNA protection. Dnl4 protein may stabilize the linear mtDNA fragments in the nucleus by binding to their physical ends. In the absence of Dnl4 protein the linear fragments are therefore unprotected and possibly degraded by nuclear nucleases. Copyright © 2012 Elsevier GmbH. All rights reserved.

  11. Subacute Low Dose Nerve Agent Exposure Causes DNA Fragmentation in Guinea Pig Leukocytes

    Science.gov (United States)

    2005-10-01

    1 SUBACUTE LOW DOSE NERVE AGENT EXPOSURE CAUSES DNA FRAGMENTATION IN GUINEA PIG LEUKOCYTES. Jitendra R. Dave1, John R. Moffett1, Sally M...DNA fragmentation in blood leukocytes from guinea pigs by ‘Comet’ assay after exposure to soman at doses ranging from 0.1LD50 to 0.4 LD50, once per...computer. Data obtained for exposure to soman demonstrated significant increases in DNA fragmentation in circulating leukocytes in CWNA treated guinea pigs as

  12. Hydrophobic and electrostatic interactions between cell penetrating peptides and plasmid DNA are important for stable non-covalent complexation and intracellular delivery.

    Science.gov (United States)

    Upadhya, Archana; Sangave, Preeti C

    2016-10-01

    Cell penetrating peptides are useful tools for intracellular delivery of nucleic acids. Delivery of plasmid DNA, a large nucleic acid, poses a challenge for peptide mediated transport. The paper investigates and compares efficacy of five novel peptide designs for complexation of plasmid DNA and subsequent delivery into cells. The peptides were designed to contain reported DNA condensing agents and basic cell penetrating sequences, octa-arginine (R 8 ) and CHK 6 HC coupled to cell penetration accelerating peptides such as Bax inhibitory mutant peptide (KLPVM) and a peptide derived from the Kaposi fibroblast growth factor (kFGF) membrane translocating sequence. A tryptophan rich peptide, an analogue of Pep-3, flanked with CH 3 on either ends was also a part of the study. The peptides were analysed for plasmid DNA complexation, protection of peptide-plasmid DNA complexes against DNase I, serum components and competitive ligands by simple agarose gel electrophoresis techniques. Hemolysis of rat red blood corpuscles (RBCs) in the presence of the peptides was used as a measure of peptide cytotoxicity. Plasmid DNA delivery through the designed peptides was evaluated in two cell lines, human cervical cancer cell line (HeLa) and (NIH/3 T3) mouse embryonic fibroblasts via expression of the secreted alkaline phosphatase (SEAP) reporter gene. The importance of hydrophobic sequences in addition to cationic sequences in peptides for non-covalent plasmid DNA complexation and delivery has been illustrated. An alternative to the employment of fatty acid moieties for enhanced gene transfer has been proposed. Comparison of peptides for plasmid DNA complexation and delivery of peptide-plasmid DNA complexes to cells estimated by expression of a reporter gene, SEAP. Copyright © 2016 European Peptide Society and John Wiley & Sons, Ltd. Copyright © 2016 European Peptide Society and John Wiley & Sons, Ltd.

  13. Transformation frequency of γ irradiated plasmid DNA and the enzymatic double strand break formation by incubation in a protein extract of Escherichia coli

    International Nuclear Information System (INIS)

    Schulte-Frohlinde, D.; Mark, F.; Ventur, Y.

    1994-01-01

    It was found that incubation of γ-irradiated or DNaseI-treated plasmid DNA in a protein extract of Escherichia coli leads to enzyme-induced formation of double strand breaks (dsb) in competition with repair of precursors of these dsb. A survival curve of the plasmid DNA (as determined by transformation of E. coli) was calculated on the basis of enzyme-induced dsb as well as those produced by irradiation assuming that they are lethal. The calculated D O value was the same as that measured directly by transformation of irradiated plasmid DNA. Two models are presented that fit the experimental survival data as a function of dose. One is based on damage formation in the plasmid DNA including enzymatic conversion of single strand damage into dsb (U-model), the other is an enzymatic repair saturation model based on Michaelis-Menten kinetics. (Author)

  14. Plasmid origin of replication of herpesvirus papio: DNA sequence and enhancer function.

    Science.gov (United States)

    Loeb, D D; Sung, N S; Pesano, R L; Sexton, C J; Hutchison, C; Pagano, J S

    1990-01-01

    Herpesvirus papio (HVP) is a lymphotropic virus of baboons which is related to Epstein-Barr virus (EBV) and produces latent infection. The nucleotide sequence of the 5,775-base-pair (bp) EcoRI K fragment of HVP, which has previously been shown to confer the ability to replicate autonomously, has been determined. Within this DNA fragment is a region which bears structural and sequence similarity to the ori-P region of EBV. The HVP ori-P region has a 10- by 26-bp tandem array which is related to the 20- by 30-bp tandem array from the EBV ori-P region. In HVP there is an intervening region of 764 bp followed by five partial copies of the 26-bp monomer. Both the EBV and HVP 3' regions have the potential to form dyad structures which, however, differ in arrangement. We also demonstrate that a transcriptional enhancer which requires transactivation by a virus-encoded factor is present in the HVP ori-P. Images PMID:2159548

  15. Formation of plasmid DNA strand breaks induced by low-energy ion beam: indication of nuclear stopping effects

    International Nuclear Information System (INIS)

    Chen Yu; Jiang Bingyao; Chen Youshan; Ding Xingzhao; Liu Xianghuai; Chen Ceshi; Guo Xinyou; Yin Guanglin

    1998-01-01

    Plasmid pGEM 3zf(+) was irradiated by nitrogen ion beam with energies between 20 and 100 keV and the fluence kept as 1 x 10 12 ions/cm 2 . The irradiated plasmid was assayed by neutral electrophoresis and quantified by densitometry. The yields of DNA with single-strand and double-strand breaks first increased then decreased with increasing ion energy. There was a maximal yield value in the range of 20-100 keV. The relationship between DNA double-strand breaks (DSB) cross-section and linear energy transfer (LET) also showed a peak-shaped distribution. To understand the physical process during DNA strand breaks, a Monte Carlo calculation code known as TRIM (Transport of Ions in Matter) was used to simulate energy losses due to nuclear stopping and to electronic stopping. It can be assumed that nuclear stopping plays a more important role in DNA strand breaks than electronic stopping in this energy range. The physical mechanisms of DNA strand breaks induced by a low-energy ion beam are also discussed. (orig.)

  16. Radiation-chemical discussion on inverse dose-rate effect observed in radiation-induced strand breaks of plasmid DNA

    International Nuclear Information System (INIS)

    Masuda, Takahiro

    1994-01-01

    Experimental results of inverse dose-rate effect, so-called Kada Effects, which was published by Takakura and her coworkers on radiation-induced strand breaks of plasmid DNA in aerated aqueous solution, have been kinetically analyzed and discussed on the basis of radiation chemistry. the kinetic analysis indicates that there are two possible mechanisms; 1) equilibrium mixture of O 2 - and HO 2 is responsible for strand breaks of DNA, and 2) peroxyl radical produced from citrate is effective for the strand breaks. However, the detailed kinetic analysis revealed that the latter is improbable because unimolecular decay of the peroxyl radical must be assumed to be negligible for its participation despite fast decay of analogous organic peroxyl radicals. The analysis has also given 9.93±0.10 dm 3 mol -1 s -1 per nucleotide unit, which corresponds to 7.62 x 10 4 dm 3 mol -1 s -1 per DNA molecule, as the rate constant for the reaction of the equilibrium mixture with plasmid pBR 322 DNA. Furthermore the probability that the reaction of the mixture with a nucleotide unit of DNA leads to strand breaks was obtained to be 3.36 x 10 -3 for gamma-irradiated system and 1.98 x 10 -3 for beta-irradiated system, respectively. (author)

  17. Effect of human polymorphonuclear and mononuclear leukocytes on chromosomal and plasmid DNA of Escherichia coli. Role of acid DNase

    International Nuclear Information System (INIS)

    Rozenberg-Arska, M.; van Strijp, J.A.; Hoekstra, W.P.; Verhoef, J.

    1984-01-01

    Phagocytosis and killing by polymorphonuclear and mononuclear leukocytes are important host resistance factors against invading microorganisms. Evidence showing that killing is rapidly followed by degradation of bacterial components is limited. Therefore, we studied the fate of Escherichia coli DNA following phagocytosis of E. coli by polymorphonuclear and mononuclear leukocytes. [ 3 H]Thymidine-labeled, unencapsulated E. coli PC2166 and E. coli 048K1 were incubated in serum, washed, and added to leukocytes. Uptake and killing of the bacteria and degradation of DNA were measured. Although phagocytosis and killing by mononuclear leukocytes was less efficient than that by polymorphonuclear leukocytes, only mononuclear leukocytes were able to degrade E. coli PC2166 DNA. Within 2 h, 60% of the radioactivity added to mononuclear leukocytes was released into the supernate, of which 40% was acid soluble. DNA of E. coli 048K1 was not degraded. To further analyze the capacity of mononuclear leukocytes to degrade E. coli DNA, chromosomal and plasmid DNA was isolated from ingested bacteria and subjected to agarose gel-electrophoresis. Only chromosomal DNA was degraded after phagocytosis. Plasmid DNA of E. coli carrying a gene coding for ampicillin resistance remained intact for a 2-h period after ingestion, and was still able to transform recipient E. coli cells after this period. Although we observed no DNA degradation during phagocytosis by polymorphonuclear leukocytes, lysates of both polymorphonuclear and mononuclear leukocytes contained acid-DNase activity with a pH optimum of 4.9. However, the DNase activity of mononuclear leukocytes was 20 times higher than that of polymorphonuclear leukocytes. No difference was observed between DNase activity from polymorphonuclear and mononuclear leukocytes from a chronic granulomatous disease patient with DNase activity from control polymorphonuclear and mononuclear leukocytes

  18. Auto-assembly of nanometer thick, water soluble layers of plasmid DNA complexed with diamines and basic amino acids on graphite: Greatest DNA protection is obtained with arginine

    Energy Technology Data Exchange (ETDEWEB)

    Khalil, T.T.; Boulanouar, O. [Université de Bourgogne Franche-Comté, UMR CNRS 6249 Chrono-Environnement, 16, Route de Gray, 25030 Besançon Cedex (France); Heintz, O. [Université de Bourgogne Franche-Comté, UMR CNRS 6303Laboratoire Interdisciplinaire Carnot de Bourgogne, DTAI/Centre de micro/nano caractérisation, 9 Av. A. Savary, BP 47870, F-21078 DIJON Cedex (France); Fromm, M., E-mail: michel.fromm@univ-fcomte.fr [Université de Bourgogne Franche-Comté, UMR CNRS 6249 Chrono-Environnement, 16, Route de Gray, 25030 Besançon Cedex (France)

    2017-02-01

    We have investigated the ability of diamines as well as basic amino acids to condense DNA onto highly ordered pyrolytic graphite with minimum damage after re-dissolution in water. Based on a bibliographic survey we briefly summarize DNA binding properties with diamines as compared to basic amino acids. Thus, solutions of DNA complexed with these linkers were drop-cast in order to deposit ultra-thin layers on the surface of HOPG in the absence or presence of Tris buffer. Atomic Force Microscopy analyses showed that, at a fixed ligand-DNA mixing ratio of 16, the mean thickness of the layers can be statistically predicted to lie in the range 0–50 nm with a maximum standard deviation ± 6 nm, using a simple linear law depending on the DNA concentration. The morphology of the layers appears to be ligand-dependent. While the layers containing diamines present holes, those formed in the presence of basic amino acids, except for lysine, are much more compact and dense. X-ray Photoelectron Spectroscopy measurements provide compositional information indicating that, compared to the maximum number of DNA sites to which the ligands may bind, the basic amino acids Arg and His are present in large excess. Conservation of the supercoiled topology of the DNA plasmids was studied after recovery of the complex layers in water. Remarkably, arginine has the best protection capabilities whether Tris was present or not in the initial solution. - Highlights: • Characterization of nanometer scaled layers composed of pUC21 plasmid DNA • Relation between nature of the ligand and structure of the layers • Capacities of the ligands to protect plasmids from strand break depending on their nature.

  19. qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

    International Nuclear Information System (INIS)

    Jackson, Christopher B.; Gallati, Sabina; Schaller, André

    2012-01-01

    Highlights: ► Serial qPCR accurately determines fragmentation state of any given DNA sample. ► Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. ► Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. ► Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze–thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA (λ nDNA ) and mtDNA (λ mtDNA ) we present an approach to possibly correct measurements in degraded samples in the future. To our knowledge this is the first time different degradation impact of the two

  20. qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

    Energy Technology Data Exchange (ETDEWEB)

    Jackson, Christopher B., E-mail: Christopher.jackson@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Gallati, Sabina, E-mail: sabina.gallati@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Schaller, Andre, E-mail: andre.schaller@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland)

    2012-07-06

    Highlights: Black-Right-Pointing-Pointer Serial qPCR accurately determines fragmentation state of any given DNA sample. Black-Right-Pointing-Pointer Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. Black-Right-Pointing-Pointer Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. Black-Right-Pointing-Pointer Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze-thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA ({lambda}{sub nDNA}) and mtDNA ({lambda}{sub mtDNA}) we present an approach to possibly correct measurements in

  1. Direct identification of antibiotic resistance genes on single plasmid molecules using CRISPR/Cas9 in combination with optical DNA mapping

    Science.gov (United States)

    Müller, Vilhelm; Rajer, Fredrika; Frykholm, Karolin; Nyberg, Lena K.; Quaderi, Saair; Fritzsche, Joachim; Kristiansson, Erik; Ambjörnsson, Tobias; Sandegren, Linus; Westerlund, Fredrik

    2016-12-01

    Bacterial plasmids are extensively involved in the rapid global spread of antibiotic resistance. We here present an assay, based on optical DNA mapping of single plasmids in nanofluidic channels, which provides detailed information about the plasmids present in a bacterial isolate. In a single experiment, we obtain the number of different plasmids in the sample, the size of each plasmid, an optical barcode that can be used to identify and trace the plasmid of interest and information about which plasmid that carries a specific resistance gene. Gene identification is done using CRISPR/Cas9 loaded with a guide-RNA (gRNA) complementary to the gene of interest that linearizes the circular plasmids at a specific location that is identified using the optical DNA maps. We demonstrate the principle on clinically relevant extended spectrum beta-lactamase (ESBL) producing isolates. We discuss how the gRNA sequence can be varied to obtain the desired information. The gRNA can either be very specific to identify a homogeneous group of genes or general to detect several groups of genes at the same time. Finally, we demonstrate an example where we use a combination of two gRNA sequences to identify carbapenemase-encoding genes in two previously not characterized clinical bacterial samples.

  2. Clusters of DNA induced by ionizing radiation: formation of short DNA fragments. I. Theoretical modeling

    Science.gov (United States)

    Holley, W. R.; Chatterjee, A.

    1996-01-01

    We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber comprised of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and delta rays due to knock-on collisions involving energy transfers >100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of OH, H, eaq, etc.; (2) OH attack on sugar molecules leading to strand breaks: (3) OH attack on bases; (4) direct ionization of the sugar molecules leading to strand breaks; (5) direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 bp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. The shapes of the spectra of DNA fragment lengths depend on the symmetries or approximate symmetries of the chromatin structure. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper (B. Rydberg, Radiat, Res. 145, 200-209, 1996) after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the

  3. Ultrasound-targeted microbubble destruction enhances naked plasmid DNA transfection in rabbit Achilles tendons in vivo.

    Science.gov (United States)

    Qiu, L; Zhang, L; Wang, L; Jiang, Y; Luo, Y; Peng, Y; Lin, L

    2012-07-01

    The study was to investigate the probability of increasing the transfection of the gene in tendons by ultrasound-targeted microbubble destruction (UTMD), and to search for the most suitable transfection conditions. A mixture of microbubbles and enhanced green fluorescent protein (EGFP) plasmids was injected into rabbit Achilles tendons by different administration routes and the tendons were ultrasound pulse by different ultrasonic conditions in order to determine the most appropriate conditions. Then, the rabbits were divided into four groups: (1) ultrasound + microbubbles + plasmid; (2) ultrasound+ plasmid; (3) microbubble + plasmid; (4) plasmid only. EGFP expression in the tendons and other tissues, and the damage to tendon and paratenon were all observed. The results showed that EGFP expression in the tendon was higher by ultrasound pulse with 2 W cm(-2) of output intensity and a 20% duty cycle for 10 min. Local injection was determined to be the better administration route. Among the four groups, EGFP expression in Group 1 was higher than that in other groups. EGFP expression was highest on seventh day, then it gradually decrease over time, and lasted more than 56 days. EGFP expression was not found in other tissues. There was no obvious injury caused by UTMD. Under suitable conditions, it is feasible to use UTMD as a safe and effective gene transfection therapy for tendon injuries.

  4. STUDY REGARDING EFFICIENCY OF INDUCED GENETIC TRANSFORMATION IN BACILLUS LICHENIFORMIS WITH PLASMID DNA

    Directory of Open Access Journals (Sweden)

    T. VINTILĂ

    2007-05-01

    Full Text Available A strain of Bacillus licheniformis was subject to genetic transformation with plasmid vectors (pLC1 and pNC61, using electroporation technique, protoplast transformation and bivalent cations (CaCl2 mediated transformation. In the case of transformation by electroporation of Bacillus licheniformis B40, the highest number of transformed colonies (3 were obtained only after a 1,79 KV electric shock, for 2,2 milliseconds. Using this transformation technique we have obtained six kanamycin resistant transformants. The frequency of Bacillus licheniformis B40 protoplasts transformation using pLC1 and pNC61 plasmid vectors is approximately 10% (TF = 10%. As a result of pLC1 plasmid integration in Bacillus licheniformis protoplasts, six kanamycin resistant transformants were obtained. The pNC61 plasmid, which confers trimethoprim resistance, does not integrate in receiver cells by protoplast transformation. The direct genetic transformation in the presence of bivalent cations (CaCl2, mediated by pLC1 and pNC61 plasmid vectors, produce a low transformation frequency. Using this technique, we have obtained three trimethoprim resistant colonies and four kanamycin resistant colonies. The chemical way of transformation is the only technique, which realizes the integration of pNC61 in B. licheniformis B40 cells.

  5. [Molecular dynamics of immune complex of photoadduct-containing DNA with Fab-Anti-DNA antibody fragment].

    Science.gov (United States)

    Akberova, N I; Zhmurov, A A; Nevzorova, T A; Litvinov, R I

    2016-01-01

    Antibodies to DNA play an important role in the pathogenesis of autoimmune diseases. The elucidation of structural mechanisms of both the antigen recognition and the interaction of anti-DNA antibodies with DNA will help to understand the role of DNA-containing immune complexes in various pathologies and can provide a basis for new treatment modalities. Moreover, the DNA-antibody complex is an analog of specific intracellular DNA-protein interactions. In this work, we used in silico molecular dynamic simulations of bimolecular complexes of the dsDNA segment containing the Fab fragment of an anti-DNA antibody to obtain the detailed thermodynamic and structural characteristics of dynamic intermolecular interactions. Using computationally modified crystal structure of the Fab-DNA complex (PDB ID: 3VW3), we studied the equilibrium molecular dynamics of the 64M-5 antibody Fab fragment associated with the dsDNA fragment containing the thymine dimer, the product of DNA photodamage. Amino acid residues that constitute paratopes and the complementary nucleotide epitopes for the Fab-DNA construct were identified. Stacking and electrostatic interactions were found to play the main role in mediating the most specific antibody-dsDNA contacts, while hydrogen bonds were less significant. These findings may shed light on the formation and properties of pathogenic anti-DNA antibodies in autoimmune diseases, such as systemic lupus erythematosus associated with skin photosensitivity and DNA photodamage.

  6. Nanospines incorporation into the structure of the hydrophobic cryogels via novel cryogelation method: an alternative sorbent for plasmid DNA purification.

    Science.gov (United States)

    Üzek, Recep; Uzun, Lokman; Şenel, Serap; Denizli, Adil

    2013-02-01

    In this study, it was aimed to prepare hydrophobic cryogels for plasmid DNA (pDNA) purification from Escherichia coli lysate. The hydrophobicity was achieved by incorporating a hydrophobic ligand, N-methacryloyl-(L)-phenylalanine (MAPA), into the cryogel backbone. In addition to the conventional cryogelation process, freeze-drying step was included to create nanospines. Three different cryogels {poly(2-hydoxyethyl methacrylate-N-methacryloyl-L-phenylalanine)-freeze dried, [P(HEMA-MAPA)-FD]; poly(2-hydoxyethyl methacrylate-N-methacryloyl-L-phenylalanine, [P(HEMA-MAPA)] and poly(2-hydoxyethyl methacrylate)-freeze dried, [P(HEMA)-FD]} were prepared, characterized, and used for DNA (salmon sperm DNA) adsorption studies from aqueous solution. The specific surface areas of cryogels were determined to be 21.4 m(2)/g for P(HEMA)-FD, 17.65 m(2)/g for P(HEMA-MAPA) and 36.0 m(2)/g for P(HEMA-MAPA)-FD. The parameters affecting adsorption such as temperature, initial DNA concentration, salt type and concentration were examined in continuous mode. The maximum adsorption capacities were observed as 45.31 mg DNA/g, 27.08 mg DNA/g and 1.81 mg DNA/g for P(HEMA-MAPA)-FD, P(HEMA-MAPA) and P(HEMA)-FD, respectively. Desorption process was performed using acetate buffer (pH 5.50) without salt. First, pDNA was isolated from E. coli lysate and the purity of pDNA was then determined by agarose gel electrophoresis. Finally, the chromatographic performance of P(HEMA-MAPA)-FD cryogel for pDNA purification was tested in FPLC. The resolution (R(s)) was 2.84, and the specific selectivity for pDNA was 237.5-folds greater than all impurities. Copyright © 2012 Elsevier B.V. All rights reserved.

  7. A Histone-Like Protein Induces Plasmid DNA to Form Liquid Crystals in Vitro and Gene Compaction in Vivo

    Directory of Open Access Journals (Sweden)

    Shiyong Sun

    2013-12-01

    Full Text Available The liquid crystalline state is a universal phenomenon involving the formation of an ordered structure via a self-assembly process that has attracted attention from numerous scientists. In this study, the dinoflagellate histone-like protein HCcp3 is shown to induce super-coiled pUC18 plasmid DNA to enter a liquid crystalline state in vitro, and the role of HCcp3 in gene condensation in vivo is also presented. The plasmid DNA (pDNA-HCcp3 complex formed birefringent spherical particles with a semi-crystalline selected area electronic diffraction (SAED pattern. Circular dichroism (CD titrations of pDNA and HCcp3 were performed. Without HCcp3, pUC18 showed the characteristic B conformation. As the HCcp3 concentration increased, the 273 nm band sharply shifted to 282 nm. When the HCcp3 concentration became high, the base pair (bp/dimer ratio fell below 42/1, and the CD spectra of the pDNA-HCcp3 complexes became similar to that of dehydrated A-form DNA. Microscopy results showed that HCcp3 compacted the super-coiled gene into a condensed state and that inclusion bodies were formed. Our results indicated that HCcp3 has significant roles in gene condensation both in vitro and in histone-less eukaryotes in vivo. The present study indicates that HCcp3 has great potential for applications in non-viral gene delivery systems, where HCcp3 may compact genetic material to form liquid crystals.

  8. STUDY REGARDING EFFICIENCY OF INDUCED GENETIC TRANSFORMATION IN BACILLUS LICHENIFORMIS WITH PLASMID DNA

    Directory of Open Access Journals (Sweden)

    VINTILĂ T.

    2007-01-01

    Full Text Available A strain of Bacillus licheniformis was subject to genetic transformation with plasmidvectors (pLC1 and pNC61, using electroporation technique, protoplasttransformation and bivalent cations (CaCl2 mediated transformation. In the case oftransformation by electroporation of Bacillus licheniformis B40, the highest numberof transformed colonies (3 were obtained only after a 1,79 KV electric shock, for 2,2milliseconds. Using this transformation technique we have obtained six kanamycinresistant transformants. The frequency of Bacillus licheniformis B40 protoplaststransformation using pLC1 and pNC61 plasmid vectors is approximately 10% (TF =10%. As a result of pLC1 plasmid integration in Bacillus licheniformis protoplasts,six kanamycin resistant transformants were obtained. The pNC61 plasmid, whichconfers trimethoprim resistance, does not integrate in receiver cells by protoplasttransformation. The direct genetic transformation in the presence of bivalent cations(CaCl2, mediated by pLC1 and pNC61 plasmid vectors, produce a lowtransformation frequency. Using this technique, we have obtained three trimethoprimresistant colonies and four kanamycin resistant colonies. The chemical way oftransformation is the only technique, which realizes the integration of pNC61 in B.licheniformis B40 cells.

  9. General method of preparation of uniformly 13C, 15N-labeled DNA fragments for NMR analysis of DNA structures

    International Nuclear Information System (INIS)

    Rene, Brigitte; Masliah, Gregoire; Zargarian, Loussine; Mauffret, Olivier; Fermandjian, Serge

    2006-01-01

    Summary 13 C, 15 N labeling of biomolecules allows easier assignments of NMR resonances and provides a larger number of NMR parameters, which greatly improves the quality of DNA structures. However, there is no general DNA-labeling procedure, like those employed for proteins and RNAs. Here, we describe a general and widely applicable approach designed for preparation of isotopically labeled DNA fragments that can be used for NMR studies. The procedure is based on the PCR amplification of oligonucleotides in the presence of labeled deoxynucleotides triphosphates. It allows great flexibility thanks to insertion of a short DNA sequence (linker) between two repeats of DNA sequence to study. Size and sequence of the linker are designed as to create restriction sites at the junctions with DNA of interest. DNA duplex with desired sequence and size is released upon enzymatic digestion of the PCR product. The suitability of the procedure is validated through the preparation of two biological relevant DNA fragments

  10. Rapid assessment of the effect of ciprofloxacin on chromosomal DNA from Escherichia coli using an in situ DNA fragmentation assay

    Directory of Open Access Journals (Sweden)

    Gosalvez Jaime

    2009-04-01

    Full Text Available Abstract Background Fluoroquinolones are extensively used antibiotics that induce DNA double-strand breaks (DSBs by trapping DNA gyrase and topoisomerase IV on DNA. This effect is usually evaluated using biochemical or molecular procedures, but these are not effective at the single-cell level. We assessed ciprofloxacin (CIP-induced chromosomal DNA breakage in single-cell Escherichia coli by direct visualization of the DNA fragments that diffused from the nucleoid obtained after bacterial lysis in an agarose microgel on a slide. Results Exposing the E. coli strain TG1 to CIP starting at a minimum inhibitory concentration (MIC of 0.012 μg/ml and at increasing doses for 40 min increased the DNA fragmentation progressively. DNA damage started to be detectable at the MIC dose. At a dose of 1 μg/ml of CIP, DNA damage was visualized clearly immediately after processing, and the DNA fragmentation increased progressively with the antibiotic incubation time. The level of DNA damage was much higher when the bacteria were taken from liquid LB broth than from solid LB agar. CIP treatment produced a progressively slower rate of DNA damage in bacteria in the stationary phase than in the exponentially growing phase. Removing the antibiotic after the 40 min incubation resulted in progressive DSB repair activity with time. The magnitude of DNA repair was inversely related to CIP dose and was noticeable after incubation with CIP at 0.1 μg/ml but scarce after 10 μg/ml. The repair activity was not strictly related to viability. Four E. coli strains with identified mechanisms of reduced sensitivity to CIP were assessed using this procedure and produced DNA fragmentation levels that were inversely related to MIC dose, except those with very high MIC dose. Conclusion This procedure for determining DNA fragmentation is a simple and rapid test for studying and evaluating the effect of quinolones.

  11. Detailed adsorption mechanism of plasmid DNA by newly isolated cellulose from waste flower spikes of Thypa latifolia using quantum chemical calculations.

    Science.gov (United States)

    Mujtaba, Muhammad; Kaya, Murat; Akyuz, Lalehan; Erdonmez, Demet; Akyuz, Bahar; Sargin, Idris

    2017-09-01

    Current study was designed to use the newly obtained cellulose from waste flower spikes of Thypa latifolia plant for plasmid DNA adsorption. Cellulose was isolated according to a previously described method including acid and base treatment, and cellulose content was recorded as 17%. T. latifolia cellulose was physicochemically characterized via FT-IR, TGA and SEM techniques. Detailed mechanism of plasmid DNA adsorption by newly isolated cellulose was described using chemical quantum calculations. To check the effect of Cu ++ immobilization on the affinity of cellulose for plasmid DNA, copper ions were immobilized onto T. latifolia cellulose. pUC18 plasmid DNA was used for adsorption studies. Membranes prepared with only T. latifolia cellulose and Cu ++ immobilized T. latifolia cellulose revealed different adsorption ratios as 43.9 and 86.9% respectively. This newly isolated cellulose from waste flower spikes of T. latifolia can be utilized as a suitable carrier for plasmid DNA. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Quantification of DNA fragmentation in processed foods using real-time PCR.

    Science.gov (United States)

    Mano, Junichi; Nishitsuji, Yasuyuki; Kikuchi, Yosuke; Fukudome, Shin-Ichi; Hayashida, Takuya; Kawakami, Hiroyuki; Kurimoto, Youichi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Takabatake, Reona; Kitta, Kazumi

    2017-07-01

    DNA analysis of processed foods is performed widely to detect various targets, such as genetically modified organisms (GMOs). Food processing often causes DNA fragmentation, which consequently affects the results of PCR analysis. In order to assess the effects of DNA fragmentation on the reliability of PCR analysis, we investigated a novel methodology to quantify the degree of DNA fragmentation. We designed four real-time PCR assays that amplified 18S ribosomal RNA gene sequences common to various plants at lengths of approximately 100, 200, 400, and 800 base pairs (bp). Then, we created an indicator value, "DNA fragmentation index (DFI)", which is calculated from the Cq values derived from the real-time PCR assays. Finally, we demonstrated the efficacy of this method for the quality control of GMO detection in processed foods by evaluating the relationship between the DFI and the limit of detection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Determination of size distribution of small DNA fragments by polyacrylamide gel electrophoresis

    International Nuclear Information System (INIS)

    Lau How Mooi

    1998-01-01

    Size distribution determination of DNA fragments can be normally determined by the agarose gel electrophoresis, including the normal DNA banding pattern analysis. However this method is only good for large DNA, such as the DNA of the size of kilo base pairs to mega base pairs range. DNA of size less than kilo base pairs is difficult to be quantified by the agarose gel method. Polyacrylamide gel electrophoresis however can be used to measure the quantity of DNA fragments of size less than kilo base pairs in length, down to less than ten base pairs. This method is good for determining the quantity of the smaller size DNA, single stranded polymers or even some proteins, if the known standards are available. In this report detail description of the method of preparing the polyacrylamide gel, and the experimental set up is discussed. Possible uses of this method, and the comparison with the standard sizes of DNA is also shown. This method is used to determine the distribution of the amount of the fragmented DNA after the Calf-thymus DNA has been exposed to various types of radiation and of different doses. The standards were used to determine the sizes of the fragmented Calf-thymus DNA. The higher the dose the higher is the amount of the smaller size DNA measured

  14. Construction of adiponectin-encoding plasmid DNA and gene therapy of non-obese type 2 diabetes mellitus.

    Science.gov (United States)

    Nan, Mei Hua; Park, Jeong-Sook; Myung, Chang-Seon

    2010-01-01

    Adiponectin (ADN), an insulin-sensitizing adipokine, stimulates glucose uptake, inhibits gluconeogenesis, and plays an important role in improving insulin sensitivity. Since blood levels of ADN are low in type 2 diabetes mellitus (DM), this study was designed to investigate the therapeutic effectiveness of increasing the ADN level through injection of plasmid DNA encoding ADN in type 2 DM. A non-obese type 2 DM mouse model was established via combined administration of streptozotocin with nicotinamide and exhibited significantly higher plasma glucose concentration and insulin resistance compared with normal controls according to oral glucose tolerance and insulin challenge tests. Plasmid DNA encoding mouse ADN from differentiated NIH3T3 adipocytes was constructed in pVAX1 (pVAX/ADN). Transfection of pVAX/ADN into various cell lines including HeLa, HT22, HEK293, HepG2, and SK-Hep1 cells, increased ADN mRNA expression levels in a dose-dependent manner. The administration of pVAX/ADN into non-obese type 2 DM mice via tail vein significantly increased the blood level of ADN and decreased the plasma glucose concentration. Moreover, the parameters related to insulin resistance (HOMA-IR) and insulin sensitivity (QUICKI) were significantly improved. These results suggest that ADN gene therapy could be a clinically effective tool for the treatment of type 2 DM.

  15. Plasmid fingerprinting and virulence gene detection among indigenous strains of salmonella enterica serovar enteritidis

    International Nuclear Information System (INIS)

    Sajid, S.U.; Schwarz, S.

    2009-01-01

    Salmonella enterica serovar Enteritidis is an important frequently reported zoonotic pathogen and a common cause of human gastroenteritis worldwide. The highly conserved Serospecific plasmids (SSPs) and Salmonella plasmid virulence (Spv) genes have been shown to mediate extra-intestinal colonization and systemic infection. The objective of current study was to document the presence of SSPs and SpvB/SpvC genes prevailing in the indigenous population of serovar Enteritidis. A total of 48 epidemiologically unrelated strains of Salmonella enteritidis were included in the study. Preparation of plasmids DNA suitable for endonuclease digestion and separation of respective fragments by agarose gel electrophoresis followed previously described protocols. The plasmids of Escherichia coli V517, 1-kbp ladder, and lambda DNA HindIII fragments served as DNA size standards. Transfer of DNA fragments from agarose gels to nitrocellulose membranes was achieved by capillary blot procedure. An ECL labeled 3.6 kbp HindIII fragment of plasmid PRQ 51 was used as probe for SpvB/SpvC gene detection. Plasmid DNA fingerprinting revealed the presence of two different profiles of approximately 55 kbp and 90 kbp and were identified as virulence plasmids by DNA hybridization. The SpvB/SpvC genes were located on HindIII fragments of 3.6 kbp in each of the two types of virulence plasmids. The study confirms the presence of SSPs and SpvB/SpvC genes in indigenous strains of S. enteritidis isolated from Northern Punjab area of Pakistan and substantiate the previous data on such findings from other parts of the world. (author)

  16. Mitochondrial DNA content in embryo culture medium is significantly associated with human embryo fragmentation.

    Science.gov (United States)

    Stigliani, S; Anserini, P; Venturini, P L; Scaruffi, P

    2013-10-01

    Is the amount of cell-free DNA released by human embryos into culture medium correlated with embryo morphological features? The mitochondrial DNA (mtDNA) content of culture medium is significantly associated with the fragmentation rate on Days 2 and 3 of embryo development, whether the oocyte came from women ≤ 35 or >35 years old. Cellular fragmentation is often utilized as one of the morphological parameters for embryo quality assessment. The amount of cellular fragments is considered to be an important morphological parameter for embryo implantation potential. It has been hypothesized that fragments are apoptotic bodies or anuclear cytoplasmatic pieces of blastomeres, although no definitive conclusion has been drawn about their pathogenesis. Human fertilized oocytes were individually cultured from Day 1 to Days 2 and 3. A total of 800 samples (166 spent media from Day 2 and 634 from Day 3) were enrolled into the present study. Double-stranded DNA (dsDNA) was quantified in 800 spent embryo culture media by Pico Green dye fluorescence assay. After DNA purification, genomic DNA (gDNA) and mtDNA were profiled by specific quantitative PCR. Statistical analyses defined correlations among DNA contents, embryo morphology and maternal age. Different independent tests confirmed the presence of DNA into embryo culture medium and, for the first time, we demonstrate that both gDNA and mtDNA are detectable in the secretome. The amount of DNA is larger in embryos with bad quality cleavage compared with high-grade embryos, suggesting that the DNA profile of culture medium is an objective marker for embryo quality assessment. In particular, DNA profiles are significantly associated with fragmentation feature (total dsDNA: P = 0.0010; mtDNA; P = 0.0247) and advanced maternal age. It is necessary to establish whether DNA profiling of spent embryo culture medium is a robust onsite test that can improve the prediction of blastulation, implantation and/or pregnancy rate. The

  17. Excessive cytosolic DNA fragments as a potential trigger of Graves’ disease: an encrypted message sent by animal models

    Directory of Open Access Journals (Sweden)

    Yuqian Luo

    2016-11-01

    Full Text Available Graves’ hyperthyroidism is caused by autoantibodies directed against the thyroid stimulating hormone receptor (TSHR that mimic the action of TSH. The establishment of Graves’ hyperthyroidism in experimental animals has proven to be an important approach to dissect the mechanisms of self-tolerance breakdown that lead to the production of thyroid-stimulating TSHR autoantibodies (TSAbs. ‘Shimojo’s model was the first successful Graves’ animal model, wherein immunization with fibroblasts cells expressing TSHR and a major histocompatibility complex (MHC class II molecule, but not either alone, induced TSAb production in AKR/N (H-2k mice. This model highlights the importance of coincident MHC class II expression on TSHR-expressing cells in the development of Graves’ hyperthyroidism. These data are also in agreement with the observation that Graves’ thyrocytes often aberrantly express MHC class II antigens via mechanisms that remain unclear. Our group demonstrated that cytosolic self-genomic DNA fragments derived from sterile injured cells can induce aberrant MHC class II expression and production of multiple inflammatory cytokines and chemokines in thyrocytes in vitro, suggesting that severe cell injury may initiate immune responses in a way that is relevant to thyroid autoimmunity mediated by cytosolic DNA signaling. Furthermore, more recent successful Graves’ animal models were primarily established by immunizing mice with TSHR-expressing plasmids or adenovirus. In these models, double-stranded DNA vaccine contents presumably exert similar immune-activating effect in cells at inoculation sites and thus might pave the way toward successful Graves’ animal models. This review focuses on evidence suggesting that cell injury-derived self-DNA fragments could act as Graves’ disease triggers.

  18. Menadione-induced DNA fragmentation without 8-oxo-2'-deoxyguanosine formation in isolated rat hepatocytes

    DEFF Research Database (Denmark)

    Fischer-Nielsen, A; Corcoran, G B; Poulsen, H E

    1995-01-01

    Menadione (2-methyl-1,4-naphthoquinone) induces oxidative stress in cells causing perturbations in the cytoplasm as well as nicking of DNA. The mechanisms by which DNA damage occurs are still unclear, but a widely discussed issue is whether menadione-generated reactive oxygen species (ROS) directly...... damage DNA. In the present study, we measured the effect of menadione on formation of 7,8-dihydro-8-oxo-2'-deoxyguanosine (8-oxodG), an index of oxidative DNA base modifications, and on DNA fragmentation. Isolated hepatocytes from phenobarbital-pretreated rats were exposed to menadione, 25-400 micro......M, for 15, 90 or 180 min with or without prior depletion of reduced glutathione (GSH) by diethyl maleate. Menadione caused profound GSH depletion and internucleosomal DNA fragmentation, which was demonstrated by a prominent fragmentation ladder on agarose gel electrophoresis. We found no oxidative...

  19. Clusters of DNA damage induced by ionizing radiation: Formation of short DNA fragments. I. Theoretical modeling

    International Nuclear Information System (INIS)

    Holley, W.R.; Chatterjee, A.

    1996-01-01

    We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber composed of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and δ rays due to knock-on collisions involving energy transfers > 100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of circ OH, circ H, e aq , etc.; circ OH attack on sugar molecules leading to strand breaks; circ OH attack on bases; direct ionization of the sugar molecules leading to strand breaks; direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 hp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the chromatin fibers in mammalian DNA. 27 refs., 7 figs

  20. Use of damaged plasmid to study DNA repair in X-ray sensitive (xrs) strains of Chinese hamster ovary (CHO) cells

    International Nuclear Information System (INIS)

    Smith-Ravin, J.; Jeggo, P.A.

    1989-01-01

    The effect of γ-irradiation of pSV2gpt DNA on its transfection frequency has been analysed using radiosensitive CHO xrs mutants showing a defect in double-strand break (dsb) rejoining. At low doses a sharp decrease in relative transfection frequency, i.e. transfection frequency of irradiated plasmid relative to untreated plasmid, as observed in xrs mutants compared with the parent line K1. Electrophoresis of irradiated plasmid DNA showed the decrease in transfection frequency in the xrs mutants correlated with the change of supercoiled molecules into open-circular forms. In the parent line CHO-K1, open-circular and supercoiled molecules have the same transfection frequency. The effect of linearization of pSV2gpt DNA by restriction enzymes on transfection frequency in xrs and wild-type strains was also examined. No difference in the relative transfection frequency between xrs and wild-type strains was detected. (author)

  1. Toward metrological traceability for DNA fragment ratios in GM quantification. 3. Suitability of DNA calibrants studied with a MON 810 corn model.

    Science.gov (United States)

    Charels, Diana; Broeders, Sylvia; Corbisier, Philippe; Trapmann, Stefanie; Schimmel, Heinz; Emons, Hendrik

    2007-05-02

    The quantification of GMOs by real-time PCR relies on an external calibrant. In this paper the suitability of two DNA calibrants, genomic DNA from plant leaves and plasmidic DNA, was investigated. The PCR efficiencies, the correlation coefficients of the calibration curves, and the ratios between PCR efficiencies of transgenic and endogenous sequences were compared for both calibrants using 59 data sets produced by 43 laboratories. There were no significant differences between plasmidic and genomic DNA except for the PCR efficiencies of the calibration curves for the transgene of the construct-specific real-time PCR method. In the GM system investigated, PCR efficiencies of plasmidic calibrants were slightly closer to the PCR efficiencies observed for the unknowns than those of the genomic DNA calibrant. Therefore, plasmidic DNA was the more suitable calibrant for the PCR measurements on genomic DNA extracted from MON 810 seeds. It is shown that plasmidic DNA is an appropriate choice for the calibration of measurements of MON 810 corn with respect to the DNA copy number ratio.

  2. Crystallization of DNA fragments from water-salt solutions, containing 2-methylpentane-2,3-diol.

    Science.gov (United States)

    Osica, V D; Sukharevsky, B Y; Vasilchenko, V N; Verkin, B I; Polyvtsev, O F

    1976-09-01

    Fragments of calf thymus DNA have been crystallized by precipitation from water-salt solutions, containing 2-methylpentane-2,3-diol (MPD). DNA crystals usually take the form either of spherulites up to 100 mu in diameter or of needles with the length up to 50 mu. No irreversible denaturation of DNA occurs during the crystallization process. X-ray diffraction from dense slurries of DNA crystals yields crystalline powder patterns.

  3. No increased sperm DNA fragmentation index in semen containing human papillomavirus or herpesvirus

    DEFF Research Database (Denmark)

    Kaspersen, Maja Døvling; Bungum, Mona; Fedder, Jens

    2013-01-01

    It remains unknown whether human papillomaviruses (HPVs) or human herpesviruses (HHVs) in semen affect sperm DNA integrity. We investigated whether the presence of these viruses in semen was associated with an elevated sperm DNA fragmentation index. Semen from 76 sperm donors was examined by a PCR......-based hybridization array that identifies all HHVs and 35 of the most common HPVs. Sperm DNA integrity was determined by the sperm chromatin structure assay. HPVs or HHVs, or both, were found in 57% of semen samples; however, sperm DNA fragmentation index was not increased in semen containing these viruses....

  4. Replication and Transcription of Eukaryotic DNA in Esherichia coli

    Science.gov (United States)

    Morrow, John F.; Cohen, Stanley N.; Chang, Annie C. Y.; Boyer, Herbert W.; Goodman, Howard M.; Helling, Robert B.

    1974-01-01

    Fragments of amplified Xenopus laevis DNA, coding for 18S and 28S ribosomal RNA and generated by EcoRI restriction endonuclease, have been linked in vitro to the bacterial plasmid pSC101; and the recombinant molecular species have been introduced into E. coli by transformation. These recombinant plasmids, containing both eukaryotic and prokaryotic DNA, replicate stably in E. coli. RNA isolated from E. coli minicells harboring the plasmids hybridizes to amplified X. laevis rDNA. Images PMID:4600264

  5. Development of a Novel Reference Plasmid for Accurate Quantification of Genetically Modified Kefeng6 Rice DNA in Food and Feed Samples

    Directory of Open Access Journals (Sweden)

    Liang Li

    2013-01-01

    Full Text Available Reference plasmids are an essential tool for the quantification of genetically modified (GM events. Quantitative real-time PCR (qPCR is the most commonly used method to characterize and quantify reference plasmids. However, the precision of this method is often limited by calibration curves, and qPCR data can be affected by matrix differences between the standards and samples. Here, we describe a digital PCR (dPCR approach that can be used to accurately measure the novel reference plasmid pKefeng6 and quantify the unauthorized variety of GM rice Kefeng6, eliminating the issues associated with matrix effects in calibration curves. The pKefeng6 plasmid was used as a calibrant for the quantification of Kefeng6 rice by determining the copy numbers of event- (77 bp and taxon-specific (68 bp fragments, their ratios, and their concentrations. The plasmid was diluted to five different concentrations. The third sample (S3 was optimized for the quantification range of dPCR according to previous reports. The ratio between the two fragments was 1.005, which closely approximated the value certified by sequencing, and the concentration was found to be 792 copies/μL. This method was precise, with an RSD of ~3%. These findings demonstrate the advantages of using the dPCR method to characterize reference materials.

  6. Efficient Double Fragmentation ChIP-seq Provides Nucleotide Resolution Protein-DNA Binding Profiles

    NARCIS (Netherlands)

    Mokry, Michal; Hatzis, Pantelis; de Bruijn, Ewart; Koster, Jan; Versteeg, Rogier; Schuijers, Jurian; van de Wetering, Marc; Guryev, Victor; Clevers, Hans; Cuppen, Edwin

    2010-01-01

    Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures. Because these larger fragments may be

  7. Repair of UV-damaged incoming plasmid DNA in Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Keszenman-Pereyra, David

    1990-01-01

    A whole-cell transformation assay was used for the repair of UV-damaged plasma DNA in highly-transformable haploid strains of Saccharomyces cerevisiae having different repair capabilities. The experiments described demonstrate that three epistasis groups (Friedberg 1988) are involved in the repair of UV-incoming DNA and that the repair processes act less efficiently on incoming DNA than they do on chromosomal DNA. The implications of these findings for UV repair in Saccharomyces cerevisiae are discussed. (author)

  8. Simultaneous vitality and DNA-fragmentation measurement in spermatozoa of smokers and non-smokers.

    Science.gov (United States)

    De Bantel, A; Fleury-Feith, J; Poirot, C; Berthaut, I; Garcin, C; Landais, P; Ravel, C

    2015-03-01

    Because cigarette smoke is a powerful ROS producer, we hypothesized that the spermatozoa of smokers would be more at risk of having increased DNA fragmentation than spermatozoa of non-smoking men. A cross-sectional study was performed on consenting smokers and non-smokers, consulting in an infertility clinic for routine sperm analysis. The application of a novel TUNEL assay coupled to a vitality marker, LIVE/DEAD®, allowed both DNA fragmentation and viability measurement within spermatozoa of participants to be analyzed by flow cytometry. The coupled vitality-DNA fragmentation analysis revealed that non-smokers and smokers, respectively presented medians of 3.6% [0.6-36.8] and 3.3% [0.9-9.6] DNA fragmented spermatozoa among the living spermatozoa population (P > 0.05). No deleterious effect of smoking on spermatozoa was found in our study. More studies concerning potential mutagenic capacities of cigarette smoke on spermatozoa are necessary. In addition, the coupled vitality-DNA fragmentation analysis may orient Assisted Reproductive Technology teams when confronted with patients having a high percentage of DNA-fragmented living spermatozoa. © 2014 International Clinical Cytometry Society.

  9. SPERM MORPHOLOGICAL ABNORMALITIES AS INDICATORS OF DNA FRAGMENTATION AND FERTILIZATION IN ASSISTED REPRODUCTION

    Directory of Open Access Journals (Sweden)

    Barbara Dariš

    2018-02-01

    Full Text Available Background. To determine the relationship between sperm morphological abnormalities, DNA fragmentation and fertilization rate in IVF and ICSI. Methods. Sperm samples from 10 IVF and 20 ICSI cycles were analyzed. Morphology was assessed according to strict criteria, and DNA fragmentation was measured by terminal deoxynucleotidyl transferase (TdT-mediated fluorescein-dUTP nick end labelling (TUNEL using a flow cytometry. Results. There was a significant difference in the amount of morphological abnormalities between sperm samples with low (< 20 % and high (≥ 20 % degree of DNA fragmentation. The percentages of amorphous heads (10 vs. 4 % and overall head abnormalities (42 vs. 30 % were significantly higher in sperm samples with elevated degree of DNA fragmentation. No correlation was found between sperm DNA fragmentation and fertilization rate after IVF and ICSI. When the predominant morphological abnormality in sperm samples was determined, a negative correlation was found between the percentage of spermatozoa with elongated heads and fertilization rate in ICSI (r = –0.45, P < 0.05. The fertilization rate after IVF was lower in the case of acrosomal abnormalities (35.3 %, compared to the cases of other predominant morphological abnormalities. Conclusions. Head abnormalities, especially amorphous heads, are related to elevated degree of DNA fragmentation. Predominant abnormal form in sperm samples, such as elongated heads and acrosomal abnormalities, may affect fertilization in ART.

  10. Plasmid segregation mechanisms

    DEFF Research Database (Denmark)

    Ebersbach, G.; Gerdes, Kenn

    2005-01-01

    Bacterial plasmids encode partitioning (par) loci that ensure ordered plasmid segregation prior to cell division. par loci come in two types: those that encode actin-like ATPases and those that encode deviant Walker-type ATPases. ParM, the actin-like ATPase of plasmid R1, forms dynamic filaments...... that segregate plasmids paired at mid-cell to daughter cells. Like microtubules, ParM filaments exhibit dynamic instability (i.e., catastrophic decay) whose regulation is an important component of the DNA segregation process. The Walker box ParA ATPases are related to MinD and form highly dynamic, oscillating...... filaments that are required for the subcellular movement and positioning of plasmids. The role of the observed ATPase oscillation is not yet understood. However, we propose a simple model that couples plasmid segregation to ParA oscillation. The model is consistent with the observed movement...

  11. Lower sperm DNA fragmentation after r-FSH administration in functional hypogonadotropic hypogonadism.

    Science.gov (United States)

    Ruvolo, Giovanni; Roccheri, Maria Carmela; Brucculeri, Anna Maria; Longobardi, Salvatore; Cittadini, Ettore; Bosco, Liana

    2013-04-01

    An observational clinical and molecular study was designed to evaluate the effects of the administration of recombinant human FSH on sperm DNA fragmentation in men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In the study were included 53 men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In all patients, sperm DNA fragmentation index (DFI), assessed by terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate (dUTP) in situ DNA nick end-labelling (TUNEL) assay, was evaluated before starting the treatment with 150 IU of recombinant human FSH, given three times a week for at least 3 months. Patients' semen analysis and DNA fragmentation index were re-evaluated after the 3-month treatment period. After recombinant human FSH therapy, we did not find any differences in terms of sperm count, motility and morphology. The average DNA fragmentation index was significantly reduced (21.15 vs 15.2, p15 %), while no significant variation occurred in the patients with DFI values ≤ 15 %. Recombinant human FSH administration improves sperm DNA integrity in hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia men with DNA fragmentation index value >15 % .

  12. Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry

    Energy Technology Data Exchange (ETDEWEB)

    Werner, James H. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Larson, Erica J. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Goodwin, Peter M. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Ambrose, W. Patrick [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Keller, Richard A. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States)

    2000-06-01

    We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America.

  13. Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry

    International Nuclear Information System (INIS)

    Werner, James H.; Larson, Erica J.; Goodwin, Peter M.; Ambrose, W. Patrick; Keller, Richard A.

    2000-01-01

    We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America

  14. Sustained delivery of plasmid DNA from polymeric scaffolds for tissue engineering.

    Science.gov (United States)

    Storrie, Hannah; Mooney, David J

    2006-07-07

    The encapsulation of DNA into polymeric depot systems can be used to spatially and temporally control DNA release, leading to a sustained, local delivery of therapeutic factors for tissue regeneration. Prior to encapsulation, DNA may be condensed with cationic polymers to decrease particle size, protect DNA from degradation, promote interaction with cell membranes, and facilitate endosomal release via the proton sponge effect. DNA has been encapsulated with either natural or synthetic polymers to form micro- and nanospheres, porous scaffolds and hydrogels for sustained DNA release and the polymer physical and chemical properties have been shown to influence transfection efficiency. Polymeric depot systems have been applied for bone, skin, and nerve regeneration as well as therapeutic angiogenesis, indicating the broad applicability of these systems for tissue engineering.

  15. DNA Sequences of RAPD Fragments in the Egyptian cotton ...

    African Journals Online (AJOL)

    Random Amplified Polymorphic DNAs (RAPDs) is a DNA polymorphism assay based on the amplification of random DNA segments with single primers of arbitrary nucleotide sequence. Despite the fact that the RAPD technique has become a very powerful tool and has found use in numerous applications, yet, the nature of ...

  16. Vaxfectin enhances antigen specific antibody titers and maintains Th1 type immune responses to plasmid DNA immunization.

    Science.gov (United States)

    Reyes, L; Hartikka, J; Bozoukova, V; Sukhu, L; Nishioka, W; Singh, G; Ferrari, M; Enas, J; Wheeler, C J; Manthorpe, M; Wloch, M K

    2001-06-14

    Antigen specific immune responses were characterized after intramuscular immunization of BALB/c mice with 5 antigen encoding plasmid DNAs (pDNAs) complexed with Vaxfectin, a cationic lipid formulation. Vaxfectin increased IgG titers for all of the antigens with no effect on the CTL responses to the 2 antigens for which CTL assays were performed. Both antigen specific IgG1 and IgG2a were increased, although IgG2a remained greater than IgG1. Furthermore, Vaxfectin had no effect on IFN-gamma or IL-4 production by splenocytes re-stimulated with antigen, suggesting that the Th1 type responses typical of intramuscular pDNA immunization were not altered. Studies with IL-6 -/- mice suggest that the antibody enhancement is IL-6 dependent and results in a correlative increase in antigen specific antibody secreting cells.

  17. Luciferase assay to study the activity of a cloned promoter DNA fragment.

    Science.gov (United States)

    Solberg, Nina; Krauss, Stefan

    2013-01-01

    Luciferase based assays have become an invaluable tool for the analysis of cloned promoter DNA fragments, both for verifying the ability of a potential promoter fragment to drive the expression of a luciferase reporter gene in various cellular contexts, and for dissecting binding elements in the promoter. Here, we describe the use of the Dual-Luciferase(®) Reporter Assay System created by Promega (Promega Corporation, Wisconsin, USA) to study the cloned 6.7 kilobases (kb) mouse (m) Tcf3 promoter DNA fragment in mouse embryonic derived neural stem cells (NSC). In this system, the expression of the firefly luciferase driven by the cloned mTcf3 promoter DNA fragment (including transcription initiation sites) is correlated with a co-transfected control reporter expressing Renilla luciferase from the herpes simplex virus (HSV) thymidine kinase promoter. Using an internal control reporter allows to normalize the activity of the experimental reporter to the internal control, which minimizes experimental variability.

  18. Effect on Antibody and T-Cell Responses of Mixing Five GMP-Produced DNA Plasmids and Administration With Plasmid Expressing GM-CSF

    National Research Council Canada - National Science Library

    Sedegah, M; Charoenvit, Y; Aguiar, J; Sacci, J; Hedstrom, R; Kumar, S; Belmonte, A; Lanar, DE; Jones, TR; Abot, E

    2004-01-01

    .... In preparation for a clinical trial, we assessed the immunogenicity of GMP-produced plasmids encoding five Plasmodium falciparum proteins, PfCSP, PfSSP2, PfEXP1, PfLSA1, and PfLSA3, given as a mixture, or alone...

  19. AN IMAGE-ANALYSIS TECHNIQUE FOR DETECTION OF RADIATION-INDUCED DNA FRAGMENTATION AFTER CHEF ELECTROPHORESIS

    NARCIS (Netherlands)

    ROSEMANN, M; KANON, B; KONINGS, AWT; KAMPINGA, HH

    CHEF-electrophoresis was used as a technique to detect radiation-induced DNA breakage with special emphasis to biological relevant X-ray doses (0-10 Gy). Fluorescence detection of DNA-fragments using a sensitive image analysis system was directly compared with conventional scintillation counting of

  20. Natural transformation of bacteria by fragmented, damaged and ancient DNA

    DEFF Research Database (Denmark)

    Overballe-Petersen, Søren

    with fullgenome comparisons that the process has general relevance in extant bacteria. Our findings reveal that the large environmental reservoir of short and damaged DNA retains capacity for natural transformation, even after thousands of years. This describes for the first time a process by which cells can...... transfer playing an important role early in the evolution of life. The published article explains the chemical structure behind an observed degradation difference between the two purine-nucleotides guanosine and adenosine in ancient DNA. We also point at new uses for high-through-put DNA sequencing...

  1. In-gel multiple displacement amplification of long DNA fragments diluted to the single molecule level.

    Science.gov (United States)

    Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi

    2008-12-15

    The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.

  2. Biological activity of cloned mammary tumor virus DNA fragments that bind purified glucocorticoid receptor protein in vitro

    International Nuclear Information System (INIS)

    Yamamoto, K.R.; Payvar, F.; Firestone, G.L.; Maler, B.A.; Wrange, O.; Carlstedt-Duke, J.; Gustafsson, J.A.; Chandler, V.L.; Karolinska Institutet, Stockholm, Sweden)

    1983-01-01

    To test whether high-affinity receptor:DNA interactions can be correlated with receptor effects on promoter function in vivo, we have mapped in greater detail the receptor-binding regions on murine mammary tumor virus DNA, using both nitrocellulose-filter binding and electron microscopy. Recombinant plasmids bearing these receptor-binding domains have been transfected into cultured cells, and the expression of the plasmid sequences has been monitored for hormonal regulation. The results are considered in terms of a speculative proposal that the glucocorticoid receptor may effect changes in promoter activity via specific alteration of chromatin and/or DNA structure. 37 references, 6 figures, 2 tables

  3. Sperm DNA fragmentation in boars is delayed or abolished by using sperm extenders.

    Science.gov (United States)

    Pérez-Llano, Begoña; Enciso, María; García-Casado, Pedro; Sala, Rubén; Gosálvez, Jaime

    2006-12-01

    The semen quality of seven young adult boars was assessed for percentages of sperm motility, normal acrosomes, abnormal sperm, cells positive to sHOST (short Hipoosmotic Swelling Test), HPNA cells (sHOST Positive with Normal Acrosome cells) and the percentage of sperm heads, which exhibited DNA fragmentation using the Sperm Chromatin Dispersion test (SCD). These parameters were analysed in sperm samples both undiluted and diluted using a commercial extender and stored at 15 degrees C for 21 days. Results showed that semen quality decreases faster in the undiluted semen samples from day 0 to day 7 compared to diluted semen samples that remained with a high quality up to day 11. The undiluted semen exhibited a low DNA fragmentation index (DFI) during the first days and then a significant increase from day 7 up to day 21. This increase in the DFI coincided with the lowest levels of the other semen quality parameters. On the contrary, the samples diluted in the commercial extender showed very low levels of DNA fragmentation in all boars during the preservation period. When the evolution of DNA fragmentation was analysed in the undiluted samples, differences were found among boars. These differences were not shown in the samples diluted in the extender where the basal DFI remained stable during the 21 days. The main conclusion of this study was that some sperm extenders delay or partially prevent sperm DNA fragmentation.

  4. A feasibility study of the use of DNA fragmentation as a method for detecting irradiation of food

    International Nuclear Information System (INIS)

    Jones, J.L.; Bulford, B.B.

    1990-07-01

    The main conclusions of the study are: 1. Gamma-irradiation at doses of 1-10 kGy, as recommended for use in food irradiation, causes extensive fragmentation of DNA molecules. The degree of fragmentation increases with increasing doses of irradiation treatment. 2. Irradiation-induced DNA fragments can be rapidly separated from intact DNA using a simple ultra-filtration method. 3. The separated DNA fragments can be detected/quantified rapidly using the simple Invitrogen DNA DipStick procedure. Dot-blot assays based on probes to widely conserved genes (e.g. histone genes) may also prove of value, but will require further development. 4. As DNA is present in a wide range of foods, DNA fragmentation offers a potentially useful marker for the irradiation treatment of foods. The assay now requires assessment with DNA extracts of a variety of foods. (author)

  5. Quantification of plasmid DNA reference materials for Shiga toxin-producing Escherichia coli based on UV, HR-ICP-MS and digital PCR.

    Science.gov (United States)

    Liang, Wen; Xu, Li; Sui, Zhiwei; Li, Yan; Li, Lanying; Wen, Yanli; Li, Chunhua; Ren, Shuzhen; Liu, Gang

    2016-01-01

    The accuracy and metrology traceability of DNA quantification is becoming a critical theme in many fields, including diagnosis, forensic analysis, microorganism detection etc. Thus the research of DNA reference materials (RMs) and consistency of DNA quantification methods has attracted considerable research interest. In this work, we developed 3 plasmid candidate RMs, containing 3 target genes of Escherichia coli O157:H7 (E. coli O157:H7) and other Shiga toxin-producing Escherichia coli (STEC): stx1, stx2, and fliC (h7) respectively. Comprehensive investigation of the plasmid RMs was performed for their sequence, purity, homogeneity and stability, and then the concentration was quantified by three different methods: ultraviolet spectrophotometer (UV), high resolution inductively coupled plasma mass spectrometry (HR-ICP-MS) and digital PCR. As a routinely applied method for DNA analysis, UV was utilized for the quantification (OD260) and purity analysis for the plasmids. HR-ICP-MS quantified the plasmid DNA through analysing the phosphorus in DNA molecules. Digital PCR distributed the DNA samples onto a microarray chip containing thousands of reaction chambers, and quantified the DNA copy numbers by analysing the number of positive signals without any calibration curves needed. Based on the high purification of the DNA reference materials and the optimization of dPCR analysis, we successfully achieved good consistency between UV, HR-ICP-MS and dPCR, with relative deviations lower than 10 %. We then performed the co-quantification of 3 DNA RMs with three different methods together, and the uncertainties of their concentration were evaluated. Finally, the certified values and expanded uncertainties for 3 DNA RMs (pFliC, pStx1 and pStx2) were (1.60 ± 0.10) × 10(10) copies/μL, (1.53 ± 0.10) × 10(10) copies/μL and (1.70 ± 0.11) × 10(10) copies/μL respectively.Graphical abstractWe developed 3 plasmid candidate RMs, containing 3 target genes of

  6. Dendritic cell mediated delivery of plasmid DNA encoding LAMP/HIV-1 Gag fusion immunogen enhances T cell epitope responses in HLA DR4 transgenic mice.

    Directory of Open Access Journals (Sweden)

    Gregory G Simon

    2010-01-01

    Full Text Available This report describes the identification and bioinformatics analysis of HLA-DR4-restricted HIV-1 Gag epitope peptides, and the application of dendritic cell mediated immunization of DNA plasmid constructs. BALB/c (H-2d and HLA-DR4 (DRA1*0101, DRB1*0401 transgenic mice were immunized with immature dendritic cells transfected by a recombinant DNA plasmid encoding the lysosome-associated membrane protein-1/HIV-1 Gag (pLAMP/gag chimera antigen. Three immunization protocols were compared: 1 primary subcutaneous immunization with 1x10(5 immature dendritic cells transfected by electroporation with the pLAMP/gag DNA plasmid, and a second subcutaneous immunization with the naked pLAMP/gag DNA plasmid; 2 primary immunization as above, and a second subcutaneous immunization with a pool of overlapping peptides spanning the HIV-1 Gag sequence; and 3 immunization twice by subcutaneous injection of the pLAMP/gag DNA plasmid. Primary immunization with pLAMP/gag-transfected dendritic cells elicited the greatest number of peptide specific T-cell responses, as measured by ex vivo IFN-gamma ELISpot assay, both in BALB/c and HLA-DR4 transgenic mice. The pLAMP/gag-transfected dendritic cells prime and naked DNA boost immunization protocol also resulted in an increased apparent avidity of peptide in the ELISpot assay. Strikingly, 20 of 25 peptide-specific T-cell responses in the HLA-DR4 transgenic mice contained sequences that corresponded, entirely or partially to 18 of the 19 human HLA-DR4 epitopes listed in the HIV molecular immunology database. Selection of the most conserved epitope peptides as vaccine targets was facilitated by analysis of their representation and variability in all reported sequences. These data provide a model system that demonstrates a the superiority of immunization with dendritic cells transfected with LAMP/gag plasmid DNA, as compared to naked DNA, b the value of HLA transgenic mice as a model system for the identification and evaluation

  7. Effect of serotonin on the expression of antigens and DNA levels in Yersinia pestis cells with different plasmid content

    Science.gov (United States)

    Klueva, Svetlana N.; Korsukov, Vladimir N.; Schukovskaya, Tatyana N.; Kravtsov, Alexander L.

    2004-08-01

    Using flow cytometry (FCM) the influence of exogenous serotonin on culture growth, DNA content and fluorescence intensity of cells binding FITC-labelled plague polyclonal immunoglobulins was studied in Yersinia pestis EV (pFra+, pCad+, pPst+), Yersinia pestis KM218 (pFra-, pCad-, pPst-), Yersinia pestis KM 216 (pFra-, pCad-, pPst+). The results have been obtained by FCM showed serotonin accelerated Yersinia pestis EV (pFra+, pCad+, pPst+), Yersinia pestis KM218 (pFra-, pCad-, pPst-) culture growth during cultivation in Hottinger broth pH 7.2 at 28°C at concentration of 10-5 M. The presence of 10-5 M serotonin in nutrient broth could modulate DNA content in 37°C growing population of plague microbe independently of their plasmid content. Serotonin have been an impact on the distribution pattern of the cells according to their phenotypical characteristics, which was reflected in the levels of population heterogeneity in the intensity of specific immunofluorescence determined by FMC.

  8. Abnormal ultraviolet mutagenic spectrum in plasmid DNA replicated in cultured fibroblasts from a patient with the skin cancer-prone disease, xeroderma pigmentosum

    International Nuclear Information System (INIS)

    Seetharam, S.; Protic-Sabljic, M.; Seidman, M.M.; Kraemer, K.H.

    1987-01-01

    A shuttle vector plasmid, pZ189, was utilized to assess the types of mutations that cells from a patient with xeroderma pigmentosum, complementation group D, introduce into ultraviolet (UV) damaged, replicating DNA. Patients with xeroderma pigmentosum have clinical and cellular UV hypersensitivity, increased frequency of sun-induced skin cancer, and deficient DNA repair. In comparison to UV-treated pZ189 replicated in DNA repair-proficient cells, there were fewer surviving plasmids, a higher frequency of plasmids with mutations, fewer plasmids with two or more mutations in the marker gene, and a new mutagenic hotspot. The major type of base substitution mutation was the G:C to A:T transition with both cell lines. These results, together with similar findings published earlier with cells from a xeroderma pigmentosum patient in complementation group A, suggest that isolated G:C to A:T somatic mutations may be particularly important in generation of human skin cancer by UV radiation

  9. Genetic alterations of hepatocellular carcinoma by random amplified polymorphic DNA analysis and cloning sequencing of tumor differential DNA fragment

    Science.gov (United States)

    Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao

    2005-01-01

    AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039

  10. Synthesis and NMR of {sup 15}N-labeled DNA fragments

    Energy Technology Data Exchange (ETDEWEB)

    Jones, R.A. [Rutgers, The State Univ. of New Jersey, Piscataway, NJ (United States)

    1994-12-01

    DNA fragments labeled with {sup 15}N at the ring nitrogens and at the exocyclic amino groups can be used to obtain novel insight into interactions such as base pairing, hydration, drug binding, and protein binding. A number of synthetic routes to {sup 15}N-labeled pyrimidine nucleosides, purines, and purine nucleosides have been reported. Moreover, many of these labeled bases or monomers have been incorporated into nucleic acids, either by chemical synthesis or by biosynthetic procedures. The focus of this chapter will be on the preparation of {sup 15}N-labeled purine 2{prime}-deoxynucleosides, their incorporation into DNA fragments by chemical synthesis, and the results of NMR studies using these labeled DNA fragments.

  11. A novel technique using DNA denaturation to detect multiply induced single-strand breaks in a hydrated plasmid DNA molecule by X-ray and 4He2+ ion irradiation

    International Nuclear Information System (INIS)

    Yokoya, A.; Shikazono, N.; Fujii, K.; Noguchi, M.; Urushibara, A.

    2011-01-01

    To detect multiple single-strand breaks (SSBs) produced in plasmid DNA molecules by direct energy deposition from radiation tracks, we have developed a novel technique using DNA denaturation by which irradiated DNA is analysed as single-strand DNA (SS-DNA). The multiple SSBs that arise in both strands of DNA, but do not induce a double-strand break, are quantified as loss of SS-DNA using agarose gel electrophoresis. We have applied this method to X-ray and 4 He 2+ ion-irradiated samples of fully hydrated pUC18 plasmid DNA. The fractions of both SS-DNA and closed circular DNA (CC-DNA) exponentially decrease with the increasing dose of X rays and 4 He 2+ ions. The efficiency of the loss of SS-DNA was half that of CC-DNA for both types of irradiation, indicating that one of two strands in DNA is not broken when one SSB is produced in CC-DNA by irradiation. Contrary to our initial expectation, these results indicate that SSBs are not multiply induced even by high linear energy transfer radiation distributed in both strands. (authors)

  12. Accurate phylogenetic classification of DNA fragments based onsequence composition

    Energy Technology Data Exchange (ETDEWEB)

    McHardy, Alice C.; Garcia Martin, Hector; Tsirigos, Aristotelis; Hugenholtz, Philip; Rigoutsos, Isidore

    2006-05-01

    Metagenome studies have retrieved vast amounts of sequenceout of a variety of environments, leading to novel discoveries and greatinsights into the uncultured microbial world. Except for very simplecommunities, diversity makes sequence assembly and analysis a verychallenging problem. To understand the structure a 5 nd function ofmicrobial communities, a taxonomic characterization of the obtainedsequence fragments is highly desirable, yet currently limited mostly tothose sequences that contain phylogenetic marker genes. We show that forclades at the rank of domain down to genus, sequence composition allowsthe very accurate phylogenetic 10 characterization of genomic sequence.We developed a composition-based classifier, PhyloPythia, for de novophylogenetic sequence characterization and have trained it on adata setof 340 genomes. By extensive evaluation experiments we show that themethodis accurate across all taxonomic ranks considered, even forsequences that originate fromnovel organisms and are as short as 1kb.Application to two metagenome datasets 15 obtained from samples ofphosphorus-removing sludge showed that the method allows the accurateclassification at genus level of most sequence fragments from thedominant populations, while at the same time correctly characterizingeven larger parts of the samples at higher taxonomic levels.

  13. Phototransfection of mouse embryonic stem cells with plasmid DNA using femtosecond laser pulses

    CSIR Research Space (South Africa)

    Thobakgale, Setumo L

    2017-02-01

    Full Text Available efficient in photonic interactions with biological material. As of late, laser pulses have been used for drug and DNA delivery into cells via transient optical perforation of the cellular membrane. Thus in this study, we design and construct an optical...

  14. FragIdent – Automatic identification and characterisation of cDNA-fragments

    Directory of Open Access Journals (Sweden)

    Goehler Heike

    2009-03-01

    Full Text Available Abstract Background Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Results Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. Conclusion We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

  15. FragIdent--automatic identification and characterisation of cDNA-fragments.

    Science.gov (United States)

    Seelow, Dominik; Goehler, Heike; Hoffmann, Katrin

    2009-03-02

    Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs) within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

  16. Development of procedures for the identification of human papilloma virus DNA fragments in laser plume

    Science.gov (United States)

    Woellmer, Wolfgang; Meder, Tom; Jappe, Uta; Gross, Gerd; Riethdorf, Sabine; Riethdorf, Lutz; Kuhler-Obbarius, Christina; Loening, Thomas

    1996-01-01

    For the investigation of laser plume for the existence of HPV DNA fragments, which possibly occur during laser treatment of virus infected tissue, human papillomas and condylomas were treated in vitro with the CO2-laser. For the sampling of the laser plume a new method for the trapping of the material was developed by use of water-soluble gelatine filters. These samples were analyzed with the polymerase chain reaction (PCR) technique, which was optimized in regard of the gelatine filters and the specific primers. Positive PCR results for HPV DNA fragments up to the size of a complete oncogene were obtained and are discussed regarding infectiousity.

  17. Effect of the Plasmid-DNA Vaccination on Macroscopic and Microscopic Damage Caused by the Experimental Chronic Trypanosoma cruzi Infection in the Canine Model

    Directory of Open Access Journals (Sweden)

    Olivia Rodríguez-Morales

    2013-01-01

    Full Text Available The dog is considered the main domestic reservoir for Trypanosoma cruzi infection and a suitable experimental animal model to study the pathological changes during the course of Chagas disease (CD. Vaccine development is one of CD prevention methods to protect people at risk. Two plasmids containing genes encoding a trans-sialidase protein (TcSP and an amastigote-specific glycoprotein (TcSSP4 were used as DNA vaccines in a canine model. Splenomegaly was not found in either of the recombinant plasmid-immunized groups; however, cardiomegaly was absent in animals immunized only with the plasmid containing the TcSSP4 gene. The inflammation of subendocardial and myocardial tissues was prevented only with the immunization with TcSSP4 gene. In conclusion, the vaccination with these genes has a partial protective effect on the enlargement of splenic and cardiac tissues during the chronic CD and on microscopic hearth damage, since both plasmids prevented splenomegaly but only one avoided cardiomegaly, and the lesions in heart tissue of dog immunized with plasmid containing the TcSSP4 gene covered only subepicardial tissue.

  18. Preparation and Characterization of Cationic PLA-PEG Nanoparticles for Delivery of Plasmid DNA

    Directory of Open Access Journals (Sweden)

    Zou Weiwei

    2009-01-01

    Full Text Available Abstract The purpose of the present work was to formulate and evaluate cationic poly(lactic acid-poly(ethylene glycol (PLA-PEG nanoparticles as novel non-viral gene delivery nano-device. Cationic PLA-PEG nanoparticles were prepared by nanoprecipitation method. The gene loaded nanoparticles were obtained by incubating the report gene pEGFP with cationic PLA-PEG nanoparticles. The physicochemical properties (e.g., morphology, particle size, surface charge, DNA binding efficiency and biological properties (e.g., integrity of the released DNA, protection from nuclease degradation, plasma stability, in vitro cytotoxicity, and in vitro transfection ability in Hela cells of the gene loaded PLA-PEG nanoparticles were evaluated, respectively. The obtained cationic PLA-PEG nanoparticles and gene loaded nanoparticles were both spherical in shape with average particle size of 89.7 and 128.9 nm, polydispersity index of 0.185 and 0.161, zeta potentials of +28.9 and +16.8 mV, respectively. The obtained cationic PLA-PEG nanoparticles with high binding efficiency (>95% could protect the loaded DNA from the degradation by nuclease and plasma. The nanoparticles displayed sustained-release properties in vitro and the released DNA maintained its structural and functional integrity. It also showed lower cytotoxicity than Lipofectamine 2000 and could successfully transfect gene into Hela cells even in presence of serum. It could be concluded that the established gene loaded cationic PLA-PEG nanoparticles with excellent properties were promising non-viral nano-device, which had potential to make cancer gene therapy achievable.

  19. Electric field-mediated transport of plasmid DNA in tumor interstitium in vivo.

    Science.gov (United States)

    Henshaw, Joshua W; Zaharoff, David A; Mossop, Brian J; Yuan, Fan

    2007-11-01

    Local pulsed electric field application is a method for improving non-viral gene delivery. Mechanisms of the improvement include electroporation and electrophoresis. To understand how electrophoresis affects pDNA delivery in vivo, we quantified the magnitude of electric field-induced interstitial transport of pDNA in 4T1 and B16.F10 tumors implanted in mouse dorsal skin-fold chambers. Four different electric pulse sequences were used in this study, each consisted of 10 identical pulses that were 100 or 400 V/cm in strength and 20 or 50 ms in duration. The interval between consecutive pulses was 1 s. The largest distance of transport was obtained with the 400 V/cm and 50 ms pulse, and was 0.23 and 0.22 microm/pulse in 4T1 and B16.F10 tumors, respectively. There were no significant differences in transport distances between 4T1 and B16.F10 tumors. Results from in vivo mapping and numerical simulations revealed an approximately uniform intratumoral electric field that was predominantly in the direction of the applied field. The data in the study suggested that interstitial transport of pDNA induced by a sequence of ten electric pulses was ineffective for macroscopic delivery of genes in tumors. However, the induced transport was more efficient than passive diffusion.

  20. KEY COMPARISON: CCQM-K61: Quantitation of a linearised plasmid DNA, based on a matched standard in a matrix of non-target DNA

    Science.gov (United States)

    Woolford, Alison; Holden, Marcia; Salit, Marc; Burns, Malcolm; Ellison, Stephen L. R.

    2009-01-01

    Key comparison CCQM-K61 was performed to demonstrate and document the capability of interested national metrology institutes in the determination of the quantity of specific DNA target in an aqueous solution. The study provides support for the following measurement claim: "Quantitation of a linearised plasmid DNA, based on a matched standard in a matrix of non-target DNA". The comparison was an activity of the Bioanalysis Working Group (BAWG) of the Comité Consultatif pour la Quantité de Matière and was coordinated by NIST (Gaithersburg, USA) and LGC (Teddington, UK). The following laboratories (in alphabetical order) participated in this key comparison. DMSC (Thailand); IRMM (European Union); KRISS (Republic of Korea); LGC (UK); NIM (China); NIST (USA); NMIA (Australia); NMIJ (Japan); VNIIM (Russian Federation) Good agreement was observed between the reported results of all nine of the participants. Uncertainty estimates did not account fully for the dispersion of results even after allowance for possible inhomogeneity in calibration materials. Preliminary studies suggest that the effects of fluorescence threshold setting might contribute to the excess dispersion, and further study of this topic is suggested Main text. To reach the main text of this paper, click on Final Report. Note that this text is that which appears in Appendix B of the BIPM key comparison database kcdb.bipm.org/. The final report has been peer-reviewed and approved for publication by the CCQM, according to the provisions of the CIPM Mutual Recognition Arrangement (MRA).

  1. Plasmid DNA studies in Lactobacillus plantarum strains isolated from olive fermentations: production of and immunity to plantaricin OL15 is associated to a 9.6 Kb plasmid (pOL15

    Directory of Open Access Journals (Sweden)

    Mourad, Kacem

    2007-06-01

    Full Text Available Previously 12 Lactobacillus plantarum strains were isolated from fermented olives. Among these, only L. plantarum OL15 produced bacteriocin (plantaricin OL15. In this study, the 12 strains were examined for plasmid DNA content. Of these, 9 strains have shown one to three plasmid bands ranging in size from 5.4 to 12.2 kb. L. plantarum OL15 exhibited one plasmid (9.6 kb which was named pOL15. After curing with novobiocin and ethidium bromide, the plasmid profile analysis of non producing derivatives, showed that the 9.6 kb plasmid pOL15 harbored by the parental strain had been lost in all cases and none of them regained the ability to produce plantaricin OL15 suggesting that the production of plantaricin OL15 is plasmid linked. Plantaricin OL15 was not inactived by amylase and lipase suggesting that plantaricin OL15 activity was not dependent on the presence of either a carbohydrate or lipid moiety. Plantaricin OL15 showed activity against lactic acid bacteria of different species and also against olive spoilage and phytopathogenic bacteria, including Pseudomonas and Erwinia.En un estudio previo, se aislaron 12 cepas de Lactobacillus plantarum a partir de aceitunas fermentadas. Entre ellas, solo L. plantarum OL15 produjo bacteriocinas (plantaricin OL15. En este estudio, se examinó el contenido de AND plásmido en las 12 cepas citadas. Entre ellas, 9 cepas han mostrado de una a tres bandas de plásmido con tamaños en el rango de 5.4 a 12.2 kb. L. plantarum OL15 exhibió un plásmido (9.6 kb que se denominó pOL15. Después del curado con novobiocina y bromuro de etidio, la pérdida del plásmido pOL15 asociada a la pérdida de su facultad para producir plantaricin OL15, sugiere que la producción de plantaricina OL15 está ligada al plásmido. La plantaricin OL15 no se inactivó por amilasa ni por lipasa sugiriendo que su actividad no es dependiente de la presencia de carbohidratos o lípidos. La plantaricina OL15 mostró actividad frente a

  2. Nature of defects produced on thymine fragment by gamma irradiation of DNA

    International Nuclear Information System (INIS)

    Teoule, R.; Bonicel, A.

    1975-01-01

    A study is reported of the nature of the DNA thymine fragment damage induced by gamma radiation in vitro conditions, by a new method involving hydrolysis in mild conditions. It is highly probable that the main lesions observed in vitro on the DNA polynucleotide chain, namely thymine glycol, 5,6-dihydroxy-5,6-dihydrothymine and 1'-(N-formamidol) deoxyribose, are formed in vivo conditions

  3. Anchoring of self-assembled plasmid DNA/ anti-DNA antibody/cationic lipid micelles on bisphosphonate-modified stent for cardiovascular gene delivery

    Directory of Open Access Journals (Sweden)

    Ma G

    2013-03-01

    Full Text Available Guilei Ma,1,# Yong Wang,1,# Ilia Fishbein,2 Mei Yu,1 Linhua Zhang,1 Ivan S Alferiev,2 Jing Yang,1 Cunxian Song,1 Robert J Levy2 1Institute of Biomedical Engineering, Chinese Academy of Medical Sciences and Peking Union Medical College, Tianjin, People's Republic of China; 2Children's Hospital of Philadelphia, Abramson Research Building, Philadelphia, PA, USA #These authors contributed equally to this work Purpose: To investigate the anchoring of plasmid DNA/anti-DNA antibody/cationic lipid tri-complex (DAC micelles onto bisphosphonate-modified 316 L coronary stents for cardiovascular site-specific gene delivery. Methods: Stents were first modified with polyallylamine bisphosphonate (PAA-BP, thereby enabling the retention of a PAA-BP molecular monolayer that permits the anchoring (via vector-binding molecules of DAC micelles. DAC micelles were then chemically linked onto the PAA-BP-modified stents by using N-succinimidyl-3-(2-pyridyldithiol-propionate (SPDP as a crosslinker. Rhodamine-labeled DNA was used to assess the anchoring of DAC micelles, and radioactive-labeled antibody was used to evaluate binding capacity and stability. DAC micelles (encoding green fluorescent protein were tethered onto the PAA-BP-modified stents, which were assessed in cell culture. The presence of a PAA-BP molecular monolayer on the steel surface was confirmed by X-ray photoelectron spectroscopy and atomic force microscope analysis. Results: The anchoring of DAC micelles was generally uniform and devoid of large-scale patches of defects. Isotopic quantification confirmed that the amount of antibody chemically linked on the stents was 17-fold higher than that of the physical adsorbed control stents and its retention time was also significantly longer. In cell culture, numerous green fluorescent protein-positive cells were found on the PAA-BP modified stents, which demonstrated high localization and efficiency of gene delivery. Conclusion: The DAC micelle

  4. Longevity of rAAV vector and plasmid DNA in blood after intramuscular injection in nonhuman primates: implications for gene doping.

    Science.gov (United States)

    Ni, W; Le Guiner, C; Gernoux, G; Penaud-Budloo, M; Moullier, P; Snyder, R O

    2011-07-01

    Legitimate uses of gene transfer technology can benefit from sensitive detection methods to determine vector biodistribution in pre-clinical studies and in human clinical trials, and similar methods can detect illegitimate gene transfer to provide sports-governing bodies with the ability to maintain fairness. Real-time PCR assays were developed to detect a performance-enhancing transgene (erythropoietin, EPO) and backbone sequences in the presence of endogenous cellular sequences. In addition to developing real-time PCR assays, the steps involved in DNA extraction, storage and transport were investigated. By real-time PCR, the vector transgene is distinguishable from the genomic DNA sequence because of the absence of introns, and the vector backbone can be identified by heterologous gene expression control elements. After performance of the assays was optimized, cynomolgus macaques received a single dose by intramuscular (IM) injection of plasmid DNA, a recombinant adeno-associated viral vector serotype 1 (rAAV1) or a rAAV8 vector expressing cynomolgus macaque EPO. Macaques received a high plasmid dose intended to achieve a significant, but not life-threatening, increase in hematocrit. rAAV vectors were used at low doses to achieve a small increase in hematocrit and to determine the limit of sensitivity for detecting rAAV sequences by single-step PCR. DNA extracted from white blood cells (WBCs) was tested to determine whether WBCs can be collaterally transfected by plasmid or transduced by rAAV vectors in this context, and can be used as a surrogate marker for gene doping. We demonstrate that IM injection of a conventional plasmid and rAAV vectors results in the presence of DNA that can be detected at high levels in blood before rapid elimination, and that rAAV genomes can persist for several months in WBCs.

  5. Electrostatic field of the large fragment of Escherichia coli DNA polymerase I.

    Science.gov (United States)

    Warwicker, J; Ollis, D; Richards, F M; Steitz, T A

    1985-12-05

    The electrostatic field of the large fragment of Escherichia coli DNA polymerase I (Klenow fragment) has been calculated by the finite difference procedure on a 2 A grid. The potential field is substantially negative at physiological pH (reflecting the net negative charge at this pH). The largest regions of positive potential are in the deep crevice of the C-terminal domain, which is the proposed binding site for the DNA substrate. Within the crevice, the electrostatic potential has a partly helical form. If the DNA is positioned to fulfil stereochemical requirements, then the positive potential generally follows the major groove and (to a lesser extent) the negative potential is in the minor groove. Such an arrangement could stabilize DNA configurations related by screw symmetry. The histidine residues of the Klenow fragment give the positive field of the groove a sensitivity to relatively small pH changes around neutrality. We suggest that the histidine residues could change their ionization states in response to DNA binding, and that this effect could contribute to the protein-DNA binding energy.

  6. Ionization and fragmentation of DNA-RNA bases: a density functional theory study

    International Nuclear Information System (INIS)

    Sadr-Arani, Leila

    2014-01-01

    Ionizing radiation (IR) cross human tissue, deposit energy and dissipate fragmenting molecules. The resulting fragments may be highlighted by mass spectrometry. Despite the amount of information obtained experimentally by the interpretation of the mass spectrum, experience alone cannot answer all the questions of the mechanism of fragmentation of DNA/RNA bases and a theoretical study is a complement to this information. A theoretical study allows us to know the weakest bonds in the molecule during ionization and thus may help to provide mechanisms of dissociation and produced fragments. The purpose of this work, using the DFT with the PBE functional, is to study the ionization and fragmentation mechanisms of DNA/RNA bases (Uracil, Cytosine, Adenine and Guanine) and to identify the cations corresponding to each peak in mass spectra. For all RNA bases, the retro Diels-Alder reaction (elimination of HNCO or NCO*) is a major route for dissociating, with the exception of adenine for which there is no atom oxygen in its structure. Loss of NH 3 (NH 2 *) molecule is another common way to all bases that contain amine group. The possibility of the loss of hydrogen from the cations is also investigated, as well as the dissociation of dehydrogenated cations and protonated uracil. This work shows the interest of providing DFT calculation in the interpretation of mass spectra of DNA bases. (author)

  7. Analysis of different DNA fragments of Corynebacterium glutamicum complementing dapE of Escherichia coli.

    Science.gov (United States)

    Wehrmann, A; Eggeling, L; Sahm, H

    1994-12-01

    In Corynebacterium glutamicum L-lysine is synthesized simultaneously via the succinylase and dehydrogenase variant of the diaminopimelate pathway. Starting from a strain with a disrupted dehydrogenase gene, three different-sized DNA fragments were isolated which complemented defective Escherichia coli mutants in the succinylase pathway. Enzyme studies revealed that in one case the dehydrogenase gene had apparently been reconstituted in the heterologous host. The two other fragments resulted in desuccinylase activity; one of them additionally in succinylase activity. However, the physical analysis showed that structural changes had taken place in all fragments. Using a probe derived from one of the fragments we isolated a 3.4 kb BamHI DNA fragment without selective pressure (by colony hybridization). This was structurally intact and proved functionally to result in tenfold desuccinylase overexpression. The nucleotide sequence of a 1966 bp fragment revealed the presence of one truncated open reading frame of unknown function and that of dapE encoding N-succinyl diaminopimelate desuccinylase (EC 3.5.1.18). The deduced amino acid sequence of the dapE gene product shares 23% identical residues with that from E. coli. The C. glutamicum gene now available is the first gene from the succinylase branch of lysine synthesis of this biotechnologically important organism.

  8. Differential diagnosis of genetic disease by DNA restriction fragment length polymorphisms

    NARCIS (Netherlands)

    Bolhuis, P. A.; Defesche, J. C.; van der Helm, H. J.

    1987-01-01

    DNA restriction fragment length polymorphisms (RFLPs) are used for diagnosis of genetic disease in families known to be affected by specific disorders, but RFLPs can be also useful for the differential diagnosis of hereditary disease. An RFLP pattern represents the inheritance of chromosomal markers

  9. Modeling the yield of double-strand breaks due to formation of multiply damaged sites in irradiated plasmid DNA

    International Nuclear Information System (INIS)

    Xapsos, M.A.; Pogozelski, W.K.

    1996-01-01

    Although double-strand breaks have long been recognized as an important type of DNa lesion, it is well established that this broad class of damage does not correlate well with indicators of the effectiveness of radiation as the cellular level. Assays of double-strand breaks do not distinguish the degree of complexity or clustering of singly damaged sites produced in a single energy deposition event, which is currently hypothesized to be key to understanding cellular end points. As a step toward this understanding, double-strand breaks that are formed proportionally to dose in plasmid DNA are analyzed from the mechanistic aspect to evaluate the yield that arises from multiply damaged sites as hypothesized by Ward (Prog. Nucleic Acid Res. Mol. Biol. 35, 95-125, 1988) and Goodhead (Int. J. Radiat. Biol. 65, 7-17, 1994) as opposed to the yield that arises form single hydroxyl radicals as hypothesized by Siddiqi and Bothe (Radiat. Res. 112, 449-463, 1987). For low-LET radiation such as γ rays, the importance of multiply damaged sites is shown to increase with the solution's hydroxyl radical scavenging capacity. For moderately high-LET radiation such as 100 keV/μm helium ions, a much different behavior is observed. In this case, a large fraction of double-strand breaks are formed as a result of multiply damaged sties over a broad range of scavenging conditions. Results also indicate that the RBE for common cellular end points correlates more closely with the RBE for common cellular end points correlates more closely with the RBE for multiply damaged sites than with the RBE for total double-strand breaks over a range of LET up to at least 100 keV/μm. 22 refs., 3 figs., 2 tabs

  10. Functional activity of plasmid DNA after entry into the atmosphere of earth investigated by a new biomarker stability assay for ballistic spaceflight experiments.

    Directory of Open Access Journals (Sweden)

    Cora S Thiel

    Full Text Available Sounding rockets represent an excellent platform for testing the influence of space conditions during the passage of Earth's atmosphere and re-entry on biological, physical and chemical experiments for astrobiological purposes. We designed a robust functionality biomarker assay to analyze the biological effects of suborbital spaceflights prevailing during ballistic rocket flights. During the TEXUS-49 rocket mission in March 2011, artificial plasmid DNA carrying a fluorescent marker (enhanced green fluorescent protein: EGFP and an antibiotic resistance cassette (kanamycin/neomycin was attached on different positions of rocket exterior; (i circular every 90 degree on the outer surface concentrical of the payload, (ii in the grooves of screw heads located in between the surface application sites, and (iii on the surface of the bottom side of the payload. Temperature measurements showed two major peaks at 118 and 130 °C during the 780 seconds lasting flight on the inside of the recovery module, while outer gas temperatures of more than 1000 °C were estimated on the sample application locations. Directly after retrieval and return transport of the payload, the plasmid DNA samples were recovered. Subsequent analyses showed that DNA could be recovered from all application sites with a maximum of 53% in the grooves of the screw heads. We could further show that up to 35% of DNA retained its full biological function, i.e., mediating antibiotic resistance in bacteria and fluorescent marker expression in eukaryotic cells. These experiments show that our plasmid DNA biomarker assay is suitable to characterize the environmental conditions affecting DNA during an atmospheric transit and the re-entry and constitute the first report of the stability of DNA during hypervelocity atmospheric transit indicating that sounding rocket flights can be used to model the high-speed atmospheric entry of organics-laden artificial meteorites.

  11. [Cleavage of DNA fragments induced by UV nanosecond laser excitation at 193 nm].

    Science.gov (United States)

    Vtiurina, N N; Grokhovskiĭ, S L; Filimonov, I V; Medvedkov, O I; Nechipurenko, D Iu; Vasil'ev, S A; Nechipurenko, Iu D

    2011-01-01

    The cleavage of dsDNA fragments in aqueous solution after irradiation with UV laser pulses at 193 nm has been studied. Samples were investigated using polyacrylamide gel electrophoresis. The intensity of damage of particular phosphodiester bond after hot alkali treatment was shown to depend on the base pair sequence. It was established that the probability of cleavage is twice higher for sites of DNA containing two or more successively running guanine residues. A possible mechanism of damage to the DNA molecule connected with the migration of holes along the helix is discussed.

  12. Cloning of Bacteroides fragilis plasmid genes affecting metronidazole resistance and ultraviolet survival in Escherichia coli

    International Nuclear Information System (INIS)

    Wehnert, G.U.; Abratt, V.R.; Goodman, H.J.; Woods, D.R.

    1990-01-01

    Since reduced metronidazole causes DNA damage, resistance to metronidazole was used as a selection method for the cloning of Bacteroides fragilis genes affecting DNA repair mechanisms in Escherichia coli. Genes from B. fragilis Bf-2 were cloned on a recombinant plasmid pMT100 which made E. coli AB1157 and uvrA, B, and C mutant strains more resistant to metronidazole, but more sensitive to far uv irradiation under aerobic conditions. The loci affecting metronidazole resistance and uv sensitivity were linked and located on a 5-kb DNA fragment which originated from the small 6-kb cryptic plasmid pBFC1 present in B. fragilis Bf-2 cells

  13. Simple method for identification of plasmid-coded proteins

    International Nuclear Information System (INIS)

    Sancar, A.; Hack, A.M.; Rupp, W.D.

    1979-01-01

    Proteins encoded by plasmid DNA are specifically labeled in uv-irradiated cells of Escherichia coli carrying recA and uvrA mutations because extensive degradation of the chromosome DNA occurs concurrently with amplification of plasmid DNA

  14. Complete mitochondrial genome sequence of a Middle Pleistocene cave bear reconstructed from ultrashort DNA fragments.

    Science.gov (United States)

    Dabney, Jesse; Knapp, Michael; Glocke, Isabelle; Gansauge, Marie-Theres; Weihmann, Antje; Nickel, Birgit; Valdiosera, Cristina; García, Nuria; Pääbo, Svante; Arsuaga, Juan-Luis; Meyer, Matthias

    2013-09-24

    Although an inverse relationship is expected in ancient DNA samples between the number of surviving DNA fragments and their length, ancient DNA sequencing libraries are strikingly deficient in molecules shorter than 40 bp. We find that a loss of short molecules can occur during DNA extraction and present an improved silica-based extraction protocol that enables their efficient retrieval. In combination with single-stranded DNA library preparation, this method enabled us to reconstruct the mitochondrial genome sequence from a Middle Pleistocene cave bear (Ursus deningeri) bone excavated at Sima de los Huesos in the Sierra de Atapuerca, Spain. Phylogenetic reconstructions indicate that the U. deningeri sequence forms an early diverging sister lineage to all Western European Late Pleistocene cave bears. Our results prove that authentic ancient DNA can be preserved for hundreds of thousand years outside of permafrost. Moreover, the techniques presented enable the retrieval of phylogenetically informative sequences from samples in which virtually all DNA is diminished to fragments shorter than 50 bp.

  15. Prophagic DNA Fragments in Streptococcus agalactiae Strains and Association with Neonatal Meningitis

    Science.gov (United States)

    van der Mee-Marquet, Nathalie; Domelier, Anne-Sophie; Mereghetti, Laurent; Lanotte, Philippe; Rosenau, Agnès; van Leeuwen, Willem; Quentin, Roland

    2006-01-01

    We identified—by randomly amplified polymorphic DNA (RAPD) analysis at the population level followed by DNA differential display, cloning, and sequencing—three prophage DNA fragments (F5, F7, and F10) in Streptococcus agalactiae that displayed significant sequence similarity to the DNA of S. agalactiae and Streptococcus pyogenes. The F5 sequence aligned with a prophagic gene encoding the large subunit of a terminase, F7 aligned with a phage-associated cell wall hydrolase and a phage-associated lysin, and F10 aligned with a transcriptional regulator (ArpU family) and a phage-associated endonuclease. We first determined the prevalence of F5, F7, and F10 by PCR in a collection of 109 strains isolated in the 1980s and divided into two populations: one with a high risk of causing meningitis (HR group) and the other with a lower risk of causing meningitis (LR group). These fragments were significantly more prevalent in the HR group than in the LR group (P S. agalactiae strains to invade the neonatal brain endothelium. We then determined the prevalence of F5, F7, and F10 by PCR in a collection of 40 strains recently isolated from neonatal meningitis cases for comparison with the cerebrospinal fluid (CSF) strains isolated in the 1980s. The prevalence of the three prophage DNA fragments was similar in these two populations isolated 15 years apart. We suggest that the prophage DNA fragments identified have remained stable in many CSF S. agalactiae strains, possibly due to their importance in virulence or fitness. PMID:16517893

  16. Antimicrobial susceptibility pattern and plasmid-mediated ...

    African Journals Online (AJOL)

    negative Staphylococci (CoNS) were isolated from clinical samples and isolates subjected to antibiotic susceptibility testing, plasmid curing and plasmid DNA isolation. Result: The highest percentages isolates were recovered from urine samples and ...

  17. Oncogenic transformation of rat lung epithelioid cells by SV40 DNA and restriction enzyme fragments

    International Nuclear Information System (INIS)

    Daya-Grosjean, L.; Lasne, C.; Nardeux, P.; Chouroulinkov, I.; Monier, R.

    1979-01-01

    Rat epithelioid lung cells were transformed with various preparations of SV40 DNA using the Ca 2+ -precipitation technique. The amount of SV40 genetic information integrated into transformed clones was evaluated by DNA-DNA renaturation kinetics. The growth properties on plastic and in soft-agar were examined, as well as the ability to induce tumors in syngeneic newborn animals or in adult nude mice. One particular transformed line, which had received the HpaII/BamHIA (59 per cent) fragment, was found to contain about 3 integrated copies of this fragment per cell and no significant amount of the HpaII/BamHIB (41 per cent fragment). This line which grew to high saturatio densities and efficiently formed clones in low serum on plastic, produced tumors in both syngeneic rats and nude mice. Thus the HpaII/BamHIA fragment, which mainly includes early viral information, was sufficient to impart these properties to rat epithelioid lung cells. (author)

  18. Plasmid construction using recombination activity in the fission yeast Schizosaccharomyces pombe.

    Directory of Open Access Journals (Sweden)

    Ayako Chino

    Full Text Available BACKGROUND: Construction of plasmids is crucial in modern genetic manipulation. As of now, the common method for constructing plasmids is to digest specific DNA sequences with restriction enzymes and to ligate the resulting DNA fragments with DNA ligase. Another potent method to construct plasmids, known as gap-repair cloning (GRC, is commonly used in the budding yeast Saccharomyces cerevisiae. GRC makes use of the homologous recombination activity that occurs within the yeast cells. Due to its flexible design and efficiency, GRC has been frequently used for constructing plasmids with complex structures as well as genome-wide plasmid collections. Although there have been reports indicating GRC feasibility in the fission yeast Schizosaccharomyces pombe, this species is not commonly used for GRC as systematic studies of reporting GRC efficiency in S. pombe have not been performed till date. METHODOLOGY/PRINCIPAL FINDINGS: We investigated GRC efficiency in S. pombe in this study. We first showed that GRC was feasible in S. pombe by constructing a plasmid that contained the LEU2 auxotrophic marker gene in vivo and showed sufficient efficiency with short homology sequences (>25 bp. No preference was shown for the sequence length from the cut site in the vector plasmid. We next showed that plasmids could be constructed in a proper way using 3 DNA fragments with 70% efficiency without any specific selections being made. The GRC efficiency with 3 DNA fragments was dramatically increased >95% in lig4Delta mutant cell, where non-homologous end joining is deficient. Following this approach, we successfully constructed plasmid vectors with leu1+, ade6+, his5+, and lys1+ markers with the low-copy stable plasmid pDblet as a backbone by applying GRC in S. pombe. CONCLUSIONS/SIGNIFICANCE: We concluded that GRC was sufficiently feasible in S. pombe for genome-wide gene functional analysis as well as for regular plasmid construction. Plasmids with different

  19. [Fingerprints identification of Gynostemma pentaphyllum by RAPD and cloning and analysis of its specific DNA fragment].

    Science.gov (United States)

    Jiang, Jun-fu; Li, Xiong-ying; Wu, Yao-sheng; Luo, Yu; Zhao, Rui-qiang; Lan, Xiu-wan

    2009-02-01

    To identify the resources of Gynostemma pentaphyllum and its spurious breed plant Cayratia japonica at level of DNA. Two random primers ( WGS001, WGS004) screened were applied to do random amplification with genomic DNA extracted from Gynostemma pentaphyllum and Cayratia japonica which were collected from different habitats. After amplificated with WGS004, one characteristic fragment about 500 bp which was common to all Gynostemma pentaphyllum samples studied but not to Cayratia japonica was cloned and sequenced. Then these sequences obtained were analyzed for identity and compared by Blastn program in GenBank. There were obvious different bands amplified by above two primers in their fingerprints of genomic DNA. On the basis of these different bands of DNA fingerprints, they could distinguish Gynostemma pentaphyllum and Cayratia japonica obviously. Sequence alignment of seven cloned bands showed that their identities ranged from 45.7% - 94.5%. There was no similar genome sequences searched in GenBank. This indicated that these seven DNA fragments had not been reported before and they should be new sequences. RAPD technique can be used for the accurate identification of Gynostemma pentaphyllum and its counterfeit goods Cayratia japonica. Besides, these specific DNA sequences for Gynostemmna pentaphyllum in this study are useful for the further research on identification of species and assisted selection breeding in Gynostemma pentaphyllum.

  20. Highly Effective Non-Viral Antitumor Gene Therapy System Comprised of Biocompatible Small Plasmid Complex Particles Consisting of pDNA, Anionic Polysaccharide, and Fully Deprotected Linear Polyethylenimine

    Directory of Open Access Journals (Sweden)

    Yoshiyuki Koyama

    2015-07-01

    Full Text Available We have reported that ternary complexes of plasmid DNA with conventional linear polyethylenimine (l-PEI and certain polyanions were very stably dispersed, and, with no cryoprotectant, they could be freeze-dried and re-hydrated without the loss of transfection ability. These properties enabled the preparation of a concentrated suspension of very small pDNA complex, by preparing the complexes at highly diluted conditions, followed by condensation via lyophilization-and-rehydration procedure. Recently, a high potency linear polyethylenimine having no residual protective groups, i.e., Polyethylenimine “Max” (PEI “Max”, is available, which has been reported to induce much higher gene expression than conventional l-PEI. We tried to prepare the small DNA/PEI “Max”/polyanion complexes by a similar freeze-drying method. Small complex particles could be obtained without apparent aggregation, but transfection activity of the rehydrated complexes was severely reduced. Complex-preparation conditions were investigated in details to achieve the freeze-dried DNA/PEI “Max”/polyanion small ternary complexes with high transfection efficiency. DNA/PEI “Max”/polyanion complexes containing cytokine-coding plasmids were then prepared, and their anti-tumor therapeutic efficacy was examined in tumor-bearing mice.

  1. Effect of vanillin on methylene blue plus light-induced single-strand breaks in plasmid pBR322 DNA.

    Science.gov (United States)

    Kumar, S S; Ghosh, A; Devasagayam, T P; Chauhan, P S

    2000-09-20

    The ability of vanillin (4-hydroxy-3-methoxybenzaldehyde), a naturally occurring food flavouring agent, in inhibiting photosensitization-induced single-strand breaks (ssbs) in plasmid pBR322 DNA has been examined in an in vitro system, independent of DNA repair/replication processes. Photosensitization of DNA with methylene blue, visible light and oxygen, induced ssbs resulting in the production of open circular form (OC form) in a concentration-dependent manner. The yield of OC form induced by photosensitization was increased several-fold by deuteration of the buffer and was found to be inhibited by sodium azide, a scavenger of singlet oxygen (1O(2)). Vanillin, per se, did not induce but inhibited photosensitization-induced ssbs in plasmid DNA, at millimolar concentrations. The inhibitory effect of vanillin was both concentration- and time-dependent. On a molar basis, vanillin was, however, less effective than trolox, a water-soluble analogue of alpha-tocopherol. Photosensitization by methylene blue system generates singlet oxygen, as one of the major components of ROS. Therefore, interaction of singlet oxygen with vanillin was investigated. The rate constant of vanillin with 1O(2) was estimated to be 5.93x10(7)M(-1)s(-1) and that of sodium azide as 2. 7x10(8)M(-1)s(-1). The present investigations show that vanillin can protect against photosensitization-induced ssbs in the plasmid pBR322 DNA, and this effect may partly be due to its ability to scavenge 1O(2).

  2. AAVS1-Targeted Plasmid Integration in AAV Producer Cell Lines.

    Science.gov (United States)

    Luo, Yuxia; Frederick, Amy; Martin, John M; Scaria, Abraham; Cheng, Seng H; Armentano, Donna; Wadsworth, Samuel C; Vincent, Karen A

    2017-06-01

    Adeno-associated virus (AAV) producer cell lines are created via transfection of HeLaS3 cells with a single plasmid containing three components (the vector sequence, the AAV rep and cap genes, and a selectable marker gene). As this plasmid contains both the cis (Rep binding sites) and trans (Rep protein encoded by the rep gene) elements required for site-specific integration, it was predicted that plasmid integration might occur within the AAVS1 locus on human chromosome 19 (chr19). The objective of this study was to investigate whether integration in AAVS1 might be correlated with vector yield. Plasmid integration sites within several independent cell lines were assessed via Southern, fluorescence in situ hybridization (FISH) and PCR analyses. In the Southern analyses, the presence of fragments detected by both rep- and AAVS1-specific probes suggested that for several mid- and high-producing lines, plasmid DNA had integrated into the AAVS1 locus. Analysis with puroR and AAVS1-specific probes suggested that integration in AAVS1 was a more widespread phenomenon. High-producing AAV2-secreted alkaline phosphatase (SEAP) lines (masterwell 82 [MW82] and MW278) were evaluated via FISH using probes specific for the plasmid, AAVS1, and a chr19 marker. FISH analysis detected two plasmid integration sites in MW278 (neither in AAVS1), while a total of three sites were identified in MW82 (two in AAVS1). An inverse PCR assay confirmed integration within AAVS1 for several mid- and high-producing lines. In summary, the FISH, Southern, and PCR data provide evidence of site-specific integration of the plasmid within AAVS1 in several AAV producer cell lines. The data also suggest that integration in AAVS1 is a general phenomenon that is not necessarily restricted to high producers. The results also suggest that plasmid integration within the AAVS1 locus is not an absolute requirement for a high vector yield.

  3. A systematic review on sperm DNA fragmentation in male factor infertility: Laboratory assessment

    Directory of Open Access Journals (Sweden)

    Manesh Kumar Panner Selvam

    2018-03-01

    Full Text Available Objective: To review sperm DNA fragmentation (SDF testing as an important sperm function test in addition to conventional semen analysis. High SDF is negatively associated with semen quality, the fertilisation process, embryo quality, and pregnancy outcome. Over recent decades, different SDF assays have been developed and reviewed extensively to assess their applicability and accuracy as advanced sperm function tests. Amongst them, the standardisation of the terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL assay with a bench top flow cytometer in clinical practice deserves special mention with a threshold value of 16.8% to differentiate infertile men with DNA damage from fertile men. Materials and methods: A systematic literature search was performed through the PubMed, Medline, and ScienceDirect databases using the keywords ‘sperm DNA fragmentation’ and ‘laboratory assessment’. Non-English articles were excluded and studies related to humans were only included. Results: Of the 618 identified, 87 studies (original research and reviews and in addition eight book chapters meeting the selection criteria were included in this review. In all, 366 articles were rejected in the preliminary screening and a further 165 articles related to non-human subjects were excluded. Conclusion: There are pros and cons to all the available SDF assays. TUNEL is a reliable technique with greater accuracy and as an additional diagnostic test in Andrology laboratories along with basic semen analysis can predict fertility outcome, and thus direct the choice of an assisted reproductive technology procedure for infertile couples. Also, the TUNEL assay can be used as a prognostic test and results are beneficial in deciding personalised treatment for infertile men. Keywords: Sperm DNA fragmentation (SDF, Terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL, DNA damage, Sperm DNA fragmentation (SDF assay

  4. DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure

    International Nuclear Information System (INIS)

    Focke, Frauke; Schuermann, David; Kuster, Niels; Schaer, Primo

    2010-01-01

    Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.

  5. DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure

    Energy Technology Data Exchange (ETDEWEB)

    Focke, Frauke; Schuermann, David [Institute of Biochemistry and Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel (Switzerland); Kuster, Niels [IT' IS Foundation, Zeughausstrasse 43, CH-8004 Zurich (Switzerland); Schaer, Primo, E-mail: primo.schaer@unibas.ch [Institute of Biochemistry and Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel (Switzerland)

    2010-01-05

    Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.

  6. The effect of dimethyl sulfoxide on the induction of DNA strand breaks in plasmid DNA and colony formation of PC Cl3 mammalian cells by alpha-, beta-, and Auger electron emitters (223)Ra, (188)Re, and (99m)Tc.

    Science.gov (United States)

    Runge, Roswitha; Oehme, Liane; Kotzerke, Jörg; Freudenberg, Robert

    2016-12-01

    DNA damage occurs as a consequence of both direct and indirect effects of ionizing radiation. The severity of DNA damage depends on the physical characteristics of the radiation quality, e.g., the linear energy transfer (LET). There are still contrary findings regarding direct or indirect interactions of high-LET emitters with DNA. Our aim is to determine DNA damage and the effect on cellular survival induced by (223)Ra compared to (188)Re and (99m)Tc modulated by the radical scavenger dimethyl sulfoxide (DMSO). Radioactive solutions of (223)Ra, (188)Re, or (99m)Tc were added to either plasmid DNA or to PC Cl3 cells in the absence or presence of DMSO. Following irradiation, single strand breaks (SSB) and double strand breaks (DSB) in plasmid DNA were analyzed by gel electrophoresis. To determine the radiosensitivity of the rat thyroid cell line (PC Cl3), survival curves were performed using the colony formation assay. Exposure to 120 Gy of (223)Ra, (188)Re, or (99m)Tc leads to maximal yields of SSB (80 %) in plasmid DNA. Irradiation with 540 Gy (223)Ra and 500 Gy (188)Re or (99m)Tc induced 40, 28, and 64 % linear plasmid conformations, respectively. DMSO prevented the SSB and DSB in a similar way for all radionuclides. However, with the α-emitter (223)Ra, a low level of DSB could not be prevented by DMSO. Irradiation of PC Cl3 cells with (223)Ra, (188)Re, and (99m)Tc pre-incubated with DMSO revealed enhanced survival fractions (SF) in comparison to treatment without DMSO. Protection factors (PF) were calculated using the fitted survival curves. These factors are 1.23 ± 0.04, 1.20 ± 0.19, and 1.34 ± 0.05 for (223)Ra, (188)Re, and (99m)Tc, respectively. For (223)Ra, as well as for (188)Re and (99m)Tc, dose-dependent radiation effects were found applicable for plasmid DNA and PC Cl3 cells. The radioprotection by DMSO was in the same range for high- and low-LET emitter. Overall, the results indicate the contribution of mainly indirect radiation

  7. Persistence Mechanisms of Conjugative Plasmids

    DEFF Research Database (Denmark)

    Bahl, Martin Iain; Hansen, Lars H.; Sørensen, Søren Johannes

    2009-01-01

    Are plasmids selfish parasitic DNA molecules or an integrated part of the bacterial genome? This chapter reviews the current understanding of the persistence mechanisms of conjugative plasmids harbored by bacterial cells and populations. The diversity and intricacy of mechanisms affecting the suc...

  8. DNA Barcoding for Identification of "Candidatus Phytoplasmas" Using a Fragment of the Elongation Factor Tu Gene

    DEFF Research Database (Denmark)

    Makarova, Olga; Contaldo, Nicoletta; Paltrinieri, Samanta

    2012-01-01

    Background Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from...... different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf) gene for phytoplasma identification is reported. Methodology....../Principal Findings We designed a new set of primers and amplified a 420–444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX). Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed...

  9. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion.

    Science.gov (United States)

    Santillán, Orlando; Ramírez-Romero, Miguel A; Dávila, Guillermo

    2017-06-25

    Here, we present chimera assembly by plasmid recovery and restriction enzyme site insertion (CAPRRESI). CAPRRESI benefits from many strengths of the original plasmid recovery method and introduces restriction enzyme digestion to ease DNA ligation reactions (required for chimera assembly). For this protocol, users clone wildtype genes into the same plasmid (pUC18 or pUC19). After the in silico selection of amino acid sequence regions where chimeras should be assembled, users obtain all the synonym DNA sequences that encode them. Ad hoc Perl scripts enable users to determine all synonym DNA sequences. After this step, another Perl script searches for restriction enzyme sites on all synonym DNA sequences. This in silico analysis is also performed using the ampicillin resistance gene (ampR) found on pUC18/19 plasmids. Users design oligonucleotides inside synonym regions to disrupt wildtype and ampR genes by PCR. After obtaining and purifying complementary DNA fragments, restriction enzyme digestion is accomplished. Chimera assembly is achieved by ligating appropriate complementary DNA fragments. pUC18/19 vectors are selected for CAPRRESI because they offer technical advantages, such as small size (2,686 base pairs), high copy number, advantageous sequencing reaction features, and commercial availability. The usage of restriction enzymes for chimera assembly eliminates the need for DNA polymerases yielding blunt-ended products. CAPRRESI is a fast and low-cost method for fusing protein-coding genes.

  10. Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins

    Energy Technology Data Exchange (ETDEWEB)

    Tee, Thiam-Tsui, E-mail: thiamtsu@yahoo.com [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Cheah, Yew-Hoong [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Bioassay Unit, Herbal Medicine Research Center, Institute for Medical Research, Jalan Pahang, Kuala Lumpur (Malaysia); Meenakshii, Nallappan [Biology Department, Faculty of Science, Universiti Putra Malaysia, 43400 Serdang, Selangor (Malaysia); Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia)

    2012-04-20

    Highlights: Black-Right-Pointing-Pointer We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. Black-Right-Pointing-Pointer Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. Black-Right-Pointing-Pointer Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. Black-Right-Pointing-Pointer DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. Black-Right-Pointing-Pointer DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X{sub L} expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.

  11. Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins

    International Nuclear Information System (INIS)

    Tee, Thiam-Tsui; Cheah, Yew-Hoong; Meenakshii, Nallappan; Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie

    2012-01-01

    Highlights: ► We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. ► Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. ► Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. ► DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. ► DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X L expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.

  12. Plasmids encoding PKI(1-31), a specific inhibitor of cAMP-stimulated gene expression, inhibit the basal transcriptional activity of some but not all cAMP-regulated DNA response elements in JEG-3 cells.

    Science.gov (United States)

    Grove, J R; Deutsch, P J; Price, D J; Habener, J F; Avruch, J

    1989-11-25

    Plasmids that encode a bioactive amino-terminal fragment of the heat-stable inhibitor of the cAMP-dependent protein kinase, PKI(1-31), were employed to characterize the role of this protein kinase in the control of transcriptional activity mediated by three DNA regulatory elements in the JEG-3 human placental cell line. The 5'-flanking sequence of the human collagenase gene contains the heptameric sequence, 5'-TGAGTCA-3', previously identified as a "phorbol ester" response element. Reporter genes containing either the intact 1.2-kilobase 5'-flanking sequence from the human collagenase gene or just the 7-base pair (bp) response element, when coupled to an enhancerless promoter, each exhibit both cAMP and phorbol ester-stimulated expression in JEG-3 cells. Cotransfection of either construct with plasmids encoding PKI(1-31) inhibits cAMP-stimulated but not basal- or phorbol ester-stimulated expression. Pretreatment of cells with phorbol ester for 1 or 2 days abrogates completely the response to rechallenge with phorbol ester but does not alter the basal expression of either construct; cAMP-stimulated expression, while modestly inhibited, remains vigorous. The 5'-flanking sequence of the human chorionic gonadotropin-alpha subunit (HCG alpha) gene has two copies of the sequence, 5'-TGACGTCA-3', contained in directly adjacent identical 18-bp segments, previously identified as a cAMP-response element. Reporter genes containing either the intact 1.5 kilobase of 5'-flanking sequence from the HCG alpha gene, or just the 36-bp tandem repeat cAMP response element, when coupled to an enhancerless promoter, both exhibit a vigorous cAMP stimulation of expression but no response to phorbol ester in JEG-3 cells. Cotransfection with plasmids encoding PKI(1-31) inhibits both basal and cAMP-stimulated expression in a parallel fashion. The 5'-flanking sequence of the human enkephalin gene mediates cAMP-stimulated expression of reporter genes in both JEG-3 and CV-1 cells. Plasmids

  13. Inhibition of gamma-radiation induced DNA damage in plasmid pBR322 by TMG, a water-soluble derivative of vitamin E.

    Science.gov (United States)

    Rajagopalan, Rema; Wani, Khalida; Huilgol, Nagaraj G; Kagiya, Tsutomu V; Nair, Cherupally K Krishnan

    2002-06-01

    Alpha-tocopherol monoglucoside (TMG), a water-soluble derivative of alpha-tocopherol, has been examined for its ability to protect DNA against radiation-induced strand breaks. Gamma radiation, up to a dose of 6 Gy (dose rate, 0.7 Gy/minute), induced a dose-dependent increase in single strand breaks (SSBs) in plasmid pBR322 DNA. TMG inhibited the formation of gamma-radiation induced DNA single strand breaks (SSBs) in a concentration-dependent manner; 500 microM of TMG protected the single strand breaks completely. It also protected thymine glycol formation induced by gamma-radiation in a dose-dependent manner, based on an estimation of thymine glycol by HPLC.

  14. Inhibition of {gamma}-radiation induced DNA damage in plasmid pBR322 by TMG, a water-soluble derivative of vitamin E

    Energy Technology Data Exchange (ETDEWEB)

    Rajagopalan, R.; Nair, C.K.K. [Bhabha Atomic Research Centre, Mumbai (India); Wani, K.; Huilgol, N.G. [Nanavati Hospital and MRC, Vile Parle (India); Kagiya, Tsutomu V. [Kinki Research Foundation, Kyoto (Japan)

    2002-06-01

    Alpha-tocopherol monoglucoside (TMG), a water-soluble derivative of {alpha}-tocopherol, has been examined for its ability to protect DNA against radiation-induced strand breaks. Gamma radiation, up to a dose of 6 Gy (dose rate, 0.7 Gy/minute), induced a dose-dependent increase in single strand breaks (SSBs) in plasmid pBR322 DNA. TMG inhibited the formation of {gamma}-radiation induced DNA single strand breaks (SSBs) in a concentration-dependent manner; 500 {mu}M of TMG protected the single strand breaks completely. It also protected thymine glycol formation induced by {gamma}-radiation in a dose-dependent manner, based on an estimation of thymine glycol by HPLC. (author)

  15. Inhibition of γ-radiation induced DNA damage in plasmid pBR322 by TMG, a water-soluble derivative of vitamin E

    International Nuclear Information System (INIS)

    Rajagopalan, R.; Nair, C.K.K.; Wani, K.; Huilgol, N.G.; Kagiya, Tsutomu V.

    2002-01-01

    Alpha-tocopherol monoglucoside (TMG), a water-soluble derivative of α-tocopherol, has been examined for its ability to protect DNA against radiation-induced strand breaks. Gamma radiation, up to a dose of 6 Gy (dose rate, 0.7 Gy/minute), induced a dose-dependent increase in single strand breaks (SSBs) in plasmid pBR322 DNA. TMG inhibited the formation of γ-radiation induced DNA single strand breaks (SSBs) in a concentration-dependent manner; 500 μM of TMG protected the single strand breaks completely. It also protected thymine glycol formation induced by γ-radiation in a dose-dependent manner, based on an estimation of thymine glycol by HPLC. (author)

  16. Effect of West Nile virus DNA-plasmid vaccination on response to live virus challenge in red-tailed hawks (Buteo jamaicensis).

    Science.gov (United States)

    Redig, Patrick T; Tully, Thomas N; Ritchie, Branson W; Roy, Alma F; Baudena, M Alexandra; Chang, Gwong-Jen J

    2011-08-01

    To evaluate the safety and efficacy of an experimental adjuvanted DNA-plasmid vaccine against West Nile virus (WNV) in red-tailed hawks (Buteo jamaicensis). 19 permanently disabled but otherwise healthy red-tailed hawks of mixed ages and both sexes without detectable serum antibodies against WNV. Hawks were injected IM with an experimental WNV DNA-plasmid vaccine in an aluminum-phosphate adjuvant (n = 14) or with the adjuvant only (control group; 5). All birds received 2 injections at a 3-week interval. Blood samples for serologic evaluation were collected before the first injection and 4 weeks after the second injection (day 0). At day 0, hawks were injected SC with live WNV. Pre- and postchallenge blood samples were collected at intervals for 14 days for assessment of viremia and antibody determination; oropharyngeal and cloacal swabs were collected for assessment of viral shedding. Vaccination was not associated with morbidity or deaths. Three of the vaccinated birds seroconverted after the second vaccine injection; all other birds seroconverted following the live virus injection. Vaccinated birds had significantly less severe viremia and shorter and less-intense shedding periods, compared with the control birds. Use of the WNV DNA-plasmid vaccine in red-tailed hawks was safe, and vaccination attenuated but did not eliminate both the viremia and the intensity of postchallenge shedding following live virus exposure. Further research is warranted to conclusively determine the efficacy of this vaccine preparation for protection of red-tailed hawks and other avian species against WNV-induced disease.

  17. DNA barcoding for identification of 'Candidatus Phytoplasmas' using a fragment of the elongation factor Tu gene.

    Directory of Open Access Journals (Sweden)

    Olga Makarova

    Full Text Available Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf gene for phytoplasma identification is reported.We designed a new set of primers and amplified a 420-444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX. Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed that the tuf tree is highly congruent with the 16S rRNA tree and had higher inter- and intra- group sequence divergence. Mean K2P inter-/intra- group divergences of the tuf barcode did not overlap and had approximately one order of magnitude difference for most groups, suggesting the presence of a DNA barcoding gap. The use of the tuf barcode allowed separation of main ribosomal groups and most of their subgroups. Phytoplasma tuf barcodes were deposited in the NCBI GenBank and Q-bank databases.This study demonstrates that DNA barcoding principles can be applied for identification of phytoplasmas. Our findings suggest that the tuf barcode performs as well or better than a 1.2 kbp fragment of the 16S rRNA gene and thus provides an easy procedure for phytoplasma identification. The obtained sequences were used to create a publicly available reference database that can be used by plant health services and researchers for online phytoplasma identification.

  18. Environmental toxicants cause sperm DNA fragmentation as detected by the Sperm Chromatin Structure Assay (SCSA[reg])

    International Nuclear Information System (INIS)

    Evenson, Donald P.; Wixon, Regina

    2005-01-01

    Studies over the past two decades have clearly shown that reproductive toxicants cause sperm DNA fragmentation. This DNA fragmentation can usually be detected prior to observing alterations of metaphase chromosomes in embryos. Thus, Sperm Chromatin Structure Assay (SCSA)-detected DNA damage is viewed as the molecular precursor to later gross chromosome damage observed under the light microscope. SCSA measurements of animal or human sperm consist of first obtaining a fresh or flash frozen neat semen sample in LN2 or dry ice. Samples are then sent to a SCSA diagnostic laboratory where the samples are thawed, diluted to ∼1-2 x 106 sperm/ml, treated for 30 s with a pH 1.2 detergent buffer and then stained with acridine orange (AO). The low pH partially denatures DNA at the sites of DNA strand breaks and the AO-ssDNA fluoresces red while the AO-dsDNA fluoresces green. Flow cytometry measurements of 5000 sperm/sample provide statistically robust data on the ratio of red to green sperm, the extent of the DNA fragmentation and the standard deviations of measures. Numerous experiments on rodents treated with reproductive toxicants clearly showed that SCSA measures are highly dose responsive and have a very low CV. Different agents that act on germ cells at various stages of development usually showed sperm DNA fragmentation when that germ cell fraction arrived in the epididymis or ejaculate. Some of these treated samples were capable of successful in vitro fertilization but with frequent embryo failure. A 2-year longitudinal study of men living a valley town with a reported abnormal level of infertility and spontaneous miscarriages and also a seasonal atmospheric smog pollution, showed, for the first time, that SCSA measurements of human sperm DNA fragmentation were detectable and correlated with dosage of air pollution while the classical semen measures were not correlated. Also, young men spraying pesticides without protective gear are at an increased risk for elevated

  19. Development of a novel rDNA based plasmid for enhanced cell surface display on Yarrowia lipolytica

    CSIR Research Space (South Africa)

    Bulani, S

    2012-05-01

    Full Text Available (YlCWP1). mCherry was used as a model protein to assess the efficiency of the constructed plasmid. Y. lipolytica transformants harbouring the expression cassettes showed a purple colour phenotype on selective YNB-casamino plates as compared to control...

  20. Plasmids in Gram negatives: molecular typing of resistance plasmids.

    Science.gov (United States)

    Carattoli, Alessandra

    2011-12-01

    A plasmid is defined as a double stranded, circular DNA molecule capable of autonomous replication. By definition, plasmids do not carry genes essential for the growth of host cells under non-stressed conditions but they have systems which guarantee their autonomous replication also controlling the copy number and ensuring stable inheritance during cell division. Most of the plasmids confer positively selectable phenotypes by the presence of antimicrobial resistance genes. Plasmids evolve as an integral part of the bacterial genome, providing resistance genes that can be easily exchanged among bacteria of different origin and source by conjugation. A multidisciplinary approach is currently applied to study the acquisition and spread of antimicrobial resistance in clinically relevant bacterial pathogens and the established surveillance can be implemented by replicon typing of plasmids. Particular plasmid families are more frequently detected among Enterobacteriaceae and play a major role in the diffusion of specific resistance genes. For instance, IncFII, IncA/C, IncL/M, IncN and IncI1 plasmids carrying extended-spectrum beta-lactamase genes and acquired AmpC genes are currently considered to be "epidemic resistance plasmids", being worldwide detected in Enterobacteriaceae of different origin and sources. The recognition of successful plasmids is an essential first step to design intervention strategies preventing their spread. Copyright © 2011 Elsevier GmbH. All rights reserved.

  1. Multiple Determinations of Sperm DNA Fragmentation Show That Varicocelectomy Is Not Indicated for Infertile Patients with Subclinical Varicocele

    Directory of Open Access Journals (Sweden)

    Agustín García-Peiró

    2014-01-01

    Full Text Available Varicocele is one of the most common causes of low semen quality, which is reflected in high percentages of sperm cells with fragmented DNA. While varicocelectomy is usually performed to ameliorate a patient’s fertility, its impact on sperm DNA integrity in the case of subclinical varicocele is poorly documented. In this study, multiple DNA fragmentation analyses (TUNEL, SCD, and SCSA were performed on semen samples from sixty infertile patients with varicocele (15 clinical varicoceles, 19 clinical varicoceles after surgical treatment, 16 subclinical varicoceles, and 10 subclinical varicoceles after surgical treatment. TUNEL, SCD, and SCSA assays all showed substantial sperm DNA fragmentation levels that were comparable between subclinical and clinical varicocele patients. Importantly, varicocelectomy did improve sperm quality in patients with clinical varicocele; however, this was not the case in patients with subclinical varicocele. In summary, although infertile patients with clinical and subclinical varicocele have similar sperm DNA quality, varicocelectomy should only be advised for patients with clinical varicocele.

  2. Identification of column edges of DNA fragments by using K-means clustering and mean algorithm on lane histograms of DNA agarose gel electrophoresis images

    Science.gov (United States)

    Turan, Muhammed K.; Sehirli, Eftal; Elen, Abdullah; Karas, Ismail R.

    2015-07-01

    Gel electrophoresis (GE) is one of the most used method to separate DNA, RNA, protein molecules according to size, weight and quantity parameters in many areas such as genetics, molecular biology, biochemistry, microbiology. The main way to separate each molecule is to find borders of each molecule fragment. This paper presents a software application that show columns edges of DNA fragments in 3 steps. In the first step the application obtains lane histograms of agarose gel electrophoresis images by doing projection based on x-axis. In the second step, it utilizes k-means clustering algorithm to classify point values of lane histogram such as left side values, right side values and undesired values. In the third step, column edges of DNA fragments is shown by using mean algorithm and mathematical processes to separate DNA fragments from the background in a fully automated way. In addition to this, the application presents locations of DNA fragments and how many DNA fragments exist on images captured by a scientific camera.

  3. Fragmentation of chromatin DNA in mouse thymus cells after whole body γ-irradiation

    International Nuclear Information System (INIS)

    Wei Kang; Liu Xueying; Zhu Xuefen

    1984-01-01

    The characteristics of soluble chromatin in mouse thymus nuclei after whole body γ-irradiation were investigated by means of polyacrylamide gel electrophoresis. After deproteinization and electrophoresis eight regular DNA bands were revealed. The molecular weights of these bands were estimated by comparing their migration rates with those of the standard fragments obtained from PBR 322 digested completely by restrictive endonuclease Hae III. The molecular weight of the first band was calculated to be 186 base pairs corresponding approximately to the size of DNA fragment from a single nucleosome, and those of other bands appeared to be its multiples. The results suggested that the disintegration of chromatin DNA after γ-irradiation might have occurred at the linkage regions of chromatin. The autolysis product of normal thymus chromatin under sterile condition were also analyzed and its electrophoretic pattern was found to be just the same as that of the postirradiation product. It seems, therefore, that the endonuclease existing in normal tissues might be responsible for the postirradiation chromatin degradation. The mechanism of this kind of enzymatic digestion remains to be elucidated in further investigation. (author)

  4. The Effect of Glyphosate on Human Sperm Motility and Sperm DNA Fragmentation

    Directory of Open Access Journals (Sweden)

    George Anifandis

    2018-05-01

    Full Text Available Glyphosate is the active ingredient of Roundup®, which is one of the most popular herbicides worldwide. Although many studies have focused on the reproductive toxicity of glyphosate or glyphosate-based herbicides, the majority of them have concluded that the effect of the specific herbicide is negligible, while only a few studies indicate the male reproductive toxicity of glyphosate alone. The aim of the present study was to investigate the effect of 0.36 mg/L glyphosate on sperm motility and sperm DNA fragmentation (SDF. Thirty healthy men volunteered to undergo semen analysis for the purpose of the study. Sperm motility was calculated according to WHO 2010 guidelines at collection time (zero time and 1 h post-treatment with glyphosate. Sperm DNA fragmentation was evaluated with Halosperm® G2 kit for both the control and glyphosate-treated sperm samples. Sperm progressive motility of glyphosate-treated samples was significantly reduced after 1 h post-treatment in comparison to the respective controls, in contrast to the SDF of glyphosate-treated samples, which was comparable to the respective controls. Conclusively, under these in vitro conditions, at high concentrations that greatly exceed environmental exposures, glyphosate exerts toxic effects on sperm progressive motility but not on sperm DNA integrity, meaning that the toxic effect is limited only to motility, at least in the first hour.

  5. DNA fragmentation and nuclear phenotype in tendons exposed to low-intensity infrared laser

    Science.gov (United States)

    de Paoli, Flavia; Ramos Cerqueira, Larissa; Martins Ramos, Mayara; Campos, Vera M.; Ferreira-Machado, Samara C.; Geller, Mauro; de Souza da Fonseca, Adenilson

    2015-03-01

    Clinical protocols are recommended in device guidelines outlined for treating many diseases on empirical basis. However, effects of low-intensity infrared lasers at fluences used in clinical protocols on DNA are controversial. Excitation of endogenous chromophores in tissues and free radicals generation could be described as a consequence of laser used. DNA lesions induced by free radicals cause changes in DNA structure, chromatin organization, ploidy degrees and cell death. In this work, we investigated whether low-intensity infrared laser therapy could alter the fibroblasts nuclei characteristics and induce DNA fragmentation. Tendons of Wistar rats were exposed to low-intensity infrared laser (830 nm), at different fluences (1, 5 and 10 J/cm2), in continuous wave (power output of 10mW, power density of 79.6 mW/cm2). Different frequencies were analyzed for the higher fluence (10 J/cm2), at pulsed emission mode (2.5, 250 and 2500 Hz), with the laser source at surface of skin. Geometric, densitometric and textural parameters obtained for Feulgen-stained nuclei by image analysis were used to define nuclear phenotypes. Significant differences were observed on the nuclear phenotype of tendons after exposure to laser, as well as, high cell death percentages was observed for all fluences and frequencies analyzed here, exception 1 J/cm2 fluence. Our results indicate that low-intensity infrared laser can alter geometric, densitometric and textural parameters in tendon fibroblasts nuclei. Laser can also induce DNA fragmentation, chromatin lost and consequently cell death, using fluences, frequencies and emission modes took out from clinical protocols.

  6. Analysis of human blood plasma cell-free DNA fragment size distribution using EvaGreen chemistry based droplet digital PCR assays.

    Science.gov (United States)

    Fernando, M Rohan; Jiang, Chao; Krzyzanowski, Gary D; Ryan, Wayne L

    2018-04-12

    Plasma cell-free DNA (cfDNA) fragment size distribution provides important information required for diagnostic assay development. We have developed and optimized droplet digital PCR (ddPCR) assays that quantify short and long DNA fragments. These assays were used to analyze plasma cfDNA fragment size distribution in human blood. Assays were designed to amplify 76,135, 490 and 905 base pair fragments of human β-actin gene. These assays were used for fragment size analysis of plasma cell-free, exosome and apoptotic body DNA obtained from normal and pregnant donors. The relative percentages for 76, 135, 490 and 905 bp fragments from non-pregnant plasma and exosome DNA were 100%, 39%, 18%, 5.6% and 100%, 40%, 18%,3.3%, respectively. The relative percentages for pregnant plasma and exosome DNA were 100%, 34%, 14%, 23%, and 100%, 30%, 12%, 18%, respectively. The relative percentages for non-pregnant plasma pellet (obtained after 2nd centrifugation step) were 100%, 100%, 87% and 83%, respectively. Non-pregnant Plasma cell-free and exosome DNA share a unique fragment distribution pattern which is different from pregnant donor plasma and exosome DNA fragment distribution indicating the effect of physiological status on cfDNA fragment size distribution. Fragment distribution pattern for plasma pellet that includes apoptotic bodies and nuclear DNA was greatly different from plasma cell-free and exosome DNA. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  7. Sequence context effects on 8-methoxypsoralen photobinding to defined DNA fragments

    International Nuclear Information System (INIS)

    Sage, E.; Moustacchi, E.

    1987-01-01

    The photoreaction of 8-methoxypsoralen (8-MOP) with DNA fragments of defined sequence was studied. The authors took advantage of the blockage by bulky adducts of the 3'-5'-exonuclease activity associated with the T4 DNA polymerase. The action of the exonuclease is stopped by biadducts as well as by monoadducts. The termination products were analyzed on sequencing gels. A strong sequence specificity was observed in the DNA photobinding of 8-MOP. The exonuclease terminates its digestion near thymine residues, mainly at potentially cross-linkable sites. There is an increasing reactivity of thymine residues in the order T < TT << TTT in a GC environment. For thymine residues in cross-linkable sites, the reactivity follows the order AT << TA ∼ TAT << ATA < ATAT < ATATAA. Repeated A-T sequences are hot spots for the photochemical reaction of 8-MOP with DNA. Both monoadducts and interstrand cross-links are formed preferentially in 5'-TpA sites. The results highlight the role of the sequence and consequently of the conformation around a potential site in the photobinding of 8-MOP to DNA

  8. Electron microscopic observations and DNA chain fragmentation studies on apoptosis in bone tumor cells induced by 153Sm-EDTMP

    International Nuclear Information System (INIS)

    Zhu Shoupeng; Xiao Dong; Han Xiaofeng

    1997-01-01

    The morphological changes observed by electron microscopy indicate that after internal irradiation with 153 Sm-EDTMP bone tumor cells displayed feature of apoptosis, such as margination of condensed chromatin, chromatin fragmentation, as well as the membrane bounded apoptotic bodies formation. The quantification analysis of fragmentation DNA for bone tumor cells induced by 153 Sm-EDTMP shows that the DNA fragmentation is enhanced with the prolongation of internally irradiated time. These characteristics suggest that 153 Sm-EDTMP internal irradiation could induce bone tumor cells to go to apoptosis

  9. Electron Resonance Decay into a Biological Function: Decrease in Viability of E. coli Transformed by Plasmid DNA Irradiated with 0.5-18 eV Electrons.

    Science.gov (United States)

    Kouass Sahbani, S; Cloutier, P; Bass, A D; Hunting, D J; Sanche, L

    2015-10-01

    Transient negative ions (TNIs) are ubiquitous in electron-molecule scattering at low electron impact energies (0-20 eV) and are particularly effective in damaging large biomolecules. Because ionizing radiation generates mostly 0-20 eV electrons, TNIs are expected to play important roles in cell mutagenesis and death during radiotherapeutic cancer treatment, although this hypothesis has never been directly verified. Here, we measure the efficiency of transforming E. coli bacteria by inserting into the cells, pGEM-3ZfL(-) plasmid DNA that confers resistance to the antibiotic ampicillin. Before transformation, plasmids are irradiated with electrons of specific energies between 0.5 and 18 eV. The loss of transformation efficiency plotted as a function of irradiation energy reveals TNIs at 5.5 and 9.5 eV, corresponding to similar states observed in the yields of DNA double strand breaks. We show that TNIs are detectable in the electron-energy dependence of a biological process and can decrease cell viability.

  10. Quantification of DNA by Agarose Gel Electrophoresis and Analysis of the Topoisomers of Plasmid and M13 DNA Following Treatment with a Restriction Endonuclease or DNA Topoisomerase I

    Science.gov (United States)

    Tweedie, John W.; Stowell, Kathryn M.

    2005-01-01

    A two-session laboratory exercise for advanced undergraduate students in biochemistry and molecular biology is described. The first session introduces students to DNA quantification by ultraviolet absorbance and agarose gel electrophoresis followed by ethidium bromide staining. The second session involves treatment of various topological forms of…

  11. The roles of family B and D DNA polymerases in Thermococcus species 9°N Okazaki fragment maturation.

    Science.gov (United States)

    Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F

    2015-05-15

    During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. The Roles of Family B and D DNA Polymerases in Thermococcus Species 9°N Okazaki Fragment Maturation*

    Science.gov (United States)

    Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F.

    2015-01-01

    During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. PMID:25814667

  13. Mapped DNA probes from Ioblolly pine can be used for restriction fragment length polymorphism mapping in other conifers

    Science.gov (United States)

    M.R. Ahuja; M.E. Devey; A.T. Groover; K.D. Jermstad; D.B Neale

    1994-01-01

    A high-density genetic map based on restriction fragment length polymorphisms (RFLPs) is being constructed for loblolly pine (Pinus taeda L.). Consequently, a large number of DNA probes from loblolly pine are potentially available for use in other species. We have used some of these DNA probes to detect RFLPs in 12 conifers and an angiosperm....

  14. The effect of swim-up and gradient sperm preparation techniques on deoxyribonucleic acid (DNA) fragmentation in subfertile patients.

    Science.gov (United States)

    Oguz, Yuksel; Guler, Ismail; Erdem, Ahmet; Mutlu, Mehmet Firat; Gumuslu, Seyhan; Oktem, Mesut; Bozkurt, Nuray; Erdem, Mehmet

    2018-03-23

    To compare the effect of two different sperm preparation techniques, including swim-up and gradient methods on sperm deoxyribonucleic acid (DNA) fragmentation status of semen samples from unexplained and mild male factor subfertile patients undergoing intrauterine insemination (IUI). A prospective randomized study was conducted in 65 subfertile patients, including 34 unexplained and 31 male factor infertility to compare basal and post-procedure DNA fragmentation rates in swim-up and gradient techniques. Sperm DNA fragmentation rates were evaluated by a sperm chromatin dispersion (SCD) test in two portions of each sample of semen that was prepared with either swim-up or gradient techniques. Sperm motility and morphology were also assessed based on WHO 2010 criteria. Swim-up but not gradient method yielded a statistically significant reduction in the DNA fragmented sperm rate after preparation as compared to basal rates, in the semen samples of both unexplained (41.85 ± 22.04 vs. 28.58 ± 21.93, p gradient) and mild male factor (46.61 ± 19.38 vs. 30.32 ± 18.20, p gradient) subgroups. Swim-up method significantly reduces sperm DNA fragmentation rates and may have some prognostic value on intrauterine insemination in patients with decreased sperm DNA integrity.

  15. Cloning and characterization of BKV(MM) DNA and its use for detection of BKV DNA in human urine

    International Nuclear Information System (INIS)

    Harley, E.H.; Olliver, C.L.; Rhodes-Harrison, L.; Mew, R.T.; Lecatsas, G.; Naude, W. du T.

    1982-01-01

    The two fragments produced by restriction of BKV(MM) DNA with the endonucleases Pst I and Eco RI have been cloned separately into the vector pBR322 and amplified in E. coli HB101. Eight recombinant plasmids were characterized by gel electrophoresis of Pst I/Eco RI double digestions or Hind III digestions of the DNA and by hybridization of Southern gel blots to a nick-translated BKV(MM) DNA probe. Four of the recombinant plasmids contained the large Pst I/Eco RI BKV(MM) DNA fragment and four contained the small fragment. Two of these recombinant plasmids were then used to make a probe for the identification of BK DNA in a urine specimen from a patient known to be exreting particles with the morphological features of papovavirus [af

  16. A LDR-PCR approach for multiplex polymorphisms genotyping of severely degraded DNA with fragment sizes <100 bp.

    Science.gov (United States)

    Zhang, Zhen; Wang, Bao-Jie; Guan, Hong-Yu; Pang, Hao; Xuan, Jin-Feng

    2009-11-01

    Reducing amplicon sizes has become a major strategy for analyzing degraded DNA typical of forensic samples. However, amplicon sizes in current mini-short tandem repeat-polymerase chain reaction (PCR) and mini-sequencing assays are still not suitable for analysis of severely degraded DNA. In this study, we present a multiplex typing method that couples ligase detection reaction with PCR that can be used to identify single nucleotide polymorphisms and small-scale insertion/deletions in a sample of severely fragmented DNA. This method adopts thermostable ligation for allele discrimination and subsequent PCR for signal enhancement. In this study, four polymorphic loci were used to assess the ability of this technique to discriminate alleles in an artificially degraded sample of DNA with fragment sizes <100 bp. Our results showed clear allelic discrimination of single or multiple loci, suggesting that this method might aid in the analysis of extremely degraded samples in which allelic drop out of larger fragments is observed.

  17. Seasonal changes of DNA fragmentation and quality of raw and cold-stored stallion spermatozoa.

    Science.gov (United States)

    Wach-Gygax, L; Burger, D; Malama, E; Bollwein, H; Fleisch, A; Jeannerat, E; Thomas, S; Schuler, G; Janett, F

    2017-09-01

    In this study annual fluctuations of DNA fragmentation and quality of cold-stored equine sperm were evaluated. Ejaculates were collected weekly during one year from 15 stallions. Ejaculate volume, sperm concentration and total sperm count were determined and semen was then extended and cold-stored for 48 h. Sperm motility was evaluated by CASA before and after 24 as well as 48 h of cold storage. In addition, the percentages of sperm with intact plasma membrane and acrosome (PMAI %) and with low intracellular Ca 2+ level were determined in cold-stored semen (24 h, 48 h). SCSA™ was performed to assess mean DFI, SD of DFI and % DFI in raw frozen-thawed as well as in extended sperm after 24 and 48 h of storage. The month of semen collection affected (P sperm concentration lower in summer compared to winter and motility lower in July than in any other month of the year (P sperm with low intracellular Ca +2 level (%) after storage for 24 and 48 h, higher values were measured in winter and in October compared to April, June and July (P sperm. Semen quality was impaired in midsummer when low sperm motility and viability were combined with an elevated DNA fragmentation and Ca 2+ level of sperm. Copyright © 2017. Published by Elsevier Inc.

  18. Safety and immunogenicity of an HIV-1 gag DNA vaccine with or without IL-12 and/or IL-15 plasmid cytokine adjuvant in healthy, HIV-1 uninfected adults.

    Directory of Open Access Journals (Sweden)

    Spyros A Kalams

    Full Text Available DNA vaccines are a promising approach to vaccination since they circumvent the problem of vector-induced immunity. DNA plasmid cytokine adjuvants have been shown to augment immune responses in small animals and in macaques.We performed two first in human HIV vaccine trials in the US, Brazil and Thailand of an RNA-optimized truncated HIV-1 gag gene (p37 DNA derived from strain HXB2 administered either alone or in combination with dose-escalation of IL-12 or IL-15 plasmid cytokine adjuvants. Vaccinations with both the HIV immunogen and cytokine adjuvant were generally well-tolerated and no significant vaccine-related adverse events were identified. A small number of subjects developed asymptomatic low titer antibodies to IL-12 or IL-15. Cellular immunogenicity following 3 and 4 vaccinations was poor, with response rates to gag of 4.9%/8.7% among vaccinees receiving gag DNA alone, 0%/11.5% among those receiving gag DNA+IL-15, and no responders among those receiving DNA+high dose (1500 ug IL-12 DNA. However, after three doses, 44.4% (4/9 of vaccinees receiving gag DNA and intermediate dose (500 ug of IL-12 DNA demonstrated a detectable cellular immune response.This combination of HIV gag DNA with plasmid cytokine adjuvants was well tolerated. There were minimal responses to HIV gag DNA alone, and no apparent augmentation with either IL-12 or IL-15 plasmid cytokine adjuvants. Despite the promise of DNA vaccines, newer formulations or methods of delivery will be required to increase their immunogenicity.Clinicaltrials.gov NCT00115960 NCT00111605.

  19. Enhanced resolution of DNA restriction fragments: A procedure by two-dimensional electrophoresis and double-labeling

    International Nuclear Information System (INIS)

    Yi, M.; Au, L.C.; Ichikawa, N.; Ts'o, P.O.

    1990-01-01

    A probe-free method was developed to detect DNA rearrangement in bacteria based on the electrophoretic separation of twice-digested restriction fragments of genomic DNA into a two-dimensional (2-D) pattern. The first restriction enzyme digestion was done in solution, followed by electrophoresis of the restriction fragments in one dimension. A second restriction enzyme digestion was carried out in situ in the gel, followed by electrophoresis in a second dimension perpendicular to the first electrophoresis. The 2-D pattern provides for the resolution of 300-400 spots, which are defined and indexed by an x,y coordinate system with size markers. This approach has greatly increased the resolution power over conventional one-dimensional (1-D) electrophoresis. To study DNA rearrangement, a 2-D pattern from a test strain was compared with the 2-D pattern from a reference strain. After the first digestion, genomic DNA fragments from the test strain were labeled with 35S, while those from the reference strain were labeled with 32P. This was done to utilize the difference in the energy emission of 35S and 32P isotopes for autoradiography when two x-ray films were exposed simultaneously on top of the gel after the 2-D electrophoresis. The irradiation from the decay of 35S exposed only the lower film, whereas the irradiation from the decay of 32P exposed both the lower and upper films. Different DNA fragments existed in the test DNA compared with the reference DNA can be identified unambiguously by the differential two 2-D patterns produced on two films upon exposure to the 35S and 32P fragments in the same gel. An appropriate photographic procedure further simplified the process, allowing only the difference in DNA fragments between these two patterns to be shown in the map

  20. Behavior of IncQ Plasmids in Agrobacterium tumefaciens

    NARCIS (Netherlands)

    Hille, Jacques; Schilperoort, Rob

    1981-01-01

    Inc-Q plasmids were introduced into Agrobacterium tumefuciens, by mobilization from Escherichia coli with an Inc-P plasmid, or by transformation with purified plasmid DNA. It was found that they were stably maintained. The presence of an Inc-Q plasmid did not influence tumorigenicity. These results

  1. Low-Molecular Weight Polyethylenimine Modified with Pluronic 123 and RGD- or Chimeric RGD-NLS Peptide: Characteristics and Transfection Efficacy of Their Complexes with Plasmid DNA

    Directory of Open Access Journals (Sweden)

    Jing Hu

    2016-05-01

    Full Text Available To solve the problem of transfection efficiency vs. cytotoxicity and tumor-targeting ability when polyethylenimine (PEI was used as a nonviral gene delivery vector, new degradable PEI polymers were synthesized via cross-linking low-molecular-weight PEI with Pluronic P123 and then further coupled with a targeting peptide R4 (RGD and a bifunctional R11 (RGD-NLS, which were termed as P123-PEI-R4 and P123-PEI-R11, respectively. Agarose gel electrophoresis showed that both P123-PEI-R4 and P123-PEI-R11 efficaciously condense plasmid DNA at a polymer-to-pDNA w/w ratio of 3.0 and 0.4, respectively. The polyplexes were stable in the presence of serum and could protect plasmid DNA against DNaseI. They had uniform spherical nanoparticles with appropriate sizes around 100–280 nm and zeta-potentials about +40 mV. Furthermore, in vitro experiments showed that these polyplexes had lower cytotoxicity at any concentration compared with PEI 25 kDa, thus giving promise to high transfection efficiency as compared with another P123-PEI derivate conjugated with trifunctional peptide RGD-TAT-NLS (P123-PEI-R18. More importantly, compared with the other polymers, P123-PEI-R11 showed the highest transfection efficiency with relatively lower cytotoxicity at any concentration, indicating that the new synthetic polymer P123-PEI-R11 could be used as a safe and efficient gene deliver vector.

  2. Hydrodynamic delivery of plasmid DNA encoding human FcγR-Ig dimers blocks immune-complex mediated inflammation in mice.

    Science.gov (United States)

    Shashidharamurthy, R; Machiah, D; Bozeman, E N; Srivatsan, S; Patel, J; Cho, A; Jacob, J; Selvaraj, P

    2012-09-01

    Therapeutic use and function of recombinant molecules can be studied by the expression of foreign genes in mice. In this study, we have expressed human Fcγ receptor-Ig fusion molecules (FcγR-Igs) in mice by administering FcγR-Ig plasmid DNAs hydrodynamically and compared their effectiveness with purified molecules in blocking immune-complex (IC)-mediated inflammation in mice. The concentration of hydrodynamically expressed FcγR-Igs (CD16A(F)-Ig, CD32A(R)-Ig and CD32A(H)-Ig) reached a maximum of 130 μg ml(-1) of blood within 24 h after plasmid DNA administration. The in vivo half-life of FcγR-Igs was found to be 9-16 days and western blot analysis showed that the FcγR-Igs were expressed as a homodimer. The hydrodynamically expressed FcγR-Igs blocked 50-80% of IC-mediated inflammation up to 3 days in a reverse passive Arthus reaction model. Comparative analysis with purified molecules showed that hydrodynamically expressed FcγR-Igs are more efficient than purified molecules in blocking IC-mediated inflammation and had a higher half-life. In summary, these results suggest that the administration of a plasmid vector with the FcγR-Ig gene can be used to study the consequences of blocking IC binding to FcγRs during the development of inflammatory diseases. This approach may have potential therapeutic value in treating IC-mediated inflammatory autoimmune diseases such as lupus, arthritis and autoimmune vasculitis.

  3. Electronic cigarette aerosols and copper nanoparticles induce mitochondrial stress and promote DNA fragmentation in lung fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Lerner, Chad A.; Rutagarama, Pierrot; Ahmad, Tanveer; Sundar, Isaac K.; Elder, Alison; Rahman, Irfan, E-mail: irfan_rahman@urmc.rochester.edu

    2016-09-02

    Oxidants or nanoparticles have recently been identified as constituents of aerosols released from various styles of electronic cigarettes (E-cigs). Cells in the lung may be directly exposed to these constituents and harbor reactive properties capable of incurring acute cell injury. Our results show mitochondria are sensitive to both E-cig aerosols and aerosol containing copper nanoparticles when exposed to human lung fibroblasts (HFL-1) using an Air-Liquid Interface culture system, evident by elevated levels of mitochondrial ROS (mtROS). Increased mtROS after aerosol exposure is associated with reduced stability of OxPhos electron transport chain (ETC) complex IV subunit and nuclear DNA fragmentation. Increased levels of IL-8 and IL-6 in HFL-1 conditioned media were also observed. These findings reveal both mitochondrial, genotoxic, and inflammatory stresses are features of direct cell exposure to E-cig aerosols which are ensued by inflammatory duress, raising a concern on deleterious effect of vaping. - Graphical abstract: Oxidants and possibly reactive properties of metal particles in E-cig aerosols impart mitochondrial oxidative stress and DNA damage. These biological effects accompany inflammatory response which may raise concern regarding long term E-cig use. Mitochondria may be particularly sensitive to reactive properties of E-cig aerosols in addition to the potential for them to induce genotoxic stress by generating increased ROS. - Highlights: • Mitochondria are sensitive to both E-cig aerosols and metal nanoparticles. • Increased mtROS by E-cig aerosol is associated with disrupted mitochondrial energy. • E-cig causes nuclear DNA fragmentation. • E-cig aerosols induce pro-inflammatory response in human fibroblasts.

  4. Electronic cigarette aerosols and copper nanoparticles induce mitochondrial stress and promote DNA fragmentation in lung fibroblasts

    International Nuclear Information System (INIS)

    Lerner, Chad A.; Rutagarama, Pierrot; Ahmad, Tanveer; Sundar, Isaac K.; Elder, Alison; Rahman, Irfan

    2016-01-01

    Oxidants or nanoparticles have recently been identified as constituents of aerosols released from various styles of electronic cigarettes (E-cigs). Cells in the lung may be directly exposed to these constituents and harbor reactive properties capable of incurring acute cell injury. Our results show mitochondria are sensitive to both E-cig aerosols and aerosol containing copper nanoparticles when exposed to human lung fibroblasts (HFL-1) using an Air-Liquid Interface culture system, evident by elevated levels of mitochondrial ROS (mtROS). Increased mtROS after aerosol exposure is associated with reduced stability of OxPhos electron transport chain (ETC) complex IV subunit and nuclear DNA fragmentation. Increased levels of IL-8 and IL-6 in HFL-1 conditioned media were also observed. These findings reveal both mitochondrial, genotoxic, and inflammatory stresses are features of direct cell exposure to E-cig aerosols which are ensued by inflammatory duress, raising a concern on deleterious effect of vaping. - Graphical abstract: Oxidants and possibly reactive properties of metal particles in E-cig aerosols impart mitochondrial oxidative stress and DNA damage. These biological effects accompany inflammatory response which may raise concern regarding long term E-cig use. Mitochondria may be particularly sensitive to reactive properties of E-cig aerosols in addition to the potential for them to induce genotoxic stress by generating increased ROS. - Highlights: • Mitochondria are sensitive to both E-cig aerosols and metal nanoparticles. • Increased mtROS by E-cig aerosol is associated with disrupted mitochondrial energy. • E-cig causes nuclear DNA fragmentation. • E-cig aerosols induce pro-inflammatory response in human fibroblasts.

  5. Hydrodynamic delivery of plasmid DNA encoding human Fc?R-Ig dimers blocks immune-complex mediated inflammation in mice

    OpenAIRE

    Shashidharamurthy, Rangaiah; Machiah, Deepa; Bozeman, Erica N.; Srivatsan, Sanjay; Patel, Jaina; Cho, Alice; Jacob, Joshy; Selvaraj, Periasamy

    2011-01-01

    Therapeutic use and function of recombinant molecules can be studied by the expression of foreign genes in mice. In this study, we have expressed human Fcgamma receptor ?Ig fusion molecules (Fc?R-Igs) in mice by administering Fc?R-Ig plasmid DNAs hydrodynamically and compared their effectiveness to purified molecules in blocking immune-complex (IC) mediated inflammation in mice. The concentration of hydrodynamically expressed Fc?R-Igs (CD16AF-Ig, CD32AR-Ig and CD32AH-Ig) reached a maximum of ...

  6. Translesion DNA synthesis and mutation induced in a plasmid with a single adduct of the environmental contaminant 3-nitrobenzanthrone in SOS-induced Escherichia coli

    International Nuclear Information System (INIS)

    Kawanishi, M.; Kanno, T.; Yagi, T.; Enya-Takamura, T.; Fuchs, R.P.

    2003-01-01

    Full text: 3-Nitrobenzanthrone (NBA) is a powerfully mutagenic nitrated aromatic hydrocarbon found in diesel exhaust and in airborne particulate matters. NBA forms an unusual DNA adduct in vitro that has a C-C bond between the C-8 position of deoxyguanosine and the C-2 position of NBA. We previously found that this adduct is also present in the human cells treated with NBA, and induces mutations in supF shuttle vector system. In this study, we analyzed translesion DNA synthesis (TLS) over a single adduct in lacZ' gene in a plasmid in uvrAmutS Escherichia coli. The result showed that the adduct blocked DNA replication and an observed TLS frequency was 5.4% in non-SOS-induced E. coli. All progenies after the TLS had no mutation. On the other hand, TLS increased to 11.3%, and 4.8% of them had mostly G to T mutations in SOS-induced E. coli. These results suggest that this unusual adduct would be one of causes of lung cancer that is increasing in the urban areas polluted with diesel exhaust. It must be interesting to reveal which DNA polymerase is involved in this TLS

  7. Is there a relationship between the chromatin status and DNA fragmentation of boar spermatozoa following freezing-thawing?

    Science.gov (United States)

    Fraser, L; Strzezek, J

    2007-07-15

    In this study a radioisotope method, which is based on the quantitative measurements of tritiated-labeled actinomycin D ((3)H-AMD) incorporation into the sperm nuclei ((3)H-AMD incorporation assay), was used to assess the chromatin status of frozen-thawed boar spermatozoa. This study also tested the hypothesis that frozen-thawed spermatozoa with altered chromatin were susceptible to DNA fragmentation measured with the neutral comet assay (NCA). Boar semen was diluted in lactose-hen egg yolk-glycerol extender (L-HEY) or lactose ostrich egg yolk lipoprotein fractions-glycerol extender (L-LPFo), packaged into aluminum tubes or plastic straws and frozen in a controlled programmable freezer. In Experiment 1, the chromatin status and DNA fragmentation were measured in fresh and frozen-thawed spermatozoa from the same ejaculates. There was a significant increase in sperm chromatin destabilization and DNA fragmentation in frozen-thawed semen as compared with fresh semen. The proportions of spermatozoa labeled with (3)H-AMD were concurrent with elevated levels of sperm DNA fragmentation in K-3 extender, without cryoprotective substances, compared with L-HEY or L-LPFo extender. Regression analysis revealed that the results of the (3)H-AMD incorporation assay and NCA for frozen-thawed spermatozoa were correlated. Boars differed significantly in terms of post-thaw sperm DNA damage. In Experiment 2, the susceptibility of sperm chromatin to decondensation was assessed using a low concentration of heparin. Treatment of frozen-thawed spermatozoa with heparin revealed enhanced (3)H-AMD binding, suggesting nuclear chromatin decondensation. The deterioration in post-thaw sperm viability, such as motility, mitochondrial function and plasma membrane integrity, was concurrent with increased chromatin instability and DNA fragmentation. This is the first report to show that freezing-thawing procedure facilitated destabilization in the chromatin structure of boar spermatozoa, resulting in

  8. Lipofection and nucleofection of substrate plasmid can generate widely different readings of DNA end-joining efficiency in different cell lines.

    Science.gov (United States)

    Magin, Simon; Saha, Janapriya; Wang, Minli; Mladenova, Veronika; Coym, Nadine; Iliakis, George

    2013-02-01

    In vivo plasmid end-joining assays are valuable tools for dissecting important qualitative and quantitative aspects of non-homologous end-joining (NHEJ)--a key mechanism for the repair of DNA double-strand breaks (DSBs) in higher eukaryotes. They enable the use of defined DNA ends as substrates for end-joining and the analysis by sequencing of the resulting junctions to identify the repair pathways engaged. Yet, plasmid assays have generated divergent results of end-joining capacity in the same DSB repair mutants when used under different conditions, which implies contributions from undefined and therefore uncontrolled parameters. To help standardize these assays, we searched for parameters underpinning these variations and identified transfection method as an important determinant. Here, we compare a lipid-based transfection method, lipofection, with an electroporation method, nucleofection, and find large, unanticipated and cell line-dependent differences in percent end-joining without recognizable trends. For example, in rodent cells, transfection using lipofection gives nearly WT end-joining in DNA-PKcs mutants and only mildly inhibited end-joining in Lig4 and Ku mutants. In contrast, transfection using nucleofection shows marked end-joining inhibition in all NHEJ mutants tested as compared to the WT. In human HCT116 cells, end-joining after nucleofection is strongly suppressed even in the WT and the differences to the mutants are small. After lipofection, in contrast, end-joining is high in WT cells and markedly suppressed in the mutants. We conclude that better understanding and control of the physicochemical/biological and analytical parameters underpinning these differences will be required to generate with plasmid assays results with quantitative power comparable to that of well-established methods of DSB analysis such as pulsed-field gel electrophoresis or γ-H2AX foci scoring. Until then, caution is needed in the interpretation of the results obtained

  9. Analysis of mutation/rearrangement frequencies and methylation patterns at a given DNA locus using restriction fragment length polymorphism.

    Science.gov (United States)

    Boyko, Alex; Kovalchuk, Igor

    2010-01-01

    Restriction fragment length polymorphism (RFLP) is a difference in DNA sequences of organisms belonging to the same species. RFLPs are typically detected as DNA fragments of different lengths after digestion with various restriction endonucleases. The comparison of RFLPs allows investigators to analyze the frequency of occurrence of mutations, such as point mutations, deletions, insertions, and gross chromosomal rearrangements, in the progeny of stressed plants. The assay involves restriction enzyme digestion of DNA followed by hybridization of digested DNA using a radioactively or enzymatically labeled probe. Since DNA can be digested with methylation sensitive enzymes, the assay can also be used to analyze a methylation pattern of a particular locus. Here, we describe RFLP analysis using methylation-insensitive and methylation-sensitive enzymes.

  10. DNA fingerprinting of Mycobacterium leprae strains using variable number tandem repeat (VNTR) - fragment length analysis (FLA).

    Science.gov (United States)

    Jensen, Ronald W; Rivest, Jason; Li, Wei; Vissa, Varalakshmi

    2011-07-15

    presence of the desired DNA segments, and then submitted for fluorescent fragment length analysis (FLA) using capillary electrophoresis. DNA from armadillo passaged bacteria with a known number of repeat copies for each locus is used as a positive control. The FLA chromatograms are then examined using Peak Scanner software and fragment length is converted to number of VNTR copies (allele). Finally, the VNTR haplotypes are analyzed for patterns, and when combined with patient clinical data can be used to track distribution of strain types.

  11. Implication of the E. coli K12 uvrA and recA genes in the repair of 8-methoxypsoralen-induced mono adducts and crosslinks on plasmid DNA

    International Nuclear Information System (INIS)

    Paramio, J.M.; Bauluz, C.; Vidania, R. de

    1986-01-01

    Genotoxicity of psoralen damages on plasmid DNA has been studied. pBR322 DNA was randomly modified with several concentrations of 8-methoxypsoralen plus 365 nm-UV light. After transformation into E. coli strains (wild-type, uvrA and recA) plasmid survival and mutagenesis were analyzed. To study the influence of the SOS response on plasmid recovery, preirradiation of the cells was performed. In absence of cell preirradiation, crosslinks were not repaired in any strain. Mono adducts were also lethal but in part removed by the excision-repair pathway. Preirradiation of the cells significantly. increased plasmid recovery in recA+ celia. In uvrA- only the mutagenic pathway seemed to be involved in the repair of the damaged DNA. Wild type strain showed the highest increase in plasmid survival, involving the repair of mono adducts and some fraction of crosslinks mainly through an error-free repair pathway. This suggests an enhancement of the excision repair promoted by the induction of SOS functions. (Author) 32 refs

  12. TbPIF5 is a Trypanosoma brucei mitochondrial DNA helicase involved in processing of minicircle Okazaki fragments.

    Directory of Open Access Journals (Sweden)

    Beiyu Liu

    2009-09-01

    Full Text Available Trypanosoma brucei's mitochondrial genome, kinetoplast DNA (kDNA, is a giant network of catenated DNA rings. The network consists of a few thousand 1 kb minicircles and several dozen 23 kb maxicircles. Here we report that TbPIF5, one of T. brucei's six mitochondrial proteins related to Saccharomyces cerevisiae mitochondrial DNA helicase ScPIF1, is involved in minicircle lagging strand synthesis. Like its yeast homolog, TbPIF5 is a 5' to 3' DNA helicase. Together with other enzymes thought to be involved in Okazaki fragment processing, TbPIF5 localizes in vivo to the antipodal sites flanking the kDNA. Minicircles in wild type cells replicate unidirectionally as theta-structures and are unusual in that Okazaki fragments are not joined until after the progeny minicircles have segregated. We now report that overexpression of TbPIF5 causes premature removal of RNA primers and joining of Okazaki fragments on theta structures. Further elongation of the lagging strand is blocked, but the leading strand is completed and the minicircle progeny, one with a truncated H strand (ranging from 0.1 to 1 kb, are segregated. The minicircles with a truncated H strand electrophorese on an agarose gel as a smear. This replication defect is associated with kinetoplast shrinkage and eventual slowing of cell growth. We propose that TbPIF5 unwinds RNA primers after lagging strand synthesis, thus facilitating processing of Okazaki fragments.

  13. Flexible bent rod model with a saturating induced dipole moment to study the electric linear dichroism of DNA fragments

    Science.gov (United States)

    Bertolotto, Jorge A.; Umazano, Juan P.

    2016-06-01

    In the present work we make a theoretical study of the steady state electric linear dichroism of DNA fragments in aqueous solution. The here developed theoretical approach considers a flexible bent rod model with a saturating induced dipole moment. The electric polarizability tensor of bent DNA fragments is calculated considering a phenomenological model which theoretical and experimental backgroung is presented here. The model has into account the electric polarizability longitudinal and transversal to the macroion. Molecular flexibility is described using an elastic potential. We consider DNA fragments originally bent with bending fluctuations around an average bending angle. The induced dipole moment is supposed constant once the electric field strength grows up at critical value. To calculate the reduced electric linear dichroism we determine the optical factor considering the basis of the bent DNA perpendicular to the molecular axis. The orientational distribution function has into account the anisotropic electric properties and the molecule flexibility. We applied the present theoretical background to fit electric dichroism experimental data of DNA fragments reported in the bibliography in a wide range of molecular weight and electric field. From these fits, values of DNA physical properties are estimated. We compare and discuss the results here obtained with the theoretical and experimental data presented by other authors. The original contributions of this work are: the inclusion of the transversal electric polarizability saturating with the electric field, the description of the electric properties with an electric polarizability tensor dependant on the bending angle and the use of an arc model originally bent.

  14. Characterization of DNA polymerase β from Danio rerio by overexpression in E. coli using the in vivo/in vitro compatible pIVEX plasmid

    Directory of Open Access Journals (Sweden)

    Ishikawa Mitsuru

    2011-10-01

    Full Text Available Abstract Background Eukaryotic DNA polymerase β (pol β, the polymerase thought to be responsible for DNA repair synthesis, has been extensively characterized in rats and humans. However, pol β has not been purified or enzymatically characterized from the model fish species Danio rerio (zebrafish. We used the in vitro/in vivo dual expression system plasmid, pIVEX, to express Danio rerio pol β (Danio pol β for biochemical characterization. Results Danio pol β encoded by the in vitro/in vivo-compatible pIVEX plasmid was expressed in E. coli BL21(DE3, BL21(DE3pLysS, and KRX, and in vitro as a C-terminal His-tagged protein. Danio pol β expressed in vitro was subject to proteolysis; therefore, bacterial overexpression was used to produce the protein for kinetic analyses. KRX cells were preferred because of their reduced propensity for leaky expression of pol β. The cDNA of Danio rerio pol β encodes a protein of 337 amino acids, which is 2-3 amino acids longer than other pol β proteins, and contains a P63D amino acid substitution, unlike mammalian pol βs. This substitution lies in a hairpin sequence within an 8-kDa domain, likely to be important in DNA binding. We performed extensive biochemical characterization of Danio pol β in comparison with rat pol β, which revealed its sensitivity to metal ion activators (Mn2+ and Mg2+, its optimum salt concentration (10 mM KCl and 50 mM NaCl, alkaline pH optimum (pH 9.0, and low temperature optimum (30°C. Substituting Mn2+ for Mg2+ resulted in 8.6-fold higher catalytic efficiency (kcat/Km. Conclusions Our characterization of pol β from a model fish organism contributes to the study of the function and evolution of DNA polymerases, which are emerging as important cellular targets for chemical intervention in the development of anticancer agents.

  15. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  16. Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

    International Nuclear Information System (INIS)

    Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.

    1986-01-01

    The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

  17. Dietary supplementation with docosahexaenoic acid (DHA) improves seminal antioxidant status and decreases sperm DNA fragmentation.

    Science.gov (United States)

    Martínez-Soto, Juan Carlos; Domingo, Joan Carles; Cordobilla, Begoña; Nicolás, María; Fernández, Laura; Albero, Pilar; Gadea, Joaquín; Landeras, José

    2016-12-01

    The purpose of this study was to evaluate the effect of docosahexaenoic acid (DHA) dietary supplementation on semen quality, fatty acid composition, antioxidant capacity, and DNA fragmentation. In this randomized, double blind, placebo-controlled, parallel-group study, 74 subjects were recruited and randomly assigned to either the placebo group (n=32) or to the DHA group (n=42) to consume three 500-mg capsules of oil per day over 10 weeks. The placebo group received 1,500 mg/day of sunflower oil and the DHA group 1,500 mg/day of DHA-enriched oil. Seminal parameters (semen volume, sperm concentration, motility, morphology, and vitality), total antioxidant capacity, deoxyribonucleic acid fragmentation, and lipid composition were evaluated prior to the treatment and after 10 weeks. Finally, 57 subjects were included in the study with 25 in the placebo group and 32 in the DHA group. No differences were found in traditional sperm parameters or lipid composition of the sperm membrane after treatment. However, an increase in DHA and Omega-3 fatty acid content in seminal plasma, an improvement in antioxidant status, and a reduction in the percentage of spermatozoa with deoxyribonucleic acid damage were observed in the DHA group after 10 weeks of treatment.

  18. A DNA metabarcoding study of a primate dietary diversity and plasticity across its entire fragmented range.

    Directory of Open Access Journals (Sweden)

    Erwan Quéméré

    Full Text Available In tropical regions, most primary ecosystems have been replaced by mosaic landscapes in which species must cope with a large shift in the distribution of their habitat and associated food resources. Primates are particularly vulnerable to habitat modifications. Most species persist in small fragments surrounded by complex human-mediated matrices whose structure and connectivity may strongly influence their dispersal and feeding behavior. Behavioral plasticity appears to be a crucial parameter governing the ability of organisms to exploit the resources offered by new matrix habitats and thus to persist in fragmented habitats. In this study, we were interested in the dietary plasticity of the golden-crowned sifaka (Propithecus tattersalli, an endangered species of lemur, found only in the Daraina region in north-eastern Madagascar. We used a DNA-based approach combining the barcoding concept and Illumina next-generation sequencing to (i describe the species diet across its entire range and (ii evaluate the influence of landscape heterogeneity on diet diversity and composition. Faeces from 96 individuals were sampled across the entire species range and their contents were analyzed using the trnL metabarcoding approach. In parallel, we built a large DNA reference database based on a checklist of the plant species of the Daraina region. Our results suggest that golden-crowned sifakas exhibit remarkable dietary diversity with at least 130 plant species belonging to 80 genera and 49 different families. We highlighted an influence of both habitat type and openness on diet composition suggesting a high flexibility of foraging strategies. Moreover, we observed the presence of numerous cultivated and naturalized plants in the faeces of groups living in forest edge areas. Overall, our findings support our initial expectation that P. tattersalli is able to cope with the current level of alteration of the landscape and confirm our previous results on the

  19. Involvement of DNA polymerase beta in repair of ionizing radiation damage as measured by in vitro plasmid assays.

    NARCIS (Netherlands)

    Vens, C.; Hofland, I.; Begg, A.C.

    2007-01-01

    Characteristic of damage introduced in DNA by ionizing radiation is the induction of a wide range of lesions. Single-strand breaks (SSBs) and base damages outnumber double-strand breaks (DSBs). If unrepaired, these lesions can lead to DSBs and increased mutagenesis. XRCC1 and DNA polymerase beta

  20. Comparison of two DNA microarrays for detection of plasmid-mediated antimicrobial resistance and virulence factor genes in clinical isolates of Enterobacteriaceae and non-Enterobacteriaceae.

    LENUS (Irish Health Repository)

    Walsh, Fiona

    2010-06-01

    A DNA microarray was developed to detect plasmid-mediated antimicrobial resistance (AR) and virulence factor (VF) genes in clinical isolates of Enterobacteriaceae and non-Enterobacteriaceae. The array was validated with the following bacterial species: Escherichiacoli (n=17); Klebsiellapneumoniae (n=3); Enterobacter spp. (n=6); Acinetobacter genospecies 3 (n=1); Acinetobacterbaumannii (n=1); Pseudomonasaeruginosa (n=2); and Stenotrophomonasmaltophilia (n=2). The AR gene profiles of these isolates were identified by polymerase chain reaction (PCR). The DNA microarray consisted of 155 and 133 AR and VF gene probes, respectively. Results were compared with the commercially available Identibac AMR-ve Array Tube. Hybridisation results indicated that there was excellent correlation between PCR and array results for AR and VF genes. Genes conferring resistance to each antibiotic class were identified by the DNA array. Unusual resistance genes were also identified, such as bla(SHV-5) in a bla(OXA-23)-positive carbapenem-resistant A. baumannii. The phylogenetic group of each E. coli isolate was verified by the array. These data demonstrate that it is possible to screen simultaneously for all important classes of mobile AR and VF genes in Enterobacteriaceae and non-Enterobacteriaceae whilst also assigning a correct phylogenetic group to E. coli isolates. Therefore, it is feasible to test clinical Gram-negative bacteria for all known AR genes and to provide important information regarding pathogenicity simultaneously.

  1. Effect of cytokine-encoding plasmid delivery on immune response to Japanese encephalitis virus DNA vaccine in mice.

    Science.gov (United States)

    Bharati, Kaushik; Appaiahgari, Mohan Babu; Vrati, Sudhanshu

    2005-01-01

    We have previously shown that immunization of mice with plasmid pMEa synthesizing Japanese encephalitis virus (JEV) envelope protein induced anti-JEV humoral and cellular immune responses. We now show that intra-muscular co-administration of mice with pMEa and pGM-CSF, encoding murine granulocyte-macrophage colony-stimulating factor or pIL-2, encoding murine interleukin-2 given 4 days after pMEa, augmented anti-JEV antibody titers. This did not enhance the level of protection in immunized mice against JEV. However, intra-dermal co-administration of pMEa and pGM-CSF in mice using the gene gun, enhanced anti-JEV antibody titers resulting in an increased level of protection in mice against lethal JEV challenge.

  2. [Real-time quantification to analyze historical Colombian samples detecting a short fragment of hypervariable region II of mitochondrial DNA].

    Science.gov (United States)

    Pérez, Luz Adriana; Rodríguez, Freddy; Langebaek, Carl Henrik; Groot, Helena

    2016-09-01

    Unlike other molecular biology studies, the analysis of ancient DNA (aDNA) requires special infrastructure and methodological conditions to guarantee the quality of the results. One of the main authenticity criteria is DNA quantification, where quantitative real-time PCR is often used given its sensitivity and specificity. Nevertheless, the implementation of these conditions and methodologies to fulfill authenticity criteria imply higher costs. Objective: To develop a simple and less costly method for mitochondrial DNA quantification suitable for highly degraded samples. Materials and methods: The proposed method is based on the use of mini-primers for the specific amplification of short fragments of mitochondrial DNA. The subsequent purification of these amplified fragments allows a standard curve to be constructed with concentrations in accordance to the state of degradation of the samples. Results: The proposed method successfully detected DNA from ancient samples including bone remains and mummified tissue. DNA inhibitory substances were also detected. Conclusion: The proposed method represents a simpler and cost-effective way to detect low amounts of aDNA, and a tool to differentiate DNA-free samples from samples with inhibitory substances.

  3. High-frequency transformation of a methylotrophic yeast, Candida boidinii, with autonomously replicating plasmids which are also functional in Saccharomyces cerevisiae.

    OpenAIRE

    Sakai, Y; Goh, T K; Tani, Y

    1993-01-01

    We have developed a transformation system which uses autonomous replicating plasmids for a methylotrophic yeast, Candida boidinii. Two autonomous replication sequences, CARS1 and CARS2, were newly cloned from the genome of C. boidinii. Plasmids having both a CARS fragment and the C. boidinii URA3 gene transformed C. boidinii ura3 cells to Ura+ phenotype at frequencies of up to 10(4) CFU/micrograms of DNA. From Southern blot analysis, CARS plasmids seemed to exist in polymeric forms as well as...

  4. A simple strategy for subcloning and amplifying random multimegabase subchromosomal acentric DNA fragments as double minute chromosomes

    International Nuclear Information System (INIS)

    Hahn, P.J.; Giddings, L.; Lane, M.J.

    1989-01-01

    Restriction mapping of relatively large genomes (e.g. human) utilizing randomly generated DNA segments requires high mapping redundancy to successfully organize 'contigs' to represent the entire genome. The number of independent DNA segment maps required is dependent on the average size of a mapping segment; the larger the segment, the fewer required. The authors have developed a strategy for subcloning intact multimegabase subchromosomal fragments as double minute chromosomes. Such fragments could serve as primary mapping elements or as adjunct (linking) fragments to rapidly connect already existent contigs generated using yeast artificial chromosomes or cosmids. They present several lines of evidence supporting the viability of this approach. (1) X-ray treated EMT-6 mouse cells (7.5 Gr.) which are selected over several months with increasing levels of methotrexate (MTX) contain highly amplified circular DNA molecules (double minutes) which include the dihydrofolate reductase (DHFR) gene in a size range between 1,000 and 3,500 kilobases as determined by pulsed-field gel electrophoresis and these acentric chromosomal fragments have been stably maintained in culture for at least a year. (2) Preliminary data based on experiments involving fusion of X-irradiated Chinese Hamster Ovary (CH0 DG44) cells containing randomly inserted cotransfected Neomycin resistance and DHFR genes to mouse EMT-6 cells shows that the linked genes can be readily cotransferred as acentric subchromosomal fragment(s) suitable for gene amplification. (3) The studies of CHO cells with cell fusion transferred X-ray induced chromosomal fragments containing the natural CHO DHFR gene suggest that transferred chromosome fragments undergo gene amplification much more readily than nonfragmented endogenous DHFR genes

  5. Restriction site extension PCR: a novel method for high-throughput characterization of tagged DNA fragments and genome walking.

    Directory of Open Access Journals (Sweden)

    Jiabing Ji

    Full Text Available BACKGROUND: Insertion mutant isolation and characterization are extremely valuable for linking genes to physiological function. Once an insertion mutant phenotype is identified, the challenge is to isolate the responsible gene. Multiple strategies have been employed to isolate unknown genomic DNA that flanks mutagenic insertions, however, all these methods suffer from limitations due to inefficient ligation steps, inclusion of restriction sites within the target DNA, and non-specific product generation. These limitations become close to insurmountable when the goal is to identify insertion sites in a high throughput manner. METHODOLOGY/PRINCIPAL FINDINGS: We designed a novel strategy called Restriction Site Extension PCR (RSE-PCR to efficiently conduct large-scale isolation of unknown genomic DNA fragments linked to DNA insertions. The strategy is a modified adaptor-mediated PCR without ligation. An adapter, with complementarity to the 3' overhang of the endonuclease (KpnI, NsiI, PstI, or SacI restricted DNA fragments, extends the 3' end of the DNA fragments in the first cycle of the primary RSE-PCR. During subsequent PCR cycles and a second semi-nested PCR (secondary RSE-PCR, touchdown and two-step PCR are combined to increase the amplification specificity of target fragments. The efficiency and specificity was demonstrated in our characterization of 37 tex mutants of Arabidopsis. All the steps of RSE-PCR can be executed in a 96 well PCR plate. Finally, RSE-PCR serves as a successful alternative to Genome Walker as demonstrated by gene isolation from maize, a plant with a more complex genome than Arabidopsis. CONCLUSIONS/SIGNIFICANCE: RSE-PCR has high potential application in identifying tagged (T-DNA or transposon sequence or walking from known DNA toward unknown regions in large-genome plants, with likely application in other organisms as well.

  6. The metabolic enhancer piracetam attenuates mitochondrion-specific endonuclease G translocation and oxidative DNA fragmentation.

    Science.gov (United States)

    Gupta, Sonam; Verma, Dinesh Kumar; Biswas, Joyshree; Rama Raju, K Siva; Joshi, Neeraj; Wahajuddin; Singh, Sarika

    2014-08-01

    This study was performed to investigate the involvement of mitochondrion-specific endonuclease G in piracetam (P)-induced protective mechanisms. Studies have shown the antiapoptotic effects of piracetam but the mechanism of action of piracetam is still an enigma. To assess the involvement of endonuclease G in piracetam-induced protective effects, astrocyte glial cells were treated with lipopolysaccharide (LPS) and piracetam. LPS treatment caused significantly decreased viability, mitochondrial activity, oxidative stress, chromatin condensation, and DNA fragmentation, which were attenuated by piracetam cotreatment. Cotreatment of astrocytes with piracetam showed its significantly time-dependent absorption as observed with high-performance liquid chromatography. Astrocytes treated with piracetam alone showed enhanced mitochondrial membrane potential (MMP) in comparison to control astrocytes. However, in LPS-treated cells no significant alteration in MMP was observed in comparison to control cells. Protein and mRNA levels of the terminal executor of the caspase-mediated pathway, caspase-3, were not altered significantly in LPS or LPS + piracetam-treated astrocytes, whereas endonuclease G was significantly translocated to the nucleus in LPS-treated astrocytes. Piracetam cotreatment attenuated the LPS-induced endonuclease G translocation. In conclusion this study indicates that LPS treatment of astrocytes caused decreased viability, oxidative stress, mitochondrial dysfunction, chromatin condensation, DNA damage, and translocation of endonuclease G to the nucleus, which was inhibited by piracetam cotreatment, confirming that the mitochondrion-specific endonuclease G is one of the factors involved in piracetam-induced protective mechanisms. Copyright © 2014 Elsevier Inc. All rights reserved.

  7. Analysis of DNA restriction fragments greater than 5.7 Mb in size from the centromeric region of human chromosomes.

    Science.gov (United States)

    Arn, P H; Li, X; Smith, C; Hsu, M; Schwartz, D C; Jabs, E W

    1991-01-01

    Pulsed electrophoresis was used to study the organization of the human centromeric region. Genomic DNA was digested with rare-cutting enzymes. DNA fragments from 0.2 to greater than 5.7 Mb were separated by electrophoresis and hybridized with alphoid and simple DNA repeats. Rare-cutting enzymes (Mlu I, Nar I, Not I, Nru I, Sal I, Sfi I, Sst II) demonstrated fewer restriction sites at centromeric regions than elsewhere in the genome. The enzyme Not I had the fewest restriction sites at centromeric regions. As much as 70% of these sequences from the centromeric region are present in Not I DNA fragments greater than 5.7 and estimated to be as large as 10 Mb in size. Other repetitive sequences such as short interspersed repeated segments (SINEs), long interspersed repeated segments (LINEs), ribosomal DNA, and mini-satellite DNA that are not enriched at the centromeric region, are not enriched in Not I fragments of greater than 5.7 Mb in size.

  8. Parameters influencing the introduction of plasmid DNA into cells by the use of synthetic amphiphiles as a carrier system

    OpenAIRE

    van der Woude, Irene; Willy Visser, H.; ter Beest, Martin B.A.; Wagenaar, Anno; Ruiters, Marcel H.J.; Engberts, Jan B.F.N.; Hoekstra, Dick

    1995-01-01

    Parameters that affect cellular transfection as accomplished by introducing DNA via carriers composed of cationic synthetic amphiphiles, have been investigated with the aim to obtain insight into the mechanism of DNA translocation. Such insight may be exploited in optimizing carrier properties of synthetic amphiphiles for molecules other than nucleic acids. In the present work, the interaction of vesicles composed of the cationic amphiphile dioleyloxy-propyl-trimethylammonium chloride (DOTMA)...

  9. Impact of the Z potential technique on reducing the sperm DNA fragmentation index, fertilization rate and embryo development.

    Science.gov (United States)

    Duarte, Carlos; Núñez, Víctor; Wong, Yat; Vivar, Carlos; Benites, Elder; Rodriguez, Urso; Vergara, Carlos; Ponce, Jorge

    2017-12-01

    In assisted reproduction procedures, we need to develop and enhance new protocols to optimize sperm selection. The aim of this study is to evaluate the ability of the Z potential technique to select sperm with intact DNA in non-normospermic patients and evaluate the impact of this selection on embryonic development. We analyzed a total of 174 human seminal samples with at least one altered parameter. We measured basal, post density gradients, and post density gradients + Z potential DNA fragmentation index. To evaluate the impact of this technique on embryo development, 54 cases were selected. The embryo development parameters evaluated were fertilization rate, cleavage rate, top quality embryos at the third day and blastocysts rate. We found significant differences in the study groups when we compared the sperm fragmentation index by adding the Z potential technique to density gradient selection vs. density gradients alone. Furthermore, there was no significant difference in the embryo development parameters between the low sperm fragmentation index group vs. the moderate and high sperm fragmentation index groups, when selecting sperms with this new technique. The Z potential technique is a very useful tool for sperm selection; it significantly reduces the DNA fragmentation index and improves the parameters of embryo development. This technique could be considered routine for its simplicity and low cost.

  10. Transfer of the lambdadv plasmid to new bacterial hosts

    International Nuclear Information System (INIS)

    Kellenberger-Gujer, G.; Boy de la Tour, E.; Berg, D.E.

    1974-01-01

    Lambda dv, which was derived from bacteriophage lambda, replicates autonomously as a plasmid in Escherichia coli and consists of only the immunity region (imm/sup lambda/) and DNA replication genes (O, P) of the ancestral phage. Addition phages (lambda imm 21 --lambda dv) carry the lambda dv fragment inserted as a tandem duplication in their genome (sequence A imm 21 O P imm/sup lambda/ O P R) are formed as recombinants after lambda imm 21 infection of strains carrying lambda dv. Addition phages were used to transfer lambda dv to new bacterial hosts. Lambda dv transfer by excision of the lambda dv segment from the addition phage genome requires a bacterial Rec or a phage Red recombination system. Successful transfer is stimulated by uv irradiation of the addition phage before infection. Some properties of the newly transferred lambda dv plasmids are described. (U.S.)

  11. Menadione-Induced DNA Damage Leads to Mitochondrial Dysfunction and Fragmentation During Rosette Formation in Fuchs Endothelial Corneal Dystrophy.

    Science.gov (United States)

    Halilovic, Adna; Schmedt, Thore; Benischke, Anne-Sophie; Hamill, Cecily; Chen, Yuming; Santos, Janine Hertzog; Jurkunas, Ula V

    2016-06-20

    Fuchs endothelial corneal dystrophy (FECD), a leading cause of age-related corneal edema requiring transplantation, is characterized by rosette formation of corneal endothelium with ensuing apoptosis. We sought to determine whether excess of mitochondrial reactive oxygen species leads to chronic accumulation of oxidative DNA damage and mitochondrial dysfunction, instigating cell death. We modeled the pathognomonic rosette formation of postmitotic corneal cells by increasing endogenous cellular oxidative stress with menadione (MN) and performed a temporal analysis of its effect in normal (HCEnC, HCECi) and FECD (FECDi) cells and ex vivo specimens. FECDi and FECD ex vivo specimens exhibited extensive mtDNA and nDNA damage as detected by quantitative PCR. Exposure to MN triggered an increase in mitochondrial superoxide levels and led to mtDNA and nDNA damage, while DNA amplification was restored with NAC pretreatment. Furthermore, MN exposure led to a decrease in ΔΨm and adenosine triphosphate levels in normal cells, while FECDi exhibited mitochondrial dysfunction at baseline. Mitochondrial fragmentation and cytochrome c release were detected in FECD tissue and after MN treatment of HCEnCs. Furthermore, cleavage of caspase-9 and caspase-3 followed MN-induced cytochrome c release in HCEnCs. This study provides the first line of evidence that accumulation of oxidative DNA damage leads to rosette formation, loss of functionally intact mitochondria via fragmentation, and subsequent cell death during postmitotic cell degeneration of ocular tissue. MN induced rosette formation, along with mtDNA and nDNA damage, mitochondrial dysfunction, and fragmentation, leading to activation of the intrinsic apoptosis via caspase cleavage and cytochrome c release. Antioxid. Redox Signal. 24, 1072-1083.

  12. A domain of the Klenow fragment of Escherichia coli DNA polymerase I has polymerase but no exonuclease activity.

    Science.gov (United States)

    Freemont, P S; Ollis, D L; Steitz, T A; Joyce, C M

    1986-09-01

    The Klenow fragment of DNA polymerase I from Escherichia coli has two enzymatic activities: DNA polymerase and 3'-5' exonuclease. The crystal structure showed that the fragment is folded into two distinct domains. The smaller domain has a binding site for deoxynucleoside monophosphate and a divalent metal ion that is thought to identify the 3'-5' exonuclease active site. The larger C-terminal domain contains a deep cleft that is believed to bind duplex DNA. Several lines of evidence suggested that the large domain also contains the polymerase active site. To test this hypothesis, we have cloned the DNA coding for the large domain into an expression system and purified the protein product. We find that the C-terminal domain has polymerase activity (albeit at a lower specific activity than the native Klenow fragment) but no measurable 3'-5' exonuclease activity. These data are consistent with the hypothesis that each of the three enzymatic activities of DNA polymerase I from E. coli resides on a separate protein structural domain.

  13. Association and Expression of Virulence from Plasmids of the Group B Strain in Pseudomonas syringae pv. eriobotryae

    Directory of Open Access Journals (Sweden)

    Tran Dang Khanh

    2018-04-01

    Full Text Available Pseudomonas syringae pv. eriobotryae causes serious stem canker in loquat (Eriobotrya japonica trees. This study was conducted to determine whether plasmids are involved with its virulence. The strain NAE89, which belonged to the B group, harbored two plasmids at approximately 6.2 and 50 Mdal that caused stem canker and halo leaf spots on loquat plants. Following digestion with BamHI and ligation into the BamHI cloning site of the broad range host cosmid pLAFR3, four DNA fragments at 3.8, 6.6, 12.3, and 22.8 kb were generated. Although the plasmid-encoded virulence gene psvA was undigested with the BamHI, the halo leaf spot gene may be adjacent to the psvA gene was digested. A pLAFR3 cosmid clone was introduced into the non-pathogenic PE0 and NAE89-1 strains by triparental matings and the pathogenicity was recovered. As a result, the pLAFR3 cosmid clone was introduced into the largest size DNA fragment of 22.8 kb and determined to be the causal agent of canker on the stem of the loquat. This study revealed that the psvA gene, previously found in the 50 Mdal plasmid, was also observed in the 22.8 kb DNA fragment.

  14. Ultrasound-mediated gene delivery of naked plasmid DNA in skeletal muscles : a case for bolus injections

    NARCIS (Netherlands)

    Gomes Sanches, P.; Muehlmeister, M.; Seip, R.; Kaijzel, E.L.; Loewik, C.; Boehmer, M.; Tiemann, K.; Grüll, H.

    2014-01-01

    Localized gene delivery has many potential clinical applications. However, the nucleic acids (e.g. pDNA and siRNA) are incapable of passively crossing the endothelium, cell membranes and other biological barriers which must be crossed to reach their intracellular targets. A possible solution is the

  15. Use of sperm plasmid DNA lipofection combined with REMI (restriction enzyme-mediated insertion) for production of transgenic chickens expressing eGFP (enhanced green fluorescent protein) or human follicle-stimulating hormone.

    Science.gov (United States)

    Harel-Markowitz, Eliane; Gurevich, Michael; Shore, Laurence S; Katz, Adi; Stram, Yehuda; Shemesh, Mordechai

    2009-05-01

    Linearized p-eGFP (plasmid-enhanced green fluorescent protein) or p-hFSH (plasmid human FSH) sequences with the corresponding restriction enzyme were lipofected into sperm genomic DNA. Sperm transfected with p-eGFP were used for artificial insemination in hens, and in 17 out of 19 of the resultant chicks, the exogenous DNA was detected in their lymphocytes as determined by PCR and expressed in tissues as determined by (a) PCR, (b) specific emission of green fluorescence by the eGFP, and (c) Southern blot analysis. A complete homology was found between the Aequorea Victoria eGFP DNA and a 313-bp PCR product of extracted DNA from chick blood cells. Following insemination with sperm lipofected with p-hFSH, transgenic offspring were obtained for two generations as determined by detection of the transgene for human FSH (PCR) and expression of the gene (RT-PCR and quantitative real-time PCR) and the presence of the protein in blood (radioimmunoassay). Data demonstrate that lipofection of plasmid DNA with restriction enzyme is a highly efficient method for the production of transfected sperm to produce transgenic offspring by direct artificial insemination.

  16. Flexible bent rod model with a saturating induced dipole moment to study the electric linear dichroism of DNA fragments

    Directory of Open Access Journals (Sweden)

    Jorge A. Bertolotto

    2016-06-01

    Full Text Available In the present work we make a theoretical study of the steady state electric linear dichroism of DNA fragments in aqueous solution. The here developed theoretical approach considers a flexible bent rod model with a saturating induced dipole moment. The electric polarizability tensor of bent DNA fragments is calculated considering a phenomenological model which theoretical and experimental backgroung is presented here. The model has into account the electric polarizability longitudinal and transversal to the macroion. Molecular flexibility is described using an elastic potential. We consider DNA fragments originally bent with bending fluctuations around an average bending angle. The induced dipole moment is supposed constant once the electric field strength grows up at critical value. To calculate the reduced electric linear dichroism we determine the optical factor considering the basis of the bent DNA perpendicular to the molecular axis. The orientational distribution function has into account the anisotropic electric properties and the molecule flexibility. We applied the present theoretical background to fit electric dichroism experimental data of DNA fragments reported in the bibliography in a wide range of molecular weight and electric field. From these fits, values of DNA physical properties are estimated. We compare and discuss the results here obtained with the theoretical and experimental data presented by other authors. The original contributions of this work are: the inclusion of the transversal electric polarizability saturating with the electric field, the description of the electric properties with an electric polarizability tensor dependant on the bending angle and the use of an arc model originally bent.

  17. DNA fragmentation and apoptosis induced by safranal in human prostate cancer cell line

    Directory of Open Access Journals (Sweden)

    Saeed Samarghandian

    2013-01-01

    Full Text Available Objectives: Apoptosis, an important mechanism that contributes to cell growth reduction, is reported to be induced by Crocus sativus (Saffron in different cancer types. However, limited effort has been made to correlate these effects to the active ingredients of saffron. The present study was designed to elucidate cytotoxic and apoptosis induction by safranal, the major coloring compound in saffron, in a human prostate cancer cell line (PC-3. Materials and Methods: PC-3 and human fetal lung fibroblast (MRC-5 cells were cultured and exposed to safranal (5, 10, 15, and 20 μg/ml. The 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay was performed to assess cytotoxicity. DNA fragmentation was assessed by gel electrophoresis. Cells were incubated with different concentrations of safranal, and cell morphologic changes and apoptosis were determined by the normal inverted microscope, Annexin V, and propidium iodide, followed by flow cytometric analysis, respectively. Results: MTT assay revealed a remarkable and concentration-dependent cytotoxic effect of safranal on PC-3 cells in comparison with non-malignant cell line. The morphologic alterations of the cells confirmed the MTT results. The IC 50 values against PC-3 cells were found to be 13.0 ΁ 0.07 and 6.4 ΁ 0.09 μg/ml at 48 and 72 h, respectively. Safranal induced an early and late apoptosis in the flow cytometry histogram of treated cells, indicating apoptosis is involved in this toxicity. DNA analysis revealed typical ladders as early as 48 and 72 h after treatment, indicative of apoptosis. Conclusions: Our preclinical study demonstrated a prostate cancer cell line to be highly sensitive to safranal-mediated growth inhibition and apoptotic cell death. Although the molecular mechanisms of safranal action are not clearly understood, it appears to have potential as a therapeutic agent.

  18. Circulating bacterial-derived DNA fragment level is a strong predictor of cardiovascular disease in peritoneal dialysis patients.

    Directory of Open Access Journals (Sweden)

    Cheuk-Chun Szeto

    Full Text Available Circulating bacterial DNA fragment is related to systemic inflammatory state in peritoneal dialysis (PD patients. We hypothesize that plasma bacterial DNA level predicts cardiovascular events in new PD patients.We measured plasma bacterial DNA level in 191 new PD patients, who were then followed for at least a year for the development of cardiovascular event, hospitalization, and patient survival.The average age was 59.3 ± 11.8 years; plasma bacterial DNA level 34.9 ± 1.5 cycles; average follow up 23.2 ± 9.7 months. At 24 months, the event-free survival was 86.1%, 69.8%, 55.4% and 30.8% for plasma bacterial DNA level quartiles I, II, III and IV, respectively (p < 0.0001. After adjusting for confounders, plasma bacterial DNA level, baseline residual renal function and malnutrition-inflammation score were independent predictors of composite cardiovascular end-point; each doubling in plasma bacterial DNA level confers a 26.9% (95% confidence interval, 13.0 - 42.5% excess in risk. Plasma bacterial DNA also correlated with the number of hospital admission (r = -0.379, p < 0.0001 and duration of hospitalization for cardiovascular reasons (r = -0.386, p < 0.0001. Plasma bacterial DNA level did not correlate with baseline arterial pulse wave velocity (PWV, but with the change in carotid-radial PWV in one year (r = -0.238, p = 0.005.Circulating bacterial DNA fragment level is a strong predictor of cardiovascular event, need of hospitalization, as well as the progressive change in arterial stiffness in new PD patients.

  19. Molecular and FISH analyses of a 53-kbp intact DNA fragment inserted by biolistics in wheat (Triticum aestivum L.) genome.

    Science.gov (United States)

    Partier, A; Gay, G; Tassy, C; Beckert, M; Feuillet, C; Barret, P

    2017-10-01

    A large, 53-kbp, intact DNA fragment was inserted into the wheat ( Triticum aestivum L.) genome. FISH analyses of individual transgenic events revealed multiple insertions of intact fragments. Transferring large intact DNA fragments containing clusters of resistance genes or complete metabolic pathways into the wheat genome remains a challenge. In a previous work, we showed that the use of dephosphorylated cassettes for wheat transformation enabled the production of simple integration patterns. Here, we used the same technology to produce a cassette containing a 44-kb Arabidopsis thaliana BAC, flanked by one selection gene and one reporter gene. This 53-kb linear cassette was integrated in the bread wheat (Triticum aestivum L.) genome by biolistic transformation. Our results showed that transgenic plants harboring the entire cassette were generated. The inheritability of the cassette was demonstrated in the T1 and T2 generation. Surprisingly, FISH analysis performed on T1 progeny of independent events identified double genomic insertions of intact fragments in non-homoeologous positions. Inheritability of these double insertions was demonstrated by FISH analysis of the T1 generation. Relative conclusions that can be drawn from molecular or FISH analysis are discussed along with future prospects of the engineering of large fragments for wheat transformation or genome editing.

  20. Delivery of a survivin promoter-driven antisense survivin-expressing plasmid DNA as a cancer therapeutic: a proof-of-concept study

    Directory of Open Access Journals (Sweden)

    Lin KY

    2016-05-01

    Full Text Available Kun-Yuan Lin,1 Siao Muk Cheng,2 Shing-Ling Tsai,2 Ju-Ya Tsai,1 Chun-Hui Lin,1 Chun Hei Antonio Cheung1,2 1Department of Pharmacology, College of Medicine, National Cheng Kung University, Tainan, Taiwan, ROC; 2Institute of Basic Medical Sciences, College of Medicine, National Cheng Kung University, Tainan, Taiwan, ROC Abstract: Survivin is a member of the inhibitor-of-apoptosis proteins family. It is overexpressed in many different cancer types but not in the differentiated normal tissue. In addition, overexpression of survivin promotes cancer cell survival and induces chemotherapeutic drug resistance, making it an attractive target for new anticancer interventions. Despite survivin being a promising molecular target for anticancer treatment, it is widely accepted that survivin is only a “semi-druggable” target. Therefore, it is important to develop a new strategy to target survivin for anticancer treatment. In this study, we constructed a novel survivin promoter-driven full-length antisense survivin (pSur/AS-Sur expression plasmid DNA. Promoter activity assay revealed that the activity of the survivin promoter of pSur/AS-Sur correlated with the endogenous expression of survivin at the transcriptional level in the transfected A549, MDA-MB-231, and PANC-1 cancer cells. Western blot analysis showed that liposomal delivery of pSur/AS-Sur successfully downregulated the expression of survivin in A549, MBA-MB-231, and PANC-1 cells in vitro. In addition, delivery of pSur/AS-Sur induced autophagy, caspase-dependent apoptosis, and caspase-independent apoptosis as indicated by the increased LC3B-II conversion, autophagosome formation, caspase-9/-3 and poly(ADP-ribose polymerase-1 cleavage, and apoptosis-inducing factor nuclear translocation in A549, MBA-MB-231, and PANC-1 cells. Importantly, liposomal delivery of pSur/AS-Sur was also capable of decreasing the proliferation of the survivin/MDR1 coexpressing multidrug-resistant KB-TAX50 cancer cells and

  1. Effect of DNA sequence of Fab fragment on yield characteristics and cell growth of E. coli.

    Science.gov (United States)

    Kulmala, Antti; Huovinen, Tuomas; Lamminmäki, Urpo

    2017-06-19

    Codon usage is one of the factors influencing recombinant protein expression. We were interested in the codon usage of an antibody Fab fragment gene exhibiting extreme toxicity in the E. coli host. The toxic synthetic human Fab gene contained domains optimized by the "one amino acid-one codon" method. We redesigned five segments of the Fab gene with a "codon harmonization" method described by Angov et al. and studied the effects of these changes on cell viability, Fab yield and display on filamentous phage using different vectors and bacterial strains. The harmonization considerably reduced toxicity, increased Fab expression from negligible levels to 10 mg/l, and restored the display on phage. Testing the impact of the individual redesigned segments revealed that the most significant effects were conferred by changes in the constant domain of the light chain. For some of the Fab gene variants, we also observed striking differences in protein yields when cloned from a chloramphenicol resistant vector into an identical vector, except with ampicillin resistance. In conclusion, our results show that the expression of a heterodimeric secretory protein can be improved by harmonizing selected DNA segments by synonymous codons and reveal additional complexity involved in heterologous protein expression.

  2. Hairpin and duplex formation in DNA fragments CCAATTTTGG, CCAATTTTTTGG, and CCATTTTTGG: a proton NMR study

    International Nuclear Information System (INIS)

    Pramanik, P.; Kanhouwa, N.; Kan, L.

    1988-01-01

    Three DNA fragments, CCAATTTTGG (1), CCAATTTTTTGG (2), AND CCATTTTTGG (3), were studied by proton NMR spectroscopy in aqueous solution. All these oligodeoxyribonucleotides contain common sequences at the 5' and 3' ends (5'-CCA and TGG-3'). 2 as well as 3 forms only hairpin structures with four unpaired thymidylyl units, four and three base pair stems, respectively, in neutral solution under low and high NaCl concentrations. At high salt concentration the oligomer 1 forms a duplex structure with -TT- internal loop. On the other hand, the same oligomer forms a stable hairpin structure at low salt and low strand concentrations at pH 7. The hairpin structure of 1 has a stem containing only three base pairs (CCA x TGG) and a loop containing four nucleotides (-ATTT-) that includes a dissociated A x T base pair. The two secondary structures of 1 coexist in an aqueous solution containing 0.1 M NaCl, at pH 7. The equilibrium shifts to the hairpin side when the temperature is raised. The stabilities and base-stacking modes of all three oligonucleotides in tow different structures are reported

  3. Co-administration of avian influenza virus H5 plasmid DNA with chicken IL-15 and IL-18 enhanced chickens immune responses.

    Science.gov (United States)

    Lim, Kian-Lam; Jazayeri, Seyed Davoud; Yeap, Swee Keong; Alitheen, Noorjahan Banu Mohamed; Bejo, Mohd Hair; Ideris, Aini; Omar, Abdul Rahman

    2012-08-06

    DNA vaccines offer several advantages over conventional vaccines in the development of effective vaccines against avian influenza virus (AIV). However, one of the limitations of the DNA vaccine in poultry is that it induces poor immune responses. In this study, chicken interleukin (IL) -15 and IL-18 were used as genetic adjuvants to improve the immune responses induced from the H5 DNA vaccination in chickens. The immunogenicity of the recombinant plasmid DNA was analyzed based on the antibody production, T cell responses and cytokine production, following inoculation in 1-day-old (Trial 1) and 14-day-old (Trial 2) specific-pathogen-free chickens. Hence, the purpose of the present study was to explore the role of chicken IL-15 and IL-18 as adjuvants following the vaccination of chickens with the H5 DNA vaccine. The overall HI antibody titer in chickens immunized with pDis/H5 + pDis/IL-15 was higher compared to chickens immunized with pDis/H5 (p chickens exhibited a shorter time to achieve the highest HI titer in comparison to the inoculation of the 1-day-old chickens. The cellular immunity was assessed by the flow cytometry analysis to enumerate CD4+ and CD8 + T cells in the peripheral blood. The chickens inoculated with pDis/H5 + pDis/IL-15 demonstrated the highest increase in CD4+ T cells population relative to the control chickens. However, this study revealed that pDis/H5 + pDis/IL-15 was not significant (P > 0.05) in inducing CD8+ T cells. Meanwhile, with the exception of Trial 1, the flow cytometry results for Trial 2 demonstrated that the pDis/H5 + pDis/IL-18 inoculated group was able to trigger a higher increase in CD4+ T cells than the pDis/H5 group (P 0.05) in modulating CD8+ T cells population in both trials. The pDis/H5 + pDis/IL-15 inoculated group showed the highest IL-15 gene expression in both trials compared to other inoculated groups (P chicken IL-15 and IL-18,with pDis/H5 + pDis/IL-15 being a better vaccine candidate

  4. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Science.gov (United States)

    Birla, Bhagyashree S; Chou, Hui-Hsien

    2015-01-01

    Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  5. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Directory of Open Access Journals (Sweden)

    Bhagyashree S Birla

    Full Text Available Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  6. Plasmid DNA linearization in the antibacterial action of a new fluorescent Ag nanoparticle-paracetamol dimer composite

    Science.gov (United States)

    Sahoo, Amaresh Kumar; Sk, Md Palashuddin; Ghosh, Siddhartha Sankar; Chattopadhyay, Arun

    2011-10-01

    Herein, we report the generation of a composite comprised of p-hydroxyacetanilide dimer and Ag nanoparticles (NPs) by reaction of AgNO3 and p-hydroxyacetanilide. The formation of the composite was established by UV-vis, FTIR and NMR spectroscopy, transmission electron microscopy and X-ray diffraction along with substantiation by mass spectrometry. Interestingly, the composite exhibited an emission spectrum with a peak at 435 nm when excited by light of wavelength 320 nm. The composite showed superior antimicrobial activity with respect to its individual components against a wide range of Gram positive and Gram negative bacteria at relatively low concentrations of Ag NPs and at which there was no apparent cytotoxicity against mammalian cells. Our results suggest that the composite strongly interacted with the bacterial cell walls leading to cell bursting. Interestingly, enhancement in the reactive oxygen species (ROS) generation in bacteria was observed in the presence of the composite. It is proposed that the ROS generation led to oxidation of the dimer to N-acetyl-p-benzoquinone imine (NAPQI). The generated NAPQI acted as a DNA gyrase inhibitor causing cell death following linearization of DNA.Herein, we report the generation of a composite comprised of p-hydroxyacetanilide dimer and Ag nanoparticles (NPs) by reaction of AgNO3 and p-hydroxyacetanilide. The formation of the composite was established by UV-vis, FTIR and NMR spectroscopy, transmission electron microscopy and X-ray diffraction along with substantiation by mass spectrometry. Interestingly, the composite exhibited an emission spectrum with a peak at 435 nm when excited by light of wavelength 320 nm. The composite showed superior antimicrobial activity with respect to its individual components against a wide range of Gram positive and Gram negative bacteria at relatively low concentrations of Ag NPs and at which there was no apparent cytotoxicity against mammalian cells. Our results suggest that the

  7. Superior induction of T cell responses to conserved HIV-1 regions by electroporated alphavirus replicon DNA compared to that with conventional plasmid DNA vaccine.

    Science.gov (United States)

    Knudsen, Maria L; Mbewe-Mvula, Alice; Rosario, Maximillian; Johansson, Daniel X; Kakoulidou, Maria; Bridgeman, Anne; Reyes-Sandoval, Arturo; Nicosia, Alfredo; Ljungberg, Karl; Hanke, Tomás; Liljeström, Peter

    2012-04-01

    Vaccination using "naked" DNA is a highly attractive strategy for induction of pathogen-specific immune responses; however, it has been only weakly immunogenic in humans. Previously, we constructed DNA-launched Semliki Forest virus replicons (DREP), which stimulate pattern recognition receptors and induce augmented immune responses. Also, in vivo electroporation was shown to enhance immune responses induced by conventional DNA vaccines. Here, we combine these two approaches and show that in vivo electroporation increases CD8(+) T cell responses induced by DREP and consequently decreases the DNA dose required to induce a response. The vaccines used in this study encode the multiclade HIV-1 T cell immunogen HIVconsv, which is currently being evaluated in clinical trials. Using intradermal delivery followed by electroporation, the DREP.HIVconsv DNA dose could be reduced to as low as 3.2 ng to elicit frequencies of HIV-1-specific CD8(+) T cells comparable to those induced by 1 μg of a conventional pTH.HIVconsv DNA vaccine, representing a 625-fold molar reduction in dose. Responses induced by both DREP.HIVconsv and pTH.HIVconsv were further increased by heterologous vaccine boosts employing modified vaccinia virus Ankara MVA.HIVconsv and attenuated chimpanzee adenovirus ChAdV63.HIVconsv. Using the same HIVconsv vaccines, the mouse observations were supported by an at least 20-fold-lower dose of DNA vaccine in rhesus macaques. These data point toward a strategy for overcoming the low immunogenicity of DNA vaccines in humans and strongly support further development of the DREP vaccine platform for clinical evaluation.

  8. A Saccharomyces cerevisiae mitochondrial DNA fragment activates Reg1p-dependent glucose-repressible transcription in the nucleus.

    Science.gov (United States)

    Santangelo, G M; Tornow, J

    1997-12-01

    As part of an effort to identify random carbon-source-regulated promoters in the Saccharomyces cerevisiae genome, we discovered that a mitochondrial DNA fragment is capable of directing glucose-repressible expression of a reporter gene. This fragment (CR24) originated from the mitochondrial genome adjacent to a transcription initiation site. Mutational analyses identified a GC cluster within the fragment that is required for transcriptional induction. Repression of nuclear CR24-driven transcription required Reg1p, indicating that this mitochondrially derived promoter is a member of a large group of glucose-repressible nuclear promoters that are similarly regulated by Reg1p. In vivo and in vitro binding assays indicated the presence of factors, located within the nucleus and the mitochondria, that bind to the GC cluster. One or more of these factors may provide a regulatory link between the nucleus and mitochondria.

  9. Ultrasound-mediated gene delivery of naked plasmid DNA in skeletal muscles: a case for bolus injections.

    Science.gov (United States)

    Sanches, Pedro Gomes; Mühlmeister, Mareike; Seip, Ralf; Kaijzel, Eric; Löwik, Clemens; Böhmer, Marcel; Tiemann, Klaus; Grüll, Holger

    2014-12-10

    Localized gene delivery has many potential clinical applications. However, the nucleic acids (e.g. pDNA and siRNA) are incapable of passively crossing the endothelium, cell membranes and other biological barriers which must be crossed to reach their intracellular targets. A possible solution is the use of ultrasound to burst circulating microbubbles inducing transient permeabilization of surrounding tissues which mediates nucleic acid extravasation and cellular uptake. In this study we report on an optimization of the ultrasound gene delivery technique. Naked pDNA (200 μg) encoding luciferase and SonoVue® microbubbles were co-injected intravenously in mice. The hindlimb skeletal muscles were exposed to ultrasound from a non-focused transducer (1 MHz, 1.25 MPa, PRI 30s) and injection protocols and total amounts as well as ultrasound parameters were systemically varied. Gene expression was quantified relative to a control using a bioluminescence camera system at day 7 after sonication. Bioluminescence ratios in sonicated/control muscles of up to 101× were obtained. In conclusion, we were able to specifically deliver genetic material to the selected skeletal muscles and overall, the use of bolus injections and high microbubble numbers resulted in increased gene expression reflected by stronger bioluminescence signals. Based on our data, bolus injections seem to be required in order to achieve transient highly concentrated levels of nucleic acids and microbubbles at the tissue of interest which upon ultrasound exposure should lead to increased levels of gene delivery. Thus, ultrasound mediated gene delivery is a promising technique for the clinical translation of localized drug delivery. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. [Construction and identification of eukaryotic plasmid pGC-silencer-U6/Neo/GFP/ABCG2].

    Science.gov (United States)

    Yu, Yanping; Zhang, Song; Kong, Weijia

    2010-09-01

    To construct three short hairpin RNA (shRNA) interference expression plasmid vectors of human ABCG2 gene, to assay the expression of ABCG2 in a human nasopharyngeal carcinoma (NPC) cell line, CEN-2 cell line, and to detect the RNAi effect of shRNA. Targeting ABCG2 gene sequence, three plasmid expression vectors coding for shRNA and a control vector containing random DNA fragment were constructed. The recombinant plasmids were amplified in Ecoli. DH5 and then identified by restriction digestion, PCR and sequencing. The recombinant plasmids were transfected into CEN-2 cells. ABCG2 expression was assayed by real-time quantitative PCR and Western blot. The construction of pGC-silencer-U6/Neo/GFP/ABCG2 was succeed. The shRNA plasmids significantly down-regulated the ABCG2 expression in CEN-2 cells, at both mRNA level and protein level. Recombinant plasmid 1 had the strongest effect compared with plasmids 2 and 3 (P < 0.05), with an inhibition ratio of 75% at the mRNA level and 68% at the protein level. pGC-silencer-U6/Neo/GFP/ABCG2 has been successfully constructed and it can down-regulate ABCG2 expression after transfected into CEN-2 cells, which could help further studies of ABCG2 functions CEN-2 cell line and contribute to the NPC gene therapy.

  11. Fibered confocal fluorescence microscopy for imaging apoptotic DNA fragmentation at the single-cell level in vivo

    International Nuclear Information System (INIS)

    Al-Gubory, Kais H.

    2005-01-01

    The major characteristic of cell death by apoptosis is the loss of nuclear DNA integrity by endonucleases, resulting in the formation of small DNA fragments. The application of confocal imaging to in vivo monitoring of dynamic cellular events, like apoptosis, within internal organs and tissues has been limited by the accessibility to these sites. Therefore, the aim of the present study was to test the feasibility of fibered confocal fluorescence microscopy (FCFM) to image in situ apoptotic DNA fragmentation in surgically exteriorized sheep corpus luteum in the living animal. Following intra-luteal administration of a fluorescent DNA-staining dye, YO-PRO-1, DNA cleavage within nuclei of apoptotic cells was serially imaged at the single-cell level by FCFM. This imaging technology is sufficiently simple and rapid to allow time series in situ detection and visualization of cells undergoing apoptosis in the intact animal. Combined with endoscope, this approach can be used for minimally invasive detection of fluorescent signals and visualization of cellular events within internal organs and tissues and thereby provides the opportunity to study biological processes in the natural physiological environment of the cell in living animals

  12. Sperm DNA fragmentation index does not correlate with blastocyst aneuploidy or morphological grading.

    Directory of Open Access Journals (Sweden)

    Itai Gat

    Full Text Available High DNA fragmentation index (DFI may be associated with poor outcome after IVF. Our aim was to determine whether DFI impacts blastocyst quality or clinical outcome. This retrospective study included 134 couples who underwent 177 IVF-ICSI and pre-implantation genetic screening (PGS cycles during January 1st, 2014-March 31st, 2016 and had documented previous DFI. Group 1 (DFI>30% encompassed 25 couples who underwent 36 cycles; Group 2 (DFI 15-30% included 45 couples and 57 cycles; group 3 (DFI<15% included 64 couples and 83 cycles. Male partners within group 1 were older (45.1 compared to 40.6 and 38.3 years, respectively, p<0.05, had higher BMI (32.4 compared to 26.6 and 25.8 respectively, p<0.05 and lower sperm count and motility (46*106/ml and 35.5%, respectively compared to groups 2 (61.8*106/ml and 46.6%, respectively and 3 (75.8*106/ml and 55.1%, respectively, p<0.05. Female parameters including ovarian reserve and response and embryo development were similar. Total numbers of biopsied blastocysts were 116, 175 and 259 in groups 1, 2 and 3, respectively. PGS for 24 chromosomes revealed comparable euploidy rate of 46-50.4%, with a similar morphological classification. No significant differences were found regarding pregnancy rates or pregnancy loss. It seems that DFI doesn't correlate with blastocyst aneuploidy or morphological grading.

  13. A polymer, random walk model for the size-distribution of large DNA fragments after high linear energy transfer radiation

    Science.gov (United States)

    Ponomarev, A. L.; Brenner, D.; Hlatky, L. R.; Sachs, R. K.

    2000-01-01

    DNA double-strand breaks (DSBs) produced by densely ionizing radiation are not located randomly in the genome: recent data indicate DSB clustering along chromosomes. Stochastic DSB clustering at large scales, from > 100 Mbp down to simulations and analytic equations. A random-walk, coarse-grained polymer model for chromatin is combined with a simple track structure model in Monte Carlo software called DNAbreak and is applied to data on alpha-particle irradiation of V-79 cells. The chromatin model neglects molecular details but systematically incorporates an increase in average spatial separation between two DNA loci as the number of base-pairs between the loci increases. Fragment-size distributions obtained using DNAbreak match data on large fragments about as well as distributions previously obtained with a less mechanistic approach. Dose-response relations, linear at small doses of high linear energy transfer (LET) radiation, are obtained. They are found to be non-linear when the dose becomes so large that there is a significant probability of overlapping or close juxtaposition, along one chromosome, for different DSB clusters from different tracks. The non-linearity is more evident for large fragments than for small. The DNAbreak results furnish an example of the RLC (randomly located clusters) analytic formalism, which generalizes the broken-stick fragment-size distribution of the random-breakage model that is often applied to low-LET data.

  14. Findings on sperm alterations and DNA fragmentation, nutritional, hormonal and antioxidant status in an elite triathlete: case report

    OpenAIRE

    Vaamonde, D.; Silva-Grigoletto, M.E. Da; Fernandez, J.M.; Algar-Santacruz, C.; García-Manso, J.M.

    2014-01-01

    Objective: The present case study analyzes semen quality, nutritional patterns, and hormonal and oxidative status of an international high-level triathlete with a low-volume, high-intensity training load. Method: The athlete was 26 years old, having participated in competitions since he was 13 years old, and practiced professional triathlon for the last five years. The qualitative sperm parameters analyzed were volume, sperm count, motility, morphology, and DNA fragmentation (additional testi...

  15. Findings on sperm alterations and DNA fragmentation, nutritional, hormonal and antioxidant status in an elite triathlete. Case report

    Directory of Open Access Journals (Sweden)

    D. Vaamonde

    2014-12-01

    Conclusions: In this high-intensity endurance athlete, sperm parameters, mainly sperm morphology and DNA fragmentation, are altered. Further knowledge is needed with regards nutritional antioxidant intake and other dietetic strategies oriented toward avoiding oxidative damage in semen of high-performance triathletes. Moreover, adequate nutritional strategies must be found and nutritional advice given to athletes so as to palliate or dampen the effects of exercise on semen quality.

  16. HYPOLIPEDEMIC EFFECT OF CYNODON DACTYLON ON HISTOPATHOLOGICAL STUDY AND DNA FRAGMENTATION ANALYSIS IN EXPERIMENTALLY INDUCED HYPERCHOLESTEREMIC RATS

    OpenAIRE

    C. Selva Kumar

    2011-01-01

    Hypercholesteremia is one of the risk factors for coronary artery disease. The present study highlights the efficacy of Ayurvedic herbal formulation Cynodon dactylon (Bermuda grass) on histopathological study and DNA fragmentation analysis in experimentally induced hypercholesteremic rats. Four groups of rats were employed namely control, hypercholesterolemia rats (4% Cholesterol+1% cholic acid), Cynodon dactylon treatment in hypercholesteremic rats and Cynodon dactylon alone treated rats. Re...

  17. cDNA cloning of human DNA topoisomerase I. Catalytic activity of a 67.7-kDa carboxyl-terminal fragment

    International Nuclear Information System (INIS)

    D'Arpa, P.; Machlin, P.S.; Ratrie, H. III; Rothfield, N.F.; Cleveland, D.W.; Earnshaw, W.C.

    1988-01-01

    cDNA clones encoding human topoisomerase I were isolated from an expression vector library (λgt11) screened with autoimmune anti-topoisomerase I serum. One of these clones has been expressed as a fusion protein comprised of a 32-kDa fragment of the bacterial TrpE protein linked to 67.7 kDa of protein encoded by the cDNA. Three lines of evidence indicate that the cloned cDNA encodes topoisomerase I. (i) Proteolysis maps of the fusion protein and human nuclear topoisomerase I are essentially identical. (ii) The fusion protein relaxes supercoiled DNA, an activity that can be immunoprecipitated by anti-topoisomerase I serum. (iii) Sequence analysis has revealed that the longest cDNA clone (3645 base pairs) encodes a protein of 765 amino acids that shares 42% identity with Saccharomyces cerevisiae topoisomerase I. The sequence data also show that the catalytically active 67.7-kDa fragment is comprised of the carboxyl terminus

  18. DNA vaccination with a plasmid encoding LACK-TSA fusion against Leishmania major infection in BALB/c mice.

    Science.gov (United States)

    Maspi, N; Ghaffarifar, F; Sharifi, Z; Dalimi, A; Khademi, S Z

    2017-12-01

    Vaccination would be the most important strategy for the prevention and elimination of leishmaniasis. The aim of the present study was to compare the immune responses induced following DNA vaccination with LACK (Leishmania analogue of the receptor kinase C), TSA (Thiol-specific-antioxidant) genes alone or LACK-TSA fusion against cutaneous leishmaniasis (CL). Cellular and humoral immune responses were evaluated before and after challenge with Leishmania major (L. major). In addition, the mean lesion size was also measured from 3th week post-infection. All immunized mice showed a partial immunity characterized by higher interferon (IFN)-γ and Immunoglobulin G (IgG2a) levels compared to control groups (pTSA fusion. Mean lesion sizes reduced significantly in all immunized mice compared with control groups at 7th week post-infection (pTSA and TSA groups than LACK group after challenge (pTSA antigens against CL. Furthermore, this study demonstrated that a bivalent vaccine can induce stronger immune responses and protection against infectious challenge with L. major.

  19. Preparation of methacrylate-based anion-exchange monolithic microbore column for chromatographic separation of DNA fragments and oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Sabarudin, Akhmad, E-mail: sabarjpn@ub.ac.id [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan); Department of Chemistry, Faculty of Science, Brawijaya University, Jl Veteran Malang 65145 (Indonesia); Huang, Junchao; Shu, Shin; Sakagawa, Shinnosuke [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan); Umemura, Tomonari, E-mail: umemura@apchem.nagoya-u.ac.jp [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan)

    2012-07-29

    Highlights: Black-Right-Pointing-Pointer Microbore-scale (1 mm i.d.) anion-exchange monolithic column. Black-Right-Pointing-Pointer Potentially preparative applications. Black-Right-Pointing-Pointer Separation of oligodeoxythymidylic acids and DNA fragments. - Abstract: In this paper, we report on the preparation of a microbore-scale (1 mm i.d.) anion-exchange monolithic column suitable not only for analytical purposes but also for potentially preparative applications. In order to meet the conflicting requirements of high permeability and good mechanical strength, the following two-step procedure was applied. First, an epoxy-containing monolith was synthesized by in situ copolymerization of glycidyl methacrylate (GMA) and ethylene dimethacrylate (EDMA) within the confines of a silicosteel tubing of 1.02 mm i.d. and 1/16 Double-Prime o.d. in the presence of a ternary porogenic mixture of 1-propanol, 1,4-butanediol, and water. The monolithic matrix was subsequently converted into weak anion-exchanger via the ring-opening reaction of epoxy group with diethyl amine. The dynamic binding capacity was 21.4 mg mL{sup -1} for bovine serum albumin (BSA) at 10% breakthrough. The morphology and porous structure of this monolith were assessed by scanning electron microscope (SEM) and inverse size exclusion chromatography (ISEC). To optimize the separation efficiency, the effects of various chromatographic parameters upon the separation of DNA fragments were investigated. The resulting monolithic anion exchanger demonstrated good potential for the separation of both single- and double-stranded DNA molecules using a gradient elution with NaCl in Tris-HCl buffer (20 mM). Oligodeoxythymidylic acids (dT{sub 12}-dT{sub 18}) were successfully resolved at pH 8, while the fragments of 20 bp DNA ladder, 100 bp DNA ladder, and pBR322-HaeIII digest were efficiently separated at pH 9.

  20. Implication of the E. coli K12 uvrA and recA genes in the repair of 8-methoxypsoralen-induced mono adducts and crosslinks on plasmid DNA; Implicacion de los genes uvrA de E. coli K12 en la reparacion de monoaductos y entrecruzamien tos inducidos en DNA plasmidico por 8-metoxipso raleno mas luz ultravioleta A

    Energy Technology Data Exchange (ETDEWEB)

    Paramio, J M; Bauluz, C; Vidania, R de

    1986-07-01

    Genotoxicity of psoralen damages on plasmid DNA has been studied. pBR322 DNA was randomly modified with several concentrations of 8-methoxypsoralen plus 365 nm-UV light. After transformation into E. coli strains (wild-type, uvrA and recA) plasmid survival and mutagenesis were analyzed. To study the influence of the SOS response on plasmid recovery, preirradiation of the cells was performed. In absence of cell preirradiation, crosslinks were not repaired in any strain. Mono adducts were also lethal but in part removed by the excision-repair pathway. Preirradiation of the cells significantly. increased plasmid recovery in recA+ celia. In uvrA- only the mutagenic pathway seemed to be involved in the repair of the damaged DNA. Wild type strain showed the highest increase in plasmid survival, involving the repair of mono adducts and some fraction of crosslinks mainly through an error-free repair pathway. This suggests an enhancement of the excision repair promoted by the induction of SOS functions. (Author) 32 refs.

  1. Radioautographic test for genetic cotton transformation by pCaVItoxneo hybrid plasmid

    International Nuclear Information System (INIS)

    Imamkhodjaeva, A.S.

    2006-01-01

    Full text: Search for novel technologies in biology, application of up-to-date methods in gene engineering, manipulation with the recombinant DNA, in particular, open opportunities for experiments with plants. To identify some DNA fragments in an organism's genome, radioautographic methods, such as dot- and blot-hybridization are frequently used. As a rule, genomic DNA is first isolated from the plant's organ. Its purification and subsequent manipulation is followed by hybridization with a probe labeled with radioactive components. The purified DNA, cDNA of RNA reverse transcription or a DNA fragment cloned in E-coli could serve as the probe. Radioautography shows homologically hybridized fragments. We have performed express dot-hybridization analysis on hybrid plasmid transformation of G.Hirsutum L. (108F) and G. Barbadense L. (C-6037) cotton sorts. pCaVItoxneo plasmid obtained on the basis of independently replicated plasmid-like DNA of the G.Hirsutum L. (pGHm2) cotton mitochondria was used (Yusupov T., 1994). There are hybrid two-domain gene of insectotoxin and enzymatically active kanamycine - phosphotransferase in the plasmid. The whole content is controlled by the plant promoter of cauliflower mosaic virus (19 S SFMV). The plasmid in question was added to the pollen sprouting medium followed by the transfer of the suspension on the pistil stigmas of the pre-prepared cotton flowers. The seed budding as the result of the experiment were analyzed by means of dot-hybridization method. DNA probes used for radioactive hybridization were labeled by method of Fainberg and Vagelstein (1990). To perform that DNA was dissolved in Tris-EDTA (10:1), containing 10mM of Tris HCl and 1mM EDTA, denaturated at 100 d eg C for 2 minutes with subsequent addition of oligonucleotide primers and annealing. DNA synthesis in the presence of 32 P labeled dATP and dCTP (Tashkent) was performed in the reaction mixture of potassium-phosphate buffer containing 67mM of MgCl 2 , 1 mg/ml of

  2. Co-administration of plasmid expressing IL-12 with 14-kDa Schistosoma mansoni fatty acid-binding protein cDNA alters immune response profiles and fails to enhance protection induced by Sm14 DNA vaccine alone.

    Science.gov (United States)

    Fonseca, Cristina T; Pacífico, Lucila G G; Barsante, Michele M; Rassi, Tatiana; Cassali, Geovanni D; Oliveira, Sérgio C

    2006-08-01

    Schistosomiasis is an endemic disease that affects 200 million people worldwide. DNA-based vaccine is a promising strategy to induce protective immunity against schistosomiasis, since both humoral and cellular immune responses are involved in parasite elimination. In this study, we evaluated the ability of Sm14 cDNA alone or in association with a plasmid expressing murine interleukin (IL)-12 to induce protection against challenge infection. Mice were immunized with four doses of the DNA vaccine and the levels of protection were determined by worm burden recovery after challenge infection. Specific antibody production to rSm14 was determined by ELISA, and cytokine production was measured in splenocyte culture supernatants stimulated with rSm14 and in bronchoalveolar lavage of vaccinated mice after challenge infection. DNA immunization with pCI/Sm14 alone induced 40.5% of worm reduction. However, the use of pCI/IL-12 as adjuvant to pCI/Sm14 immunization failed to enhance protection against challenge infection. Protection induced by pCI/Sm14 immunization correlates with specific IgG antibody production against Sm14, Th1 type of immune response with high levels of interferon (IFN)-gamma and low levels of IL-4 in splenocyte culture supernatants and in bronchoalveolar lavage after challenge infection. IL-12 co-administration with pCI/Sm14 induced a significant production of nitric oxide in splenocyte culture supernatants and also lymphocyte suppression, with reduced percentage of T cells producing IFN-gamma and tumor necrosis factor-alpha.

  3. Screening and identification of male-specific DNA fragments in common carps Cyprinus carpio using suppression subtractive hybridization.

    Science.gov (United States)

    Chen, J J; Du, Q Y; Yue, Y Y; Dang, B J; Chang, Z J

    2010-08-01

    In this study, a sex subtractive genomic DNA library was constructed using suppression subtractive hybridization (SSH) between male and female Cyprinus carpio. Twenty-two clones with distinguishable hybridization signals were selected and sequenced. The specific primers were designed based on the sequence data. Those primers were then used to amplify the sex-specific fragments from the genomic DNA of male and female carp. The amplified fragments from two clones showed specificity to males but not to females, which were named as Ccmf2 [387 base pairs (bp)] and Ccmf3 (183 bp), respectively. The sex-specific pattern was analysed in a total of 40 individuals from three other different C. carpio. stocks and grass carp Ctenopharyngodon idella using Ccmf2 and Ccmf3 as dot-blotting probes. The results revealed that the molecular diversity exists on the Y chromosome of C. carpio. No hybridization signals, however, were detected from individuals of C. idella, suggesting that the two sequences are specific to C. carpio. No significant homologous sequences of Ccmf2 and Ccmf3 were found in GenBank. Therefore, it was interpreted that the results as that Ccmf2 and Ccmf3 are two novel male-specific sequences; and both fragments could be used as markers to rapidly and accurately identify the genetic sex of part of C. carpio. This may provide a very efficient selective tool for practically breeding monosex female populations in aquacultural production.

  4. Analysis of Endonuclease R·EcoRI Fragments of DNA from Lambdoid Bacteriophages and Other Viruses by Agarose-Gel Electrophoresis

    Science.gov (United States)

    Helling, Robert B.; Goodman, Howard M.; Boyer, Herbert W.

    1974-01-01

    By means of agarose-gel electrophoresis, endonuclease R·EcoRI-generated fragments of DNA from various viruses were separated, their molecular weights were determined, and complete or partial fragment maps for lambda, φ80, and hybrid phages were constructed. Images PMID:4372397

  5. Characterization of IncN plasmids carrying blaCTX-M-1 and qnr genes in Escherichia coli and Salmonella from animals, the environment and humans

    DEFF Research Database (Denmark)

    Dolejska, Monika; Villa, Laura; Hasman, Henrik

    2013-01-01

    were compared using restriction fragment length polymorphism (RFLP), plasmid multilocus sequence typing (pMLST) and hybridization with repN, qnrS1, qnrB19 or blaCTX-M-1 probes. Plasmids pKT58A and pHHA45 were sequenced using the 454-Genome Sequencer FLX platform on a library constructed from plasmid...... DNA purified from the respective E. coli transformants.Results Three types of IncN plasmids carrying blaCTX-M-1, qnrS1 and qnrB19 genes were identified in strains isolated from the Czech Republic, Poland, Slovakia, Denmark, Italy and the Netherlands, corresponding to pMLST sequence type (ST) 1, ST3...

  6. Construction of pTM series plasmids for gene expression in Brucella species.

    Science.gov (United States)

    Tian, Mingxing; Qu, Jing; Bao, Yanqing; Gao, Jianpeng; Liu, Jiameng; Wang, Shaohui; Sun, Yingjie; Ding, Chan; Yu, Shengqing

    2016-04-01

    Brucellosis, the most common widespread zoonotic disease, is caused by Brucella spp., which are facultative, intracellular, Gram-negative bacteria. With the development of molecular biology techniques, more and more virulence-associated factors have been identified in Brucella spp. A suitable plasmid system is an important tool to study virulence genes in Brucella. In this study, we constructed three constitutive replication plasmids (pTM1-Cm, pTM2-Amp, and pTM3-Km) using the replication origin (rep) region derived from the pBBR1-MCS vector. Also, a DNA fragment containing multiple cloning sites (MCSs) and a terminator sequence derived from the pCold vector were produced for complementation of the deleted genes. Besides pGH-6×His, a plasmid containing the groE promoter of Brucella spp. was constructed to express exogenous proteins in Brucella with high efficiency. Furthermore, we constructed the inducible expression plasmid pZT-6×His, containing the tetracycline-inducible promoter pzt1, which can induce expression by the addition of tetracycline in the Brucella culture medium. The constructed pTM series plasmids will play an important role in the functional investigation of Brucella spp. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Tranformasi Fragmen Dna Kromosom Xanthomonas Campestris ke dalam Escherichia Coli

    Directory of Open Access Journals (Sweden)

    Wibowo Mangunwardoyo

    2002-04-01

    Full Text Available Research on DNA transformation of Xanthomonas campestris into Escherichia coli DH5αα using plasmid vector Escherichia coli (pUC19. was carried out. DNA chromosome was isolated using CTAB method, alkali lysis method was used to isolate DNA plasmid. Both of DNA plasmid and chromosome were digested using restriction enzyme EcoRI. Competent cell was prepared with CaCl2 and heat shock method for transformation procedure. The result revealed transformation obtain 5 white colonies, with transformation frequency was 1,22 x 10-8 colony/competent cell. Electrophoresis analysis showed the DNA fragment (insert in range 0.5 – 7,5 kb. Further research should be carried out to prepare the genomic library to obtain better result of transformant.

  8. Use of testicular sperm for intracytoplasmic sperm injection in men with high sperm DNA fragmentation: a SWOT analysis.

    Science.gov (United States)

    Esteves, Sandro C; Roque, Matheus; Garrido, Nicolás

    2018-01-01

    Spermatozoa retrieved from the testis of men with high levels of sperm DNA fragmentation (SDF) in the neat semen tend to have better DNA quality. Given the negative impact of SDF on the outcomes of Assisted Reproductive Technology (ART), an increased interest has emerged about the use of testicular sperm for intracytoplasmic sperm injection (Testi-ICSI). In this article, we used a SWOT (strengths, weaknesses, opportunities, and threats) analysis to summarize the advantages and drawbacks of this intervention. The rationale of Testi-ICSI is bypass posttesticular DNA fragmentation caused by oxidative stress during sperm transit through the epididymis. Hence, oocyte fertilization by genomically intact testicular spermatozoa may be optimized, thus increasing the chances of creating a normal embryonic genome and the likelihood of achieving a live birth, as recently demonstrated in men with high SDF. However, there is still limited evidence as regards the clinical efficacy of Testi-ICSI, thus creating opportunities for further confirmatory clinical research as well as investigation of Testi-ICSI in clinical scenarios other than high SDF. Furthermore, Testi-ICSI can be compared to other laboratory preparation methods for deselecting sperm with damaged DNA. At present, the available literature supports the use of testicular sperm when performing ICSI in infertile couples whose male partners have posttesticular SDF. Due to inherent risks of sperm retrieval, Testi-ICSI should be offered when less invasive treatments for alleviating DNA damage have failed. A call for continuous monitoring is nonetheless required concerning the health of generated offspring and the potential complications of sperm retrieval.

  9. EFFECT OF PROSTATILEN® AC ON SPERM DNA FRAGMENTATION DURING TREATMENT OF PATIENTS WITH CHRONIC NONBACTERIAL PROSTATITIS AND CONCOMITANT DISORDERS OF THE REPRODUCTIVE FUNCTION

    Directory of Open Access Journals (Sweden)

    S. Yu. Borovets

    2017-01-01

    Full Text Available The study objective is to analyze the effect of Prostatilen® AC on sperm DNA fragmentation during treatment of patients with chronic nonbacterial prostatitis and concomitant disorders of the reproductive function.Materials and methods. The study is based on the results of treatment of 25 men aged 24 to 45 years (mean age 35.3 ± 4.4 years with a verified diagnosis of chronic nonbacterial prostatitis and complaints of early-stage missed miscarriage in a spouse/sexual partner. All patients received Prostatilen® AC daily in rectal suppositories formulation. The duration of treatment was 10 days with retreatment after 20 days. In all patients before treatment and 20 days after it, spermiogram parameters (5th ed., WHO, 2010 and sperm DNA fragmentation level using SCSA (sperm chromatin structure assay by FACSCantoll with monoclonal antibodies (Roche, Germany were determined, and all patients underwent the MAR (mixed antiglobulin reaction test with normal value considered to be 10 % or less. The normal value of sperm DNA fragmentation was considered to be 15 % or less (low risk of fertility impairment. The analysis of the obtained data was carried out using the IBM SPSS Statistics program 22.Results. Before the treatment, pathologic level of sperm DNA fragmentation was observed in 6 (43 % of 14 patients with normozoospermia and in 7 (63 % of 11 patients with pathozoospermia (χ² = 1.06; p <0.3. Thus, there weren’t any significant difference between the rates of occurrence of increased sperm DNA fragmentation in patients with normo- and pathozoospermia. A correlation was found between the level of sperm DNA fragmentation and the results of MAR test before treatment (r = 0.8, p <0.05, which varied between 0 and 99 % (mean 16.48 ± 31.64 %. Meanwhile, increased sperm DNA fragmentation was observed in 7 (53 % of 13 patients with pathological MAR test results, and in 2 (40 % of 5 patients with normal MAR test results (χ² = 0.67; p <0.01. The level

  10. DNA fragmentation and membrane damage of bocachico Prochilodus magdalenae (Ostariophysi: Prochilodontidae sperm following cryopreservation with dimethylsulfoxide and glucose

    Directory of Open Access Journals (Sweden)

    José Gregorio Martínez

    Full Text Available The endangered bocachico Prochilodus magdalenae is a native freshwater fish of Colombia, the most captured species locally and one of the most important species for ex-situ conservation (germplasm banks. The aim of this study was to examine the effect of three concentrations of Dimethylsulfoxide (DMSO (5%, 10%, 15% and three of glucose (305, 333, 361 mM in the extender on spermatic DNA fragmentation (F-DNA (by Halomax®, Chromatin dispersion and membrane damage (D-Me (by eosin-nigrosin staining. After assessment of sperm quality by computer analysis of motility, one part of semen from males was diluted separately with three parts of extender and filled into 0.5 ml straws. Freezing was carried out in liquid nitrogen vapor dry shipper for 30 minutes and thawed at 60ºC for 8 seconds in a water bath and evaluated for the percentage of cells found with F-DNA and D-Me. The results demonstrated that cryopreservation causes greater F-DNA (13.62 ± 1.6% to 28.91 ± 3.25 and D-Me (24.27 ± 1.1% to 58.33 ± 2.81% when compared with pre-freezing semen (PFS (6.71 ± 1.54% and 2.34 ± 0.5%, respectively for F-DNA and D-Me. A significant interaction was found between DMSO and glucose concentration in this experiment. Use of extender: 10% DMSO + 305 mM glucose + 12% chicken egg yolk and, 10% DMSO + 333 mM glucose + 12% chicken egg yolk, allow for lower F-DNA and D-Me during cryopreservation of bocachico semen. A high correlation between F-DNA and D-Me was found (r = 0.771.

  11. The interaction of linear and ring forms of DNA molecules with nanodiamonds synthesized by detonation

    International Nuclear Information System (INIS)

    Purtov, K V; Burakova, L P; Puzyr, A P; Bondar, V S

    2008-01-01

    Nanodiamonds synthesized by detonation have been found not to immobilize the ring form of pUC19 plasmid DNA. Linear pUC19 molecules with blunt ends, prepared by restriction of the initial ring form of pUC19 DNA, and linear 0.25-10 kb DNA fragments are adsorbed on nanodiamonds. The amount of adsorbed linear DNA molecules depends on the size of the molecules and the size of the nanodiamond clusters

  12. Genomic DNA fingerprinting of clinical Haemophilus influenzae isolates by polymerase chain reaction amplification: comparison with major outer-membrane protein and restriction fragment length polymorphism analysis

    NARCIS (Netherlands)

    van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.

    1994-01-01

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  13. Absence of superoxide dismutase activity causes nuclear DNA fragmentation during the aging process

    International Nuclear Information System (INIS)

    Muid, Khandaker Ashfaqul; Karakaya, Hüseyin Çaglar; Koc, Ahmet

    2014-01-01

    Highlights: • Aging process increases ROS accumulation. • Aging process increases DNA damage levels. • Absence of SOD activity does not cause DNA damage in young cells. • Absence of SOD activity accelerate aging and increase oxidative DNA damages during the aging process. - Abstract: Superoxide dismutases (SOD) serve as an important antioxidant defense mechanism in aerobic organisms, and deletion of these genes shortens the replicative life span in the budding yeast Saccharomyces cerevisiae. Even though involvement of superoxide dismutase enzymes in ROS scavenging and the aging process has been studied extensively in different organisms, analyses of DNA damages has not been performed for replicatively old superoxide dismutase deficient cells. In this study, we investigated the roles of SOD1, SOD2 and CCS1 genes in preserving genomic integrity in replicatively old yeast cells using the single cell comet assay. We observed that extend of DNA damage was not significantly different among the young cells of wild type, sod1Δ and sod2Δ strains. However, ccs1Δ mutants showed a 60% higher amount of DNA damage in the young stage compared to that of the wild type cells. The aging process increased the DNA damage rates 3-fold in the wild type and more than 5-fold in sod1Δ, sod2Δ, and ccs1Δ mutant cells. Furthermore, ROS levels of these strains showed a similar pattern to their DNA damage contents. Thus, our results confirm that cells accumulate DNA damages during the aging process and reveal that superoxide dismutase enzymes play a substantial role in preserving the genomic integrity in this process

  14. Absence of superoxide dismutase activity causes nuclear DNA fragmentation during the aging process

    Energy Technology Data Exchange (ETDEWEB)

    Muid, Khandaker Ashfaqul; Karakaya, Hüseyin Çaglar; Koc, Ahmet, E-mail: ahmetkoc@iyte.edu.tr

    2014-02-07

    Highlights: • Aging process increases ROS accumulation. • Aging process increases DNA damage levels. • Absence of SOD activity does not cause DNA damage in young cells. • Absence of SOD activity accelerate aging and increase oxidative DNA damages during the aging process. - Abstract: Superoxide dismutases (SOD) serve as an important antioxidant defense mechanism in aerobic organisms, and deletion of these genes shortens the replicative life span in the budding yeast Saccharomyces cerevisiae. Even though involvement of superoxide dismutase enzymes in ROS scavenging and the aging process has been studied extensively in different organisms, analyses of DNA damages has not been performed for replicatively old superoxide dismutase deficient cells. In this study, we investigated the roles of SOD1, SOD2 and CCS1 genes in preserving genomic integrity in replicatively old yeast cells using the single cell comet assay. We observed that extend of DNA damage was not significantly different among the young cells of wild type, sod1Δ and sod2Δ strains. However, ccs1Δ mutants showed a 60% higher amount of DNA damage in the young stage compared to that of the wild type cells. The aging process increased the DNA damage rates 3-fold in the wild type and more than 5-fold in sod1Δ, sod2Δ, and ccs1Δ mutant cells. Furthermore, ROS levels of these strains showed a similar pattern to their DNA damage contents. Thus, our results confirm that cells accumulate DNA damages during the aging process and reveal that superoxide dismutase enzymes play a substantial role in preserving the genomic integrity in this process.

  15. Highly efficient gene delivery by mRNA electroporation in human hematopoietic cells: superiority to lipofection and passive pulsing of mRNA and to electroporation of plasmid cDNA for tumor antigen loading of dendritic cells.

    Science.gov (United States)

    Van Tendeloo, V F; Ponsaerts, P; Lardon, F; Nijs, G; Lenjou, M; Van Broeckhoven, C; Van Bockstaele, D R; Berneman, Z N

    2001-07-01

    Designing effective strategies to load human dendritic cells (DCs) with tumor antigens is a challenging approach for DC-based tumor vaccines. Here, a cytoplasmic expression system based on mRNA electroporation to efficiently introduce tumor antigens into DCs is described. Preliminary experiments in K562 cells using an enhanced green fluorescent protein (EGFP) reporter gene revealed that mRNA electroporation as compared with plasmid DNA electroporation showed a markedly improved transfection efficiency (89% versus 40% EGFP(+) cells, respectively) and induced a strikingly lower cell toxicity (15% death rate with mRNA versus 51% with plasmid DNA). Next, mRNA electroporation was applied for nonviral transfection of different types of human DCs, including monocyte-derived DCs (Mo-DCs), CD34(+) progenitor-derived DCs (34-DCs) and Langerhans cells (34-LCs). High-level transgene expression by mRNA electroporation was obtained in more than 50% of all DC types. mRNA-electroporated DCs retained their phenotype and maturational potential. Importantly, DCs electroporated with mRNA-encoding Melan-A strongly activated a Melan-A-specific cytotoxic T lymphocyte (CTL) clone in an HLA-restricted manner and were superior to mRNA-lipofected or -pulsed DCs. Optimal stimulation of the CTL occurred when Mo-DCs underwent maturation following mRNA transfection. Strikingly, a nonspecific stimulation of CTL was observed when DCs were transfected with plasmid DNA. The data clearly demonstrate that Mo-DCs electroporated with mRNA efficiently present functional antigenic peptides to cytotoxic T cells. Therefore, electroporation of mRNA-encoding tumor antigens is a powerful technique to charge human dendritic cells with tumor antigens and could serve applications in future DC-based tumor vaccines.

  16. Single-Cell-Based Platform for Copy Number Variation Profiling through Digital Counting of Amplified Genomic DNA Fragments.

    Science.gov (United States)

    Li, Chunmei; Yu, Zhilong; Fu, Yusi; Pang, Yuhong; Huang, Yanyi

    2017-04-26

    We develop a novel single-cell-based platform through digital counting of amplified genomic DNA fragments, named multifraction amplification (mfA), to detect the copy number variations (CNVs) in a single cell. Amplification is required to acquire genomic information from a single cell, while introducing unavoidable bias. Unlike prevalent methods that directly infer CNV profiles from the pattern of sequencing depth, our mfA platform denatures and separates the DNA molecules from a single cell into multiple fractions of a reaction mix before amplification. By examining the sequencing result of each fraction for a specific fragment and applying a segment-merge maximum likelihood algorithm to the calculation of copy number, we digitize the sequencing-depth-based CNV identification and thus provide a method that is less sensitive to the amplification bias. In this paper, we demonstrate a mfA platform through multiple displacement amplification (MDA) chemistry. When performing the mfA platform, the noise of MDA is reduced; therefore, the resolution of single-cell CNV identification can be improved to 100 kb. We can also determine the genomic region free of allelic drop-out with mfA platform, which is impossible for conventional single-cell amplification methods.

  17. DNA fragmentation and cell cycle arrest: a hallmark of apoptosis induced by Ruta graveolens in human colon cancer cells.

    Science.gov (United States)

    Arora, Shagun; Tandon, Simran

    2015-01-01

    In the present study, we investigated the anti-cancer effect of various potencies of Ruta graveolens (Ruta) on COLO-205 cell line, as evidenced by cytotoxicity, migration, clonogenecity, morphological and biochemical changes and modification in the levels of genes associated with apoptosis and cell cycle. On treatment of COLO-205 cells maximal effects were seen with mother tincture (MT) and 30C potencies, wherein decrease in cell viability along with reduced clonogenecity and migration capabilities were noted. In addition morphological and biochemical alterations such as nuclear changes (fragmented nuclei with condensed chromatin) and DNA ladder-like pattern (increased amount of fragmented DNA) in COLO-205 cells indicating apoptotic related cell death were seen. The expression of apoptosis and cell-cycle related regulatory genes assessed by reverse transcriptase-PCR revealed an up-regulation of caspase 9, caspase-3, Bax, p21 and p27 expression and down-regulation of Bcl-2 expression in treated cells. The mode of cell death was suggestive of intrinsic apoptotic pathway along with cell cycle arrest at the G2/M of the cell cycle. Our findings indicate that phytochemicals present in Ruta showed potential for natural therapeutic product development for colon carcinoma. Copyright © 2014 The Faculty of Homeopathy. Published by Elsevier Ltd. All rights reserved.

  18. IRMA iterative relaxation matrix approach for NMR structure determination application to DNA fragments

    International Nuclear Information System (INIS)

    Koning, M.M.G.

    1990-01-01

    The subject of this thesis is the structure determination of DNA molecules in solution with the use of NMR. For this purpose a new relaxation matrix approach is introduced. The emphasis is on the interpretation of nuclear Overhauser effects (NOEs) in terms of proton-proton distances and related three dimensional structures. The DNA molecules studied are obligonucleotides, unmodifief as well as modified molecules bu UV radiation. From comparison with unmodified molecules it turned out that UV irradiation scarcely influences the helical structure of the DNA string. At one place of the string a nucleotide is rotated towards the high-ANTI conformation which results in a slight unwinding of the DNA string but sufficient for blocking of the normal reading of genetic information. (H.W.). 456 refs.; 50 figs.; 30 tabs

  19. Unusual structures are present in DNA fragments containing super-long Huntingtin CAG repeats.

    Directory of Open Access Journals (Sweden)

    Daniel Duzdevich

    2011-02-01

    Full Text Available In the R6/2 mouse model of Huntington's disease (HD, expansion of the CAG trinucleotide repeat length beyond about 300 repeats induces a novel phenotype associated with a reduction in transcription of the transgene.We analysed the structure of polymerase chain reaction (PCR-generated DNA containing up to 585 CAG repeats using atomic force microscopy (AFM. As the number of CAG repeats increased, an increasing proportion of the DNA molecules exhibited unusual structural features, including convolutions and multiple protrusions. At least some of these features are hairpin loops, as judged by cross-sectional analysis and sensitivity to cleavage by mung bean nuclease. Single-molecule force measurements showed that the convoluted DNA was very resistant to untangling. In vitro replication by PCR was markedly reduced, and TseI restriction enzyme digestion was also hindered by the abnormal DNA structures. However, significantly, the DNA gained sensitivity to cleavage by the Type III restriction-modification enzyme, EcoP15I."Super-long" CAG repeats are found in a number of neurological diseases and may also appear through CAG repeat instability. We suggest that unusual DNA structures associated with super-long CAG repeats decrease transcriptional efficiency in vitro. We also raise the possibility that if these structures occur in vivo, they may play a role in the aetiology of CAG repeat diseases such as HD.

  20. Alkaline DNA fragmentation, DNA disentanglement evaluated viscosimetrically and sister chromatid exchanges, after treatment in vivo with nitrofurantoin.

    Science.gov (United States)

    Parodi, S; Pala, M; Russo, P; Balbi, C; Abelmoschi, M L; Taningher, M; Zunino, A; Ottaggio, L; de Ferrari, M; Carbone, A; Santi, L

    1983-07-01

    Nitrofurantoin was not positive as a carcinogen in long term assays. In vitro it was positive in some short term tests and negative in others. We have examined Nitrofurantoin for its capability of inducing DNA damage in vivo. With the alkaline elution technique, Nitrofurantoin appeared clearly positive in all the tissues examined (liver, kidney, lung, spleen and bone marrow). In the liver we also observed some cross-linking effect. In bone marrow cells Nitrofurantoin was also clearly positive in terms of sister chromatid exchanges (SCEs) induction. DNA damage in vivo was also examined with a viscosimetric method, more sensitive than alkaline elution. With this method the results were essentially negative, suggesting that the two methods detect different types of damage. In view of its positivity in many organs and in two short term tests in vivo, the carcinogenic potential of Nitrofurantoin should be reconsidered.

  1. Positive and negative ion mode comparison for the determination of DNA/peptide noncovalent binding sites through the formation of "three-body" noncovalent fragment ions.

    Science.gov (United States)

    Brahim, Bessem; Tabet, Jean-Claude; Alves, Sandra

    2018-02-01

    Gas-phase fragmentation of single strand DNA-peptide noncovalent complexes is investigated in positive and negative electrospray ionization modes.Collision-induced dissociation experiments, performed on the positively charged noncovalent complex precursor ions, have confirmed the trend previously observed in negative ion mode, i.e. a high stability of noncovalent complexes containing very basic peptidic residues (i.e. R > K) and acidic nucleotide units (i.e. Thy units), certainly incoming from the existence of salt bridge interactions. Independent of the ion polarity, stable noncovalent complex precursor ions were found to dissociate preferentially through covalent bond cleavages of the partners without disrupting noncovalent interactions. The resulting DNA fragment ions were found to be still noncovalently linked to the peptides. Additionally, the losses of an internal nucleic fragment producing "three-body" noncovalent fragment ions were also observed in both ion polarities, demonstrating the spectacular salt bridge interaction stability. The identical fragmentation patterns (regardless of the relative fragment ion abundances) observed in both polarities have shown a common location of salt bridge interaction certainly preserved from solution. Nonetheless, most abundant noncovalent fragment ions (and particularly three-body ones) are observed from positively charged noncovalent complexes. Therefore, we assume that, independent of the preexisting salt bridge interaction and zwitterion structures, multiple covalent bond cleavages from single-stranded DNA/peptide complexes rely on an excess of positive charges in both electrospray ionization ion polarities.

  2. Construction of a recombinant eukaryotic human ZHX1 gene expression plasmid and the role of ZHX1 in hepatocellular carcinoma.

    Science.gov (United States)

    Wang, Jianping; Liu, Dejie; Liang, Xiaohong; Gao, Lifen; Yue, Xuetian; Yang, Yang; Ma, Chunhong; Liu, Jun

    2013-11-01

    The zinc-fingers and homeoboxes protein 1 (ZHX1) consists of 873 amino acid residues, is localized in the cell nucleus and appears to act as a transcriptional repressor. Previous studies have shown that ZHX1 interacts with nuclear factor Y subunit α (NF-YA), DNA methyltransferases (DNMT) 3B and ZHX2, all of which are involved in tumorigenesis. However, the exact role of ZHX1 in tumorigenesis remains unknown. The aim of the current study was to construct a recombinant eukaryotic expression plasmid containing the human ZHX1 (hZHX1) gene and to investigate the biological activities of ZHX1 in hepatocellular carcinoma (HCC). Reverse transcription-polymerase chain reaction (RT‑PCR) was used to amplify the N- and C-terminal fragments (ZHX1‑N and ZHX1‑C, respectively) of the hZHX1 gene. The two PCR fragments were cloned into the pEASY-T1 vector and subcloned into the pcDNA3 plasmid to generate a recombinant pcDNA3‑ZHX1 plasmid. Following identification by enzyme digestion and DNA sequencing, the recombinant pcDNA3‑ZHX1 plasmid was transfected into SMMC-7721 cells. The level of ZHX1 expression was detected by RT-PCR and western blot analysis. Cell growth curve assays were used to evaluate the effect of ZHX1 on cell proliferation. Moreover, the differential expression of ZHX1 between cancer and adjacent cirrhotic liver tissue was investigated by quantitative PCR (qPCR). Enzyme digestion and DNA sequencing confirmed the successful construction of the recombinant plasmid, pcDNA3‑ZHX1. qPCR and western blot analysis demonstrated that ZHX1 was efficiently expressed in SMMC-7721 cells and overexpression of ZHX1 may inhibit the proliferation of SMMC-7721 cells. In addition, reduced ZHX1 expression is widespread among cancer tissues from HCC patients. In conclusion, a recombinant eukaryotic expression plasmid, pcDNA3‑ZHX1, was successfully constructed. In addition, the current results indicate that a low expression of ZHX1 may be responsible for hepatocarcinogenesis.

  3. Site-specific deletions of chromosomally located DNA segments with the multimer resolution system of broad-host-range plasmid RP4

    DEFF Research Database (Denmark)

    Sternberg, Claus; Eberl, Leo; Sanchezromero, Juan M.

    1995-01-01

    The multimer resolution system (mrs) of the broad-host-range plasmid RP4 has been exploited to develop a general method that permits the precise excision of chromosomal segments in a variety of gram-negative bacteria. The procedure is based on the site-specific recombination between two directly ...

  4. Studies on the expression of plasmid-borne genes in the endosymbiotic state of Rhizobium leguminosarum

    NARCIS (Netherlands)

    Krol, A.J.M.

    1982-01-01

    The subject matter of the research reported in this thesis is the role of plasmid-borne genes of Rhizobium in symbiosis and nitrogen fixation. Plasmid DNA was isolated from Rhizobium leguminosarum strain PRE and the expression of plasmid DNA in nitrogen

  5. Covalent Bonding of Pyrrolobenzodiazepines (PBDs) to Terminal Guanine Residues within Duplex and Hairpin DNA Fragments

    Science.gov (United States)

    Mantaj, Julia; Jackson, Paul J. M.; Karu, Kersti; Rahman, Khondaker M.; Thurston, David E.

    2016-01-01

    Pyrrolobenzodiazepines (PBDs) are covalent-binding DNA-interactive agents with growing importance as payloads in Antibody Drug Conjugates (ADCs). Until now, PBDs were thought to covalently bond to C2-NH2 groups of guanines in the DNA-minor groove across a three-base-pair recognition sequence. Using HPLC/MS methodology with designed hairpin and duplex oligonucleotides, we have now demonstrated that the PBD Dimer SJG-136 and the C8-conjugated PBD Monomer GWL-78 can covalently bond to a terminal guanine of DNA, with the PBD skeleton spanning only two base pairs. Control experiments with the non-C8-conjugated anthramycin along with molecular dynamics simulations suggest that the C8-substituent of a PBD Monomer, or one-half of a PBD Dimer, may provide stability for the adduct. This observation highlights the importance of PBD C8-substituents, and also suggests that PBDs may bind to terminal guanines within stretches of DNA in cells, thus representing a potentially novel mechanism of action at the end of DNA strand breaks. PMID:27055050

  6. AFEAP cloning: a precise and efficient method for large DNA sequence assembly.

    Science.gov (United States)

    Zeng, Fanli; Zang, Jinping; Zhang, Suhua; Hao, Zhimin; Dong, Jingao; Lin, Yibin

    2017-11-14

    Recent development of DNA assembly technologies has spurred myriad advances in synthetic biology, but new tools are always required for complicated scenarios. Here, we have developed an alternative DNA assembly method named AFEAP cloning (Assembly of Fragment Ends After PCR), which allows scarless, modular, and reliable construction of biological pathways and circuits from basic genetic parts. The AFEAP method requires two-round of PCRs followed by ligation of the sticky ends of DNA fragments. The first PCR yields linear DNA fragments and is followed by a second asymmetric (one primer) PCR and subsequent annealing that inserts overlapping overhangs at both sides of each DNA fragment. The overlapping overhangs of the neighboring DNA fragments annealed and the nick was sealed by T4 DNA ligase, followed by bacterial transformation to yield the desired plasmids. We characterized the capability and limitations of new developed AFEAP cloning and demonstrated its application to assemble DNA with varying scenarios. Under the optimized conditions, AFEAP cloning allows assembly of an 8 kb plasmid from 1-13 fragments with high accuracy (between 80 and 100%), and 8.0, 11.6, 19.6, 28, and 35.6 kb plasmids from five fragments at 91.67, 91.67, 88.33, 86.33, and 81.67% fidelity, respectively. AFEAP cloning also is capable to construct bacterial artificial chromosome (BAC, 200 kb) with a fidelity of 46.7%. AFEAP cloning provides a powerful, efficient, seamless, and sequence-independent DNA assembly tool for multiple fragments up to 13 and large DNA up to 200 kb that expands synthetic biologist's toolbox.

  7. Expansion during PCR of short single-stranded DNA fragments carrying nonselfcomplementary dinucleotide or trinucleotide repeats

    Czech Academy of Sciences Publication Activity Database

    Reichová, Naďa; Kypr, Jaroslav

    2003-01-01

    Roč. 30, č. 3 (2003), s. 155-163 ISSN 0301-4851 R&D Projects: GA ČR GA301/01/0590 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA * PCR * expansion Subject RIV: BO - Biophysics Impact factor: 0.565, year: 2003

  8. Solution structure of a short dna fragment studied by neutron scattering

    DEFF Research Database (Denmark)

    Lederer, H.; May, R. P.; Kjems, Jørgen

    1986-01-01

    -DNA. The neutron scattering curve is well fitted by that of a rigid rod with a length of 44 nm and a diameter of 2 nm. The result were confirmed by quasi-elastic light scattering and analytical centrifugation. The neutron measurements in H2O and D2O buffer reveal a cross-sectional in homogeneity not detected by X...

  9. i-Motif of cytosine-rich human telomere DNA fragments containing natural base lesions

    Czech Academy of Sciences Publication Activity Database

    Dvořáková, Zuzana; Renčiuk, Daniel; Kejnovská, Iva; Školáková, Petra; Bednářová, Klára; Sagi, J.; Vorlíčková, Michaela

    2018-01-01

    Roč. 46, č. 4 (2018), s. 1624-1634 ISSN 1362-4962 R&D Projects: GA ČR(CZ) GA15-06785S; GA ČR GA17-12075S; GA ČR(CZ) GJ17-19170Y; GA MŠk EF15_003/0000477 Institutional support: RVO:68081707 Keywords : pair opening kinetics * g-quadruplex dna Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology

  10. [Comet assay of DNA fragmentation: modification of silver staining for obtaining permanent preparations].

    Science.gov (United States)

    Kamins'kyĭ, V O; Lutsyk, M D; Stoĭka, R S

    2005-01-01

    Modification of comet analysis is proposed for obtaining permanent preparations by DNA staining with silver compounds. The sensitivity of staining is similar to that observed at the treatment by ethidium bromide and other fluorochromes. The advantages of the method are stability of slides and possibility of their reinvestigation by light microscopy. The method does not need expensive fluorescent microscope and lacks contacting with carcinogenic compounds and UV light irradiation.

  11. Quantification of apoptotic DNA fragmentation in a transformed uterine epithelial cell line, HRE-H9, using capillary electrophoresis with laser-induced fluorescence detector (CE-LIF).

    Science.gov (United States)

    Fiscus, R R; Leung, C P; Yuen, J P; Chan, H C

    2001-01-01

    Apoptotic cell death of uterine epithelial cells is thought to play an important role in the onset of menstruation and the successful implantation of an embryo during early pregnancy. Abnormal apoptosis in these cells can result in dysmenorrhoea and infertility. In addition, decreased rate of epithelial apoptosis likely contributes to endometriosis. A key step in the onset of apoptosis in these cells is cleavage of the genomic DNA between nucleosomes, resulting in polynucleosomal-sized fragments of DNA. The conventional technique for assessing apoptotic DNA fragmentation uses agarose (slab) gel electrophoresis (i.e. DNA laddering). However, recent technological advances in the use of capillary electrophoresis (CE), particularly the introduction of the laser-induced fluorescence detector (LIF), has made it possible to perform DNA laddering with improved automation and much greater sensitivity. In the present study, we have further developed the CE-LIF technique by using a DNA standard curve to quantify accurately the amount of DNA in the apoptotic DNA fragments and have applied this new quantitative technique to study apoptosis in a transformed uterine epithelial cell line, the HRE-H9 cells. Apoptosis was induced in the HRE-H9 cells by serum deprivation for 5, 7 and 24 h, resulting in increased DNA fragmentation of 2.2-, 3.1- and 6.2-fold, respectively, above the 0 h or plus-serum controls. This ultrasensitive CE-LIF technique provides a novel method for accurately measuring the actions of pro- or anti-apoptotic agents or conditions on uterine epithelial cell lines. Copyright 2001 Academic Press.

  12. Drug resistance plasmids in Lactobacillus acidophilus and Lactobacillus reuteri.

    OpenAIRE

    Vescovo, M; Morelli, L; Bottazzi, V

    1982-01-01

    Sixteen strains of Lactobacillus reuteri and 20 strains of Lactobacillus acidophilus were tested for resistance to 22 antibiotics by using commercially available sensitivity disks. Evidence suggesting linkage of these resistances to plasmids was obtained by "curing" experiments with acridine dyes and high growth temperatures. Examination of plasmid patterns of agarose gel electrophoresis provided further evidence of loss in plasmid DNA under curing conditions in some of the strains examined.

  13. [Value of specific 16S rDNA fragment of algae in diagnosis of drowning: an experiment with rabbits].

    Science.gov (United States)

    Li, Peng; Xu, Qu-Yi; Chen, Ling; Liu, Chao; Zhao, Jian; Wang, Yu-Zhong; Yu, Zheng-Liang; Hu, Sun-Lin; Wang, Hui-Jun

    2015-08-01

    To establish a method for amplifying specific 16S rDNA fragment of algae related with drowning and test its value in drowning diagnosis. Thirty-five rabbits were randomly divided into 3 the drowning group (n=15), postmortem water immersion group (n=15, subjected to air embolism before seawater immersion), and control group(n=5, with air embolism only). Twenty samples of the liver tissues from human corpses found in water were also used, including 14 diatom-positive and 6 diatom-negative samples identified by microwave digestion-vacuum filtration-automated scanning electron microscopy (MD-VF-Auto SEM). Seven known species of algae served as the control algae (Melosira sp, Nitzschia sp, Synedra sp, Navicula sp, Microcystis sp, Cyclotella meneghiniana, and Chlorella sp). The total DNA was extracted from the tissues and algae to amplify the specific fragment of algae followed by 8% polyacrylamide gelelectrophoresis and sliver-staining. In the drowning group, algae was detected in the lungs (100%), liver (86%), and kidney (86%); algae was detected in the lungs in 2 rabbits in the postmortem group (13%) and none in the control group. The positivity rates of algae were significantly higher in the drowning group than in the postmortem group (Palgae, including sample that had been identified as diatom-negative by MD-VF-Auto SEM. All the 7 control algae samples yielded positive results in PCR. The PCR-based method has a high sensitivity in algae detection for drowning diagnosis and allows simultaneous detection of multiple algae species related with drowning.

  14. Protective effects of Opuntia ficus-indica extract on ram sperm quality, lipid peroxidation and DNA fragmentation during liquid storage.

    Science.gov (United States)

    Allai, Larbi; Druart, Xavier; Öztürk, Mehmet; BenMoula, Anass; Nasser, Boubker; El Amiri, Bouchra

    2016-12-01

    The present study aimed to assess the phenolic composition of the acetone extract from Opuntia ficus indica cladodes (ACTEX) and its effects on ram semen variables, lipid peroxidation and DNA fragmentation during liquid storage at 5°C for up to 72h in skim milk and Tris egg yolk extenders. Semen samples from five rams were pooled extended with Tris-egg yolk (TEY) or skim milk (SM) extenders containing ACTEX (0%, 1%, 2%, 4% and 8%) at a final concentration of 0.8×10 9 sperm/ml and stored for up to 72h at 5°C. The sperm variables were evaluated at different time periods (8, 24, 48 and 72h). Sperm total motility and viability were superior in TEY than in SM whereas the progressive motility, membrane integrity, abnormality and spontaneous lipid peroxidation were greater in SM compared to TEY (P<0.05). The results also indicated that the inclusion of 1% ACTEX in the SM or TEY extender increased the sperm motility, viability, membrane integrity, and decreased the abnormality, lipids peroxidation up to 72h in storage compared to control group. Similarly, even at 72h of storage, 1% ACTEX can efficiently decrease the negative effects of liquid storage on sperm DNA fragmentation (P<0.05). In conclusion, SM and TEY supplemented with 1% of ACTEX can improve the quality of ram semen. Further studies are required to identify the active components in ACTEX involved in its effect on ram sperm preservation. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. [Applylication of new type combined fragments: nrDNA ITS+ nad 1-intron 2 for identification of Dendrobium species of Fengdous].

    Science.gov (United States)

    Geng, Li-xia; Zheng, Rui; Ren, Jie; Niu, Zhi-tao; Sun, Yu-long; Xue, Qing-yun; Liu, Wei; Ding, Xiao-yu

    2015-08-01

    In this study, 17 kinds of Dendrobium species of Fengdous including 39 individuals were collected from 4 provinces. Mitochondrial gene sequences co I, nad 5, nad 1-intron 2 and chloroplast gene sequences rbcL, matK amd psbA-trnH were amplified from these materials, as well as nrDNA ITS. Furthermore, suitable sequences for identification of Dendrobium species of Fengdous were screened by K-2-P and P-distance. The results showed that during the mentioned 7 sequences, nrDNA ITS, nad 1-intron 2 and psbA-trnH which had a high degree of variability could be used to identify Dendrobium species of Fengdous. However, single fragment could not be used to distinguish D. moniliforme and D. huoshanense. Moreover, compared to other combined fragments, new type combined fragments nrDNA ITS+nad 1-intron 2 was more effective in identifying the original plants of Dendrobium species and could be used to identify D. huoshanense and D. moniliforme. Besides, according to the UPGMA tree constructed with nrDNA ITS+nad 1-intron 2, 3 inspected Dendrobium plants were identified as D. huoshanense, D. moniliforme and D. officinale, respectively. This study identified Dendrobium species of Fengdous by combined fragments nrDNA ITS+nad 1-intron 2 for the first time, which provided a more effective basis for identification of Dendrobium species. And this study will be helpful for regulating the market of Fengdous.

  16. Effects of cyanoacrylate fuming, time after recovery, and location of biological material on the recovery and analysis of DNA from post-blast pipe bomb fragments*.

    Science.gov (United States)

    Bille, Todd W; Cromartie, Carter; Farr, Matthew

    2009-09-01

    This study investigated the effects of time, cyanoacrylate fuming, and location of the biological material on DNA analysis of post-blast pipe bomb fragments. Multiple aliquots of a cell suspension (prepared by soaking buccal swabs in water) were deposited on components of the devices prior to assembly. The pipe bombs were then deflagrated and the fragments recovered. Fragments from half of the devices were cyanoacrylate fumed. The cell spots on the fragments were swabbed and polymerase chain reaction/short tandem repeat analysis was performed 1 week and 3 months after deflagration. A significant decrease in the amount of DNA recovered was observed between samples collected and analyzed within 1 week compared with the samples collected and analyzed 3 months after deflagration. Cyanoacrylate fuming did not have a measurable effect on the success of the DNA analysis at either time point. Greater quantities of DNA were recovered from the pipe nipples than the end caps. Undeflagrated controls showed that the majority (>95%) of the DNA deposited on the devices was not recovered at a week or 3 months.

  17. Diversity and homogeneity among small plasmids of Aeromonas salmonicida subsp. salmonicida linked with geographical origin

    Directory of Open Access Journals (Sweden)

    Sabrina A Attéré

    2015-11-01

    Full Text Available Furunculosis, which is caused by Aeromonas salmonicida subsp. salmonicida, is a major salmonid disease in fish farms worldwide. Several plasmids found in this bacterium confer phenotypes such drug resistance and virulence. Small plasmids (pAsa1, pAsa2, pAsa3, and pAsal1 related to ColE1- and ColE2-type replicons are usually present in its normal plasmidome. In the present study, with the objective to investigate if these plasmids display particularities related to the origin of the isolates bearing them, a total of 153 isolates, including 78 new and 75 previously described, were analyzed for the presence of small plasmids by PCR and DNA restriction fragment profiling. A geographical dichotomy between Canadian and European isolates for their propensity to do not have pAsa3 or pAsal1 was found. In addition, the genotyping analysis led to the identification of two European isolates harboring an unusual pAsal1. An investigation by next-generation sequencing (NGS of these two isolates shed light on two pAsal1 variants (pAsal1C and pAsal1D. As with pAsal1B, another pAsal1 variant previously described, these two new variants bore a second insertion sequence (ISAS5 in addition to the usual ISAS11. The characterization of these variants suggested that they could predominate over the wild-type pAsal1 in stressful conditions such as growth at temperatures of 25°C and above. To obtain a comprehensive portrait of the mutational pressure on small plasmids, 26 isolates whose DNA had been sequenced by NGS were investigated. pAsa3 and pAsal1 were more prone to mutations than pAsa1 and pAsa2, especially in the mobA gene, which encodes a relaxase and a primase. Lastly, the average copy number of each plasmid per cell was assessed using raw sequencing data. A clear trend with respect to the relative proportion per cell of each plasmid was identified. Our large-scale study revealed a geographical dichotomy in small plasmid repertoire in addition to a clear trend

  18. Plasmid marker rescue transformation proceeds by breakage-reunion in Bacillus subtilis

    International Nuclear Information System (INIS)

    Weinrauch, Y.; Dubnau, D.

    1987-01-01

    Bacillus subtilis carrying a plasmid which replicates with a copy number of about 1 was transformed with linearized homologous plasmid DNA labeled with the heavy isotopes 2 H and 15 N, in the presence of 32 Pi and 6-(p-hydroxyphenylazo)-uracil to inhibit DNA replication. Plasmid DNA was isolated from the transformed culture and fractionated in cesium chloride density gradients. The distribution of total and donor plasmid DNA was examined, using specific hybridization probes. The synthesis of new DNA, associated with the integration of donor moiety, was also monitored. Donor-specific sequences were present at a density intermediate between that of light and hybrid DNA. This recombinant DNA represented 1.4% of total plasmid DNA. The latter value corresponded well with the transforming activity (1.7%) obtained for the donor marker. Newly synthesized material associated with plasmid DNA at the recombinant density amounted to a minor portion of the recombinant plasmid DNA. These data suggest that, like chromosomal transformation, plasmid marker rescue transformation does not require replication for the integration of donor markers and, also like chromosomal transformation, proceeds by a breakage-reunion mechanism. The extent of donor DNA replacement of recipient DNA per plasmid molecule of 54 kilobases (27 kilobase pairs) was estimated as 16 kilobases

  19. Investigation of interaction between magnetic silica particles and lambda phage DNA fragment.

    Science.gov (United States)

    Smerkova, Kristyna; Dostalova, Simona; Vaculovicova, Marketa; Kynicky, Jindrich; Trnkova, Libuse; Kralik, Miroslav; Adam, Vojtech; Hubalek, Jaromir; Provaznik, Ivo; Kizek, Rene

    2013-12-01

    Nucleic acids belong to the most important molecules and therefore the understanding of their properties, function and behavior is crucial. Even though a range of analytical and biochemical methods have been developed for this purpose, one common step is essential for all of them - isolation of the nucleic acid from the from complex sample matrix. The use of magnetic particles for the separation of nucleic acids has many advantages over other isolation methods. In this study, an isolation procedure for extraction of DNA was optimized. Each step of the isolation process including washing, immobilization and elution was optimized and therefore the efficiency was increased from 1.7% to 28.7% and the total time was shortened from 75 to 30min comparing to the previously described method. Quantification of the particular parameter influence was performed by square-wave voltammetry using hanging drop mercury electrode. Further, we compared the optimized method with standard chloroform extraction and applied on isolation of DNA from Staphylococcus aureus and Escherichia coli. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. Analysis of the mycoplasma genome by recombinant DNA technology

    DEFF Research Database (Denmark)

    Christiansen, C; Frydenberg, Jane; Christiansen, G

    1984-01-01

    A library of DNA fragments from Mycoplasma sp. strain PG50 has been made in the vector pBR325. Analysis in Escherichia coli minicells of randomly picked clones from this library demonstrated that many plasmids can promote synthesis of mycoplasma protein in the E. coli genetic background. Screening....... The DNA sequence of 16S rRNA and the surrounding control regions has been determined....

  1. Towards the onset of fruit tree growing north of the Alps: ancient DNA from waterlogged apple (Malus sp.) seed fragments.

    Science.gov (United States)

    Schlumbaum, Angela; van Glabeke, Sabine; Roldan-Ruiz, Isabel

    2012-01-20

    Wild apples (Malus sp.) have been a major food source in the northern Alpine region since prehistory and their use is well understood. The onset of deliberate fruit tree growing in the area is, however, less clear. It is generally assumed that horticulture was practised in Roman times, but it might be even earlier. In the archaeological record seed testa and pericarp remains are particularly frequent at sites with waterlogged preservation such as lakeshore settlements or wells, pits and ditches, but the distinction between wild and domestic plants is not morphologically possible. With waterlogged remains being one main source of information about past fruit cultivation, we have tested the feasibility of analysing ancient DNA from waterlogged preserved bulk samples of testa fragments. We studied apple seeds from three Neolithic and three Roman sites with waterlogged preservation in the Alpine foreland. Chloroplast markers failed in all samples, but nuclear ITS1 (internal transcribed spacer region 1) of the ribosomal DNA was successfully typed in two Roman samples from the site Oedenburg/Biesheim-Kunheim (Haut-Rhin, F). The retrieved ITS1 sequences are identical to each other and are shared with wild Malus sylvestris and Malus sieversii, and with domestic apple cultivars, supporting the potential of using waterlogged remains for identifying the genetic status of apple diachronically. Copyright © 2011 Elsevier GmbH. All rights reserved.

  2. Rapid identification and classification of bacteria by 16S rDNA restriction fragment melting curve analyses (RFMCA).

    Science.gov (United States)

    Rudi, Knut; Kleiberg, Gro H; Heiberg, Ragnhild; Rosnes, Jan T

    2007-08-01

    The aim of this work was to evaluate restriction fragment melting curve analyses (RFMCA) as a novel approach for rapid classification of bacteria during food production. RFMCA was evaluated for bacteria isolated from sous vide food products, and raw materials used for sous vide production. We identified four major bacterial groups in the material analysed (cluster I-Streptococcus, cluster II-Carnobacterium/Bacillus, cluster III-Staphylococcus and cluster IV-Actinomycetales). The accuracy of RFMCA was evaluated by comparison with 16S rDNA sequencing. The strains satisfying the RFMCA quality filtering criteria (73%, n=57), with both 16S rDNA sequence information and RFMCA data (n=45) gave identical group assignments with the two methods. RFMCA enabled rapid and accurate classification of bacteria that is database compatible. Potential application of RFMCA in the food or pharmaceutical industry will include development of classification models for the bacteria expected in a given product, and then to build an RFMCA database as a part of the product quality control.

  3. Episodic air pollution is associated with increased DNA fragmentation in human sperm without other changes in semen quality

    Energy Technology Data Exchange (ETDEWEB)

    Rubes, J.; Selevan, S.G.; Evenson, D.P.; Zudova, D.; Vozdova, M.; Zudova, Z.; Robbins, W.A.; Perreault, S.D. [US EPA, Research Triangle Park, NC (United States)

    2005-10-01

    This study examined potential associations between exposure to episodes of air pollution and alterations in semen quality. The air pollution, resulting from combustion of coal for industry and home heating in the Teplice district of the Czech Republic, was much higher during the winter than at other times of year with peaks exceeding US air quality standards. Young men from Teplice were sampled up to seven times over 2 years allowing evaluation of semen quality after periods of exposure to both low and high air pollution. Routine semen analysis (sperm concentration, motility and morphology) and tests for sperm aneuploidy and chromatin integrity were performed, comparing measurements within each subject. Exposure was classified as high or low based on data from ambient air pollution monitoring. Using repeated measures analysis, a significant association was found between exposure to periods of high air pollution (at or above the upper limit of US air quality standards) and the percentage of sperm with DNA fragmentation according to sperm chromatin structure assay (SCSA). Other semen measures were not associated with air pollution. It is concluded that exposure to intermittent air pollution may result in sperm DNA damage and thereby increase the rates of male-mediated infertility, miscarriage, and other adverse reproductive outcomes.

  4. DNA double-strand breaks in mammalian cells exposed to γ-rays and very heavy ions. Fragment-size distributions determined by pulsed-field gel electrophoresis

    International Nuclear Information System (INIS)

    Kraxenberger, F.; Friedl, A.A.; Eckardt-Schupp, F.; Weber, K.J.; Flentje, M.; Quicken, P.; Kellerer, A.M.; Ludwig-Maximilians University, Munich

    1998-01-01

    The spatial distribution of DNA double-strand breaks (DSB) was assessed after treatment of mammalian cells (V79) with densely ionizing radiation. Cells were exposed to beams of heavy charged particles (calcium ions: 6.9 MeV/u, 2.1.10 3 keV/μm; uranium ions: 9.0 MeV/u, 1.4.10 4 keV/μm) at the linear accelerator UNILAC of GSI, Darmstadt. DNA was isolated in agarose plugs and subjected to pulsed-field gel electrophoresis under conditions that separated DNA fragments of size 50 kbp to 5 Mbp. The measured fragment distributions were compared to those obtained after γ-irradiation and were analyzed by means of a convolution and a deconvolution technique. In contrast to the finding for γ-radiation, the distributions produced by heavy ions do not correspond to the random breakage model. Their marked overdispersion and the observed excess of short fragments reflect spatial clustering of DSB that extends over large regions of the DNA, up to several mega base pairs (Mbp). At fluences of 0.75 and 1.5/μm 2 , calcium ions produce nearly the same shape of fragment spectrum, merely with a difference in the amount of DNA entering the gel; this suggests that the DNA is fragmented by individual calcium ions. At a fluence of 0.8/μm 2 uranium ions produce a profile that is shifted to smaller fragment sizes in comparison to the profile obtained at a fluence of 0.4/μm 2 ; this suggests cumulative action of two separate ions in the formation of fragments. These observations are not consistent with the expectation that the uranium ions, with their much larger LET, should be more likely to produce single particle action than the calcium ions. However, a consideration of the greater lateral extension of the tracks of the faster uranium ions explains the observed differences; it suggests that the DNA is closely coiled so that even DNA locations several Mbp apart are usually not separated by less than 0.1 or 0.2 μm. (orig.)

  5. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes

    Science.gov (United States)

    Masuyama, Kotoka; Shojo, Hideki; Nakanishi, Hiroaki; Inokuchi, Shota; Adachi, Noboru

    2017-01-01

    Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female) were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted “bidirectional analysis,” which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples) whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples. PMID:28052096

  6. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes.

    Directory of Open Access Journals (Sweden)

    Kotoka Masuyama

    Full Text Available Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted "bidirectional analysis," which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples.

  7. Investigation of DNA double strand breaks induced by α particle and 7Li ions

    International Nuclear Information System (INIS)

    Kong Fuquan; Cai Minghui; Zhao Kui; Guo Jiyu; Ni Meinan; Sui Li; Yang Mingjian; Zhan Yong

    2006-01-01

    α particles and Lithium ions were produced by 241 Am radiation source and HI-13 tandem accelerator at China Institute of Atomic Energy (CIAE) respectively to simulate ionizing radiation in Boron Neutron Capture Therapy (BNCT) process. Plasmid DNA in aqueous solution was irradiated and the DNA fragments were imaged by AFM. The image software ImageJ was used to measure the length of DNA fragments. The length distribution and conformation changes of DNA fragments were assessed. Our results showed that the mean length of DNA fragments as well as the fraction of linear and open circle DNA molecules decreased by dose. At higher dose, Lithium ions induced more pronounced relative biological effects than α particles. (author)

  8. Characterization of Mycoplasma hyosynoviae strains by amplified fragment length polymorphism analysis, pulsed-field gel electrophoresis and 16S ribosomal DNA sequencing

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, N.F.; Ahrens, Peter

    2002-01-01

    , were investigated by analysis of amplified fragment length polymorphisms of the Bgl II and Mfe I restriction sites and by pulsed-field gel electrophoresis of a Bss HII digest of chromosomal DNA. Both methods allowed unambiguous differentiation of the analysed strains and showed similar discriminatory...

  9. Plasmid and chromosome segregation in prokaryotes

    DEFF Research Database (Denmark)

    Møller-Jensen, Jakob; Bugge Jensen, Rasmus; Gerdes, Kenn

    2000-01-01

    Recent major advances in the understanding of prokaryotic DNA segregation have been achieved by using fluorescence microscopy to visualize the localization of cellular components. Plasmids and bacterial chromosomes are partitioned in a highly dynamic fashion, suggesting the presence of a mitotic...

  10. A Qualitative and Quantitative Assay to Study DNA/Drug Interaction ...

    African Journals Online (AJOL)

    Purpose: To explore the use of restriction inhibition assay (RIA) to study the binding specificity of some anticancer drugs. Methods: A 448 bp DNA fragment derived from pBCKS+ plasmid (harboring the polylinker region with multiple restriction endonuclease sites) was used as a template for sequence selective inhibition of ...

  11. DNA fragmentation and membrane damage of bocachico Prochilodus magdalenae (Ostariophysi: Prochilodontidae sperm following cryopreservation with dimethylsulfoxide and glucose

    Directory of Open Access Journals (Sweden)

    José Gregorio Martínez

    2012-09-01

    Full Text Available The endangered bocachico Prochilodus magdalenae is a native freshwater fish of Colombia, the most captured species locally and one of the most important species for ex-situ conservation (germplasm banks. The aim of this study was to examine the effect of three concentrations of Dimethylsulfoxide (DMSO (5%, 10%, 15% and three of glucose (305, 333, 361 mM in the extender on spermatic DNA fragmentation (F-DNA (by Halomax®, Chromatin dispersion and membrane damage (D-Me (by eosin-nigrosin staining. After assessment of sperm quality by computer analysis of motility, one part of semen from males was diluted separately with three parts of extender and filled into 0.5 ml straws. Freezing was carried out in liquid nitrogen vapor dry shipper for 30 minutes and thawed at 60ºC for 8 seconds in a water bath and evaluated for the percentage of cells found with F-DNA and D-Me. The results demonstrated that cryopreservation causes greater F-DNA (13.62 ± 1.6% to 28.91 ± 3.25 and D-Me (24.27 ± 1.1% to 58.33 ± 2.81% when compared with pre-freezing semen (PFS (6.71 ± 1.54% and 2.34 ± 0.5%, respectively for F-DNA and D-Me. A significant interaction was found between DMSO and glucose concentration in this experiment. Use of extender: 10% DMSO + 305 mM glucose + 12% chicken egg yolk and, 10% DMSO + 333 mM glucose + 12% chicken egg yolk, allow for lower F-DNA and D-Me during cryopreservation of bocachico semen. A high correlation between F-DNA and D-Me was found (r = 0.771.O curimba Prochilodus magdalenae, é uma espécie nativa de água doce da Colômbia ameaçada de extinção, sendo a mais capturada localmente e uma das mais importantes para a conservação ex-situ (bancos de germoplasma. O objetivo deste estudo foi avaliar o efeito de três concentrações de dimetilsulfóxido (DMSO (5%, 10%, 15% e três de glicose (305, 333, 361 mM no diluente sobre a fragmentação do ADN espermático (F-DNA (através de Halomax®, dispersão da cromatina e danos em

  12. The technology of large-scale pharmaceutical plasmid purification ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-01-04

    Jan 4, 2010 ... DNA vaccine, the cost of purification must be decreased. Although commonly .... Three mice were killed every 4 days interval. Tissues of heart, liver, .... Now, methods such as chromatography had good prospects in plasmid ...

  13. Chlamydial plasmids and bacteriophages.

    Science.gov (United States)

    Pawlikowska-Warych, Małgorzata; Śliwa-Dominiak, Joanna; Deptuła, Wiesław

    2015-01-01

    Chlamydia are absolute pathogens of humans and animals; despite being rather well recognised, they are still open for discovery. One such discovery is the occurrence of extrachromosomal carriers of genetic information. In prokaryotes, such carriers include plasmids and bacteriophages, which are present only among some Chlamydia species. Plasmids were found exclusively in Chlamydia (C.) trachomatis, C. psittaci, C. pneumoniae, C. suis, C. felis, C. muridarum and C. caviae. In prokaryotic organisms, plasmids usually code for genes that facilitate survival of the bacteria in the environment (although they are not essential). In chlamydia, their role has not been definitely recognised, apart from the fact that they participate in the synthesis of glycogen and encode proteins responsible for their virulence. Furthermore, in C. suis it was evidenced that the plasmid is integrated in a genomic island and contains the tetracycline-resistance gene. Bacteriophages specific for chlamydia (chlamydiaphages) were detected only in six species: C. psittaci, C. abortus, C. felis, C. caviae C. pecorum and C. pneumoniae. These chlamydiaphages cause inhibition of the developmental cycle, and delay transformation of reticulate bodies (RBs) into elementary bodies (EBs), thus reducing the possibility of infecting other cells in time. Plasmids and bacteriophages can be used in the diagnostics of chlamydioses; although especially in the case of plasmids, they are already used for detection of chlamydial infections. In addition, bacteriophages could be used as therapeutic agents to replace antibiotics, potentially addressing the problem of increasing antibiotic-resistance among chlamydia.

  14. Anethole induces apoptotic cell death accompanied by reactive oxygen species production and DNA fragmentation in Aspergillus fumigatus and Saccharomyces cerevisiae.

    Science.gov (United States)

    Fujita, Ken-Ichi; Tatsumi, Miki; Ogita, Akira; Kubo, Isao; Tanaka, Toshio

    2014-02-01

    trans-Anethole (anethole), a major component of anise oil, has a broad antimicrobial spectrum, and antimicrobial activity that is weaker than that of other antibiotics on the market. When combined with polygodial, nagilactone E, and n-dodecanol, anethole has been shown to possess significant synergistic antifungal activity against a budding yeast, Saccharomyces cerevisiae, and a human opportunistic pathogenic yeast, Candida albicans. However, the antifungal mechanism of anethole has not been completely determined. We found that anethole stimulated cell death of a human opportunistic pathogenic fungus, Aspergillus fumigatus, in addition to S. cerevisiae. The anethole-induced cell death was accompanied by reactive oxygen species production, metacaspase activation, and DNA fragmentation. Several mutants of S. cerevisiae, in which genes related to the apoptosis-initiating execution signals from mitochondria were deleted, were resistant to anethole. These results suggest that anethole-induced cell death could be explained by oxidative stress-dependent apoptosis via typical mitochondrial death cascades in fungi, including A. fumigatus and S. cerevisiae. © 2014 FEBS.

  15. Nucleotide Sequences and Comparison of Two Large Conjugative Plasmids from Different Campylobacter species

    National Research Council Canada - National Science Library

    Batchelor, Roger A; Pearson, Bruce M; Friis, Lorna M; Guerry, Patricia; Wells, Jerry M

    2004-01-01

    .... Both plasmids are mosaic in structure, having homologues of genes found in a variety of different commensal and pathogenic bacteria, but nevertheless, showed striking similarities in DNA sequence...

  16. 125IdUrd-induced chromosome fragments, assayed by premature chromosome condensation, and DNA double-strand breaks have similar repair kinetics in G1-phase CHO-cells

    International Nuclear Information System (INIS)

    Iliakis, George; Pantelias, G.E.; Okayasu, Ryuichi; Seaner, Robert

    1987-01-01

    The effect of 125 I-decay on cell lethality, and induction of chromosome and DNA damage, was studied in synchronous non-cycling, G 1 -phase CHO-cells. Neutral filter elution was used to assay repair of DNA double-strand breaks (dsbs), and premature chromosome condensation was used to assay repair of chromosome fragments and induction of ring chromosomes. The results indicate very little repair at the cell survival level (repair of PLD). At the DNA level an efficient repair of DNA dsbs was observed, with kinetics similar to those observed after exposure to X-rays. At the chromosome level a fast repair of prematurely condensed chromosome fragments was observed, with a concomitant increase in the number of ring chromosomes induced. The repair kinetics of chromosome fragments and DNA dsbs were very similar, suggesting that DNA dsbs may underlie chromosome fragmentation. (author)

  17. Flow-cytometric analysis of mouse embryonic stem cell lipofection using small and large DNA constructs.

    Science.gov (United States)

    McLenachan, Samuel; Sarsero, Joseph P; Ioannou, Panos A

    2007-06-01

    Using the lipofection reagent LipofectAMINE 2000 we have examined the delivery of plasmid DNA (5-200 kb) to mouse embryonic stem (mES) cells by flow cytometry. To follow the physical uptake of lipoplexes we labeled DNA molecules with the fluorescent dye TOTO-1. In parallel, expression of an EGFP reporter cassette in constructs of different sizes was used as a measure of nuclear delivery. The cellular uptake of DNA lipoplexes is dependent on the uptake competence of mES cells, but it is largely independent of DNA size. In contrast, nuclear delivery was reduced with increasing plasmid size. In addition, linear DNA is transfected with lower efficiency than circular DNA. Inefficient cytoplasmic trafficking appears to be the main limitation in the nonviral delivery of large DNA constructs to the nucleus of mES cells. Overcoming this limitation should greatly facilitate functional studies with large genomic fragments in embryonic stem cells.

  18. Synthesis and structure elucidation of a copper(II) Schiff-base complex: in vitro DNA binding, pBR322 plasmid cleavage and HSA binding studies.

    Science.gov (United States)

    Tabassum, Sartaj; Ahmad, Musheer; Afzal, Mohd; Zaki, Mehvash; Bharadwaj, Parimal K

    2014-11-01

    New copper(II) complex with Schiff base ligand 4-[(2-Hydroxy-3-methoxy-benzylidene)-amino]-benzoic acid (H₂L) was synthesized and characterized by spectroscopic and analytical and single crystal X-ray diffraction studies which revealed that the complex 1 exist in a distorted octahedral environment. In vitro CT-DNA binding studies were performed by employing different biophysical technique which indicated that the 1 strongly binds to DNA in comparison to ligand via electrostatic binding mode. Complex 1 cleaves pBR322 DNA via hydrolytic pathway and recognizes minor groove of DNA double helix. The HSA binding results showed that ligand and complex 1 has ability to quench the fluorescence emission intensity of Trp 214 residue available in the subdomain IIA of HSA. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Hair Dye–DNA Interaction: Plausible Cause of Mutation

    Directory of Open Access Journals (Sweden)

    Swati Maiti

    2015-09-01

    Full Text Available Hair dye is one of the most popular cosmetic products which are used more widely and frequently to improve an individual’s appearance. Although the genotoxic effects of dye ingredients are widely reported, hair dye in its usable form is not reported extensively. In this contribution, we report the possible mode of interaction of hair dye with DNA which leads to genotoxicity. The effect of dye DNA interaction was studied on the most popular and globally used hair dye with Calf Thymus DNA and plasmid DNA. This interaction of dye DNA was studied by spectroscopic analyses and gel electrophoresis. The result had shown positive interaction of dye with DNA. Gel electrophoresis study confirms the binding of dye with DNA which results in linearization and fragmentation of the plasmid DNA. Dye–DNA interaction causes fragmentation and oxidation of DNA in absence of any catalyst, implies high toxicity of commercial hair dyes. Thus, it can be deduced from the present studies that hair dye in its usable form may lead to its penetration through skin affecting genomic DNA possesses genotoxic property and can be treated as one of the most common mutagen.

  20. Differential Salt-Induced Dissociation of the p53 Protein Complexes with Circular and Linear Plasmid DNA Substrates Suggest Involvement of a Sliding Mechanism

    Czech Academy of Sciences Publication Activity Database

    Šebest, Peter; Brázdová, Marie; Fojta, Miroslav; Pivoňková, Hana

    2015-01-01

    Roč. 16, č. 2 (2015), s. 3163-3177 E-ISSN 1422-0067 R&D Projects: GA ČR(CZ) GAP301/11/2076; GA ČR(CZ) GBP206/12/G151 Institutional support: RVO:68081707 Keywords : TUMOR-SUPPRESSOR P53 * CISPLATIN -DAMAGED DNA * SUPERCOILED DNA Subject RIV: BO - Biophysics Impact factor: 3.257, year: 2015

  1. Development of DNA probes for Candida albicans

    International Nuclear Information System (INIS)

    Cheung, L.L.; Hudson, J.B.

    1988-01-01

    An attempt was made to produce DNA probes that could be used as a rapid and efficient means of detecting candidiasis (invasive Candida infection) in immunocompromised patients. Whole DNA from Candida albicans was digested with restriction endonuclease, and the resulting fragments were randomly cloned into a plasmid vector. Several recombinant plasmids were evaluated for cross-hybridization to various other Candida species, other fungal DNAs, and to nonfungal DNAs. Cross reactions were observed between the probes and different yeasts, but none with unrelated DNAs. Some recombinants were genus-specific, and two of these were applied to the analysis of C. albicans growth curves. It became evident that, although both 32 P- and biotin-labelled probes could be made quite sensitive, a possible limitation in their diagnostic potential was the poor liberation of Candida DNA from cells. Thus, better methods of treatment of clinical specimens will be required before such probes will be useful in routine diagnosis

  2. Development of DNA probes for Candida albicans

    Energy Technology Data Exchange (ETDEWEB)

    Cheung, L.L.; Hudson, J.B.

    1988-07-01

    An attempt was made to produce DNA probes that could be used as a rapid and efficient means of detecting candidiasis (invasive Candida infection) in immunocompromised patients. Whole DNA from Candida albicans was digested with restriction endonuclease, and the resulting fragments were randomly cloned into a plasmid vector. Several recombinant plasmids were evaluated for cross-hybridization to various other Candida species, other fungal DNAs, and to nonfungal DNAs. Cross reactions were observed between the probes and different yeasts, but none with unrelated DNAs. Some recombinants were genus-specific, and two of these were applied to the analysis of C. albicans growth curves. It became evident that, although both /sup 32/P- and biotin-labelled probes could be made quite sensitive, a possible limitation in their diagnostic potential was the poor liberation of Candida DNA from cells. Thus, better methods of treatment of clinical specimens will be required before such probes will be useful in routine diagnosis.

  3. Chondroitin sulfate-polyethylenimine copolymer-coated superparamagnetic iron oxide nanoparticles as an efficient magneto-gene carrier for microRNA-encoding plasmid DNA delivery

    Science.gov (United States)

    Lo, Yu-Lun; Chou, Han-Lin; Liao, Zi-Xian; Huang, Shih-Jer; Ke, Jyun-Han; Liu, Yu-Sheng; Chiu, Chien-Chih; Wang, Li-Fang

    2015-04-01

    MicroRNA-128 (miR-128) is an attractive therapeutic molecule with powerful glioblastoma regulation properties. However, miR-128 lacks biological stability and leads to poor delivery efficacy in clinical applications. In our previous study, we demonstrated two effective transgene carriers, including polyethylenimine (PEI)-decorated superparamagnetic iron oxide nanoparticles (SPIONs) as well as chemically-conjugated chondroitin sulfate-PEI copolymers (CPs). In this contribution, we report optimized conditions for coating CPs onto the surfaces of SPIONs, forming CPIOs, for magneto-gene delivery systems. The optimized weight ratio of the CPs and SPIONs is 2 : 1, which resulted in the formation of a stable particle as a good transgene carrier. The hydrodynamic diameter of the CPIOs is ~136 nm. The gel electrophoresis results demonstrate that the weight ratio of CPIO/DNA required to completely encapsulate pDNA is >=3. The in vitro tests of CPIO/DNA were done in 293 T, CRL5802, and U87-MG cells in the presence and absence of an external magnetic field. The magnetofection efficiency of CPIO/DNA was measured in the three cell lines with or without fetal bovine serum (FBS). CPIO/DNA exhibited remarkably improved gene expression in the presence of the magnetic field and 10% FBS as compared with a gold non-viral standard, PEI/DNA, and a commercial magnetofection reagent, PolyMag/DNA. In addition, CPIO/DNA showed less cytotoxicity than PEI/DNA and PolyMag/DNA against the three cell lines. The transfection efficiency of the magnetoplex improved significantly with an assisted magnetic field. In miR-128 delivery, a microRNA plate array and fluorescence in situ hybridization were used to demonstrate that CPIO/pMIRNA-128 indeed expresses more miR-128 with the assisted magnetic field than without. In a biodistribution test, CPIO/Cy5-DNA showed higher accumulation at the tumor site where an external magnet is placed nearby.MicroRNA-128 (miR-128) is an attractive therapeutic molecule

  4. Investigation of diversity of plasmids carrying the blaTEM-52 gene

    DEFF Research Database (Denmark)

    Bielak, Eliza Maria; Bergenholtz, Rikke D.; Jørgensen, Mikael Skaanning

    2011-01-01

    OBJECTIVES: To investigate the diversity of plasmids that carry blaTEM-52 genes among Escherichia coli and Salmonella enterica originating from animals, meat products and humans. METHODS: A collection of 22 blaTEM-52-encoding plasmids was characterized by restriction fragment length polymorphism...... of self-transfer to a plasmid-free E. coli recipient. CONCLUSIONS: The blaTEM-52 gene found in humans could have been transmitted on transferable plasmids originating from animal sources. Some of the blaTEM-52 plasmids carry replicons that differ from the classical ones. Two novel replicons were detected...

  5. Application of methylation in improving plasmid transformation into Helicobacter pylori.

    Science.gov (United States)

    Zhao, Huilin; Xu, Linlin; Rong, Qianyu; Xu, Zheng; Ding, Yunfei; Zhang, Ying; Wu, Yulong; Li, Boqing; Ji, Xiaofei

    2018-05-23

    Helicobacter pylori is an important gastrointestinal pathogen. Its strains possess different levels of powerful restriction modification systems, which are significant barriers to genetic tools used for studying the role of functional genes in its pathogenesis. Methylating vectors in vitro was reported as an alternative to overcome this barrier in several bacteria. In this study we used two H. pylori-E. coli shuttle plasmids and several single/double-crossover homologous recombination gene-targeting plasmids, to test the role of methylation in H. pylori transformation. According to our results, transformants could be obtained only after shuttle plasmids were methylated before transformation. It is helpful in gene complementation and over-expression although at a low frequency. The frequency of gene-targeting transformation was also increased after methylation, especially for the single-crossover recombination plasmids, the transformants of which could only be obtained after methylation. For the double-crossover recombination targeting plasmids, the initial yield of transformants was 0.3-0.8 × 10 2 CFUs per microgram plasmid DNA. With the help of methylation, the yield was increased to 0.4-1.3 × 10 2 CFUs per microgram plasmid DNA. These results suggest that in vitro methylation can improve H. pylori transformation by different plasmids, which will benefit the pathogenic mechanism research. Copyright © 2018. Published by Elsevier B.V.

  6. Damage to plasmid DNA produced by 60Co-gamma radiation and subsequent repair processes in E. coli with and without SOS induction

    International Nuclear Information System (INIS)

    Bien, M.

    1986-01-01

    This study was carried out to provide information on the question as to whether radiation-induced separation of double-stranded DNA in E. coli is followed by repair processes leading to the formation of replicable material. For the detection of those double-strand breaks, E. coli was first transformed using enzymatically linearised dBR 322-DNA. This served as a reference standard to compare the transformations using radiated DNA. DNA was either exposed to increasing doses of 60 Co-gamma radiation or separated into one oc-fraction and one lin-fraction following exposure to 30 Gy. The DNA samples thus obtained were then used to transform three different strains of E. coli (wild strain, SFX, SFXrecA - ). In order to improve the repair yield, the cells were additionally SOS-induced using ultraviolet radiation. The mutation rates were a measure of the number of errors occurring during the various repair processes. Restriction analysis was carried out to characterise the resulting mutants in greater detail. (orig./MG) [de

  7. Ternary complex of plasmid DNA with NLS-Mu-Mu protein and cationic niosome for biocompatible and efficient gene delivery: a comparative study with protamine and lipofectamine.

    Science.gov (United States)

    Nematollahi, Mohammad Hadi; Torkzadeh-Mahanai, Masoud; Pardakhty, Abbas; Ebrahimi Meimand, Hossein Ali; Asadikaram, Gholamreza

    2017-10-28

    Non-viral gene delivery methods are considered due to safety and simplicity in human gene therapy. Since the use of cationic peptide and niosome represent a promising approach for gene delivery purposes we used recombinant fusion protein and cationic niosome as a gene carrier. A multi-domain fusion protein including nuclear localization motif (NLS) and two DNA-binding (Mu) domains, namely NLS-Mu-Mu (NMM) has been designed, cloned and expressed in E. coli DE3 strain. Afterward, the interested protein was purified by affinity chromatography. Binary vectors based on protein/DNA and ternary vectors based on protein/DNA/niosome were prepared. Protamine was used as a control. DNA condensing properties of NMM and protamine were evaluated by various experiments. Furthermore, we examined cytotoxicity, hemolysis and transfection potential of the binary and ternary complexes in HEK293T and MCF-7 cell lines. Protamine and Lipofectamine™2000 were used as positive controls, correspondingly. The recombinant NMM was expressed and purified successfully and DNA was condensed efficiently at charge ratios that were not harmful to cells. Peptidoplexes showed transfection efficiency (TE) but ternary complexes had higher TE. Additionally, NMM ternary complex was more efficient compared to protamine ternary vectors. Our results showed that niosomal ternary vector of NMM is a promising non-viral gene carrier to achieve an effective and safe carrier system for gene therapy.

  8. Influence of anoxia on the induction of mutations by phenylalanine radicals during gamma-irradiation of plasmid DNA in aqueous solution.

    Science.gov (United States)

    Kuipers, Gitta K; Slotman, Ben J; Reitsma-Wijker, Carola A; van Andel, Rob J; Poldervaart, Hester A; Lafleur, M Vincent M

    2004-12-21

    When DNA is irradiated in aqueous solution, most of the damage is inflicted by water-derived radicals. This is called the indirect effect of ionizing radiation. However in whole cells not only the primary formed water radicals play a role, because some cellular compounds form secondary radicals which can also damage DNA. It is known that the amino acid phenylalanine is able to react with water radicals, resulting in the production of secondary phenylalanine radicals which can damage and inactivate DNA. In a previous study the influence of the presence of phenylalanine during gamma-irradiation of DNA in aqueous solution under oxic conditions was studied. Under anoxic irradiation conditions different amounts and types of reactive water-derived radicals are formed compared to oxic conditions and also different phenylalanine radicals are formed. Therefore, this study examines the influence of the presence of phenylalanine under anoxic conditions on the gamma-radiation-induced mutation spectrum. The results indicate that phenylalanine radicals are damaging to DNA, but less effective compared to primary water radicals. On the mutational level, in the presence of phenylalanine radicals under anoxic conditions, the amount of mutations on G:C base pairs was significantly decreased as compared to oxic conditions. Furthermore, the results of this study indicate that nucleotide excision repair is involved in repair of both inactivating and mutagenic damage induced by phenylalanine radicals under anoxic conditions.

  9. A DNA fragment from Xq21 replaces a deleted region containing the entire FVIII gene in a severe hemophilia A patient

    Energy Technology Data Exchange (ETDEWEB)

    Murru, S.; Casula, L.; Moi, P. [Insituto di Clinica e Biologia dell` Eta Evolutiva, Cagliari (Italy)] [and others

    1994-09-15

    In this paper the authors report the molecular characterization of a large deletion that removes the entire Factor VIII gene in a severe hemophilia A patient. Accurate DNA analysis of the breakpoint region revealed that a large DNA fragment replaced the 300-kb one, which was removed by the deletion. Pulsed-field gel electrophoresis analysis revealed that the size of the inserted fragment is about 550 kb. In situ hybridization demonstrated that part of the inserted region normally maps to Xq21 and to the tip of the short arm of the Y chromosome (Yp). In this patient this locus is present both in Xq21 and in Xq28, in addition to the Yp, being thus duplicated in the X chromosome. Sequence analysis of the 3` breakpoint suggested that an illegitimate recombination is probably the cause of this complex rearrangement. 52 refs., 7 figs.

  10. Relationships between sperm DNA fragmentation, sperm apoptotic markers and serum levels of CB-153 and p,p'-DDE in European and Inuit populations

    DEFF Research Database (Denmark)

    Stronati, A; Manicardi, G C; Cecati, M

    2006-01-01

    Persistent organochlorine pollutants (POPs) are suspected to interfere with hormone activity and the normal homeostasis of spermatogenesis. We investigated the relationships between sperm DNA fragmentation, apoptotic markers identified on ejaculated spermatozoa and POP levels in the blood of 652...... adult males (200 Inuits from Greenland, 166 Swedish, 134 Polish and 152 Ukrainian). Serum levels of 2, 2', 4, 4', 5, 5'-hexachlorobiphenyl (CB-153), as a proxy of the total POP burden, and of 1,1-dichloro-2,2-bis(p-chlorophenyl)-ethylene (p,p'-DDE), as a proxy of the total DDT exposure were determined...... neither sperm DNA fragmentation nor apoptotic sperm parameters and the large variations in POPs exposure was observed for the separate study groups. However, considering the European populations taken together, we showed that both %TUNEL positivity and Bcl-xL were related to CB-153 serum levels, whereas...

  11. Chemical repair activity of free radical scavenger edaravone. Reduction reactions with dGMP hydroxyl radical adducts and suppression of base lesions and AP sites on irradiated plasmid DNA

    International Nuclear Information System (INIS)

    Hata, Kuniki; Katsumura, Yosuke; Urushibara, Ayumi; Yamashita, Shinichi; Lin Mingzhang; Muroya, Yusa; Shikazono, Naoya; Yokoya, Akinari; Fu Haiying

    2015-01-01

    Reactions of edaravone (3-methyl-1-phenyl-2-pyrazolin-5-one) with deoxyguanosine monophosphate (dGMP) hydroxyl radical adducts were investigated by pulse radiolysis technique. Edaravone was found to reduce the dGMP hydroxyl radical adducts through electron transfer reactions. The rate constants of the reactions were greater than 4 × 10 8 dm 3 mol -1 s -1 and similar to those of the reactions of ascorbic acid, which is a representative antioxidant. Yields of single-strand breaks, base lesions, and abasic sites produced in pUC18 plasmid DNA by gamma ray irradiation in the presence of low concentrations (10–1000 μmol dm -3 ) of edaravone were also quantified, and the chemical repair activity of edaravone was estimated by a method recently developed by the authors. By comparing suppression efficiencies to the induction of each DNA lesion, it was found that base lesions and abasic sites were suppressed by the chemical repair activity of edaravone, although the suppression of single-strand breaks was not very effective. This phenomenon was attributed to the chemical repair activity of edaravone toward base lesions and abasic sites. However, the chemical repair activity of edaravone for base lesions was lower than that of ascorbic acid. (author)

  12. Chemical repair activity of free radical scavenger edaravone: reduction reactions with dGMP hydroxyl radical adducts and suppression of base lesions and AP sites on irradiated plasmid DNA.

    Science.gov (United States)

    Hata, Kuniki; Urushibara, Ayumi; Yamashita, Shinichi; Lin, Mingzhang; Muroya, Yusa; Shikazono, Naoya; Yokoya, Akinari; Fu, Haiying; Katsumura, Yosuke

    2015-01-01

    Reactions of edaravone (3-methyl-1-phenyl-2-pyrazolin-5-one) with deoxyguanosine monophosphate (dGMP) hydroxyl radical adducts were investigated by pulse radiolysis technique. Edaravone was found to reduce the dGMP hydroxyl radical adducts through electron transfer reactions. The rate constants of the reactions were greater than 4 × 10(8) dm(3) mol(-1) s(-1) and similar to those of the reactions of ascorbic acid, which is a representative antioxidant. Yields of single-strand breaks, base lesions, and abasic sites produced in pUC18 plasmid DNA by gamma ray irradiation in the presence of low concentrations (10-1000 μmol dm(-3)) of edaravone were also quantified, and the chemical repair activity of edaravone was estimated by a method recently developed by the authors. By comparing suppression efficiencies to the induction of each DNA lesion, it was found that base lesions and abasic sites were suppressed by the chemical repair activity of edaravone, although the suppression of single-strand breaks was not very effective. This phenomenon was attributed to the chemical repair activity of edaravone toward base lesions and abasic sites. However, the chemical repair activity of edaravone for base lesions was lower than that of ascorbic acid. © The Author 2014. Published by Oxford University Press on behalf of The Japan Radiation Research Society and Japanese Society for Radiation Oncology.

  13. ERIC-PCR fingerprinting-based community DNA hybridization to pinpoint genome-specific fragments as molecular markers to identify and track populations common to healthy human guts.

    Science.gov (United States)

    Wei, Guifang; Pan, Li; Du, Huimin; Chen, Junyi; Zhao, Liping

    2004-10-01

    Bacterial populations common to healthy human guts may play important roles in human health. A new strategy for discovering genomic sequences as markers for these bacteria was developed using Enterobacterial Repetitive Intergenic Consensus (ERIC)-PCR fingerprinting. Structural features within microbial communities are compared with ERIC-PCR followed by DNA hybridization to identify genomic fragments shared by samples from healthy human individuals. ERIC-PCR profiles of fecal samples from 12 diseased or healthy human and piglet subjects demonstrated stable, unique banding patterns for each individual tested. Sequence homology of DNA fragments in bands of identical size was examined between samples by hybridization under high stringency conditions with DIG-labeled ERIC-PCR products derived from the fecal sample of one healthy child. Comparative analysis of the hybridization profiles with the original agarose fingerprints identified three predominant bands as signatures for populations associated with healthy human guts with sizes of 500, 800 and 1000 bp. Clone library profiling of the three bands produced 17 genome fragments, three of which showed high similarity only with regions of the Bacteroides thetaiotaomicron genome, while the remainder were orphan sequences. Association of these sequences with healthy guts was validated by sequence-selective PCR experiments, which showed that a single fragment was present in all 32 healthy humans and 13 healthy piglets tested. Two fragments were present in the healthy human group and in 18 children with non-infectious diarrhea but not in eight children with infectious diarrhea. Genome fragments identified with this novel strategy may be used as genome-specific markers for dynamic monitoring and sequence-guided isolation of functionally important bacterial populations in complex communities such as human gut microflora.

  14. Sperm DNA fragmentation induced by cryopreservation: new insights and effect of a natural extract from Opuntia ficus-indica.

    Science.gov (United States)

    Meamar, Mehrdad; Zribi, Nassira; Cambi, Marta; Tamburrino, Lara; Marchiani, Sara; Filimberti, Erminio; Fino, Maria Grazia; Biggeri, Annibale; Menezo, Yves; Forti, Gianni; Baldi, Elisabetta; Muratori, Monica

    2012-08-01

    To analyze the effect of cryopreservation on sperm DNA fragmentation (SDF) in two cytometric sperm populations, PI(brighter) and PI(dimmer), and to test the effects of Opuntia ficus-indica (OFI) extracts, which contain antioxidants and flavanoids, and of resveratrol on cryopreservation of human semen. In vitro prospective study. Institutional study. Twenty-one normozoospermic men undergoing semen analysis for couple infertility. Cryopreservation using the routine method in the presence of OFI extracts or resveratrol. Measurement of SDF by TUNEL/PI flow cytometric method to evaluate sperm motility (by automated motion analysis, CASA system) and viability (by eosin/nigrosin staining) in the two populations of sperm PI(br) and PI(dim). Cryopreservation induced an increase of SDF only in the PI(br) sperm population. The increase was negatively dependent on the basal values of SDF in the same population. Addition of OFI extracts and resveratrol to the cryopreservation medium slightly but statistically significantly reduced SDF in the PI(br) population without affecting the deleterious effect of cryopreservation on sperm motion parameters or viability. The increase of SDF in the PI(br) population, which is unrelated to semen quality, suggests that caution must be taken in using cryopreserved semen, as morphologically normal and motile sperm may be damaged. The addition of substances with multifunctional properties such as OFI extracts to cryopreservation medium is only slightly effective in preventing the dramatic effects on SDF. Copyright © 2012 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  15. The influence of ginger (Zingiber officinale on human sperm quality and DNA fragmentation: A double-blind randomized clinical trial

    Directory of Open Access Journals (Sweden)

    Jalil Hosseini

    2016-08-01

    Full Text Available Background: Although the effectiveness of ginger as an antioxidant agent has been exploited, little human research has been conducted on its activity on male reproductive functions. Objective: This study was designed to investigate the effects of ginger (Zingiber officinale on sperm DNA fragmentation (SDF in infertile men. Materials and Methods: This randomized double-blind, placebo-controlled trial with a 1:1 allocation was performed on 100 infertility treatment candidates who were admitted to Royan Institute for Reproductive Biomedicine, Tehran, Iran. Patients were randomly assigned to receive one of two treatments: ginger and placebo. Patients were given a 3-month oral treatment (members received capsules containing 250 mg of ginger powder twice a day in ginger and a placebo in other group. Before and after treatment, standardized semen samples were obtained to determine sperm concentration, motility, and SDF according to World Health Organization. Results: There was no significant difference between two groups regarding SDF at baseline (53.48. 95%CI: 37.95-69.02 in cases and (56.75, 95%CI: 40.01-73.5 in controls. The average positive percentage of SDF in patients receiving ginger (17.77, 95%CI: 6.16-29.39 was lower compared with placebo (40.54, 95%CI: 23.94-57.13 after three month of treatment (p=0.02. In multivariate analysis, SDF was significantly lower in patients receiving ginger compared with placebo (mean difference: 3.21, 95%CI: 0.78-5.63, p=0.009. There were no significant differences between two groups regarding to semen parameters. Conclusion: The present study has demonstrated that ginger in a controlled study of efficacy was effective in decreasing SDF in infertile men.

  16. Yeast transformation mediated by Agrobacterium strains harboring an Ri plasmid: comparative study between GALLS of an Ri plasmid and virE of a Ti plasmid.

    Science.gov (United States)

    Kiyokawa, Kazuya; Yamamoto, Shinji; Sato, Yukari; Momota, Naoto; Tanaka, Katsuyuki; Moriguchi, Kazuki; Suzuki, Katsunori

    2012-07-01

    Agrobacterium strains containing a Ti plasmid can transfer T-DNA not only to plants but also to fungi, including the yeast Saccharomyces cerevisiae. However, no Agrobacterium strain harboring an Ri plasmid has been evaluated in fungal transformation. Some Ri plasmids have GALLS , instead of virE1 and virE2. GALLS protein can functionally substitute in plant transformation for a structurally different protein VirE2. In this study, we compared the yeast transformation ability among Agrobacterium donors: a strain containing a Ti plasmid, strains harboring either an agropine-type or a mikimopine-type Ri plasmid, and a strain having a modified Ri plasmid supplemented with a Ti plasmid type virE operon. Agrobacterium strains possessing GALLS transformed yeast cells far less efficiently than the strain containing virE operon. Production of GALLS in recipient yeast cells improved the yeast transformation mediated by an Agrobacterium strain lacking neither GALLS nor virE operon. A reporter assay to detect mobilization of the proteins fused with Cre recombinase revealed that VirE2 protein is much more abundant in yeast cells than GALLS. Based on these results, we concluded that the low yeast transformability mediated by Agrobacterium strains having the Ri plasmid is because of low amount of mobilized GALLS in yeast cells. © 2012 The Authors Journal compilation © 2012 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.

  17. Morphometric comparison by the ISAS® CASA-DNAf system of two techniques for the evaluation of DNA fragmentation in human spermatozoa.

    Science.gov (United States)

    Sadeghi, Sara; García-Molina, Almudena; Celma, Ferran; Valverde, Anthony; Fereidounfar, Sogol; Soler, Carles

    2016-01-01

    DNA fragmentation has been shown to be one of the causes of male infertility, particularly related to repeated abortions, and different methods have been developed to analyze it. In the present study, two commercial kits based on the SCD technique (Halosperm ® and SDFA) were evaluated by the use of the DNA fragmentation module of the ISAS ® v1 CASA system. Seven semen samples from volunteers were analyzed. To compare the results between techniques, the Kruskal-Wallis test was used. Data were used for calculation of Principal Components (two PCs were obtained), and subsequent subpopulations were identified using the Halo, Halo/Core Ratio, and PC data. Results from both kits were significantly different (P < 0.001). In each case, four subpopulations were obtained, independently of the classification method used. The distribution of subpopulations differed depending on the kit used. From the PC data, a discriminant analysis matrix was obtained and a good a posteriori classification was obtained (97.1% for Halosperm and 96.6% for SDFA). The present results are the first approach on morphometric evaluation of DNA fragmentation from the SCD technique. This approach could be used for the future definition of a classification matrix surpassing the current subjective evaluation of this important sperm factor.

  18. Morphometric comparison by the ISAS® CASA-DNAf system of two techniques for the evaluation of DNA fragmentation in human spermatozoa

    Directory of Open Access Journals (Sweden)

    Sara Sadeghi

    2016-01-01

    Full Text Available DNA fragmentation has been shown to be one of the causes of male infertility, particularly related to repeated abortions, and different methods have been developed to analyze it. In the present study, two commercial kits based on the SCD technique (Halosperm ® and SDFA were evaluated by the use of the DNA fragmentation module of the ISAS ® v1 CASA system. Seven semen samples from volunteers were analyzed. To compare the results between techniques, the Kruskal-Wallis test was used. Data were used for calculation of Principal Components (two PCs were obtained, and subsequent subpopulations were identified using the Halo, Halo/Core Ratio, and PC data. Results from both kits were significantly different (P < 0.001. In each case, four subpopulations were obtained, independently of the classification method used. The distribution of subpopulations differed depending on the kit used. From the PC data, a discriminant analysis matrix was obtained and a good a posteriori classification was obtained (97.1% for Halosperm and 96.6% for SDFA. The present results are the first approach on morphometric evaluation of DNA fragmentation from the SCD technique. This approach could be used for the future definition of a classification matrix surpassing the current subjective evaluation of this important sperm factor.

  19. Influence of anoxia on the induction of mutations by phenylalanine radicals during gamma-irradiation of plasmid DNA in aqueous solution.

    NARCIS (Netherlands)

    Kuipers, G.K.; Slotman, B.J.; Reitsma-Wijker, CA; Andel, R.J.; Poldervaart, H.A.; Lafleur, M.V.M.

    2004-01-01

    When DNA is irradiated in aqueous solution, most of the damage is inflicted by water-derived radicals. This is called the indirect effect of ionizing radiation. However in whole cells not only the primary formed water radicals play a role, because some cellular compounds form secondary radicals

  20. The extended regulatory networks of SXT/R391 integrative and conjugative elements and IncA/C conjugative plasmids.

    Science.gov (United States)

    Poulin-Laprade, Dominic; Carraro, Nicolas; Burrus, Vincent

    2015-01-01

    Nowadays, healthcare systems are challenged by a major worldwide drug resistance crisis caused by the massive and rapid dissemination of antibiotic resistance genes and associated emergence of multidrug resistant pathogenic bacteria, in both clinical and environmental settings. Conjugation is the main driving force of gene transfer among microorganisms. This mechanism of horizontal gene transfer mediates the translocation of large DNA fragments between two bacterial cells in direct contact. Integrative and conjugative elements (ICEs) of the SXT/R391 family (SRIs) and IncA/C conjugative plasmids (ACPs) are responsible for the dissemination of a broad spectrum of antibiotic resistance genes among diverse species of Enterobacteriaceae and Vibrionaceae. The biology, diversity, prevalence and distribution of these two families of conjugative elements have been the subject of extensive studies for the past 15 years. Recently, the transcriptional regulators that govern their dissemination through the expression of ICE- or plasmid-encoded transfer genes have been described. Unrelated repressors control the activation of conjugation by preventing the expression of two related master activator complexes in both types of elements, i.e., SetCD in SXT/R391 ICEs and AcaCD in IncA/C plasmids. Finally, in addition to activating ICE- or plasmid-borne genes, these master activators have been shown to specifically activate phylogenetically unrelated mobilizable genomic islands (MGIs) that also disseminate antibiotic resistance genes and other adaptive traits among a plethora of pathogens such as Vibrio cholerae and Salmonella enterica.

  1. The extended regulatory networks of SXT/R391 integrative and conjugative elements and IncA/C conjugative plasmids.

    Directory of Open Access Journals (Sweden)

    Dominic ePoulin-Laprade

    2015-08-01

    Full Text Available Nowadays, healthcare systems are challenged by a major worldwide drug resistance crisis caused by the massive and rapid dissemination of antibiotic resistance genes and associated emergence of multidrug resistant pathogenic bacteria, in both clinical and environmental settings. Conjugation is the main driving force of gene transfer among microorganisms. This mechanism of horizontal gene transfer mediates the translocation of large DNA fragments between two bacterial cells in direct contact. Integrative and conjugative elements (ICEs of the SXT/R391 family (SRIs and IncA/C conjugative plasmids (ACPs are responsible for the dissemination of a broad spectrum of antibiotic resistance genes among diverse species of Enterobacteriaceae and Vibrionaceae. The biology, diversity, prevalence and distribution of these two families of conjugative elements have been the subject of extensive studies for the past 15 years. Recently, the transcriptional regulators that govern their dissemination through the expression of ICE- or plasmid-encoded transfer genes have been described. Unrelated repressors control the activation of conjugation by preventing the expression of two related master activator complexes in both types of elements, i.e. SetCD in SXT/R391 ICEs and AcaCD in IncA/C plasmids. Finally, in addition to activating ICE- or plasmid-borne genes, these master activators have been shown to specifically activate phylogenetically unrelated mobilizable genomic islands (MGIs that also disseminate antibiotic resistance genes and other adaptive traits among a plethora of pathogens such as Vibrio cholerae and Salmonella enterica.

  2. Apoptotic DNA Degradation into Oligonucleosomal Fragments, but Not Apoptotic Nuclear Morphology, Relies on a Cytosolic Pool of DFF40/CAD Endonuclease*

    Science.gov (United States)

    Iglesias-Guimarais, Victoria; Gil-Guiñon, Estel; Gabernet, Gisela; García-Belinchón, Mercè; Sánchez-Osuna, María; Casanelles, Elisenda; Comella, Joan X.; Yuste, Victor J.

    2012-01-01

    Apoptotic cell death is characterized by nuclear fragmentation and oligonucleosomal DNA degradation, mediated by the caspase-dependent specific activation of DFF40/CAD endonuclease. Here, we describe how, upon apoptotic stimuli, SK-N-AS human neuroblastoma-derived cells show apoptotic nuclear morphology without displaying concomitant internucleosomal DNA fragmentation. Cytotoxicity afforded after staurosporine treatment is comparable with that obtained in SH-SY5Y cells, which exhibit a complete apoptotic phenotype. SK-N-AS cell death is a caspase-dependent process that can be impaired by the pan-caspase inhibitor q-VD-OPh. The endogenous inhibitor of DFF40/CAD, ICAD, is correctly processed, and dff40/cad cDNA sequence does not reveal mutations altering its amino acid composition. Biochemical approaches show that both SH-SY5Y and SK-N-AS resting cells express comparable levels of DFF40/CAD. However, the endonuclease is poorly expressed in the cytosolic fraction of healthy SK-N-AS cells. Despite this differential subcellular distribution of DFF40/CAD, we find no differences in the subcellular localization of both pro-caspase-3 and ICAD between the analyzed cell lines. After staurosporine treatment, the preferential processing of ICAD in the cytosolic fraction allows the translocation of DFF40/CAD from this fraction to a chromatin-enriched one. Therefore, the low levels of cytosolic DFF40/CAD detected in SK-N-AS cells determine the absence of DNA laddering after staurosporine treatment. In these cells DFF40/CAD cytosolic levels can be restored by the overexpression of their own endonuclease, which is sufficient to make them proficient at degrading their chromatin into oligonucleosome-size fragments after staurosporine treatment. Altogether, the cytosolic levels of DFF40/CAD are determinants in achieving a complete apoptotic phenotype, including oligonucleosomal DNA degradation. PMID:22253444

  3. DNA fragmentation dynamics allows the assessment of cryptic sperm damage in human: Evaluation of exposure to ionizing radiation, hyperthermia, acidic pH and nitric oxide

    Energy Technology Data Exchange (ETDEWEB)

    Santiso, Rebeca; Tamayo, Maria [Laboratorio de Genetica Molecular y Radiobiologia, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Genetics Unit, INIBIC-Complejo Hospitalario Universitario A Coruna (CHUAC), As Xubias, 84, 15006-A Coruna (Spain); Gosalvez, Jaime [Genetics Unit, Facultad de Biologia, Universidad Autonoma de Madrid, Ciudad Universitaria de Cantoblanco, 28049 Madrid (Spain); Johnston, Steve [School of Agriculture and Food Science, University of Queensland, Gatton 4343 (Australia); Marino, Alfonso [Servicio de Oncologia Radioterapica, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Fernandez, Carlos; Losada, Carlos [Servicio de Radiofisica, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Fernandez, Jose Luis, E-mail: Jose.Luis.Fernandez.Garcia@sergas.es [Laboratorio de Genetica Molecular y Radiobiologia, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Genetics Unit, INIBIC-Complejo Hospitalario Universitario A Coruna (CHUAC), As Xubias, 84, 15006-A Coruna (Spain)

    2012-06-01

    Sperm DNA fragmentation (SDF) is not a static seminal parameter, since the longevity of sperm DNA decreases progressively with time following ejaculation or thawing. While the dynamics of SDF is a species-specific characteristic, in the case of humans, there is still significant variation within patients. To evaluate the suitability of the dynamic SDF assay to assess the adverse effects of agents that cause genetic damage, fresh semen samples from different donors were exposed in vitro to (1) increasing acute doses of ionizing radiation, (2) elevated temperature (41 Degree-Sign C and 45 Degree-Sign C), (3) acidic pH (pH 4) and (4) the nitric oxide (NO) donor sodium nitroprusside (SNP). Sperm DNA fragmentation was analyzed after an incubation period of chronic (24 h), or acute (1 h) exposure to each treatment followed by incubation at 37 Degree-Sign C over a period of 24 h. SDF was assessed using the sperm chromatin dispersion (SCD) test. Dynamic SDF for each treatment was analyzed using Kaplan-Meier survival curves. All agents, except for ionizing radiation, accelerated SDF kinetics following chronic exposure over a 24 h period. Transient exposure to NO and heat but not acidic pH increased the basal (T0) level of SDF. Despite the removal of the three toxicants, the remaining sperm following acute exposure showed a decrease in their expected DNA longevity. It is concluded that the assessment of sperm DNA fragmentation dynamics is an effective methodological approach for revealing latent damage associated with toxicants that is not initially expressed following a single initial observation of SDF.

  4. Comparative Immunogenicity in Rhesus Monkeys of DNA Plasmid, Recombinant Vaccinia Virus, and Replication-Defective Adenovirus Vectors Expressing a Human Immunodeficiency Virus Type 1 gag Gene

    OpenAIRE

    Casimiro, Danilo R.; Chen, Ling; Fu, Tong-Ming; Evans, Robert K.; Caulfield, Michael J.; Davies, Mary-Ellen; Tang, Aimin; Chen, Minchun; Huang, Lingyi; Harris, Virginia; Freed, Daniel C.; Wilson, Keith A.; Dubey, Sheri; Zhu, De-Min; Nawrocki, Denise

    2003-01-01

    Cellular immune responses, particularly those associated with CD3+ CD8+ cytotoxic T lymphocytes (CTL), play a primary role in controlling viral infection, including persistent infection with human immunodeficiency virus type 1 (HIV-1). Accordingly, recent HIV-1 vaccine research efforts have focused on establishing the optimal means of eliciting such antiviral CTL immune responses. We evaluated several DNA vaccine formulations, a modified vaccinia virus Ankara vector, and a replication-defecti...

  5. Cold-inducible RNA-binding protein through TLR4 signaling induces mitochondrial DNA fragmentation and regulates macrophage cell death after trauma.

    Science.gov (United States)

    Li, Zhigang; Fan, Erica K; Liu, Jinghua; Scott, Melanie J; Li, Yuehua; Li, Song; Xie, Wen; Billiar, Timothy R; Wilson, Mark A; Jiang, Yong; Wang, Ping; Fan, Jie

    2017-05-11

    Trauma is a major cause of systemic inflammatory response syndrome and multiple organ dysfunction syndrome. Macrophages (Mφ) direct trauma-induced inflammation, and Mφ death critically influences the progression of the inflammatory response. In the current study, we explored an important role of trauma in inducing mitochondrial DNA (mtDNA) damage in Mφ and the subsequent regulation of Mφ death. Using an animal pseudo-fracture trauma model, we demonstrated that tissue damage induced NADPH oxidase activation and increased the release of reactive oxygen species via cold-inducible RNA-binding protein (CIRP)-TLR4-MyD88 signaling. This in turn, activates endonuclease G, which serves as an executor for the fragmentation of mtDNA in Mφ. We further showed that fragmented mtDNA triggered both p62-related autophagy and necroptosis in Mφ. However, autophagy activation also suppressed Mφ necroptosis and pro-inflammatory responses. This study demonstrates a previously unidentified intracellular regulation of Mφ homeostasis in response to trauma.

  6. Paramecium putrinum (Ciliophora, Protozoa): the first insight into the variation of two DNA fragments - molecular support for the existence of cryptic species.

    Science.gov (United States)

    Tarcz, Sebastian; Rautian, Maria; Potekhin, Alexey; Sawka, Natalia; Beliavskaya, Alexandra; Kiselev, Andrey; Nekrasova, Irina; Przyboś, Ewa

    2014-04-01

    Paramecium putrinum (Claparede & Lachmann 1858) is one of the smallest (80-140 μm long) species of the genus Paramecium. Although it commonly occurs in freshwater reservoirs, no molecular studies of P. putrinum have been conducted to date. Herein we present an assessment of molecular variation in 27 strains collected from widely separated populations by using two selected DNA fragments (ITS1-5.8S-ITS2-5'LSU rDNA and COI mtDNA). Both the trees and haplotype networks reconstructed for both genome fragments show that the studied strains of P. putrinum form five main haplogroups. The mean distance between the studied strains is p-distance=0.007/0.068 (rDNA/COI) and exhibits similar variability as that between P. bursaria syngens. Based on these data, one could hypothesize that the clusters revealed in the present study may correspond to previously reported syngens and that there are at least five cryptic species within P. putrinum. Copyright © 2014 Elsevier Inc. All rights reserved.

  7. Individual and combined effects of ochratoxin A and citrinin on viability and DNA fragmentation in cultured Vero cells and on chromosome aberrations in mice bone marrow cells

    International Nuclear Information System (INIS)

    Bouslimi, Amel; Bouaziz, Chayma; Ayed-Boussema, Imen; Hassen, Wafa; Bacha, Hassen

    2008-01-01

    Ochratoxin A (OTA) and citrinin (CTN) are two common contaminant mycotoxins which can occur jointly in a wide range of food commodities. Both mycotoxins have several toxic effects but share a significant nephrotoxic and carcinogenic potential since OTA and CTN were reported to be responsible for naturally occurring human and animal kidney diseases and tumors. Considering the concomitant production of OTA and CTN, it is very likely that humans and animals are always exposed to the mixture rather than to individual compounds. Therefore, the aim of the present study was to investigate, in vivo and in vitro, whether DNA damage is enhanced by combination of both mycotoxins as compared to their effect separately. To this end, we have assessed their effects individually or combined on cell proliferation and DNA fragmentation in cultured Vero cells and in vivo by monitoring the induction of chromosome aberrations. Our results clearly showed that cultured renal cells respond to OTA and CTN exposure by a moderate and weak inhibition of cell proliferation, respectively. However, when combined, they exert a significant increase in inhibition of cell viability. Similar results were found for the investigated genotoxicity endpoints (DNA fragmentation and chromosome aberrations). Altogether, our study showed that OTA and CTN combination effects are clearly synergistic. The synergistic induction of DNA damage observed with OTA and CTN taken concomitantly could be relevant to explain the molecular basis of the renal diseases and tumorogenesis induced by naturally occurring mycotoxins

  8. Mitochondrial outer membrane permeabilization increases reactive oxygen species production and decreases mean sperm velocity but is not associated with DNA fragmentation in human sperm.

    Science.gov (United States)

    Treulen, F; Uribe, P; Boguen, R; Villegas, J V

    2016-02-01

    Does induction of mitochondrial outer membrane permeabilization (MOMP) in vitro affect specific functional parameters of human spermatozoa? Our findings show that MOMP induction increases intracellular reactive oxygen species (ROS) and decreases mean sperm velocity but does not alter DNA integrity. MOMP in somatic cells is related to a variety of apoptotic traits, such as alteration of mitochondrial membrane potential (ΔΨm), and increase in ROS production and DNA fragmentation. Although the presence of these apoptotic features has been reported in spermatozoa, to date the effects of MOMP on sperm function and DNA integrity have not been analysed. The study included spermatozoa from fertile donors. Motile sperm were obtained using the swim-up method. The highly motile sperm were collected and diluted with human tubal fluid to a final cell concentration of 5 × 10(6) ml(-1). To induce MOMP, selected sperm were treated at 37°C for 4 h with a mimetic of a Bcl-2 pro-apoptotic protein, ABT-737. MOMP was evaluated by relocating of cytochrome c. In addition, the effect of ABT-737 on mitochondrial inner membrane permeabilization was assessed using the calcein-AM/cobalt chloride method. In turn, ΔΨm was evaluated with JC-1 staining, intracellular ROS production with dihydroethidium, sperm motility was analysed by computer-assisted sperm analysis and DNA fragmentation by terminal deoxynucleotidyl transferase-mediated dUTP nick-end labelling (TUNEL) assay. Measurements were performed by flow cytometry. MOMP was associated with ΔΨm dissipation (P < 0.05), increased ROS production (P < 0.05) and decreased mean sperm velocity (P < 0.05), but it was not associated with DNA fragmentation. MOMP did not induce a large increase in ROS, which could explain the negligible effect of MOMP on sperm DNA fragmentation under our experimental conditions. The study was carried out in vitro using highly motile sperm, selected by swim-up, from healthy donors. The results obtained in this

  9. Fluorescence-labeled methylation-sensitive amplified fragment length polymorphism (FL-MS-AFLP) analysis for quantitative determination of DNA methylation and demethylation status.

    Science.gov (United States)

    Kageyama, Shinji; Shinmura, Kazuya; Yamamoto, Hiroko; Goto, Masanori; Suzuki, Koichi; Tanioka, Fumihiko; Tsuneyoshi, Toshihiro; Sugimura, Haruhiko

    2008-04-01

    The PCR-based DNA fingerprinting method called the methylation-sensitive amplified fragment length polymorphism (MS-AFLP) analysis is used for genome-wide scanning of methylation status. In this study, we developed a method of fluorescence-labeled MS-AFLP (FL-MS-AFLP) analysis by applying a fluorescence-labeled primer and fluorescence-detecting electrophoresis apparatus to the existing method of MS-AFLP analysis. The FL-MS-AFLP analysis enables quantitative evaluation of more than 350 random CpG loci per run. It was shown to allow evaluation of the differences in methylation level of blood DNA of gastric cancer patients and evaluation of hypermethylation and hypomethylation in DNA from gastric cancer tissue in comparison with adjacent non-cancerous tissue.

  10. Structural analysis of the ParR/parC plasmid partition complex

    DEFF Research Database (Denmark)

    Møller-Jensen, Jakob; Ringgaard, Simon; Mercogliano, Christopher P

    2007-01-01

    Accurate DNA partition at cell division is vital to all living organisms. In bacteria, this process can involve partition loci, which are found on both chromosomes and plasmids. The initial step in Escherichia coli plasmid R1 partition involves the formation of a partition complex between the DNA...

  11. In vitro and in vivo assay of radio-induced damage in Escherichia Coli, DNA labelled on thymidilic fragment

    International Nuclear Information System (INIS)

    Bonicel, A.

    1977-01-01

    A technique of rapid assay for a particular and very important damage, N-formamido (DNA), is described. Using this technique, the importance of radio-induced DNA damage can be evaluated before the repair enzymatic system takes place [fr

  12. Cloning in Streptococcus lactis of plasmid-mediated UV resistance and effect on prophage stability

    International Nuclear Information System (INIS)

    Chopin, M.C.; Chopin, A.; Rouault, A.; Simon, D.

    1986-01-01

    Plasmid pIL7 (33 kilobases) from Streptococcus lactis enhances UV resistance and prophage stability. A 5.4-kilobase pIL7 fragment carrying genes coding for both characters was cloned into S. lactis, using plasmid pHV1301 as the cloning vector. The recombinant plasmid was subsequently transferred to three other S. lactis strains by transformation or protoplast fusion. Cloned genes were expressed in all tested strains

  13. Biochemical analyses indicate that binding and cleavage specificities define the ordered processing of human Okazaki fragments by Dna2 and FEN1.

    Science.gov (United States)

    Gloor, Jason W; Balakrishnan, Lata; Campbell, Judith L; Bambara, Robert A

    2012-08-01

    In eukaryotic Okazaki fragment processing, the RNA primer is displaced into a single-stranded flap prior to removal. Evidence suggests that some flaps become long before they are cleaved, and that this cleavage involves the sequential action of two nucleases. Strand displacement characteristics of the polymerase show that a short gap precedes the flap during synthesis. Using biochemical techniques, binding and cleavage assays presented here indicate that when the flap is ∼ 30 nt long the nuclease Dna2 can bind with high affinity to the flap and downstream double strand and begin cleavage. When the polymerase idles or dissociates the Dna2 can reorient for additional contacts with the upstream primer region, allowing the nuclease to remain stably bound as the flap is further shortened. The DNA can then equilibrate to a double flap that can bind Dna2 and flap endonuclease (FEN1) simultaneously. When Dna2 shortens the flap even more, FEN1 can displace the Dna2 and cleave at the flap base to make a nick for ligation.

  14. A new optimized formulation of cationic solid lipid nanoparticles intended for gene delivery: development, characterization and DNA binding efficiency of TCERG1 expression plasmid.

    Science.gov (United States)

    Fàbregas, Anna; Sánchez-Hernández, Noemí; Ticó, Josep Ramon; García-Montoya, Encarna; Pérez-Lozano, Pilar; Suñé-Negre, Josep M; Hernández-Munain, Cristina; Suñé, Carlos; Miñarro, Montserrat

    2014-10-01

    Solid lipid nanoparticles (SLNs) are being considered as a new approach for therapeutics for many known diseases. In addition to drug delivery, their use as non-viral vectors for gene delivery can be achieved by the inclusion of cationic lipids, which provide a positive surface potential that favours binding to the DNA backbone. This work is based on the idea that the optimization of the components is required as the first step in simplifying the qualitative and quantitative composition of SLNs as much as possible without affecting the essential properties that define SLNs as optimal non-viral vectors for gene delivery. We selected the best lipids and surfactants in terms of particle size and zeta potential and characterized the properties of the resulting nanoparticles using X-ray photoelectron spectroscopy (XPS) and atomic force microscopy (AFM). The SLNs had a particle size of approximately 120 nm and a positive surface charge of 42 mV. In addition, we analysed the main physicochemical characteristics of the bulk components of the nanoparticles using X-ray diffraction (XRD), differential scanning calorimetry (DSC) and mass spectrometry (MS). The suitability of the optimized SLNs for DNA binding was evaluated after the lyophilisation process using a carboxyl-terminal region of the TCERG1 gene, a human factor that has been implicated in several diseases. We show that the SLNs presented high efficiency in the binding of DNA, and importantly, they presented no toxicity when assayed in an in vivo system. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Plasmid-Mediated Antimicrobial Resistance in Staphylococci and Other Firmicutes.

    Science.gov (United States)

    Schwarz, Stefan; Shen, Jianzhong; Wendlandt, Sarah; Fessler, Andrea T; Wang, Yang; Kadlec, Kristina; Wu, Cong-Ming

    2014-12-01

    In staphylococci and other Firmicutes, resistance to numerous classes of antimicrobial agents, which are commonly used in human and veterinary medicine, is mediated by genes that are associated with mobile genetic elements. The gene products of some of these antimicrobial resistance genes confer resistance to only specific members of a certain class of antimicrobial agents, whereas others confer resistance to the entire class or even to members of different classes of antimicrobial agents. The resistance mechanisms specified by the resistance genes fall into any of three major categories: active efflux, enzymatic inactivation, and modification/replacement/protection of the target sites of the antimicrobial agents. Among the mobile genetic elements that carry such resistance genes, plasmids play an important role as carriers of primarily plasmid-borne resistance genes, but also as vectors for nonconjugative and conjugative transposons that harbor resistance genes. Plasmids can be exchanged by horizontal gene transfer between members of the same species but also between bacteria belonging to different species and genera. Plasmids are highly flexible elements, and various mechanisms exist by which plasmids can recombine, form cointegrates, or become integrated in part or in toto into the chromosomal DNA or into other plasmids. As such, plasmids play a key role in the dissemination of antimicrobial resistance genes within the gene pool to which staphylococci and other Firmicutes have access. This chapter is intended to provide an overview of the current knowledge of plasmid-mediated antimicrobial resistance in staphylococci and other Firmicutes.

  16. Screening of degradative plasmids from Arthrobacter sp. HW08 and ...

    African Journals Online (AJOL)

    Administrator

    2011-06-08

    Jun 8, 2011 ... Media were solidified, if necessary, by the addition of 15 g agar ... genome extraction reagent kit, plasmid DNA fast extraction kit and. DNA segments ... spectrophotometer (Spectronic Instruments, Rochester, NY) and. SW content .... cultivation on LB slant for 100 times at 30 °C for 2 days, it was found that ...

  17. Isolation and properties of plasmids from Deinococcus radiodurans Sark

    International Nuclear Information System (INIS)

    Sjarief, S.H.; Kikuchi, Masahiro; Kurita, Hiromi; Kitayama, Shigeru; Watanabe, Hiroshi.

    1990-05-01

    Radioresistant bacterium, Deinococcus radiodurans, can repair completely almost all of DNA damages including double strand breaks induced by gamma-rays up to about 5 kGy. In order to reveal the repair mechanism, it is necessary to develop a cloning vector available for the genetic analysis. We tried to isolate plasmids from D.radiodurans Sark strain. In the present paper the isolation and properties of plasmids were described. (author)

  18. trans-Acting Virulence Functions of the Octopine Ti Plasmid from Agrobacterium tumefaciens

    NARCIS (Netherlands)

    Hille, Jacques; Kan, Jan van; Schilperoort, Rob

    1984-01-01

    All Ti plasmid-encoded virulence functions that were studied act in trans. An octopine Ti plasmid-specific vir operon, called vir-O, located on an EcoRI restriction fragment has been characterized. Sequences with promoter activity in Escherichia coli were identified for a second vir operon, called

  19. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong

    2009-10-09

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  20. Accumulation of single-strand breaks doses not result in double-strand DNA breaks: peculiarity of transcribing fragment of human ribosomal operon that allows its detection in biological fluids at the death of various cells in organism

    International Nuclear Information System (INIS)

    Vejko, N.N.; Spitkovskij, D.M.

    2000-01-01

    The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru

  1. Chromosomal context and replication properties of ARS plasmids in ...

    Indian Academy of Sciences (India)

    2015-11-28

    Nov 28, 2015 ... plasmid but only a subset of them functions as replication origins in their ... except that they are rich in A + T content (As on one strand and Ts .... different unique, terminal, PCR-generated restriction sites used for cloning each fragment are ..... Hall TA 1999 BioEdit: a user-friendly biological sequence align-.

  2. Identification of DNA Fragments that Showed Linkage to the Radiation-induced Yellow Vein Mosaic Disease Resistance Mutation in Okra

    International Nuclear Information System (INIS)

    Boonsirichai, Kanokporn; Phadvibulya, Valailak; Adthalungrong, Amnuai; Srithongchai, Wanphen; Puripunyavanich, Vichai

    2007-08-01

    Full text: The yellow vein mosaic disease resistant mutant of okra was crossed to Pichit 03, a susceptible variety. Their progeny showed prolonged resistance when compared with Pichit 03. DNA fingerprints of F2 and BC1F1 individuals from the cross indicated that most DNA bands did not segregate with either the resistance or the susceptible characteristics. Nonetheless, polymorphic DNA bands could be identified between the mutant and Okura, the parental variety

  3. Gene expression profiles in primary duodenal chick cells following transfection with avian influenza virus H5 DNA plasmid encapsulated in silver nanoparticles

    Directory of Open Access Journals (Sweden)

    Jazayeri SD

    2013-02-01

    Full Text Available Seyed Davoud Jazayeri,1 Aini Ideris,1,2 Kamyar Shameli,3 Hassan Moeini,1 Abdul Rahman Omar1,21Institute of Bioscience, 2Faculty of Veterinary Medicine, 3Faculty of Science, Universiti Putra Malaysia, Serdang, Selangor, MalaysiaAbstract: In order to develop a systemically administered safe and effective nonviral gene delivery system against avian influenza virus (AIV that induced cytokine expression, the hemagglutinin (H5 gene of AIV, A/Ck/Malaysia/5858/04 (H5N1 and green fluorescent protein were cloned into a coexpression vector pIRES (pIREGFP-H5 and formulated using green synthesis of silver nanoparticles (AgNPs with poly(ethylene glycol and transfected into primary duodenal cells taken from 18-day-old specific-pathogen-free chick embryos. The AgNPs were prepared using moderated temperature and characterized for particle size, surface charge, ultraviolet-visible spectra, DNA loading, and stability. AgNPs and AgNP-pIREGFP-H5 were prepared in the size range of 13.9 nm and 25 nm with a positive charge of +78 ± 0.6 mV and +40 ± 6.2 mV, respectively. AgNPs with a positive surface charge could encapsulate pIREGFP-H5 efficiently. The ultraviolet-visible spectra for AgNP-pIREGFP-H5 treated with DNase I showed that the AgNPs were able to encapsulate pIREGFP-H5 efficiently. Polymerase chain reaction showed that AgNP-pIREGFP-H5 entered into primary duodenal cells rapidly, as early as one hour after transfection. Green fluorescent protein expression was observed after 36 hours, peaked at 48 hours, and remained stable for up to 60 hours. In addition, green fluorescent protein expression generally increased with increasing DNA concentration and time. Cells were transfected using Lipocurax in vitro transfection reagent as a positive control. A multiplex quantitative mRNA gene expression assay in the transfected primary duodenal cells via the transfection reagent and AgNPs with pIREGFP-H5 revealed expression of interleukin (IL-18, IL-15, and IL-12

  4. The impact of partial manganese superoxide dismutase (SOD2)-deficiency on mitochondrial oxidant stress, DNA fragmentation and liver injury during acetaminophen hepatotoxicity

    International Nuclear Information System (INIS)

    Ramachandran, Anup; Lebofsky, Margitta; Weinman, Steven A.; Jaeschke, Hartmut

    2011-01-01

    Acetaminophen (APAP) hepatotoxicity is the most frequent cause of acute liver failure in many countries. The mechanism of cell death is initiated by formation of a reactive metabolite that binds to mitochondrial proteins and promotes mitochondrial dysfunction and oxidant stress. Manganese superoxide dismutase (SOD2) is a critical defense enzyme located in the mitochondrial matrix. The objective of this investigation was to evaluate the functional consequences of partial SOD2-deficiency (SOD2+/-) on intracellular signaling mechanisms of necrotic cell death after APAP overdose. Treatment of C57Bl/6J wild type animals with 200 mg/kg APAP resulted in liver injury as indicated by elevated plasma alanine aminotransferase activities (2870 ± 180 U/L) and centrilobular necrosis at 6 h. In addition, increased tissue glutathione disulfide (GSSG) levels and GSSG-to-GSH ratios, delayed mitochondrial GSH recovery, and increased mitochondrial protein carbonyls and nitrotyrosine protein adducts indicated mitochondrial oxidant stress. In addition, nuclear DNA fragmentation (TUNEL assay) correlated with translocation of Bax to the mitochondria and release of apoptosis-inducing factor (AIF). Furthermore, activation of c-jun-N-terminal kinase (JNK) was documented by the mitochondrial translocation of phospho-JNK. SOD2+/- mice showed 4-fold higher ALT activities and necrosis, an enhancement of all parameters of the mitochondrial oxidant stress, more AIF release and more extensive DNA fragmentation and more prolonged JNK activation. Conclusions: the impaired defense against mitochondrial superoxide formation in SOD2+/- mice prolongs JNK activation after APAP overdose and consequently further enhances the mitochondrial oxidant stress leading to exaggerated mitochondrial dysfunction, release of intermembrane proteins with nuclear DNA fragmentation and more necrosis.

  5. Protective role of probiotic lactic acid bacteria against dietary fumonisin B1-induced toxicity and DNA-fragmentation in sprague-dawley rats.

    Science.gov (United States)

    Khalil, Ashraf A; Abou-Gabal, Ashgan E; Abdellatef, Amira A; Khalid, Ahmed E

    2015-08-18

    The genus Fusarium, especially F. verticillioides and F. proliferatum, has been found in several agricultural products worldwide, especially in maize. Regardless the occurrence of symptoms, the presence of Fusarium in maize constitutes an imminent risk due to its ability to produce fumonisins, mycotoxins with proven carcinogenic effect on rats, swine, and equines and already classified as possible carcinogens to humans. The toxicity of incremental levels of fumonisin B1 (FB1), that is, 50, 100, and 200 mg FB1/kg diet, and the role of Lactobacillus delbrueckii subsp. lactis DSM 20076 (LL) and Pediococcus acidilactici NNRL B-5627 (PA) supplementation in counteracting the FB1 effects in intoxicated rats were monitored over a period of 4 weeks. Effects on the feed intake and body weight gain were noticed. A significant (p ≤ 0.05) increase in the level of liver and kidney functions markers and DNA fragmentation was also noticed in rat groups T100 and T200. The lactic acid bacteria (LAB) supplementation could bring back the normal serum biochemical parameters in rats fed on fumonisin B1-contaminated diets (T50 and T100) compared to FB1-treated groups. In rats of high-dosage dietary groups supplemented with LAB (T200-LL and T200-PA), the supplementation reduced the serum activity levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), and creatinine by 11.3, 11.9, 32, and 20%, respectively. DNA fragmentations were observed in the rat group treated with 200 mg FB1 after 3 weeks, while fragmentation was noticed in treated groups with 100 and 200 mg FB1 after 4 weeks. No DNA fragmentation was apparent in FB1-treated rats co-administered the LL or PA strain. These results suggest that in male rats consuming diets containing FB1, there is a time- and dose-dependent increase in serum enzyme activities and DNA lesions. Moreover, Lb. delbrueckii subsp. lactis (LL) and P. acidilactici (PA) strains have a protective effect

  6. Properties of internalization factors contributing to the uptake of extracellular DNA into tumor-initiating stem cells of mouse Krebs-2 cell line.

    Science.gov (United States)

    Dolgova, Evgeniya V; Potter, Ekaterina A; Proskurina, Anastasiya S; Minkevich, Alexandra M; Chernych, Elena R; Ostanin, Alexandr A; Efremov, Yaroslav R; Bayborodin, Sergey I; Nikolin, Valeriy P; Popova, Nelly A; Kolchanov, Nikolay A; Bogachev, Sergey S

    2016-05-25

    Previously, we demonstrated that poorly differentiated cells of various origins, including tumor-initiating stem cells present in the ascites form of mouse cancer cell line Krebs-2, are capable of naturally internalizing both linear double-stranded DNA and circular plasmid DNA. The method of co-incubating Krebs-2 cells with extracellular plasmid DNA (pUC19) or TAMRA-5'-dUTP-labeled polymerase chain reaction (PCR) product was used. It was found that internalized plasmid DNA isolated from Krebs-2 can be transformed into competent Escherichia coli cells. Thus, the internalization processes taking place in the Krebs-2 cell subpopulation have been analyzed and compared, as assayed by E. coli colony formation assay (plasmid DNA) and cytofluorescence (TAMRA-DNA). We showed that extracellular DNA both in the form of plasmid DNA and a PCR product is internalized by the same subpopulation of Krebs-2 cells. We found that the saturation threshold for Krebs-2 ascites cells is 0.5 μg DNA/10(6) cells. Supercoiled plasmid DNA, human high-molecular weight DNA, and 500 bp PCR fragments are internalized into the Krebs-2 tumor-initiating stem cells via distinct, non-competing internalization pathways. Under our experimental conditions, each cell may harbor 340-2600 copies of intact plasmid material, or up to 3.097 ± 0.044×10(6) plasmid copies (intact or not), as detected by quantitative PCR. The internalization dynamics of extracellular DNA, copy number of the plasmids taken up by the cells, and competition between different types of double-stranded DNA upon internalization into tumor-initiating stem cells of mouse ascites Krebs-2 have been comprehensively analyzed. Investigation of the extracellular DNA internalization into tumor-initiating stem cells is an important part of understanding their properties and possible destruction mechanisms. For example, a TAMRA-labeled DNA probe may serve as an instrument to develop a target for the therapy of cancer, aiming at elimination of

  7. GENOMIC DNA-FINGERPRINTING OF CLINICAL HAEMOPHILUS-INFLUENZAE ISOLATES BY POLYMERASE CHAIN-REACTION AMPLIFICATION - COMPARISON WITH MAJOR OUTER-MEMBRANE PROTEIN AND RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISM ANALYSIS

    NARCIS (Netherlands)

    VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  8. Natural plasmid transformation in a high-frequency-of transformation marine Vibrio strain

    International Nuclear Information System (INIS)

    Frischer, M.E.; Thurmond, J.M.; Paul, J.H.

    1990-01-01

    The estuarine bacterium Vibrio strain DI-9 has been shown to be naturally transformable with both broad host range plasmid multimers and homologous chromosomal DNA at average frequencies of 3.5 x 10 -9 and 3.4 x 10 -7 transformants per recipient, respectively. Growth of plasmid transformants in nonselective medium resulted in cured strains that transformed 6 to 42,857 times more frequently than the parental strain, depending on the type of transforming DNA. These high-frequency-of-transformation (HfT) strains were transformed at frequencies ranging from 1.1 x 10 -8 to 1.3 x 10 -4 transformants per recipient with plasmid DNA and at an average frequency of 8.3 x 10 -5 transformants per recipient with homologous chromosomal DNA. The highest transformation frequencies were observed by using multimers of an R1162 derivative carrying the transposon Tn5 (pQSR50). Probing of total DNA preparations from one of the cured strains demonstrated that no plasmid DNA remained in the cured strains which may have provided homology to the transforming DNA. All transformants and cured strains could be differentiated from the parental strains by colony morphology. DNA binding studies indicated that late-log-phase HfT strains bound [ 3 H]bacteriophage lambda DNA 2.1 times more rapidly than the parental strain. These results suggest that the original plasmid transformation event of strain DI-9 was the result of uptake and expression of plasmid DNA by a competent mutant (HfT strain). Additionally, it was found that a strain of Vibrio parahaemolyticus, USFS 3420, could be naturally transformed with plasmid DNA. Natural plasmid transformation by high-transforming mutants may be a means of plasmid acquisition by natural aquatic bacterial populations

  9. Safety and tolerability of conserved region vaccines vectored by plasmid DNA, simian adenovirus and modified vaccinia virus ankara administered to human immunodeficiency virus type 1-uninfected adults in a randomized, single-blind phase I trial.

    Directory of Open Access Journals (Sweden)

    Emma-Jo Hayton

    Full Text Available HIV-1 vaccine development has advanced slowly due to viral antigenic diversity, poor immunogenicity and recently, safety concerns associated with human adenovirus serotype-5 vectors. To tackle HIV-1 variation, we designed a unique T-cell immunogen HIVconsv from functionally conserved regions of the HIV-1 proteome, which were presented to the immune system using a heterologous prime-boost combination of plasmid DNA, a non-replicating simian (chimpanzee adenovirus ChAdV-63 and a non-replicating poxvirus, modified vaccinia virus Ankara. A block-randomized, single-blind, placebo-controlled phase I trial HIV-CORE 002 administered for the first time candidate HIV-1- vaccines or placebo to 32 healthy HIV-1/2-uninfected adults in Oxford, UK and elicited high frequencies of HIV-1-specific T cells capable of inhibiting HIV-1 replication in vitro. Here, detail safety and tolerability of these vaccines are reported.Local and systemic reactogenicity data were collected using structured interviews and study-specific diary cards. Data on all other adverse events were collected using open questions. Serum neutralizing antibody titres to ChAdV-63 were determined before and after vaccination.Two volunteers withdrew for vaccine-unrelated reasons. No vaccine-related serious adverse events or reactions occurred during 190 person-months of follow-up. Local and systemic events after vaccination occurred in 27/32 individuals and most were mild (severity grade 1 and predominantly transient (<48 hours. Myalgia and flu-like symptoms were more strongly associated with MVA than ChAdV63 or DNA vectors and more common in vaccine recipients than in placebo. There were no intercurrent HIV-1 infections during follow-up. 2/24 volunteers had low ChAdV-63-neutralizing titres at baseline and 7 increased their titres to over 200 with a median (range of 633 (231-1533 post-vaccination, which is of no safety concern.These data demonstrate safety and good tolerability of the pSG2

  10. Isolation and characterization of DNA probes from a flow-sorted human chromosome 8 library that detect restriction fragment length polymorphism (RFLP).

    Science.gov (United States)

    Wood, S; Starr, T V; Shukin, R J

    1986-01-01

    We have used a recombinant DNA library constructed from flow-sorted human chromosome 8 as a source of single-copy human probes. These probes have been screened for restriction fragment length polymorphism (RFLP) by hybridization to Southern transfers of genomic DNA from five unrelated individuals. We have detected six RFLPs distributed among four probes after screening 741 base pairs for restriction site variation. These RFLPs all behave as codominant Mendelian alleles. Two of the probes detect rare variants, while the other two detect RFLPs with PIC values of .36 and .16. Informative probes will be useful for the construction of a linkage map for chromosome 8 and for the localization of mutant alleles to this chromosome. Images Fig. 1 PMID:2879441

  11. Construction and identification of eukaryotic expression vector of pcDNA3-UHRF1

    International Nuclear Information System (INIS)

    Li Xinli; Zhu Ran; Zhu Wei; Fan Saijun; Meng Qinghui

    2011-01-01

    Objective: To generate eukaryotic expression vector of pcDNA3-UHRF1(ubiquitin-like, containing PHD and RING finger domains 1, UHRF1) and testify its expression in breast cancer cells MDA-MB-231. Methods: A 2.3 kb cDNA fragment was amplified from the total RNA of the human breast cancer cells MCF-7 by the RT-PCR method and was cloned into the plasmid pcDNA3. The vector was identified by the double digestion with restriction enzymes Kpn I and Xho I and was sequenced. The cDNA of UHRF1 was transfected into human breast cancer cells MDA-MB-231 by Lipofactamin2000. The positive clones were selected by G418. The expression of the UHRF1 was detected by RT-PCR and Western blot analysis. Results: The recombinant eukaryotic expression vector pcDNA3-UHRF1 was digested with Kpn I and BamH I, and the electrophoresis of the digested products showed two fragments; 2.3kb fragment of UHRF1 and 5.4 kb fragment of pcDNA3, and the sequence inserted was identical to the published sequence. The MDA-MB-231 cells transfected with the pcDNA3-UHRF1 plasmid expressed a high level of the UHRF1 mRNA and protein. Conclusion: The recombinant eukaryotic cell expression vector of pcDNA3-UHRF1 is constructed successfully. The recombinant plasmid pcDNA3-UHRF1 can provide a very useful tool and lay an important foundation for the research on the function of UHRF1. (authors)

  12. How much DNA is lost? Measuring DNA loss of short-tandem-repeat length fragments targeted by the PowerPlex 16® system using the Qiagen MinElute Purification Kit.

    Science.gov (United States)

    Kemp, Brian M; Winters, Misa; Monroe, Cara; Barta, Jodi Lynn

    2014-01-01

    The success in recovering genetic profiles from aged and degraded biological samples is diminished by fundamental aspects of DNA extraction, as well as its long-term preservation, that are not well understood. While numerous studies have been conducted to determine whether one extraction method was superior to others, nearly all of them were initiated with no knowledge of the actual starting DNA quantity in the samples prior to extraction, so they ultimately compared the outcome of all methods relative to the best. Using quantitative PCR to estimate the copy count of synthetic standards before (i.e., "copies in") and after (i.e., "copies out") purification by the Qiagen MinElute PCR Purification Kit, we documented DNA loss within a pool of 16 different-sized fragments ranging from 106 to 409 bp in length, corresponding to those targeted by the PowerPlex 16 System (Promega, Madison, WI). Across all standards from 10(4) to 10(7) copies/μL, loss averaged between 21.75% and 60.56% (mean, 39.03%), which is not congruent with Qiagen's claim that 80% of 70 bp to 4 kb fragments are retained using this product (i.e., 20% loss). Our study also found no clear relationship either between DNA strand length and retention or between starting copy number and retention. This suggests that there is no molecule bias across the MinElute column membrane and highlights the need for manufacturers to clearly and accurately describe on what their claims are based, and should also encourage researchers to document DNA retention efficiencies of their own methods and protocols. Understanding how and where to reduce loss of molecules during extraction and purification will serve to generate clearer and more accurate data, which will enhance the utility of ancient and low-copy-number DNA as a tool for closing forensic cases or in reconstructing the evolutionary history of humans and other organisms.

  13. Differential Gene Expression in Response to Papaya ringspot virus Infection in Cucumis metuliferus Using cDNA- Amplified Fragment Length Polymorphism Analysis

    Science.gov (United States)

    Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei

    2013-01-01

    A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746

  14. Safety and immunogenicity of an HIV adenoviral vector boost after DNA plasmid vaccine prime by route of administration: a randomized clinical trial.

    Directory of Open Access Journals (Sweden)

    Beryl A Koblin

    Full Text Available In the development of HIV vaccines, improving immunogenicity while maintaining safety is critical. Route of administration can be an important factor.This multicenter, open-label, randomized trial, HVTN 069, compared routes of administration on safety and immunogenicity of a DNA vaccine prime given intramuscularly at 0, 1 and 2 months and a recombinant replication-defective adenovirus type 5 (rAd5 vaccine boost given at 6 months by intramuscular (IM, intradermal (ID, or subcutaneous (SC route. Randomization was computer-generated by a central data management center; participants and staff were not blinded to group assignment. The outcomes were vaccine reactogenicity and humoral and cellular immunogenicity. Ninety healthy, HIV-1 uninfected adults in the US and Peru, aged 18-50 were enrolled and randomized. Due to the results of the Step Study, injections with rAd5 vaccine were halted; thus 61 received the booster dose of rAd5 vaccine (IM: 20; ID:21; SC:20. After the rAd5 boost, significant differences by study arm were found in severity of headache, pain and erythema/induration. Immune responses (binding and neutralizing antibodies, IFN-γ ELISpot HIV-specific responses and CD4+ and CD8+ T-cell responses by ICS at four weeks after the rAd5 booster were not significantly different by administration route of the rAd5 vaccine boost (Binding antibody responses: IM: 66.7%; ID: 70.0%; SC: 77.8%; neutralizing antibody responses: IM: 11.1%; ID: 0.0%; SC 16.7%; ELISpot responses: IM: 46.7%; ID: 35.3%; SC: 44.4%; CD4+ T-cell responses: IM: 29.4%; ID: 20.0%; SC: 35.3%; CD8+ T-cell responses: IM: 29.4%; ID: 16.7%; SC: 50.0%.This study was limited by the reduced sample size. The higher frequency of local reactions after ID and SC administration and the lack of sufficient evidence to show that there were any differences in immunogenicity by route of administration do not support changing route of administration for the rAd5 boost.ClinicalTrials.gov NCT00384787.

  15. PCR typing of DNA fragments of the short tandem repeat (STR) system HUMTH01 in Danes and Greenland Eskimos

    DEFF Research Database (Denmark)

    Nellemann, L J; Møller, A; Morling, N

    1994-01-01

    /child pairs were analyzed. Significant differences were observed between the distribution of fragments ('alleles'), whereby allele number 7 was considerably more frequent in Eskimos (0.687) than in Danes (0.201). The distributions of HUMTH01 phenotypes were in Hardy-Weinberg equilibrium in both the Eskimo...

  16. Efficient production of antibody Fab fragment by transient gene expression in insect cells.

    Science.gov (United States)

    Mori, Keita; Hamada, Hirotsugu; Ogawa, Takafumi; Ohmuro-Matsuyama, Yuki; Katsuda, Tomohisa; Yamaji, Hideki

    2017-08-01

    Transient gene expression allows a rapid production of diverse recombinant proteins in early-stage preclinical and clinical developments of biologics. Insect cells have proven to be an excellent platform for the production of functional recombinant proteins. In the present study, the production of an antibody Fab fragment by transient gene expression in lepidopteran insect cells was investigated. The DNA fragments encoding heavy-chain (Hc; Fd fragment) and light-chain (Lc) genes of an Fab fragment were individually cloned into the plasmid vector pIHAneo, which contained the Bombyx mori actin promoter downstream of the B. mori nucleopolyhedrovirus (BmNPV) IE-1 transactivator and the BmNPV HR3 enhancer for high-level expression. Trichoplusia ni BTI-TN-5B1-4 (High Five) cells were co-transfected with the resultant plasmid vectors using linear polyethyleneimine. When the transfection efficiency was evaluated, a plasmid vector encoding an enhanced green fluorescent protein (EGFP) gene was also co-transfected. Transfection and culture conditions were optimized based on both the flow cytometry of the EGFP expression in transfected cells and the yield of the secreted Fab fragments determined by enzyme-linked immunosorbent assay (ELISA). Under optimal conditions, a yield of approximately 120 mg/L of Fab fragments was achieved in 5 days in a shake-flask culture. Transient gene expression in insect cells may offer a promising approach to the high-throughput production of recombinant proteins. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  17. Validation of a new test for Schistosoma haematobium based on detection of Dra1 DNA fragments in urine: evaluation through latent class analysis.

    Directory of Open Access Journals (Sweden)

    Olufunmilola Ibironke

    2012-01-01

    Full Text Available Diagnosis of urogenital schistosomiasis in chronically infected adults is challenging but important, especially because long term infection of the bladder and urinary tract can have dire consequences. We evaluated three tests for viable infection: detection of parasite specific DNA Dra1 fragments, haematuria and presence of parasite eggs for sensitivity (Se and specificity (Sp.Over 400 urine specimens collected from adult volunteers in an endemic area in Western Nigeria were assessed for haematuria then filtered in the field, the filter papers dried and later examined for eggs and DNA. The results were stratified according to sex and age and subjected to Latent Class analysis.Presence of Dra1 in males (Se=100%; Sp=100% exceeded haematuria (Se=87.6%: Sp=34.7% and detection of eggs (Se=70.1%; Sp=100%. In females presence of Dra1 was Se=100%: Sp=100%, exceeding haematuria (Se=86.7%: Sp=77.0% and eggs (Se=70.1%; Sp=100%. Dra1 became undetectable 2 weeks after praziquantel treatment. We conclude detection of Dra1 fragment is a definitive test for the presence of Schistosoma haematobium infection.

  18. Reactive oxygen species levels and DNA fragmentation on astrocytes in primary culture after acute exposure to low intensity microwave electromagnetic field.

    Science.gov (United States)

    Campisi, Agata; Gulino, Marisa; Acquaviva, Rosaria; Bellia, Paolo; Raciti, Giuseppina; Grasso, Rosaria; Musumeci, Francesco; Vanella, Angelo; Triglia, Antonio

    2010-03-31

    The exposure of primary rat neocortical astroglial cell cultures to acute electromagnetic fields (EMF) in the microwave range was studied. Differentiated astroglial cell cultures at 14 days in vitro were exposed for 5, 10, or 20min to either 900MHz continuous waves or 900MHz waves modulated in amplitude at 50Hz using a sinusoidal waveform and 100% modulation index. The strength of the electric field (rms value) at the sample position was 10V/m. No change in cellular viability evaluated by MTT test and lactate dehydrogenase release was observed. A significant increase in ROS levels and DNA fragmentation was found only after exposure of the astrocytes to modulated EMF for 20min. No evident effects were detected when shorter time intervals or continuous waves were used. The irradiation conditions allowed the exclusion of any possible thermal effect. Our data demonstrate, for the first time, that even acute exposure to low intensity EMF induces ROS production and DNA fragmentation in astrocytes in primary cultures, which also represent the principal target of modulated EMF. Our findings also suggest the hypothesis that the effects could be due to hyperstimulation of the glutamate receptors, which play a crucial role in acute and chronic brain damage. Furthermore, the results show the importance of the amplitude modulation in the interaction between EMF and neocortical astrocytes. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

  19. Recombinogenic engineering of conjugative plasmids with fluorescent marker cassettes

    DEFF Research Database (Denmark)

    Reisner, A.; Molin, Søren; Zechner, E.L.

    2002-01-01

    An efficient approach for the insertion of fluorescent marker genes with sequence specificity into conjugative plasmids in Escherichia coli is described. For this purpose, homologous recombination of linear double-stranded targeting DNA was mediated by the bacteriophage lambda recombination...... resistance genes and fluorescent markers. The choice of 5' non-homologous extensions in primer pairs used for amplifying the marker cassettes determines the site specificity of the targeting DNA. This methodology is applicable to the modification of all plasmids that replicate in E coli and is not restricted...

  20. Crystallization and preliminary X-ray crystallographic studies on the parD-encoded protein Kid from Escherichia coli plasmid R1

    NARCIS (Netherlands)

    Hargreaves, D.; Giraldo, R.; Santos-Sierra, S.; Boelens, R.; Rice, D.W.; Díaz Orejas, R.; Rafferty, J.B.

    2002-01-01

    DNA replication in Escherichia coli and therefore bacterial proliferation relies upon the efficient functioning of the DnaB helicase. The toxin protein Kid from the plasmid-stability system parD encoded on plasmid R1 of E. coli is thought to target and block DnaB-dependent DNA replication. The

  1. Effect of ovarian tissue storage in Morus nigra extract on the morphology and DNA fragmentation of ovine preantral follicles

    Directory of Open Access Journals (Sweden)

    Agnes Yasmin Pitombeira Cavalcante

    2017-08-01

    Full Text Available This study demonstrated the effect of Morus nigra leaf extract during ovine ovarian tissue transportation on the survival and apoptosis of preantral follicles in vitro. High Performance Liquid Chromatography (HPLC was used to determine the fingerprint chromatogram of the crude ethanolic extract. Four pairs of ovaries from four sheep were collected. The ovarian cortex was fragmented and one fragment was fixed in 10% buffered formaldehyde and processed for histological and TUNEL analysis (fresh control. The other fragments were placed in Minimal Essential Medium (MEM – control medium or M. nigra extract (0.025; 0.05 or 0.1 mg/mL and stored (simulating transport at 4ºC for 6, 12 or 24 h. Preserved fragments (6 h were also destined to histological and TUNEL analysis. HPLC analysis confirmed the presence of antioxidant compounds (rutin, isoquercetin e kaempferitrin in the extract. There was a decrease (P 0.05 to 0.1 mg/mL of the extract. Apoptosis increased (P < 0.05 after conservation for 6 h in all treatments compared to the fresh control. Moreover, TUNEL positive cells decreased (P < 0.05 after preservation in 0.05 or 0.1 mg/mL M. nigra compared to MEM or 0.025 mg/mL M. nigra. In conclusion, 0.05 mg/mL M. nigra extract can be used as a preservation medium for ovine ovarian tissue at 4°C for up to 6 h.

  2. Molecular characterization of Rhodococcus equi isolates from horses in Poland: pVapA characteristics and plasmid new variant, 85-kb type V.

    Science.gov (United States)

    Witkowski, Lucjan; Rzewuska, Magdalena; Takai, Shinji; Chrobak-Chmiel, Dorota; Kizerwetter-Świda, Magdalena; Feret, Małgorzata; Gawryś, Marta; Witkowski, Maciej; Kita, Jerzy

    2017-01-26

    Rhodococcus equi is one of the most significant bacterial pathogens affecting foals up to 6 months of age worldwide. Rhodococcosis is present in Poland however information about molecular characterization of R. equi isolates is scarce. This study describes molecular characterization of Rhodococcus equi infection on 13 horse breeding farms in Poland between 2001 and 2012. Samples were collected by tracheobronchial aspiration from pneumonic foals or during necropsy. The R. equi isolates were genotyped by plasmid profiling and pulsed-field gel electrophoresis. Totally, 58 R. equi isolates were investigated. One isolate lost its plasmid. Among the 57 VapA-positive isolates, 48 contained 85-kb type I plasmid (82.8%), 8 contained 87-kb type I plasmid (13.8%). One isolate (1.7%) had a unique restriction cleavage pattern and the 2nd fragment of EcoRI digests of this plasmid DNA was about 2600 bases smaller than that of the 85 kb type I. This new plasmid variant was designated as the "85-kb type V". Among the 58 isolates typeable with VspI-PFGE, ten PFGE clusters were detected. The majority of foals were infected mostly with isolates of low genetic diversity. Most of clinical isolates of R. equi from foals in Poland contain pVapA 85-kb type I and 87-kb type I similarly to the other European countries and the United States. However, the new variant of pVapA 85-kb type V was identified. The chromosomal variability was detected among some of the investigated isolates and the presence of farm-specific isolates might be possible.

  3. Sodium phenylbutyrate ameliorates focal cerebral ischemic/reperfusion injury associated with comorbid type 2 diabetes by reducing endoplasmic reticulum stress and DNA fragmentation.

    Science.gov (United States)

    Srinivasan, Krishnamoorthy; Sharma, Shyam S

    2011-11-20

    Endoplasmic reticulum (ER) stress has been postulated to play a crucial role in the pathophysiology of cerebral ischemic/reperfusion (I/R) injury and diabetes. Diabetes is a major risk factor and also common amongst the people who suffer from stroke. In this study, we have investigated the neuroprotective potential of sodium 4-phenylbutyrate (SPB; 30-300mg/kg), a chemical chaperone by targeting ER stress in a rat model of transient focal cerebral ischemia associated with comorbid type 2 diabetes. Intraperitoneal treatment with SPB (100 and 300mg/kg) significantly ameliorated brain I/R damage as evidenced by reduction in cerebral infarct and edema volume. It also significantly improved the functional recovery of various neurobehavioral impairments (neurological deficit score, grip strength and rota rod) evoked by I/R compared with vehicle-treatment. Further, SPB (100mg/kg) significantly reduced the DNA fragmentation as shown by prominent reduction in terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL)-positive cells. This effect was observed concomitantly with significant attenuation in upregulation of 78kDa glucose regulated protein (GRP78), CCAAT/enhancer binding protein homologous protein or growth arrest DNA damage-inducible gene 153 (CHOP/GADD153) and activation of caspase-12, specific markers of ER stress/apoptosis. The neuroprotection observed with SPB was independent of its effect on cerebral blood flow and blood glucose. In conclusion, this study demonstrates the neuroprotective effect of SPB owing to amelioration of ER stress and DNA fragmentation. It also suggest that targeting ER stress might offer a promising therapeutic approach and benefits against ischemic stroke associated with comorbid type 2 diabetes. Copyright © 2011 Elsevier B.V. All rights reserved.

  4. High-frequency transformation of a methylotrophic yeast, Candida boidinii, with autonomously replicating plasmids which are also functional in Saccharomyces cerevisiae.

    Science.gov (United States)

    Sakai, Y; Goh, T K; Tani, Y

    1993-06-01

    We have developed a transformation system which uses autonomous replicating plasmids for a methylotrophic yeast, Candida boidinii. Two autonomous replication sequences, CARS1 and CARS2, were newly cloned from the genome of C. boidinii. Plasmids having both a CARS fragment and the C. boidinii URA3 gene transformed C. boidinii ura3 cells to Ura+ phenotype at frequencies of up to 10(4) CFU/micrograms of DNA. From Southern blot analysis, CARS plasmids seemed to exist in polymeric forms as well as in monomeric forms in C. boidinii cells. The C. boidinii URA3 gene was overexpressed in C. boidinii on these CARS vectors. CARS1 and CARS2 were found to function as an autonomous replicating element in Saccharomyces cerevisiae as well. Different portions of the CARS1 sequence were needed for autonomous replicating activity in C. boidinii and S. cerevisiae. C. boidinii could also be transformed with vectors harboring a CARS fragment and the S. cerevisiae URA3 gene.

  5. Identification of Candida species by PCR and restriction fragment length polymorphism analysis of intergenic spacer regions of ribosomal DNA.

    OpenAIRE

    Williams, D W; Wilson, M J; Lewis, M A; Potts, A J

    1995-01-01

    The PCR was used to amplify a targeted region of the ribosomal DNA from 84 Candida isolates. Unique product sizes were obtained for Candida guilliermondii, Candida (Torulopsis) glabrata, and Candida pseudotropicalis. Isolates of Candida albicans, Candida tropicalis, Candida stellatoidea, Candida parapsilosis, and Candida krusei could be identified following restriction digestion of the PCR products.

  6. Reconstructing the complex evolutionary history of mobile plasmids in red algal genomes

    Science.gov (United States)

    Lee, JunMo; Kim, Kyeong Mi; Yang, Eun Chan; Miller, Kathy Ann; Boo, Sung Min; Bhattacharya, Debashish; Yoon, Hwan Su

    2016-01-01

    The integration of foreign DNA into algal and plant plastid genomes is a rare event, with only a few known examples of horizontal gene transfer (HGT). Plasmids, which are well-studied drivers of HGT in prokaryotes, have been reported previously in red algae (Rhodophyta). However, the distribution of these mobile DNA elements and their sites of integration into the plastid (ptDNA), mitochondrial (mtDNA), and nuclear genomes of Rhodophyta remain unknown. Here we reconstructed the complex evolutionary history of plasmid-derived DNAs in red algae. Comparative analysis of 21 rhodophyte ptDNAs, including new genome data for 5 species, turned up 22 plasmid-derived open reading frames (ORFs) that showed syntenic and copy number variation among species, but were conserved within different individuals in three lineages. Several plasmid-derived homologs were found not only in ptDNA but also in mtDNA and in the nuclear genome of green plants, stramenopiles, and rhizarians. Phylogenetic and plasmid-derived ORF analyses showed that the majority of plasmid DNAs originated within red algae, whereas others were derived from cyanobacteria, other bacteria, and viruses. Our results elucidate the evolution of plasmid DNAs in red algae and suggest that they spread as parasitic genetic elements. This hypothesis is consistent with their sporadic distribution within Rhodophyta. PMID:27030297

  7. Persistence of plasmid DNA in different soils

    African Journals Online (AJOL)

    STORAGESEVER

    2008-08-04

    Aug 4, 2008 ... perform better, not only in the term of bioremediation efficiency, but also in an environmentally safe ... would never interbreed in nature. Completely new, exotic genes can therefore be introduced into crops. ... zontal gene transfer from genetically modified plants. (GMP) to soil associated bacteria (Nielsen et ...

  8. Physical and chemical properties of chromatin and its fragments formed in the rat thymus during postirradiation autolysis and under the influence of DNA-ase and protease on DNP preparations

    International Nuclear Information System (INIS)

    Ermolaeva, N.V.; Vodolazskaya, N.A.

    1978-01-01

    It has been shown that the thymus chromatin degradation 2-8 hr after irradiation is followed by its cross-splitting and accumulation of several types of fragments differing in the degree of DNA association with the protein. Participation of proteases in the formation of fragments is hardly probable. Acid DNAase is involved in the autolysis perhaps in his maximum later 6 hr after irradiation

  9. Toward metrological traceability for DNA fragment ratios in GM quantification. 1. Effect of DNA extraction methods on the quantitative determination of Bt176 corn by real-time PCR.

    Science.gov (United States)

    Corbisier, Philippe; Broothaerts, Wim; Gioria, Sabrina; Schimmel, Heinz; Burns, Malcolm; Baoutina, Anna; Emslie, Kerry R; Furui, Satoshi; Kurosawa, Yasunori; Holden, Marcia J; Kim, Hyong-Ha; Lee, Yun-Mi; Kawaharasaki, Mamoru; Sin, Della; Wang, Jing

    2007-05-02

    An international CCQM-P60 pilot study involving eight national metrological institutes was organized to investigate if the quantification of genetically modified (GM) corn powder by real-time PCR was affected by the DNA extraction method applied. Four commonly used extraction methods were compared for the extraction of DNA from a GM Bt176 corn powder. The CTAB-based method yielded the highest DNA template quantity and quality. A difference in the 260 nm/230 nm absorbance ratio was observed among the different extraction methods. Real-time amplification of sequences specific for endogenous genes zein and hmg as well as transgenic sequences within the cryIA(b) gene and a fragment covering the junction between the transformed DNA and the plant genome were used to determine the GM percentage. The detection of the transgenic gene was affected by the quantity and quality of template used for the PCR reaction. The Bt176 percentages measured on diluted or purified templates were statistically different depending on the extraction method applied.

  10. Electrochemical sensors based on stationary electrodes and immobilized DNA or its fragments and the assessment of their analytical potentials

    Czech Academy of Sciences Publication Activity Database

    Babkina, S. S.; Paleček, Emil; Jelen, František; Fojta, Miroslav

    2005-01-01

    Roč. 60, č. 6 (2005), s. 567-572 ISSN 1061-9348. [VII All-Russia Conference (with international participation) on Electrochemical Methods of Analysis. Ufa, 23.05.2004-27.05.2004] R&D Projects: GA MPO(CZ) 1H-PK/42 Institutional research plan: CEZ:AV0Z50040507 Keywords : electrochemical biosensor * DNA imobilization * nitrocellulose matrix Subject RIV: BO - Biophysics Impact factor: 0.496, year: 2005

  11. In Silico Detection and Typing of Plasmids using PlasmidFinder and Plasmid Multilocus Sequence Typing

    DEFF Research Database (Denmark)

    Carattoli, Alessandra; Zankari, Ea; García-Fernández, Aurora

    2014-01-01

    In the work presented here, we designed and developed two easy-to-use Web tools for in silico detection and characterization of whole-genome sequence (WGS) and whole-plasmid sequence data from members of the family Enterobacteriaceae. These tools will facilitate bacterial typing based on draft...... genomes of multidrug-resistant Enterobacteriaceae species by the rapid detection of known plasmid types. Replicon sequences from 559 fully sequenced plasmids associated with the family Enterobacteriaceae in the NCBI nucleotide database were collected to build a consensus database for integration...... sequences identified in the 559 fully sequenced plasmids. For plasmid multilocus sequence typing (pMLST) analysis, a database that is updated weekly was generated from www.pubmlst.org and integrated into a Web tool called pMLST. Both databases were evaluated using draft genomes from a collection...

  12. A homicide in the Ukraine: DNA-based identification of a boiled, skeletonized, and varnished human skull, and of bone fragments found in a fireplace.

    Science.gov (United States)

    Sivolap, Y; Krivda, G; Kozhuhova, N; Chebotar, S; Benecke, M

    2001-12-01

    In an apartment, bone fragments were found in a fireplace. Furthermore, a varnished skull was found elsewhere in the same apartment. The tenant confessed to a murder and stated that the head of a victim, a girl, was boiled for 12 hours. He stated that the soft tissue was then removed and the skull was varnished. Other parts of the body were burned to ashes in an open field. Comparison of loci D19S252, CD4, CYAR04, TII01, F13A01, F13B, and D6S366 from the skull and the bone remains to loci of the mother of a missing girl showed that the skull came from that missing child. Biological maternity was calculated as 99.99%. The bone pieces were DNA typed as male and did not share alleles with the mother in several systems. Therefore, they belonged to a different (human) victim.

  13. Nucleolin forms a specific complex with a fragment of the viral (minus) strand of minute virus of mice DNA.

    Science.gov (United States)

    Barrijal, S; Perros, M; Gu, Z; Avalosse, B L; Belenguer, P; Amalric, F; Rommelaere, J

    1992-01-01

    Nucleolin, a major nucleolar protein, forms a specific complex with the genome (a single-stranded DNA molecule of minus polarity) of parvovirus MVMp in vitro. By means of South-western blotting experiments, we mapped the binding site to a 222-nucleotide motif within the non-structural transcription unit, referred to as NUBE (nucleolin-binding element). The specificity of the interaction was confirmed by competitive gel retardation assays. DNaseI and nuclease S1 probing showed that NUBE folds into a secondary structure, in agreement with a computer-assisted conformational prediction. The whole NUBE may be necessary for the interaction with nucleolin, as suggested by the failure of NUBE subfragments to bind the protein and by the nuclease footprinting experiments. The present work extends the previously reported ability of nucleolin to form a specific complex with ribosomal RNA, to a defined DNA substrate. Considering the tropism of MVMp DNA replication for host cell nucleoli, these data raise the possibility that nucleolin may contribute to the regulation of the parvoviral life-cycle. Images PMID:1408821

  14. Characterization of a human MSX-2 cDNA and its fragment isolated as a transformation suppressor gene against v-Ki-ras oncogene.

    Science.gov (United States)

    Takahashi, C; Akiyama, N; Matsuzaki, T; Takai, S; Kitayama, H; Noda, M

    1996-05-16

    A cDNA (termed CT124) encoding a carboxyl-terminal fragment of the human homeobox protein MSX-2 was found to induce flat reversion when expressed in v-Ki-ras-transformed NIH3T3 cells. Although the expression of endogenous MSX-2 gene is low in most of the normal adult tissues examined, it is frequently activated in carcinoma-derived cell lines. Likewise, the gene is inactive in NIH3T3 cells but is transcriptionally activated after transformation by v-Ki-ras oncogene, suggesting that the intact MSX-2 may play a positive, rather than suppressive, role in cell transformation. To test this possibility, we isolated a near full-length human MSX-2 cDNA and tested its activities in two cell systems, i.e. fibroblast and myoblast. In NIH3T3 fibroblasts, although the gene by itself failed to confer a transformed phenotype, antisense MSX-2 cDNA as well as truncated CT124 cDNA interfered with the transforming activities of v-Ki-ras oncogene. In C2C12 myoblasts, MSX-2 was found to suppress MyoD gene expression, as do activated ras oncogenes, under certain culture conditions, and CT124 was found to inhibit the activities of both MSX-2 and ras in this system as well. Our findings not only suggest that CT124 may act as a dominant suppressor of MSX-2 but also raise the possibility that MSX-2 gene may be an important downstream target for the Ras signaling pathways.

  15. The characteristics of micrococcus (deinococcus) radiodurans sark plasmids

    International Nuclear Information System (INIS)

    Sjarief, Sri Hariani; Kikuchi, Masahiro; Watanabe, Hiroshi.

    1994-01-01

    The characterization of micrococcus (deinococcus) radiodurans sark plasmids. This bacterium has been classified as a new genus deinococcus radiodurans which is resistant to gamma-rays. It can repair itself completely almost all of DNA damages including double strand breaks induced by gamma-rays up to about 5 KGy. To reveal the repair mechanism, several investigations had been done to develop a cloning vector available for the genetic analysis. For this purpose D. radiodurans Sark are to be prepared as a vector by studying the characteristics of its plasmid. Plasmids were isolated by electrophoresis using 0.6% low-melting-temperature agarose in TAE and run for 5.5 hours, followed by the identification. An antibiotic marker was also carried out in this experiment to identify its location in the genetic materials of the cell, beside making a restriction map of the plasmid. Results have shown that D. radiodurans Sark has 4 plasmids (P1, P2, P3, and P4) and the refampicin resistant genes were not found in the plasmid. (authors). 14 refs; 4 figs

  16. Multiple drug resistant carbapenemases producing Acinetobacter baumannii isolates harbours multiple R-plasmids

    Directory of Open Access Journals (Sweden)

    Rajagopalan Saranathan

    2014-01-01

    Full Text Available Background & objectives: The nosocomial human pathogen Acinetobacter baumannii has high propensity to develop resistance to antimicrobials and to become multidrug resistant (MDR, consequently complicating the treatment. This study was carried out to investigate the prese