Directly transforming PCR-amplified DNA fragments into plant cells is a versatile system that facilitates the transient expression assay.

Directory of Open Access Journals (Sweden)

Yuming Lu

Full Text Available A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments based transient expression system (PCR-TES for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells.

Plasmid-derived DNA Strand Displacement Gates for Implementing Chemical Reaction Networks.

Science.gov (United States)

Chen, Yuan-Jyue; Rao, Sundipta D; Seelig, Georg

2015-11-25

DNA nanotechnology requires large amounts of highly pure DNA as an engineering material. Plasmid DNA could meet this need since it is replicated with high fidelity, is readily amplified through bacterial culture and can be stored indefinitely in the form of bacterial glycerol stocks. However, the double-stranded nature of plasmid DNA has so far hindered its efficient use for construction of DNA nanostructures or devices that typically contain single-stranded or branched domains. In recent work, it was found that nicked double stranded DNA (ndsDNA) strand displacement gates could be sourced from plasmid DNA. The following is a protocol that details how these ndsDNA gates can be efficiently encoded in plasmids and can be derived from the plasmids through a small number of enzymatic processing steps. Also given is a protocol for testing ndsDNA gates using fluorescence kinetics measurements. NdsDNA gates can be used to implement arbitrary chemical reaction networks (CRNs) and thus provide a pathway towards the use of the CRN formalism as a prescriptive molecular programming language. To demonstrate this technology, a multi-step reaction cascade with catalytic kinetics is constructed. Further it is shown that plasmid-derived components perform better than identical components assembled from synthetic DNA.

Plasmid construction using recombination activity in the fission yeast Schizosaccharomyces pombe.

Directory of Open Access Journals (Sweden)

Ayako Chino

Full Text Available BACKGROUND: Construction of plasmids is crucial in modern genetic manipulation. As of now, the common method for constructing plasmids is to digest specific DNA sequences with restriction enzymes and to ligate the resulting DNA fragments with DNA ligase. Another potent method to construct plasmids, known as gap-repair cloning (GRC, is commonly used in the budding yeast Saccharomyces cerevisiae. GRC makes use of the homologous recombination activity that occurs within the yeast cells. Due to its flexible design and efficiency, GRC has been frequently used for constructing plasmids with complex structures as well as genome-wide plasmid collections. Although there have been reports indicating GRC feasibility in the fission yeast Schizosaccharomyces pombe, this species is not commonly used for GRC as systematic studies of reporting GRC efficiency in S. pombe have not been performed till date. METHODOLOGY/PRINCIPAL FINDINGS: We investigated GRC efficiency in S. pombe in this study. We first showed that GRC was feasible in S. pombe by constructing a plasmid that contained the LEU2 auxotrophic marker gene in vivo and showed sufficient efficiency with short homology sequences (>25 bp. No preference was shown for the sequence length from the cut site in the vector plasmid. We next showed that plasmids could be constructed in a proper way using 3 DNA fragments with 70% efficiency without any specific selections being made. The GRC efficiency with 3 DNA fragments was dramatically increased >95% in lig4Delta mutant cell, where non-homologous end joining is deficient. Following this approach, we successfully constructed plasmid vectors with leu1+, ade6+, his5+, and lys1+ markers with the low-copy stable plasmid pDblet as a backbone by applying GRC in S. pombe. CONCLUSIONS/SIGNIFICANCE: We concluded that GRC was sufficiently feasible in S. pombe for genome-wide gene functional analysis as well as for regular plasmid construction. Plasmids with different

Quantification bias caused by plasmid DNA conformation in quantitative real-time PCR assay.

Science.gov (United States)

Lin, Chih-Hui; Chen, Yu-Chieh; Pan, Tzu-Ming

2011-01-01

Quantitative real-time PCR (qPCR) is the gold standard for the quantification of specific nucleic acid sequences. However, a serious concern has been revealed in a recent report: supercoiled plasmid standards cause significant over-estimation in qPCR quantification. In this study, we investigated the effect of plasmid DNA conformation on the quantification of DNA and the efficiency of qPCR. Our results suggest that plasmid DNA conformation has significant impact on the accuracy of absolute quantification by qPCR. DNA standard curves shifted significantly among plasmid standards with different DNA conformations. Moreover, the choice of DNA measurement method and plasmid DNA conformation may also contribute to the measurement error of DNA standard curves. Due to the multiple effects of plasmid DNA conformation on the accuracy of qPCR, efforts should be made to assure the highest consistency of plasmid standards for qPCR. Thus, we suggest that the conformation, preparation, quantification, purification, handling, and storage of standard plasmid DNA should be described and defined in the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) to assure the reproducibility and accuracy of qPCR absolute quantification.

Characterization of Plasmid DNA Location within Chitosan/PLGA/pDNA Nanoparticle Complexes Designed for Gene Delivery

Directory of Open Access Journals (Sweden)

Hali Bordelon

2011-01-01

Full Text Available Poly(D,L-lactide-co-glycolide- (PLGA-chitosan nanoparticles are becoming an increasingly common choice for the delivery of nucleic acids to cells for various genetic manipulation techniques. These particles are biocompatible, with tunable size and surface properties, possessing an overall positive charge that promotes complex formation with negatively charged nucleic acids. This study examines properties of the PLGA-chitosan nanoparticle/plasmid DNA complex after formation. Specifically, the study aims to determine the optimal ratio of plasmid DNA:nanoparticles for nucleic acid delivery purposes and to elucidate the location of the pDNA within these complexes. Such characterization will be necessary for the adoption of these formulations in a clinical setting. The ability of PLGA-chitosan nanoparticles to form complexes with pDNA was evaluated by using the fluorescent intercalating due OliGreen to label free plasmid DNA. By monitoring the fluorescence at different plasmid: nanoparticle ratios, the ideal plasmid:nanoparticle ration for complete complexation of plasmid was determined to be 1:50. Surface-Enhanced Raman Spectroscopy and gel digest studies suggested that even at these optimal complexation ratios, a portion of the plasmid DNA was located on the outer complex surface. This knowledge will facilitate future investigations into the functionality of the system in vitro and in vivo.

Magnetic bead purification of labeled DNA fragments forhigh-throughput capillary electrophoresis sequencing

Energy Technology Data Exchange (ETDEWEB)

Elkin, Christopher; Kapur, Hitesh; Smith, Troy; Humphries, David; Pollard, Martin; Hammon, Nancy; Hawkins, Trevor

2001-09-15

We have developed an automated purification method for terminator sequencing products based on a magnetic bead technology. This 384-well protocol generates labeled DNA fragments that are essentially free of contaminates for less than $0.005 per reaction. In comparison to laborious ethanol precipitation protocols, this method increases the phred20 read length by forty bases with various DNA templates such as PCR fragments, Plasmids, Cosmids and RCA products. Our method eliminates centrifugation and is compatible with both the MegaBACE 1000 and ABIPrism 3700 capillary instruments. As of September 2001, this method has produced over 1.6 million samples with 93 percent averaging 620 phred20 bases as part of Joint Genome Institutes Production Process.

Comparative assessment of plasmid DNA delivery by encapsulation ...

African Journals Online (AJOL)

Tropical Journal of Pharmaceutical Research January 2018; 17 (1): 1-10 ... Purpose: To compare the gene delivery effectiveness of plasmid DNA (pDNA) ..... Intramuscular delivery of DNA ... copolymeric system for gene delivery in complete.

DNA repair in bacterial cultures and plasmid DNA exposed to infrared laser for treatment of pain

International Nuclear Information System (INIS)

Canuto, K S; Sergio, L P S; Marciano, R S; Guimarães, O R; Polignano, G A C; Geller, M; Fonseca, A S; Paoli, F

2013-01-01

Biostimulation of tissues by low intensity lasers has been described on a photobiological basis and clinical protocols are recommended for treatment of various diseases, but their effects on DNA are controversial. The objective of this work was to evaluate effects of low intensity infrared laser exposure on survival and bacterial filamentation in Escherichia coli cultures, and induction of DNA lesions in bacterial plasmids. In E. coli cultures and plasmids exposed to an infrared laser at fluences used to treat pain, bacterial survival and filamentation and DNA lesions in plasmids were evaluated by electrophoretic profile. Data indicate that the infrared laser (i) increases survival of E. coli wild type in 24 h of stationary growth phase, (ii) induces bacterial filamentation, (iii) does not alter topological forms of plasmids and (iv) does not alter the electrophoretic profile of plasmids incubated with exonuclease III or formamidopyrimidine DNA glycosylase. A low intensity infrared laser at the therapeutic fluences used to treat pain can alter survival of E. coli wild type, induce filamentation in bacterial cells, depending on physiologic conditions and DNA repair, and induce DNA lesions other than single or double DNA strand breaks or alkali-labile sites, which are not targeted by exonuclease III or formamidopyrimidine DNA glycosylase. (letter)

Comparative assessment of plasmid DNA delivery by encapsulation ...

African Journals Online (AJOL)

Purpose: To compare the gene delivery effectiveness of plasmid DNA (pDNA) encapsulated within poly (D,L-lactide-co-glycolide) (PLGA) nanoparticles with that adsorbed on PLGA nanoparticles. Methods: PLGA nanoparticles were prepared using solvent-evaporation method. To encapsulate pDNA within the particles, ...

Rapid and inexpensive method for isolating plasmid DNA

International Nuclear Information System (INIS)

Aljanabi, S. M.; Al-Awadi, S. J.; Al-Kazaz, A. A.; Baghdad Univ.

1997-01-01

A small-scale and economical method for isolating plasmid DNA from bacteria is described. The method provides DNA of suitable quality for most DNA manipulation techniques. This DNA can be used for restriction endonuclease digestion, southern blot hybridization, nick translation and end labeling of DNA probes, Polymerase Chain Reaction (PCR) -based techniques, transformation, DNA cycle-sequencing, and Chain-termination method for DNA sequencing. The entire procedure is adapted to 1.5 ml microfuge tubes and takes approximately 30 mins. The DNA isolated by this method has the same purity produced by CTAB and cesium chloride precipitation and purification procedures respectively. The two previous methods require many hours to obtain the final product and require the use of very expensive equipment as ultracentrifuge. This method is well suited for the isolation of plasmid DNA from a large number of bacterial samples and in a very short time and low cost in laboratories where chemicals, expensive equipment and finance are limited factors in conducting molecular research. (authors). 11refs. 11refs

DNA fragmentation in spermatozoa

DEFF Research Database (Denmark)

Rex, A S; Aagaard, J.; Fedder, J

2017-01-01

Sperm DNA Fragmentation has been extensively studied for more than a decade. In the 1940s the uniqueness of the spermatozoa protein complex which stabilizes the DNA was discovered. In the fifties and sixties, the association between unstable chromatin structure and subfertility was investigated....... In the seventies, the impact of induced DNA damage was investigated. In the 1980s the concept of sperm DNA fragmentation as related to infertility was introduced as well as the first DNA fragmentation test: the Sperm Chromatin Structure Assay (SCSA). The terminal deoxynucleotidyl transferase nick end labelling...... (TUNEL) test followed by others was introduced in the nineties. The association between DNA fragmentation in spermatozoa and pregnancy loss has been extensively investigated spurring the need for a therapeutic tool for these patients. This gave rise to an increased interest in the aetiology of DNA damage...

3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

Science.gov (United States)

Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

2008-09-01

We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

Restriction Fragment Length Polymorphisms of Virulence Plasmids in Rhodococcus equi

Science.gov (United States)

Takai, Shinji; Shoda, Masato; Sasaki, Yukako; Tsubaki, Shiro; Fortier, Guillaume; Pronost, Stephane; Rahal, Karim; Becu, Teotimo; Begg, Angela; Browning, Glenn; Nicholson, Vivian M.; Prescott, John F.

1999-01-01

Virulent Rhodococcus equi, which is a well-known cause of pyogranulomatous pneumonia in foals, possesses a large plasmid encoding virulence-associated 15- to 17-kDa antigens. Foal and soil isolates from five countries—Argentina, Australia, Canada, France, and Japan—were investigated for the presence of 15- to 17-kDa antigens by colony blotting, using the monoclonal antibody 10G5, and the gene coding for 15- to 17-kDa antigens by PCR. Plasmid DNAs extracted from positive isolates were digested with restriction endonucleases BamHI, EcoRI, EcoT22I, and HindIII, and the digestion patterns that resulted divided the plasmids of virulent isolates into five closely related types. Three of the five types had already been reported in Canadian and Japanese isolates, and the two new types had been found in French and Japanese isolates. Therefore, we tentatively designated these five types 85-kb type I (pREAT701), 85-kb type II (a new type), 87-kb type I (EcoRI and BamHI type 2 [V. M. Nicholson and J. F. Prescott, J. Clin. Microbiol. 35:738–740, 1997]), 87-kb type II (a new type), and 90-kb (pREL1) plasmids. The 85-kb type I plasmid was found in isolates from Argentina, Australia, Canada, and France. Plasmid 87-kb type I was isolated in specimens from Argentina, Canada, and France. The 85-kb type II plasmid appeared in isolates from France. On the other hand, plasmids 87-kb type II and 90-kb were found only in isolates from Japan. These results revealed geographic differences in the distribution of the virulence plasmids found in the five countries and suggested that the restriction fragment length polymorphism of virulence plasmids might be useful to elucidate the molecular epidemiology of virulent R. equi in the world. PMID:10488224

Repair of UV-irradiated plasmid DNA in excision repair deficient mutants of Saccharomyces cerevisiae

International Nuclear Information System (INIS)

Ikai, K.; Tano, K.; Ohnishi, T.; Nozu, K.

1985-01-01

The repair of UV-irradiated DNA of plasmid YEp13 was studied in the incision defective strains by measurement of cell transformation frequency. In Saccharomyces cerevisiae, rad1,2,3 and 4 mutants could repair UV-damaged plasmid DNA. In Escherichia coli, uvrA mutant was unable to repair UV-damaged plasmid DNA; however, pretreatment of the plasmid with Micrococcus luteus endonuclease increased repair. It was concluded that all the mutations of yeast were probably limited only to the nuclear DNA. (author)

Autonomous replication of plasmids bearing monkey DNA origin-enriched sequences

International Nuclear Information System (INIS)

Frappier, L.; Zannis-Hadjopoulos, M.

1987-01-01

Twelve clones of origin-enriched sequences (ORS) isolated from early replicating monkey (CV-1) DNA were examined for transient episomal replication in transfected CV-1, COS-7, and HeLa cells. Plasmid DNA was isolated at time intervals after transfection and screened by the Dpn I resistance assay or by the bromodeoxyuridine substitution assay to differentiate between input and replicated DNA. The authors have identified four monkey ORS (ORS3, -8, -9, and -12) that can support plasmid replication in mammalian cells. This replication is carried out in a controlled and semiconservative manner characteristic of mammalian replicons. ORS replication was most efficient in HeLa cells. Electron microscopy showed ORS8 and ORS12 plasmids of the correct size with replication bubbles. Using a unique restriction site in ORS12, we have mapped the replication bubble within the monkey DNA sequence

Effect of the atmospheric pressure nonequilibrium plasmas on the conformational changes of plasmid DNA

International Nuclear Information System (INIS)

Yan Xu; He Guangyuan; Shi Mengjun; Gao Xuan; Li Yin; Ma Fengyun; Yu Men; Wang Changdong; Wang Yuesheng; Yang Guangxiao; Zou Fei; Lu Xinpei; Xiong Qing; Xiong Zilan

2009-01-01

The cold atmospheric pressure plasma, which has been widely used for biomedical applications, may potentially affect the conformation of DNA. In this letter, an atmospheric pressure plasma plume is used to investigate its effects on the conformational changes of DNA of plasmid pAHC25. It is found that the plasma plume could cause plasmid DNA topology alteration, resulting in the percentage of the supercoiled plasmid DNA form decreased while that of the open circular and linearized form of plasmid DNA increased as detected by agrose gel electrophoresis. On the other hand, further investigation by using polymerase chain reaction method shows that the atmospheric pressure plasma jet treatments under proper conditions does not affect the genes of the plasmid DNA, which may have potential application in increasing the transformation frequency by genetic engineering.

Plasmid DNA damage induced by helium atmospheric pressure plasma jet

Science.gov (United States)

Han, Xu; Cantrell, William A.; Escobar, Erika E.; Ptasinska, Sylwia

2014-03-01

A helium atmospheric pressure plasma jet (APPJ) is applied to induce damage to aqueous plasmid DNA. The resulting fractions of the DNA conformers, which indicate intact molecules or DNA with single- or double-strand breaks, are determined using agarose gel electrophoresis. The DNA strand breaks increase with a decrease in the distance between the APPJ and DNA samples under two working conditions of the plasma source with different parameters of applied electric pulses. The damage level induced in the plasmid DNA is also enhanced with increased plasma irradiation time. The reactive species generated in the APPJ are characterized by optical emission spectra, and their roles in possible DNA damage processes occurring in an aqueous environment are also discussed.

CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion.

Science.gov (United States)

Santillán, Orlando; Ramírez-Romero, Miguel A; Dávila, Guillermo

2017-06-25

Here, we present chimera assembly by plasmid recovery and restriction enzyme site insertion (CAPRRESI). CAPRRESI benefits from many strengths of the original plasmid recovery method and introduces restriction enzyme digestion to ease DNA ligation reactions (required for chimera assembly). For this protocol, users clone wildtype genes into the same plasmid (pUC18 or pUC19). After the in silico selection of amino acid sequence regions where chimeras should be assembled, users obtain all the synonym DNA sequences that encode them. Ad hoc Perl scripts enable users to determine all synonym DNA sequences. After this step, another Perl script searches for restriction enzyme sites on all synonym DNA sequences. This in silico analysis is also performed using the ampicillin resistance gene (ampR) found on pUC18/19 plasmids. Users design oligonucleotides inside synonym regions to disrupt wildtype and ampR genes by PCR. After obtaining and purifying complementary DNA fragments, restriction enzyme digestion is accomplished. Chimera assembly is achieved by ligating appropriate complementary DNA fragments. pUC18/19 vectors are selected for CAPRRESI because they offer technical advantages, such as small size (2,686 base pairs), high copy number, advantageous sequencing reaction features, and commercial availability. The usage of restriction enzymes for chimera assembly eliminates the need for DNA polymerases yielding blunt-ended products. CAPRRESI is a fast and low-cost method for fusing protein-coding genes.

Virus-sized self-assembling lamellar complexes between plasmid DNA and cationic micelles promote gene transfer

Science.gov (United States)

Pitard, Bruno; Aguerre, Olivier; Airiau, Marc; Lachagès, Anne-Marie; Boukhnikachvili, Tsiala; Byk, Gérardo; Dubertret, Catherine; Herviou, Christian; Scherman, Daniel; Mayaux, Jean-François; Crouzet, Joël

1997-01-01

Gene therapy is based on the vectorization of genes to target cells and their subsequent expression. Cationic amphiphile-mediated delivery of plasmid DNA is the nonviral gene transfer method most often used. We examined the supramolecular structure of lipopolyamine/plasmid DNA complexes under various condensing conditions. Plasmid DNA complexation with lipopolyamine micelles whose mean diameter was 5 nm revealed three domains, depending on the lipopolyamine/plasmid DNA ratio. These domains respectively corresponded to negatively, neutrally, and positively charged complexes. Transmission electron microscopy and x-ray scattering experiments on complexes originating from these three domains showed that although their morphology depends on the lipopolyamine/plasmid DNA ratio, their particle structure consists of ordered domains characterized by even spacing of 80 Å, irrespective of the lipid/DNA ratio. The most active lipopolyamine/DNA complexes for gene transfer were positively charged. They were characterized by fully condensed DNA inside spherical particles (diameter: 50 nm) sandwiched between lipid bilayers. These results show that supercoiled plasmid DNA is able to transform lipopolyamine micelles into a supramolecular organization characterized by ordered lamellar domains. PMID:9405626

Functionalized tetrapod-like ZnO nanostructures for plasmid DNA purification, polymerase chain reaction and delivery

International Nuclear Information System (INIS)

Nie Leng; Gao Lizeng; Yan Xiyun; Wang Taihong

2007-01-01

Functionalized tetrapodal ZnO nanostructures are tested in plasmid DNA experiments (1) as a solid-phase adsorbent for plasmid DNA purification (2) as improving reagents in a polymerase chain reaction (PCR) and (3) as novel carriers for gene delivery. The amino-modification, the tetrapod-like shape of the nanostructure and its high biocompatibility all contribute to measurements showing promise for applications. A sol-gel method is used for silica coating and amino-modification. Plasmid DNA is purified through reversible conjugations of amino-modified ZnO tetrapods with DNA. Also, as additional reagents, functionalized tetrapods are shown to improve the amount of PCR product. For transfection, ZnO tetrapods provide some protection against deoxyribonuclease cleavage of plasmid DNA and deliver plasmid DNA into cells with little cytotoxicity

Cloning and characterization of BKV(MM) DNA and its use for detection of BKV DNA in human urine

International Nuclear Information System (INIS)

Harley, E.H.; Olliver, C.L.; Rhodes-Harrison, L.; Mew, R.T.; Lecatsas, G.; Naude, W. du T.

1982-01-01

The two fragments produced by restriction of BKV(MM) DNA with the endonucleases Pst I and Eco RI have been cloned separately into the vector pBR322 and amplified in E. coli HB101. Eight recombinant plasmids were characterized by gel electrophoresis of Pst I/Eco RI double digestions or Hind III digestions of the DNA and by hybridization of Southern gel blots to a nick-translated BKV(MM) DNA probe. Four of the recombinant plasmids contained the large Pst I/Eco RI BKV(MM) DNA fragment and four contained the small fragment. Two of these recombinant plasmids were then used to make a probe for the identification of BK DNA in a urine specimen from a patient known to be exreting particles with the morphological features of papovavirus [af

Chemical and biological consequences of the radioactive decay of iodine-125 in plasmid DNA

International Nuclear Information System (INIS)

Linz, U.

1983-09-01

The consequences of the decay of iodine-125 incorporated into DNA were studied on a molecular basis. Doubly ( 14 C and 125 I) labelled 5-iodo-2'-deoxycytidine 5'-triphosphate (IdCTP) was synthesized and incorporated enzymatically into the SalI-cutting site of the plasmid pBR 322. Part of the radioiodinated DNA was treated with T4-DNA ligase in order to restore the circular structure of the native plasmid molecule. After 4 months of storage under various conditions the stable end products were analyzed by radio GC, radio HPLC and electron microscopy. The experiments were not only carried out with doubly-labelled DNA but also with solutions of 14 C-labelled DNA containing Na 125 I as internal radiation source. The results clearly indicate that radiolysis alone causes only minor damage. Transmutation of the covalently bound iodine, on the other hand, leads to complete destruction of the labelled nucleotide, giving rise to 14 CO 2 and 14 CO as main products. The production of 14 CO 2 which originates from both the base as well as the sugar component shows a strong solvent effect. The electron microscopy analysis of the DNA reveals that the local effects are always connected with at least one double strand break directly at the site of decay. In addition, one finds DNA double strand breaks in areas which are hundreds of base pairs apart from that site. Under certain circumstances most of the DNA molecules exhibit up to 10 breaks. A comparison between ligase-treated and untreated DNA shows that the configuration of the DNA and the position of the labelled nucleotide play in important role in the extent of the overall damage. It could be demonstrated that there is a linear correlation between gaseous fragmentation products and the number of double strand breaks. (orig./MG) [de

Radioautographic test for genetic cotton transformation by pCaVItoxneo hybrid plasmid

International Nuclear Information System (INIS)

Imamkhodjaeva, A.S.

2006-01-01

Full text: Search for novel technologies in biology, application of up-to-date methods in gene engineering, manipulation with the recombinant DNA, in particular, open opportunities for experiments with plants. To identify some DNA fragments in an organism's genome, radioautographic methods, such as dot- and blot-hybridization are frequently used. As a rule, genomic DNA is first isolated from the plant's organ. Its purification and subsequent manipulation is followed by hybridization with a probe labeled with radioactive components. The purified DNA, cDNA of RNA reverse transcription or a DNA fragment cloned in E-coli could serve as the probe. Radioautography shows homologically hybridized fragments. We have performed express dot-hybridization analysis on hybrid plasmid transformation of G.Hirsutum L. (108F) and G. Barbadense L. (C-6037) cotton sorts. pCaVItoxneo plasmid obtained on the basis of independently replicated plasmid-like DNA of the G.Hirsutum L. (pGHm2) cotton mitochondria was used (Yusupov T., 1994). There are hybrid two-domain gene of insectotoxin and enzymatically active kanamycine - phosphotransferase in the plasmid. The whole content is controlled by the plant promoter of cauliflower mosaic virus (19 S SFMV). The plasmid in question was added to the pollen sprouting medium followed by the transfer of the suspension on the pistil stigmas of the pre-prepared cotton flowers. The seed budding as the result of the experiment were analyzed by means of dot-hybridization method. DNA probes used for radioactive hybridization were labeled by method of Fainberg and Vagelstein (1990). To perform that DNA was dissolved in Tris-EDTA (10:1), containing 10mM of Tris HCl and 1mM EDTA, denaturated at 100 d eg C for 2 minutes with subsequent addition of oligonucleotide primers and annealing. DNA synthesis in the presence of 32 P labeled dATP and dCTP (Tashkent) was performed in the reaction mixture of potassium-phosphate buffer containing 67mM of MgCl 2 , 1 mg/ml of

Fragment Length of Circulating Tumor DNA.

Science.gov (United States)

Underhill, Hunter R; Kitzman, Jacob O; Hellwig, Sabine; Welker, Noah C; Daza, Riza; Baker, Daniel N; Gligorich, Keith M; Rostomily, Robert C; Bronner, Mary P; Shendure, Jay

2016-07-01

Malignant tumors shed DNA into the circulation. The transient half-life of circulating tumor DNA (ctDNA) may afford the opportunity to diagnose, monitor recurrence, and evaluate response to therapy solely through a non-invasive blood draw. However, detecting ctDNA against the normally occurring background of cell-free DNA derived from healthy cells has proven challenging, particularly in non-metastatic solid tumors. In this study, distinct differences in fragment length size between ctDNAs and normal cell-free DNA are defined. Human ctDNA in rat plasma derived from human glioblastoma multiforme stem-like cells in the rat brain and human hepatocellular carcinoma in the rat flank were found to have a shorter principal fragment length than the background rat cell-free DNA (134-144 bp vs. 167 bp, respectively). Subsequently, a similar shift in the fragment length of ctDNA in humans with melanoma and lung cancer was identified compared to healthy controls. Comparison of fragment lengths from cell-free DNA between a melanoma patient and healthy controls found that the BRAF V600E mutant allele occurred more commonly at a shorter fragment length than the fragment length of the wild-type allele (132-145 bp vs. 165 bp, respectively). Moreover, size-selecting for shorter cell-free DNA fragment lengths substantially increased the EGFR T790M mutant allele frequency in human lung cancer. These findings provide compelling evidence that experimental or bioinformatic isolation of a specific subset of fragment lengths from cell-free DNA may improve detection of ctDNA.

Plasmid DNA damage caused by stibine and trimethylstibine

International Nuclear Information System (INIS)

Andrewes, Paul; Kitchin, Kirk T.; Wallace, Kathleen

2004-01-01

Antimony is classified as 'possibly carcinogenic to humans' and there is also sufficient evidence for antimony carcinogenicity in experimental animals. Stibine is a volatile inorganic antimony compound to which humans can be exposed in occupational settings (e.g., lead-acid battery charging). Because it is highly toxic, stibine is considered a significant health risk; however, its genotoxicity has received little attention. For the work reported here, stibine was generated by sodium borohydride reduction of potassium antimony tartrate. Trimethylstibine is a volatile organometallic antimony compound found commonly in landfill and sewage fermentation gases at concentrations ranging between 0.1 and 100 μg/m 3 . Trimethylstibine is generally considered to pose little environmental or health risk. In the work reported here, trimethylstibine was generated by reduction of trimethylantimony dichloride using either sodium borohydride or the thiol compounds, dithioerythritol (DTE), L-cysteine, and glutathione. Here we report the evaluation of the in vitro genotoxicities of five antimony compounds--potassium antimony tartrate, stibine, potassium hexahydroxyantimonate, trimethylantimony dichloride, and trimethylstibine--using a plasmid DNA-nicking assay. Of these five antimony compounds, only stibine and trimethylstibine were genotoxic (significant nicking to pBR 322 plasmid DNA). We found stibine and trimethylstibine to be about equipotent with trimethylarsine using this plasmid DNA-nicking assay. Reaction of trimethylantimony dichloride with either glutathione or L-cysteine to produce DNA-damaging trimethylstibine was observed with a trimethylantimony dichloride concentration as low as 50 μM and L-cysteine or glutathione concentrations as low as 500 and 200 μM, respectively, for a 24 h incubation

Tissue-specific Calibration of Real-time PCR Facilitates Absolute Quantification of Plasmid DNA in Biodistribution Studies

Directory of Open Access Journals (Sweden)

Joan K Ho

2016-01-01

Full Text Available Analysis of the tissue distribution of plasmid DNA after administration of nonviral gene delivery systems is best accomplished using quantitative real-time polymerase chain reaction (qPCR, although published strategies do not allow determination of the absolute mass of plasmid delivered to different tissues. Generally, data is expressed as the mass of plasmid relative to the mass of genomic DNA (gDNA in the sample. This strategy is adequate for comparisons of efficiency of delivery to a single site but it does not allow direct comparison of delivery to multiple tissues, as the mass of gDNA extracted per unit mass of each tissue is different. We show here that by constructing qPCR standard curves for each tissue it is possible to determine the dose of intact plasmid remaining in each tissue, which is a more useful parameter when comparing the fates of different formulations of DNA. We exemplify the use of this tissue-specific qPCR method by comparing the delivery of naked DNA, cationic DNA complexes, and neutral PEGylated DNA complexes after intramuscular injection. Generally, larger masses of intact plasmid were present 24 hours after injection of DNA complexes, and neutral complexes resulted in delivery of a larger mass of intact plasmid to the spleen.

Evaluation of the effect of non-B DNA structures on plasmid integrity via accelerated stability studies.

Science.gov (United States)

Ribeiro, S C; Monteiro, G A; Prazeres, D M F

2009-04-01

Plasmid biopharmaceuticals are a new class of medicines with an enormous potential. Attempts to increase the physical stability of highly purified supercoiled (SC) plasmid DNA in pharmaceutical aqueous solutions have relied on: (i) changing the DNA sequence, (ii) improving manufacturing to reduce deleterious impurities and initial DNA damage, and (iii) controlling the storage medium characteristics. In this work we analyzed the role of secondary structures on the degradation of plasmid molecules. Accelerated stability experiments were performed with SC, open circular (OC) and linear (L) isoforms of three plasmids which differed only in the "single-strandlike" content of their polyadenylation (poly A) signals. We have proved that the presence of more altered or interrupted (non-B) DNA secondary structures did not directly translate into an easier strand scission of the SC isoforms. Rather, those unusual structures imposed a lower degree of SC in the plasmids, leading to an increase in their resistance to thermal degradation. However, this behavior was reversed when the relaxed or L isoforms were tested, in which case the absence of SC rendered the plasmids essentially double-stranded. Overall, this work suggests that plasmid DNA sequence and secondary structures should be taken into account in future investigations of plasmid stability during prolonged storage.

Photoinduced silver nanoparticles/nanorings on plasmid DNA scaffolds.

Science.gov (United States)

Liu, Jianhua; Zhang, Xiaoliang; Yu, Mei; Li, Songmei; Zhang, Jindan

2012-01-23

Biological scaffolds are being actively explored for the synthesis of nanomaterials with novel structures and unexpected properties. Toroidal plasmid DNA separated from the Bacillus host is applied as a sacrificial mold for the synthesis of silver nanoparticles and nanorings. The photoirradiation method is applied to reduce Ag(I) on the plasmid. The nanoparticles are obtained by varying the concentration of the Ag(I) ion solution and the exposure time of the plasmid-Ag(I) complex under UV light at 254 nm and room temperature. It is found that the plasmid serves not only as a template but also as a reductant to drive the silver nucleation and deposition. The resulting nanoparticles have a face-centered cubic (fcc) crystal structure and 20-30 nm average diameter. The detailed mechanism is discussed, and other metals or alloys could also be synthesized with this method. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

Directory of Open Access Journals (Sweden)

Utut Widyastuti Suharsono

2008-11-01

Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

Association and Expression of Virulence from Plasmids of the Group B Strain in Pseudomonas syringae pv. eriobotryae

Directory of Open Access Journals (Sweden)

Tran Dang Khanh

2018-04-01

Full Text Available Pseudomonas syringae pv. eriobotryae causes serious stem canker in loquat (Eriobotrya japonica trees. This study was conducted to determine whether plasmids are involved with its virulence. The strain NAE89, which belonged to the B group, harbored two plasmids at approximately 6.2 and 50 Mdal that caused stem canker and halo leaf spots on loquat plants. Following digestion with BamHI and ligation into the BamHI cloning site of the broad range host cosmid pLAFR3, four DNA fragments at 3.8, 6.6, 12.3, and 22.8 kb were generated. Although the plasmid-encoded virulence gene psvA was undigested with the BamHI, the halo leaf spot gene may be adjacent to the psvA gene was digested. A pLAFR3 cosmid clone was introduced into the non-pathogenic PE0 and NAE89-1 strains by triparental matings and the pathogenicity was recovered. As a result, the pLAFR3 cosmid clone was introduced into the largest size DNA fragment of 22.8 kb and determined to be the causal agent of canker on the stem of the loquat. This study revealed that the psvA gene, previously found in the 50 Mdal plasmid, was also observed in the 22.8 kb DNA fragment.

Photoresponsive Bridged Silsesquioxane Nanoparticles with Tunable Morphology for Light-Triggered Plasmid DNA Delivery

KAUST Repository

Fatieiev, Yevhen

2015-09-25

Bridged silsesquioxane nanocomposites with tunable morphologies incorporating o-nitrophenylene-ammonium bridges are described. The systematic screening of the sol-gel parameters allowed the material to reach the nanoscale –unlike most reported bridged silsesquioxane materials– with controlled dense and hollow structures of 100 to 200 nm. The hybrid composition of silsesquioxanes with 50% of organic content homogenously distributed in the nanomaterials endowed them with photoresponsive properties. Light irradiation was performed to reverse the surface charge of nanoparticles from +46 to -39 mV via the photoreaction of the organic fragments within the particles, as confirmed by spectroscopic monitorings. Furthermore, such NPs were ap-plied for the first time for the on-demand delivery of plasmid DNA in HeLa cancer cells via light actuation.

Photoresponsive Bridged Silsesquioxane Nanoparticles with Tunable Morphology for Light-Triggered Plasmid DNA Delivery

KAUST Repository

Fatieiev, Yevhen; Croissant, Jonas G.; Alsaiari, Shahad K.; Moosa, Basem; Anjum, Dalaver H.; Khashab, Niveen M.

2015-01-01

Bridged silsesquioxane nanocomposites with tunable morphologies incorporating o-nitrophenylene-ammonium bridges are described. The systematic screening of the sol-gel parameters allowed the material to reach the nanoscale –unlike most reported bridged silsesquioxane materials– with controlled dense and hollow structures of 100 to 200 nm. The hybrid composition of silsesquioxanes with 50% of organic content homogenously distributed in the nanomaterials endowed them with photoresponsive properties. Light irradiation was performed to reverse the surface charge of nanoparticles from +46 to -39 mV via the photoreaction of the organic fragments within the particles, as confirmed by spectroscopic monitorings. Furthermore, such NPs were ap-plied for the first time for the on-demand delivery of plasmid DNA in HeLa cancer cells via light actuation.

Optimizing hyaluronidase dose and plasmid DNA delivery greatly improves gene electrotransfer efficiency in rat skeletal muscle

DEFF Research Database (Denmark)

Åkerström, Thorbjörn; Vedel, Kenneth; Needham Andersen, Josefine

2015-01-01

Transfection of rat skeletal muscle in vivo is a widely used research model. However, gene electrotransfer protocols have been developed for mice and yield variable results in rats. We investigated whether changes in hyaluronidase pre-treatment and plasmid DNA delivery can improve transfection...... with a homogenous distribution. We also show that transfection was stable over five weeks of regular exercise or inactivity. Our findings show that species-specific plasmid DNA delivery and hyaluronidase pre-treatment greatly improves transfection efficiency in rat skeletal muscle....... efficiency in rat skeletal muscle. We found that pre-treating the muscle with a hyaluronidase dose suitable for rats (0.56. U/g b.w.) prior to plasmid DNA injection increased transfection efficiency by >200% whereas timing of the pre-treatment did not affect efficiency. Uniformly distributing plasmid DNA...

Solid lipid nanoparticles mediate non-viral delivery of plasmid DNA to dendritic cells

Science.gov (United States)

Penumarthi, Alekhya; Parashar, Deepti; Abraham, Amanda N.; Dekiwadia, Chaitali; Macreadie, Ian; Shukla, Ravi; Smooker, Peter M.

2017-06-01

There is an increasing demand for novel DNA vaccine delivery systems, mainly for the non-viral type as they are considered relatively safe. Therefore, solid lipid nanoparticles (SLNs) were investigated for their suitability as a non-viral DNA vaccine delivery system. SLNs were synthesised by a modified solvent-emulsification method in order to study their potential to conjugate with plasmid DNA and deliver them in vitro to dendritic cells using eGFP as the reporter plasmid. The DNA-SLN complexes were characterised by electron microscopy, gel retardation assays and dynamic light scattering. The cytotoxicity assay data supported their biocompatibility and was used to estimate safe threshold concentration resulting in high transfection rate. The transfection efficiency of these complexes in a dendritic cell line was shown to increase significantly compared to plasmid alone, and was comparable to that mediated by lipofectamine. Transmission electron microscopy studies delineated the pathway of cellular uptake. Endosomal escape was observed supporting the mechanism of transfection.

Plasmid DNA damage by heavy ions at spread-out Bragg peak energies

NARCIS (Netherlands)

Dang, H. M.; van Goethem, M. J.; van der Graaf, E. R.; Brandenburg, S.; Hoekstra, R.; Schlatholter, T.

2010-01-01

Interaction of ionizing radiation with plasmid DNA can lead to formation of single strand breaks, double strand breaks and clustered lesions. We have investigated the response of the synthetic plasmid pBR322 in aqueous solution upon irradiation with (12)C ions under spread-out Bragg peak conditions

Plasmid DNA Analysis of Pasteurella multocida Serotype B isolated from Haemorrhagic Septicaemia outbreaks in Malaysia

Directory of Open Access Journals (Sweden)

Jamal, H.

2005-01-01

Full Text Available A total of 150 purified isolates of Pasteurella multocida serotype B were used (Salmah, 2004 for plasmid DNA curing experiment to determine hyaluronidase activity, antibiotic resistance pattern (ARP and mice lethality test (LD50 for their role of pathogenicity. A plasmid curing experiment was carried out by using the intercalating agent; ethidium bromide and rifampicin, where it was found all the plasmids had been cured (plasmidless from Pasteurella multocida. All of these plasmidless isolates maintained their phenotypic characteristics. They showed the same antibiotic resistancepattern as before curing, produced hyaluronidase and possessed lethality activity in mice when injected intraperitoneally(i.p. Based on this observation, the antibiotic resistance, hyaluronidase activity and mice virulence could probably be chromosomal-mediated. Plasmids were detected 100% in all P. multocida isolates with identical profile of 2 plasmids size 3.0 and 5.5 kb. No large plasmids could be detected in all isolates. Since all the isolates appeared to have identicalplasmid profiles, they were subjected to restriction enzyme(RE analysis. From RE analysis results obtained, it can be concluded that the plasmid DNA in serotype B isolates are identical. Only 4 of 32 REs were found to cleave these plasmids with identical restriction fingerprints; BglII, HaeIII, RsaI and SspI. From RE analysis results, it can be concluded that the plasmid DNA isolates are identical. This plasmid might not played any role in pathogenicity of Pasteurella multocida serotype B, however this information is important for the construction of shuttle vectors in genetic studies of the pathogenicity of haemorrhagic septicaemia(HS.

AFEAP cloning: a precise and efficient method for large DNA sequence assembly.

Science.gov (United States)

Zeng, Fanli; Zang, Jinping; Zhang, Suhua; Hao, Zhimin; Dong, Jingao; Lin, Yibin

2017-11-14

Recent development of DNA assembly technologies has spurred myriad advances in synthetic biology, but new tools are always required for complicated scenarios. Here, we have developed an alternative DNA assembly method named AFEAP cloning (Assembly of Fragment Ends After PCR), which allows scarless, modular, and reliable construction of biological pathways and circuits from basic genetic parts. The AFEAP method requires two-round of PCRs followed by ligation of the sticky ends of DNA fragments. The first PCR yields linear DNA fragments and is followed by a second asymmetric (one primer) PCR and subsequent annealing that inserts overlapping overhangs at both sides of each DNA fragment. The overlapping overhangs of the neighboring DNA fragments annealed and the nick was sealed by T4 DNA ligase, followed by bacterial transformation to yield the desired plasmids. We characterized the capability and limitations of new developed AFEAP cloning and demonstrated its application to assemble DNA with varying scenarios. Under the optimized conditions, AFEAP cloning allows assembly of an 8 kb plasmid from 1-13 fragments with high accuracy (between 80 and 100%), and 8.0, 11.6, 19.6, 28, and 35.6 kb plasmids from five fragments at 91.67, 91.67, 88.33, 86.33, and 81.67% fidelity, respectively. AFEAP cloning also is capable to construct bacterial artificial chromosome (BAC, 200 kb) with a fidelity of 46.7%. AFEAP cloning provides a powerful, efficient, seamless, and sequence-independent DNA assembly tool for multiple fragments up to 13 and large DNA up to 200 kb that expands synthetic biologist's toolbox.

Fragmentation in DNA double-strand breaks

International Nuclear Information System (INIS)

Wei Zhiyong; Suzhou Univ., Suzhou; Zhang Lihui; Li Ming; Fan Wo; Xu Yujie

2005-01-01

DNA double strand breaks are important lesions induced by irradiations. Random breakage model or quantification supported by this concept is suitable to analyze DNA double strand break data induced by low LET radiation, but deviation from random breakage model is more evident in high LET radiation data analysis. In this work we develop a new method, statistical fragmentation model, to analyze the fragmentation process of DNA double strand breaks. After charged particles enter the biological cell, they produce ionizations along their tracks, and transfer their energies to the cells and break the cellular DNA strands into fragments. The probable distribution of the fragments is obtained under the condition in which the entropy is maximum. Under the approximation E≅E 0 + E 1 l + E 2 l 2 , the distribution functions are obtained as exp(αl + βl 2 ). There are two components, the one proportional to exp(βl 2 ), mainly contributes to the low mass fragment yields, the other component, proportional to exp(αl), decreases slowly as the mass of the fragments increases. Numerical solution of the constraint equations provides parameters α and β. Experimental data, especially when the energy deposition is higher, support the statistical fragmentation model. (authors)

Persistence of plasmids, cholera toxin genes, and prophage DNA in classical Vibrio cholerae O1.

Science.gov (United States)

Cook, W L; Wachsmuth, K; Johnson, S R; Birkness, K A; Samadi, A R

1984-07-01

Plasmid profiles, the location of cholera toxin subunit A genes, and the presence of the defective VcA1 prophage genome in classical Vibrio cholerae isolated from patients in Bangladesh in 1982 were compared with those in older classical strains isolated during the sixth pandemic and with those in selected eltor and nontoxigenic O1 isolates. Classical strains typically had two plasmids (21 and 3 megadaltons), eltor strains typically had no plasmids, and nontoxigenic O1 strains had zero to three plasmids. The old and new isolates of classical V. cholerae had two HindIII chromosomal digest fragments containing cholera toxin subunit A genes, whereas the eltor strains from Eastern countries had one fragment. The eltor strains from areas surrounding the Gulf of Mexico also had two subunit A gene fragments, which were smaller and easily distinguished from the classical pattern. All classical strains had 8 to 10 HindIII fragments containing the defective VcA1 prophage genome; none of the Eastern eltor strains had these genes, and the Gulf Coast eltor strains contained a different array of weakly hybridizing genes. These data suggest that the recent isolates of classical cholera in Bangladesh are closely related to the bacterial strain(s) which caused classical cholera during the sixth pandemic. These data do not support hypotheses that either the eltor or the nontoxigenic O1 strains are precursors of the new classical strains.

Supramolecular gel electrophoresis of large DNA fragments.

Science.gov (United States)

Tazawa, Shohei; Kobayashi, Kazuhiro; Oyoshi, Takanori; Yamanaka, Masamichi

2017-10-01

Pulsed-field gel electrophoresis is a frequent technique used to separate exceptionally large DNA fragments. In a typical continuous field electrophoresis, it is challenging to separate DNA fragments larger than 20 kbp because they migrate at a comparable rate. To overcome this challenge, it is necessary to develop a novel matrix for the electrophoresis. Here, we describe the electrophoresis of large DNA fragments up to 166 kbp using a supramolecular gel matrix and a typical continuous field electrophoresis system. C 3 -symmetric tris-urea self-assembled into a supramolecular hydrogel in tris-boric acid-EDTA buffer, a typical buffer for DNA electrophoresis, and the supramolecular hydrogel was used as a matrix for electrophoresis to separate large DNA fragments. Three types of DNA marker, the λ-Hind III digest (2 to 23 kbp), Lambda DNA-Mono Cut Mix (10 to 49 kbp), and Marker 7 GT (10 to 165 kbp), were analyzed in this study. Large DNA fragments of greater than 100 kbp showed distinct mobility using a typical continuous field electrophoresis system. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Absence of ultraviolet-inducible DNA polymerase I-like activity in Escherichia coli strains harbouring R plasmids

International Nuclear Information System (INIS)

Upton, C.; Pinney, R.J.

1981-01-01

No DNA polymerase I-like activity was found associated with the ultraviolet (u.v.)-protecting plasmids R205, R46 or pKM101 in either uninduced or u.v.-induced wild-type or DNA polymerase I-deficient strains of Escherichia coli. Nor was any plasmid-associated polymerase activity detectable in similar systems containing u.v.-irradiated DNA as template. However, plasmids R205, R46 and pKM 101 still increased survival and mutagenesis of the polymerase I-deficient E. coli strain after u.v. irradiation. (author)

TOL plasmid carriage enhances biofilm formation and increases extracellular DNA content in Pseudomonas putida KT2440

DEFF Research Database (Denmark)

D'Alvise, Paul; Sjoholm, O.R.; Yankelevich, T.

2010-01-01

laser scanning microscopy. The TOL-carrying strains formed pellicles and thick biofilms, whereas the same strains without the plasmid displayed little adherent growth. Microscopy using fluorescent nucleic acid-specific stains revealed differences in the production of extracellular polymeric substances......: TOL carriage leads to more extracellular DNA (eDNA) in pellicles and biofilms. Pellicles were dissolved by DNase I treatment. Enhanced cell lysis due to plasmid carriage was ruled out as the mechanism for eDNA release. We report, for the first time, that carriage of a conjugative plasmid leads...

Pharmaceutical development of the plasmid DNA vaccine pDERMATT

NARCIS (Netherlands)

Quaak, S.G.L.

2009-01-01

The discovery of tumor specific antigens and self tolerance mechanisms against these antigens led to the assumption that antigens circulating at sufficient concentration levels could break this self tolerance mechanism and evoke immunological antitumor effects. pDERMATT (plasmid DNA encoding

Dichromatic laser radiation effects on DNA of Escherichia coli and plasmids

Science.gov (United States)

Martins, W. A.; Polignano, G. A. C.; Guimarães, O. R.; Geller, M.; Paoli, F.; Fonseca, A. S.

2015-04-01

Dichromatic and consecutive laser radiations have attracted increased attention for clinical applications as offering new tools for the treatment of dysfunctional tissues in situations where monochromatic radiation is not effective. This work evaluated the survival, filamentation and morphology of Escherichia coli cells, and the induction of DNA lesions, in plasmid DNA exposed to low-intensity consecutive dichromatic laser radiation. Exponential and stationary wild type and formamidopyrimidine DNA glycosylase/MutM protein deficient E. coli cultures were exposed to consecutive low-intensity dichromatic laser radiation (infrared laser immediately after red laser) to study the survival, filamentation and morphology of bacterial cells. Plasmid DNA samples were exposed to dichromatic radiation to study DNA lesions by electrophoretic profile. Dichromatic laser radiation affects the survival, filamentation and morphology of E. coli cultures depending on the growth phase and the functional repair mechanism of oxidizing lesions in DNA, but does not induce single/double strands breaks or alkali-labile DNA lesions. Results show that low-intensity consecutive dichromatic laser radiation induces biological effects that differ from those induced by monochromatic laser radiation, suggesting that other therapeutic effects could be obtained using dichromatic radiation.

Toward metrological traceability for DNA fragment ratios in GM quantification. 3. Suitability of DNA calibrants studied with a MON 810 corn model.

Science.gov (United States)

Charels, Diana; Broeders, Sylvia; Corbisier, Philippe; Trapmann, Stefanie; Schimmel, Heinz; Emons, Hendrik

2007-05-02

The quantification of GMOs by real-time PCR relies on an external calibrant. In this paper the suitability of two DNA calibrants, genomic DNA from plant leaves and plasmidic DNA, was investigated. The PCR efficiencies, the correlation coefficients of the calibration curves, and the ratios between PCR efficiencies of transgenic and endogenous sequences were compared for both calibrants using 59 data sets produced by 43 laboratories. There were no significant differences between plasmidic and genomic DNA except for the PCR efficiencies of the calibration curves for the transgene of the construct-specific real-time PCR method. In the GM system investigated, PCR efficiencies of plasmidic calibrants were slightly closer to the PCR efficiencies observed for the unknowns than those of the genomic DNA calibrant. Therefore, plasmidic DNA was the more suitable calibrant for the PCR measurements on genomic DNA extracted from MON 810 seeds. It is shown that plasmidic DNA is an appropriate choice for the calibration of measurements of MON 810 corn with respect to the DNA copy number ratio.

Evaluation of plasmid and genomic DNA calibrants used for the quantification of genetically modified organisms.

Science.gov (United States)

Caprioara-Buda, M; Meyer, W; Jeynov, B; Corbisier, P; Trapmann, S; Emons, H

2012-07-01

The reliable quantification of genetically modified organisms (GMOs) by real-time PCR requires, besides thoroughly validated quantitative detection methods, sustainable calibration systems. The latter establishes the anchor points for the measured value and the measurement unit, respectively. In this paper, the suitability of two types of DNA calibrants, i.e. plasmid DNA and genomic DNA extracted from plant leaves, for the certification of the GMO content in reference materials as copy number ratio between two targeted DNA sequences was investigated. The PCR efficiencies and coefficients of determination of the calibration curves as well as the measured copy number ratios for three powder certified reference materials (CRMs), namely ERM-BF415e (NK603 maize), ERM-BF425c (356043 soya), and ERM-BF427c (98140 maize), originally certified for their mass fraction of GMO, were compared for both types of calibrants. In all three systems investigated, the PCR efficiencies of plasmid DNA were slightly closer to the PCR efficiencies observed for the genomic DNA extracted from seed powders rather than those of the genomic DNA extracted from leaves. Although the mean DNA copy number ratios for each CRM overlapped within their uncertainties, the DNA copy number ratios were significantly different using the two types of calibrants. Based on these observations, both plasmid and leaf genomic DNA calibrants would be technically suitable as anchor points for the calibration of the real-time PCR methods applied in this study. However, the most suitable approach to establish a sustainable traceability chain is to fix a reference system based on plasmid DNA.

The effects of a low-intensity red laser on bacterial growth, filamentation and plasmid DNA

International Nuclear Information System (INIS)

Roos, C; Santos, J N; Guimarães, O R; Geller, M; Fonseca, A S; Paoli, F

2013-01-01

Exposure of nonphotosynthesizing microorganisms to light could increase cell division in cultures, a phenomenon denominated as biostimulation. However, data concerning the importance of the genetic characteristics of cells on this effect are as yet scarce. The aim of this work was to evaluate the effects of a low-intensity red laser on the growth, filamentation and plasmids in Escherichia coli cells proficient and deficient in DNA repair. E. coli cultures were exposed to a laser (658 nm, 10 mW, 1 and 8 J cm −2 ) to study bacterial growth and filamentation. Also, bacterial cultures hosting pBSK plasmids were exposed to the laser to study DNA topological forms from the electrophoretic profile in agarose gels. Data indicate the low-intensity red laser: (i) had no effect on the growth of E. coli wild type and exonuclease III deficient cells; (ii) induced bacterial filamentation, (iii) led to no alteration in the electrophoretic profile of plasmids from exonuclease III deficient cells, but plasmids from wild type cells were altered. A low-intensity red laser at the low fluences used in phototherapy has no effect on growth, but induces filamentation and alters the topological forms of plasmid DNA in E. coli cultures depending on the DNA repair mechanisms. (paper)

Damage of plasmid DNA by high energy ions

International Nuclear Information System (INIS)

Michaelidesova, A.; Pachnerova Brabcova, K.; Davidkova, M.

2018-01-01

The aim of the study was to determine the degree of direct DNA damage by high-energy ions, which are one of the components of cosmic rays, and therefore the knowledge of the biological effects of these ions is key to long-term space missions with human crew. The pBR322 plasmid containing 4361 base pairs was used in this study. The aqueous solution of plasmid pBR322 was transferred on ice to Japan to the Heavy Ion Medical Accelerator in Chiba, the Research Center for Charged Particle Therapy. Just before the experiment, the droplets of solution of known concentration were applied to the slides and the water was allowed to evaporate to produce dry DNA samples. Half of the slides were irradiated with 290 MeV/u of carbon ions and a dose rate of 20 Gy/min. The other half of the slides were irradiated with helium nuclei of 150 MeV/hr and a dose rate of 12.6 Gy/min. Both sets of slides were irradiated with doses of 0-1,400 Gy with a 200 Gy step. After irradiation, the samples were re-dissolved in distilled water, frozen and transported on ice to the Czech Republic for processing. Samples were analyzed by agarose gel electrophoresis. The plasmid was evaluated separately to determine the degree of radiation induced lesions and further to incubation with enzymes recognizing basal damage. (authors)

Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

Science.gov (United States)

Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

2014-11-01

Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates

Resident enhanced repair: novel repair process action on plasmid DNA transformed into Escherichia coli K-12

International Nuclear Information System (INIS)

Strike, P.; Roberts, R.J.

1982-01-01

The survival of UV-irradiated DNA of plasmid NTP16 was monitored after its transformation into recipient cells containing an essentially homologous undamaged plasmid, pLV9. The presence of pLV9 resulted in a substantial increase in the fraction of damaged NTP16 molecules which survived in the recipient cells. This enhanced survival requires the host uvrA + and uvrB + gene products, but not the host recA + gene product. The requirement for both homologous DNA and the uvrA + gene products suggests that a novel repair process may act on plasmid DNA. Possible mechanisms for this process are considered

Breaks in plasmid DNA strand induced by laser radiation at a wavelength of 193 nm

International Nuclear Information System (INIS)

Gurzadyan, G.G.; Shul'te Frolinde, D.

1996-01-01

DNA of plasmid pB322 irradiated with laser at a wavelength of 193 nm was treated with an extract containing proteins from E.coli K12 AB1157 (wild-type). The enzymes were found to produce single- and double-strand DNA breaks, which was interpreted as a transformation of a portion of cyclobutane pyrimidine dimers and (6-4) photoproducts into nonrepairable single-strand DNA breaks. The products resulted from ionization of DNA, in particular, single-strand breaks, transform to double-strand breaks. A comparison of these data with the data on survival of plasmid upon transformation of E.coli K12 AB1157 enables one to assess the biological significance of single- and double-strand breaks. The inactivation of the plasmid is mainly determined by the number of directly formed laser-induced single-strand breaks. 26 refs.; 2 figs

Replication and Transcription of Eukaryotic DNA in Esherichia coli

Science.gov (United States)

Morrow, John F.; Cohen, Stanley N.; Chang, Annie C. Y.; Boyer, Herbert W.; Goodman, Howard M.; Helling, Robert B.

1974-01-01

Fragments of amplified Xenopus laevis DNA, coding for 18S and 28S ribosomal RNA and generated by EcoRI restriction endonuclease, have been linked in vitro to the bacterial plasmid pSC101; and the recombinant molecular species have been introduced into E. coli by transformation. These recombinant plasmids, containing both eukaryotic and prokaryotic DNA, replicate stably in E. coli. RNA isolated from E. coli minicells harboring the plasmids hybridizes to amplified X. laevis rDNA. Images PMID:4600264

Strand breaks and lethal damage in plasmid DNA subjected to 60CO-γirradiation

International Nuclear Information System (INIS)

Klimczak, U.

1992-01-01

Experiments with calf thymus DNA subjected to extracellular irradiation yield information on the role of direct and indirect effects in single-strand breakage, if this is evaluated with reference to the scavenger activity in respect of OH radicals. The role of the two processes in the occurrence of double-stand breaks and further damage leading to cell decay has so far remained largely obscure. It was the aim of the study described here to contribute to research in this field by performing in vitro experiments on biologically active DNA. For this purpose, DNA from pBR322 plasmids was irradiated in the presence of OH-radical scavengers. The number of single-strand and double-strand breaks was determined on the basis of the system's ability to eliminate OH radicals. In order to asses the influence of irradiation processes on the biological activity of DNA, investigations were carried out in E. coli for transformations caused by irradiated plasmid DNA. The results were interpreted in the light of theories about inhomogenous reaction kinetics put forward by Mark et al. (1989). It was finally discussed, which of the gamma-irradiation injuries occurring in DNA was to be held responsible for the inactivation of plasmid DNA and which enzymatic processes were additionally at work here. (orig./MG) [de

Genotoxic activity of 4,4',5'-trimethylazapsoralen on plasmid DNA.

Science.gov (United States)

Lagatolla, C; Dolzani, L; Granzotto, M; Monti-Bragadin, C

1998-01-01

The genotoxic activities of 8-methoxypsoralen (8-MOP) and 4,4',5'-trimethylazapsoralen (4,4',5'-TMAP) on plasmid DNA have been compared. In a previous work, 4,4',5'-TMAP, a methyl derivative of a psoralen isoster, had shown potential photochemotherapeutic activity. The mutagenic activity of mono- and bifunctional lesions caused by these compounds was evaluated both after UVA irradiation, which causes the formation of both kinds of lesions, and after a two-step irradiation procedure of the psoralen-plasmid DNA complex, which allowed monoadducts and interstrand crosslinks to be studied separately. Furthermore, we used a procedure that allowed us to evaluate both the mutagenic and recombinogenic activity of the two compounds. Results indicate that the most important difference between 8-MOP and 4,4',5'-TMAP consists in their mode of photoreaction with DNA rather than in their mutagenic potential. In fact, in all of the experimental procedures, 4,4',5'-TMAP shows a lower ability than 8-MOP to generate interstrand crosslinks. However, when comparable toxicity levels are reached, the two compounds show the same mutagenic potentiality.

A comparison of synthetic oligodeoxynucleotides, DNA fragments and AAV-1 for targeted episomal and chromosomal gene repair

Directory of Open Access Journals (Sweden)

Leclerc Xavier

2009-04-01

Full Text Available Abstract Background Current strategies for gene therapy of inherited diseases consist in adding functional copies of the gene that is defective. An attractive alternative to these approaches would be to correct the endogenous mutated gene in the affected individual. This study presents a quantitative comparison of the repair efficiency using different forms of donor nucleic acids, including synthetic DNA oligonucleotides, double stranded DNA fragments with sizes ranging from 200 to 2200 bp and sequences carried by a recombinant adeno-associated virus (rAAV-1. Evaluation of each gene repair strategy was carried out using two different reporter systems, a mutated eGFP gene or a dual construct with a functional eGFP and an inactive luciferase gene, in several different cell systems. Gene targeting events were scored either following transient co-transfection of reporter plasmids and donor DNAs, or in a system where a reporter construct was stably integrated into the chromosome. Results In both episomal and chromosomal assays, DNA fragments were more efficient at gene repair than oligonucleotides or rAAV-1. Furthermore, the gene targeting frequency could be significantly increased by using DNA repair stimulating drugs such as doxorubicin and phleomycin. Conclusion Our results show that it is possible to obtain repair frequencies of 1% of the transfected cell population under optimized transfection protocols when cells were pretreated with phleomycin using rAAV-1 and dsDNA fragments.

Fragmentation of DNA affects the accuracy of the DNA quantitation by the commonly used methods

Directory of Open Access Journals (Sweden)

Sedlackova Tatiana

2013-02-01

Full Text Available Abstract Background Specific applications and modern technologies, like non-invasive prenatal testing, non-invasive cancer diagnostic and next generation sequencing, are currently in the focus of researchers worldwide. These have common characteristics in use of highly fragmented DNA molecules for analysis. Hence, for the performance of molecular methods, DNA concentration is a crucial parameter; we compared the influence of different levels of DNA fragmentation on the accuracy of DNA concentration measurements. Results In our comparison, the performance of the currently most commonly used methods for DNA concentration measurement (spectrophotometric, fluorometric and qPCR based were tested on artificially fragmented DNA samples. In our comparison, unfragmented and three specifically fragmented DNA samples were used. According to our results, the level of fragmentation did not influence the accuracy of spectrophotometric measurements of DNA concentration, while other methods, fluorometric as well as qPCR-based, were significantly influenced and a decrease in measured concentration was observed with more intensive DNA fragmentation. Conclusions Our study has confirmed that the level of fragmentation of DNA has significant impact on accuracy of DNA concentration measurement with two of three mostly used methods (PicoGreen and qPCR. Only spectrophotometric measurement was not influenced by the level of fragmentation, but sensitivity of this method was lowest among the three tested. Therefore if it is possible the DNA quantification should be performed with use of equally fragmented control DNA.

Cloning of Bacteroides fragilis plasmid genes affecting metronidazole resistance and ultraviolet survival in Escherichia coli

International Nuclear Information System (INIS)

Wehnert, G.U.; Abratt, V.R.; Goodman, H.J.; Woods, D.R.

1990-01-01

Since reduced metronidazole causes DNA damage, resistance to metronidazole was used as a selection method for the cloning of Bacteroides fragilis genes affecting DNA repair mechanisms in Escherichia coli. Genes from B. fragilis Bf-2 were cloned on a recombinant plasmid pMT100 which made E. coli AB1157 and uvrA, B, and C mutant strains more resistant to metronidazole, but more sensitive to far uv irradiation under aerobic conditions. The loci affecting metronidazole resistance and uv sensitivity were linked and located on a 5-kb DNA fragment which originated from the small 6-kb cryptic plasmid pBFC1 present in B. fragilis Bf-2 cells

Effect of Surfactants on Plasmid DNA Stability and Release from ...

African Journals Online (AJOL)

Purpose: To evaluate the effect of surfactants on plasmid DNA during preparation and release from polylactic glycolide (PLGA) microspheres. Methods: Various surfactants, both ionic and non-ionic (Span, Tween, Triton X100, cetyltrimethylammonium bromide and sodium dodecyl sulphate), were added during the ...

Putative DNA-dependent RNA polymerase in Mitochondrial Plasmid of Paramecium caudatum Stock GT704

Directory of Open Access Journals (Sweden)

Trina Ekawati Tallei

2015-10-01

Full Text Available Mitochondria of Paramecium caudatum stock GT704 has a set of four kinds of linear plasmids with sizes of 8.2, 4.1, 2.8 and 1.4 kb. The plasmids of 8.2 and 2.8 kb exist as dimers consisting of 4.1- and 1.4-kb monomers, respectively. The plasmid 2.8 kb, designated as pGT704-2.8, contains an open reading frame encodes for putative DNA-dependent RNA polymerase (RNAP. This study reveals that this RNAP belongs to superfamily of DNA/RNA polymerase and family of T7/T3 single chain RNA polymerase and those of mitochondrial plasmid of fungi belonging to Basidiomycota and Ascomycota. It is suggested that RNAP of pGT704-2.8 can perform transcription without transcription factor as promoter recognition. Given that only two motifs were found, it could not be ascertained whether this RNAP has a full function independently or integrated with mtDNA in carrying out its function.

[Effect of endonuclease G depletion on plasmid DNA uptake and levels of homologous recombination in hela cells].

Science.gov (United States)

Misic, V; El-Mogy, M; Geng, S; Haj-Ahmad, Y

2016-01-01

Endonuclease G (EndoG) is a mitochondrial apoptosis regulator that also has roles outside of programmed cell death. It has been implicated as a defence DNase involved in the degradation of exogenous DNA after transfection of mammalian cells and in homologous recombination of viral and endogenous DNA. In this study, we looked at the effect of EndoG depletion on plasmid DNA uptake and the levels of homologous recombination in HeLa cells. We show that the proposed defence role of EndoG against uptake of non-viral DNA vectors does not extend to the cervical carcinoma HeLa cells, as targeting of EndoG expression by RNA interference failed to increase intracellular plasmid DNA levels. However, reducing EndoG levels in HeLa cells resulted in a statistically significant reduction of homologous recombination between two plasmid DNA substrates. These findings suggest that non-viral DNA vectors are also substrates for EndoG in its role in homologous recombination.

Ca2+ promoted the low transformation efficiency of plasmid DNA exposed to PAH contaminants.

Directory of Open Access Journals (Sweden)

Fuxing Kang

Full Text Available The effects of interactions between genetic materials and polycyclic aromatic hydrocarbons (PAHs on gene expression in the extracellular environment remain to be elucidated and little information is currently available on the effect of ionic strength on the transformation of plasmid DNA exposed to PAHs. Phenanthrene and pyrene were used as representative PAHs to evaluate the transformation of plasmid DNA after PAH exposure and to determine the role of Ca(2+ during the transformation. Plasmid DNA exposed to the test PAHs demonstrated low transformation efficiency. In the absence of PAHs, the transformation efficiency was 4.7 log units; however, the efficiency decreased to 3.72-3.14 log units with phenanthrene/pyrene exposures of 50 µg · L(-1. The addition of Ca(2+ enhanced the low transformation efficiency of DNA exposed to PAHs. Based on the co-sorption of Ca(2+ and phenanthrene/pyrene by DNA, we employed Fourier-transform infrared spectroscopy (FTIR, X-ray photoelectron spectroscopy (XPS, and mass spectrometry (MS to determine the mechanisms involved in PAH-induced DNA transformation. The observed low transformation efficiency of DNA exposed to either phenanthrene or pyrene can be attributed to a broken hydrogen bond in the double helix caused by planar PAHs. Added Ca(2+ formed strong electrovalent bonds with "-POO(--" groups in the DNA, weakening the interaction between PAHs and DNA based on weak molecular forces. This decreased the damage of PAHs to hydrogen bonds in double-stranded DNA by isolating DNA molecules from PAHs and consequently enhanced the transformation efficiency of DNA exposed to PAH contaminants. The findings provide insight into the effects of anthropogenic trace PAHs on DNA transfer in natural environments.

Fluoride enhances transfection activity of carbonate apatite by increasing cytoplasmic stability of plasmid DNA

Energy Technology Data Exchange (ETDEWEB)

Chowdhury, E.H., E-mail: md.ezharul.hoque@med.monash.edu.my [Jeffrey Cheah School of Medicine and Health Sciences, Monash University Sunway Campus, Jalan Lagoon Selatan, Bandar Sunway, Selangor Darul Ehsan (Malaysia)

2011-06-17

Highlights: {yields} Cytoplasmic stability of plasmid DNA is enhanced by fluoride incorporation into carbonate apatite carrier. {yields} Fluoridated carbonate apatite promotes a robust increase in transgene expression. {yields} Controlled dissolution of fluoridated carbonate apatite in endosomal acidic environment might buffer the endosomes and prevent degradation of the released DNA. -- Abstract: Intracellular delivery of a functional gene or a nucleic acid sequence to specifically knockdown a harmful gene is a potential approach to precisely treat a critical human disease. The intensive efforts in the last few decades led to the development of a number of viral and non-viral synthetic vectors. However, an ideal delivery tool in terms of the safety and efficacy has yet to be established. Recently, we have developed pH-sensing inorganic nanocrystals of carbonate apatite for efficient and cell-targeted delivery of gene and gene-silencing RNA. Here we show that addition of very low level of fluoride to the particle-forming medium facilitates a robust increase in transgene expression following post-incubation of the particles with HeLa cells. Confocal microscopic observation and Southern blotting prove the cytoplasmic existence of plasmid DNA delivered by likely formed fluoridated carbonate apatite particles while degradation of plasmid DNA presumably by cytoplasmic nucleases was noticed following delivery with apatite particles alone. The beneficial role of fluoride in enhancing carbonate apatite-mediated gene expression might be due to the buffering potential of generated fluoridated apatite in endosomal acidic environment, thereby increasing the half-life of delivered plasmid DNA.

Fluoride enhances transfection activity of carbonate apatite by increasing cytoplasmic stability of plasmid DNA

International Nuclear Information System (INIS)

Chowdhury, E.H.

2011-01-01

Highlights: → Cytoplasmic stability of plasmid DNA is enhanced by fluoride incorporation into carbonate apatite carrier. → Fluoridated carbonate apatite promotes a robust increase in transgene expression. → Controlled dissolution of fluoridated carbonate apatite in endosomal acidic environment might buffer the endosomes and prevent degradation of the released DNA. -- Abstract: Intracellular delivery of a functional gene or a nucleic acid sequence to specifically knockdown a harmful gene is a potential approach to precisely treat a critical human disease. The intensive efforts in the last few decades led to the development of a number of viral and non-viral synthetic vectors. However, an ideal delivery tool in terms of the safety and efficacy has yet to be established. Recently, we have developed pH-sensing inorganic nanocrystals of carbonate apatite for efficient and cell-targeted delivery of gene and gene-silencing RNA. Here we show that addition of very low level of fluoride to the particle-forming medium facilitates a robust increase in transgene expression following post-incubation of the particles with HeLa cells. Confocal microscopic observation and Southern blotting prove the cytoplasmic existence of plasmid DNA delivered by likely formed fluoridated carbonate apatite particles while degradation of plasmid DNA presumably by cytoplasmic nucleases was noticed following delivery with apatite particles alone. The beneficial role of fluoride in enhancing carbonate apatite-mediated gene expression might be due to the buffering potential of generated fluoridated apatite in endosomal acidic environment, thereby increasing the half-life of delivered plasmid DNA.

Plasmid DNA loaded chitosan nanoparticles for nasal mucosal immunization against hepatitis B.

Science.gov (United States)

Khatri, Kapil; Goyal, Amit K; Gupta, Prem N; Mishra, Neeraj; Vyas, Suresh P

2008-04-16

This work investigates the preparation and in vivo efficacy of plasmid DNA loaded chitosan nanoparticles for nasal mucosal immunization against hepatitis B. Chitosan pDNA nanoparticles were prepared using a complex coacervation process. Prepared nanoparticles were characterized for size, shape, surface charge, plasmid loading and ability of nanoparticles to protect DNA against nuclease digestion and for their transfection efficacy. Nasal administration of nanoparticles resulted in serum anti-HBsAg titre that was less compared to that elicited by naked DNA and alum adsorbed HBsAg, but the mice were seroprotective within 2 weeks and the immunoglobulin level was above the clinically protective level. However, intramuscular administration of naked DNA and alum adsorbed HBsAg did not elicit sIgA titre in mucosal secretions that was induced by nasal immunization with chitosan nanoparticles. Similarly, cellular responses (cytokine levels) were poor in case of alum adsorbed HBsAg. Chitosan nanoparticles thus produced humoral (both systemic and mucosal) and cellular immune responses upon nasal administration. The study signifies the potential of chitosan nanoparticles as DNA vaccine carrier and adjuvant for effective immunization through non-invasive nasal route.

Plasmid DNA initiates replication of yellow fever vaccine in vitro and elicits virus-specific immune response in mice

International Nuclear Information System (INIS)

Tretyakova, Irina; Nickols, Brian; Hidajat, Rachmat; Jokinen, Jenny; Lukashevich, Igor S.; Pushko, Peter

2014-01-01

Yellow fever (YF) causes an acute hemorrhagic fever disease in tropical Africa and Latin America. To develop a novel experimental YF vaccine, we applied iDNA infectious clone technology. The iDNA represents plasmid that encodes the full-length RNA genome of 17D vaccine downstream from a cytomegalovirus (CMV) promoter. The vaccine was designed to transcribe the full-length viral RNA and to launch 17D vaccine virus in vitro and in vivo. Transfection with 10 ng of iDNA plasmid was sufficient to start replication of vaccine virus in vitro. Safety of the parental 17D and iDNA-derived 17D viruses was confirmed in AG129 mice deficient in receptors for IFN-α/β/γ. Finally, direct vaccination of BALB/c mice with a single 20 μg dose of iDNA plasmid resulted in seroconversion and elicitation of virus-specific neutralizing antibodies in animals. We conclude that iDNA immunization approach combines characteristics of DNA and attenuated vaccines and represents a promising vaccination strategy for YF. - Highlights: • The iDNA ® platform combines advantages of DNA and live attenuated vaccines. • Yellow fever (YF) 17D vaccine was launched from iDNA plasmid in vitro and in vivo. • Safety of iDNA-generated 17D virus was confirmed in AG129 mice. • BALB/c mice seroconverted after a single-dose vaccination with iDNA. • YF virus-neutralizing response was elicited in iDNA-vaccinated mice

Plasmid DNA initiates replication of yellow fever vaccine in vitro and elicits virus-specific immune response in mice

Energy Technology Data Exchange (ETDEWEB)

Tretyakova, Irina; Nickols, Brian; Hidajat, Rachmat [Medigen, Inc., 8420 Gas House Pike, Suite S, Frederick, MD 21701 (United States); Jokinen, Jenny; Lukashevich, Igor S. [Department of Pharmacology and Toxicology, School of Medicine, Center for Predictive Medicine and Emerging Infectious Diseases, University of Louisville, Louisville, KY (United States); Pushko, Peter, E-mail: ppushko@medigen-usa.com [Medigen, Inc., 8420 Gas House Pike, Suite S, Frederick, MD 21701 (United States)

2014-11-15

Yellow fever (YF) causes an acute hemorrhagic fever disease in tropical Africa and Latin America. To develop a novel experimental YF vaccine, we applied iDNA infectious clone technology. The iDNA represents plasmid that encodes the full-length RNA genome of 17D vaccine downstream from a cytomegalovirus (CMV) promoter. The vaccine was designed to transcribe the full-length viral RNA and to launch 17D vaccine virus in vitro and in vivo. Transfection with 10 ng of iDNA plasmid was sufficient to start replication of vaccine virus in vitro. Safety of the parental 17D and iDNA-derived 17D viruses was confirmed in AG129 mice deficient in receptors for IFN-α/β/γ. Finally, direct vaccination of BALB/c mice with a single 20 μg dose of iDNA plasmid resulted in seroconversion and elicitation of virus-specific neutralizing antibodies in animals. We conclude that iDNA immunization approach combines characteristics of DNA and attenuated vaccines and represents a promising vaccination strategy for YF. - Highlights: • The iDNA{sup ®} platform combines advantages of DNA and live attenuated vaccines. • Yellow fever (YF) 17D vaccine was launched from iDNA plasmid in vitro and in vivo. • Safety of iDNA-generated 17D virus was confirmed in AG129 mice. • BALB/c mice seroconverted after a single-dose vaccination with iDNA. • YF virus-neutralizing response was elicited in iDNA-vaccinated mice.

DNA fragments assembly based on nicking enzyme system.

Directory of Open Access Journals (Sweden)

Rui-Yan Wang

Full Text Available A couple of DNA ligation-independent cloning (LIC methods have been reported to meet various requirements in metabolic engineering and synthetic biology. The principle of LIC is the assembly of multiple overlapping DNA fragments by single-stranded (ss DNA overlaps annealing. Here we present a method to generate single-stranded DNA overlaps based on Nicking Endonucleases (NEases for LIC, the method was termed NE-LIC. Factors related to cloning efficiency were optimized in this study. This NE-LIC allows generating 3'-end or 5'-end ss DNA overlaps of various lengths for fragments assembly. We demonstrated that the 10 bp/15 bp overlaps had the highest DNA fragments assembling efficiency, while 5 bp/10 bp overlaps showed the highest efficiency when T4 DNA ligase was added. Its advantage over Sequence and Ligation Independent Cloning (SLIC and Uracil-Specific Excision Reagent (USER was obvious. The mechanism can be applied to many other LIC strategies. Finally, the NEases based LIC (NE-LIC was successfully applied to assemble a pathway of six gene fragments responsible for synthesizing microbial poly-3-hydroxybutyrate (PHB.

Mutant DNA quantification by digital PCR can be confounded by heating during DNA fragmentation.

Science.gov (United States)

Kang, Qing; Parkin, Brian; Giraldez, Maria D; Tewari, Muneesh

2016-04-01

Digital PCR (dPCR) is gaining popularity as a DNA mutation quantification method for clinical specimens. Fragmentation prior to dPCR is required for non-fragmented genomic DNA samples; however, the effect of fragmentation on DNA analysis has not been well-studied. Here we evaluated three fragmentation methods for their effects on dPCR point mutation assay performance. Wild-type (WT) human genomic DNA was fragmented by heating, restriction digestion, or acoustic shearing using a Covaris focused-ultrasonicator. dPCR was then used to determine the limit of blank (LoB) by quantifying observed WT and mutant allele counts of the proto-oncogenes KRAS and BRAF in the WT DNA sample. DNA fragmentation by heating to 95°C, while the simplest and least expensive method, produced a high background mutation frequency for certain KRAS mutations relative to the other methods. This was due to heat-induced mutations, specifically affecting dPCR assays designed to interrogate guanine to adenine (G>A) mutations. Moreover, heat-induced fragmentation overestimated gene copy number, potentially due to denaturation and partition of single-stranded DNA into different droplets. Covaris acoustic shearing and restriction enzyme digestion showed similar LoBs and gene copy number estimates to one another. It should be noted that moderate heating, commonly used in genomic DNA extraction protocols, did not significantly increase observed KRAS mutation counts.

Linkage map of the fragments of herpesvirus papio DNA.

Science.gov (United States)

Lee, Y S; Tanaka, A; Lau, R Y; Nonoyama, M; Rabin, H

1981-01-01

Herpesvirus papio (HVP), an Epstein-Barr-like virus, causes lymphoblastoid disease in baboons. The physical map of HVP DNA was constructed for the fragments produced by cleavage of HVP DNA with restriction endonucleases EcoRI, HindIII, SalI, and PvuI, which produced 12, 12, 10, and 4 fragments, respectively. The total molecular size of HVP DNA was calculated as close to 110 megadaltons. The following methods were used for construction of the map; (i) fragments near the ends of HVP DNA were identified by treating viral DNA with lambda exonuclease before restriction enzyme digestion; (ii) fragments containing nucleotide sequences in common with fragments from the second enzyme digest of HVP DNA were examined by Southern blot hybridization; and (iii) the location of some fragments was determined by isolating individual fragments from agarose gels and redigesting the isolated fragments with a second restriction enzyme. Terminal heterogeneity and internal repeats were found to be unique features of HVP DNA molecule. One to five repeats of 0.8 megadaltons were found at both terminal ends. Although the repeats of both ends shared a certain degree of homology, it was not determined whether they were identical repeats. The internal repeat sequence of HVP DNA was found in the EcoRI-C region, which extended from 8.4 to 23 megadaltons from the left end of the molecule. The average number of the repeats was calculated to be seven, and the molecular size was determined to be 1.8 megadaltons. Similar unique features have been reported in EBV DNA (D. Given and E. Kieff, J. Virol. 28:524-542, 1978). Images PMID:6261015

Hydrophobic and electrostatic interactions between cell penetrating peptides and plasmid DNA are important for stable non-covalent complexation and intracellular delivery.

Science.gov (United States)

Upadhya, Archana; Sangave, Preeti C

2016-10-01

Cell penetrating peptides are useful tools for intracellular delivery of nucleic acids. Delivery of plasmid DNA, a large nucleic acid, poses a challenge for peptide mediated transport. The paper investigates and compares efficacy of five novel peptide designs for complexation of plasmid DNA and subsequent delivery into cells. The peptides were designed to contain reported DNA condensing agents and basic cell penetrating sequences, octa-arginine (R 8 ) and CHK 6 HC coupled to cell penetration accelerating peptides such as Bax inhibitory mutant peptide (KLPVM) and a peptide derived from the Kaposi fibroblast growth factor (kFGF) membrane translocating sequence. A tryptophan rich peptide, an analogue of Pep-3, flanked with CH 3 on either ends was also a part of the study. The peptides were analysed for plasmid DNA complexation, protection of peptide-plasmid DNA complexes against DNase I, serum components and competitive ligands by simple agarose gel electrophoresis techniques. Hemolysis of rat red blood corpuscles (RBCs) in the presence of the peptides was used as a measure of peptide cytotoxicity. Plasmid DNA delivery through the designed peptides was evaluated in two cell lines, human cervical cancer cell line (HeLa) and (NIH/3 T3) mouse embryonic fibroblasts via expression of the secreted alkaline phosphatase (SEAP) reporter gene. The importance of hydrophobic sequences in addition to cationic sequences in peptides for non-covalent plasmid DNA complexation and delivery has been illustrated. An alternative to the employment of fatty acid moieties for enhanced gene transfer has been proposed. Comparison of peptides for plasmid DNA complexation and delivery of peptide-plasmid DNA complexes to cells estimated by expression of a reporter gene, SEAP. Copyright © 2016 European Peptide Society and John Wiley & Sons, Ltd. Copyright © 2016 European Peptide Society and John Wiley & Sons, Ltd.

Intrathecal injection of naked plasmid DNA provides long-term expression of secreted proteins.

Science.gov (United States)

Hughes, Travis S; Langer, Stephen J; Johnson, Kirk W; Chavez, Raymond A; Watkins, Linda R; Milligan, Erin D; Leinwand, Leslie A

2009-01-01

Therapeutic benefit has been reported to result from intrathecal (i.t.) injection of transgene vectors, including naked DNA. However, most studies using naked DNA have measured only the transgene expression of intracellular proteins. Here we demonstrate that i.t. injection of naked DNA can result in long-term expression of secreted proteins. Plasmids expressing either secreted alkaline phosphatase (SEAP) or human interleukin-10 (hIL-10) were injected into the i.t. space in rats, and transgene products were repeatedly measured in the cerebrospinal fluid (CSF). Both SEAP and hIL-10 were maximal at 1 and 2 days after the injection and still detectable at 4 months. The utilization of a plasmid having two features that are hypothesized to increase gene expression (matrix attachment regions (MARs) and lack of CpG dinucleotides) resulted in a significant increase in gene expression. Reinjection of SEAP or hIL-10 plasmids after 4 months significantly increased protein levels at 1 and 14 days after the reinjection. SEAP was uniformly distributed between the DNA delivery site (approximately vertebral level T13) and the lumbar puncture site (L5/L6 inter-vertebral space), was reduced at the cisterna magna, and was detectable, though at much lower levels, in serum. These data suggest that naked DNA has the potential to be used as a therapeutic tool for applications that require long-term release of transgenes into the CSF.

Complementary DNA-amplified fragment length polymorphism ...

African Journals Online (AJOL)

Complementary DNA-amplified fragment length polymorphism (AFLP-cDNA) analysis of differential gene expression from the xerophyte Ammopiptanthus mongolicus in response to cold, drought and cold together with drought.

Proton-induced direct and indirect damage of plasmid DNA

Czech Academy of Sciences Publication Activity Database

Vyšín, Luděk; Pachnerová Brabcová, Kateřina; Štěpán, V.; Moretto-Capelle, P.; Bugler, B.; Legube, G.; Cafarelli, P.; Casta, R.; Champeaux, J. P.; Sence, M.; Vlk, M.; Wagner, Richard; Štursa, Jan; Zach, Václav; Incerti, S.; Juha, Libor; Davídková, Marie

2015-01-01

Roč. 54, č. 3 (2015), s. 343-352 ISSN 0301-634X R&D Projects: GA ČR GA13-28721S; GA MŠk LD12008; GA MŠk LM2011019 Institutional support: RVO:68378271 ; RVO:61389005 Keywords : proton radiation * DNA plasmid * direct and indirect effects * clustered damage * repair enzymes Subject RIV: BO - Biophysics Impact factor: 1.923, year: 2015

Effect of the caffeine on treated and non-treated plasmid DNA with stannic chloride

International Nuclear Information System (INIS)

Moreno, Silvana Ramos F.; Universidade Federal Fluminense, Niteroi, RJ; Mattos, Jose C.P. de; Dantas, Flavio; Araujo, Adriano Caldeira de; Bernardo-Filho, Mario

2000-01-01

Caffeine, a methilxantine drug is a component of coffee, tea, stimulants and other drinks. Caffeine inhibits phosphodiesterase leading to intracellular accumulation of cyclic AMP, blocks adenosine receptors, and increases the release of Ca 2+ . We have studied the possible effect of caffeine in DNA plasmid treated or not with stannous chloride (SnCl 2 ). Previous evaluations of the effect of caffeine on the labeling of red blood cells and plasma proteins with technetium-99m have showed a decrease of % ATI in the insoluble fraction of plasma proteins. Samples of DNA were treated with SnCl 2 (0 and 200μg/ml) in 0.8% agarose. SnCl 2 has induced break on DNA and caffeine has not showed effect on the DNA. This indicates that caffeine does not eliminate the oxidant action of SnCl 2 and does not promote break in isolated DNA plasmid. (author)

Sperm DNA fragmentation affects epigenetic feature in human male pronucleus.

Science.gov (United States)

Rajabi, H; Mohseni-Kouchesfehani, H; Eslami-Arshaghi, T; Salehi, M

2018-02-01

To evaluate whether the sperm DNA fragmentation affects male pronucleus epigenetic factors, semen analysis was performed and DNA fragmentation was assessed by the method of sperm chromatin structure assay (SCSA). Human-mouse interspecies fertilisation was used to create human male pronucleus. Male pronucleus DNA methylation and H4K12 acetylation were evaluated by immunostaining. Results showed a significant positive correlation between the level of sperm DNA fragmentation and DNA methylation in male pronuclei. In other words, an increase in DNA damage caused an upsurge in DNA methylation. In the case of H4K12 acetylation, no correlation was detected between DNA damage and the level of histone acetylation in the normal group, but results for the group in which male pronuclei were derived from sperm cells with DNA fragmentation, increased DNA damage led to a decreased acetylation level. Sperm DNA fragmentation interferes with the active demethylation process and disrupts the insertion of histones into the male chromatin in the male pronucleus, following fertilisation. © 2017 Blackwell Verlag GmbH.

Detailed adsorption mechanism of plasmid DNA by newly isolated cellulose from waste flower spikes of Thypa latifolia using quantum chemical calculations.

Science.gov (United States)

Mujtaba, Muhammad; Kaya, Murat; Akyuz, Lalehan; Erdonmez, Demet; Akyuz, Bahar; Sargin, Idris

2017-09-01

Current study was designed to use the newly obtained cellulose from waste flower spikes of Thypa latifolia plant for plasmid DNA adsorption. Cellulose was isolated according to a previously described method including acid and base treatment, and cellulose content was recorded as 17%. T. latifolia cellulose was physicochemically characterized via FT-IR, TGA and SEM techniques. Detailed mechanism of plasmid DNA adsorption by newly isolated cellulose was described using chemical quantum calculations. To check the effect of Cu ++ immobilization on the affinity of cellulose for plasmid DNA, copper ions were immobilized onto T. latifolia cellulose. pUC18 plasmid DNA was used for adsorption studies. Membranes prepared with only T. latifolia cellulose and Cu ++ immobilized T. latifolia cellulose revealed different adsorption ratios as 43.9 and 86.9% respectively. This newly isolated cellulose from waste flower spikes of T. latifolia can be utilized as a suitable carrier for plasmid DNA. Copyright © 2017 Elsevier B.V. All rights reserved.

Isolation/separation of plasmid DNA using hemoglobin modified magnetic nanocomposites as solid-phase adsorbent.

Science.gov (United States)

Chen, Xu-Wei; Mao, Quan-Xing; Liu, Jia-Wei; Wang, Jian-Hua

2012-10-15

Hemoglobin (Hb) modified magnetic nanocomposites are prepared by immobilization of Hb onto the surface of amino-functionalized Fe(3)O(4)@SiO(2) magnetic nanoparticles via covalent bonding with glutaraldehyde as cross-linker. The obtained nanocomposites are characterized with FT-IR, SEM, XRD and surface charge analysis. A direct solid-phase extraction procedure for the isolation/separation of plasmid DNA using this nanocomposite as a novel adsorbent is thus developed. Some important experimental parameters governing the sorption efficiency, i.e., the pH of sample solution and the ionic strength, are investigated. The Hb modified magnetic nanocomposites provide a sorption capacity of 27.86 mg g(-1) for DNA. By using 2.0mg of the nanocomposites as sorption medium and a suitable acidity of pH 6.1, a sorption efficiency of 93% is achieved for 25 μg mL(-1) of DNA in 1.0 mL of sample solution. Afterwards, the absorbed DNA could be readily recovered by using 1.0 mL of Tris-HCl buffer (pH 8.9, 0.01 mol L(-1)), giving rise to a recovery of ca. 68.3%. The present solid-phased extraction protocol is applied for the isolation of plasmid DNA from Escherichia coli culture, resulting in comparable yield and purity of plasmid DNA with respect to those obtained by using commercial kits. Copyright © 2012 Elsevier B.V. All rights reserved.

High efficiency hydrodynamic DNA fragmentation in a bubbling system

NARCIS (Netherlands)

Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; Van Den Berg, Albert; Eijkel, Jan C.T.; Shui, Lingling

2017-01-01

DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling

High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System.

Science.gov (United States)

Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C T; Shui, Lingling

2017-01-18

DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1-10 Kbp fragment lengths with a yield of 75.30-91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future.

Process optimisation for anion exchange monolithic chromatography of 4.2kbp plasmid vaccine (pcDNA3F).

Science.gov (United States)

Ongkudon, Clarence M; Danquah, Michael K

2010-10-15

Anion exchange monolithic chromatography is increasingly becoming a prominent tool for plasmid DNA purification but no generic protocol is available to purify all types of plasmid DNA. In this work, we established a simple framework and used it to specifically purify a plasmid DNA model from a clarified alkaline-lysed plasmid-containing cell lysate. The framework involved optimising ligand functionalisation temperature (30-80°C), mobile phase flow rate (0.1-1.8mL/min), monolith pore size (done by changing the porogen content in the polymerisation reaction by 50-80%), buffer pH (6-10), ionic strength of binding buffer (0.3-0.7M) and buffer gradient elution slope (1-10% buffer B/min). We concluded that preferential pcDNA3F adsorption and optimum resolution could be achieved within the tested conditions by loading the clarified cell lysate into 400nm pore size of monolith in 0.7M NaCl (pH 6) of binding buffer followed by increasing the NaCl concentration to 1.0M at 3%B/min. Copyright © 2010 Elsevier B.V. All rights reserved.

Correction of the lack of commutability between plasmid DNA and genomic DNA for quantification of genetically modified organisms using pBSTopas as a model.

Science.gov (United States)

Zhang, Li; Wu, Yuhua; Wu, Gang; Cao, Yinglong; Lu, Changming

2014-10-01

Plasmid calibrators are increasingly applied for polymerase chain reaction (PCR) analysis of genetically modified organisms (GMOs). To evaluate the commutability between plasmid DNA (pDNA) and genomic DNA (gDNA) as calibrators, a plasmid molecule, pBSTopas, was constructed, harboring a Topas 19/2 event-specific sequence and a partial sequence of the rapeseed reference gene CruA. Assays of the pDNA showed similar limits of detection (five copies for Topas 19/2 and CruA) and quantification (40 copies for Topas 19/2 and 20 for CruA) as those for the gDNA. Comparisons of plasmid and genomic standard curves indicated that the slopes, intercepts, and PCR efficiency for pBSTopas were significantly different from CRM Topas 19/2 gDNA for quantitative analysis of GMOs. Three correction methods were used to calibrate the quantitative analysis of control samples using pDNA as calibrators: model a, or coefficient value a (Cva); model b, or coefficient value b (Cvb); and the novel model c or coefficient formula (Cf). Cva and Cvb gave similar estimated values for the control samples, and the quantitative bias of the low concentration sample exceeded the acceptable range within ±25% in two of the four repeats. Using Cfs to normalize the Ct values of test samples, the estimated values were very close to the reference values (bias -13.27 to 13.05%). In the validation of control samples, model c was more appropriate than Cva or Cvb. The application of Cf allowed pBSTopas to substitute for Topas 19/2 gDNA as a calibrator to accurately quantify the GMO.

Plasmid DNA initiates replication of yellow fever vaccine in vitro and elicits virus-specific immune response in mice.

Science.gov (United States)

Tretyakova, Irina; Nickols, Brian; Hidajat, Rachmat; Jokinen, Jenny; Lukashevich, Igor S; Pushko, Peter

2014-11-01

Yellow fever (YF) causes an acute hemorrhagic fever disease in tropical Africa and Latin America. To develop a novel experimental YF vaccine, we applied iDNA infectious clone technology. The iDNA represents plasmid that encodes the full-length RNA genome of 17D vaccine downstream from a cytomegalovirus (CMV) promoter. The vaccine was designed to transcribe the full-length viral RNA and to launch 17D vaccine virus in vitro and in vivo. Transfection with 10 ng of iDNA plasmid was sufficient to start replication of vaccine virus in vitro. Safety of the parental 17D and iDNA-derived 17D viruses was confirmed in AG129 mice deficient in receptors for IFN-α/β/γ. Finally, direct vaccination of BALB/c mice with a single 20 μg dose of iDNA plasmid resulted in seroconversion and elicitation of virus-specific neutralizing antibodies in animals. We conclude that iDNA immunization approach combines characteristics of DNA and attenuated vaccines and represents a promising vaccination strategy for YF. Copyright © 2014 Elsevier Inc. All rights reserved.

Sperm DNA fragmentation, recurrent implantation failure and recurrent miscarriage

Directory of Open Access Journals (Sweden)

Carol Coughlan

2015-01-01

Full Text Available Evidence is increasing that the integrity of sperm DNA may also be related to implantation failure and recurrent miscarriage (RM. To investigate this, the sperm DNA fragmentation in partners of 35 women with recurrent implantation failure (RIF following in vitro fertilization, 16 women diagnosed with RM and seven recent fathers (control were examined. Sperm were examined pre- and post-density centrifugation by the sperm chromatin dispersion (SCD test and the terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL assay. There were no significant differences in the age of either partner or sperm concentration, motility or morphology between three groups. Moreover, there were no obvious differences in sperm DNA fragmentation measured by either test. However, whilst on average sperm DNA fragmentation in all groups was statistically lower in prepared sperm when measured by the SCD test, this was not seen with the results from the TUNEL assay. These results do not support the hypothesis that sperm DNA fragmentation is an important cause of RIF or RM, or that sperm DNA integrity testing has value in such patients. It also highlights significant differences between test methodologies and sperm preparation methods in interpreting the data from sperm DNA fragmentation tests.

Purification of supercoiled DNA of plasmid Col E1 by RPC-5 chromatography

Energy Technology Data Exchange (ETDEWEB)

Best, A.N.; Allison, D.P.; Novelli, G.D.

1981-07-01

Col E1 DNA can be purified to a high degree by RPC-5 chromatography of a partially purified cell lysate with a very shallow linear NaC1 gradient at pH 7.8. Electron micrographs demonstrated that the purest fractions were composed of 93% supercoiled (form I) DNA and 7% open circular (form II) DNA. The actual chromatography can be accomplished in 13 to 14 h and is designed for the production of several milligrams of plasmid DNA.

Explanatory chapter: how plasmid preparation kits work.

Science.gov (United States)

Koontz, Laura

2013-01-01

To isolate plasmid DNA from bacteria using a commercial plasmid miniprep kit (if interested, compare this protocol with Isolation of plasmid DNA from bacteria). Copyright © 2013 Elsevier Inc. All rights reserved.

High-frequency transformation of a methylotrophic yeast, Candida boidinii, with autonomously replicating plasmids which are also functional in Saccharomyces cerevisiae.

OpenAIRE

Sakai, Y; Goh, T K; Tani, Y

1993-01-01

We have developed a transformation system which uses autonomous replicating plasmids for a methylotrophic yeast, Candida boidinii. Two autonomous replication sequences, CARS1 and CARS2, were newly cloned from the genome of C. boidinii. Plasmids having both a CARS fragment and the C. boidinii URA3 gene transformed C. boidinii ura3 cells to Ura+ phenotype at frequencies of up to 10(4) CFU/micrograms of DNA. From Southern blot analysis, CARS plasmids seemed to exist in polymeric forms as well as...

Protection of vanillin derivative VND3207 on plasmid DNA damage induced by different LET ionizing radiation

International Nuclear Information System (INIS)

Xu Huihui; Wang Li; Sui Li; Guan Hua; Wang Yu; Liu Xiaodan; Zhang Shimeng; Xu Qinzhi; Wang Xiao; Zhou Pingkun

2011-01-01

Objective: To evaluate the radioprotective effect of vanillin derivative VND3207 on DNA damage induced by different LET ionizing radiation. Methods: The plasmid DNA in liquid was irradiated by 60 Co γ-rays, proton or 7 Li heavy ion with or without VND3207. The conformation changes of plasmid DNA were assessed by agarose gel electrophoresis and the quantification was done using gel imaging system. Results: The DNA damage induced by proton and 7 Li heavy ion was much more serious as compared with that by 60 Co γ-rays, and the vanillin derivative VND3207 could efficiently decrease the DNA damage induced by all three types of irradiation sources, which was expressed as a significantly reduced ratio of open circular form (OC) of plasmid DNA. The radioprotective effect of VND3207 increased with the increasing of drug concentration. The protective efficiencies of 200 μmol/L VND3207 were 85.3% (t =3.70, P=0.033), 73.3% (t=10.58, P=0.017) and 80.4% (t=8.57, P=0.008) on DNA damage induction by 50 Gy of γ-rays, proton and 7 Li heavy ion, respectively. It seemed that the radioprotection of VND3207 was more effective on DNA damage induced by high LET heavy ion than that by proton. Conclusions: VND3207 has a protective effect against the genotoxicity of different LET ionizing radiation, especially for γ-rays and 7 Li heavy ion. (authors)

Construction of a recombinant eukaryotic human ZHX1 gene expression plasmid and the role of ZHX1 in hepatocellular carcinoma.

Science.gov (United States)

Wang, Jianping; Liu, Dejie; Liang, Xiaohong; Gao, Lifen; Yue, Xuetian; Yang, Yang; Ma, Chunhong; Liu, Jun

2013-11-01

The zinc-fingers and homeoboxes protein 1 (ZHX1) consists of 873 amino acid residues, is localized in the cell nucleus and appears to act as a transcriptional repressor. Previous studies have shown that ZHX1 interacts with nuclear factor Y subunit α (NF-YA), DNA methyltransferases (DNMT) 3B and ZHX2, all of which are involved in tumorigenesis. However, the exact role of ZHX1 in tumorigenesis remains unknown. The aim of the current study was to construct a recombinant eukaryotic expression plasmid containing the human ZHX1 (hZHX1) gene and to investigate the biological activities of ZHX1 in hepatocellular carcinoma (HCC). Reverse transcription-polymerase chain reaction (RT‑PCR) was used to amplify the N- and C-terminal fragments (ZHX1‑N and ZHX1‑C, respectively) of the hZHX1 gene. The two PCR fragments were cloned into the pEASY-T1 vector and subcloned into the pcDNA3 plasmid to generate a recombinant pcDNA3‑ZHX1 plasmid. Following identification by enzyme digestion and DNA sequencing, the recombinant pcDNA3‑ZHX1 plasmid was transfected into SMMC-7721 cells. The level of ZHX1 expression was detected by RT-PCR and western blot analysis. Cell growth curve assays were used to evaluate the effect of ZHX1 on cell proliferation. Moreover, the differential expression of ZHX1 between cancer and adjacent cirrhotic liver tissue was investigated by quantitative PCR (qPCR). Enzyme digestion and DNA sequencing confirmed the successful construction of the recombinant plasmid, pcDNA3‑ZHX1. qPCR and western blot analysis demonstrated that ZHX1 was efficiently expressed in SMMC-7721 cells and overexpression of ZHX1 may inhibit the proliferation of SMMC-7721 cells. In addition, reduced ZHX1 expression is widespread among cancer tissues from HCC patients. In conclusion, a recombinant eukaryotic expression plasmid, pcDNA3‑ZHX1, was successfully constructed. In addition, the current results indicate that a low expression of ZHX1 may be responsible for hepatocarcinogenesis.

Construction and identification of eukaryotic expression vector of pcDNA3-UHRF1

International Nuclear Information System (INIS)

Li Xinli; Zhu Ran; Zhu Wei; Fan Saijun; Meng Qinghui

2011-01-01

Objective: To generate eukaryotic expression vector of pcDNA3-UHRF1(ubiquitin-like, containing PHD and RING finger domains 1, UHRF1) and testify its expression in breast cancer cells MDA-MB-231. Methods: A 2.3 kb cDNA fragment was amplified from the total RNA of the human breast cancer cells MCF-7 by the RT-PCR method and was cloned into the plasmid pcDNA3. The vector was identified by the double digestion with restriction enzymes Kpn I and Xho I and was sequenced. The cDNA of UHRF1 was transfected into human breast cancer cells MDA-MB-231 by Lipofactamin2000. The positive clones were selected by G418. The expression of the UHRF1 was detected by RT-PCR and Western blot analysis. Results: The recombinant eukaryotic expression vector pcDNA3-UHRF1 was digested with Kpn I and BamH I, and the electrophoresis of the digested products showed two fragments; 2.3kb fragment of UHRF1 and 5.4 kb fragment of pcDNA3, and the sequence inserted was identical to the published sequence. The MDA-MB-231 cells transfected with the pcDNA3-UHRF1 plasmid expressed a high level of the UHRF1 mRNA and protein. Conclusion: The recombinant eukaryotic cell expression vector of pcDNA3-UHRF1 is constructed successfully. The recombinant plasmid pcDNA3-UHRF1 can provide a very useful tool and lay an important foundation for the research on the function of UHRF1. (authors)

Tranformasi Fragmen Dna Kromosom Xanthomonas Campestris ke dalam Escherichia Coli

Directory of Open Access Journals (Sweden)

Wibowo Mangunwardoyo

2002-04-01

Full Text Available Research on DNA transformation of Xanthomonas campestris into Escherichia coli DH5αα using plasmid vector Escherichia coli (pUC19. was carried out. DNA chromosome was isolated using CTAB method, alkali lysis method was used to isolate DNA plasmid. Both of DNA plasmid and chromosome were digested using restriction enzyme EcoRI. Competent cell was prepared with CaCl2 and heat shock method for transformation procedure. The result revealed transformation obtain 5 white colonies, with transformation frequency was 1,22 x 10-8 colony/competent cell. Electrophoresis analysis showed the DNA fragment (insert in range 0.5 – 7,5 kb. Further research should be carried out to prepare the genomic library to obtain better result of transformant.

Agarose gel electrophoresis for the separation of DNA fragments.

Science.gov (United States)

Lee, Pei Yun; Costumbrado, John; Hsu, Chih-Yuan; Kim, Yong Hoon

2012-04-20

Agarose gel electrophoresis is the most effective way of separating DNA fragments of varying sizes ranging from 100 bp to 25 kb(1). Agarose is isolated from the seaweed genera Gelidium and Gracilaria, and consists of repeated agarobiose (L- and D-galactose) subunits(2). During gelation, agarose polymers associate non-covalently and form a network of bundles whose pore sizes determine a gel's molecular sieving properties. The use of agarose gel electrophoresis revolutionized the separation of DNA. Prior to the adoption of agarose gels, DNA was primarily separated using sucrose density gradient centrifugation, which only provided an approximation of size. To separate DNA using agarose gel electrophoresis, the DNA is loaded into pre-cast wells in the gel and a current applied. The phosphate backbone of the DNA (and RNA) molecule is negatively charged, therefore when placed in an electric field, DNA fragments will migrate to the positively charged anode. Because DNA has a uniform mass/charge ratio, DNA molecules are separated by size within an agarose gel in a pattern such that the distance traveled is inversely proportional to the log of its molecular weight(3). The leading model for DNA movement through an agarose gel is "biased reptation", whereby the leading edge moves forward and pulls the rest of the molecule along(4). The rate of migration of a DNA molecule through a gel is determined by the following: 1) size of DNA molecule; 2) agarose concentration; 3) DNA conformation(5); 4) voltage applied, 5) presence of ethidium bromide, 6) type of agarose and 7) electrophoresis buffer. After separation, the DNA molecules can be visualized under uv light after staining with an appropriate dye. By following this protocol, students should be able to: Understand the mechanism by which DNA fragments are separated within a gel matrix Understand how conformation of the DNA molecule will determine its mobility through a gel matrix Identify an agarose solution of appropriate

Heavy ion induced damage to plasmid DNA : plateau region vs. spread out Bragg-peak

NARCIS (Netherlands)

Dang, H.M.; van Goethem, M.J.; van der Graaf, E.R.; Brandenburg, S.; Hoekstra, R.A.; Schlathölter, T.A.

We have investigated the damage of synthetic plasmid pBR322 DNA in dilute aqueous solutions induced by fast carbon ions. The relative contribution of indirect damage and direct damage to the DNA itself is expected to vary with linear energy transfer along the ion track, with the direct damage

Role for a region of helically unstable DNA within the Epstein-Barr virus latent cycle origin of DNA replication oriP in origin function

International Nuclear Information System (INIS)

Polonskaya, Zhanna; Benham, Craig J.; Hearing, Janet

2004-01-01

The minimal replicator of the Epstein-Barr virus (EBV) latent cycle origin of DNA replication oriP is composed of two binding sites for the Epstein-Barr virus nuclear antigen-1 (EBNA-1) and flanking inverted repeats that bind the telomere repeat binding factor TRF2. Although not required for minimal replicator activity, additional binding sites for EBNA-1 and TRF2 and one or more auxiliary elements located to the right of the EBNA-1/TRF2 sites are required for the efficient replication of oriP plasmids. Another region of oriP that is predicted to be destabilized by DNA supercoiling is shown here to be an important functional component of oriP. The ability of DNA fragments of unrelated sequence and possessing supercoiled-induced DNA duplex destabilized (SIDD) structures, but not fragments characterized by helically stable DNA, to substitute for this component of oriP demonstrates a role for the SIDD region in the initiation of oriP-plasmid DNA replication

A mechanism of gene amplification driven by small DNA fragments.

Directory of Open Access Journals (Sweden)

Kuntal Mukherjee

Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation

Hair Dye–DNA Interaction: Plausible Cause of Mutation

Directory of Open Access Journals (Sweden)

Swati Maiti

2015-09-01

Full Text Available Hair dye is one of the most popular cosmetic products which are used more widely and frequently to improve an individual’s appearance. Although the genotoxic effects of dye ingredients are widely reported, hair dye in its usable form is not reported extensively. In this contribution, we report the possible mode of interaction of hair dye with DNA which leads to genotoxicity. The effect of dye DNA interaction was studied on the most popular and globally used hair dye with Calf Thymus DNA and plasmid DNA. This interaction of dye DNA was studied by spectroscopic analyses and gel electrophoresis. The result had shown positive interaction of dye with DNA. Gel electrophoresis study confirms the binding of dye with DNA which results in linearization and fragmentation of the plasmid DNA. Dye–DNA interaction causes fragmentation and oxidation of DNA in absence of any catalyst, implies high toxicity of commercial hair dyes. Thus, it can be deduced from the present studies that hair dye in its usable form may lead to its penetration through skin affecting genomic DNA possesses genotoxic property and can be treated as one of the most common mutagen.

Cholesterol-conjugated supramolecular assemblies of low generations polyamidoamine dendrimers for enhanced EGFP plasmid DNA transfection

Energy Technology Data Exchange (ETDEWEB)

Golkar, Nasim; Samani, Soliman Mohammadi; Tamaddon, Ali Mohammad, E-mail: amtamadon@gmail.com [Shiraz University of Medical Sciences, Department of Pharmaceutics, School of Pharmacy (Iran, Islamic Republic of)

2016-05-15

Aimed to prepare an enhanced gene delivery system with low cytotoxicity and high transfection efficiency, various cholesterol-conjugated derivates of low generation polyamidoamine (PAMAM) dendrimers were prepared. The conjugates were characterized by TNBS assay, FTIR, and {sup 1}H-NMR spectroscopy. Self-assembly of the dendrimer conjugates (G1-Chol, G2-Chol, and G3-Chol) was investigated by pyrene assay. Following formation of the complexes between enhanced green fluorescence protein plasmid and the dendrimer conjugates at various N (primary amine)/P (phosphate) mole ratios, plasmid condensation, biologic stability, cytotoxicity, and protein expression were investigated. The conjugates self-assembled into micellar dispersions with the critical micelle concentration values (<50 µg/ml) depending on the dendrimer generation and cholesterol/amine mole ratio. Cholesterol conjugation resulted in higher resistance of the condensed plasmid DNA in a competition assay with heparin sulfate. Also, the transfection efficiency was determined higher for the cholesterol conjugates than unmodified dendrimers in HepG2 cells, showing the highest for G2-Chol at 40 % degree of cholesterol modification (G2-Chol{sub 40 %}) among various dendrimer generations. Interestingly, such conjugate showed a complete protection of plasmid against serum nucleases. Our results confirmed that the cholesterol conjugation to PAMAM dendrimers of low generations bearing little cytotoxicity improves their several physicochemical and biological characteristics required for an enhanced delivery of plasmid DNA into cells.

Electrophoresis examination of strand breaks in plasmid DNA induced by low-energy nitrogen ion irradiation

International Nuclear Information System (INIS)

Zhao Yong; Tan Zheng; Du Yanhua; Qiu Guanying

2003-01-01

To study the effect on plasmid DNA of heavy ion in the energy range of keV where nuclear stopping interaction becomes more important or even predominant, thin film of plasmid pGEM-3Zf(-) DNA was prepared on aluminum surface and irradiated in vacuum ( -3 Pa) by low-energy nitrogen ions with energy of 30 keV (LET=285 keV/μm) at various fluence ranging from 2 x 10 10 to 8.2 x 10 13 ions/cm 2 . DNA strand breaks were analyzed by neutral electrophoresis followed by quantification with image analysis software. Low-energy nitrogen ion irradiation induced single-, double- and multiple double-strand breaks (DSB) and multiple DSB as the dominating form of DNA damages. Moreover, the linear fluence-response relationship at a low fluence range suggests that DSBs are induced predominantly by single ion track. However, strand break production is limited to a short range in the irradiated samples

TOL Plasmid Carriage Enhances Biofilm Formation and Increases Extracellular DNA Content in Pseudomonas Putida KT2440

DEFF Research Database (Denmark)

Smets, Barth F.; D'Alvise, Paul; Yankelovich, T.

laser scanning microscopy. The TOL-carrying strains formed pellicles and thick biofilms, whereas the same strains without the plasmid displayed little adherent growth. Microscopy using fluorescent nucleic acid- specific stains (cytox orange, propidium iodide) revealed differences in production...... combined with specific cytostains; release of cytoplasmic material was assayed by a β-glucosidase assay. Enhanced cell lysis due to plasmid carriage was ruled out as the mechanism for eDNA release. We report, for the first time, that carriage of a conjugative plasmid leads to increased biofilm formation...

Plasmid marker rescue transformation proceeds by breakage-reunion in Bacillus subtilis

International Nuclear Information System (INIS)

Weinrauch, Y.; Dubnau, D.

1987-01-01

Bacillus subtilis carrying a plasmid which replicates with a copy number of about 1 was transformed with linearized homologous plasmid DNA labeled with the heavy isotopes 2 H and 15 N, in the presence of 32 Pi and 6-(p-hydroxyphenylazo)-uracil to inhibit DNA replication. Plasmid DNA was isolated from the transformed culture and fractionated in cesium chloride density gradients. The distribution of total and donor plasmid DNA was examined, using specific hybridization probes. The synthesis of new DNA, associated with the integration of donor moiety, was also monitored. Donor-specific sequences were present at a density intermediate between that of light and hybrid DNA. This recombinant DNA represented 1.4% of total plasmid DNA. The latter value corresponded well with the transforming activity (1.7%) obtained for the donor marker. Newly synthesized material associated with plasmid DNA at the recombinant density amounted to a minor portion of the recombinant plasmid DNA. These data suggest that, like chromosomal transformation, plasmid marker rescue transformation does not require replication for the integration of donor markers and, also like chromosomal transformation, proceeds by a breakage-reunion mechanism. The extent of donor DNA replacement of recipient DNA per plasmid molecule of 54 kilobases (27 kilobase pairs) was estimated as 16 kilobases

Effects of 32 P incorporated in plasmid DNA: strand breaks and mutagenesis

International Nuclear Information System (INIS)

Fonseca, Adenilson de S. da; Felzenszwalb, Israel

1996-01-01

In order to study the 32 P decay effects in DNA, bacterial plasmid were labeled with different activities of the radioisotope in vivo: 1,2 and 6 x 10 5 Bk/ml of bacterial culture, leading to 1,2 and 6 x 10 3 Bk/μg of nucleic acid or in vitro: 0.7, 1.5 and 3.5 x 10 3 Bk/μg of nucleic acid, stored at -20 deg C and its electroforetic profiles, transformation capacity of wild type and DNA repair. E. coli mutants cells and mutagenesis, were followed during three months. The results achieved in this work suggest that: the decay of the incorporated 32 P in vivo is able to change the pBR322 electroforetic profile, we detected a decrease on the form III (super coiled) and increase on the form II (circular), indicating single strands breaks; the decay incorporated 32 in vitro does not modify the electrophoretic profile of pBR322, suggesting that in some way the effects of the radioactive decay of incorporated 32 P is dependent of the DNA topology, the damages induced by 32 P decay increase mutation frequency in pAC189 plasmids. MRF is increased by a factor of three after 6 t 1/2 of storage, indicating direct or indirect action through mismatch DNA repair pathway. (author)

Bacterial natural transformation by highly fragmented and damaged DNA

DEFF Research Database (Denmark)

Overballe-Petersen, Søren; Harms, Klaus; Orlando, Ludovic Antoine Alexandre

2013-01-01

for microbes, but not as potential substrate for bacterial evolution. Here, we show that fragmented DNA molecules (≥20 bp) that additionally may contain abasic sites, cross-links, or miscoding lesions are acquired by the environmental bacterium Acinetobacter baylyi through natural transformation. With uptake......DNA molecules are continuously released through decomposition of organic matter and are ubiquitous in most environments. Such DNA becomes fragmented and damaged (often DNA is recognized as nutrient source...... of DNA from a 43,000-y-old woolly mammoth bone, we further demonstrate that such natural transformation events include ancient DNA molecules. We find that the DNA recombination is RecA recombinase independent and is directly linked to DNA replication. We show that the adjacent nucleotide variations...

Photo-transfection of mouse embryonic stem cells with plasmid DNA using femtosecond laser pulses

CSIR Research Space (South Africa)

Thobakgale, Lebogang

2017-01-01

Full Text Available This presentation is about the photo-transfection of mouse embryonic stem cells with plasmid DNA using femtosecond laser pulses. It outlines the background on embryonic stem cells (ES) and phototransfection....

DNA Length Modulates the Affinity of Fragments of Genomic DNA for the Nuclear Matrix In Vitro.

Science.gov (United States)

García-Vilchis, David; Aranda-Anzaldo, Armando

2017-12-01

Classical observations have shown that during the interphase the chromosomal DNA of metazoans is organized in supercoiled loops attached to a compartment known as the nuclear matrix (NM). Fragments of chromosomal DNA able to bind the isolated NM in vitro are known as matrix associated/attachment/addressed regions or MARs. No specific consensus sequence or motif has been found that may constitute a universal, defining feature of MARs. On the other hand, high-salt resistant DNA-NM interactions in situ define true DNA loop anchorage regions or LARs, that might correspond to a subset of the potential MARs but are not necessarily identical to MARs characterized in vitro, since there are several examples of MARs able to bind the NM in vitro but which are not actually bound to the NM in situ. In the present work we assayed the capacity of two LARs, as well as of shorter fragments within such LARs, for binding to the NM in vitro. Paradoxically the isolated (≈2 kb) LARs cannot bind to the NM in vitro while their shorter (≈300 pb) sub-fragments and other non-related but equally short DNA fragments, bind to the NM in a high-salt resistant fashion. Our results suggest that the ability of a given DNA fragment for binding to the NM in vitro primarily depends on the length of the fragment, suggesting that binding to the NM is modulated by the local topology of the DNA fragment in suspension that it is known to depend on the DNA length. J. Cell. Biochem. 118: 4487-4497, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Transformation frequency of γ irradiated plasmid DNA and the enzymatic double strand break formation by incubation in a protein extract of Escherichia coli

International Nuclear Information System (INIS)

Schulte-Frohlinde, D.; Mark, F.; Ventur, Y.

1994-01-01

It was found that incubation of γ-irradiated or DNaseI-treated plasmid DNA in a protein extract of Escherichia coli leads to enzyme-induced formation of double strand breaks (dsb) in competition with repair of precursors of these dsb. A survival curve of the plasmid DNA (as determined by transformation of E. coli) was calculated on the basis of enzyme-induced dsb as well as those produced by irradiation assuming that they are lethal. The calculated D O value was the same as that measured directly by transformation of irradiated plasmid DNA. Two models are presented that fit the experimental survival data as a function of dose. One is based on damage formation in the plasmid DNA including enzymatic conversion of single strand damage into dsb (U-model), the other is an enzymatic repair saturation model based on Michaelis-Menten kinetics. (Author)

Cloning and DNA sequence of the mercuric- and organomercurial-resistance determinants of plasmid pDU1358

International Nuclear Information System (INIS)

Griffin, H.G.; Foster, T.J.; Silver, S.; Misra, T.K.

1987-01-01

The broad-spectrum mercurial-resistance plasmid pDU1358 was analyzed by cloning the resistance determinants and preparing a physical and genetic map of a 45-kilobase (kb) region of the plasmid that contains two separate mercurial-resistance operons that mapped about 20 kb apart. One encoded narrow-spectrum mercurial resistance to Hg 2+ and a few organomercurials; the other specified broad-spectrum resistance to phenylmercury and additional organomercurials. Each determinant governed mercurial transport functions. Southern DNA x DNA hybridization experiments using gene-specific probes from the plasmid R100 mer operon indicated close homology with the R100 deteminant. The 2153 base pairs of the promoter-distal part of the broad-spectrum Hg 2+ -resistance operon of pDU1358 were sequenced. This region included the 3'-terminal part of the merA gene, merD, unidentified reading frame URF1, and a part of URF2 homologous to previously sequenced determinants of plasmid R100. Between the merA and merD genes, an open reading frame encoding a 212 amino acid polypeptide was identified as the merB gene that determines the enzyme organomercurial lyase that cleaves the C-Hg bond of phenylmercury

Investigation of DNA double strand breaks induced by α particle and 7Li ions

International Nuclear Information System (INIS)

Kong Fuquan; Cai Minghui; Zhao Kui; Guo Jiyu; Ni Meinan; Sui Li; Yang Mingjian; Zhan Yong

2006-01-01

α particles and Lithium ions were produced by 241 Am radiation source and HI-13 tandem accelerator at China Institute of Atomic Energy (CIAE) respectively to simulate ionizing radiation in Boron Neutron Capture Therapy (BNCT) process. Plasmid DNA in aqueous solution was irradiated and the DNA fragments were imaged by AFM. The image software ImageJ was used to measure the length of DNA fragments. The length distribution and conformation changes of DNA fragments were assessed. Our results showed that the mean length of DNA fragments as well as the fraction of linear and open circle DNA molecules decreased by dose. At higher dose, Lithium ions induced more pronounced relative biological effects than α particles. (author)

Direct identification of antibiotic resistance genes on single plasmid molecules using CRISPR/Cas9 in combination with optical DNA mapping

Science.gov (United States)

Müller, Vilhelm; Rajer, Fredrika; Frykholm, Karolin; Nyberg, Lena K.; Quaderi, Saair; Fritzsche, Joachim; Kristiansson, Erik; Ambjörnsson, Tobias; Sandegren, Linus; Westerlund, Fredrik

2016-12-01

Bacterial plasmids are extensively involved in the rapid global spread of antibiotic resistance. We here present an assay, based on optical DNA mapping of single plasmids in nanofluidic channels, which provides detailed information about the plasmids present in a bacterial isolate. In a single experiment, we obtain the number of different plasmids in the sample, the size of each plasmid, an optical barcode that can be used to identify and trace the plasmid of interest and information about which plasmid that carries a specific resistance gene. Gene identification is done using CRISPR/Cas9 loaded with a guide-RNA (gRNA) complementary to the gene of interest that linearizes the circular plasmids at a specific location that is identified using the optical DNA maps. We demonstrate the principle on clinically relevant extended spectrum beta-lactamase (ESBL) producing isolates. We discuss how the gRNA sequence can be varied to obtain the desired information. The gRNA can either be very specific to identify a homogeneous group of genes or general to detect several groups of genes at the same time. Finally, we demonstrate an example where we use a combination of two gRNA sequences to identify carbapenemase-encoding genes in two previously not characterized clinical bacterial samples.

FragIdent--automatic identification and characterisation of cDNA-fragments.

Science.gov (United States)

Seelow, Dominik; Goehler, Heike; Hoffmann, Katrin

2009-03-02

Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs) within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

Simple method for identification of plasmid-coded proteins

International Nuclear Information System (INIS)

Sancar, A.; Hack, A.M.; Rupp, W.D.

1979-01-01

Proteins encoded by plasmid DNA are specifically labeled in uv-irradiated cells of Escherichia coli carrying recA and uvrA mutations because extensive degradation of the chromosome DNA occurs concurrently with amplification of plasmid DNA

[Molecular dynamics of immune complex of photoadduct-containing DNA with Fab-Anti-DNA antibody fragment].

Science.gov (United States)

Akberova, N I; Zhmurov, A A; Nevzorova, T A; Litvinov, R I

2016-01-01

Antibodies to DNA play an important role in the pathogenesis of autoimmune diseases. The elucidation of structural mechanisms of both the antigen recognition and the interaction of anti-DNA antibodies with DNA will help to understand the role of DNA-containing immune complexes in various pathologies and can provide a basis for new treatment modalities. Moreover, the DNA-antibody complex is an analog of specific intracellular DNA-protein interactions. In this work, we used in silico molecular dynamic simulations of bimolecular complexes of the dsDNA segment containing the Fab fragment of an anti-DNA antibody to obtain the detailed thermodynamic and structural characteristics of dynamic intermolecular interactions. Using computationally modified crystal structure of the Fab-DNA complex (PDB ID: 3VW3), we studied the equilibrium molecular dynamics of the 64M-5 antibody Fab fragment associated with the dsDNA fragment containing the thymine dimer, the product of DNA photodamage. Amino acid residues that constitute paratopes and the complementary nucleotide epitopes for the Fab-DNA construct were identified. Stacking and electrostatic interactions were found to play the main role in mediating the most specific antibody-dsDNA contacts, while hydrogen bonds were less significant. These findings may shed light on the formation and properties of pathogenic anti-DNA antibodies in autoimmune diseases, such as systemic lupus erythematosus associated with skin photosensitivity and DNA photodamage.

Amplification of deoxyribonucleic acid (DNA) fragment using two ...

African Journals Online (AJOL)

user

2011-04-11

Apr 11, 2011 ... polymerases on this method, whether different lengths of. DNA fragments could be amplified by two-step PCR and the difference of DNA product quality produced by the two methods. MATERIALS AND METHODS. PCR template and reagents. Enterobacteria phage lambda DNA (GenBank no: V00636) ...

Generation of a reliable full-length cDNA of infectiousTembusu virus using a PCR-based protocol.

Science.gov (United States)

Liang, Te; Liu, Xiaoxiao; Cui, Shulin; Qu, Shenghua; Wang, Dan; Liu, Ning; Wang, Fumin; Ning, Kang; Zhang, Bing; Zhang, Dabing

2016-02-02

Full-length cDNA of Tembusu virus (TMUV) cloned in a plasmid has been found instable in bacterial hosts. Using a PCR-based protocol, we generated a stable full-length cDNA of TMUV. Different cDNA fragments of TMUV were amplified by reverse transcription (RT)-PCR, and cloned into plasmids. Fragmented cDNAs were amplified and assembled by fusion PCR to produce a full-length cDNA using the recombinant plasmids as templates. Subsequently, a full-length RNA was transcribed from the full-length cDNA in vitro and transfected into BHK-21 cells; infectious viral particles were rescued successfully. Following several passages in BKH-21 cells, the rescued virus was compared with the parental virus by genetic marker checks, growth curve determinations and animal experiments. These assays clearly demonstrated the genetic and biological stabilities of the rescued virus. The present work will be useful for future investigations on the molecular mechanisms involved in replication and pathogenesis of TMUV. Copyright © 2015 Elsevier B.V. All rights reserved.

Menadione-induced DNA fragmentation without 8-hydroxy-2'-deoxyguanosine formation in isolated rat hepatocytes

DEFF Research Database (Denmark)

Fischer-Nielsen, Anne; Corcoran, George B.; Poulsen, Henrik E.

1995-01-01

Farmakologi, frie iltradikaler, menadion, DNA fragmentering, rotteleverceller, oksidativ DNA skade......Farmakologi, frie iltradikaler, menadion, DNA fragmentering, rotteleverceller, oksidativ DNA skade...

Quantification of DNA fragmentation in processed foods using real-time PCR.

Science.gov (United States)

Mano, Junichi; Nishitsuji, Yasuyuki; Kikuchi, Yosuke; Fukudome, Shin-Ichi; Hayashida, Takuya; Kawakami, Hiroyuki; Kurimoto, Youichi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Takabatake, Reona; Kitta, Kazumi

2017-07-01

DNA analysis of processed foods is performed widely to detect various targets, such as genetically modified organisms (GMOs). Food processing often causes DNA fragmentation, which consequently affects the results of PCR analysis. In order to assess the effects of DNA fragmentation on the reliability of PCR analysis, we investigated a novel methodology to quantify the degree of DNA fragmentation. We designed four real-time PCR assays that amplified 18S ribosomal RNA gene sequences common to various plants at lengths of approximately 100, 200, 400, and 800 base pairs (bp). Then, we created an indicator value, "DNA fragmentation index (DFI)", which is calculated from the Cq values derived from the real-time PCR assays. Finally, we demonstrated the efficacy of this method for the quality control of GMO detection in processed foods by evaluating the relationship between the DFI and the limit of detection. Copyright © 2017 Elsevier Ltd. All rights reserved.

Design of expanded bed supports for the recovery of plasmid DNA by anion exchange adsorption

DEFF Research Database (Denmark)

Theodossiou, Irini; Søndergaard, M.; Thomas, Owen R. T.

2001-01-01

In this study we detail the rational design of new chromatographic adsorbents tailored for the capture of plasmid DNA. Features present on current chromatographic supports that can significantly enhance plasmid binding capacity have been identified in packed bed chromatography experiments...... and blueprints for improved expanded bed adsorbents have been put forward. The characterisation and testing of small (20-40 mum) high density (>3.7 g cm(-3)) pellicular expanded bed materials functionalised with various anion exchange structures is presented. In studies with calf thymus DNA, dynamic binding...... capacities of 1.2 and 3.4 mg ml(-1) were recorded for prototype diethylaminoethyl-and polyethylene imine-linked adsorbents which were respectively 25 and 70 fold higher than those of equivalently derivatised commercial expanded bed materials. The prototype polyethylene imine-coupled material exhibited severe...

DNA fragmentation and cytotoxicity by recombinant human tumor necrosis factor in L929 fibroblast cells

International Nuclear Information System (INIS)

Kosaka, T.; Kuwabara, M.; Koide, F.

1992-01-01

Induction of cell DNA fragmentation by treatment of recombinant human Tumor Necrosis Factor alpha (rhTNF alpha) was examined by using mouse L929 cells derived from mouse fibroblast cells. The amount of DNA fragments derived from rhTNF alpha-treated cells, detected by alkaline elution technique, was smaller than that derived from X-irradiated cells. The rhTNF alpha caused the DNA fragmentation depending on its incubation time and concentration. The DNA damage caused by rhTNF alpha treatment correlated with its cytotoxicity. This result suggested that the DNA fragmentation is one of causes of cell death. The treatment with proteinase K of DNA obtained from rhTNF alpha-treated cells did not increase the amount of DNA fragmentation, which indicates that rhTNF alpha causes DNA-fragmentation but not DNA-protein cross-linking

Lower sperm DNA fragmentation after r-FSH administration in functional hypogonadotropic hypogonadism.

Science.gov (United States)

Ruvolo, Giovanni; Roccheri, Maria Carmela; Brucculeri, Anna Maria; Longobardi, Salvatore; Cittadini, Ettore; Bosco, Liana

2013-04-01

An observational clinical and molecular study was designed to evaluate the effects of the administration of recombinant human FSH on sperm DNA fragmentation in men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In the study were included 53 men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In all patients, sperm DNA fragmentation index (DFI), assessed by terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate (dUTP) in situ DNA nick end-labelling (TUNEL) assay, was evaluated before starting the treatment with 150 IU of recombinant human FSH, given three times a week for at least 3 months. Patients' semen analysis and DNA fragmentation index were re-evaluated after the 3-month treatment period. After recombinant human FSH therapy, we did not find any differences in terms of sperm count, motility and morphology. The average DNA fragmentation index was significantly reduced (21.15 vs 15.2, p15 %), while no significant variation occurred in the patients with DFI values ≤ 15 %. Recombinant human FSH administration improves sperm DNA integrity in hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia men with DNA fragmentation index value >15 % .

Plasmid segregation mechanisms

DEFF Research Database (Denmark)

Ebersbach, G.; Gerdes, Kenn

2005-01-01

Bacterial plasmids encode partitioning (par) loci that ensure ordered plasmid segregation prior to cell division. par loci come in two types: those that encode actin-like ATPases and those that encode deviant Walker-type ATPases. ParM, the actin-like ATPase of plasmid R1, forms dynamic filaments...... that segregate plasmids paired at mid-cell to daughter cells. Like microtubules, ParM filaments exhibit dynamic instability (i.e., catastrophic decay) whose regulation is an important component of the DNA segregation process. The Walker box ParA ATPases are related to MinD and form highly dynamic, oscillating...... filaments that are required for the subcellular movement and positioning of plasmids. The role of the observed ATPase oscillation is not yet understood. However, we propose a simple model that couples plasmid segregation to ParA oscillation. The model is consistent with the observed movement...

Abnormal ultraviolet mutagenic spectrum in plasmid DNA replicated in cultured fibroblasts from a patient with the skin cancer-prone disease, xeroderma pigmentosum

International Nuclear Information System (INIS)

Seetharam, S.; Protic-Sabljic, M.; Seidman, M.M.; Kraemer, K.H.

1987-01-01

A shuttle vector plasmid, pZ189, was utilized to assess the types of mutations that cells from a patient with xeroderma pigmentosum, complementation group D, introduce into ultraviolet (UV) damaged, replicating DNA. Patients with xeroderma pigmentosum have clinical and cellular UV hypersensitivity, increased frequency of sun-induced skin cancer, and deficient DNA repair. In comparison to UV-treated pZ189 replicated in DNA repair-proficient cells, there were fewer surviving plasmids, a higher frequency of plasmids with mutations, fewer plasmids with two or more mutations in the marker gene, and a new mutagenic hotspot. The major type of base substitution mutation was the G:C to A:T transition with both cell lines. These results, together with similar findings published earlier with cells from a xeroderma pigmentosum patient in complementation group A, suggest that isolated G:C to A:T somatic mutations may be particularly important in generation of human skin cancer by UV radiation

Synthesis and NMR of {sup 15}N-labeled DNA fragments

Energy Technology Data Exchange (ETDEWEB)

Jones, R.A. [Rutgers, The State Univ. of New Jersey, Piscataway, NJ (United States)

1994-12-01

DNA fragments labeled with {sup 15}N at the ring nitrogens and at the exocyclic amino groups can be used to obtain novel insight into interactions such as base pairing, hydration, drug binding, and protein binding. A number of synthetic routes to {sup 15}N-labeled pyrimidine nucleosides, purines, and purine nucleosides have been reported. Moreover, many of these labeled bases or monomers have been incorporated into nucleic acids, either by chemical synthesis or by biosynthetic procedures. The focus of this chapter will be on the preparation of {sup 15}N-labeled purine 2{prime}-deoxynucleosides, their incorporation into DNA fragments by chemical synthesis, and the results of NMR studies using these labeled DNA fragments.

Use of damaged plasmid to study DNA repair in X-ray sensitive (xrs) strains of Chinese hamster ovary (CHO) cells

International Nuclear Information System (INIS)

Smith-Ravin, J.; Jeggo, P.A.

1989-01-01

The effect of γ-irradiation of pSV2gpt DNA on its transfection frequency has been analysed using radiosensitive CHO xrs mutants showing a defect in double-strand break (dsb) rejoining. At low doses a sharp decrease in relative transfection frequency, i.e. transfection frequency of irradiated plasmid relative to untreated plasmid, as observed in xrs mutants compared with the parent line K1. Electrophoresis of irradiated plasmid DNA showed the decrease in transfection frequency in the xrs mutants correlated with the change of supercoiled molecules into open-circular forms. In the parent line CHO-K1, open-circular and supercoiled molecules have the same transfection frequency. The effect of linearization of pSV2gpt DNA by restriction enzymes on transfection frequency in xrs and wild-type strains was also examined. No difference in the relative transfection frequency between xrs and wild-type strains was detected. (author)

Characterization of IncN plasmids carrying blaCTX-M-1 and qnr genes in Escherichia coli and Salmonella from animals, the environment and humans

DEFF Research Database (Denmark)

Dolejska, Monika; Villa, Laura; Hasman, Henrik

2013-01-01

were compared using restriction fragment length polymorphism (RFLP), plasmid multilocus sequence typing (pMLST) and hybridization with repN, qnrS1, qnrB19 or blaCTX-M-1 probes. Plasmids pKT58A and pHHA45 were sequenced using the 454-Genome Sequencer FLX platform on a library constructed from plasmid...... DNA purified from the respective E. coli transformants.Results Three types of IncN plasmids carrying blaCTX-M-1, qnrS1 and qnrB19 genes were identified in strains isolated from the Czech Republic, Poland, Slovakia, Denmark, Italy and the Netherlands, corresponding to pMLST sequence type (ST) 1, ST3...

Simultaneous vitality and DNA-fragmentation measurement in spermatozoa of smokers and non-smokers.

Science.gov (United States)

De Bantel, A; Fleury-Feith, J; Poirot, C; Berthaut, I; Garcin, C; Landais, P; Ravel, C

2015-03-01

Because cigarette smoke is a powerful ROS producer, we hypothesized that the spermatozoa of smokers would be more at risk of having increased DNA fragmentation than spermatozoa of non-smoking men. A cross-sectional study was performed on consenting smokers and non-smokers, consulting in an infertility clinic for routine sperm analysis. The application of a novel TUNEL assay coupled to a vitality marker, LIVE/DEAD®, allowed both DNA fragmentation and viability measurement within spermatozoa of participants to be analyzed by flow cytometry. The coupled vitality-DNA fragmentation analysis revealed that non-smokers and smokers, respectively presented medians of 3.6% [0.6-36.8] and 3.3% [0.9-9.6] DNA fragmented spermatozoa among the living spermatozoa population (P > 0.05). No deleterious effect of smoking on spermatozoa was found in our study. More studies concerning potential mutagenic capacities of cigarette smoke on spermatozoa are necessary. In addition, the coupled vitality-DNA fragmentation analysis may orient Assisted Reproductive Technology teams when confronted with patients having a high percentage of DNA-fragmented living spermatozoa. © 2014 International Clinical Cytometry Society.

Initiation and termination of the bacteriophage phi X174 rolling circle DNA replication in vivo: packaging of plasmid single-stranded DNA into bacteriophage phi X174 coats

NARCIS (Netherlands)

van der Ende, A.; Teertstra, R.; Weisbeek, P. J.

1982-01-01

The bacteriophage phi X174 viral (+) origin when inserted in a plasmid can interact in vivo with the A protein produced by infecting phi X174 phages. A consequence of this interaction is packaging of single-stranded plasmid DNA into preformed phage coats resulting in infective particles (1). This

Formation of plasmid DNA strand breaks induced by low-energy ion beam: indication of nuclear stopping effects

International Nuclear Information System (INIS)

Chen Yu; Jiang Bingyao; Chen Youshan; Ding Xingzhao; Liu Xianghuai; Chen Ceshi; Guo Xinyou; Yin Guanglin

1998-01-01

Plasmid pGEM 3zf(+) was irradiated by nitrogen ion beam with energies between 20 and 100 keV and the fluence kept as 1 x 10 12 ions/cm 2 . The irradiated plasmid was assayed by neutral electrophoresis and quantified by densitometry. The yields of DNA with single-strand and double-strand breaks first increased then decreased with increasing ion energy. There was a maximal yield value in the range of 20-100 keV. The relationship between DNA double-strand breaks (DSB) cross-section and linear energy transfer (LET) also showed a peak-shaped distribution. To understand the physical process during DNA strand breaks, a Monte Carlo calculation code known as TRIM (Transport of Ions in Matter) was used to simulate energy losses due to nuclear stopping and to electronic stopping. It can be assumed that nuclear stopping plays a more important role in DNA strand breaks than electronic stopping in this energy range. The physical mechanisms of DNA strand breaks induced by a low-energy ion beam are also discussed. (orig.)

Strand breaks in plasmid DNA following positional changes of Auger-electron-emitting radionuclides

International Nuclear Information System (INIS)

Adelstein, S.J.; Kassis, A.I.

1996-01-01

The purpose of our studies is to elucidate the kinetics of DNA strand breaks caused by low-energy Auger electron emitters in close proximity to DNA. Previously we have studied the DNA break yields in plasmids after the decay of indium-111 bound to DNA or free in solution. In this work, we compare the DNA break yields in supercoiled DNA of iodine-125 decaying close to DNA following DNA intercalation, minor-groove binding, or surface binding, and at a distance form DNA. Supercoiled DNA, stored at 4 C to accumulate radiation dose from the decay of 125 I, was then resolved by gel electrophoresis into supercoiled, nicked circular, and linear forms, representing undamaged DNA, single-strand breaks, and double-strand breaks respectively. DNA-intercalated or groove-bound 125 I is more effective than surface-bound radionuclide or 125 I free in solution. The hydroxyl radical scavenger DMSO protects against damage by 125 I free in solution but has minimal effect on damage by groove-bound 125 I. (orig.)

Development of a Novel Reference Plasmid for Accurate Quantification of Genetically Modified Kefeng6 Rice DNA in Food and Feed Samples

Directory of Open Access Journals (Sweden)

Liang Li

2013-01-01

Full Text Available Reference plasmids are an essential tool for the quantification of genetically modified (GM events. Quantitative real-time PCR (qPCR is the most commonly used method to characterize and quantify reference plasmids. However, the precision of this method is often limited by calibration curves, and qPCR data can be affected by matrix differences between the standards and samples. Here, we describe a digital PCR (dPCR approach that can be used to accurately measure the novel reference plasmid pKefeng6 and quantify the unauthorized variety of GM rice Kefeng6, eliminating the issues associated with matrix effects in calibration curves. The pKefeng6 plasmid was used as a calibrant for the quantification of Kefeng6 rice by determining the copy numbers of event- (77 bp and taxon-specific (68 bp fragments, their ratios, and their concentrations. The plasmid was diluted to five different concentrations. The third sample (S3 was optimized for the quantification range of dPCR according to previous reports. The ratio between the two fragments was 1.005, which closely approximated the value certified by sequencing, and the concentration was found to be 792 copies/μL. This method was precise, with an RSD of ~3%. These findings demonstrate the advantages of using the dPCR method to characterize reference materials.

Plasmids in Gram negatives: molecular typing of resistance plasmids.

Science.gov (United States)

Carattoli, Alessandra

2011-12-01

A plasmid is defined as a double stranded, circular DNA molecule capable of autonomous replication. By definition, plasmids do not carry genes essential for the growth of host cells under non-stressed conditions but they have systems which guarantee their autonomous replication also controlling the copy number and ensuring stable inheritance during cell division. Most of the plasmids confer positively selectable phenotypes by the presence of antimicrobial resistance genes. Plasmids evolve as an integral part of the bacterial genome, providing resistance genes that can be easily exchanged among bacteria of different origin and source by conjugation. A multidisciplinary approach is currently applied to study the acquisition and spread of antimicrobial resistance in clinically relevant bacterial pathogens and the established surveillance can be implemented by replicon typing of plasmids. Particular plasmid families are more frequently detected among Enterobacteriaceae and play a major role in the diffusion of specific resistance genes. For instance, IncFII, IncA/C, IncL/M, IncN and IncI1 plasmids carrying extended-spectrum beta-lactamase genes and acquired AmpC genes are currently considered to be "epidemic resistance plasmids", being worldwide detected in Enterobacteriaceae of different origin and sources. The recognition of successful plasmids is an essential first step to design intervention strategies preventing their spread. Copyright © 2011 Elsevier GmbH. All rights reserved.

Antibacterial effect of cationic porphyrazines and anionic phthalocyanine and their interaction with plasmid DNA

Science.gov (United States)

Hassani, Leila; Hakimian, Fatemeh; Safaei, Elham; Fazeli, Zahra

2013-11-01

Resistance to antibiotics is a public health issue and identification of new antibacterial agents is one of the most important goals of pharmacological research. Among the novel developed antibacterial agents, porphyrin complexes and their derivatives are ideal candidates for use in medical applications. Phthalocyanines differ from porphyrins by having nitrogen atoms link the individual pyrrol units. The aza analogues of the phthalocyanines (azaPcs) such as tetramethylmetalloporphyrazines are heterocyclic Pc analogues. In this investigation, interaction of an anionic phthalocyanine (Cu(PcTs)) and two cationic tetrapyridinoporphyrazines including [Cu(2,3-tmtppa)]4+ and [Cu(3,4-tmtppa)]4+ complexes with plasmid DNA was studied using spectroscopic and gel electrophoresis methods. In addition, antibacterial effect of the complexes against Gram-positive (Staphylococcus aureus) and Gram-negative (Escherichia coli) bacteria was investigated using dilution test method. The results indicated that both porphyrazines have significant antibacterial properties, but Cu(PcTs) has weak antibacterial effect. Compairing the binding of the phthalocyanine and the porphyrazines to DNA demonstrated that the interaction of cationic porphyrazines is stronger than the anionic phthalocyanine remarkably. The extent of hypochromicity and red shift of absorption spectra indicated preferential intercalation of the two porphyrazine into the base pairs of DNA helix. Gel electrophoresis result implied Cu(2,3-tmtppa) and Cu(3,4-tmtppa) are able to perform cleavage of the plasmid DNA. Consequently, DNA binding and cleavage might be one of the antibacterial mechanisms of the complexes.

High-frequency transformation of a methylotrophic yeast, Candida boidinii, with autonomously replicating plasmids which are also functional in Saccharomyces cerevisiae.

Science.gov (United States)

Sakai, Y; Goh, T K; Tani, Y

1993-06-01

We have developed a transformation system which uses autonomous replicating plasmids for a methylotrophic yeast, Candida boidinii. Two autonomous replication sequences, CARS1 and CARS2, were newly cloned from the genome of C. boidinii. Plasmids having both a CARS fragment and the C. boidinii URA3 gene transformed C. boidinii ura3 cells to Ura+ phenotype at frequencies of up to 10(4) CFU/micrograms of DNA. From Southern blot analysis, CARS plasmids seemed to exist in polymeric forms as well as in monomeric forms in C. boidinii cells. The C. boidinii URA3 gene was overexpressed in C. boidinii on these CARS vectors. CARS1 and CARS2 were found to function as an autonomous replicating element in Saccharomyces cerevisiae as well. Different portions of the CARS1 sequence were needed for autonomous replicating activity in C. boidinii and S. cerevisiae. C. boidinii could also be transformed with vectors harboring a CARS fragment and the S. cerevisiae URA3 gene.

Determination of size distribution of small DNA fragments by polyacrylamide gel electrophoresis

International Nuclear Information System (INIS)

Lau How Mooi

1998-01-01

Size distribution determination of DNA fragments can be normally determined by the agarose gel electrophoresis, including the normal DNA banding pattern analysis. However this method is only good for large DNA, such as the DNA of the size of kilo base pairs to mega base pairs range. DNA of size less than kilo base pairs is difficult to be quantified by the agarose gel method. Polyacrylamide gel electrophoresis however can be used to measure the quantity of DNA fragments of size less than kilo base pairs in length, down to less than ten base pairs. This method is good for determining the quantity of the smaller size DNA, single stranded polymers or even some proteins, if the known standards are available. In this report detail description of the method of preparing the polyacrylamide gel, and the experimental set up is discussed. Possible uses of this method, and the comparison with the standard sizes of DNA is also shown. This method is used to determine the distribution of the amount of the fragmented DNA after the Calf-thymus DNA has been exposed to various types of radiation and of different doses. The standards were used to determine the sizes of the fragmented Calf-thymus DNA. The higher the dose the higher is the amount of the smaller size DNA measured

Transfer of the lambdadv plasmid to new bacterial hosts

International Nuclear Information System (INIS)

Kellenberger-Gujer, G.; Boy de la Tour, E.; Berg, D.E.

1974-01-01

Lambda dv, which was derived from bacteriophage lambda, replicates autonomously as a plasmid in Escherichia coli and consists of only the immunity region (imm/sup lambda/) and DNA replication genes (O, P) of the ancestral phage. Addition phages (lambda imm 21 --lambda dv) carry the lambda dv fragment inserted as a tandem duplication in their genome (sequence A imm 21 O P imm/sup lambda/ O P R) are formed as recombinants after lambda imm 21 infection of strains carrying lambda dv. Addition phages were used to transfer lambda dv to new bacterial hosts. Lambda dv transfer by excision of the lambda dv segment from the addition phage genome requires a bacterial Rec or a phage Red recombination system. Successful transfer is stimulated by uv irradiation of the addition phage before infection. Some properties of the newly transferred lambda dv plasmids are described. (U.S.)

Immunization with plasmid DNA encoding the hemagglutinin and the nucleoprotein confers robust protection against a lethal canine distemper virus challenge.

Science.gov (United States)

Dahl, Lotte; Jensen, Trine Hammer; Gottschalck, Elisabeth; Karlskov-Mortensen, Peter; Jensen, Tove Dannemann; Nielsen, Line; Andersen, Mads Klindt; Buckland, Robin; Wild, T Fabian; Blixenkrone-Møller, Merete

2004-09-09

We have investigated the protective effect of immunization of a highly susceptible natural host of canine distemper virus (CDV) with DNA plasmids encoding the viral nucleoprotein (N) and hemagglutinin (H). The combined intradermal and intramuscular routes of immunization elicited high virus-neutralizing serum antibody titres in mink (Mustela vison). To mimic natural exposure, we also conducted challenge infection by horizontal transmission from infected contact animals. Other groups received a lethal challenge infection by administration to the mucosae of the respiratory tract and into the muscle. One of the mink vaccinated with N plasmid alone developed severe disease after challenge. In contrast, vaccination with the H plasmid together with the N plasmid conferred solid protection against disease and we were unable to detect CDV infection in PBMCs or in different tissues after challenge. Our findings show that DNA immunization by the combined intradermal and intramuscular routes can confer solid protective immunity against naturally transmitted morbillivirus infection and disease.

A novel technique using DNA denaturation to detect multiply induced single-strand breaks in a hydrated plasmid DNA molecule by X-ray and 4He2+ ion irradiation

International Nuclear Information System (INIS)

Yokoya, A.; Shikazono, N.; Fujii, K.; Noguchi, M.; Urushibara, A.

2011-01-01

To detect multiple single-strand breaks (SSBs) produced in plasmid DNA molecules by direct energy deposition from radiation tracks, we have developed a novel technique using DNA denaturation by which irradiated DNA is analysed as single-strand DNA (SS-DNA). The multiple SSBs that arise in both strands of DNA, but do not induce a double-strand break, are quantified as loss of SS-DNA using agarose gel electrophoresis. We have applied this method to X-ray and 4 He 2+ ion-irradiated samples of fully hydrated pUC18 plasmid DNA. The fractions of both SS-DNA and closed circular DNA (CC-DNA) exponentially decrease with the increasing dose of X rays and 4 He 2+ ions. The efficiency of the loss of SS-DNA was half that of CC-DNA for both types of irradiation, indicating that one of two strands in DNA is not broken when one SSB is produced in CC-DNA by irradiation. Contrary to our initial expectation, these results indicate that SSBs are not multiply induced even by high linear energy transfer radiation distributed in both strands. (authors)

Effect of vanillin on methylene blue plus light-induced single-strand breaks in plasmid pBR322 DNA.

Science.gov (United States)

Kumar, S S; Ghosh, A; Devasagayam, T P; Chauhan, P S

2000-09-20

The ability of vanillin (4-hydroxy-3-methoxybenzaldehyde), a naturally occurring food flavouring agent, in inhibiting photosensitization-induced single-strand breaks (ssbs) in plasmid pBR322 DNA has been examined in an in vitro system, independent of DNA repair/replication processes. Photosensitization of DNA with methylene blue, visible light and oxygen, induced ssbs resulting in the production of open circular form (OC form) in a concentration-dependent manner. The yield of OC form induced by photosensitization was increased several-fold by deuteration of the buffer and was found to be inhibited by sodium azide, a scavenger of singlet oxygen (1O(2)). Vanillin, per se, did not induce but inhibited photosensitization-induced ssbs in plasmid DNA, at millimolar concentrations. The inhibitory effect of vanillin was both concentration- and time-dependent. On a molar basis, vanillin was, however, less effective than trolox, a water-soluble analogue of alpha-tocopherol. Photosensitization by methylene blue system generates singlet oxygen, as one of the major components of ROS. Therefore, interaction of singlet oxygen with vanillin was investigated. The rate constant of vanillin with 1O(2) was estimated to be 5.93x10(7)M(-1)s(-1) and that of sodium azide as 2. 7x10(8)M(-1)s(-1). The present investigations show that vanillin can protect against photosensitization-induced ssbs in the plasmid pBR322 DNA, and this effect may partly be due to its ability to scavenge 1O(2).

Quantification of plasmid DNA reference materials for Shiga toxin-producing Escherichia coli based on UV, HR-ICP-MS and digital PCR.

Science.gov (United States)

Liang, Wen; Xu, Li; Sui, Zhiwei; Li, Yan; Li, Lanying; Wen, Yanli; Li, Chunhua; Ren, Shuzhen; Liu, Gang

2016-01-01

The accuracy and metrology traceability of DNA quantification is becoming a critical theme in many fields, including diagnosis, forensic analysis, microorganism detection etc. Thus the research of DNA reference materials (RMs) and consistency of DNA quantification methods has attracted considerable research interest. In this work, we developed 3 plasmid candidate RMs, containing 3 target genes of Escherichia coli O157:H7 (E. coli O157:H7) and other Shiga toxin-producing Escherichia coli (STEC): stx1, stx2, and fliC (h7) respectively. Comprehensive investigation of the plasmid RMs was performed for their sequence, purity, homogeneity and stability, and then the concentration was quantified by three different methods: ultraviolet spectrophotometer (UV), high resolution inductively coupled plasma mass spectrometry (HR-ICP-MS) and digital PCR. As a routinely applied method for DNA analysis, UV was utilized for the quantification (OD260) and purity analysis for the plasmids. HR-ICP-MS quantified the plasmid DNA through analysing the phosphorus in DNA molecules. Digital PCR distributed the DNA samples onto a microarray chip containing thousands of reaction chambers, and quantified the DNA copy numbers by analysing the number of positive signals without any calibration curves needed. Based on the high purification of the DNA reference materials and the optimization of dPCR analysis, we successfully achieved good consistency between UV, HR-ICP-MS and dPCR, with relative deviations lower than 10 %. We then performed the co-quantification of 3 DNA RMs with three different methods together, and the uncertainties of their concentration were evaluated. Finally, the certified values and expanded uncertainties for 3 DNA RMs (pFliC, pStx1 and pStx2) were (1.60 ± 0.10) × 10(10) copies/μL, (1.53 ± 0.10) × 10(10) copies/μL and (1.70 ± 0.11) × 10(10) copies/μL respectively.Graphical abstractWe developed 3 plasmid candidate RMs, containing 3 target genes of

FragIdent – Automatic identification and characterisation of cDNA-fragments

Directory of Open Access Journals (Sweden)

Goehler Heike

2009-03-01

Full Text Available Abstract Background Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Results Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. Conclusion We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

Improvement of in vivo transfer of plasmid DNA in muscle : Comparison of electroporation versus ultrasound

NARCIS (Netherlands)

Kusumanto, Yoka H.; Mulder, Nanno H.; Dam, Wendy A.; Losen, Mario H.; Meijer, Coby; Hospers, Geke A. P.

Plasmid-based gene delivery to muscle is a treatment strategy for many diseases with potential advantages above viral-based gene delivery methods, however, with a relative low transfection efficiency. We compared two physical methods-electroporation and ultrasound-that facilitate DNA uptake into

Accumulation of linear mitochondrial DNA fragments in the nucleus shortens the chronological life span of yeast.

Science.gov (United States)

Cheng, Xin; Ivessa, Andreas S

2012-10-01

Translocation of mitochondrial DNA (mtDNA) fragments to the nucleus and insertion of those fragments into nuclear DNA has been observed in several organisms ranging from yeast to plants and mammals. Disruption of specific nuclear genes by de novo insertions of mtDNA fragments has even been linked to the initiation of several human diseases. Recently, we demonstrated that baker's yeast strains with high rates of mtDNA fragments migrating to the nucleus (yme1-1 mutant) exhibit short chronological life spans (CLS). The yeast CLS is determined by the survival of non-dividing cell populations. Here, we show that lack of the non-homologous-end-joining enzyme DNA ligase IV (DNL4) can rescue the short CLS of the yme1-1 mutant. In fission yeast, DNA ligase IV has been shown to be required for the capture of mtDNA fragments during the repair of double-stranded DNA breaks in nuclear DNA. In further analyses using pulse field gel and 2D gel electrophoresis we demonstrate that linear mtDNA fragments with likely nuclear localization accumulate in the yme1-1 mutant. The accumulation of the linear mtDNA fragments in the yme1-1 mutant is suppressed when Dnl4 is absent. We propose that the linear nuclear mtDNA fragments accelerate the aging process in the yme1-1 mutant cells by possibly affecting nuclear processes including DNA replication, recombination, and repair as well as transcription of nuclear genes. We speculate further that Dnl4 protein has besides its function as a ligase also a role in DNA protection. Dnl4 protein may stabilize the linear mtDNA fragments in the nucleus by binding to their physical ends. In the absence of Dnl4 protein the linear fragments are therefore unprotected and possibly degraded by nuclear nucleases. Copyright © 2012 Elsevier GmbH. All rights reserved.

Construction of pTM series plasmids for gene expression in Brucella species.

Science.gov (United States)

Tian, Mingxing; Qu, Jing; Bao, Yanqing; Gao, Jianpeng; Liu, Jiameng; Wang, Shaohui; Sun, Yingjie; Ding, Chan; Yu, Shengqing

2016-04-01

Brucellosis, the most common widespread zoonotic disease, is caused by Brucella spp., which are facultative, intracellular, Gram-negative bacteria. With the development of molecular biology techniques, more and more virulence-associated factors have been identified in Brucella spp. A suitable plasmid system is an important tool to study virulence genes in Brucella. In this study, we constructed three constitutive replication plasmids (pTM1-Cm, pTM2-Amp, and pTM3-Km) using the replication origin (rep) region derived from the pBBR1-MCS vector. Also, a DNA fragment containing multiple cloning sites (MCSs) and a terminator sequence derived from the pCold vector were produced for complementation of the deleted genes. Besides pGH-6×His, a plasmid containing the groE promoter of Brucella spp. was constructed to express exogenous proteins in Brucella with high efficiency. Furthermore, we constructed the inducible expression plasmid pZT-6×His, containing the tetracycline-inducible promoter pzt1, which can induce expression by the addition of tetracycline in the Brucella culture medium. The constructed pTM series plasmids will play an important role in the functional investigation of Brucella spp. Copyright © 2016 Elsevier B.V. All rights reserved.

Persistence Mechanisms of Conjugative Plasmids

DEFF Research Database (Denmark)

Bahl, Martin Iain; Hansen, Lars H.; Sørensen, Søren Johannes

2009-01-01

Are plasmids selfish parasitic DNA molecules or an integrated part of the bacterial genome? This chapter reviews the current understanding of the persistence mechanisms of conjugative plasmids harbored by bacterial cells and populations. The diversity and intricacy of mechanisms affecting the suc...

Effect of the caffeine on treated and non-treated plasmid DNA with stannic chloride; Efeito da cafeina em DNA plasmidial tratado e nao tratado com cloreto estanoso

Energy Technology Data Exchange (ETDEWEB)

Moreno, Silvana Ramos F. [Universidade do Estado, Rio de Janeiro, RJ (Brazil). Inst. de Biologia. Dept. de Biofisica e Biometria]|[Universidade Federal Fluminense, Niteroi, RJ (Brazil). Faculdade de Ciencias Medicas. Curso de Pos-graduacao em Patologia Experimental; Mattos, Jose C.P. de; Dantas, Flavio; Araujo, Adriano Caldeira de; Bernardo-Filho, Mario [Universidade do Estado, Rio de Janeiro, RJ (Brazil). Inst. de Biologia. Dept. de Biofisica e Biometria]. E-mail: bernardo@uerj.br

2000-07-01

Caffeine, a methilxantine drug is a component of coffee, tea, stimulants and other drinks. Caffeine inhibits phosphodiesterase leading to intracellular accumulation of cyclic AMP, blocks adenosine receptors, and increases the release of Ca{sup 2+}. We have studied the possible effect of caffeine in DNA plasmid treated or not with stannous chloride (SnCl{sub 2}). Previous evaluations of the effect of caffeine on the labeling of red blood cells and plasma proteins with technetium-99m have showed a decrease of % ATI in the insoluble fraction of plasma proteins. Samples of DNA were treated with SnCl{sub 2} (0 and 200{mu}g/ml) in 0.8% agarose. SnCl{sub 2} has induced break on DNA and caffeine has not showed effect on the DNA. This indicates that caffeine does not eliminate the oxidant action of SnCl{sub 2} and does not promote break in isolated DNA plasmid. (author)

Real-time Tracking of DNA Fragment Separation by Smartphone.

Science.gov (United States)

Tao, Chunxian; Yang, Bo; Li, Zhenqing; Zhang, Dawei; Yamaguchi, Yoshinori

2017-06-01

Slab gel electrophoresis (SGE) is the most common method for the separation of DNA fragments; thus, it is broadly applied to the field of biology and others. However, the traditional SGE protocol is quite tedious, and the experiment takes a long time. Moreover, the chemical consumption in SGE experiments is very high. This work proposes a simple method for the separation of DNA fragments based on an SGE chip. The chip is made by an engraving machine. Two plastic sheets are used for the excitation and emission wavelengths of the optical signal. The fluorescence signal of the DNA bands is collected by smartphone. To validate this method, 50, 100, and 1,000 bp DNA ladders were separated. The results demonstrate that a DNA ladder smaller than 5,000 bp can be resolved within 12 min and with high resolution when using this method, indicating that it is an ideal substitute for the traditional SGE method.

Auto-assembly of nanometer thick, water soluble layers of plasmid DNA complexed with diamines and basic amino acids on graphite: Greatest DNA protection is obtained with arginine

Energy Technology Data Exchange (ETDEWEB)

Khalil, T.T.; Boulanouar, O. [Université de Bourgogne Franche-Comté, UMR CNRS 6249 Chrono-Environnement, 16, Route de Gray, 25030 Besançon Cedex (France); Heintz, O. [Université de Bourgogne Franche-Comté, UMR CNRS 6303Laboratoire Interdisciplinaire Carnot de Bourgogne, DTAI/Centre de micro/nano caractérisation, 9 Av. A. Savary, BP 47870, F-21078 DIJON Cedex (France); Fromm, M., E-mail: michel.fromm@univ-fcomte.fr [Université de Bourgogne Franche-Comté, UMR CNRS 6249 Chrono-Environnement, 16, Route de Gray, 25030 Besançon Cedex (France)

2017-02-01

We have investigated the ability of diamines as well as basic amino acids to condense DNA onto highly ordered pyrolytic graphite with minimum damage after re-dissolution in water. Based on a bibliographic survey we briefly summarize DNA binding properties with diamines as compared to basic amino acids. Thus, solutions of DNA complexed with these linkers were drop-cast in order to deposit ultra-thin layers on the surface of HOPG in the absence or presence of Tris buffer. Atomic Force Microscopy analyses showed that, at a fixed ligand-DNA mixing ratio of 16, the mean thickness of the layers can be statistically predicted to lie in the range 0–50 nm with a maximum standard deviation ± 6 nm, using a simple linear law depending on the DNA concentration. The morphology of the layers appears to be ligand-dependent. While the layers containing diamines present holes, those formed in the presence of basic amino acids, except for lysine, are much more compact and dense. X-ray Photoelectron Spectroscopy measurements provide compositional information indicating that, compared to the maximum number of DNA sites to which the ligands may bind, the basic amino acids Arg and His are present in large excess. Conservation of the supercoiled topology of the DNA plasmids was studied after recovery of the complex layers in water. Remarkably, arginine has the best protection capabilities whether Tris was present or not in the initial solution. - Highlights: • Characterization of nanometer scaled layers composed of pUC21 plasmid DNA • Relation between nature of the ligand and structure of the layers • Capacities of the ligands to protect plasmids from strand break depending on their nature.

Natural plasmid transformation in a high-frequency-of transformation marine Vibrio strain

International Nuclear Information System (INIS)

Frischer, M.E.; Thurmond, J.M.; Paul, J.H.

1990-01-01

The estuarine bacterium Vibrio strain DI-9 has been shown to be naturally transformable with both broad host range plasmid multimers and homologous chromosomal DNA at average frequencies of 3.5 x 10 -9 and 3.4 x 10 -7 transformants per recipient, respectively. Growth of plasmid transformants in nonselective medium resulted in cured strains that transformed 6 to 42,857 times more frequently than the parental strain, depending on the type of transforming DNA. These high-frequency-of-transformation (HfT) strains were transformed at frequencies ranging from 1.1 x 10 -8 to 1.3 x 10 -4 transformants per recipient with plasmid DNA and at an average frequency of 8.3 x 10 -5 transformants per recipient with homologous chromosomal DNA. The highest transformation frequencies were observed by using multimers of an R1162 derivative carrying the transposon Tn5 (pQSR50). Probing of total DNA preparations from one of the cured strains demonstrated that no plasmid DNA remained in the cured strains which may have provided homology to the transforming DNA. All transformants and cured strains could be differentiated from the parental strains by colony morphology. DNA binding studies indicated that late-log-phase HfT strains bound [ 3 H]bacteriophage lambda DNA 2.1 times more rapidly than the parental strain. These results suggest that the original plasmid transformation event of strain DI-9 was the result of uptake and expression of plasmid DNA by a competent mutant (HfT strain). Additionally, it was found that a strain of Vibrio parahaemolyticus, USFS 3420, could be naturally transformed with plasmid DNA. Natural plasmid transformation by high-transforming mutants may be a means of plasmid acquisition by natural aquatic bacterial populations

Behavior of IncQ Plasmids in Agrobacterium tumefaciens

NARCIS (Netherlands)

Hille, Jacques; Schilperoort, Rob

1981-01-01

Inc-Q plasmids were introduced into Agrobacterium tumefuciens, by mobilization from Escherichia coli with an Inc-P plasmid, or by transformation with purified plasmid DNA. It was found that they were stably maintained. The presence of an Inc-Q plasmid did not influence tumorigenicity. These results

Excessive cytosolic DNA fragments as a potential trigger of Graves’ disease: an encrypted message sent by animal models

Directory of Open Access Journals (Sweden)

Yuqian Luo

2016-11-01

Full Text Available Graves’ hyperthyroidism is caused by autoantibodies directed against the thyroid stimulating hormone receptor (TSHR that mimic the action of TSH. The establishment of Graves’ hyperthyroidism in experimental animals has proven to be an important approach to dissect the mechanisms of self-tolerance breakdown that lead to the production of thyroid-stimulating TSHR autoantibodies (TSAbs. ‘Shimojo’s model was the first successful Graves’ animal model, wherein immunization with fibroblasts cells expressing TSHR and a major histocompatibility complex (MHC class II molecule, but not either alone, induced TSAb production in AKR/N (H-2k mice. This model highlights the importance of coincident MHC class II expression on TSHR-expressing cells in the development of Graves’ hyperthyroidism. These data are also in agreement with the observation that Graves’ thyrocytes often aberrantly express MHC class II antigens via mechanisms that remain unclear. Our group demonstrated that cytosolic self-genomic DNA fragments derived from sterile injured cells can induce aberrant MHC class II expression and production of multiple inflammatory cytokines and chemokines in thyrocytes in vitro, suggesting that severe cell injury may initiate immune responses in a way that is relevant to thyroid autoimmunity mediated by cytosolic DNA signaling. Furthermore, more recent successful Graves’ animal models were primarily established by immunizing mice with TSHR-expressing plasmids or adenovirus. In these models, double-stranded DNA vaccine contents presumably exert similar immune-activating effect in cells at inoculation sites and thus might pave the way toward successful Graves’ animal models. This review focuses on evidence suggesting that cell injury-derived self-DNA fragments could act as Graves’ disease triggers.

Gene Transfer into the Lung by Nanoparticle Dextran-Spermine/Plasmid DNA Complexes

Directory of Open Access Journals (Sweden)

Syahril Abdullah

2010-01-01

Full Text Available A novel cationic polymer, dextran-spermine (D-SPM, has been found to mediate gene expression in a wide variety of cell lines and in vivo through systemic delivery. Here, we extended the observations by determining the optimal conditions for gene expression of D-SPM/plasmid DNA (D-SPM/pDNA in cell lines and in the lungs of BALB/c mice via instillation delivery. In vitro studies showed that D-SPM could partially protect pDNA from degradation by nuclease and exhibited optimal gene transfer efficiency at D-SPM to pDNA weight-mixing ratio of 12. In the lungs of mice, the levels of gene expression generated by D-SPM/pDNA are highly dependent on the weight-mixing ratio of D-SPM to pDNA, amount of pDNA in the complex, and the assay time postdelivery. Readministration of the complex at day 1 following the first dosing showed no significant effect on the retention and duration of gene expression. The study also showed that there was a clear trend of increasing size of the complexes as the amount of pDNA was increased, where the sizes of the D-SPM/pDNA complexes were within the nanometer range.

Antimicrobial susceptibility pattern and plasmid-mediated ...

African Journals Online (AJOL)

negative Staphylococci (CoNS) were isolated from clinical samples and isolates subjected to antibiotic susceptibility testing, plasmid curing and plasmid DNA isolation. Result: The highest percentages isolates were recovered from urine samples and ...

DNA damage produced by exposure of supercoiled plasmid DNA to high- and low-LET ionizing radiation: Effects of hydroxyl radical quenchers. DNA breakage, neutrons, OH radicals

International Nuclear Information System (INIS)

Peak, J.G.; Ito, T.; Peak, M.J.; Robb, F.T.

1994-01-01

A supercoiled plasmid of 7300 base pairs was isolated and exposed in an aqueous environment to 60 Co γ rays and JANUS 0.85 MeV fission-spectrum neutrons. Dose responses for the production of single-strand breaks (SSBs), double-strand breaks (DSBs) and alkali-labile sites (ALSs) were compared with computations made from the conversion of the supercoil to its relaxed and linear forms. The relative biological effectiveness (RBE) for production of SSBs and DSBs was similar to that previously measured in the cellular environment. The RBE for destruction of genetic transforming activity of M13 viral DNA followed that for DNA damage. This is in contrast to the situation for biological effects such as lethality, mutagenesis, and cellular transformation measured in mammalian cells, where the RBE values are reversed. The role of hydroxyl (OH) radical in DNA damage induction by neutrons was investigated by exposure of plasmid in the presence of known quenchers of this species. Of four quenchers tested, all were able to reduce the yields of both SSBs and DSBs. These findings are consistent with a model for SSB and DSB induction by high linear energy transfer that involves OH radical mediation

Subacute Low Dose Nerve Agent Exposure Causes DNA Fragmentation in Guinea Pig Leukocytes

Science.gov (United States)

2005-10-01

1 SUBACUTE LOW DOSE NERVE AGENT EXPOSURE CAUSES DNA FRAGMENTATION IN GUINEA PIG LEUKOCYTES. Jitendra R. Dave1, John R. Moffett1, Sally M...DNA fragmentation in blood leukocytes from guinea pigs by ‘Comet’ assay after exposure to soman at doses ranging from 0.1LD50 to 0.4 LD50, once per...computer. Data obtained for exposure to soman demonstrated significant increases in DNA fragmentation in circulating leukocytes in CWNA treated guinea pigs as

SPERM MORPHOLOGICAL ABNORMALITIES AS INDICATORS OF DNA FRAGMENTATION AND FERTILIZATION IN ASSISTED REPRODUCTION

Directory of Open Access Journals (Sweden)

Barbara Dariš

2018-02-01

Full Text Available Background. To determine the relationship between sperm morphological abnormalities, DNA fragmentation and fertilization rate in IVF and ICSI. Methods. Sperm samples from 10 IVF and 20 ICSI cycles were analyzed. Morphology was assessed according to strict criteria, and DNA fragmentation was measured by terminal deoxynucleotidyl transferase (TdT-mediated fluorescein-dUTP nick end labelling (TUNEL using a flow cytometry. Results. There was a significant difference in the amount of morphological abnormalities between sperm samples with low (< 20 % and high (≥ 20 % degree of DNA fragmentation. The percentages of amorphous heads (10 vs. 4 % and overall head abnormalities (42 vs. 30 % were significantly higher in sperm samples with elevated degree of DNA fragmentation. No correlation was found between sperm DNA fragmentation and fertilization rate after IVF and ICSI. When the predominant morphological abnormality in sperm samples was determined, a negative correlation was found between the percentage of spermatozoa with elongated heads and fertilization rate in ICSI (r = –0.45, P < 0.05. The fertilization rate after IVF was lower in the case of acrosomal abnormalities (35.3 %, compared to the cases of other predominant morphological abnormalities. Conclusions. Head abnormalities, especially amorphous heads, are related to elevated degree of DNA fragmentation. Predominant abnormal form in sperm samples, such as elongated heads and acrosomal abnormalities, may affect fertilization in ART.

Nondetectability of restriction fragments and independence of DNA fragment sizes within and between loci in RFLP typing of DNA

Energy Technology Data Exchange (ETDEWEB)

Chakraborty, R.; Zhong, Y.; Jin, L. (Univ. of Texas Health Science Center, Houston, TX (United States)); Budowle, B. (FBI Academy, Quantico, VA (United States))

1994-08-01

The authors provide experimental evidence showing that, during the restriction-enzyme digestion of DNA samples, some of the HaeIII-digested DNA fragments are small enough to prevent their reliable sizing on a Southern gel. As a result of such nondetectability of DNA fragments, individuals who show a single-band DNA profile at a VNTR locus may not necessarily be true homozygotes. In a population database, when the presence of such nondetectable alleles is ignored, they show that a pseudodependence of alleles within as well as across loci may occur. Using a known statistical method, under the hypothesis of independence of alleles within loci, they derive an efficient estimate of null allele frequency, which may be subsequently used for testing allelic independence within and across loci. The estimates of null allele frequencies, thus derived, are shown to agree with direct experimental data on the frequencies of HaeIII-null alleles. Incorporation of null alleles into the analysis of the forensic VNTR database suggests that the assumptions of allelic independence within and between loci are appropriate. In contrast, a failure to incorporate the occurrence of null alleles would provide a wrong inference regarding the independence of alleles within and between loci. 47 refs., 2 figs., 4 tabs.

Plasmid DNA is released from nanosized acicular material surface by low molecular weight oligonucleotides: exogenous plasmid acquisition mechanism for penetration intermediates based on the Yoshida effect.

Science.gov (United States)

Yoshida, N; Ide, K

2008-10-01

When a colloidal solution consisting of nanosized acicular material and bacterial cells is stimulated with sliding friction at the interface between the hydrogel and interface-forming material where the frictional coefficient increases rapidly, the nanosized acicular material accompanying the bacterial cells forms a penetration intermediate. This effect is known as the Yoshida effect in honor of its discoverer. Through the Yoshida effect, a novel property in which penetration intermediates incorporate exogenous plasmid DNA has been identified. This report proposes a possible mechanism for exogenous plasmid acquisition by penetration intermediates in the Yoshida effect. Escherichia coli cells, pUC18, and chrysotile were used as recipient cells, plasmid DNA, and nanosized acicular material, respectively. Even when repeatedly washing the mixture consisting of pUC18 and chrysotile, transformation efficiency by pUC18 was stable. Accordingly, pUC18 adsorbed onto chrysotile was introduced into recipient E. coli cells. At saturation, the amount of pUC18 adsorbed onto chrysotile was 0.8-1.2 microg/mg. To investigate whether pUC18 adsorbed on chrysotile is replicated by polymerase, polymerase chain reaction (PCR) was carried out with the chrysotile. Amplification of the beta-lactamase gene coded in pUC18, which was adsorbed onto chrysotile, was strongly inhibited. This suggests that DNA adsorbed onto chrysotile is not replicated in vivo. When we searched for substances to release pUC18 adsorbed onto chrysotile, we found that a 300-bp single- or double-stranded segment of DNA releases pUC18 from chrysotile. Competitive adsorption onto chrysotile between double-stranded DNA and pUC18 was then examined through the Yoshida effect. The 310- and 603-bp double-stranded nucleotides caused 50% competitive inhibition at the same molar ratio with pUC18. Hence, the adsorbed region of pUC18 is about 300 bp in length. As the culture period for recipient cells increases, transformation

Efficient production of antibody Fab fragment by transient gene expression in insect cells.

Science.gov (United States)

Mori, Keita; Hamada, Hirotsugu; Ogawa, Takafumi; Ohmuro-Matsuyama, Yuki; Katsuda, Tomohisa; Yamaji, Hideki

2017-08-01

Transient gene expression allows a rapid production of diverse recombinant proteins in early-stage preclinical and clinical developments of biologics. Insect cells have proven to be an excellent platform for the production of functional recombinant proteins. In the present study, the production of an antibody Fab fragment by transient gene expression in lepidopteran insect cells was investigated. The DNA fragments encoding heavy-chain (Hc; Fd fragment) and light-chain (Lc) genes of an Fab fragment were individually cloned into the plasmid vector pIHAneo, which contained the Bombyx mori actin promoter downstream of the B. mori nucleopolyhedrovirus (BmNPV) IE-1 transactivator and the BmNPV HR3 enhancer for high-level expression. Trichoplusia ni BTI-TN-5B1-4 (High Five) cells were co-transfected with the resultant plasmid vectors using linear polyethyleneimine. When the transfection efficiency was evaluated, a plasmid vector encoding an enhanced green fluorescent protein (EGFP) gene was also co-transfected. Transfection and culture conditions were optimized based on both the flow cytometry of the EGFP expression in transfected cells and the yield of the secreted Fab fragments determined by enzyme-linked immunosorbent assay (ELISA). Under optimal conditions, a yield of approximately 120 mg/L of Fab fragments was achieved in 5 days in a shake-flask culture. Transient gene expression in insect cells may offer a promising approach to the high-throughput production of recombinant proteins. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Biological activity of cloned mammary tumor virus DNA fragments that bind purified glucocorticoid receptor protein in vitro

International Nuclear Information System (INIS)

Yamamoto, K.R.; Payvar, F.; Firestone, G.L.; Maler, B.A.; Wrange, O.; Carlstedt-Duke, J.; Gustafsson, J.A.; Chandler, V.L.; Karolinska Institutet, Stockholm, Sweden)

1983-01-01

To test whether high-affinity receptor:DNA interactions can be correlated with receptor effects on promoter function in vivo, we have mapped in greater detail the receptor-binding regions on murine mammary tumor virus DNA, using both nitrocellulose-filter binding and electron microscopy. Recombinant plasmids bearing these receptor-binding domains have been transfected into cultured cells, and the expression of the plasmid sequences has been monitored for hormonal regulation. The results are considered in terms of a speculative proposal that the glucocorticoid receptor may effect changes in promoter activity via specific alteration of chromatin and/or DNA structure. 37 references, 6 figures, 2 tables

Replication of each copy of the yeast 2 micron DNA plasmid occurs during the S phase.

Science.gov (United States)

Zakian, V A; Brewer, B J; Fangman, W L

1979-08-01

Saccharomyces cerevisiae contains 50-100 copies per cell of a circular plasmid called 2 micron DNA. Replication of this DNA was studied in two ways. The distribution of replication events among 2 micron DNA molecules was examined by density transfer experiments with asynchronous cultures. The data show that 2 micron DNA replication is similar to chromosomal DNA replication: essentially all 2 micron duplexes were of hybrid density at one cell doubling after the density transfer, with the majority having one fully dense strand and one fully light strand. The results show that replication of 2 micron DNA occurs by a semiconservative mechanism where each of the plasmid molecules replicates once each cell cycle. 2 micron DNA is the only known example of a multiple-copy, extrachromosomal DNA in which every molecule replicates in each cell cycle. Quantitative analysis of the data indicates that 2 micron DNA replication is limited to a fraction of the cell cycle. The period in the cell cycle when 2 micron DNA replicates was examined directly with synchronous cell cultures. Synchronization was accomplished by sequentially arresting cells in G1 phase using the yeast pheromone alpha-factor and incubating at the restrictive temperature for a cell cycle (cdc 7) mutant. Replication was monitored by adding 3H-uracil to cells previously labeled with 14C-uracil, and determining the 3H/14C ratio for purified DNA species. 2 micron DNA replication did not occur during the G1 arrest periods. However, the population of 2 micron DNA doubled during the synchronous S phase at the permissive temperature, with most of the replication occurring in the first third of S phase. Our results indicate that a mechanism exists which insures that the origin of replication of each 2 micron DNA molecule is activated each S phase. As with chromosomal DNA, further activation is prevented until the next cell cycle. We propose that the mechanism which controls the replication initiation of each 2 micron DNA

Longevity of rAAV vector and plasmid DNA in blood after intramuscular injection in nonhuman primates: implications for gene doping.

Science.gov (United States)

Ni, W; Le Guiner, C; Gernoux, G; Penaud-Budloo, M; Moullier, P; Snyder, R O

2011-07-01

Legitimate uses of gene transfer technology can benefit from sensitive detection methods to determine vector biodistribution in pre-clinical studies and in human clinical trials, and similar methods can detect illegitimate gene transfer to provide sports-governing bodies with the ability to maintain fairness. Real-time PCR assays were developed to detect a performance-enhancing transgene (erythropoietin, EPO) and backbone sequences in the presence of endogenous cellular sequences. In addition to developing real-time PCR assays, the steps involved in DNA extraction, storage and transport were investigated. By real-time PCR, the vector transgene is distinguishable from the genomic DNA sequence because of the absence of introns, and the vector backbone can be identified by heterologous gene expression control elements. After performance of the assays was optimized, cynomolgus macaques received a single dose by intramuscular (IM) injection of plasmid DNA, a recombinant adeno-associated viral vector serotype 1 (rAAV1) or a rAAV8 vector expressing cynomolgus macaque EPO. Macaques received a high plasmid dose intended to achieve a significant, but not life-threatening, increase in hematocrit. rAAV vectors were used at low doses to achieve a small increase in hematocrit and to determine the limit of sensitivity for detecting rAAV sequences by single-step PCR. DNA extracted from white blood cells (WBCs) was tested to determine whether WBCs can be collaterally transfected by plasmid or transduced by rAAV vectors in this context, and can be used as a surrogate marker for gene doping. We demonstrate that IM injection of a conventional plasmid and rAAV vectors results in the presence of DNA that can be detected at high levels in blood before rapid elimination, and that rAAV genomes can persist for several months in WBCs.

Radiation-chemical discussion on inverse dose-rate effect observed in radiation-induced strand breaks of plasmid DNA

International Nuclear Information System (INIS)

Masuda, Takahiro

1994-01-01

Experimental results of inverse dose-rate effect, so-called Kada Effects, which was published by Takakura and her coworkers on radiation-induced strand breaks of plasmid DNA in aerated aqueous solution, have been kinetically analyzed and discussed on the basis of radiation chemistry. the kinetic analysis indicates that there are two possible mechanisms; 1) equilibrium mixture of O 2 - and HO 2 is responsible for strand breaks of DNA, and 2) peroxyl radical produced from citrate is effective for the strand breaks. However, the detailed kinetic analysis revealed that the latter is improbable because unimolecular decay of the peroxyl radical must be assumed to be negligible for its participation despite fast decay of analogous organic peroxyl radicals. The analysis has also given 9.93±0.10 dm 3 mol -1 s -1 per nucleotide unit, which corresponds to 7.62 x 10 4 dm 3 mol -1 s -1 per DNA molecule, as the rate constant for the reaction of the equilibrium mixture with plasmid pBR 322 DNA. Furthermore the probability that the reaction of the mixture with a nucleotide unit of DNA leads to strand breaks was obtained to be 3.36 x 10 -3 for gamma-irradiated system and 1.98 x 10 -3 for beta-irradiated system, respectively. (author)

Analysis of the mycoplasma genome by recombinant DNA technology

DEFF Research Database (Denmark)

Christiansen, C; Frydenberg, Jane; Christiansen, G

1984-01-01

A library of DNA fragments from Mycoplasma sp. strain PG50 has been made in the vector pBR325. Analysis in Escherichia coli minicells of randomly picked clones from this library demonstrated that many plasmids can promote synthesis of mycoplasma protein in the E. coli genetic background. Screening....... The DNA sequence of 16S rRNA and the surrounding control regions has been determined....

Implication of the E. coli K12 uvrA and recA genes in the repair of 8-methoxypsoralen-induced mono adducts and crosslinks on plasmid DNA

International Nuclear Information System (INIS)

Paramio, J.M.; Bauluz, C.; Vidania, R. de

1986-01-01

Genotoxicity of psoralen damages on plasmid DNA has been studied. pBR322 DNA was randomly modified with several concentrations of 8-methoxypsoralen plus 365 nm-UV light. After transformation into E. coli strains (wild-type, uvrA and recA) plasmid survival and mutagenesis were analyzed. To study the influence of the SOS response on plasmid recovery, preirradiation of the cells was performed. In absence of cell preirradiation, crosslinks were not repaired in any strain. Mono adducts were also lethal but in part removed by the excision-repair pathway. Preirradiation of the cells significantly. increased plasmid recovery in recA+ celia. In uvrA- only the mutagenic pathway seemed to be involved in the repair of the damaged DNA. Wild type strain showed the highest increase in plasmid survival, involving the repair of mono adducts and some fraction of crosslinks mainly through an error-free repair pathway. This suggests an enhancement of the excision repair promoted by the induction of SOS functions. (Author) 32 refs

Reconstructing the complex evolutionary history of mobile plasmids in red algal genomes

Science.gov (United States)

Lee, JunMo; Kim, Kyeong Mi; Yang, Eun Chan; Miller, Kathy Ann; Boo, Sung Min; Bhattacharya, Debashish; Yoon, Hwan Su

2016-01-01

The integration of foreign DNA into algal and plant plastid genomes is a rare event, with only a few known examples of horizontal gene transfer (HGT). Plasmids, which are well-studied drivers of HGT in prokaryotes, have been reported previously in red algae (Rhodophyta). However, the distribution of these mobile DNA elements and their sites of integration into the plastid (ptDNA), mitochondrial (mtDNA), and nuclear genomes of Rhodophyta remain unknown. Here we reconstructed the complex evolutionary history of plasmid-derived DNAs in red algae. Comparative analysis of 21 rhodophyte ptDNAs, including new genome data for 5 species, turned up 22 plasmid-derived open reading frames (ORFs) that showed syntenic and copy number variation among species, but were conserved within different individuals in three lineages. Several plasmid-derived homologs were found not only in ptDNA but also in mtDNA and in the nuclear genome of green plants, stramenopiles, and rhizarians. Phylogenetic and plasmid-derived ORF analyses showed that the majority of plasmid DNAs originated within red algae, whereas others were derived from cyanobacteria, other bacteria, and viruses. Our results elucidate the evolution of plasmid DNAs in red algae and suggest that they spread as parasitic genetic elements. This hypothesis is consistent with their sporadic distribution within Rhodophyta. PMID:27030297

[Construction and identification of eukaryotic plasmid pGC-silencer-U6/Neo/GFP/ABCG2].

Science.gov (United States)

Yu, Yanping; Zhang, Song; Kong, Weijia

2010-09-01

To construct three short hairpin RNA (shRNA) interference expression plasmid vectors of human ABCG2 gene, to assay the expression of ABCG2 in a human nasopharyngeal carcinoma (NPC) cell line, CEN-2 cell line, and to detect the RNAi effect of shRNA. Targeting ABCG2 gene sequence, three plasmid expression vectors coding for shRNA and a control vector containing random DNA fragment were constructed. The recombinant plasmids were amplified in Ecoli. DH5 and then identified by restriction digestion, PCR and sequencing. The recombinant plasmids were transfected into CEN-2 cells. ABCG2 expression was assayed by real-time quantitative PCR and Western blot. The construction of pGC-silencer-U6/Neo/GFP/ABCG2 was succeed. The shRNA plasmids significantly down-regulated the ABCG2 expression in CEN-2 cells, at both mRNA level and protein level. Recombinant plasmid 1 had the strongest effect compared with plasmids 2 and 3 (P < 0.05), with an inhibition ratio of 75% at the mRNA level and 68% at the protein level. pGC-silencer-U6/Neo/GFP/ABCG2 has been successfully constructed and it can down-regulate ABCG2 expression after transfected into CEN-2 cells, which could help further studies of ABCG2 functions CEN-2 cell line and contribute to the NPC gene therapy.

PlasmaDNA: a free, cross-platform plasmid manipulation program for molecular biology laboratories

Directory of Open Access Journals (Sweden)

Rainy Jeffrey

2007-09-01

Full Text Available Abstract Background Most molecular biology experiments, and the techniques associated with this field of study, involve a great deal of engineering in the form of molecular cloning. Like all forms of engineering, perfect information about the starting material is crucial for successful completion of design and strategies. Results We have generated a program that allows complete in silico simulation of the cloning experiment. Starting with a primary DNA sequence, PlasmaDNA looks for restriction sites, open reading frames, primer annealing sequences, and various common domains. The databases are easily expandable by the user to fit his most common cloning needs. PlasmaDNA can manage and graphically represent multiple sequences at the same time, and keeps in memory the overhangs at the end of the sequences if any. This means that it is possible to virtually digest fragments, to add the digestion products to the project, and to ligate together fragments with compatible ends to generate the new sequences. Polymerase Chain Reaction (PCR fragments can also be virtually generated using the primer database, automatically adding to the fragments any 5' extra sequences present in the primers. Conclusion PlasmaDNA is a program available both on Windows and Apple operating systems, designed to facilitate molecular cloning experiments by building a visual map of the DNA. It then allows the complete planning and simulation of the cloning experiment. It also automatically updates the new sequences generated in the process, which is an important help in practice. The capacity to maintain multiple sequences in the same file can also be used to archive the various steps and strategies involved in the cloning of each construct. The program is freely available for download without charge or restriction.

Dendritic cell mediated delivery of plasmid DNA encoding LAMP/HIV-1 Gag fusion immunogen enhances T cell epitope responses in HLA DR4 transgenic mice.

Directory of Open Access Journals (Sweden)

Gregory G Simon

2010-01-01

Full Text Available This report describes the identification and bioinformatics analysis of HLA-DR4-restricted HIV-1 Gag epitope peptides, and the application of dendritic cell mediated immunization of DNA plasmid constructs. BALB/c (H-2d and HLA-DR4 (DRA1*0101, DRB1*0401 transgenic mice were immunized with immature dendritic cells transfected by a recombinant DNA plasmid encoding the lysosome-associated membrane protein-1/HIV-1 Gag (pLAMP/gag chimera antigen. Three immunization protocols were compared: 1 primary subcutaneous immunization with 1x10(5 immature dendritic cells transfected by electroporation with the pLAMP/gag DNA plasmid, and a second subcutaneous immunization with the naked pLAMP/gag DNA plasmid; 2 primary immunization as above, and a second subcutaneous immunization with a pool of overlapping peptides spanning the HIV-1 Gag sequence; and 3 immunization twice by subcutaneous injection of the pLAMP/gag DNA plasmid. Primary immunization with pLAMP/gag-transfected dendritic cells elicited the greatest number of peptide specific T-cell responses, as measured by ex vivo IFN-gamma ELISpot assay, both in BALB/c and HLA-DR4 transgenic mice. The pLAMP/gag-transfected dendritic cells prime and naked DNA boost immunization protocol also resulted in an increased apparent avidity of peptide in the ELISpot assay. Strikingly, 20 of 25 peptide-specific T-cell responses in the HLA-DR4 transgenic mice contained sequences that corresponded, entirely or partially to 18 of the 19 human HLA-DR4 epitopes listed in the HIV molecular immunology database. Selection of the most conserved epitope peptides as vaccine targets was facilitated by analysis of their representation and variability in all reported sequences. These data provide a model system that demonstrates a the superiority of immunization with dendritic cells transfected with LAMP/gag plasmid DNA, as compared to naked DNA, b the value of HLA transgenic mice as a model system for the identification and evaluation

Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry

Energy Technology Data Exchange (ETDEWEB)

Werner, James H. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Larson, Erica J. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Goodwin, Peter M. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Ambrose, W. Patrick [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Keller, Richard A. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States)

2000-06-01

We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America.

Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry

International Nuclear Information System (INIS)

Werner, James H.; Larson, Erica J.; Goodwin, Peter M.; Ambrose, W. Patrick; Keller, Richard A.

2000-01-01

We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America

Fragmentation of sperm DNA using the TUNEL method.

Science.gov (United States)

Chenlo, P H; Curi, S M; Pugliese, M N; Ariagno, J I; Sardi-Segovia, M; Furlan, M J; Repetto, H E; Zeitler, E; Cohen, M; Mendeluk, G R

2014-11-01

To establish the validity of the TUNEL assay in determining sperm DNA fragmentation, the relationship between the degree of fragmentation and the seminal parameters and the sample needed to conduct the test. We used semen samples from healthy fertile men (n=33), patients who consulted for infertility with a prescription for the TUNEL assay (n=77) and patients with intracytoplasmic sperm injection failure (n=20), analyzed according to the 2010 WHO. The TUNEL/propidium iodide test was performed by flow cytometry, on baseline and post-swim-up samples. The cutoff value for the TUNEL assay (ROC curves) was 26%, with a sensitivity and specificity of 85% and 89%, respectively. The pre-swim-up and post-swim-up medians of the results from the TUNEL assay showed no significant differences (17.0% vs. 12.9%, respectively). However, 39.1% of the samples showed a difference greater than 15 in absolute value between the results of the baseline and post-swim-up TUNEL assays. The linear correlation study of the morphology, mobility and vitality using the post-swim-up TUNEL assay showed a greater correlation than preselection, with significant results (r: -0.394, P<.0001; r: -0.461, P<.0001; r: -0.526, P<.0001). The TUNEL assay is a valid test for clinical use. DNA fragmentation is a factor independent from traditional semen tests. We found a greater susceptibility to damage generated in the laboratory procedures in the samples with lower quality. The sample of choice for evaluating DNA fragmentation will depend on whether the clinician is treating a natural or assisted fertilization. Copyright © 2014 AEU. Published by Elsevier Espana. All rights reserved.

Electrostatic field of the large fragment of Escherichia coli DNA polymerase I.

Science.gov (United States)

Warwicker, J; Ollis, D; Richards, F M; Steitz, T A

1985-12-05

The electrostatic field of the large fragment of Escherichia coli DNA polymerase I (Klenow fragment) has been calculated by the finite difference procedure on a 2 A grid. The potential field is substantially negative at physiological pH (reflecting the net negative charge at this pH). The largest regions of positive potential are in the deep crevice of the C-terminal domain, which is the proposed binding site for the DNA substrate. Within the crevice, the electrostatic potential has a partly helical form. If the DNA is positioned to fulfil stereochemical requirements, then the positive potential generally follows the major groove and (to a lesser extent) the negative potential is in the minor groove. Such an arrangement could stabilize DNA configurations related by screw symmetry. The histidine residues of the Klenow fragment give the positive field of the groove a sensitivity to relatively small pH changes around neutrality. We suggest that the histidine residues could change their ionization states in response to DNA binding, and that this effect could contribute to the protein-DNA binding energy.

Mitochondrial DNA content in embryo culture medium is significantly associated with human embryo fragmentation.

Science.gov (United States)

Stigliani, S; Anserini, P; Venturini, P L; Scaruffi, P

2013-10-01

Is the amount of cell-free DNA released by human embryos into culture medium correlated with embryo morphological features? The mitochondrial DNA (mtDNA) content of culture medium is significantly associated with the fragmentation rate on Days 2 and 3 of embryo development, whether the oocyte came from women ≤ 35 or >35 years old. Cellular fragmentation is often utilized as one of the morphological parameters for embryo quality assessment. The amount of cellular fragments is considered to be an important morphological parameter for embryo implantation potential. It has been hypothesized that fragments are apoptotic bodies or anuclear cytoplasmatic pieces of blastomeres, although no definitive conclusion has been drawn about their pathogenesis. Human fertilized oocytes were individually cultured from Day 1 to Days 2 and 3. A total of 800 samples (166 spent media from Day 2 and 634 from Day 3) were enrolled into the present study. Double-stranded DNA (dsDNA) was quantified in 800 spent embryo culture media by Pico Green dye fluorescence assay. After DNA purification, genomic DNA (gDNA) and mtDNA were profiled by specific quantitative PCR. Statistical analyses defined correlations among DNA contents, embryo morphology and maternal age. Different independent tests confirmed the presence of DNA into embryo culture medium and, for the first time, we demonstrate that both gDNA and mtDNA are detectable in the secretome. The amount of DNA is larger in embryos with bad quality cleavage compared with high-grade embryos, suggesting that the DNA profile of culture medium is an objective marker for embryo quality assessment. In particular, DNA profiles are significantly associated with fragmentation feature (total dsDNA: P = 0.0010; mtDNA; P = 0.0247) and advanced maternal age. It is necessary to establish whether DNA profiling of spent embryo culture medium is a robust onsite test that can improve the prediction of blastulation, implantation and/or pregnancy rate. The

AAVS1-Targeted Plasmid Integration in AAV Producer Cell Lines.

Science.gov (United States)

Luo, Yuxia; Frederick, Amy; Martin, John M; Scaria, Abraham; Cheng, Seng H; Armentano, Donna; Wadsworth, Samuel C; Vincent, Karen A

2017-06-01

Adeno-associated virus (AAV) producer cell lines are created via transfection of HeLaS3 cells with a single plasmid containing three components (the vector sequence, the AAV rep and cap genes, and a selectable marker gene). As this plasmid contains both the cis (Rep binding sites) and trans (Rep protein encoded by the rep gene) elements required for site-specific integration, it was predicted that plasmid integration might occur within the AAVS1 locus on human chromosome 19 (chr19). The objective of this study was to investigate whether integration in AAVS1 might be correlated with vector yield. Plasmid integration sites within several independent cell lines were assessed via Southern, fluorescence in situ hybridization (FISH) and PCR analyses. In the Southern analyses, the presence of fragments detected by both rep- and AAVS1-specific probes suggested that for several mid- and high-producing lines, plasmid DNA had integrated into the AAVS1 locus. Analysis with puroR and AAVS1-specific probes suggested that integration in AAVS1 was a more widespread phenomenon. High-producing AAV2-secreted alkaline phosphatase (SEAP) lines (masterwell 82 [MW82] and MW278) were evaluated via FISH using probes specific for the plasmid, AAVS1, and a chr19 marker. FISH analysis detected two plasmid integration sites in MW278 (neither in AAVS1), while a total of three sites were identified in MW82 (two in AAVS1). An inverse PCR assay confirmed integration within AAVS1 for several mid- and high-producing lines. In summary, the FISH, Southern, and PCR data provide evidence of site-specific integration of the plasmid within AAVS1 in several AAV producer cell lines. The data also suggest that integration in AAVS1 is a general phenomenon that is not necessarily restricted to high producers. The results also suggest that plasmid integration within the AAVS1 locus is not an absolute requirement for a high vector yield.

Size effect on transfection and cytotoxicity of nanoscale plasmid DNA/polyethyleneimine complexes for aerosol gene delivery

Energy Technology Data Exchange (ETDEWEB)

Hoon Byeon, Jeong, E-mail: jbyeon@purdue.edu [Department of Chemistry, Purdue University, West Lafayette, Indiana 47907 (United States); Kim, Jang-Woo, E-mail: jwkim@hoseo.edu [Department of Digital Display Engineering, Hoseo University, Asan 336-795 (Korea, Republic of)

2014-02-03

Nanoscale plasmid DNA (pDNA)/polyethyleneimine (PEI) complexes were fabricated in the aerosol state using a nebulization system consisting of a collison atomizer and a cool-walled diffusion dryer. The aerosol fabricated nanoscale complexes were collected and employed to determine fundamental properties of the complexes, such as size, structure, surface charge, and in vitro gene transfection efficiency and cytotoxicity. The results showed that mass ratio between pDNA and PEI should be optimized to enhance gene transfection efficiency without a significant loss of cell viability. These findings may support practical advancements in the field of nonviral gene delivery.

Lipofection of plasmid DNA into human mast cell lines using lipid nanoparticles generated by microfluidic mixing.

Science.gov (United States)

Duguay, Brett A; Huang, Kate Wei-Chen; Kulka, Marianna

2018-04-18

Mast cells are important immune cells that have significant roles in mediating allergy and asthma. Therefore, studying the molecular mechanisms regulating these and other processes in mast cells is important to elucidate. Methods such as lipofection, transduction, and electroporation are often employed to dissect these mechanisms by disrupting gene expression in mast cell lines. However, as with other leukocytes, human mast cells (HMCs) are often refractory to the delivery of plasmids by lipofection. In this study, we investigated the utility of lipid nanoparticles (LNPs) containing the ionizable cationic lipids 1,2-dioleoyloxy-3-dimethylaminopropane, 1,2-dioleyloxy-3-dimethylaminopropane, or 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane for the delivery of plasmid DNA into HMC lines. Herein, we demonstrate for the first time the use of LNPs to achieve significant and reproducible levels of plasmid DNA transfection in HMC-1.2 and laboratory of allergic diseases 2 (LAD2) cells. These levels reached 53.2% and 16.0% in HMC-1.2 and LAD2 cells, respectively; and outperformed Lipofectamine 3000 in both cases. Moreover, cell viability in the transfected cells remained above 65% for all LNP conditions tested. Together, these observations illustrate the efficacy of this technique for mast cell researchers and further support the use of LNPs for nucleic acid delivery into leukocytes. ©2018 Society for Leukocyte Biology.

A feasibility study of the use of DNA fragmentation as a method for detecting irradiation of food

International Nuclear Information System (INIS)

Jones, J.L.; Bulford, B.B.

1990-07-01

The main conclusions of the study are: 1. Gamma-irradiation at doses of 1-10 kGy, as recommended for use in food irradiation, causes extensive fragmentation of DNA molecules. The degree of fragmentation increases with increasing doses of irradiation treatment. 2. Irradiation-induced DNA fragments can be rapidly separated from intact DNA using a simple ultra-filtration method. 3. The separated DNA fragments can be detected/quantified rapidly using the simple Invitrogen DNA DipStick procedure. Dot-blot assays based on probes to widely conserved genes (e.g. histone genes) may also prove of value, but will require further development. 4. As DNA is present in a wide range of foods, DNA fragmentation offers a potentially useful marker for the irradiation treatment of foods. The assay now requires assessment with DNA extracts of a variety of foods. (author)

Identification of column edges of DNA fragments by using K-means clustering and mean algorithm on lane histograms of DNA agarose gel electrophoresis images

Science.gov (United States)

Turan, Muhammed K.; Sehirli, Eftal; Elen, Abdullah; Karas, Ismail R.

2015-07-01

Gel electrophoresis (GE) is one of the most used method to separate DNA, RNA, protein molecules according to size, weight and quantity parameters in many areas such as genetics, molecular biology, biochemistry, microbiology. The main way to separate each molecule is to find borders of each molecule fragment. This paper presents a software application that show columns edges of DNA fragments in 3 steps. In the first step the application obtains lane histograms of agarose gel electrophoresis images by doing projection based on x-axis. In the second step, it utilizes k-means clustering algorithm to classify point values of lane histogram such as left side values, right side values and undesired values. In the third step, column edges of DNA fragments is shown by using mean algorithm and mathematical processes to separate DNA fragments from the background in a fully automated way. In addition to this, the application presents locations of DNA fragments and how many DNA fragments exist on images captured by a scientific camera.

Dual recombinant Lactococcus lactis for enhanced delivery of DNA vaccine reporter plasmid pPERDBY.

Science.gov (United States)

Yagnik, Bhrugu; Sharma, Drashya; Padh, Harish; Desai, Priti

2017-04-01

Food grade Lactococcus lactis has been widely used as an antigen and DNA delivery vehicle. We have previously reported the use of non-invasive L. lactis to deliver the newly constructed immunostimulatory DNA vaccine reporter plasmid, pPERDBY. In the present report, construction of dual recombinant L. lactis expressing internalin A of Listeria monocytogenes and harboring pPERDBY (LL InlA + pPERDBY) to enhance the efficiency of delivery of DNA by L. lactis is outlined. After confirmation and validation of LL InlA + pPERDBY, its DNA delivery potential was compared with previously developed non-invasive r- L. lactis::pPERDBY. The use of invasive L. lactis resulted in around threefold increases in the number of enhanced green fluorescent protein-expressing Caco-2 cells. These findings reinforce the prospective application of invasive strain of L. lactis for delivery of DNA/RNA and antigens. © 2017 The Societies and John Wiley & Sons Australia, Ltd.

Rapid assessment of the effect of ciprofloxacin on chromosomal DNA from Escherichia coli using an in situ DNA fragmentation assay

Directory of Open Access Journals (Sweden)

Gosalvez Jaime

2009-04-01

Full Text Available Abstract Background Fluoroquinolones are extensively used antibiotics that induce DNA double-strand breaks (DSBs by trapping DNA gyrase and topoisomerase IV on DNA. This effect is usually evaluated using biochemical or molecular procedures, but these are not effective at the single-cell level. We assessed ciprofloxacin (CIP-induced chromosomal DNA breakage in single-cell Escherichia coli by direct visualization of the DNA fragments that diffused from the nucleoid obtained after bacterial lysis in an agarose microgel on a slide. Results Exposing the E. coli strain TG1 to CIP starting at a minimum inhibitory concentration (MIC of 0.012 μg/ml and at increasing doses for 40 min increased the DNA fragmentation progressively. DNA damage started to be detectable at the MIC dose. At a dose of 1 μg/ml of CIP, DNA damage was visualized clearly immediately after processing, and the DNA fragmentation increased progressively with the antibiotic incubation time. The level of DNA damage was much higher when the bacteria were taken from liquid LB broth than from solid LB agar. CIP treatment produced a progressively slower rate of DNA damage in bacteria in the stationary phase than in the exponentially growing phase. Removing the antibiotic after the 40 min incubation resulted in progressive DSB repair activity with time. The magnitude of DNA repair was inversely related to CIP dose and was noticeable after incubation with CIP at 0.1 μg/ml but scarce after 10 μg/ml. The repair activity was not strictly related to viability. Four E. coli strains with identified mechanisms of reduced sensitivity to CIP were assessed using this procedure and produced DNA fragmentation levels that were inversely related to MIC dose, except those with very high MIC dose. Conclusion This procedure for determining DNA fragmentation is a simple and rapid test for studying and evaluating the effect of quinolones.

Luciferase assay to study the activity of a cloned promoter DNA fragment.

Science.gov (United States)

Solberg, Nina; Krauss, Stefan

2013-01-01

Luciferase based assays have become an invaluable tool for the analysis of cloned promoter DNA fragments, both for verifying the ability of a potential promoter fragment to drive the expression of a luciferase reporter gene in various cellular contexts, and for dissecting binding elements in the promoter. Here, we describe the use of the Dual-Luciferase(®) Reporter Assay System created by Promega (Promega Corporation, Wisconsin, USA) to study the cloned 6.7 kilobases (kb) mouse (m) Tcf3 promoter DNA fragment in mouse embryonic derived neural stem cells (NSC). In this system, the expression of the firefly luciferase driven by the cloned mTcf3 promoter DNA fragment (including transcription initiation sites) is correlated with a co-transfected control reporter expressing Renilla luciferase from the herpes simplex virus (HSV) thymidine kinase promoter. Using an internal control reporter allows to normalize the activity of the experimental reporter to the internal control, which minimizes experimental variability.

Safety and immunogenicity of an HIV-1 gag DNA vaccine with or without IL-12 and/or IL-15 plasmid cytokine adjuvant in healthy, HIV-1 uninfected adults.

Directory of Open Access Journals (Sweden)

Spyros A Kalams

Full Text Available DNA vaccines are a promising approach to vaccination since they circumvent the problem of vector-induced immunity. DNA plasmid cytokine adjuvants have been shown to augment immune responses in small animals and in macaques.We performed two first in human HIV vaccine trials in the US, Brazil and Thailand of an RNA-optimized truncated HIV-1 gag gene (p37 DNA derived from strain HXB2 administered either alone or in combination with dose-escalation of IL-12 or IL-15 plasmid cytokine adjuvants. Vaccinations with both the HIV immunogen and cytokine adjuvant were generally well-tolerated and no significant vaccine-related adverse events were identified. A small number of subjects developed asymptomatic low titer antibodies to IL-12 or IL-15. Cellular immunogenicity following 3 and 4 vaccinations was poor, with response rates to gag of 4.9%/8.7% among vaccinees receiving gag DNA alone, 0%/11.5% among those receiving gag DNA+IL-15, and no responders among those receiving DNA+high dose (1500 ug IL-12 DNA. However, after three doses, 44.4% (4/9 of vaccinees receiving gag DNA and intermediate dose (500 ug of IL-12 DNA demonstrated a detectable cellular immune response.This combination of HIV gag DNA with plasmid cytokine adjuvants was well tolerated. There were minimal responses to HIV gag DNA alone, and no apparent augmentation with either IL-12 or IL-15 plasmid cytokine adjuvants. Despite the promise of DNA vaccines, newer formulations or methods of delivery will be required to increase their immunogenicity.Clinicaltrials.gov NCT00115960 NCT00111605.

Aqueous extract of Pinus caribaea inhibits the damage induced by ultraviolet radiations, in plasmid DNA

Directory of Open Access Journals (Sweden)

Marioly Vernhes Tamayo

2017-08-01

Full Text Available Context: The incidence of solar ultraviolet radiation (UV on Earth has increased due to diminish of the ozone layer. This enviromental agent is highly genotoxic causing numerous damage in DNA molecule. Nowadays there is a growing interest in the search of compounds capable to minimize these effects. In particular, phytocompounds have been tested as excelent candidates for their antigenotoxic properties. Aims: To evaluate the protective effect of the aqueous extract of Pinus caribaea (EPC against the damage induced by the UVB and UVC radiation. Methods: The cell-free plasmid DNA assay was employed. The forms of plasmid were separated electrophoretically in agarose gel. For genotoxic and photoprotective evaluation of P. caribaea, different concentrations of the extract (0.1 – 2.0 mg/mL and exposure times were evaluated. The CPD lesions were detected enzymatically. Additionally, the transmittance of the aqueous extract against 254 nm and 312 nm was measured. Results: None of the concentrations were genotoxic in 30 min of treatment, for superior times a clastogenic effect was observed. The EPC despite inhibiting the activity of the enzyme T4 endo V, impedes photolesions formation in DNA at concentrations ≥ 0.1 mg/mL. Conclusions: The EPC has photoprotective properties, this effect could be related with its antioxidants and absorptives capacities.

Menadione-induced DNA fragmentation without 8-oxo-2'-deoxyguanosine formation in isolated rat hepatocytes

DEFF Research Database (Denmark)

Fischer-Nielsen, A; Corcoran, G B; Poulsen, H E

1995-01-01

Menadione (2-methyl-1,4-naphthoquinone) induces oxidative stress in cells causing perturbations in the cytoplasm as well as nicking of DNA. The mechanisms by which DNA damage occurs are still unclear, but a widely discussed issue is whether menadione-generated reactive oxygen species (ROS) directly...... damage DNA. In the present study, we measured the effect of menadione on formation of 7,8-dihydro-8-oxo-2'-deoxyguanosine (8-oxodG), an index of oxidative DNA base modifications, and on DNA fragmentation. Isolated hepatocytes from phenobarbital-pretreated rats were exposed to menadione, 25-400 micro......M, for 15, 90 or 180 min with or without prior depletion of reduced glutathione (GSH) by diethyl maleate. Menadione caused profound GSH depletion and internucleosomal DNA fragmentation, which was demonstrated by a prominent fragmentation ladder on agarose gel electrophoresis. We found no oxidative...

Genetic alterations of hepatocellular carcinoma by random amplified polymorphic DNA analysis and cloning sequencing of tumor differential DNA fragment

Science.gov (United States)

Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao

2005-01-01

AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039

Repair promoted by plasmid pKM101 is different from SOS repair

International Nuclear Information System (INIS)

Goze, A.; Devoret, R.

1979-01-01

In E. coli K12 bacteria carrying plasmid pKM101, prophage lambda was induced at UV doses higher than in plasmid-less parental bacteria. UV-induced reactivation per se was less effective. Bacteria with pKM101 showed no alteration in their division cycle. Plasmid PKM101 coded for a constitutive error-prone repair different from the inducible error-prone repair called SOS repair. Plasmid pKM101 protected E. coli bacteria from UV damage but slightly sensitized them to X-ray lesions. Protection against UV damage was effective in mutant bacteria deficient in DNA excision-repair provided that the recA, lexA and uvrE genes were functional. Survival of phages lambda and S13 after UV irradiation was enhanced in bacteria carrying plasmid pKM101; phage lambda mutagenesis was also increased. Plasmid pKM101 repaired potentially lethal DNA lesions, although Wild-type DNA sequences may not necessarily be restored; hence the mutations observed are the traces of the original DNA lesions. (Auth.)

A Qualitative and Quantitative Assay to Study DNA/Drug Interaction ...

African Journals Online (AJOL)

Purpose: To explore the use of restriction inhibition assay (RIA) to study the binding specificity of some anticancer drugs. Methods: A 448 bp DNA fragment derived from pBCKS+ plasmid (harboring the polylinker region with multiple restriction endonuclease sites) was used as a template for sequence selective inhibition of ...

Environmental toxicants cause sperm DNA fragmentation as detected by the Sperm Chromatin Structure Assay (SCSA[reg])

International Nuclear Information System (INIS)

Evenson, Donald P.; Wixon, Regina

2005-01-01

Studies over the past two decades have clearly shown that reproductive toxicants cause sperm DNA fragmentation. This DNA fragmentation can usually be detected prior to observing alterations of metaphase chromosomes in embryos. Thus, Sperm Chromatin Structure Assay (SCSA)-detected DNA damage is viewed as the molecular precursor to later gross chromosome damage observed under the light microscope. SCSA measurements of animal or human sperm consist of first obtaining a fresh or flash frozen neat semen sample in LN2 or dry ice. Samples are then sent to a SCSA diagnostic laboratory where the samples are thawed, diluted to ∼1-2 x 106 sperm/ml, treated for 30 s with a pH 1.2 detergent buffer and then stained with acridine orange (AO). The low pH partially denatures DNA at the sites of DNA strand breaks and the AO-ssDNA fluoresces red while the AO-dsDNA fluoresces green. Flow cytometry measurements of 5000 sperm/sample provide statistically robust data on the ratio of red to green sperm, the extent of the DNA fragmentation and the standard deviations of measures. Numerous experiments on rodents treated with reproductive toxicants clearly showed that SCSA measures are highly dose responsive and have a very low CV. Different agents that act on germ cells at various stages of development usually showed sperm DNA fragmentation when that germ cell fraction arrived in the epididymis or ejaculate. Some of these treated samples were capable of successful in vitro fertilization but with frequent embryo failure. A 2-year longitudinal study of men living a valley town with a reported abnormal level of infertility and spontaneous miscarriages and also a seasonal atmospheric smog pollution, showed, for the first time, that SCSA measurements of human sperm DNA fragmentation were detectable and correlated with dosage of air pollution while the classical semen measures were not correlated. Also, young men spraying pesticides without protective gear are at an increased risk for elevated

The interaction of linear and ring forms of DNA molecules with nanodiamonds synthesized by detonation

International Nuclear Information System (INIS)

Purtov, K V; Burakova, L P; Puzyr, A P; Bondar, V S

2008-01-01

Nanodiamonds synthesized by detonation have been found not to immobilize the ring form of pUC19 plasmid DNA. Linear pUC19 molecules with blunt ends, prepared by restriction of the initial ring form of pUC19 DNA, and linear 0.25-10 kb DNA fragments are adsorbed on nanodiamonds. The amount of adsorbed linear DNA molecules depends on the size of the molecules and the size of the nanodiamond clusters

Investigation of diversity of plasmids carrying the blaTEM-52 gene

DEFF Research Database (Denmark)

Bielak, Eliza Maria; Bergenholtz, Rikke D.; Jørgensen, Mikael Skaanning

2011-01-01

OBJECTIVES: To investigate the diversity of plasmids that carry blaTEM-52 genes among Escherichia coli and Salmonella enterica originating from animals, meat products and humans. METHODS: A collection of 22 blaTEM-52-encoding plasmids was characterized by restriction fragment length polymorphism...... of self-transfer to a plasmid-free E. coli recipient. CONCLUSIONS: The blaTEM-52 gene found in humans could have been transmitted on transferable plasmids originating from animal sources. Some of the blaTEM-52 plasmids carry replicons that differ from the classical ones. Two novel replicons were detected...

Prophagic DNA Fragments in Streptococcus agalactiae Strains and Association with Neonatal Meningitis

Science.gov (United States)

van der Mee-Marquet, Nathalie; Domelier, Anne-Sophie; Mereghetti, Laurent; Lanotte, Philippe; Rosenau, Agnès; van Leeuwen, Willem; Quentin, Roland

2006-01-01

We identified—by randomly amplified polymorphic DNA (RAPD) analysis at the population level followed by DNA differential display, cloning, and sequencing—three prophage DNA fragments (F5, F7, and F10) in Streptococcus agalactiae that displayed significant sequence similarity to the DNA of S. agalactiae and Streptococcus pyogenes. The F5 sequence aligned with a prophagic gene encoding the large subunit of a terminase, F7 aligned with a phage-associated cell wall hydrolase and a phage-associated lysin, and F10 aligned with a transcriptional regulator (ArpU family) and a phage-associated endonuclease. We first determined the prevalence of F5, F7, and F10 by PCR in a collection of 109 strains isolated in the 1980s and divided into two populations: one with a high risk of causing meningitis (HR group) and the other with a lower risk of causing meningitis (LR group). These fragments were significantly more prevalent in the HR group than in the LR group (P S. agalactiae strains to invade the neonatal brain endothelium. We then determined the prevalence of F5, F7, and F10 by PCR in a collection of 40 strains recently isolated from neonatal meningitis cases for comparison with the cerebrospinal fluid (CSF) strains isolated in the 1980s. The prevalence of the three prophage DNA fragments was similar in these two populations isolated 15 years apart. We suggest that the prophage DNA fragments identified have remained stable in many CSF S. agalactiae strains, possibly due to their importance in virulence or fitness. PMID:16517893

A Histone-Like Protein Induces Plasmid DNA to Form Liquid Crystals in Vitro and Gene Compaction in Vivo

Directory of Open Access Journals (Sweden)

Shiyong Sun

2013-12-01

Full Text Available The liquid crystalline state is a universal phenomenon involving the formation of an ordered structure via a self-assembly process that has attracted attention from numerous scientists. In this study, the dinoflagellate histone-like protein HCcp3 is shown to induce super-coiled pUC18 plasmid DNA to enter a liquid crystalline state in vitro, and the role of HCcp3 in gene condensation in vivo is also presented. The plasmid DNA (pDNA-HCcp3 complex formed birefringent spherical particles with a semi-crystalline selected area electronic diffraction (SAED pattern. Circular dichroism (CD titrations of pDNA and HCcp3 were performed. Without HCcp3, pUC18 showed the characteristic B conformation. As the HCcp3 concentration increased, the 273 nm band sharply shifted to 282 nm. When the HCcp3 concentration became high, the base pair (bp/dimer ratio fell below 42/1, and the CD spectra of the pDNA-HCcp3 complexes became similar to that of dehydrated A-form DNA. Microscopy results showed that HCcp3 compacted the super-coiled gene into a condensed state and that inclusion bodies were formed. Our results indicated that HCcp3 has significant roles in gene condensation both in vitro and in histone-less eukaryotes in vivo. The present study indicates that HCcp3 has great potential for applications in non-viral gene delivery systems, where HCcp3 may compact genetic material to form liquid crystals.

Sperm DNA fragmentation in boars is delayed or abolished by using sperm extenders.

Science.gov (United States)

Pérez-Llano, Begoña; Enciso, María; García-Casado, Pedro; Sala, Rubén; Gosálvez, Jaime

2006-12-01

The semen quality of seven young adult boars was assessed for percentages of sperm motility, normal acrosomes, abnormal sperm, cells positive to sHOST (short Hipoosmotic Swelling Test), HPNA cells (sHOST Positive with Normal Acrosome cells) and the percentage of sperm heads, which exhibited DNA fragmentation using the Sperm Chromatin Dispersion test (SCD). These parameters were analysed in sperm samples both undiluted and diluted using a commercial extender and stored at 15 degrees C for 21 days. Results showed that semen quality decreases faster in the undiluted semen samples from day 0 to day 7 compared to diluted semen samples that remained with a high quality up to day 11. The undiluted semen exhibited a low DNA fragmentation index (DFI) during the first days and then a significant increase from day 7 up to day 21. This increase in the DFI coincided with the lowest levels of the other semen quality parameters. On the contrary, the samples diluted in the commercial extender showed very low levels of DNA fragmentation in all boars during the preservation period. When the evolution of DNA fragmentation was analysed in the undiluted samples, differences were found among boars. These differences were not shown in the samples diluted in the extender where the basal DFI remained stable during the 21 days. The main conclusion of this study was that some sperm extenders delay or partially prevent sperm DNA fragmentation.

Development of DNA probes for Candida albicans

International Nuclear Information System (INIS)

Cheung, L.L.; Hudson, J.B.

1988-01-01

An attempt was made to produce DNA probes that could be used as a rapid and efficient means of detecting candidiasis (invasive Candida infection) in immunocompromised patients. Whole DNA from Candida albicans was digested with restriction endonuclease, and the resulting fragments were randomly cloned into a plasmid vector. Several recombinant plasmids were evaluated for cross-hybridization to various other Candida species, other fungal DNAs, and to nonfungal DNAs. Cross reactions were observed between the probes and different yeasts, but none with unrelated DNAs. Some recombinants were genus-specific, and two of these were applied to the analysis of C. albicans growth curves. It became evident that, although both 32 P- and biotin-labelled probes could be made quite sensitive, a possible limitation in their diagnostic potential was the poor liberation of Candida DNA from cells. Thus, better methods of treatment of clinical specimens will be required before such probes will be useful in routine diagnosis

Development of DNA probes for Candida albicans

Energy Technology Data Exchange (ETDEWEB)

Cheung, L.L.; Hudson, J.B.

1988-07-01

An attempt was made to produce DNA probes that could be used as a rapid and efficient means of detecting candidiasis (invasive Candida infection) in immunocompromised patients. Whole DNA from Candida albicans was digested with restriction endonuclease, and the resulting fragments were randomly cloned into a plasmid vector. Several recombinant plasmids were evaluated for cross-hybridization to various other Candida species, other fungal DNAs, and to nonfungal DNAs. Cross reactions were observed between the probes and different yeasts, but none with unrelated DNAs. Some recombinants were genus-specific, and two of these were applied to the analysis of C. albicans growth curves. It became evident that, although both /sup 32/P- and biotin-labelled probes could be made quite sensitive, a possible limitation in their diagnostic potential was the poor liberation of Candida DNA from cells. Thus, better methods of treatment of clinical specimens will be required before such probes will be useful in routine diagnosis.

No increased sperm DNA fragmentation index in semen containing human papillomavirus or herpesvirus

DEFF Research Database (Denmark)

Kaspersen, Maja Døvling; Bungum, Mona; Fedder, Jens

2013-01-01

It remains unknown whether human papillomaviruses (HPVs) or human herpesviruses (HHVs) in semen affect sperm DNA integrity. We investigated whether the presence of these viruses in semen was associated with an elevated sperm DNA fragmentation index. Semen from 76 sperm donors was examined by a PCR......-based hybridization array that identifies all HHVs and 35 of the most common HPVs. Sperm DNA integrity was determined by the sperm chromatin structure assay. HPVs or HHVs, or both, were found in 57% of semen samples; however, sperm DNA fragmentation index was not increased in semen containing these viruses....

Photolysis of phosphodiester bonds in plasmid DNA by high intensity UV laser irradiation

International Nuclear Information System (INIS)

Croke, D.T.; Blau, Werner; OhUigin, Colm; Kelly, J.M.; McConnell, D.J.

1988-01-01

The cleavage of phosphodiester bonds in DNA exposed to high intensity UV laser pulses in aerated aqueous solution has been investigated using a krypton fluoride excimer laser (248 nm) and bacterial plasmid DNA. The dependence of strand breakage on fluence and intensity has been studied in detail and shows that the process is non-linear with respect to intensity. The relationship between the quantum yield for strand breakage and intensity shows that the strand breakage reaction involves two-photon excitation of DNA bases. The quantum yield rises with intensity from a lower value of 7 x 10 -5 until a maximum value of 4.5 x 10 -4 is attained at intensities of 10 11 W m -2 and above. This value is approximately fifty-fold higher than the quantum yield for strand breakage induced by exposure to low density UV irradiation (254 nm, 12 W m -2 ). DNA sequencing experiments have shown that strand breakage occurs by the specific cleavage of the phosphodiester bond which lies immediately 3' to guanine residues in the DNA, leaving some alkali-labile remnant attached to the terminal phosphate. A mechanism for DNA strand breakage which involves the generation of guanine radical cations is proposed. (author)

(PCR) for direct cloning of blunt-end DNA fragments

African Journals Online (AJOL)

Administrator

2011-09-19

Sep 19, 2011 ... Key words: Blunt-end cloning, phosphorylated DNA fragment, dephosphorylated blunt-end vector. INTRODUCTION ... With this method, a lot of steps are saved, which includes restriction .... pBSK-blunt (data not shown).

Brownian Ratchet Mechanism for Faithful Segregation of Low-Copy-Number Plasmids.

Science.gov (United States)

Hu, Longhua; Vecchiarelli, Anthony G; Mizuuchi, Kiyoshi; Neuman, Keir C; Liu, Jian

2017-04-11

Bacterial plasmids are extrachromosomal DNA that provides selective advantages for bacterial survival. Plasmid partitioning can be remarkably robust. For high-copy-number plasmids, diffusion ensures that both daughter cells inherit plasmids after cell division. In contrast, most low-copy-number plasmids need to be actively partitioned by a conserved tripartite ParA-type system. ParA is an ATPase that binds to chromosomal DNA; ParB is the stimulator of the ParA ATPase and specifically binds to the plasmid at a centromere-like site, parS. ParB stimulation of the ParA ATPase releases ParA from the bacterial chromosome, after which it takes a long time to reset its DNA-binding affinity. We previously demonstrated in vitro that the ParA system can exploit this biochemical asymmetry for directed cargo transport. Multiple ParA-ParB bonds can bridge a parS-coated cargo to a DNA carpet, and they can work collectively as a Brownian ratchet that directs persistent cargo movement with a ParA-depletion zone trailing behind. By extending this model, we suggest that a similar Brownian ratchet mechanism recapitulates the full range of actively segregated plasmid motilities observed in vivo. We demonstrate that plasmid motility is tuned as the replenishment rate of the ParA-depletion zone progressively increases relative to the cargo speed, evolving from diffusion to pole-to-pole oscillation, local excursions, and, finally, immobility. When the plasmid replicates, the daughters largely display motilities similar to that of their mother, except that when the single-focus progenitor is locally excursive, the daughter foci undergo directed segregation. We show that directed segregation maximizes the fidelity of plasmid partition. Given that local excursion and directed segregation are the most commonly observed modes of plasmid motility in vivo, we suggest that the operation of the ParA-type partition system has been shaped by evolution for high fidelity of plasmid segregation

Analysis of human blood plasma cell-free DNA fragment size distribution using EvaGreen chemistry based droplet digital PCR assays.

Science.gov (United States)

Fernando, M Rohan; Jiang, Chao; Krzyzanowski, Gary D; Ryan, Wayne L

2018-04-12

Plasma cell-free DNA (cfDNA) fragment size distribution provides important information required for diagnostic assay development. We have developed and optimized droplet digital PCR (ddPCR) assays that quantify short and long DNA fragments. These assays were used to analyze plasma cfDNA fragment size distribution in human blood. Assays were designed to amplify 76,135, 490 and 905 base pair fragments of human β-actin gene. These assays were used for fragment size analysis of plasma cell-free, exosome and apoptotic body DNA obtained from normal and pregnant donors. The relative percentages for 76, 135, 490 and 905 bp fragments from non-pregnant plasma and exosome DNA were 100%, 39%, 18%, 5.6% and 100%, 40%, 18%,3.3%, respectively. The relative percentages for pregnant plasma and exosome DNA were 100%, 34%, 14%, 23%, and 100%, 30%, 12%, 18%, respectively. The relative percentages for non-pregnant plasma pellet (obtained after 2nd centrifugation step) were 100%, 100%, 87% and 83%, respectively. Non-pregnant Plasma cell-free and exosome DNA share a unique fragment distribution pattern which is different from pregnant donor plasma and exosome DNA fragment distribution indicating the effect of physiological status on cfDNA fragment size distribution. Fragment distribution pattern for plasma pellet that includes apoptotic bodies and nuclear DNA was greatly different from plasma cell-free and exosome DNA. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

DNA-PK dependent targeting of DNA-ends to a protein complex assembled on matrix attachment region DNA sequences

International Nuclear Information System (INIS)

Mauldin, S.K.; Getts, R.C.; Perez, M.L.; DiRienzo, S.; Stamato, T.D.

2003-01-01

Full text: We find that nuclear protein extracts from mammalian cells contain an activity that allows DNA ends to associate with circular pUC18 plasmid DNA. This activity requires the catalytic subunit of DNA-PK (DNA-PKcs) and Ku since it was not observed in mutants lacking Ku or DNA-PKcs but was observed when purified Ku/DNA-PKcs was added to these mutant extracts. Competition experiments between pUC18 and pUC18 plasmids containing various nuclear matrix attachment region (MAR) sequences suggest that DNA ends preferentially associate with plasmids containing MAR DNA sequences. At a 1:5 mass ratio of MAR to pUC18, approximately equal amounts of DNA end binding to the two plasmids were observed, while at a 1:1 ratio no pUC18 end-binding was observed. Calculation of relative binding activities indicates that DNA-end binding activities to MAR sequences was 7 to 21 fold higher than pUC18. Western analysis of proteins bound to pUC18 and MAR plasmids indicates that XRCC4, DNA ligase IV, scaffold attachment factor A, topoisomerase II, and poly(ADP-ribose) polymerase preferentially associate with the MAR plasmid in the absence or presence of DNA ends. In contrast, Ku and DNA-PKcs were found on the MAR plasmid only in the presence of DNA ends. After electroporation of a 32P-labeled DNA probe into human cells and cell fractionation, 87% of the total intercellular radioactivity remained in nuclei after a 0.5M NaCl extraction suggesting the probe was strongly bound in the nucleus. The above observations raise the possibility that DNA-PK targets DNA-ends to a repair and/or DNA damage signaling complex which is assembled on MAR sites in the nucleus

Exponential Megapriming PCR (EMP) Cloning—Seamless DNA Insertion into Any Target Plasmid without Sequence Constraints

Science.gov (United States)

Ulrich, Alexander; Andersen, Kasper R.; Schwartz, Thomas U.

2012-01-01

We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP) cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF) cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts. PMID:23300917

Enhanced resolution of DNA restriction fragments: A procedure by two-dimensional electrophoresis and double-labeling

International Nuclear Information System (INIS)

Yi, M.; Au, L.C.; Ichikawa, N.; Ts'o, P.O.

1990-01-01

A probe-free method was developed to detect DNA rearrangement in bacteria based on the electrophoretic separation of twice-digested restriction fragments of genomic DNA into a two-dimensional (2-D) pattern. The first restriction enzyme digestion was done in solution, followed by electrophoresis of the restriction fragments in one dimension. A second restriction enzyme digestion was carried out in situ in the gel, followed by electrophoresis in a second dimension perpendicular to the first electrophoresis. The 2-D pattern provides for the resolution of 300-400 spots, which are defined and indexed by an x,y coordinate system with size markers. This approach has greatly increased the resolution power over conventional one-dimensional (1-D) electrophoresis. To study DNA rearrangement, a 2-D pattern from a test strain was compared with the 2-D pattern from a reference strain. After the first digestion, genomic DNA fragments from the test strain were labeled with 35S, while those from the reference strain were labeled with 32P. This was done to utilize the difference in the energy emission of 35S and 32P isotopes for autoradiography when two x-ray films were exposed simultaneously on top of the gel after the 2-D electrophoresis. The irradiation from the decay of 35S exposed only the lower film, whereas the irradiation from the decay of 32P exposed both the lower and upper films. Different DNA fragments existed in the test DNA compared with the reference DNA can be identified unambiguously by the differential two 2-D patterns produced on two films upon exposure to the 35S and 32P fragments in the same gel. An appropriate photographic procedure further simplified the process, allowing only the difference in DNA fragments between these two patterns to be shown in the map

General method of preparation of uniformly 13C, 15N-labeled DNA fragments for NMR analysis of DNA structures

International Nuclear Information System (INIS)

Rene, Brigitte; Masliah, Gregoire; Zargarian, Loussine; Mauffret, Olivier; Fermandjian, Serge

2006-01-01

Summary 13 C, 15 N labeling of biomolecules allows easier assignments of NMR resonances and provides a larger number of NMR parameters, which greatly improves the quality of DNA structures. However, there is no general DNA-labeling procedure, like those employed for proteins and RNAs. Here, we describe a general and widely applicable approach designed for preparation of isotopically labeled DNA fragments that can be used for NMR studies. The procedure is based on the PCR amplification of oligonucleotides in the presence of labeled deoxynucleotides triphosphates. It allows great flexibility thanks to insertion of a short DNA sequence (linker) between two repeats of DNA sequence to study. Size and sequence of the linker are designed as to create restriction sites at the junctions with DNA of interest. DNA duplex with desired sequence and size is released upon enzymatic digestion of the PCR product. The suitability of the procedure is validated through the preparation of two biological relevant DNA fragments

Structural analysis of the ParR/parC plasmid partition complex

DEFF Research Database (Denmark)

Møller-Jensen, Jakob; Ringgaard, Simon; Mercogliano, Christopher P

2007-01-01

Accurate DNA partition at cell division is vital to all living organisms. In bacteria, this process can involve partition loci, which are found on both chromosomes and plasmids. The initial step in Escherichia coli plasmid R1 partition involves the formation of a partition complex between the DNA...

Ionization and fragmentation of DNA-RNA bases: a density functional theory study

International Nuclear Information System (INIS)

Sadr-Arani, Leila

2014-01-01

Ionizing radiation (IR) cross human tissue, deposit energy and dissipate fragmenting molecules. The resulting fragments may be highlighted by mass spectrometry. Despite the amount of information obtained experimentally by the interpretation of the mass spectrum, experience alone cannot answer all the questions of the mechanism of fragmentation of DNA/RNA bases and a theoretical study is a complement to this information. A theoretical study allows us to know the weakest bonds in the molecule during ionization and thus may help to provide mechanisms of dissociation and produced fragments. The purpose of this work, using the DFT with the PBE functional, is to study the ionization and fragmentation mechanisms of DNA/RNA bases (Uracil, Cytosine, Adenine and Guanine) and to identify the cations corresponding to each peak in mass spectra. For all RNA bases, the retro Diels-Alder reaction (elimination of HNCO or NCO*) is a major route for dissociating, with the exception of adenine for which there is no atom oxygen in its structure. Loss of NH 3 (NH 2 *) molecule is another common way to all bases that contain amine group. The possibility of the loss of hydrogen from the cations is also investigated, as well as the dissociation of dehydrogenated cations and protonated uracil. This work shows the interest of providing DFT calculation in the interpretation of mass spectra of DNA bases. (author)

Studies on the expression of plasmid-borne genes in the endosymbiotic state of Rhizobium leguminosarum

NARCIS (Netherlands)

Krol, A.J.M.

1982-01-01

The subject matter of the research reported in this thesis is the role of plasmid-borne genes of Rhizobium in symbiosis and nitrogen fixation. Plasmid DNA was isolated from Rhizobium leguminosarum strain PRE and the expression of plasmid DNA in nitrogen

Molecular cloning and expression of Corynebacterium glutamicum genes for amino acid synthesis in Escherichia coli cells

International Nuclear Information System (INIS)

Beskrovnaya, O.Yu.; Fonshtein, M.Yu.; Kolibaba, L.G.; Yankovskii, N.K.; Debabov, V.G.

1989-01-01

Molecular cloning of Corynebacterium glutamicum genes for threonine and lysine synthesis has been done in Escherichia coli cells. The clonal library of EcoRI fragments of chromosomal DNA of C. glutamicum was constructed on the plasmid vector λpSL5. The genes for threonine and lysine synthesis were identified by complementation of E. coli mutations in thrB and lysA genes, respectively. Recombinant plasmids, isolated from independent ThrB + clone have a common 4.1-kb long EcoRI DNA fragment. Hybrid plasmids isolated from LysA + transductants of E. coli have common 2.2 and 3.3 kb long EcoRI fragments of C. glutamicum DNA. The hybrid plasmids consistently transduced the markers thrB + and lysA + . The Southern hybridization analysis showed that the cloned DNA fragments hybridized with the fragments of identical length in C. glutamicum chromosomes

Exponential megapriming PCR (EMP cloning--seamless DNA insertion into any target plasmid without sequence constraints.

Directory of Open Access Journals (Sweden)

Alexander Ulrich

Full Text Available We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts.

Effect of thiol pendant conjugates on plasmid DNA binding, release, and stability of polymeric delivery vectors.

Science.gov (United States)

Bacalocostantis, Irene; Mane, Viraj P; Kang, Michael S; Goodley, Addison S; Muro, Silvia; Kofinas, Peter

2012-05-14

Polymers have attracted much attention as potential gene delivery vectors due to their chemical and structural versatility. However, several challenges associated with polymeric carriers, including low transfection efficiencies, insufficient cargo release, and high cytotoxicity levels have prevented clinical implementation. Strong electrostatic interactions between polymeric carriers and DNA cargo can prohibit complete cargo release within the cell. As a result, cargo DNA never reaches the cell's nucleus where gene expression takes place. In addition, highly charged cationic polymers have been correlated with high cytotoxicity levels, making them unsuitable carriers in vivo. Using poly(allylamine) (PAA) as a model, we investigated how pH-sensitive disulfide cross-linked polymer networks can improve the delivery potential of cationic polymer carriers. To accomplish this, we conjugated thiol-terminated pendant chains onto the primary amines of PAA using 2-iminothiolane, developing three new polymer vectors with 5, 13, or 20% thiol modification. Unmodified PAA and thiol-conjugated polymers were tested for their ability to bind and release plasmid DNA, their capacity to protect genetic cargo from enzymatic degradation, and their potential for endolysosomal escape. Our results demonstrate that polymer-plasmid complexes (polyplexes) formed by the 13% thiolated polymer demonstrate the greatest delivery potential. At high N/P ratios, all thiolated polymers (but not unmodified counterparts) were able to resist decomplexation in the presence of heparin, a negatively charged polysaccharide used to mimic in vivo polyplex-protein interactions. Further, all thiolated polymers exhibited higher buffering capacities than unmodified PAA and, therefore, have a greater potential for endolysosomal escape. However, 5 and 20% thiolated polymers exhibited poor DNA binding-release kinetics, making them unsuitable carriers for gene delivery. The 13% thiolated polymers, on the other hand

Processing of Nonconjugative Resistance Plasmids by Conjugation Nicking Enzyme of Staphylococci

Energy Technology Data Exchange (ETDEWEB)

Pollet, Rebecca M.; Ingle, James D.; Hymes, Jeff P.; Eakes, Thomas C.; Eto, Karina Yui; Kwong, Stephen M.; Ramsay, Joshua P.; Firth, Neville; Redinbo, Matthew R. (Curtin U.); (Sydney); (UNC)

2016-01-04

Antimicrobial resistance inStaphylococcus aureuspresents an increasing threat to human health. This resistance is often encoded on mobile plasmids, such as pSK41; however, the mechanism of transfer of these plasmids is not well understood. In this study, we first examine key protein-DNA interactions formed by the relaxase enzyme, NES, which initiates and terminates the transfer of the multidrug resistance plasmid pSK41. Two loops on the NES protein, hairpin loops 1 and 2, form extensive contacts with the DNA hairpin formed at theoriTregion of pSK41, and here we establish that these contacts are essential for proper DNA cleavage and religation by the full 665-residue NES proteinin vitro. Second, pSK156 and pCA347 are nonconjugativeStaphylococcus aureusplasmids that contain sequences similar to theoriTregion of pSK41 but differ in the sequence predicted to form a DNA hairpin. We show that pSK41-encoded NES is able to bind, cleave, and religate theoriTsequences of these nonconjugative plasmidsin vitro. Although pSK41 could mobilize a coresident plasmid harboring its cognateoriT, it was unable to mobilize plasmids containing the pSK156 and pCA347 variantoriTmimics, suggesting that an accessory protein like that previously shown to confer specificity in the pWBG749 system may also be involved in transmission of plasmids containing a pSK41-likeoriT. These data indicate that the conjugative relaxase intransmechanism recently described for the pWBG749 family of plasmids also applies to the pSK41 family of plasmids, further heightening the potential significance of this mechanism in the horizontal transfer of staphylococcal plasmids.

IMPORTANCEUnderstanding the

Flow-cytometric analysis of mouse embryonic stem cell lipofection using small and large DNA constructs.

Science.gov (United States)

McLenachan, Samuel; Sarsero, Joseph P; Ioannou, Panos A

2007-06-01

Using the lipofection reagent LipofectAMINE 2000 we have examined the delivery of plasmid DNA (5-200 kb) to mouse embryonic stem (mES) cells by flow cytometry. To follow the physical uptake of lipoplexes we labeled DNA molecules with the fluorescent dye TOTO-1. In parallel, expression of an EGFP reporter cassette in constructs of different sizes was used as a measure of nuclear delivery. The cellular uptake of DNA lipoplexes is dependent on the uptake competence of mES cells, but it is largely independent of DNA size. In contrast, nuclear delivery was reduced with increasing plasmid size. In addition, linear DNA is transfected with lower efficiency than circular DNA. Inefficient cytoplasmic trafficking appears to be the main limitation in the nonviral delivery of large DNA constructs to the nucleus of mES cells. Overcoming this limitation should greatly facilitate functional studies with large genomic fragments in embryonic stem cells.

DNA sequence analysis of plasmids from multidrug resistant Salmonella enterica serotype Heidelberg isolates.

Directory of Open Access Journals (Sweden)

Jing Han

Full Text Available Salmonella enterica serovar Heidelberg is among the most detected serovars in swine and poultry, ranks among the top five serotypes associated with human salmonellosis and is disproportionately associated with invasive infections and mortality in humans. Salmonella are known to carry plasmids associated with antimicrobial resistance and virulence. To identify plasmid-associated genes in multidrug resistant S. enterica serovar Heidelberg, antimicrobial resistance plasmids from five isolates were sequenced using the 454 LifeSciences pyrosequencing technology. Four of the isolates contained incompatibility group (Inc A/C multidrug resistance plasmids harboring at least eight antimicrobial resistance genes. Each of these strains also carried a second resistance plasmid including two IncFIB, an IncHI2 and a plasmid lacking an identified Inc group. The fifth isolate contained an IncI1 plasmid, encoding resistance to gentamicin, streptomycin and sulfonamides. Some of the IncA/C plasmids lacked the full concert of transfer genes and yet were able to be conjugally transferred, likely due to the transfer genes carried on the companion plasmids in the strains. Several non-IncA/C resistance plasmids also carried putative virulence genes. When the sequences were compared to previously sequenced plasmids, it was found that while all plasmids demonstrated some similarity to other plasmids, they were unique, often due to differences in mobile genetic elements in the plasmids. Our study suggests that Salmonella Heidelberg isolates harbor plasmids that co-select for antimicrobial resistance and virulence, along with genes that can mediate the transfer of plasmids within and among other bacterial isolates. Prevalence of such plasmids can complicate efforts to control the spread of S. enterica serovar Heidelberg in food animal and human populations.

Properties of internalization factors contributing to the uptake of extracellular DNA into tumor-initiating stem cells of mouse Krebs-2 cell line.

Science.gov (United States)

Dolgova, Evgeniya V; Potter, Ekaterina A; Proskurina, Anastasiya S; Minkevich, Alexandra M; Chernych, Elena R; Ostanin, Alexandr A; Efremov, Yaroslav R; Bayborodin, Sergey I; Nikolin, Valeriy P; Popova, Nelly A; Kolchanov, Nikolay A; Bogachev, Sergey S

2016-05-25

Previously, we demonstrated that poorly differentiated cells of various origins, including tumor-initiating stem cells present in the ascites form of mouse cancer cell line Krebs-2, are capable of naturally internalizing both linear double-stranded DNA and circular plasmid DNA. The method of co-incubating Krebs-2 cells with extracellular plasmid DNA (pUC19) or TAMRA-5'-dUTP-labeled polymerase chain reaction (PCR) product was used. It was found that internalized plasmid DNA isolated from Krebs-2 can be transformed into competent Escherichia coli cells. Thus, the internalization processes taking place in the Krebs-2 cell subpopulation have been analyzed and compared, as assayed by E. coli colony formation assay (plasmid DNA) and cytofluorescence (TAMRA-DNA). We showed that extracellular DNA both in the form of plasmid DNA and a PCR product is internalized by the same subpopulation of Krebs-2 cells. We found that the saturation threshold for Krebs-2 ascites cells is 0.5 μg DNA/10(6) cells. Supercoiled plasmid DNA, human high-molecular weight DNA, and 500 bp PCR fragments are internalized into the Krebs-2 tumor-initiating stem cells via distinct, non-competing internalization pathways. Under our experimental conditions, each cell may harbor 340-2600 copies of intact plasmid material, or up to 3.097 ± 0.044×10(6) plasmid copies (intact or not), as detected by quantitative PCR. The internalization dynamics of extracellular DNA, copy number of the plasmids taken up by the cells, and competition between different types of double-stranded DNA upon internalization into tumor-initiating stem cells of mouse ascites Krebs-2 have been comprehensively analyzed. Investigation of the extracellular DNA internalization into tumor-initiating stem cells is an important part of understanding their properties and possible destruction mechanisms. For example, a TAMRA-labeled DNA probe may serve as an instrument to develop a target for the therapy of cancer, aiming at elimination of

Multiple drug resistant carbapenemases producing Acinetobacter baumannii isolates harbours multiple R-plasmids

Directory of Open Access Journals (Sweden)

Rajagopalan Saranathan

2014-01-01

Full Text Available Background & objectives: The nosocomial human pathogen Acinetobacter baumannii has high propensity to develop resistance to antimicrobials and to become multidrug resistant (MDR, consequently complicating the treatment. This study was carried out to investigate the presence of resistant plasmids (R-plasmids among the clinical isolates of A. baumannii. In addition, the study was performed to check the presence of common β-lactamases encoding genes on these plasmids. Methods: A total of 55 clinical isolates of A. baumannii were included in the study and all were subjected to plasmid DNA isolation, followed by PCR to check the presence of resistance gene determinants such as blaOXA-23 , blaOXA-51, blaOXA-58 and blaIMP-1 on these plasmids that encode for oxacillinase (OXA and metallo-β-lactamase (MBL type of carbapenemases. Plasmid curing experiments were carried out on selected isolates using ethidium bromide and acridine orange as curing agents and the antibiotic resistance profiles were evaluated before and after curing. Results: All the isolates were identified as A. baumannii by 16SrDNA amplification and sequencing. Plasmid DNA isolated from these isolates showed the occurrence of multiple plasmids with size ranging from 500bp to ≥ 25 kb. The percentage of blaOXA-51 and blaOXA-23 on plasmids were found to be 78 and 42 per cent, respectively and 20 isolates (36% carried blaIMP-1 gene on plasmids. Significant difference was observed in the antibiograms of plasmid cured isolates when compared to their parental ones. The clinical isolates became susceptible to more than two antibiotic classes after curing of plasmids indicating plasmid borne resistance. Interpretation & conclusions: Our study determined the plasmid mediated resistance mechanisms and occurrence of different resistance genes on various plasmids isolated from MDR A. baumannii. The present findings showed the evidence for antibiotic resistance mediated through multiple plasmids in

Transformation of UV-hypersensitive Chinese hamster ovary cell mutants with UV-irradiated plasmids

International Nuclear Information System (INIS)

Nairn, R.S.; Humphrey, R.M.; Adair, G.M.

1988-01-01

Transfection of UV-hypersensitive, DNA repair-deficient Chinese hamster ovary (CHO) cell lines and parental, repair-proficient CHO cells with UV-irradiated pHaprt-1 or pSV2gpt plasmids resulted in different responses by recipient cell lines to UV damage in transfected DNA. Unlike results reported for human cells, UV irradiation of transfecting DNA did not stimulate genetic transformation of CHO recipient cells. In repair-deficient CHO cells, proportionally fewer transformants were produced with increasing UV damage than in repair-proficient cells in transfections with UV-irradiated hamster adenine phosphoribosyltransferase (APRT) gene contained in plasmid pHaprt-1. Transfection of CHO cells with UV-irradiated pSV2gpt resulted in neither decline in transformation frequencies in repair-deficient cell lines relative to repair-proficient cells nor stimulation of genetic transformation by UV damage in the plasmid. Blot hybridization analysis of DNA samples isolated from transformed cells showed no dramatic changes in copy number or arrangement of transfected plasmid DNA with increasing UV dose. The authors conclude responses of recipient cells to UV-damaged transfecting plasmids depend on type of recipient cell and characteristics of the genetic sequence used for transfection. (author)

Yeast transformation mediated by Agrobacterium strains harboring an Ri plasmid: comparative study between GALLS of an Ri plasmid and virE of a Ti plasmid.

Science.gov (United States)

Kiyokawa, Kazuya; Yamamoto, Shinji; Sato, Yukari; Momota, Naoto; Tanaka, Katsuyuki; Moriguchi, Kazuki; Suzuki, Katsunori

2012-07-01

Agrobacterium strains containing a Ti plasmid can transfer T-DNA not only to plants but also to fungi, including the yeast Saccharomyces cerevisiae. However, no Agrobacterium strain harboring an Ri plasmid has been evaluated in fungal transformation. Some Ri plasmids have GALLS , instead of virE1 and virE2. GALLS protein can functionally substitute in plant transformation for a structurally different protein VirE2. In this study, we compared the yeast transformation ability among Agrobacterium donors: a strain containing a Ti plasmid, strains harboring either an agropine-type or a mikimopine-type Ri plasmid, and a strain having a modified Ri plasmid supplemented with a Ti plasmid type virE operon. Agrobacterium strains possessing GALLS transformed yeast cells far less efficiently than the strain containing virE operon. Production of GALLS in recipient yeast cells improved the yeast transformation mediated by an Agrobacterium strain lacking neither GALLS nor virE operon. A reporter assay to detect mobilization of the proteins fused with Cre recombinase revealed that VirE2 protein is much more abundant in yeast cells than GALLS. Based on these results, we concluded that the low yeast transformability mediated by Agrobacterium strains having the Ri plasmid is because of low amount of mobilized GALLS in yeast cells. © 2012 The Authors Journal compilation © 2012 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.

Effect of human polymorphonuclear and mononuclear leukocytes on chromosomal and plasmid DNA of Escherichia coli. Role of acid DNase

International Nuclear Information System (INIS)

Rozenberg-Arska, M.; van Strijp, J.A.; Hoekstra, W.P.; Verhoef, J.

1984-01-01

Phagocytosis and killing by polymorphonuclear and mononuclear leukocytes are important host resistance factors against invading microorganisms. Evidence showing that killing is rapidly followed by degradation of bacterial components is limited. Therefore, we studied the fate of Escherichia coli DNA following phagocytosis of E. coli by polymorphonuclear and mononuclear leukocytes. [ 3 H]Thymidine-labeled, unencapsulated E. coli PC2166 and E. coli 048K1 were incubated in serum, washed, and added to leukocytes. Uptake and killing of the bacteria and degradation of DNA were measured. Although phagocytosis and killing by mononuclear leukocytes was less efficient than that by polymorphonuclear leukocytes, only mononuclear leukocytes were able to degrade E. coli PC2166 DNA. Within 2 h, 60% of the radioactivity added to mononuclear leukocytes was released into the supernate, of which 40% was acid soluble. DNA of E. coli 048K1 was not degraded. To further analyze the capacity of mononuclear leukocytes to degrade E. coli DNA, chromosomal and plasmid DNA was isolated from ingested bacteria and subjected to agarose gel-electrophoresis. Only chromosomal DNA was degraded after phagocytosis. Plasmid DNA of E. coli carrying a gene coding for ampicillin resistance remained intact for a 2-h period after ingestion, and was still able to transform recipient E. coli cells after this period. Although we observed no DNA degradation during phagocytosis by polymorphonuclear leukocytes, lysates of both polymorphonuclear and mononuclear leukocytes contained acid-DNase activity with a pH optimum of 4.9. However, the DNase activity of mononuclear leukocytes was 20 times higher than that of polymorphonuclear leukocytes. No difference was observed between DNase activity from polymorphonuclear and mononuclear leukocytes from a chronic granulomatous disease patient with DNase activity from control polymorphonuclear and mononuclear leukocytes

Functional activity of plasmid DNA after entry into the atmosphere of earth investigated by a new biomarker stability assay for ballistic spaceflight experiments.

Directory of Open Access Journals (Sweden)

Cora S Thiel

Full Text Available Sounding rockets represent an excellent platform for testing the influence of space conditions during the passage of Earth's atmosphere and re-entry on biological, physical and chemical experiments for astrobiological purposes. We designed a robust functionality biomarker assay to analyze the biological effects of suborbital spaceflights prevailing during ballistic rocket flights. During the TEXUS-49 rocket mission in March 2011, artificial plasmid DNA carrying a fluorescent marker (enhanced green fluorescent protein: EGFP and an antibiotic resistance cassette (kanamycin/neomycin was attached on different positions of rocket exterior; (i circular every 90 degree on the outer surface concentrical of the payload, (ii in the grooves of screw heads located in between the surface application sites, and (iii on the surface of the bottom side of the payload. Temperature measurements showed two major peaks at 118 and 130 °C during the 780 seconds lasting flight on the inside of the recovery module, while outer gas temperatures of more than 1000 °C were estimated on the sample application locations. Directly after retrieval and return transport of the payload, the plasmid DNA samples were recovered. Subsequent analyses showed that DNA could be recovered from all application sites with a maximum of 53% in the grooves of the screw heads. We could further show that up to 35% of DNA retained its full biological function, i.e., mediating antibiotic resistance in bacteria and fluorescent marker expression in eukaryotic cells. These experiments show that our plasmid DNA biomarker assay is suitable to characterize the environmental conditions affecting DNA during an atmospheric transit and the re-entry and constitute the first report of the stability of DNA during hypervelocity atmospheric transit indicating that sounding rocket flights can be used to model the high-speed atmospheric entry of organics-laden artificial meteorites.

Integral parametrization of the Kinetics of Crosslink production in plasmid DNA as a function of 8-methoxypsoralen concentration

Energy Technology Data Exchange (ETDEWEB)

Vidania, R. de; Paramio, J. M.; Bauluz, C.

1986-07-01

In this paper we present results of crosslink production in pBR322 DNA along a wide range of 8-methoxypsoralen (8-MOP) concentration. Experimental data were obtained as DNA renaturation percentages, from the shift in hyperchromicity after a temperature-dependent denaturation-renaturation process. the experimental results showed a three-stage profile when represented as a function of the natural logarithms of 8-MOP concentration. an integral parametrization which allows a simultaneous fit of the three observed stages is presented here. the theoretical values of crosslink production determined from the fit are useful to asses the genotoxicity of psoralen-induced crosslinks in plasmid DNA. (Author) 24 refs.

Integral parametrization of the Kinetics of Crosslink production in plasmid DNA as a function of 8-methoxypsoralen concentration

International Nuclear Information System (INIS)

Vidania, R. de; Paramio, J. M.; Bauluz, C.

1986-01-01

In this paper we present results of crosslink production in pBR322 DNA along a wide range of 8-methoxypsoralen (8-MOP) concentration. Experimental data were obtained as DNA renaturation percentages, from the shift in hyperchromicity after a temperature-dependent denaturation-renaturation process. the experimental results showed a three-stage profile when represented as a function of the natural logarithms of 8-MOP concentration. an integral parametrization which allows a simultaneous fit of the three observed stages is presented here. the theoretical values of crosslink production determined from the fit are useful to asses the genotoxicity of psoralen-induced crosslinks in plasmid DNA. (Author) 24 refs

trans-Acting Virulence Functions of the Octopine Ti Plasmid from Agrobacterium tumefaciens

NARCIS (Netherlands)

Hille, Jacques; Kan, Jan van; Schilperoort, Rob

1984-01-01

All Ti plasmid-encoded virulence functions that were studied act in trans. An octopine Ti plasmid-specific vir operon, called vir-O, located on an EcoRI restriction fragment has been characterized. Sequences with promoter activity in Escherichia coli were identified for a second vir operon, called

Effective plasmid DNA and small interfering RNA delivery to diseased human brain microvascular endothelial cells.

Science.gov (United States)

Slanina, H; Schmutzler, M; Christodoulides, M; Kim, K S; Schubert-Unkmeir, A

2012-01-01

Expression of exogenous DNA or small interfering RNA (siRNA) in vitro is significantly affected by the particular delivery system utilized. In this study, we evaluated the transfection efficiency of plasmid DNA and siRNA into human brain microvascular endothelial cells (HBMEC) and meningioma cells, which constitute the blood-cerebrospinal fluid barrier, a target of meningitis-causing pathogens. Chemical transfection methods and various lipofection reagents including Lipofectamin™, FuGene™, or jetPRIME®, as well as physical transfection methods and electroporation techniques were applied. To monitor the transfection efficiencies, HBMEC and meningioma cells were transfected with the reporter plasmid pTagGFP2-actin vector, and efficiency of transfection was estimated by fluorescence microscopy and flow cytometry. We established protocols based on electroporation using Cell Line Nucleofector® Kit V with the Amaxa® Nucleofector® II system from Lonza and the Neon® Transfection system from Invitrogen resulting in up to 41 and 82% green fluorescent protein-positive HBMEC, respectively. Optimal transfection solutions, pulse programs and length were evaluated. We furthermore demonstrated that lipofection is an efficient method to transfect meningioma cells with a transfection efficiency of about 81%. Finally, we applied the successful electroporation protocols to deliver synthetic siRNA to HBMEC and analyzed the role of the actin-binding protein cortactin in Neisseria meningitidis pathogenesis. Copyright © 2012 S. Karger AG, Basel.

Transformation of Saccharomyces cerevisiae with UV-irradiated single-stranded plasmid.

Science.gov (United States)

Zgaga, Z

1991-08-01

UV-irradiated single-stranded replicative plasmids were used to transform different yeast strains. The low doses of UV used in this study (10-75 J/m2) caused a significant decrease in the transforming efficiency of plasmid DNA in the Rad+ strain, while they had no effect on transformation with double-stranded plasmids of comparable size. Neither the rev3 mutation, nor the rad18 or rad52 mutations influenced the efficiency of transformation with irradiated single-stranded plasmid. However, it was found to be decreased in the double rev3 rad52 mutant. Extracellular irradiation of plasmid that contains both URA3 and LEU2 genes (psLU) gave rise to up to 5% Leu- transformants among selected Ura+ ones in the repair-proficient strain. Induction of Leu- transformants was dose-dependent and only partially depressed in the rev3 mutant. These results suggest that both mutagenic and recombinational repair processes operate on UV-damaged single-stranded DNA in yeast.

Plasmid pVAX1-NH36 purification by membrane and bead perfusion chromatography.

Science.gov (United States)

Franco-Medrano, Diana Ivonne; Guerrero-Germán, Patricia; Montesinos-Cisneros, Rosa María; Ortega-López, Jaime; Tejeda-Mansir, Armando

2017-03-01

The demand for plasmid DNA (pDNA) has increased in response to the rapid advances in vaccines applications to prevent and treat infectious diseases caused by virus, bacteria or parasites, such as Leishmania species. The immunization protocols require large amounts of supercoiled plasmid DNA (sc-pDNA) challenging the development of efficient and profitable processes for capturing and purified pDNA molecules from large volumes of lysates. A typical bioprocess involves four steps: fermentation, primary recovery, intermediate recovery and final purification. Ion-exchange chromatography is one of the key operations in the purification schemes of pDNA owing the chemical structure of these macromolecules. The goal of this research was to compare the performance of the final purification step of pDNA using ion-exchange chromatography on columns packed with Mustang Q membranes or perfusive beads POROS 50 HQ. The experimental results showed that both matrixes could separate the plasmid pVAX1-NH36 (3936 bp) from impurities in clarified Escherichia coli lysates with an adequate resolution. In addition, a 24- and 21-fold global purification factor was obtained. An 88 and 63% plasmid recuperation was achieved with ion-exchange membranes and perfusion beads, respectively. A better understanding of perfusion-based matrices for the purification of pDNA was developed in this research.

Effect of West Nile virus DNA-plasmid vaccination on response to live virus challenge in red-tailed hawks (Buteo jamaicensis).

Science.gov (United States)

Redig, Patrick T; Tully, Thomas N; Ritchie, Branson W; Roy, Alma F; Baudena, M Alexandra; Chang, Gwong-Jen J

2011-08-01

To evaluate the safety and efficacy of an experimental adjuvanted DNA-plasmid vaccine against West Nile virus (WNV) in red-tailed hawks (Buteo jamaicensis). 19 permanently disabled but otherwise healthy red-tailed hawks of mixed ages and both sexes without detectable serum antibodies against WNV. Hawks were injected IM with an experimental WNV DNA-plasmid vaccine in an aluminum-phosphate adjuvant (n = 14) or with the adjuvant only (control group; 5). All birds received 2 injections at a 3-week interval. Blood samples for serologic evaluation were collected before the first injection and 4 weeks after the second injection (day 0). At day 0, hawks were injected SC with live WNV. Pre- and postchallenge blood samples were collected at intervals for 14 days for assessment of viremia and antibody determination; oropharyngeal and cloacal swabs were collected for assessment of viral shedding. Vaccination was not associated with morbidity or deaths. Three of the vaccinated birds seroconverted after the second vaccine injection; all other birds seroconverted following the live virus injection. Vaccinated birds had significantly less severe viremia and shorter and less-intense shedding periods, compared with the control birds. Use of the WNV DNA-plasmid vaccine in red-tailed hawks was safe, and vaccination attenuated but did not eliminate both the viremia and the intensity of postchallenge shedding following live virus exposure. Further research is warranted to conclusively determine the efficacy of this vaccine preparation for protection of red-tailed hawks and other avian species against WNV-induced disease.

Molecular processes as basis for plasmid-mediated bacterial UV-light resistance and mutagenesis

International Nuclear Information System (INIS)

Aleshkin, G.I.; Brukhanskij, G.V.; Skavronskaya, A.G.

1985-01-01

The increase of UV-resistance and UV-induced mutagenesis by lambda 1 pint intmid as well as molecular-genetic mechanisms of plasmid participation in reparation and DNA replication and its degradation after UV-irradiation in plasmid cells on pKM101 plasmid model have been investigated. Data testifying to the necessity of intmid integration in chromosome as obligatory stage of intmid participation in increasing UV-resistance of bacterial cells are obtained. It has been found that intmid raises UV-resistance of cells and increases respectively the UV-induced reverants efficiency. On the basis of the experiment data the conclusion is drawn that the intmid capacity to raise UV-resistance and, possibly, mutagenesis is bound not only with its integration into chromosome but also with pol A + chromosome replication by dependendent imtmid replication complex. It is shown that pKM101 plasmid ensures functioning in E coli cells of inducible, chloroamphenicol-resistant DNA replication, highly resistant to UV-light harmful effect and that the volume of excision reparation in E. coli cells carrying pKM101 plasmid is increased as compared with the volume of reparation in plasmid legs cells. The combination of the data obtained gives grounds to the authors to assume that inducible replication, inducible reparation of DNA and inducible decrease of DNA degradation determined by pKM101 plasmid may serve as recA + lexA + basis dependent increase of UV-resistance and mutagenesis and that these processes provide the possibility of functioning of integrative replication mechanism of plasmid participation in ensuring UV-resistance and mutagenesis of plants

The effect of dimethyl sulfoxide on the induction of DNA strand breaks in plasmid DNA and colony formation of PC Cl3 mammalian cells by alpha-, beta-, and Auger electron emitters (223)Ra, (188)Re, and (99m)Tc.

Science.gov (United States)

Runge, Roswitha; Oehme, Liane; Kotzerke, Jörg; Freudenberg, Robert

2016-12-01

DNA damage occurs as a consequence of both direct and indirect effects of ionizing radiation. The severity of DNA damage depends on the physical characteristics of the radiation quality, e.g., the linear energy transfer (LET). There are still contrary findings regarding direct or indirect interactions of high-LET emitters with DNA. Our aim is to determine DNA damage and the effect on cellular survival induced by (223)Ra compared to (188)Re and (99m)Tc modulated by the radical scavenger dimethyl sulfoxide (DMSO). Radioactive solutions of (223)Ra, (188)Re, or (99m)Tc were added to either plasmid DNA or to PC Cl3 cells in the absence or presence of DMSO. Following irradiation, single strand breaks (SSB) and double strand breaks (DSB) in plasmid DNA were analyzed by gel electrophoresis. To determine the radiosensitivity of the rat thyroid cell line (PC Cl3), survival curves were performed using the colony formation assay. Exposure to 120 Gy of (223)Ra, (188)Re, or (99m)Tc leads to maximal yields of SSB (80 %) in plasmid DNA. Irradiation with 540 Gy (223)Ra and 500 Gy (188)Re or (99m)Tc induced 40, 28, and 64 % linear plasmid conformations, respectively. DMSO prevented the SSB and DSB in a similar way for all radionuclides. However, with the α-emitter (223)Ra, a low level of DSB could not be prevented by DMSO. Irradiation of PC Cl3 cells with (223)Ra, (188)Re, and (99m)Tc pre-incubated with DMSO revealed enhanced survival fractions (SF) in comparison to treatment without DMSO. Protection factors (PF) were calculated using the fitted survival curves. These factors are 1.23 ± 0.04, 1.20 ± 0.19, and 1.34 ± 0.05 for (223)Ra, (188)Re, and (99m)Tc, respectively. For (223)Ra, as well as for (188)Re and (99m)Tc, dose-dependent radiation effects were found applicable for plasmid DNA and PC Cl3 cells. The radioprotection by DMSO was in the same range for high- and low-LET emitter. Overall, the results indicate the contribution of mainly indirect radiation

Drug resistance plasmids in Lactobacillus acidophilus and Lactobacillus reuteri.

OpenAIRE

Vescovo, M; Morelli, L; Bottazzi, V

1982-01-01

Sixteen strains of Lactobacillus reuteri and 20 strains of Lactobacillus acidophilus were tested for resistance to 22 antibiotics by using commercially available sensitivity disks. Evidence suggesting linkage of these resistances to plasmids was obtained by "curing" experiments with acridine dyes and high growth temperatures. Examination of plasmid patterns of agarose gel electrophoresis provided further evidence of loss in plasmid DNA under curing conditions in some of the strains examined.

Efficient Double Fragmentation ChIP-seq Provides Nucleotide Resolution Protein-DNA Binding Profiles

NARCIS (Netherlands)

Mokry, Michal; Hatzis, Pantelis; de Bruijn, Ewart; Koster, Jan; Versteeg, Rogier; Schuijers, Jurian; van de Wetering, Marc; Guryev, Victor; Clevers, Hans; Cuppen, Edwin

2010-01-01

Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures. Because these larger fragments may be

cDNA cloning of human DNA topoisomerase I. Catalytic activity of a 67.7-kDa carboxyl-terminal fragment

International Nuclear Information System (INIS)

D'Arpa, P.; Machlin, P.S.; Ratrie, H. III; Rothfield, N.F.; Cleveland, D.W.; Earnshaw, W.C.

1988-01-01

cDNA clones encoding human topoisomerase I were isolated from an expression vector library (λgt11) screened with autoimmune anti-topoisomerase I serum. One of these clones has been expressed as a fusion protein comprised of a 32-kDa fragment of the bacterial TrpE protein linked to 67.7 kDa of protein encoded by the cDNA. Three lines of evidence indicate that the cloned cDNA encodes topoisomerase I. (i) Proteolysis maps of the fusion protein and human nuclear topoisomerase I are essentially identical. (ii) The fusion protein relaxes supercoiled DNA, an activity that can be immunoprecipitated by anti-topoisomerase I serum. (iii) Sequence analysis has revealed that the longest cDNA clone (3645 base pairs) encodes a protein of 765 amino acids that shares 42% identity with Saccharomyces cerevisiae topoisomerase I. The sequence data also show that the catalytically active 67.7-kDa fragment is comprised of the carboxyl terminus

Novel Plasmid Transformation Method Mediated by Chrysotile, Sliding Friction, and Elastic Body Exposure

Directory of Open Access Journals (Sweden)

Naoto Yoshida

2007-01-01

Full Text Available Escherichia coli as a plasmid recipient cell was dispersed in a chrysotile colloidal solution, containing chrysotile adsorbed to plasmid DNA (chrysotile-plasmid cell mixture. Following this, the chrysotile-plasmid cell mixture was dropped onto the surface of an elastic body, such as agarose, and treated physically by sliding a polystyrene streak bar over the elastic body to create friction. Plasmid DNA was easily incorporated into E. coli, and antibiotic resistance was conferred by transformation. The transformation efficiency of E. coli cultured in solid medium was greater than that of E. coli cultured in broth. To obtain greater transformation efficiency, we attempted to determine optimal transformation conditions. The following conditions resulted in the greatest transformation efficiency: the recipient cell concentration within the chrysotileplasmid cell mixture had an optical density greater than or equal to 2 at 550 nm, the vertical reaction force applied to the streak bar was greater than or equal to 40 g, and the rotation speed of the elastic body was greater than or equal to 34 rpm. Under these conditions, we observed a transformation efficiency of 107 per μg plasmid DNA. The advantage of achieving bacterial transformation using the elastic body exposure method is that competent cell preparation of the recipient cell is not required. In addition to E. coli, other Gram negative bacteria are able to acquire plasmid DNA using the elastic body exposure method.

The Roles of Family B and D DNA Polymerases in Thermococcus Species 9°N Okazaki Fragment Maturation*

Science.gov (United States)

Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F.

2015-01-01

During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. PMID:25814667

Application of methylation in improving plasmid transformation into Helicobacter pylori.

Science.gov (United States)

Zhao, Huilin; Xu, Linlin; Rong, Qianyu; Xu, Zheng; Ding, Yunfei; Zhang, Ying; Wu, Yulong; Li, Boqing; Ji, Xiaofei

2018-05-23

Helicobacter pylori is an important gastrointestinal pathogen. Its strains possess different levels of powerful restriction modification systems, which are significant barriers to genetic tools used for studying the role of functional genes in its pathogenesis. Methylating vectors in vitro was reported as an alternative to overcome this barrier in several bacteria. In this study we used two H. pylori-E. coli shuttle plasmids and several single/double-crossover homologous recombination gene-targeting plasmids, to test the role of methylation in H. pylori transformation. According to our results, transformants could be obtained only after shuttle plasmids were methylated before transformation. It is helpful in gene complementation and over-expression although at a low frequency. The frequency of gene-targeting transformation was also increased after methylation, especially for the single-crossover recombination plasmids, the transformants of which could only be obtained after methylation. For the double-crossover recombination targeting plasmids, the initial yield of transformants was 0.3-0.8 × 10 2 CFUs per microgram plasmid DNA. With the help of methylation, the yield was increased to 0.4-1.3 × 10 2 CFUs per microgram plasmid DNA. These results suggest that in vitro methylation can improve H. pylori transformation by different plasmids, which will benefit the pathogenic mechanism research. Copyright © 2018. Published by Elsevier B.V.

Diversity and homogeneity among small plasmids of Aeromonas salmonicida subsp. salmonicida linked with geographical origin

Directory of Open Access Journals (Sweden)

Sabrina A Attéré

2015-11-01

Full Text Available Furunculosis, which is caused by Aeromonas salmonicida subsp. salmonicida, is a major salmonid disease in fish farms worldwide. Several plasmids found in this bacterium confer phenotypes such drug resistance and virulence. Small plasmids (pAsa1, pAsa2, pAsa3, and pAsal1 related to ColE1- and ColE2-type replicons are usually present in its normal plasmidome. In the present study, with the objective to investigate if these plasmids display particularities related to the origin of the isolates bearing them, a total of 153 isolates, including 78 new and 75 previously described, were analyzed for the presence of small plasmids by PCR and DNA restriction fragment profiling. A geographical dichotomy between Canadian and European isolates for their propensity to do not have pAsa3 or pAsal1 was found. In addition, the genotyping analysis led to the identification of two European isolates harboring an unusual pAsal1. An investigation by next-generation sequencing (NGS of these two isolates shed light on two pAsal1 variants (pAsal1C and pAsal1D. As with pAsal1B, another pAsal1 variant previously described, these two new variants bore a second insertion sequence (ISAS5 in addition to the usual ISAS11. The characterization of these variants suggested that they could predominate over the wild-type pAsal1 in stressful conditions such as growth at temperatures of 25°C and above. To obtain a comprehensive portrait of the mutational pressure on small plasmids, 26 isolates whose DNA had been sequenced by NGS were investigated. pAsa3 and pAsal1 were more prone to mutations than pAsa1 and pAsa2, especially in the mobA gene, which encodes a relaxase and a primase. Lastly, the average copy number of each plasmid per cell was assessed using raw sequencing data. A clear trend with respect to the relative proportion per cell of each plasmid was identified. Our large-scale study revealed a geographical dichotomy in small plasmid repertoire in addition to a clear trend

Oncogenic transformation of rat lung epithelioid cells by SV40 DNA and restriction enzyme fragments

International Nuclear Information System (INIS)

Daya-Grosjean, L.; Lasne, C.; Nardeux, P.; Chouroulinkov, I.; Monier, R.

1979-01-01

Rat epithelioid lung cells were transformed with various preparations of SV40 DNA using the Ca 2+ -precipitation technique. The amount of SV40 genetic information integrated into transformed clones was evaluated by DNA-DNA renaturation kinetics. The growth properties on plastic and in soft-agar were examined, as well as the ability to induce tumors in syngeneic newborn animals or in adult nude mice. One particular transformed line, which had received the HpaII/BamHIA (59 per cent) fragment, was found to contain about 3 integrated copies of this fragment per cell and no significant amount of the HpaII/BamHIB (41 per cent fragment). This line which grew to high saturatio densities and efficiently formed clones in low serum on plastic, produced tumors in both syngeneic rats and nude mice. Thus the HpaII/BamHIA fragment, which mainly includes early viral information, was sufficient to impart these properties to rat epithelioid lung cells. (author)

Poly(hydroxyethyl methacrylate) based magnetic nanoparticles for plasmid DNA purification from Escherichia coli lysate

International Nuclear Information System (INIS)

Perçin, Işık; Karakoç, Veyis; Akgöl, Sinan; Aksöz, Erol; Denizli, Adil

2012-01-01

The aim of this study is to prepare poly(hydroxyethyl methacrylate-N-methacryloyl-(L)-histidine) [PHEMAH] magnetic nanoparticles for plasmid DNA (pDNA) purification from Escherichia coli (E. coli) cell lysate. Magnetic nanoparticles were produced by surfactant free emulsion polymerization. mPHEMAH nanoparticles were characterized by elemental analysis, Fourier transform infrared spectroscopy (FTIR), atomic force microscopy (AFM), vibrating sample magnetometer (VSM), electron spin resonance (ESR), thermogravimetric analyses (TGA) and transmission electron microscopy (TEM). Surface area, average particle size and size distribution were also performed. Specific surface area of the mPHEMAH nanoparticles was found to be 1180 m 2 /g. Elemental analysis of MAH for nitrogen was estimated as 0.18 mmol/g polymer. The amount of pDNA adsorbed onto the mPHEMAH nanoparticles first increased and then reached a saturation value at around 1.0 mg/mL of pDNA concentration. Compared with the mPHEMA nanoparticles (50 μg/g polymer), the pDNA adsorption capacity of the mPHEMAH nanoparticles (154 mg/g polymer) was improved significantly due to the MAH incorporation into the polymeric matrix. The maximum pDNA adsorption was achieved at 25 °C. The overall recovery of pDNA was calculated as 92%. The mPHEMAH nanoparticles could be used six times without decreasing the pDNA adsorption capacity significantly. The results indicate that the PHEMAH nanoparticles promise high selectivity for pDNA. - Highlights: ► Magnetic nanoparticles have several advantages over conventional adsorbents. ► MAH acted as the pseudospecific ligand, ligand immobilization step was eliminated. ► pDNA adsorption amount was 154 mg/g. ► Fifty-fold capacity increase was obtained when compared to conventional matrices.

Recombinogenic engineering of conjugative plasmids with fluorescent marker cassettes

DEFF Research Database (Denmark)

Reisner, A.; Molin, Søren; Zechner, E.L.

2002-01-01

An efficient approach for the insertion of fluorescent marker genes with sequence specificity into conjugative plasmids in Escherichia coli is described. For this purpose, homologous recombination of linear double-stranded targeting DNA was mediated by the bacteriophage lambda recombination...... resistance genes and fluorescent markers. The choice of 5' non-homologous extensions in primer pairs used for amplifying the marker cassettes determines the site specificity of the targeting DNA. This methodology is applicable to the modification of all plasmids that replicate in E coli and is not restricted...

Mutation in ESBL Plasmid from Escherichia coli O104:H4 Leads Autoagglutination and Enhanced Plasmid Dissemination

Directory of Open Access Journals (Sweden)

Mickaël Poidevin

2018-02-01

Full Text Available Conjugative plasmids are one of the main driving force of wide-spreading of multidrug resistance (MDR bacteria. They are self-transmittable via conjugation as carrying the required set of genes and cis-acting DNA locus for direct cell-to-cell transfer. IncI incompatibility plasmids are nowadays often associated with extended-spectrum beta-lactamases producing Enterobacteria in clinic and environment. pESBL-EA11 was isolated from Escherichia coli O104:H4 outbreak strain in Germany in 2011. During the previous study identifying transfer genes of pESBL-EA11, it was shown that transposon insertion at certain DNA region of the plasmid, referred to as Hft, resulted in great enhancement of transfer ability. This suggested that genetic modifications can enhance dissemination of MDR plasmids. Such ‘superspreader’ mutations have attracted little attention so far despite their high potential to worsen MDR spreading. Present study aimed to gain our understanding on regulatory elements that involved pESBL transfer. While previous studies of IncI plasmids indicated that immediate downstream gene of Hft, traA, is not essential for conjugative transfer, here we showed that overexpression of TraA in host cell elevated transfer rate of pESBL-EA11. Transposon insertion or certain nucleotide substitutions in Hft led strong TraA overexpression which resulted in activation of essential regulator TraB and likely overexpression of conjugative pili. Atmospheric Scanning Electron Microscopy observation suggested that IncI pili are distinct from other types of conjugative pili (such as long filamentous F-type pili and rather expressed throughout the cell surface. High transfer efficiency in the mutant pESBL-EA11 was involved with hyperpiliation which facilitates cell-to-cell adhesion, including autoagglutination. The capability of plasmids to evolve to highly transmissible mutant is alarming, particularly it might also have adverse effect on host pathogenicity.

Construction and expression of pEgr-sHemopexin recombinant plasmid induced by ionizing radiation in vitro

International Nuclear Information System (INIS)

Wang Guiquan; Jilin Univ., Changchun; Xu Chuanjie; Yang Wen; Piao Chunji; Dong Zhen

2005-01-01

Objective: To clone mouse secretable Hemopexin (sPEX) cDNA, construct pEgr-sPEX recombinant plasmid and detect the expression of recombinant plasmid in B16F10 cells. Methods: Hemopexin cDNA was amplified from the NIH3T3 cells by RT-PCR. After the cDNA identified by sequencing, the pEgr-sPEX recombinant plasmid was constructed and the plasmid was transfected into B16F10 cells with liposome and the expression of PEX induced by ionizing radiation in B16F10 cells was detected by Western blotting. Results: The sequencing results proved the cloned sPEX cDNA to be completely identical with that reported in the GenBank. The mouse sPEX cDNA was inserted correctly into expression vector and expressed successfully. Conclusion: The mouse sPEX cDNA is cloned successfully and it is confirmed that pEgr-sPEX possesses the radiation inducing expression characteristics in vitro. (authors)

Investigation of DNA strand breaks induced by 7Li and 12C ions

International Nuclear Information System (INIS)

Sui Li; Zhao Kui; Ni Meinan; Guo Jiyu; Luo Hongbing; Mei Junping; Lu Xiuqin; Zhou Ping

2004-01-01

Deoxyribonucleic acid (DNA) is an important biomacromolecule. It is a carrier of genetic information and a critical target for radiobiological effects. Numerous lesions have been identified in irradiated DNA. DNA double strand breaks (DSBs) are considered as the most important initial damage of all biological effects induced by ionizing radiation. In this experiment, DNA DSBs induced by heavy ions in the early period were investigated with atomic force microscopy (AFM). Choosing 7 Li and 12 C heavy ions with different LET values delivered by HI-13 tandem accelerator respectively, purified plasmid DNA samples in aqueous solution were irradiated at different doses. AFM was used for nanometer-level-structure analysis of DNA damage induced by these two kinds of heavy ions. Measurement of the DNA fragment lengths was accomplished with the Scion Image analyzed soft-ware. Change laws of three forms of DNA, supercoils, open circular and linear form as dose increased were obtained. Distributed function of DNA fragment length was also obtained, and fitted with Tsallis entropy statistical theory. (author)

The roles of family B and D DNA polymerases in Thermococcus species 9°N Okazaki fragment maturation.

Science.gov (United States)

Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F

2015-05-15

During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Anchoring of self-assembled plasmid DNA/ anti-DNA antibody/cationic lipid micelles on bisphosphonate-modified stent for cardiovascular gene delivery

Directory of Open Access Journals (Sweden)

Ma G

2013-03-01

Full Text Available Guilei Ma,1,# Yong Wang,1,# Ilia Fishbein,2 Mei Yu,1 Linhua Zhang,1 Ivan S Alferiev,2 Jing Yang,1 Cunxian Song,1 Robert J Levy2 1Institute of Biomedical Engineering, Chinese Academy of Medical Sciences and Peking Union Medical College, Tianjin, People's Republic of China; 2Children's Hospital of Philadelphia, Abramson Research Building, Philadelphia, PA, USA #These authors contributed equally to this work Purpose: To investigate the anchoring of plasmid DNA/anti-DNA antibody/cationic lipid tri-complex (DAC micelles onto bisphosphonate-modified 316 L coronary stents for cardiovascular site-specific gene delivery. Methods: Stents were first modified with polyallylamine bisphosphonate (PAA-BP, thereby enabling the retention of a PAA-BP molecular monolayer that permits the anchoring (via vector-binding molecules of DAC micelles. DAC micelles were then chemically linked onto the PAA-BP-modified stents by using N-succinimidyl-3-(2-pyridyldithiol-propionate (SPDP as a crosslinker. Rhodamine-labeled DNA was used to assess the anchoring of DAC micelles, and radioactive-labeled antibody was used to evaluate binding capacity and stability. DAC micelles (encoding green fluorescent protein were tethered onto the PAA-BP-modified stents, which were assessed in cell culture. The presence of a PAA-BP molecular monolayer on the steel surface was confirmed by X-ray photoelectron spectroscopy and atomic force microscope analysis. Results: The anchoring of DAC micelles was generally uniform and devoid of large-scale patches of defects. Isotopic quantification confirmed that the amount of antibody chemically linked on the stents was 17-fold higher than that of the physical adsorbed control stents and its retention time was also significantly longer. In cell culture, numerous green fluorescent protein-positive cells were found on the PAA-BP modified stents, which demonstrated high localization and efficiency of gene delivery. Conclusion: The DAC micelle

Comparative Sequence Analysis of Multidrug-Resistant IncA/C Plasmids from Salmonella enterica.

Science.gov (United States)

Hoffmann, Maria; Pettengill, James B; Gonzalez-Escalona, Narjol; Miller, John; Ayers, Sherry L; Zhao, Shaohua; Allard, Marc W; McDermott, Patrick F; Brown, Eric W; Monday, Steven R

2017-01-01

Determinants of multidrug resistance (MDR) are often encoded on mobile elements, such as plasmids, transposons, and integrons, which have the potential to transfer among foodborne pathogens, as well as to other virulent pathogens, increasing the threats these traits pose to human and veterinary health. Our understanding of MDR among Salmonella has been limited by the lack of closed plasmid genomes for comparisons across resistance phenotypes, due to difficulties in effectively separating the DNA of these high-molecular weight, low-copy-number plasmids from chromosomal DNA. To resolve this problem, we demonstrate an efficient protocol for isolating, sequencing and closing IncA/C plasmids from Salmonella sp. using single molecule real-time sequencing on a Pacific Biosciences (Pacbio) RS II Sequencer. We obtained six Salmonella enterica isolates from poultry, representing six different serovars, each exhibiting the MDR-Ampc resistance profile. Salmonella plasmids were obtained using a modified mini preparation and transformed with Escherichia coli DH10Br. A Qiagen Large-Construct kit™ was used to recover highly concentrated and purified plasmid DNA that was sequenced using PacBio technology. These six closed IncA/C plasmids ranged in size from 104 to 191 kb and shared a stable, conserved backbone containing 98 core genes, with only six differences among those core genes. The plasmids encoded a number of antimicrobial resistance genes, including those for quaternary ammonium compounds and mercury. We then compared our six IncA/C plasmid sequences: first with 14 IncA/C plasmids derived from S. enterica available at the National Center for Biotechnology Information (NCBI), and then with an additional 38 IncA/C plasmids derived from different taxa. These comparisons allowed us to build an evolutionary picture of how antimicrobial resistance may be mediated by this common plasmid backbone. Our project provides detailed genetic information about resistance genes in

Comparative Sequence Analysis of Multidrug-Resistant IncA/C Plasmids from Salmonella enterica

Directory of Open Access Journals (Sweden)

Maria Hoffmann

2017-08-01

Full Text Available Determinants of multidrug resistance (MDR are often encoded on mobile elements, such as plasmids, transposons, and integrons, which have the potential to transfer among foodborne pathogens, as well as to other virulent pathogens, increasing the threats these traits pose to human and veterinary health. Our understanding of MDR among Salmonella has been limited by the lack of closed plasmid genomes for comparisons across resistance phenotypes, due to difficulties in effectively separating the DNA of these high-molecular weight, low-copy-number plasmids from chromosomal DNA. To resolve this problem, we demonstrate an efficient protocol for isolating, sequencing and closing IncA/C plasmids from Salmonella sp. using single molecule real-time sequencing on a Pacific Biosciences (Pacbio RS II Sequencer. We obtained six Salmonella enterica isolates from poultry, representing six different serovars, each exhibiting the MDR-Ampc resistance profile. Salmonella plasmids were obtained using a modified mini preparation and transformed with Escherichia coli DH10Br. A Qiagen Large-Construct kit™ was used to recover highly concentrated and purified plasmid DNA that was sequenced using PacBio technology. These six closed IncA/C plasmids ranged in size from 104 to 191 kb and shared a stable, conserved backbone containing 98 core genes, with only six differences among those core genes. The plasmids encoded a number of antimicrobial resistance genes, including those for quaternary ammonium compounds and mercury. We then compared our six IncA/C plasmid sequences: first with 14 IncA/C plasmids derived from S. enterica available at the National Center for Biotechnology Information (NCBI, and then with an additional 38 IncA/C plasmids derived from different taxa. These comparisons allowed us to build an evolutionary picture of how antimicrobial resistance may be mediated by this common plasmid backbone. Our project provides detailed genetic information about

Construction of adiponectin-encoding plasmid DNA and gene therapy of non-obese type 2 diabetes mellitus.

Science.gov (United States)

Nan, Mei Hua; Park, Jeong-Sook; Myung, Chang-Seon

2010-01-01

Adiponectin (ADN), an insulin-sensitizing adipokine, stimulates glucose uptake, inhibits gluconeogenesis, and plays an important role in improving insulin sensitivity. Since blood levels of ADN are low in type 2 diabetes mellitus (DM), this study was designed to investigate the therapeutic effectiveness of increasing the ADN level through injection of plasmid DNA encoding ADN in type 2 DM. A non-obese type 2 DM mouse model was established via combined administration of streptozotocin with nicotinamide and exhibited significantly higher plasma glucose concentration and insulin resistance compared with normal controls according to oral glucose tolerance and insulin challenge tests. Plasmid DNA encoding mouse ADN from differentiated NIH3T3 adipocytes was constructed in pVAX1 (pVAX/ADN). Transfection of pVAX/ADN into various cell lines including HeLa, HT22, HEK293, HepG2, and SK-Hep1 cells, increased ADN mRNA expression levels in a dose-dependent manner. The administration of pVAX/ADN into non-obese type 2 DM mice via tail vein significantly increased the blood level of ADN and decreased the plasma glucose concentration. Moreover, the parameters related to insulin resistance (HOMA-IR) and insulin sensitivity (QUICKI) were significantly improved. These results suggest that ADN gene therapy could be a clinically effective tool for the treatment of type 2 DM.

Effect of the Plasmid-DNA Vaccination on Macroscopic and Microscopic Damage Caused by the Experimental Chronic Trypanosoma cruzi Infection in the Canine Model

Directory of Open Access Journals (Sweden)

Olivia Rodríguez-Morales

2013-01-01

Full Text Available The dog is considered the main domestic reservoir for Trypanosoma cruzi infection and a suitable experimental animal model to study the pathological changes during the course of Chagas disease (CD. Vaccine development is one of CD prevention methods to protect people at risk. Two plasmids containing genes encoding a trans-sialidase protein (TcSP and an amastigote-specific glycoprotein (TcSSP4 were used as DNA vaccines in a canine model. Splenomegaly was not found in either of the recombinant plasmid-immunized groups; however, cardiomegaly was absent in animals immunized only with the plasmid containing the TcSSP4 gene. The inflammation of subendocardial and myocardial tissues was prevented only with the immunization with TcSSP4 gene. In conclusion, the vaccination with these genes has a partial protective effect on the enlargement of splenic and cardiac tissues during the chronic CD and on microscopic hearth damage, since both plasmids prevented splenomegaly but only one avoided cardiomegaly, and the lesions in heart tissue of dog immunized with plasmid containing the TcSSP4 gene covered only subepicardial tissue.

The effect of swim-up and gradient sperm preparation techniques on deoxyribonucleic acid (DNA) fragmentation in subfertile patients.

Science.gov (United States)

Oguz, Yuksel; Guler, Ismail; Erdem, Ahmet; Mutlu, Mehmet Firat; Gumuslu, Seyhan; Oktem, Mesut; Bozkurt, Nuray; Erdem, Mehmet

2018-03-23

To compare the effect of two different sperm preparation techniques, including swim-up and gradient methods on sperm deoxyribonucleic acid (DNA) fragmentation status of semen samples from unexplained and mild male factor subfertile patients undergoing intrauterine insemination (IUI). A prospective randomized study was conducted in 65 subfertile patients, including 34 unexplained and 31 male factor infertility to compare basal and post-procedure DNA fragmentation rates in swim-up and gradient techniques. Sperm DNA fragmentation rates were evaluated by a sperm chromatin dispersion (SCD) test in two portions of each sample of semen that was prepared with either swim-up or gradient techniques. Sperm motility and morphology were also assessed based on WHO 2010 criteria. Swim-up but not gradient method yielded a statistically significant reduction in the DNA fragmented sperm rate after preparation as compared to basal rates, in the semen samples of both unexplained (41.85 ± 22.04 vs. 28.58 ± 21.93, p gradient) and mild male factor (46.61 ± 19.38 vs. 30.32 ± 18.20, p gradient) subgroups. Swim-up method significantly reduces sperm DNA fragmentation rates and may have some prognostic value on intrauterine insemination in patients with decreased sperm DNA integrity.

Cellulose biodegradation studies: application of rDNA and protoplast fusion techniques

International Nuclear Information System (INIS)

Halos, S.C.; Caday, R.; Claudio, J. University of the Philippines, Diliman, Quezon City . Natural Sciences Research Inst.; Pham, L.J.

1991-01-01

A gene library of cellulomonas DNA digested with Sau3AI was constructed in BamHI site of pBr322. About 300 recombinants were screened for endo glucanase (CMC-ase) production using congo red assay technique. Out of seven CMC-ase positive clones, four were stable in E. coli C600. The plasmids were extracted from these stable clones and re transformed to HB101 and were analysed for cellulase production both intracellularly and extra cellularly. The plasmids were re isolated from HB101 clones and analysed for inserts using 23 restriction enzymes, which indicated inserts in the range of 6.8-12.5Kb. Cloning of sub fragments indicated two different fragments of 2.8 Kb and 3.7 Kb showing complete CMC-ase activity. This indicates the presence of isozymes in Cellulomonas and strengthens the reports on mutagenic expression of cellulase family. (author)

Use of sperm plasmid DNA lipofection combined with REMI (restriction enzyme-mediated insertion) for production of transgenic chickens expressing eGFP (enhanced green fluorescent protein) or human follicle-stimulating hormone.

Science.gov (United States)

Harel-Markowitz, Eliane; Gurevich, Michael; Shore, Laurence S; Katz, Adi; Stram, Yehuda; Shemesh, Mordechai

2009-05-01

Linearized p-eGFP (plasmid-enhanced green fluorescent protein) or p-hFSH (plasmid human FSH) sequences with the corresponding restriction enzyme were lipofected into sperm genomic DNA. Sperm transfected with p-eGFP were used for artificial insemination in hens, and in 17 out of 19 of the resultant chicks, the exogenous DNA was detected in their lymphocytes as determined by PCR and expressed in tissues as determined by (a) PCR, (b) specific emission of green fluorescence by the eGFP, and (c) Southern blot analysis. A complete homology was found between the Aequorea Victoria eGFP DNA and a 313-bp PCR product of extracted DNA from chick blood cells. Following insemination with sperm lipofected with p-hFSH, transgenic offspring were obtained for two generations as determined by detection of the transgene for human FSH (PCR) and expression of the gene (RT-PCR and quantitative real-time PCR) and the presence of the protein in blood (radioimmunoassay). Data demonstrate that lipofection of plasmid DNA with restriction enzyme is a highly efficient method for the production of transfected sperm to produce transgenic offspring by direct artificial insemination.

Is there a relationship between the chromatin status and DNA fragmentation of boar spermatozoa following freezing-thawing?

Science.gov (United States)

Fraser, L; Strzezek, J

2007-07-15

In this study a radioisotope method, which is based on the quantitative measurements of tritiated-labeled actinomycin D ((3)H-AMD) incorporation into the sperm nuclei ((3)H-AMD incorporation assay), was used to assess the chromatin status of frozen-thawed boar spermatozoa. This study also tested the hypothesis that frozen-thawed spermatozoa with altered chromatin were susceptible to DNA fragmentation measured with the neutral comet assay (NCA). Boar semen was diluted in lactose-hen egg yolk-glycerol extender (L-HEY) or lactose ostrich egg yolk lipoprotein fractions-glycerol extender (L-LPFo), packaged into aluminum tubes or plastic straws and frozen in a controlled programmable freezer. In Experiment 1, the chromatin status and DNA fragmentation were measured in fresh and frozen-thawed spermatozoa from the same ejaculates. There was a significant increase in sperm chromatin destabilization and DNA fragmentation in frozen-thawed semen as compared with fresh semen. The proportions of spermatozoa labeled with (3)H-AMD were concurrent with elevated levels of sperm DNA fragmentation in K-3 extender, without cryoprotective substances, compared with L-HEY or L-LPFo extender. Regression analysis revealed that the results of the (3)H-AMD incorporation assay and NCA for frozen-thawed spermatozoa were correlated. Boars differed significantly in terms of post-thaw sperm DNA damage. In Experiment 2, the susceptibility of sperm chromatin to decondensation was assessed using a low concentration of heparin. Treatment of frozen-thawed spermatozoa with heparin revealed enhanced (3)H-AMD binding, suggesting nuclear chromatin decondensation. The deterioration in post-thaw sperm viability, such as motility, mitochondrial function and plasma membrane integrity, was concurrent with increased chromatin instability and DNA fragmentation. This is the first report to show that freezing-thawing procedure facilitated destabilization in the chromatin structure of boar spermatozoa, resulting in

Clusters of DNA induced by ionizing radiation: formation of short DNA fragments. I. Theoretical modeling

Science.gov (United States)

Holley, W. R.; Chatterjee, A.

1996-01-01

We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber comprised of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and delta rays due to knock-on collisions involving energy transfers >100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of OH, H, eaq, etc.; (2) OH attack on sugar molecules leading to strand breaks: (3) OH attack on bases; (4) direct ionization of the sugar molecules leading to strand breaks; (5) direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 bp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. The shapes of the spectra of DNA fragment lengths depend on the symmetries or approximate symmetries of the chromatin structure. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper (B. Rydberg, Radiat, Res. 145, 200-209, 1996) after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the

Cloning in Streptococcus lactis of plasmid-mediated UV resistance and effect on prophage stability

International Nuclear Information System (INIS)

Chopin, M.C.; Chopin, A.; Rouault, A.; Simon, D.

1986-01-01

Plasmid pIL7 (33 kilobases) from Streptococcus lactis enhances UV resistance and prophage stability. A 5.4-kilobase pIL7 fragment carrying genes coding for both characters was cloned into S. lactis, using plasmid pHV1301 as the cloning vector. The recombinant plasmid was subsequently transferred to three other S. lactis strains by transformation or protoplast fusion. Cloned genes were expressed in all tested strains

Poly(hydroxyethyl methacrylate) based magnetic nanoparticles for plasmid DNA purification from Escherichia coli lysate

Energy Technology Data Exchange (ETDEWEB)

Percin, Is Latin-Small-Letter-Dotless-I k [Department of Biology, Hacettepe University, Ankara (Turkey); Karakoc, Veyis [Department of Chemistry, Biochemistry Division, Hacettepe University, Ankara (Turkey); Akgoel, Sinan [Department of Biochemistry, Ege University, Izmir (Turkey); Aksoez, Erol [Department of Biology, Hacettepe University, Ankara (Turkey); Denizli, Adil, E-mail: denizli@hacettepe.edu.tr [Department of Chemistry, Biochemistry Division, Hacettepe University, Ankara (Turkey)

2012-07-01

The aim of this study is to prepare poly(hydroxyethyl methacrylate-N-methacryloyl-(L)-histidine) [PHEMAH] magnetic nanoparticles for plasmid DNA (pDNA) purification from Escherichia coli (E. coli) cell lysate. Magnetic nanoparticles were produced by surfactant free emulsion polymerization. mPHEMAH nanoparticles were characterized by elemental analysis, Fourier transform infrared spectroscopy (FTIR), atomic force microscopy (AFM), vibrating sample magnetometer (VSM), electron spin resonance (ESR), thermogravimetric analyses (TGA) and transmission electron microscopy (TEM). Surface area, average particle size and size distribution were also performed. Specific surface area of the mPHEMAH nanoparticles was found to be 1180 m{sup 2}/g. Elemental analysis of MAH for nitrogen was estimated as 0.18 mmol/g polymer. The amount of pDNA adsorbed onto the mPHEMAH nanoparticles first increased and then reached a saturation value at around 1.0 mg/mL of pDNA concentration. Compared with the mPHEMA nanoparticles (50 {mu}g/g polymer), the pDNA adsorption capacity of the mPHEMAH nanoparticles (154 mg/g polymer) was improved significantly due to the MAH incorporation into the polymeric matrix. The maximum pDNA adsorption was achieved at 25 Degree-Sign C. The overall recovery of pDNA was calculated as 92%. The mPHEMAH nanoparticles could be used six times without decreasing the pDNA adsorption capacity significantly. The results indicate that the PHEMAH nanoparticles promise high selectivity for pDNA. - Highlights: Black-Right-Pointing-Pointer Magnetic nanoparticles have several advantages over conventional adsorbents. Black-Right-Pointing-Pointer MAH acted as the pseudospecific ligand, ligand immobilization step was eliminated. Black-Right-Pointing-Pointer pDNA adsorption amount was 154 mg/g. Black-Right-Pointing-Pointer Fifty-fold capacity increase was obtained when compared to conventional matrices.

Antibiotic resistance and plasmid carriage among Escherichia coli isolates from chicken meat in Malaysia

International Nuclear Information System (INIS)

Tin Tin Myaing; Saleha, A.A.; Arifah, A.K.; Raha, A.R.

2005-01-01

Escherichia coli isolates from 131 raw chicken meat samples were tested for susceptibility to 12 antibiotics. Plasmids were isolated from many samples and their DNA molecular weight calculated. An 81.7% plasmid occurrence rate was observed among the isolates, ranging from 0 to 8 in number and with sizes from 1.2 to 118.6 MDa. Plasmids were detected in 93.8% of E. coIi isolates resistant to all 12 antibiotics, and in 90.5% of E. coli isolates resistant to 11. Three (2.8%) isolates harboured 8 plasmids and were resistant to all 12 antibiotics. Antibiotic resistant genes in bacteria are usually carried in extrachromosomal DNA and it is postulated that E. coli with a high number of plasmids possesses wider resistance to antibiotics. (author)

Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

International Nuclear Information System (INIS)

Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.

1986-01-01

The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

Genetic characterization of plasmid pRJ5 of Staphylococcus aureus compared to plasmid pE194

International Nuclear Information System (INIS)

Oliveira, S.S. de; Freire Bastos, M.C. de

1993-01-01

The pRJ5, a naturally occurring constitutive macrolide, lincosamide and streptogramin B (MLS) resistance plasmid of Staphylococcus aureus, was compared to pE194, a plasmid that confers the inducible phenotype. pRJ5 was stable in all strains of S. aureus tested, even under growth at 43 O C, which distinguished it from pE194 which was shown to be thermo-sensitive for replication. pRJ5, like pE194, was highly unstable in Bacillus subtilis when the cells were grown in nonselective conditions. Multimeric forms of pRJ5 DNA were detected in the few cells of B. subtilis that retained this plasmid. pE194 was transduced by phages φ 11 and φ 443 at frequencies 400 and 20-fold higher, respectively, than pRJ5. Both plasmids were co-transduced with the plasmid pRJ4. pRJ5 was shown to be compatible with pE194. Therefore they belong to distinct Inc groups. Hybridization studies revealed that pRJ5 shares a 1.35 kb region of homology to pE194, which is limited to the erm gene, conferring MLS resistance. (author)

Complete mitochondrial genome sequence of a Middle Pleistocene cave bear reconstructed from ultrashort DNA fragments.

Science.gov (United States)

Dabney, Jesse; Knapp, Michael; Glocke, Isabelle; Gansauge, Marie-Theres; Weihmann, Antje; Nickel, Birgit; Valdiosera, Cristina; García, Nuria; Pääbo, Svante; Arsuaga, Juan-Luis; Meyer, Matthias

2013-09-24

Although an inverse relationship is expected in ancient DNA samples between the number of surviving DNA fragments and their length, ancient DNA sequencing libraries are strikingly deficient in molecules shorter than 40 bp. We find that a loss of short molecules can occur during DNA extraction and present an improved silica-based extraction protocol that enables their efficient retrieval. In combination with single-stranded DNA library preparation, this method enabled us to reconstruct the mitochondrial genome sequence from a Middle Pleistocene cave bear (Ursus deningeri) bone excavated at Sima de los Huesos in the Sierra de Atapuerca, Spain. Phylogenetic reconstructions indicate that the U. deningeri sequence forms an early diverging sister lineage to all Western European Late Pleistocene cave bears. Our results prove that authentic ancient DNA can be preserved for hundreds of thousand years outside of permafrost. Moreover, the techniques presented enable the retrieval of phylogenetically informative sequences from samples in which virtually all DNA is diminished to fragments shorter than 50 bp.

Sequence Analysis of the Cryptic Plasmid pMG101 from Rhodopseudomonas palustris and Construction of Stable Cloning Vectors

Science.gov (United States)

Inui, Masayuki; Roh, Jung Hyeob; Zahn, Kenneth; Yukawa, Hideaki

2000-01-01

A 15-kb cryptic plasmid was obtained from a natural isolate of Rhodopseudomonas palustris. The plasmid, designated pMG101, was able to replicate in R. palustris and in closely related strains of Bradyrhizobium japonicum and phototrophic Bradyrhizobium species. However, it was unable to replicate in the purple nonsulfur bacterium Rhodobacter sphaeroides and in Rhizobium species. The replication region of pMG101 was localized to a 3.0-kb SalI-XhoI fragment, and this fragment was stably maintained in R. palustris for over 100 generations in the absence of selection. The complete nucleotide sequence of this fragment revealed two open reading frames (ORFs), ORF1 and ORF2. The deduced amino acid sequence of ORF1 is similar to sequences of Par proteins, which mediate plasmid stability from certain plasmids, while ORF2 was identified as a putative rep gene, coding for an initiator of plasmid replication, based on homology with the Rep proteins of several other plasmids. The function of these sequences was studied by deletion mapping and gene disruptions of ORF1 and ORF2. pMG101-based Escherichia coli-R. palustris shuttle cloning vectors pMG103 and pMG105 were constructed and were stably maintained in R. palustris growing under nonselective conditions. The ability of plasmid pMG101 to replicate in R. palustris and its close phylogenetic relatives should enable broad application of these vectors within this group of α-proteobacteria. PMID:10618203

Bacterial mitosis: Partitioning protein ParA oscillates in spiral-shaped structures and positions plasmids at mid-cell

DEFF Research Database (Denmark)

Ebersbach, G.; Gerdes, Kenn

2004-01-01

The par2 locus of Escherichia coli plasmid pB171 encodes oscillating ATPase ParA, DNA binding protein ParB and two cis-acting DNA regions to which ParB binds (parC1 and parC2). Three independent techniques were used to investigate the subcellular localization of plasmids carrying par2. In cells......A-GFP oscillated in spiral-shaped structures. Amino acid substitutions in ParA simultaneously abolished ParA spiral formation, oscillation and either plasmid localization or plasmid separation at mid-cell. Therefore, our results suggest that ParA spirals position plasmids at the middle of the bacterial nucleoid...

Amplification of a transcriptionally active DNA sequence in the human brain

International Nuclear Information System (INIS)

Yakovlev, A.G.; Sazonov, A.E.; Spunde, A.Ya.; Gindilis, V.M.

1986-01-01

The authors present their findings of tissue-specific amplification of a DNA fragment actively transcribed in the human brain. This genome fragment was found in the library complement of cDNA of the human brain and evidently belongs to a new class of moderate repetitions of DNA with an unstable copying capacity in the human genome. The authors isolated total cell RNA from various human tissues (brain, placenta), and rat tissues (brain, liver), by the method of hot phenol extraction with guanidine thiocynate. The poly(A + ) RNA fraction was isolated by chromatography. Synthesis of cDNA was done on a matrix of poly(A + ) RNA of human brain. The cDNA obtained was cloned in plasmid pBR322 for the PstI site using (dC/dG) sequences synthesized on the 3' ends of the vector molecule and cDNA respectively. In cloning 75 ng cDNA, the authors obtained approximately 10 5 recombinant. This library was analyzed by the hybridization method on columns with two radioactive ( 32 P) probes: the total cDNA preparation and the total nuclear DNA from the human brain. The number of copies of the cloned DNA fragment in the genome was determined by dot hybridization. Restricting fragments of human and rat DNA genomes homologous to the cloned cDNA were identified on radio-autographs. In each case, 10 micrograms of EcoRI DNA hydrolyzate was fractionated in 1% agarose gel. The probe was also readied with RNA samples fractionated in agarose gel with formaldehyde and transferred to a nitrocellulose filter under weak vacuum. The filter was hybridized with 0.1 micrograms DNA pAG 02, labeled with ( 32 P) to a specific activity of 0.5-1 x 10 9 counts/min x microgram. The autograph was exposed with amplifying screens at -70 0 C for 2 days

Increasing plasmid transformation efficiency of natural spizizen method in Bacillus Subtilis by a cell permeable peptide

Directory of Open Access Journals (Sweden)

Mehrdad Moosazadeh Moghaddam

2013-01-01

Full Text Available Introduction: Some of bacterial species are able to uptake DNA molecule from environment, the yield of this process depends on some conditions such as plasmid size and host type. In the case of Bacillus subtilis, DNA uptake has low efficacy. Using Spizizen minimal medium is common method in plasmid transformation into B. subtilis, but rate of this process is not suitable and noteworthy. The aim of this study was investigation of novel method for improvement of DNA transformation into B. subtilis based on CM11 cationic peptide as a membrane permeable agent.Materials and methods: In this study, for optimization of pWB980 plasmid transformation into B. subtilis, the CM11 cationic peptide was used. For this purpose, B. subtilis competent cell preparation in the present of different concentration of peptide was implemented by two methods. In the first method, after treatment of bacteria with different amount of peptide for 14h, plasmid was added. In the second method, several concentration of peptide with plasmid was exposed to bacteria simultaneously. Bacteria that uptake DNA were screened on LB agar medium containing kanamycin. The total transformed bacteria per microgram of DNA was calculated and compared with the control.Results: Plasmid transformation in best conditions was 6.5 folds higher than the control. This result was statistically significant (P value <0.001.Discussion and conclusion: This study showed that CM11 cationic peptide as a membrane permeable agent was able to increase plasmid transformation rate into B. subtilis. This property was useful for resolution of low transformation efficacy.

Crystallization of DNA fragments from water-salt solutions, containing 2-methylpentane-2,3-diol.

Science.gov (United States)

Osica, V D; Sukharevsky, B Y; Vasilchenko, V N; Verkin, B I; Polyvtsev, O F

1976-09-01

Fragments of calf thymus DNA have been crystallized by precipitation from water-salt solutions, containing 2-methylpentane-2,3-diol (MPD). DNA crystals usually take the form either of spherulites up to 100 mu in diameter or of needles with the length up to 50 mu. No irreversible denaturation of DNA occurs during the crystallization process. X-ray diffraction from dense slurries of DNA crystals yields crystalline powder patterns.

Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein

International Nuclear Information System (INIS)

Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.

1985-01-01

Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, 32 P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV

Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein

Energy Technology Data Exchange (ETDEWEB)

Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.

1985-02-01

Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, /sup 32/P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV.

Plasmid and chromosome segregation in prokaryotes

DEFF Research Database (Denmark)

Møller-Jensen, Jakob; Bugge Jensen, Rasmus; Gerdes, Kenn

2000-01-01

Recent major advances in the understanding of prokaryotic DNA segregation have been achieved by using fluorescence microscopy to visualize the localization of cellular components. Plasmids and bacterial chromosomes are partitioned in a highly dynamic fashion, suggesting the presence of a mitotic...

Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

Science.gov (United States)

Birla, Bhagyashree S; Chou, Hui-Hsien

2015-01-01

Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

Directory of Open Access Journals (Sweden)

Bhagyashree S Birla

Full Text Available Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

Analysis of different DNA fragments of Corynebacterium glutamicum complementing dapE of Escherichia coli.

Science.gov (United States)

Wehrmann, A; Eggeling, L; Sahm, H

1994-12-01

In Corynebacterium glutamicum L-lysine is synthesized simultaneously via the succinylase and dehydrogenase variant of the diaminopimelate pathway. Starting from a strain with a disrupted dehydrogenase gene, three different-sized DNA fragments were isolated which complemented defective Escherichia coli mutants in the succinylase pathway. Enzyme studies revealed that in one case the dehydrogenase gene had apparently been reconstituted in the heterologous host. The two other fragments resulted in desuccinylase activity; one of them additionally in succinylase activity. However, the physical analysis showed that structural changes had taken place in all fragments. Using a probe derived from one of the fragments we isolated a 3.4 kb BamHI DNA fragment without selective pressure (by colony hybridization). This was structurally intact and proved functionally to result in tenfold desuccinylase overexpression. The nucleotide sequence of a 1966 bp fragment revealed the presence of one truncated open reading frame of unknown function and that of dapE encoding N-succinyl diaminopimelate desuccinylase (EC 3.5.1.18). The deduced amino acid sequence of the dapE gene product shares 23% identical residues with that from E. coli. The C. glutamicum gene now available is the first gene from the succinylase branch of lysine synthesis of this biotechnologically important organism.

Nature of defects produced on thymine fragment by gamma irradiation of DNA

International Nuclear Information System (INIS)

Teoule, R.; Bonicel, A.

1975-01-01

A study is reported of the nature of the DNA thymine fragment damage induced by gamma radiation in vitro conditions, by a new method involving hydrolysis in mild conditions. It is highly probable that the main lesions observed in vitro on the DNA polynucleotide chain, namely thymine glycol, 5,6-dihydroxy-5,6-dihydrothymine and 1'-(N-formamidol) deoxyribose, are formed in vivo conditions

Plasmid DNA transfection using magnetite cationic liposomes for construction of multilayered gene-engineered cell sheet.

Science.gov (United States)

Ino, Kosuke; Kawasumi, Tamayo; Ito, Akira; Honda, Hiroyuki

2008-05-01

Modification of cellular functions by overexpression of genes is being increasingly practiced for tissue engineering. In the present study, we investigated whether transfection efficiency could be enhanced by magnetofection that involves the use of plasmid DNA (pDNA)/magnetite cationic liposomes (MCLs) complexes (pDNA/MCL) and magnetic force. The transfection efficiencies of the magnetofection technique by pDNA/MCL in fibroblasts and keratinocytes using reporter genes were 36- and 10-fold higher, respectively, than those of a lipofection technique by cationic liposomes. Moreover, in vitro construction of three-dimensional (3D) tissues is an important challenge. We recently proposed a novel technique termed "magnetic force-based tissue engineering" (Mag-TE) to produce 3D tissues. Since the fibroblasts after magnetofection incorporated both magnetite nanoparticles and pDNA, we investigated whether multilayered heterotypic cell sheets expressing transgene could be fabricated by Mag-TE. First, the fibroblasts were seeded onto an ultra-low attachment culture plate. When a magnet was placed under the plate, the cells accumulated at the bottom of the culture plate. After 24 h of culture, the transgene-expressing cells formed a multilayered cell sheet-like structure. These results indicated that MCLs are a potent biomanipulation tool for both gene transfer and 3D tissue construction, suggesting that these techniques are useful for tissue engineering. Copyright 2007 Wiley Periodicals, Inc.

The characteristics of micrococcus (deinococcus) radiodurans sark plasmids

International Nuclear Information System (INIS)

Sjarief, Sri Hariani; Kikuchi, Masahiro; Watanabe, Hiroshi.

1994-01-01

The characterization of micrococcus (deinococcus) radiodurans sark plasmids. This bacterium has been classified as a new genus deinococcus radiodurans which is resistant to gamma-rays. It can repair itself completely almost all of DNA damages including double strand breaks induced by gamma-rays up to about 5 KGy. To reveal the repair mechanism, several investigations had been done to develop a cloning vector available for the genetic analysis. For this purpose D. radiodurans Sark are to be prepared as a vector by studying the characteristics of its plasmid. Plasmids were isolated by electrophoresis using 0.6% low-melting-temperature agarose in TAE and run for 5.5 hours, followed by the identification. An antibiotic marker was also carried out in this experiment to identify its location in the genetic materials of the cell, beside making a restriction map of the plasmid. Results have shown that D. radiodurans Sark has 4 plasmids (P1, P2, P3, and P4) and the refampicin resistant genes were not found in the plasmid. (authors). 14 refs; 4 figs

A systematic review on sperm DNA fragmentation in male factor infertility: Laboratory assessment

Directory of Open Access Journals (Sweden)

Manesh Kumar Panner Selvam

2018-03-01

Full Text Available Objective: To review sperm DNA fragmentation (SDF testing as an important sperm function test in addition to conventional semen analysis. High SDF is negatively associated with semen quality, the fertilisation process, embryo quality, and pregnancy outcome. Over recent decades, different SDF assays have been developed and reviewed extensively to assess their applicability and accuracy as advanced sperm function tests. Amongst them, the standardisation of the terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL assay with a bench top flow cytometer in clinical practice deserves special mention with a threshold value of 16.8% to differentiate infertile men with DNA damage from fertile men. Materials and methods: A systematic literature search was performed through the PubMed, Medline, and ScienceDirect databases using the keywords ‘sperm DNA fragmentation’ and ‘laboratory assessment’. Non-English articles were excluded and studies related to humans were only included. Results: Of the 618 identified, 87 studies (original research and reviews and in addition eight book chapters meeting the selection criteria were included in this review. In all, 366 articles were rejected in the preliminary screening and a further 165 articles related to non-human subjects were excluded. Conclusion: There are pros and cons to all the available SDF assays. TUNEL is a reliable technique with greater accuracy and as an additional diagnostic test in Andrology laboratories along with basic semen analysis can predict fertility outcome, and thus direct the choice of an assisted reproductive technology procedure for infertile couples. Also, the TUNEL assay can be used as a prognostic test and results are beneficial in deciding personalised treatment for infertile men. Keywords: Sperm DNA fragmentation (SDF, Terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL, DNA damage, Sperm DNA fragmentation (SDF assay

Development and Host Compatibility of Plasmids for Two Important Ruminant Pathogens, Mycoplasma bovis and Mycoplasma agalactiae

Science.gov (United States)

Sharma, Shukriti; Citti, Chistine; Sagné, Eveline; Marenda, Marc S.

2015-01-01

Mycoplasma bovis is a cause of pneumonia, mastitis, arthritis and otitis media in cattle throughout the world. However, despite its clinical significance, there is a paucity of tools to genetically manipulate it, impeding our capacity to further explore the molecular basis of its virulence. To address this limitation, we developed a series of homologous and heterologous replicable plasmids from M. bovis and M. agalactiae. The shortest replicable oriC plasmid based on the region downstream of dnaA in M. bovis was 247 bp and contained two DnaA boxes, while oriC plasmids based on the region downstream of dnaA in M. agalactiae strains 5632 and PG2 were 219 bp and 217 bp in length, respectively, and contained only a single DnaA box. The efficiency of transformation in M. bovis and M. agalactiae was inversely correlated with the size of the oriC region in the construct, and, in general, homologous oriC plasmids had a higher transformation efficiency than heterologous oriC plasmids. The larger pWholeoriC45 and pMM21-7 plasmids integrated into the genomic oriC region of M. bovis, while the smaller oriC plasmids remained extrachromosomal for up to 20 serial passages in selective media. Although specific gene disruptions were not be achieved in M. bovis in this study, the oriC plasmids developed here could still be useful as tools in complementation studies and for expression of exogenous genes in both M. bovis and M. agalactiae. PMID:25746296

Development and host compatibility of plasmids for two important ruminant pathogens, Mycoplasma bovis and Mycoplasma agalactiae.

Directory of Open Access Journals (Sweden)

Shukriti Sharma

Full Text Available Mycoplasma bovis is a cause of pneumonia, mastitis, arthritis and otitis media in cattle throughout the world. However, despite its clinical significance, there is a paucity of tools to genetically manipulate it, impeding our capacity to further explore the molecular basis of its virulence. To address this limitation, we developed a series of homologous and heterologous replicable plasmids from M. bovis and M. agalactiae. The shortest replicable oriC plasmid based on the region downstream of dnaA in M. bovis was 247 bp and contained two DnaA boxes, while oriC plasmids based on the region downstream of dnaA in M. agalactiae strains 5632 and PG2 were 219 bp and 217 bp in length, respectively, and contained only a single DnaA box. The efficiency of transformation in M. bovis and M. agalactiae was inversely correlated with the size of the oriC region in the construct, and, in general, homologous oriC plasmids had a higher transformation efficiency than heterologous oriC plasmids. The larger pWholeoriC45 and pMM21-7 plasmids integrated into the genomic oriC region of M. bovis, while the smaller oriC plasmids remained extrachromosomal for up to 20 serial passages in selective media. Although specific gene disruptions were not be achieved in M. bovis in this study, the oriC plasmids developed here could still be useful as tools in complementation studies and for expression of exogenous genes in both M. bovis and M. agalactiae.

Plasmid-Mediated Quinolone Resistance in Shigella flexneri Isolated From Macaques

Directory of Open Access Journals (Sweden)

Anthony J. Mannion

2018-03-01

Full Text Available Non-human primates (NHPs for biomedical research are commonly infected with Shigella spp. that can cause acute dysentery or chronic episodic diarrhea. These animals are often prophylactically and clinically treated with quinolone antibiotics to eradicate these possible infections. However, chromosomally- and plasmid-mediated antibiotic resistance has become an emerging concern for species in the family Enterobacteriaceae. In this study, five individual isolates of multi-drug resistant Shigella flexneri were isolated from the feces of three macaques. Antibiotic susceptibility testing confirmed resistance or decreased susceptibility to ampicillin, amoxicillin-clavulanic acid, cephalosporins, gentamicin, tetracycline, ciprofloxacin, enrofloxacin, levofloxacin, and nalidixic acid. S. flexneri isolates were susceptible to trimethoprim-sulfamethoxazole, and this drug was used to eradicate infection in two of the macaques. Plasmid DNA from all isolates was positive for the plasmid-encoded quinolone resistance gene qnrS, but not qnrA and qnrB. Conjugation and transformation of plasmid DNA from several S. flexneri isolates into antibiotic-susceptible Escherichia coli strains conferred the recipients with resistance or decreased susceptibility to quinolones and beta-lactams. Genome sequencing of two representative S. flexneri isolates identified the qnrS gene on a plasmid-like contig. These contigs showed >99% homology to plasmid sequences previously characterized from quinolone-resistant Shigella flexneri 2a and Salmonella enterica strains. Other antibiotic resistance genes and virulence factor genes were also identified in chromosome and plasmid sequences in these genomes. The findings from this study indicate macaques harbor pathogenic S. flexneri strains with chromosomally- and plasmid-encoded antibiotic resistance genes. To our knowledge, this is the first report of plasmid-mediated quinolone resistance in S. flexneri isolated from NHPs and warrants

AN IMAGE-ANALYSIS TECHNIQUE FOR DETECTION OF RADIATION-INDUCED DNA FRAGMENTATION AFTER CHEF ELECTROPHORESIS

NARCIS (Netherlands)

ROSEMANN, M; KANON, B; KONINGS, AWT; KAMPINGA, HH

CHEF-electrophoresis was used as a technique to detect radiation-induced DNA breakage with special emphasis to biological relevant X-ray doses (0-10 Gy). Fluorescence detection of DNA-fragments using a sensitive image analysis system was directly compared with conventional scintillation counting of

qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

International Nuclear Information System (INIS)

Jackson, Christopher B.; Gallati, Sabina; Schaller, André

2012-01-01

Highlights: ► Serial qPCR accurately determines fragmentation state of any given DNA sample. ► Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. ► Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. ► Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze–thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA (λ nDNA ) and mtDNA (λ mtDNA ) we present an approach to possibly correct measurements in degraded samples in the future. To our knowledge this is the first time different degradation impact of the two

qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

Energy Technology Data Exchange (ETDEWEB)

Jackson, Christopher B., E-mail: Christopher.jackson@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Gallati, Sabina, E-mail: sabina.gallati@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Schaller, Andre, E-mail: andre.schaller@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland)

2012-07-06

Highlights: Black-Right-Pointing-Pointer Serial qPCR accurately determines fragmentation state of any given DNA sample. Black-Right-Pointing-Pointer Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. Black-Right-Pointing-Pointer Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. Black-Right-Pointing-Pointer Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze-thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA ({lambda}{sub nDNA}) and mtDNA ({lambda}{sub mtDNA}) we present an approach to possibly correct measurements in

Differential diagnosis of genetic disease by DNA restriction fragment length polymorphisms

NARCIS (Netherlands)

Bolhuis, P. A.; Defesche, J. C.; van der Helm, H. J.

1987-01-01

DNA restriction fragment length polymorphisms (RFLPs) are used for diagnosis of genetic disease in families known to be affected by specific disorders, but RFLPs can be also useful for the differential diagnosis of hereditary disease. An RFLP pattern represents the inheritance of chromosomal markers

Identification, characterization and preliminary X-ray diffraction analysis of the rolling-circle replication initiator protein from plasmid pSTK1

International Nuclear Information System (INIS)

Carr, Stephen B.; Mecia, Lauren B.; Phillips, Simon E. V.; Thomas, Christopher D.

2013-01-01

A proteolytically stable fragment of a plasmid replication initiation protein from the thermophile G. stearothermophilus has been biochemically characterized, crystallized and diffraction data collected to a resolution of 2.5 Å. Antibiotic resistance in bacterial pathogens poses an ever-increasing risk to human health. In antibiotic-resistant strains of Staphylococcus aureus this resistance often resides in extra-chromosomal plasmids, such as those of the pT181 family, which replicate via a rolling-circle mechanism mediated by a plasmid-encoded replication initiation protein. Currently, there is no structural information available for the pT181-family Rep proteins. Here, the crystallization of a catalytically active fragment of a homologous replication initiation protein from the thermophile Geobacillus stearothermophilus responsible for the replication of plasmid pSTK1 is reported. Crystals of the RepSTK1 fragment diffracted to a resolution of 2.5 Å and belonged to space group P2 1 2 1 2 1

Inhibition of γ-radiation induced DNA damage in plasmid pBR322 by TMG, a water-soluble derivative of vitamin E

International Nuclear Information System (INIS)

Rajagopalan, R.; Nair, C.K.K.; Wani, K.; Huilgol, N.G.; Kagiya, Tsutomu V.

2002-01-01

Alpha-tocopherol monoglucoside (TMG), a water-soluble derivative of α-tocopherol, has been examined for its ability to protect DNA against radiation-induced strand breaks. Gamma radiation, up to a dose of 6 Gy (dose rate, 0.7 Gy/minute), induced a dose-dependent increase in single strand breaks (SSBs) in plasmid pBR322 DNA. TMG inhibited the formation of γ-radiation induced DNA single strand breaks (SSBs) in a concentration-dependent manner; 500 μM of TMG protected the single strand breaks completely. It also protected thymine glycol formation induced by γ-radiation in a dose-dependent manner, based on an estimation of thymine glycol by HPLC. (author)

Inhibition of gamma-radiation induced DNA damage in plasmid pBR322 by TMG, a water-soluble derivative of vitamin E.

Science.gov (United States)

Rajagopalan, Rema; Wani, Khalida; Huilgol, Nagaraj G; Kagiya, Tsutomu V; Nair, Cherupally K Krishnan

2002-06-01

Alpha-tocopherol monoglucoside (TMG), a water-soluble derivative of alpha-tocopherol, has been examined for its ability to protect DNA against radiation-induced strand breaks. Gamma radiation, up to a dose of 6 Gy (dose rate, 0.7 Gy/minute), induced a dose-dependent increase in single strand breaks (SSBs) in plasmid pBR322 DNA. TMG inhibited the formation of gamma-radiation induced DNA single strand breaks (SSBs) in a concentration-dependent manner; 500 microM of TMG protected the single strand breaks completely. It also protected thymine glycol formation induced by gamma-radiation in a dose-dependent manner, based on an estimation of thymine glycol by HPLC.

Inhibition of {gamma}-radiation induced DNA damage in plasmid pBR322 by TMG, a water-soluble derivative of vitamin E

Energy Technology Data Exchange (ETDEWEB)

Rajagopalan, R.; Nair, C.K.K. [Bhabha Atomic Research Centre, Mumbai (India); Wani, K.; Huilgol, N.G. [Nanavati Hospital and MRC, Vile Parle (India); Kagiya, Tsutomu V. [Kinki Research Foundation, Kyoto (Japan)

2002-06-01

Alpha-tocopherol monoglucoside (TMG), a water-soluble derivative of {alpha}-tocopherol, has been examined for its ability to protect DNA against radiation-induced strand breaks. Gamma radiation, up to a dose of 6 Gy (dose rate, 0.7 Gy/minute), induced a dose-dependent increase in single strand breaks (SSBs) in plasmid pBR322 DNA. TMG inhibited the formation of {gamma}-radiation induced DNA single strand breaks (SSBs) in a concentration-dependent manner; 500 {mu}M of TMG protected the single strand breaks completely. It also protected thymine glycol formation induced by {gamma}-radiation in a dose-dependent manner, based on an estimation of thymine glycol by HPLC. (author)

Salmonella Typhimurium ST213 is associated with two types of IncA/C plasmids carrying multiple resistance determinants.

Science.gov (United States)

Wiesner, Magdalena; Calva, Edmundo; Fernández-Mora, Marcos; Cevallos, Miguel A; Campos, Freddy; Zaidi, Mussaret B; Silva, Claudia

2011-01-11

Salmonella Typhimurium ST213 was first detected in the Mexican Typhimurium population in 2001. It is associated with a multi-drug resistance phenotype and a plasmid-borne blaCMY-2 gene conferring resistance to extended-spectrum cephalosporins. The objective of the current study was to examine the association between the ST213 genotype and blaCMY-2 plasmids. The blaCMY-2 gene was carried by an IncA/C plasmid. ST213 strains lacking the blaCMY-2 gene carried a different IncA/C plasmid. PCR analysis of seven DNA regions distributed throughout the plasmids showed that these IncA/C plasmids were related, but the presence and absence of DNA stretches produced two divergent types I and II. A class 1 integron (dfrA12, orfF and aadA2) was detected in most of the type I plasmids. Type I contained all the plasmids carrying the blaCMY-2 gene and a subset of plasmids lacking blaCMY-2. Type II included all of the remaining blaCMY-2-negative plasmids. A sequence comparison of the seven DNA regions showed that both types were closely related to IncA/C plasmids found in Escherichia, Salmonella, Yersinia, Photobacterium, Vibrio and Aeromonas. Analysis of our Typhimurium strains showed that the region containing the blaCMY-2 gene is inserted between traA and traC as a single copy, like in the E. coli plasmid pAR060302. The floR allele was identical to that of Newport pSN254, suggesting a mosaic pattern of ancestry with plasmids from other Salmonella serovars and E. coli. Only one of the tested strains was able to conjugate the IncA/C plasmid at very low frequencies (10-7 to 10-9). The lack of conjugation ability of our IncA/C plasmids agrees with the clonal dissemination trend suggested by the chromosomal backgrounds and plasmid pattern associations. The ecological success of the newly emerging Typhimurium ST213 genotype in Mexico may be related to the carriage of IncA/C plasmids. We conclude that types I and II of IncA/C plasmids originated from a common ancestor and that the

Highly Effective Non-Viral Antitumor Gene Therapy System Comprised of Biocompatible Small Plasmid Complex Particles Consisting of pDNA, Anionic Polysaccharide, and Fully Deprotected Linear Polyethylenimine

Directory of Open Access Journals (Sweden)

Yoshiyuki Koyama

2015-07-01

Full Text Available We have reported that ternary complexes of plasmid DNA with conventional linear polyethylenimine (l-PEI and certain polyanions were very stably dispersed, and, with no cryoprotectant, they could be freeze-dried and re-hydrated without the loss of transfection ability. These properties enabled the preparation of a concentrated suspension of very small pDNA complex, by preparing the complexes at highly diluted conditions, followed by condensation via lyophilization-and-rehydration procedure. Recently, a high potency linear polyethylenimine having no residual protective groups, i.e., Polyethylenimine “Max” (PEI “Max”, is available, which has been reported to induce much higher gene expression than conventional l-PEI. We tried to prepare the small DNA/PEI “Max”/polyanion complexes by a similar freeze-drying method. Small complex particles could be obtained without apparent aggregation, but transfection activity of the rehydrated complexes was severely reduced. Complex-preparation conditions were investigated in details to achieve the freeze-dried DNA/PEI “Max”/polyanion small ternary complexes with high transfection efficiency. DNA/PEI “Max”/polyanion complexes containing cytokine-coding plasmids were then prepared, and their anti-tumor therapeutic efficacy was examined in tumor-bearing mice.

TbPIF5 is a Trypanosoma brucei mitochondrial DNA helicase involved in processing of minicircle Okazaki fragments.

Directory of Open Access Journals (Sweden)

Beiyu Liu

2009-09-01

Full Text Available Trypanosoma brucei's mitochondrial genome, kinetoplast DNA (kDNA, is a giant network of catenated DNA rings. The network consists of a few thousand 1 kb minicircles and several dozen 23 kb maxicircles. Here we report that TbPIF5, one of T. brucei's six mitochondrial proteins related to Saccharomyces cerevisiae mitochondrial DNA helicase ScPIF1, is involved in minicircle lagging strand synthesis. Like its yeast homolog, TbPIF5 is a 5' to 3' DNA helicase. Together with other enzymes thought to be involved in Okazaki fragment processing, TbPIF5 localizes in vivo to the antipodal sites flanking the kDNA. Minicircles in wild type cells replicate unidirectionally as theta-structures and are unusual in that Okazaki fragments are not joined until after the progeny minicircles have segregated. We now report that overexpression of TbPIF5 causes premature removal of RNA primers and joining of Okazaki fragments on theta structures. Further elongation of the lagging strand is blocked, but the leading strand is completed and the minicircle progeny, one with a truncated H strand (ranging from 0.1 to 1 kb, are segregated. The minicircles with a truncated H strand electrophorese on an agarose gel as a smear. This replication defect is associated with kinetoplast shrinkage and eventual slowing of cell growth. We propose that TbPIF5 unwinds RNA primers after lagging strand synthesis, thus facilitating processing of Okazaki fragments.

Crystallization and preliminary X-ray crystallographic studies on the parD-encoded protein Kid from Escherichia coli plasmid R1

NARCIS (Netherlands)

Hargreaves, D.; Giraldo, R.; Santos-Sierra, S.; Boelens, R.; Rice, D.W.; Díaz Orejas, R.; Rafferty, J.B.

2002-01-01

DNA replication in Escherichia coli and therefore bacterial proliferation relies upon the efficient functioning of the DnaB helicase. The toxin protein Kid from the plasmid-stability system parD encoded on plasmid R1 of E. coli is thought to target and block DnaB-dependent DNA replication. The

Multiple Determinations of Sperm DNA Fragmentation Show That Varicocelectomy Is Not Indicated for Infertile Patients with Subclinical Varicocele

Directory of Open Access Journals (Sweden)

Agustín García-Peiró

2014-01-01

Full Text Available Varicocele is one of the most common causes of low semen quality, which is reflected in high percentages of sperm cells with fragmented DNA. While varicocelectomy is usually performed to ameliorate a patient’s fertility, its impact on sperm DNA integrity in the case of subclinical varicocele is poorly documented. In this study, multiple DNA fragmentation analyses (TUNEL, SCD, and SCSA were performed on semen samples from sixty infertile patients with varicocele (15 clinical varicoceles, 19 clinical varicoceles after surgical treatment, 16 subclinical varicoceles, and 10 subclinical varicoceles after surgical treatment. TUNEL, SCD, and SCSA assays all showed substantial sperm DNA fragmentation levels that were comparable between subclinical and clinical varicocele patients. Importantly, varicocelectomy did improve sperm quality in patients with clinical varicocele; however, this was not the case in patients with subclinical varicocele. In summary, although infertile patients with clinical and subclinical varicocele have similar sperm DNA quality, varicocelectomy should only be advised for patients with clinical varicocele.

Implication of the E. coli K12 uvrA and recA genes in the repair of 8-methoxypsoralen-induced mono adducts and crosslinks on plasmid DNA; Implicacion de los genes uvrA de E. coli K12 en la reparacion de monoaductos y entrecruzamien tos inducidos en DNA plasmidico por 8-metoxipso raleno mas luz ultravioleta A

Energy Technology Data Exchange (ETDEWEB)

Paramio, J M; Bauluz, C; Vidania, R de

1986-07-01

Genotoxicity of psoralen damages on plasmid DNA has been studied. pBR322 DNA was randomly modified with several concentrations of 8-methoxypsoralen plus 365 nm-UV light. After transformation into E. coli strains (wild-type, uvrA and recA) plasmid survival and mutagenesis were analyzed. To study the influence of the SOS response on plasmid recovery, preirradiation of the cells was performed. In absence of cell preirradiation, crosslinks were not repaired in any strain. Mono adducts were also lethal but in part removed by the excision-repair pathway. Preirradiation of the cells significantly. increased plasmid recovery in recA+ celia. In uvrA- only the mutagenic pathway seemed to be involved in the repair of the damaged DNA. Wild type strain showed the highest increase in plasmid survival, involving the repair of mono adducts and some fraction of crosslinks mainly through an error-free repair pathway. This suggests an enhancement of the excision repair promoted by the induction of SOS functions. (Author) 32 refs.

Enhancement of gene expression under hypoxic conditions using fragments of the human vascular endothelial growth factor and the erythropoietin genes

International Nuclear Information System (INIS)

Shibata, Toru; Akiyama, Nobutake; Noda, Makoto; Sasai, Keisuke; Hiraoka, Masahiro

1998-01-01

Purpose: Selective gene expression in response to tumor hypoxia may provide new avenues, not only for radiotherapy and chemotherapy, but also for gene therapy. In this study, we have assessed the extent of hypoxia responsiveness of various DNA constructs by the luciferase assay to help design vectors suitable for cancer therapy. Materials and Methods: Reporter plasmids were constructed with fragments of the human vascular endothelial growth factor (VEGF) and the erythropoietin (Epo) genes encompassing the putative hypoxia-responsive elements (HRE) and the pGL3 promoter vector. Test plasmids and the control pRL-CMV plasmid were cotransfected into tumor cells by the calcium phosphate method. After 6 h hypoxic treatment, the reporter assay was performed. Results: The construct pGL3/VEGF containing the 385 bp fragment of the 5' flanking region in human VEGF gene showed significant increases in luciferase activity in response to hypoxia. The hypoxic/aerobic ratios were about 3-4, and 8-12 for murine and human tumor cells, respectively. Despite the very high degree of conservation among the HREs of mammalian VEGF genes, murine cells showed lower responsiveness than human cells. We next tested the construct pGL3/Epo containing the 150 bp fragment of the 3' flanking region in the Epo gene. Luciferase activity of pGL3/Epo was increased with hypoxia only in human cell lines. The insertion of 5 copies of the 35-bp fragments derived from the VEGF HREs and 32 bp of the E1b minimal promoter resulted in maximal enhancement of hypoxia responsiveness. Conclusions: The constructs with VEGF or Epo fragments containing HRE may be useful for inducing specific gene expression in hypoxic cells. Especially, the application of multiple copies of the HREs and an E1b minimal promoter appears to have the advantage of great improvement in hypoxia responsiveness

A LDR-PCR approach for multiplex polymorphisms genotyping of severely degraded DNA with fragment sizes <100 bp.

Science.gov (United States)

Zhang, Zhen; Wang, Bao-Jie; Guan, Hong-Yu; Pang, Hao; Xuan, Jin-Feng

2009-11-01

Reducing amplicon sizes has become a major strategy for analyzing degraded DNA typical of forensic samples. However, amplicon sizes in current mini-short tandem repeat-polymerase chain reaction (PCR) and mini-sequencing assays are still not suitable for analysis of severely degraded DNA. In this study, we present a multiplex typing method that couples ligase detection reaction with PCR that can be used to identify single nucleotide polymorphisms and small-scale insertion/deletions in a sample of severely fragmented DNA. This method adopts thermostable ligation for allele discrimination and subsequent PCR for signal enhancement. In this study, four polymorphic loci were used to assess the ability of this technique to discriminate alleles in an artificially degraded sample of DNA with fragment sizes <100 bp. Our results showed clear allelic discrimination of single or multiple loci, suggesting that this method might aid in the analysis of extremely degraded samples in which allelic drop out of larger fragments is observed.

Lipophilic Polycation Vehicles Display High Plasmid DNA Delivery to Multiple Cell Types.

Science.gov (United States)

Wu, Yaoying; Smith, Adam E; Reineke, Theresa M

2017-08-16

A class of cationic poly(alkylamidoamine)s (PAAAs) containing lipophilic methylene linkers were designed and examined as in vitro plasmid DNA (pDNA) delivery agents. The PAAAs were synthesized via step-growth polymerization between a diamine monomer and each of four different diacid chloride monomers with varying methylene linker lengths, including glutaryl chloride, adipoyl chloride, pimeloyl chloride, and suberoyl chloride, which served to systematically increase the lipophilicity of the polymers. The synthesized polymers successfully complexed with pDNA in reduced serum medium at N/P ratios of 5 and greater, resulting in polyplexes with hydrodynamic diameters of approximately 1 μm. These polyplexes were tested for in vitro transgene expression and cytotoxicity using HDFa (human dermal fibroblast), HeLa (human cervical carcinoma), HMEC (human mammary epithelial), and HUVEC (human umbilical vein endothelial) cells. Interestingly, select PAAA polyplex formulations were found to be more effective than Lipofectamine 2000 at promoting transgene expression (GFP) while maintaining comparable or higher cell viability. Transgene expression was highest in HeLa cells (∼90% for most formulations) and lowest in HDFa cells (up to ∼20%) as measured by GFP fluorescence. In addition, the cytotoxicity of PAAA polyplex formulations was significantly increased as the molecular weight, N/P ratio, and methylene linker length were increased. The PAAA vehicles developed herein provide a new delivery vehicle design strategy of displaying attributes of both polycations and lipids, which show promise as a tunable scaffold for refining the structure-activity-toxicity profiles for future genome editing studies.

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Analysis of DNA restriction fragments greater than 5.7 Mb in size from the centromeric region of human chromosomes.

Science.gov (United States)

Arn, P H; Li, X; Smith, C; Hsu, M; Schwartz, D C; Jabs, E W

1991-01-01

Pulsed electrophoresis was used to study the organization of the human centromeric region. Genomic DNA was digested with rare-cutting enzymes. DNA fragments from 0.2 to greater than 5.7 Mb were separated by electrophoresis and hybridized with alphoid and simple DNA repeats. Rare-cutting enzymes (Mlu I, Nar I, Not I, Nru I, Sal I, Sfi I, Sst II) demonstrated fewer restriction sites at centromeric regions than elsewhere in the genome. The enzyme Not I had the fewest restriction sites at centromeric regions. As much as 70% of these sequences from the centromeric region are present in Not I DNA fragments greater than 5.7 and estimated to be as large as 10 Mb in size. Other repetitive sequences such as short interspersed repeated segments (SINEs), long interspersed repeated segments (LINEs), ribosomal DNA, and mini-satellite DNA that are not enriched at the centromeric region, are not enriched in Not I fragments of greater than 5.7 Mb in size.

Herpesvirus papio contains a plasmid origin of replication that acts in cis interspecies with an Epstein-Barr virus trans-acting function.

Science.gov (United States)

Pesano, R L; Pagano, J S

1986-01-01

Herpesvirus papio (HVP) and Epstein-Barr virus (EBV) are closely related biologically and biochemically; lymphoblastoid cells infected with either virus contain episomal viral DNA. The putative origin of replication for EBV plasmids (oriP) has been assigned to a 1,790-base-pair fragment (cis) in the short unique region of the genome which requires a viral function supplied in trans from elsewhere in the genome (J. Yates, N. Warren, D. Reisman, and B. Sugden, Proc. Natl. Acad. Sci. USA 81:3806-3810, 1984). We report here the identification of the putative origin of replication (cis) in HVP; we assigned it to the HVP EcoRI K fragment. The results indicate that the HVP replication process requires both a cis and a trans-acting function, analogous to that found in EBV. Images PMID:3023667

Isolation and properties of plasmids from Deinococcus radiodurans Sark

International Nuclear Information System (INIS)

Sjarief, S.H.; Kikuchi, Masahiro; Kurita, Hiromi; Kitayama, Shigeru; Watanabe, Hiroshi.

1990-05-01

Radioresistant bacterium, Deinococcus radiodurans, can repair completely almost all of DNA damages including double strand breaks induced by gamma-rays up to about 5 kGy. In order to reveal the repair mechanism, it is necessary to develop a cloning vector available for the genetic analysis. We tried to isolate plasmids from D.radiodurans Sark strain. In the present paper the isolation and properties of plasmids were described. (author)

Reversible entrapment of plasmid deoxyribonucleic acid on different chromatographic supports.

Science.gov (United States)

Gabor, Boštjan; Černigoj, Urh; Barut, Miloš; Štrancar, Aleš

2013-10-11

HPLC based analytical assay is a powerful technique that can be used to efficiently monitor plasmid DNA (pDNA) purity and quantity throughout the entire purification process. Anion exchange monolithic and non-porous particle based stationary phases were used to study the recovery of the different pDNA isoforms from the analytical column. Three differently sized pDNA molecules of 3.0kbp, 5.2kbp and 14.0kbp were used. Plasmid DNA was injected onto columns under the binding conditions and the separation of the isoforms took place by increasing the ionic strength of the elution buffer. While there was no substantial decrease of the recovered supercoiled and linear isoforms of the pDNA with the increase of the plasmid size and with the increase of the flow rate (recoveries in all cases larger than 75%), a pronounced decrease of the oc isoform recovery was observed. The entrapment of the oc pDNA isoform occurred under non-binding conditions as well. The partial oc isoform elution from the column could be achieved by decreasing the flow rate of the elution mobile phase. The results suggested a reversible entrapment of the oc isoform in the restrictions within the pores of the monolithic material as well as within the intra-particle space of the non-porous particles. This phenomenon was observed on both types of the stationary phase morphologies and could only be connected to the size of a void space through which the pDNA needs to migrate. A prediction of reversible pDNA entrapment was successfully estimated with the calculation of Peclet numbers, Pe, which defines the ratio between a convective and diffusive mass transport. Copyright © 2013 Elsevier B.V. All rights reserved.

Lipofection and nucleofection of substrate plasmid can generate widely different readings of DNA end-joining efficiency in different cell lines.

Science.gov (United States)

Magin, Simon; Saha, Janapriya; Wang, Minli; Mladenova, Veronika; Coym, Nadine; Iliakis, George

2013-02-01

In vivo plasmid end-joining assays are valuable tools for dissecting important qualitative and quantitative aspects of non-homologous end-joining (NHEJ)--a key mechanism for the repair of DNA double-strand breaks (DSBs) in higher eukaryotes. They enable the use of defined DNA ends as substrates for end-joining and the analysis by sequencing of the resulting junctions to identify the repair pathways engaged. Yet, plasmid assays have generated divergent results of end-joining capacity in the same DSB repair mutants when used under different conditions, which implies contributions from undefined and therefore uncontrolled parameters. To help standardize these assays, we searched for parameters underpinning these variations and identified transfection method as an important determinant. Here, we compare a lipid-based transfection method, lipofection, with an electroporation method, nucleofection, and find large, unanticipated and cell line-dependent differences in percent end-joining without recognizable trends. For example, in rodent cells, transfection using lipofection gives nearly WT end-joining in DNA-PKcs mutants and only mildly inhibited end-joining in Lig4 and Ku mutants. In contrast, transfection using nucleofection shows marked end-joining inhibition in all NHEJ mutants tested as compared to the WT. In human HCT116 cells, end-joining after nucleofection is strongly suppressed even in the WT and the differences to the mutants are small. After lipofection, in contrast, end-joining is high in WT cells and markedly suppressed in the mutants. We conclude that better understanding and control of the physicochemical/biological and analytical parameters underpinning these differences will be required to generate with plasmid assays results with quantitative power comparable to that of well-established methods of DSB analysis such as pulsed-field gel electrophoresis or γ-H2AX foci scoring. Until then, caution is needed in the interpretation of the results obtained

A genetic study of a Staphylococus aureus plasmid involving cure and transference

Directory of Open Access Journals (Sweden)

Ana Lúcia Costa Darini

Full Text Available High frequency transfer and elimination of drug resistance may indicate an extrachromosomal inheritance of genetic determinants. This study shows the cure and transfer of a small plasmid and tetracycline resistance in Staphylococcus aureus 1030 (55TetR strains. Several methods are available for plasmid elimination. We used ethidium bromide, an agent that binds to DNA, and thus inhibits DNA polymerase. This caused a high frequency of loss of the small plasmid and resistance to tetracycline. Transfer of tetracycline resistance was done in a mixed culture at a frequency of 10-6. This type of study is very important to physicians and epidemiology investigators and provides better knowledge on antibiotic-resistance mechanisms that may occur in vivo in a hospital environment.

Peroxynitrite modified DNA presents better epitopes for anti-DNA autoantibodies in diabetes type 1 patients.

Science.gov (United States)

Tripathi, Prashant; Moinuddin; Dixit, Kiran; Mir, Abdul Rouf; Habib, Safia; Alam, Khursheed; Ali, Asif

2014-07-01

Peroxynitrite (ONOO(-)), formed by the reaction between nitric oxide (NO) and superoxide (O2(-)), has been implicated in the etiology of numerous disease processes. Peroxynitrite interacts with DNA via direct oxidative reactions or via indirect radical-mediated mechanism. It can inflict both oxidative and nitrosative damages on DNA bases, generating abasic sites, resulting in the single strand breaks. Plasmid pUC 18 isolated from Escherichiacoli was modified with peroxynitrite, generated by quenched flow process. Modifications incurred in plasmid DNA were characterized by ultraviolet and fluorescence spectroscopy, circular dichroism, HPLC and melting temperature studies. Binding characteristics and specificity of antibodies from diabetes patients were analyzed by direct binding and inhibition ELISA. Peroxynitrite modification of pUC 18 plasmid resulted in the formation of strand breaks and base modification. The major compound formed when peroxynitrite reacted with DNA was 8-nitroguanine, a specific marker for peroxynitrite induced DNA damage in inflamed tissues. The concentration of 8-nitroguanine was found to be 3.8 μM. Sera from diabetes type 1 patients from different age groups were studied for their binding to native and peroxynitrite modified plasmid. Direct binding and competitive-inhibition ELISA results showed higher recognition of peroxynitrite modified plasmid, as compared to the native form, by auto-antibodies present in diabetes patients. The preferential recognition of modified plasmid by diabetes autoantibodies was further reiterated by gel shift assay. Experimentally induced anti-peroxynitrite-modified plasmid IgG was used as a probe to detect nitrosative lesions in the DNA isolated from diabetes patients. Copyright © 2014 Elsevier Inc. All rights reserved.

DNA immunisation. New histochemical and morphometric data

Directory of Open Access Journals (Sweden)

D Ehirchiou

2010-01-01

Full Text Available Splenic germinal center reactions were measured during primary response to a plasmidic DNA intramuscular injection. Cardiotoxin-pretreated Balb/c mice were immunized with DNA plasmids encoding or not the SAG1 protein, a membrane antigen of Toxoplasma gondii. Specific anti-SAG1 antibodies were detected on days 16 and 36 after injection of coding plasmids. The results of ELISAs showed that the SAG1-specific antibodies are of the IgG2a class. Morphometric analyses were done on serial immunostained cryosections of spleen and draining or non-draining lymph nodes. This new approach made it possible to evaluate the chronological changes induced by DNA immunisation in the germinal centres (in number and in size. Significant increases in the number of germinal centres were measured in the spleen and only in draining lymph nodes after plasmid injection. the measured changes of the germinal centers appeared to result from the adjuvant stimulatory effect of the plasmidic DNA since both the coding and the noncoding plasmid DNA induced them. No measurable changes were recorded in the Tdependent zone of lymph organs.

Enhanced extraction and purification of plasmid DNA from escherichia coli by applying a hybrid magnetic nanocomposite

Energy Technology Data Exchange (ETDEWEB)

Silva, R.J. da; Chavez-Guajardo, A.E.; Medina-llamas, J.C.; Alcaraz-Espinoza, J.J.; Melo, C.P. de [Universidade Federal de Pernambuco (UFPE), PE (Brazil)

2016-07-01

Full text: Plasmid DNA (pDNA), a special kind of nucleic acid usually found in bacteria, is a small molecule physically distinct from chromosomal DNA that can replicate independently. This genetic material has been used in a wide set of biotechnological methodologies, such as genetic engineering, production of recombinant drugs and gene therapy, among others. In all these applications, the extraction and purification of pDNA appears as a crucial step. In this work, we describe the synthesis of a polyaniline and maghemite (PANI/?-Fe2O3) magnetic nanocomposite (MNC) and its use in a new Escherichia coli (E. coli) pDNA extraction and purification protocol. We have used transmission electron microscopy (TEM), UV-Vis spectroscopy, infrared spectroscopy (FTIR), X-ray diffraction (XRD), dynamic light scattering (DLS) and magnetic measurements to characterize the MNC, which was synthesized through an emulsion polymerization method. The yield, purity and quality of the pDNA extracted by using our proposed MNC protocol were evaluated through UV-Vis, agarose gel electrophoreses and PCR techniques, respectively. After comparing our results to those obtained by use of a commercial kit (Promega Wizard Plus SV Minipreps), we suggest that the novel protocol here proposed appears as a competitive alternative methodology. Not only the purification step can be completed within only 10 min, but the high adsorption capacity of the MNC results in pDNA yields that are almost twice the best values obtained by using the commercial kit. Hence, this new MNC methodology can be of general interest and find widespread use in different types of biomedical applications. (author)

A domain of the Klenow fragment of Escherichia coli DNA polymerase I has polymerase but no exonuclease activity.

Science.gov (United States)

Freemont, P S; Ollis, D L; Steitz, T A; Joyce, C M

1986-09-01

The Klenow fragment of DNA polymerase I from Escherichia coli has two enzymatic activities: DNA polymerase and 3'-5' exonuclease. The crystal structure showed that the fragment is folded into two distinct domains. The smaller domain has a binding site for deoxynucleoside monophosphate and a divalent metal ion that is thought to identify the 3'-5' exonuclease active site. The larger C-terminal domain contains a deep cleft that is believed to bind duplex DNA. Several lines of evidence suggested that the large domain also contains the polymerase active site. To test this hypothesis, we have cloned the DNA coding for the large domain into an expression system and purified the protein product. We find that the C-terminal domain has polymerase activity (albeit at a lower specific activity than the native Klenow fragment) but no measurable 3'-5' exonuclease activity. These data are consistent with the hypothesis that each of the three enzymatic activities of DNA polymerase I from E. coli resides on a separate protein structural domain.

A simple strategy for subcloning and amplifying random multimegabase subchromosomal acentric DNA fragments as double minute chromosomes

International Nuclear Information System (INIS)

Hahn, P.J.; Giddings, L.; Lane, M.J.

1989-01-01

Restriction mapping of relatively large genomes (e.g. human) utilizing randomly generated DNA segments requires high mapping redundancy to successfully organize 'contigs' to represent the entire genome. The number of independent DNA segment maps required is dependent on the average size of a mapping segment; the larger the segment, the fewer required. The authors have developed a strategy for subcloning intact multimegabase subchromosomal fragments as double minute chromosomes. Such fragments could serve as primary mapping elements or as adjunct (linking) fragments to rapidly connect already existent contigs generated using yeast artificial chromosomes or cosmids. They present several lines of evidence supporting the viability of this approach. (1) X-ray treated EMT-6 mouse cells (7.5 Gr.) which are selected over several months with increasing levels of methotrexate (MTX) contain highly amplified circular DNA molecules (double minutes) which include the dihydrofolate reductase (DHFR) gene in a size range between 1,000 and 3,500 kilobases as determined by pulsed-field gel electrophoresis and these acentric chromosomal fragments have been stably maintained in culture for at least a year. (2) Preliminary data based on experiments involving fusion of X-irradiated Chinese Hamster Ovary (CH0 DG44) cells containing randomly inserted cotransfected Neomycin resistance and DHFR genes to mouse EMT-6 cells shows that the linked genes can be readily cotransferred as acentric subchromosomal fragment(s) suitable for gene amplification. (3) The studies of CHO cells with cell fusion transferred X-ray induced chromosomal fragments containing the natural CHO DHFR gene suggest that transferred chromosome fragments undergo gene amplification much more readily than nonfragmented endogenous DHFR genes

[Cleavage of DNA fragments induced by UV nanosecond laser excitation at 193 nm].

Science.gov (United States)

Vtiurina, N N; Grokhovskiĭ, S L; Filimonov, I V; Medvedkov, O I; Nechipurenko, D Iu; Vasil'ev, S A; Nechipurenko, Iu D

2011-01-01

The cleavage of dsDNA fragments in aqueous solution after irradiation with UV laser pulses at 193 nm has been studied. Samples were investigated using polyacrylamide gel electrophoresis. The intensity of damage of particular phosphodiester bond after hot alkali treatment was shown to depend on the base pair sequence. It was established that the probability of cleavage is twice higher for sites of DNA containing two or more successively running guanine residues. A possible mechanism of damage to the DNA molecule connected with the migration of holes along the helix is discussed.

Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins

International Nuclear Information System (INIS)

Tee, Thiam-Tsui; Cheah, Yew-Hoong; Meenakshii, Nallappan; Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie

2012-01-01

Highlights: ► We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. ► Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. ► Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. ► DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. ► DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X L expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.

Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins

Energy Technology Data Exchange (ETDEWEB)

Tee, Thiam-Tsui, E-mail: thiamtsu@yahoo.com [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Cheah, Yew-Hoong [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Bioassay Unit, Herbal Medicine Research Center, Institute for Medical Research, Jalan Pahang, Kuala Lumpur (Malaysia); Meenakshii, Nallappan [Biology Department, Faculty of Science, Universiti Putra Malaysia, 43400 Serdang, Selangor (Malaysia); Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia)

2012-04-20

Highlights: Black-Right-Pointing-Pointer We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. Black-Right-Pointing-Pointer Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. Black-Right-Pointing-Pointer Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. Black-Right-Pointing-Pointer DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. Black-Right-Pointing-Pointer DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X{sub L} expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.

The extended regulatory networks of SXT/R391 integrative and conjugative elements and IncA/C conjugative plasmids.

Science.gov (United States)

Poulin-Laprade, Dominic; Carraro, Nicolas; Burrus, Vincent

2015-01-01

Nowadays, healthcare systems are challenged by a major worldwide drug resistance crisis caused by the massive and rapid dissemination of antibiotic resistance genes and associated emergence of multidrug resistant pathogenic bacteria, in both clinical and environmental settings. Conjugation is the main driving force of gene transfer among microorganisms. This mechanism of horizontal gene transfer mediates the translocation of large DNA fragments between two bacterial cells in direct contact. Integrative and conjugative elements (ICEs) of the SXT/R391 family (SRIs) and IncA/C conjugative plasmids (ACPs) are responsible for the dissemination of a broad spectrum of antibiotic resistance genes among diverse species of Enterobacteriaceae and Vibrionaceae. The biology, diversity, prevalence and distribution of these two families of conjugative elements have been the subject of extensive studies for the past 15 years. Recently, the transcriptional regulators that govern their dissemination through the expression of ICE- or plasmid-encoded transfer genes have been described. Unrelated repressors control the activation of conjugation by preventing the expression of two related master activator complexes in both types of elements, i.e., SetCD in SXT/R391 ICEs and AcaCD in IncA/C plasmids. Finally, in addition to activating ICE- or plasmid-borne genes, these master activators have been shown to specifically activate phylogenetically unrelated mobilizable genomic islands (MGIs) that also disseminate antibiotic resistance genes and other adaptive traits among a plethora of pathogens such as Vibrio cholerae and Salmonella enterica.

The extended regulatory networks of SXT/R391 integrative and conjugative elements and IncA/C conjugative plasmids.

Directory of Open Access Journals (Sweden)

Dominic ePoulin-Laprade

2015-08-01

Full Text Available Nowadays, healthcare systems are challenged by a major worldwide drug resistance crisis caused by the massive and rapid dissemination of antibiotic resistance genes and associated emergence of multidrug resistant pathogenic bacteria, in both clinical and environmental settings. Conjugation is the main driving force of gene transfer among microorganisms. This mechanism of horizontal gene transfer mediates the translocation of large DNA fragments between two bacterial cells in direct contact. Integrative and conjugative elements (ICEs of the SXT/R391 family (SRIs and IncA/C conjugative plasmids (ACPs are responsible for the dissemination of a broad spectrum of antibiotic resistance genes among diverse species of Enterobacteriaceae and Vibrionaceae. The biology, diversity, prevalence and distribution of these two families of conjugative elements have been the subject of extensive studies for the past 15 years. Recently, the transcriptional regulators that govern their dissemination through the expression of ICE- or plasmid-encoded transfer genes have been described. Unrelated repressors control the activation of conjugation by preventing the expression of two related master activator complexes in both types of elements, i.e. SetCD in SXT/R391 ICEs and AcaCD in IncA/C plasmids. Finally, in addition to activating ICE- or plasmid-borne genes, these master activators have been shown to specifically activate phylogenetically unrelated mobilizable genomic islands (MGIs that also disseminate antibiotic resistance genes and other adaptive traits among a plethora of pathogens such as Vibrio cholerae and Salmonella enterica.

Plasmid origin of replication of herpesvirus papio: DNA sequence and enhancer function.

Science.gov (United States)

Loeb, D D; Sung, N S; Pesano, R L; Sexton, C J; Hutchison, C; Pagano, J S

1990-01-01

Herpesvirus papio (HVP) is a lymphotropic virus of baboons which is related to Epstein-Barr virus (EBV) and produces latent infection. The nucleotide sequence of the 5,775-base-pair (bp) EcoRI K fragment of HVP, which has previously been shown to confer the ability to replicate autonomously, has been determined. Within this DNA fragment is a region which bears structural and sequence similarity to the ori-P region of EBV. The HVP ori-P region has a 10- by 26-bp tandem array which is related to the 20- by 30-bp tandem array from the EBV ori-P region. In HVP there is an intervening region of 764 bp followed by five partial copies of the 26-bp monomer. Both the EBV and HVP 3' regions have the potential to form dyad structures which, however, differ in arrangement. We also demonstrate that a transcriptional enhancer which requires transactivation by a virus-encoded factor is present in the HVP ori-P. Images PMID:2159548

Fragmentation of chromatin DNA in mouse thymus cells after whole body γ-irradiation

International Nuclear Information System (INIS)

Wei Kang; Liu Xueying; Zhu Xuefen

1984-01-01

The characteristics of soluble chromatin in mouse thymus nuclei after whole body γ-irradiation were investigated by means of polyacrylamide gel electrophoresis. After deproteinization and electrophoresis eight regular DNA bands were revealed. The molecular weights of these bands were estimated by comparing their migration rates with those of the standard fragments obtained from PBR 322 digested completely by restrictive endonuclease Hae III. The molecular weight of the first band was calculated to be 186 base pairs corresponding approximately to the size of DNA fragment from a single nucleosome, and those of other bands appeared to be its multiples. The results suggested that the disintegration of chromatin DNA after γ-irradiation might have occurred at the linkage regions of chromatin. The autolysis product of normal thymus chromatin under sterile condition were also analyzed and its electrophoretic pattern was found to be just the same as that of the postirradiation product. It seems, therefore, that the endonuclease existing in normal tissues might be responsible for the postirradiation chromatin degradation. The mechanism of this kind of enzymatic digestion remains to be elucidated in further investigation. (author)

Analysis of mutation/rearrangement frequencies and methylation patterns at a given DNA locus using restriction fragment length polymorphism.

Science.gov (United States)

Boyko, Alex; Kovalchuk, Igor

2010-01-01

Restriction fragment length polymorphism (RFLP) is a difference in DNA sequences of organisms belonging to the same species. RFLPs are typically detected as DNA fragments of different lengths after digestion with various restriction endonucleases. The comparison of RFLPs allows investigators to analyze the frequency of occurrence of mutations, such as point mutations, deletions, insertions, and gross chromosomal rearrangements, in the progeny of stressed plants. The assay involves restriction enzyme digestion of DNA followed by hybridization of digested DNA using a radioactively or enzymatically labeled probe. Since DNA can be digested with methylation sensitive enzymes, the assay can also be used to analyze a methylation pattern of a particular locus. Here, we describe RFLP analysis using methylation-insensitive and methylation-sensitive enzymes.

A combined approach of hollow microneedles and nanocarriers for skin immunization with plasmid DNA encoding ovalbumin

Directory of Open Access Journals (Sweden)

Pamornpathomkul B

2017-01-01

Full Text Available Boonnada Pamornpathomkul,1 Adisak Wongkajornsilp,2 Wanida Laiwattanapaisal,3 Theerasak Rojanarata,1 Praneet Opanasopit,1 Tanasait Ngawhirunpat1 1Department of Pharmaceutical Technology, Faculty of Pharmacy, Pharmaceutical Development of Green Innovations Group, Silpakorn University, Nakhon Pathom, 2Department of Pharmacology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, 3Department of Clinical Chemistry, Faculty of Allied Health Sciences, Chulalongkorn University, Bangkok, Thailand Abstract: The aim of this study was to investigate the use of different types of microneedles (MNs and nanocarriers for in vitro skin permeation and in vivo immunization of plasmid DNA encoding ovalbumin (pOVA. In vitro skin permeation studies indicated that hollow MNs had a superior enhancing effect on skin permeation compared with solid MN patches, electroporation (EP patches, the combination of MN and EP patches, and untreated skin. Upon using hollow MNs combined with nanocarriers for pOVA delivery, the skin permeation was higher than for the delivery of naked pOVA, as evidenced by the increased amount of pOVA in Franz diffusion cells and immunoglobulin G (IgG antibody responses. When the hollow MNs were used for the delivery of nanocarrier:pOVA complexes into the skin of mice, they induced a stronger IgG immune response than conventional subcutaneous (SC injections. In addition, immunization of mice with the hollow MNs did not induce signs of skin infection or pinpoint bleeding. Accordingly, the hollow MNs combined with a nanocarrier delivery system is a promising approach for delivering pOVA complexes to the skin for promoting successful immunization. Keywords: hollow microneedle, solid microneedle, electroporation, plasmid DNA encoding ovalbumin, skin immunization, nanocarrier

Electron microscopic observations and DNA chain fragmentation studies on apoptosis in bone tumor cells induced by 153Sm-EDTMP

International Nuclear Information System (INIS)

Zhu Shoupeng; Xiao Dong; Han Xiaofeng

1997-01-01

The morphological changes observed by electron microscopy indicate that after internal irradiation with 153 Sm-EDTMP bone tumor cells displayed feature of apoptosis, such as margination of condensed chromatin, chromatin fragmentation, as well as the membrane bounded apoptotic bodies formation. The quantification analysis of fragmentation DNA for bone tumor cells induced by 153 Sm-EDTMP shows that the DNA fragmentation is enhanced with the prolongation of internally irradiated time. These characteristics suggest that 153 Sm-EDTMP internal irradiation could induce bone tumor cells to go to apoptosis

The technology of large-scale pharmaceutical plasmid purification ...

African Journals Online (AJOL)

STORAGESEVER

2010-01-04

Jan 4, 2010 ... DNA vaccine, the cost of purification must be decreased. Although commonly .... Three mice were killed every 4 days interval. Tissues of heart, liver, .... Now, methods such as chromatography had good prospects in plasmid ...

Second-strand cDNA synthesis: classical method

International Nuclear Information System (INIS)

Gubler, U.

1987-01-01

The classical scheme for the synthesis of double-stranded cDNA as it was reported in 1976 is described. Reverse transcription of mRNA with oligo(dT) as the primer generates first strands with a small loop at the 3' end of the cDNA (the end that corresponds to the 5' end of the mRNA). Subsequent removal of the mRNA by alkaline hydrolysis leaves single-stranded cDNA molecules again with a small 3' loop. This loop can be used by either reverse transcriptase or Klenow fragment of DNA polymerase I as a primer for second-strand synthesis. The resulting products are double-stranded cDNA molecules that are covalently closed at the end corresponding to the 5' end of the original mRNA. Subsequent cleavage of the short piece of single-stranded cDNA within the loop with the single-strand-specific S 1 nuclease generate open double-stranded molecules that can be used for molecular cloning in plasmids or in phage. Useful variations of this scheme have been described

Development of procedures for the identification of human papilloma virus DNA fragments in laser plume

Science.gov (United States)

Woellmer, Wolfgang; Meder, Tom; Jappe, Uta; Gross, Gerd; Riethdorf, Sabine; Riethdorf, Lutz; Kuhler-Obbarius, Christina; Loening, Thomas

1996-01-01

For the investigation of laser plume for the existence of HPV DNA fragments, which possibly occur during laser treatment of virus infected tissue, human papillomas and condylomas were treated in vitro with the CO2-laser. For the sampling of the laser plume a new method for the trapping of the material was developed by use of water-soluble gelatine filters. These samples were analyzed with the polymerase chain reaction (PCR) technique, which was optimized in regard of the gelatine filters and the specific primers. Positive PCR results for HPV DNA fragments up to the size of a complete oncogene were obtained and are discussed regarding infectiousity.

Restriction site extension PCR: a novel method for high-throughput characterization of tagged DNA fragments and genome walking.

Directory of Open Access Journals (Sweden)

Jiabing Ji

Full Text Available BACKGROUND: Insertion mutant isolation and characterization are extremely valuable for linking genes to physiological function. Once an insertion mutant phenotype is identified, the challenge is to isolate the responsible gene. Multiple strategies have been employed to isolate unknown genomic DNA that flanks mutagenic insertions, however, all these methods suffer from limitations due to inefficient ligation steps, inclusion of restriction sites within the target DNA, and non-specific product generation. These limitations become close to insurmountable when the goal is to identify insertion sites in a high throughput manner. METHODOLOGY/PRINCIPAL FINDINGS: We designed a novel strategy called Restriction Site Extension PCR (RSE-PCR to efficiently conduct large-scale isolation of unknown genomic DNA fragments linked to DNA insertions. The strategy is a modified adaptor-mediated PCR without ligation. An adapter, with complementarity to the 3' overhang of the endonuclease (KpnI, NsiI, PstI, or SacI restricted DNA fragments, extends the 3' end of the DNA fragments in the first cycle of the primary RSE-PCR. During subsequent PCR cycles and a second semi-nested PCR (secondary RSE-PCR, touchdown and two-step PCR are combined to increase the amplification specificity of target fragments. The efficiency and specificity was demonstrated in our characterization of 37 tex mutants of Arabidopsis. All the steps of RSE-PCR can be executed in a 96 well PCR plate. Finally, RSE-PCR serves as a successful alternative to Genome Walker as demonstrated by gene isolation from maize, a plant with a more complex genome than Arabidopsis. CONCLUSIONS/SIGNIFICANCE: RSE-PCR has high potential application in identifying tagged (T-DNA or transposon sequence or walking from known DNA toward unknown regions in large-genome plants, with likely application in other organisms as well.

Plasmid DNA studies in Lactobacillus plantarum strains isolated from olive fermentations: production of and immunity to plantaricin OL15 is associated to a 9.6 Kb plasmid (pOL15

Directory of Open Access Journals (Sweden)

Mourad, Kacem

2007-06-01

Full Text Available Previously 12 Lactobacillus plantarum strains were isolated from fermented olives. Among these, only L. plantarum OL15 produced bacteriocin (plantaricin OL15. In this study, the 12 strains were examined for plasmid DNA content. Of these, 9 strains have shown one to three plasmid bands ranging in size from 5.4 to 12.2 kb. L. plantarum OL15 exhibited one plasmid (9.6 kb which was named pOL15. After curing with novobiocin and ethidium bromide, the plasmid profile analysis of non producing derivatives, showed that the 9.6 kb plasmid pOL15 harbored by the parental strain had been lost in all cases and none of them regained the ability to produce plantaricin OL15 suggesting that the production of plantaricin OL15 is plasmid linked. Plantaricin OL15 was not inactived by amylase and lipase suggesting that plantaricin OL15 activity was not dependent on the presence of either a carbohydrate or lipid moiety. Plantaricin OL15 showed activity against lactic acid bacteria of different species and also against olive spoilage and phytopathogenic bacteria, including Pseudomonas and Erwinia.En un estudio previo, se aislaron 12 cepas de Lactobacillus plantarum a partir de aceitunas fermentadas. Entre ellas, solo L. plantarum OL15 produjo bacteriocinas (plantaricin OL15. En este estudio, se examinó el contenido de AND plásmido en las 12 cepas citadas. Entre ellas, 9 cepas han mostrado de una a tres bandas de plásmido con tamaños en el rango de 5.4 a 12.2 kb. L. plantarum OL15 exhibió un plásmido (9.6 kb que se denominó pOL15. Después del curado con novobiocina y bromuro de etidio, la pérdida del plásmido pOL15 asociada a la pérdida de su facultad para producir plantaricin OL15, sugiere que la producción de plantaricina OL15 está ligada al plásmido. La plantaricin OL15 no se inactivó por amilasa ni por lipasa sugiriendo que su actividad no es dependiente de la presencia de carbohidratos o lípidos. La plantaricina OL15 mostró actividad frente a

Production optimisation of a DNA vaccine candidate against ...

African Journals Online (AJOL)

Plasmid DNA (pDNA) vaccines are promising means to prevent and treat infectious diseases, such as leishmaniasis, but immunisation protocols require large amounts of supercoiled plasmid DNA (scpDNA). Although pDNA can be produced at a reasonable cost in bioreactors; this scale of production may not be the best ...

Chromosomal context and replication properties of ARS plasmids in ...

Indian Academy of Sciences (India)

2015-11-28

Nov 28, 2015 ... plasmid but only a subset of them functions as replication origins in their ... except that they are rich in A + T content (As on one strand and Ts .... different unique, terminal, PCR-generated restriction sites used for cloning each fragment are ..... Hall TA 1999 BioEdit: a user-friendly biological sequence align-.

Protein-Nanocrystal Conjugates Support a Single Filament Polymerization Model in R1 Plasmid Segregation

Energy Technology Data Exchange (ETDEWEB)

Choi, Charina L.; Claridge, Shelley A.; Garner, Ethan C.; Alivisatos, A. Paul; Mullins, R. Dyche

2008-07-15

To ensure inheritance by daughter cells, many low-copy number bacterial plasmids, including the R1 drug-resistance plasmid, encode their own DNA segregation systems. The par operon of plasmid R1 directs construction of a simple spindle structure that converts free energy of polymerization of an actin-like protein, ParM, into work required to move sister plasmids to opposite poles of rod-shaped cells. The structures of individual components have been solved, but little is known about the ultrastructure of the R1 spindle. To determine the number of ParM filaments in a minimal R1 spindle, we used DNA-gold nanocrystal conjugates as mimics of the R1 plasmid. Wefound that each end of a single polar ParM filament binds to a single ParR/parC-gold complex, consistent with the idea that ParM filaments bind in the hollow core of the ParR/parC ring complex. Our results further suggest that multifilament spindles observed in vivo are associated with clusters of plasmidssegregating as a unit.

Novel archaeal plasmid pAH1 and its interactions with the lipothrixvirus AFV1

DEFF Research Database (Denmark)

Basta, Tamara; Smyth, John; Forterre, Patrick

2009-01-01

. Although nucleotide sequence comparisons revealed extensive intergenomic exchange during the evolution of archaeal conjugative plasmids, pAH1 was shown to be stably maintained suggesting that the host system is suitable for studying plasmid-virus interactions. AFV1 infection and propagation leads to a loss...... of the circular form of pAH1 and this effect correlates positively with the increase in the intracellular quantity of AFV1 DNA. We infer that the virus inhibits plasmid replication since no pAH1 degradation was observed. This mechanism of archaeal viral inhibition of plasmid propagation is not observed...... in bacteria where relevant bacteriophages either are dependent on a conjugative plasmid for successful infection or are excluded by a resident plasmid....

Effect of pyrimido[1,6-a]benzimidazoles, quinolones, and Ca2+ on the DNA gyrase-mediated cleavage reaction.

Science.gov (United States)

Gmünder, H; Kuratli, K; Keck, W

1995-01-01

The quinolones inhibit the A subunit of DNA gyrase in the presence of Mg2+ by interrupting the DNA breakage and resealing steps, and the latter step is also retarded without quinolones if Mg2+ is replaced by Ca2+. Pyrimido[1,6-a]benzimidazoles have been found to represent a new class of potent DNA gyrase inhibitors which also act at the A subunit. To determine alterations in the DNA sequence specificity of DNA gyrase for cleavage sites in the presence of inhibitors of both classes or in the presence of Ca2+, we used DNA restriction fragments of 164, 85, and 71 bp from the pBR322 plasmid as model substrates. Each contained, at a different position, the 20-bp pBR322 sequence around position 990, where DNA gyrase preferentially cleaves in the presence of quinolones. Our results show that pyrimido[1,6-a]benzimidazoles have a mode of action similar to that of quinolones; they inhibit the resealing step and influence the DNA sequence specificity of DNA gyrase in the same way. Differences between inhibitors of both classes could be observed only in the preferences of DNA gyrase for these cleavage sites. The 20-bp sequence appeared to have some properties that induced DNA gyrase to cleave all three DNA fragments in the presence of inhibitors within this sequence, whereas cleavage in the presence of Ca2+ was in addition dependent on the length of the DNA fragments. PMID:7695300

Sequence context effects on 8-methoxypsoralen photobinding to defined DNA fragments

International Nuclear Information System (INIS)

Sage, E.; Moustacchi, E.

1987-01-01

The photoreaction of 8-methoxypsoralen (8-MOP) with DNA fragments of defined sequence was studied. The authors took advantage of the blockage by bulky adducts of the 3'-5'-exonuclease activity associated with the T4 DNA polymerase. The action of the exonuclease is stopped by biadducts as well as by monoadducts. The termination products were analyzed on sequencing gels. A strong sequence specificity was observed in the DNA photobinding of 8-MOP. The exonuclease terminates its digestion near thymine residues, mainly at potentially cross-linkable sites. There is an increasing reactivity of thymine residues in the order T < TT << TTT in a GC environment. For thymine residues in cross-linkable sites, the reactivity follows the order AT << TA ∼ TAT << ATA < ATAT < ATATAA. Repeated A-T sequences are hot spots for the photochemical reaction of 8-MOP with DNA. Both monoadducts and interstrand cross-links are formed preferentially in 5'-TpA sites. The results highlight the role of the sequence and consequently of the conformation around a potential site in the photobinding of 8-MOP to DNA

Molecular characterization of a complex site-specific radiation-induced DNA double-strand break

International Nuclear Information System (INIS)

Datta, K.; Dizdaroglu, M.; Jaruga, P.; Neumann, R.D.; Winters, T.A.

2003-01-01

Radiation lethality is a function of radiation-induced DNA double-strand breaks (DSB). Current models propose the lethality of a DSB to be a function of its structural complexity. We present here for the first time a map of damage associated with a site-specific double-strand break produced by decay of 125 I in a plasmid bound by a 125 I-labeled triplex forming oligonucleotide ( 125 I-TFO). The E. coli DNA repair enzymes, endonuclease IV (endo IV), endonuclease III (endo III), and formamidopyrimidine-DNA glycosylase (Fpg), which recognize AP sites, and pyrimidine and purine base damage respectively, were used as probes in this study. 125 I-TFO bound plasmid was incubated with and without DMSO at -80 deg C for 1 month. No significant difference in DSB yield was observed under these conditions. A 32 base pair fragment from the upstream side of the decay site was isolated by restriction digestion and enzymatically probed to identify damage sites. Endo IV treatment of the 5'-end labeled upper strand indicated clustering of AP sites within 3 bases downstream and 7 bases upstream of the targeted base. Also, repeated experiments consistently detected an AP site 4 bases upstream of the 125 Itarget base. This was further supported by complementary results with the 3'-end labeled upper strand. Endo IV analysis of the lower strand also shows clustering of AP sites near the DSB end. Endo III and Fpg probing demonstrated that base damage is also clustered near the targeted break site. DSBs produced in the absence of DMSO displayed a different pattern of enzyme sensitive damage than those produced in the presence of DMSO. Identification of specific base damage types within the restriction fragment containing the DSB end was achieved with GC/MS. Base damage consisted of 8-hydroguanine, 8-hydroxyadenine, and 5-hydroxycytosine. These lesions were observed at relative yields of 8-hydroguanine and 5-hydroxycytosine to 8-hydroxyadenine of 7.4:1 and 4.7:1, respectively, in the absence

Extended HSR/CARD domain mediates AIRE binding to DNA

Energy Technology Data Exchange (ETDEWEB)

Maslovskaja, Julia, E-mail: julia.maslovskaja@ut.ee; Saare, Mario; Liiv, Ingrid; Rebane, Ana; Peterson, Pärt

2015-12-25

Autoimmune regulator (AIRE) activates the transcription of many genes in an unusual promiscuous and stochastic manner. The mechanism by which AIRE binds to the chromatin and DNA is not fully understood, and the regulatory elements that AIRE target genes possess are not delineated. In the current study, we demonstrate that AIRE activates the expression of transiently transfected luciferase reporters that lack defined promoter regions, as well as intron and poly(A) signal sequences. Our protein-DNA interaction experiments with mutated AIRE reveal that the intact homogeneously staining region/caspase recruitment domain (HSR/CARD) and amino acids R113 and K114 are key elements involved in AIRE binding to DNA. - Highlights: • Promoter and mRNA processing elements are not important for AIRE to activate gene expression from reporter plasmids. • AIRE protein fragment aa 1–138 mediates direct binding to DNA. • Integrity of the HSR/CARD domain is needed for AIRE binding to DNA.

Extended HSR/CARD domain mediates AIRE binding to DNA

International Nuclear Information System (INIS)

Maslovskaja, Julia; Saare, Mario; Liiv, Ingrid; Rebane, Ana; Peterson, Pärt

2015-01-01

Autoimmune regulator (AIRE) activates the transcription of many genes in an unusual promiscuous and stochastic manner. The mechanism by which AIRE binds to the chromatin and DNA is not fully understood, and the regulatory elements that AIRE target genes possess are not delineated. In the current study, we demonstrate that AIRE activates the expression of transiently transfected luciferase reporters that lack defined promoter regions, as well as intron and poly(A) signal sequences. Our protein-DNA interaction experiments with mutated AIRE reveal that the intact homogeneously staining region/caspase recruitment domain (HSR/CARD) and amino acids R113 and K114 are key elements involved in AIRE binding to DNA. - Highlights: • Promoter and mRNA processing elements are not important for AIRE to activate gene expression from reporter plasmids. • AIRE protein fragment aa 1–138 mediates direct binding to DNA. • Integrity of the HSR/CARD domain is needed for AIRE binding to DNA.

STUDY REGARDING EFFICIENCY OF INDUCED GENETIC TRANSFORMATION IN BACILLUS LICHENIFORMIS WITH PLASMID DNA

Directory of Open Access Journals (Sweden)

T. VINTILĂ

2007-05-01

Full Text Available A strain of Bacillus licheniformis was subject to genetic transformation with plasmid vectors (pLC1 and pNC61, using electroporation technique, protoplast transformation and bivalent cations (CaCl2 mediated transformation. In the case of transformation by electroporation of Bacillus licheniformis B40, the highest number of transformed colonies (3 were obtained only after a 1,79 KV electric shock, for 2,2 milliseconds. Using this transformation technique we have obtained six kanamycin resistant transformants. The frequency of Bacillus licheniformis B40 protoplasts transformation using pLC1 and pNC61 plasmid vectors is approximately 10% (TF = 10%. As a result of pLC1 plasmid integration in Bacillus licheniformis protoplasts, six kanamycin resistant transformants were obtained. The pNC61 plasmid, which confers trimethoprim resistance, does not integrate in receiver cells by protoplast transformation. The direct genetic transformation in the presence of bivalent cations (CaCl2, mediated by pLC1 and pNC61 plasmid vectors, produce a low transformation frequency. Using this technique, we have obtained three trimethoprim resistant colonies and four kanamycin resistant colonies. The chemical way of transformation is the only technique, which realizes the integration of pNC61 in B. licheniformis B40 cells.

Application of DNA-DNA colony hybridization to the detection of catabolic genotypes in environmental samples

International Nuclear Information System (INIS)

Sayler, G.S.; Shields, M.S.; Tedford, E.T.; Breen, A.; Hooper, S.W.; Sirotkin, K.M.; Davis, J.W.

1985-01-01

The application of preexisting DNA hybridization techniques was investigated for potential in determining populations of specific gene sequences in environmental samples. Cross-hybridizations among two degradative plasmids, TOL and NAH, and two cloning vehicles, pLAFR1 and RSF1010, were determined. The detection limits for the TOL plasmid against a nonhomologous plasmid-bearing bacterial background was ascertained. The colony hybridization technique allowed detection of one colony containing TOL plasmid among 10(6) Escherichia coli colonies of nonhomologous DNA. Comparisons between population estimates derived from growth on selective substrates and from hybridizations were examined. Findings indicated that standard sole carbon source enumeration procedures for degradative populations lead to overestimations due to nonspecific growth of other bacteria on the microcontaminant carbon sources present in the media. Population estimates based on the selective growth of a microcosm population on two aromatic substrates (toluene and naphthalene) and estimates derived from DNA-DNA colony hybridizations, using the TOL or NAH plasmid as a probe, corresponded with estimates of substrate mineralization rates and past exposure to environmental contaminants. The applications of such techniques are hoped to eventually allow enumeration of any specific gene sequences in the environment, including both anabolic and catabolic genes. In addition, this procedure should prove useful in monitoring recombinant DNA clones released into environmental situations

In-gel multiple displacement amplification of long DNA fragments diluted to the single molecule level.

Science.gov (United States)

Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi

2008-12-15

The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.

Electron Resonance Decay into a Biological Function: Decrease in Viability of E. coli Transformed by Plasmid DNA Irradiated with 0.5-18 eV Electrons.

Science.gov (United States)

Kouass Sahbani, S; Cloutier, P; Bass, A D; Hunting, D J; Sanche, L

2015-10-01

Transient negative ions (TNIs) are ubiquitous in electron-molecule scattering at low electron impact energies (0-20 eV) and are particularly effective in damaging large biomolecules. Because ionizing radiation generates mostly 0-20 eV electrons, TNIs are expected to play important roles in cell mutagenesis and death during radiotherapeutic cancer treatment, although this hypothesis has never been directly verified. Here, we measure the efficiency of transforming E. coli bacteria by inserting into the cells, pGEM-3ZfL(-) plasmid DNA that confers resistance to the antibiotic ampicillin. Before transformation, plasmids are irradiated with electrons of specific energies between 0.5 and 18 eV. The loss of transformation efficiency plotted as a function of irradiation energy reveals TNIs at 5.5 and 9.5 eV, corresponding to similar states observed in the yields of DNA double strand breaks. We show that TNIs are detectable in the electron-energy dependence of a biological process and can decrease cell viability.

Plasmid-Mediated Antimicrobial Resistance in Staphylococci and Other Firmicutes.

Science.gov (United States)

Schwarz, Stefan; Shen, Jianzhong; Wendlandt, Sarah; Fessler, Andrea T; Wang, Yang; Kadlec, Kristina; Wu, Cong-Ming

2014-12-01

In staphylococci and other Firmicutes, resistance to numerous classes of antimicrobial agents, which are commonly used in human and veterinary medicine, is mediated by genes that are associated with mobile genetic elements. The gene products of some of these antimicrobial resistance genes confer resistance to only specific members of a certain class of antimicrobial agents, whereas others confer resistance to the entire class or even to members of different classes of antimicrobial agents. The resistance mechanisms specified by the resistance genes fall into any of three major categories: active efflux, enzymatic inactivation, and modification/replacement/protection of the target sites of the antimicrobial agents. Among the mobile genetic elements that carry such resistance genes, plasmids play an important role as carriers of primarily plasmid-borne resistance genes, but also as vectors for nonconjugative and conjugative transposons that harbor resistance genes. Plasmids can be exchanged by horizontal gene transfer between members of the same species but also between bacteria belonging to different species and genera. Plasmids are highly flexible elements, and various mechanisms exist by which plasmids can recombine, form cointegrates, or become integrated in part or in toto into the chromosomal DNA or into other plasmids. As such, plasmids play a key role in the dissemination of antimicrobial resistance genes within the gene pool to which staphylococci and other Firmicutes have access. This chapter is intended to provide an overview of the current knowledge of plasmid-mediated antimicrobial resistance in staphylococci and other Firmicutes.

Unique Helicase Determinants in the Essential Conjugative TraI Factor from Salmonella enterica Serovar Typhimurium Plasmid pCU1

Energy Technology Data Exchange (ETDEWEB)

McLaughlin, Krystle J.; Nash, Rebekah P.; Redinbo, Mathew R. (UNC)

2014-06-16

The widespread development of multidrug-resistant bacteria is a major health emergency. Conjugative DNA plasmids, which harbor a wide range of antibiotic resistance genes, also encode the protein factors necessary to orchestrate the propagation of plasmid DNA between bacterial cells through conjugative transfer. Successful conjugative DNA transfer depends on key catalytic components to nick one strand of the duplex DNA plasmid and separate the DNA strands while cell-to-cell transfer occurs. The TraI protein from the conjugative Salmonella plasmid pCU1 fulfills these key catalytic roles, as it contains both single-stranded DNA-nicking relaxase and ATP-dependent helicase domains within a single, 1,078-residue polypeptide. In this work, we unraveled the helicase determinants of Salmonella pCU1 TraI through DNA binding, ATPase, and DNA strand separation assays. TraI binds DNA substrates with high affinity in a manner influenced by nucleic acid length and the presence of a DNA hairpin structure adjacent to the nick site. TraI selectively hydrolyzes ATP, and mutations in conserved helicase motifs eliminate ATPase activity. Surprisingly, the absence of a relatively short (144-residue) domain at the extreme C terminus of the protein severely diminishes ATP-dependent strand separation. Collectively, these data define the helicase motifs of the conjugative factor TraI from Salmonella pCU1 and reveal a previously uncharacterized C-terminal functional domain that uncouples ATP hydrolysis from strand separation activity.

The dose of HBV genome contained plasmid has a great impact on HBV persistence in hydrodynamic injection mouse model.

Science.gov (United States)

Li, Lei; Li, Sheng; Zhou, Yun; Yang, Lu; Zhou, Di; Yang, Yan; Lu, Mengji; Yang, Dongliang; Song, Jingjiao

2017-10-25

Hydrodynamic injection (HI) of hepatitis B virus (HBV) mouse model is an useful tool for HBV related research in vivo. However, only 40% of C57/BL6 mice injected with 10 μg HBV genome contained plasmid (pAAV-HBV1.2), serum HBsAg more than 6 months and none of the BALB/c mice injected with 10 μg pAAV-HBV1.2 plasmid DNA, serum HBsAg positive more than 4 weeks in the previous study. In this study, C57/BL6 and BALB/c mice were hydrodynamic injected with different doses of pAAV-HBV1.2 plasmid DNA. HBV related serum markers were detected by ELISA. ALT levels in the serum were measured using full automated biochemistry analyzer. HBcAg positive cells in the liver were detected by immunohistochemical staining. The mRNA levels of IRF3, ISGs including ISG15, OAS, PKR and immune factors including IFNγ, TNFα, TGFβ, IL-6, IL-10, PDL1 in liver of the mice were quantified by qRT-PCR. The results showed that the mice injected with 100 μg high-concentration or 1 μg low-concentration of pAAV-HBV1.2 plasmid DNA did not excert dominant influence on HBV persistence. In contrast, injection of 5 μg intermediate-dose of pAAV-HBV1.2 plasmid DNA led to significant prolonged HBsAg expression and HBV persistence in both C57/BL6 (80% of the mice with HBsAg positive more than 6 months) and BALB/c (60% of the mice with HBsAg positive more than 3 months) mice. IFNγ was significant up-regulated in liver of the mice injected with 1 μg or 100 μg pAAV-HBV1.2 plasmid DNA. TNFα was up-regulated significantly in liver of the mice injected with 100 μg pAAV-HBV1.2 plasmid DNA. Moreover, PDL1 was significant up-regulated in liver of the mice injected with 5 μg pAAV-HBV1.2 plasmid DNA. In this paper we demonstrated that, in the HBV HI mouse model, the concentration of injected pAAV-HBV1.2 plasmid DNA contributes to the diverse kinetics of HBsAg and HBeAg in the serum as well as HBcAg expression level in the liver, which then determined the HBV persisternce, while the antiviral

Diversity of Clostridium perfringens isolates from various sources and prevalence of conjugative plasmids.

Science.gov (United States)

Park, Miseon; Deck, Joanna; Foley, Steven L; Nayak, Rajesh; Songer, J Glenn; Seibel, Janice R; Khan, Saeed A; Rooney, Alejandro P; Hecht, David W; Rafii, Fatemeh

2016-04-01

Clostridium perfringens is an important pathogen, causing food poisoning and other mild to severe infections in humans and animals. Some strains of C. perfringens contain conjugative plasmids, which may carry antimicrobial resistance and toxin genes. We studied genomic and plasmid diversity of 145 C. perfringens type A strains isolated from soils, foods, chickens, clinical samples, and domestic animals (porcine, bovine and canine), from different geographic areas in the United States between 1994 and 2006, using multiple-locus variable-number tandem repeat analysis (MLVA) and/or pulsed-field gel electrophoresis (PFGE). MLVA detected the genetic diversity in a majority of the isolates. PFGE, using SmaI and KspI, confirmed the MLVA results but also detected differences among the strains that could not be differentiated by MLVA. All of the PFGE profiles of the strains were different, except for a few of the epidemiologically related strains, which were identical. The PFGE profiles of strains isolated from the same domestic animal species were clustered more closely with each other than with other strains. However, a variety of C. perfringens strains with distinct genetic backgrounds were found among the clinical isolates. Variation was also observed in the size and number of plasmids in the strains. Primers for the internal fragment of a conjugative tcpH gene of C. perfringens plasmid pCPF4969 amplified identical size fragments from a majority of strains tested; and this gene hybridized to the various-sized plasmids of these strains. The sequences of the PCR-amplified tcpH genes from 12 strains showed diversity among the tcpH genes. Regardless of the sources of the isolates, the genetic diversity of C. perfringens extended to the plasmids carrying conjugative genes. Published by Elsevier Ltd.

EFFECT OF PROSTATILEN® AC ON SPERM DNA FRAGMENTATION DURING TREATMENT OF PATIENTS WITH CHRONIC NONBACTERIAL PROSTATITIS AND CONCOMITANT DISORDERS OF THE REPRODUCTIVE FUNCTION

Directory of Open Access Journals (Sweden)

S. Yu. Borovets

2017-01-01

Full Text Available The study objective is to analyze the effect of Prostatilen® AC on sperm DNA fragmentation during treatment of patients with chronic nonbacterial prostatitis and concomitant disorders of the reproductive function.Materials and methods. The study is based on the results of treatment of 25 men aged 24 to 45 years (mean age 35.3 ± 4.4 years with a verified diagnosis of chronic nonbacterial prostatitis and complaints of early-stage missed miscarriage in a spouse/sexual partner. All patients received Prostatilen® AC daily in rectal suppositories formulation. The duration of treatment was 10 days with retreatment after 20 days. In all patients before treatment and 20 days after it, spermiogram parameters (5th ed., WHO, 2010 and sperm DNA fragmentation level using SCSA (sperm chromatin structure assay by FACSCantoll with monoclonal antibodies (Roche, Germany were determined, and all patients underwent the MAR (mixed antiglobulin reaction test with normal value considered to be 10 % or less. The normal value of sperm DNA fragmentation was considered to be 15 % or less (low risk of fertility impairment. The analysis of the obtained data was carried out using the IBM SPSS Statistics program 22.Results. Before the treatment, pathologic level of sperm DNA fragmentation was observed in 6 (43 % of 14 patients with normozoospermia and in 7 (63 % of 11 patients with pathozoospermia (χ² = 1.06; p <0.3. Thus, there weren’t any significant difference between the rates of occurrence of increased sperm DNA fragmentation in patients with normo- and pathozoospermia. A correlation was found between the level of sperm DNA fragmentation and the results of MAR test before treatment (r = 0.8, p <0.05, which varied between 0 and 99 % (mean 16.48 ± 31.64 %. Meanwhile, increased sperm DNA fragmentation was observed in 7 (53 % of 13 patients with pathological MAR test results, and in 2 (40 % of 5 patients with normal MAR test results (χ² = 0.67; p <0.01. The level

Screening of degradative plasmids from Arthrobacter sp. HW08 and ...

African Journals Online (AJOL)

Administrator

2011-06-08

Jun 8, 2011 ... Media were solidified, if necessary, by the addition of 15 g agar ... genome extraction reagent kit, plasmid DNA fast extraction kit and. DNA segments ... spectrophotometer (Spectronic Instruments, Rochester, NY) and. SW content .... cultivation on LB slant for 100 times at 30 °C for 2 days, it was found that ...

DNA probes for distinguishing Psychodopygus wellcomei from Psychodopygus complexus (Diptera: Psychodidae

Directory of Open Access Journals (Sweden)

P. D. Ready

1991-03-01

Full Text Available Genomic DNA fragments from males of Psychodopygus wellcomei were isolated and shown to be useful as sensitive diagnostic probles for positively separting individuals of this species from those of Ps. complexus. These two members of the Ps. squamiventris series are found sympatrically in foci of cutaneous leishmaniasis in the hill forests of southern Pará State. Of the two species, only Ps. welcomei is thought to be an important vector of Leishmania braziliensis sensu stricto, buth this is based on circumstantial evidence because of the difficulties of identifying female sandflies wothin the series. The diagnostic probes were isolated from a library of Ps. wellcomei built by ligationg short fragments of Sau 3A-resistricted, genomic DNA into the plasmid vector PUC 18. Differential screening of 1316 library clones with total genomic DNA of Ps. Wellcomei and Ps. complexus identified 5 recombinants, with cross-hybridizing inserts of repetitive DNA, that showed strong specificity for Ps. wellcomei. As little as 0.4% of the DNA extracted from an individual sandfly (=ca. 0.5 namograms was specifically detected. The diagnostic probes were used to identify as Ps. wellcomei a wild-caught female sandfly found infected with L. braziliensis s.s., providing only the second positive association between these two species.

Lactose carrier protein of Escherichia coli. Structure and expression of plasmids carrying the Y gene of the lac operon.

Science.gov (United States)

Teather, R M; Bramhall, J; Riede, I; Wright, J K; Fürst, M; Aichele, G; Wilhelm, U; Overath, P

1980-01-01

The previously described hybrid plasmid pC7 which carries lacI+O+delta(Z)Y+A+ on a 12.3 X 10(6)-Mr DNA fragment [Teather et al. (1978) Mol. Gen. Genet. 159, 239-248] was partially digested with the restriction endonuclease EcoRI under conditions reducing the recognition sequence to d(A-A-T-T) and ligated to the vector pB322. lac Y-carrying inserts of various sized (Mr 1.5-4.7 X 10(6)) were obtained. Hybrid plasmid pTE18 (2300-base-pair insert) carries part of the I (repressor) gene, the promotor-operator region, part of the Z (beta-galactosidase) gene, the Y (lactose carrier) gene and part of the A (transacetylase) gene. Upon induction of pTE18-harbouring strains the Y-gene product is expressed at a nearly constant rate for several generations and accumulates to a level of 12-16% of the total cytoplasmic membrane protein. Integration into the membrane leads to active carrier as judged by binding and transport measurements.

Plasmid metagenomics reveals multiple antibiotic resistance gene classes among the gut microbiomes of hospitalised patients

DEFF Research Database (Denmark)

Jitwasinkul, Tossawan; Suriyaphol, Prapat; Tangphatsornruang, Sithichoke

2016-01-01

Antibiotic resistance genes are rapidly spread between pathogens and the normal flora, with plasmids playing an important role in their circulation. This study aimed to investigate antibiotic resistance plasmids in the gut microbiome of hospitalised patients. Stool samples were collected from seven...... inpatients at Siriraj Hospital (Bangkok, Thailand) and were compared with a sample from a healthy volunteer. Plasmids from the gut microbiomes extracted from the stool samples were subjected to high-throughput DNA sequencing (GS Junior). Newbler-assembled DNA reads were categorised into known and unknown...... in the gut microbiome; however, it was difficult to link these to the antibiotic resistance genes identified. That the antibiotic resistance genes came from hospital and community environments is worrying....

Plasmids and packaging cell lines for use in phage display

Science.gov (United States)

Bradbury, Andrew M.

2012-07-24

The invention relates to a novel phagemid display system for packaging phagemid DNA into phagemid particles which completely avoids the use of helper phage. The system of the invention incorporates the use of bacterial packaging cell lines which have been transformed with helper plasmids containing all required phage proteins but not the packaging signals. The absence of packaging signals in these helper plasmids prevents their DNA from being packaged in the bacterial cell, which provides a number of significant advantages over the use of both standard and modified helper phage. Packaged phagemids expressing a protein or peptide of interest, in fusion with a phage coat protein such as g3p, are generated simply by transfecting phagemid into the packaging cell line.

Molecular characterization of Rhodococcus equi isolates from horses in Poland: pVapA characteristics and plasmid new variant, 85-kb type V.

Science.gov (United States)

Witkowski, Lucjan; Rzewuska, Magdalena; Takai, Shinji; Chrobak-Chmiel, Dorota; Kizerwetter-Świda, Magdalena; Feret, Małgorzata; Gawryś, Marta; Witkowski, Maciej; Kita, Jerzy

2017-01-26

Rhodococcus equi is one of the most significant bacterial pathogens affecting foals up to 6 months of age worldwide. Rhodococcosis is present in Poland however information about molecular characterization of R. equi isolates is scarce. This study describes molecular characterization of Rhodococcus equi infection on 13 horse breeding farms in Poland between 2001 and 2012. Samples were collected by tracheobronchial aspiration from pneumonic foals or during necropsy. The R. equi isolates were genotyped by plasmid profiling and pulsed-field gel electrophoresis. Totally, 58 R. equi isolates were investigated. One isolate lost its plasmid. Among the 57 VapA-positive isolates, 48 contained 85-kb type I plasmid (82.8%), 8 contained 87-kb type I plasmid (13.8%). One isolate (1.7%) had a unique restriction cleavage pattern and the 2nd fragment of EcoRI digests of this plasmid DNA was about 2600 bases smaller than that of the 85 kb type I. This new plasmid variant was designated as the "85-kb type V". Among the 58 isolates typeable with VspI-PFGE, ten PFGE clusters were detected. The majority of foals were infected mostly with isolates of low genetic diversity. Most of clinical isolates of R. equi from foals in Poland contain pVapA 85-kb type I and 87-kb type I similarly to the other European countries and the United States. However, the new variant of pVapA 85-kb type V was identified. The chromosomal variability was detected among some of the investigated isolates and the presence of farm-specific isolates might be possible.

Flexible bent rod model with a saturating induced dipole moment to study the electric linear dichroism of DNA fragments

Directory of Open Access Journals (Sweden)

Jorge A. Bertolotto

2016-06-01

Full Text Available In the present work we make a theoretical study of the steady state electric linear dichroism of DNA fragments in aqueous solution. The here developed theoretical approach considers a flexible bent rod model with a saturating induced dipole moment. The electric polarizability tensor of bent DNA fragments is calculated considering a phenomenological model which theoretical and experimental backgroung is presented here. The model has into account the electric polarizability longitudinal and transversal to the macroion. Molecular flexibility is described using an elastic potential. We consider DNA fragments originally bent with bending fluctuations around an average bending angle. The induced dipole moment is supposed constant once the electric field strength grows up at critical value. To calculate the reduced electric linear dichroism we determine the optical factor considering the basis of the bent DNA perpendicular to the molecular axis. The orientational distribution function has into account the anisotropic electric properties and the molecule flexibility. We applied the present theoretical background to fit electric dichroism experimental data of DNA fragments reported in the bibliography in a wide range of molecular weight and electric field. From these fits, values of DNA physical properties are estimated. We compare and discuss the results here obtained with the theoretical and experimental data presented by other authors. The original contributions of this work are: the inclusion of the transversal electric polarizability saturating with the electric field, the description of the electric properties with an electric polarizability tensor dependant on the bending angle and the use of an arc model originally bent.

Flexible bent rod model with a saturating induced dipole moment to study the electric linear dichroism of DNA fragments

Science.gov (United States)

Bertolotto, Jorge A.; Umazano, Juan P.

2016-06-01

In the present work we make a theoretical study of the steady state electric linear dichroism of DNA fragments in aqueous solution. The here developed theoretical approach considers a flexible bent rod model with a saturating induced dipole moment. The electric polarizability tensor of bent DNA fragments is calculated considering a phenomenological model which theoretical and experimental backgroung is presented here. The model has into account the electric polarizability longitudinal and transversal to the macroion. Molecular flexibility is described using an elastic potential. We consider DNA fragments originally bent with bending fluctuations around an average bending angle. The induced dipole moment is supposed constant once the electric field strength grows up at critical value. To calculate the reduced electric linear dichroism we determine the optical factor considering the basis of the bent DNA perpendicular to the molecular axis. The orientational distribution function has into account the anisotropic electric properties and the molecule flexibility. We applied the present theoretical background to fit electric dichroism experimental data of DNA fragments reported in the bibliography in a wide range of molecular weight and electric field. From these fits, values of DNA physical properties are estimated. We compare and discuss the results here obtained with the theoretical and experimental data presented by other authors. The original contributions of this work are: the inclusion of the transversal electric polarizability saturating with the electric field, the description of the electric properties with an electric polarizability tensor dependant on the bending angle and the use of an arc model originally bent.

DNA fragmentation and nuclear phenotype in tendons exposed to low-intensity infrared laser

Science.gov (United States)

de Paoli, Flavia; Ramos Cerqueira, Larissa; Martins Ramos, Mayara; Campos, Vera M.; Ferreira-Machado, Samara C.; Geller, Mauro; de Souza da Fonseca, Adenilson

2015-03-01

Clinical protocols are recommended in device guidelines outlined for treating many diseases on empirical basis. However, effects of low-intensity infrared lasers at fluences used in clinical protocols on DNA are controversial. Excitation of endogenous chromophores in tissues and free radicals generation could be described as a consequence of laser used. DNA lesions induced by free radicals cause changes in DNA structure, chromatin organization, ploidy degrees and cell death. In this work, we investigated whether low-intensity infrared laser therapy could alter the fibroblasts nuclei characteristics and induce DNA fragmentation. Tendons of Wistar rats were exposed to low-intensity infrared laser (830 nm), at different fluences (1, 5 and 10 J/cm2), in continuous wave (power output of 10mW, power density of 79.6 mW/cm2). Different frequencies were analyzed for the higher fluence (10 J/cm2), at pulsed emission mode (2.5, 250 and 2500 Hz), with the laser source at surface of skin. Geometric, densitometric and textural parameters obtained for Feulgen-stained nuclei by image analysis were used to define nuclear phenotypes. Significant differences were observed on the nuclear phenotype of tendons after exposure to laser, as well as, high cell death percentages was observed for all fluences and frequencies analyzed here, exception 1 J/cm2 fluence. Our results indicate that low-intensity infrared laser can alter geometric, densitometric and textural parameters in tendon fibroblasts nuclei. Laser can also induce DNA fragmentation, chromatin lost and consequently cell death, using fluences, frequencies and emission modes took out from clinical protocols.