Essential Bacillus subtilis genes
DEFF Research Database (Denmark)
Kobayashi, K.; Ehrlich, S.D.; Albertini, A.
2003-01-01
To estimate the minimal gene set required to sustain bacterial life in nutritious conditions, we carried out a systematic inactivation of Bacillus subtilis genes. Among approximate to4,100 genes of the organism, only 192 were shown to be indispensable by this or previous work. Another 79 genes were...... predicted to be essential. The vast majority of essential genes were categorized in relatively few domains of cell metabolism, with about half involved in information processing, one-fifth involved in the synthesis of cell envelope and the determination of cell shape and division, and one-tenth related...... to cell energetics. Only 4% of essential genes encode unknown functions. Most essential genes are present throughout a wide range of Bacteria, and almost 70% can also be found in Archaea and Eucarya. However, essential genes related to cell envelope, shape, division, and respiration tend to be lost from...
Killiny, N; Martinez, R Hernandez; Dumenyo, C Korsi; Cooksey, D A; Almeida, R P P
2013-09-01
Exopolysaccharides (EPS) synthesized by plant-pathogenic bacteria are generally essential for virulence. The role of EPS produced by the vector-transmitted bacterium Xylella fastidiosa was investigated by knocking out two genes implicated in the EPS biosynthesis, gumD and gumH. Mutant strains were affected in growth characteristics in vitro, including adhesion to surfaces and biofilm formation. In addition, different assays were used to demonstrate that the mutant strains produced significantly less EPS compared with the wild type. Furthermore, gas chromatography-mass spectrometry showed that both mutant strains did not produce oligosaccharides. Biologically, the mutants were deficient in movement within plants, resulting in an avirulent phenotype. Additionally, mutant strains were affected in transmission by insects: they were very poorly transmitted by and retained within vectors. The gene expression profile indicated upregulation of genes implicated in cell-to-cell signaling and adhesins while downregulation in genes was required for within-plant movement in EPS-deficient strains. These results suggest an essential role for EPS in X. fastidiosa interactions with both plants and insects.
Freed, Nikki E; Bumann, Dirk; Silander, Olin K
2016-09-06
Gene essentiality - whether or not a gene is necessary for cell growth - is a fundamental component of gene function. It is not well established how quickly gene essentiality can change, as few studies have compared empirical measures of essentiality between closely related organisms. Here we present the results of a Tn-seq experiment designed to detect essential protein coding genes in the bacterial pathogen Shigella flexneri 2a 2457T on a genome-wide scale. Superficial analysis of this data suggested that 481 protein-coding genes in this Shigella strain are critical for robust cellular growth on rich media. Comparison of this set of genes with a gold-standard data set of essential genes in the closely related Escherichia coli K12 BW25113 revealed that an excessive number of genes appeared essential in Shigella but non-essential in E. coli. Importantly, and in converse to this comparison, we found no genes that were essential in E. coli and non-essential in Shigella, implying that many genes were artefactually inferred as essential in Shigella. Controlling for such artefacts resulted in a much smaller set of discrepant genes. Among these, we identified three sets of functionally related genes, two of which have previously been implicated as critical for Shigella growth, but which are dispensable for E. coli growth. The data presented here highlight the small number of protein coding genes for which we have strong evidence that their essentiality status differs between the closely related bacterial taxa E. coli and Shigella. A set of genes involved in acetate utilization provides a canonical example. These results leave open the possibility of developing strain-specific antibiotic treatments targeting such differentially essential genes, but suggest that such opportunities may be rare in closely related bacteria.
Exploring the Optimal Strategy to Predict Essential Genes in Microbes
Directory of Open Access Journals (Sweden)
Yao Lu
2011-12-01
Full Text Available Accurately predicting essential genes is important in many aspects of biology, medicine and bioengineering. In previous research, we have developed a machine learning based integrative algorithm to predict essential genes in bacterial species. This algorithm lends itself to two approaches for predicting essential genes: learning the traits from known essential genes in the target organism, or transferring essential gene annotations from a closely related model organism. However, for an understudied microbe, each approach has its potential limitations. The first is constricted by the often small number of known essential genes. The second is limited by the availability of model organisms and by evolutionary distance. In this study, we aim to determine the optimal strategy for predicting essential genes by examining four microbes with well-characterized essential genes. Our results suggest that, unless the known essential genes are few, learning from the known essential genes in the target organism usually outperforms transferring essential gene annotations from a related model organism. In fact, the required number of known essential genes is surprisingly small to make accurate predictions. In prokaryotes, when the number of known essential genes is greater than 2% of total genes, this approach already comes close to its optimal performance. In eukaryotes, achieving the same best performance requires over 4% of total genes, reflecting the increased complexity of eukaryotic organisms. Combining the two approaches resulted in an increased performance when the known essential genes are few. Our investigation thus provides key information on accurately predicting essential genes and will greatly facilitate annotations of microbial genomes.
Exploring the relationship between fractal features and bacterial essential genes
International Nuclear Information System (INIS)
Yu Yong-Ming; Yang Li-Cai; Zhao Lu-Lu; Liu Zhi-Ping; Zhou Qian
2016-01-01
Essential genes are indispensable for the survival of an organism in optimal conditions. Rapid and accurate identifications of new essential genes are of great theoretical and practical significance. Exploring features with predictive power is fundamental for this. Here, we calculate six fractal features from primary gene and protein sequences and then explore their relationship with gene essentiality by statistical analysis and machine learning-based methods. The models are applied to all the currently available identified genes in 27 bacteria from the database of essential genes (DEG). It is found that the fractal features of essential genes generally differ from those of non-essential genes. The fractal features are used to ascertain the parameters of two machine learning classifiers: Naïve Bayes and Random Forest. The area under the curve (AUC) of both classifiers show that each fractal feature is satisfactorily discriminative between essential genes and non-essential genes individually. And, although significant correlations exist among fractal features, gene essentiality can also be reliably predicted by various combinations of them. Thus, the fractal features analyzed in our study can be used not only to construct a good essentiality classifier alone, but also to be significant contributors for computational tools identifying essential genes. (paper)
High Rate of Chimeric Gene Origination by Retroposition in Plant Genomes
DEFF Research Database (Denmark)
Wang, Wen; Zheng, Hongkung; Fan, Chuanzhu
2006-01-01
Retroposition is widely found to play essential roles in origination of new mammalian and other animal genes. However, the scarcity of retrogenes in plants has led to the assumption that plant genomes rarely evolve new gene duplicates by retroposition, despite abundant retrotransposons in plants......, confirming a previously observed role of retroelements in generating plant retrogenes. Substitution analyses revealed that the vast majority are subject to negative selection, suggesting, along with expression data and evidence of age, that they are likely functional retrogenes. In addition, 42...
Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.
Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L
2013-01-01
The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.
Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.
Directory of Open Access Journals (Sweden)
Linda J Savage
Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles
Patterns of evolutionary conservation of essential genes correlate with their compensability.
Directory of Open Access Journals (Sweden)
Tobias Bergmiller
2012-06-01
Full Text Available Essential genes code for fundamental cellular functions required for the viability of an organism. For this reason, essential genes are often highly conserved across organisms. However, this is not always the case: orthologues of genes that are essential in one organism are sometimes not essential in other organisms or are absent from their genomes. This suggests that, in the course of evolution, essential genes can be rendered nonessential. How can a gene become non-essential? Here we used genetic manipulation to deplete the products of 26 different essential genes in Escherichia coli. This depletion results in a lethal phenotype, which could often be rescued by the overexpression of a non-homologous, non-essential gene, most likely through replacement of the essential function. We also show that, in a smaller number of cases, the essential genes can be fully deleted from the genome, suggesting that complete functional replacement is possible. Finally, we show that essential genes whose function can be replaced in the laboratory are more likely to be non-essential or not present in other taxa. These results are consistent with the notion that patterns of evolutionary conservation of essential genes are influenced by their compensability-that is, by how easily they can be functionally replaced, for example through increased expression of other genes.
Evolutionary diversification of plant shikimate kinase gene duplicates.
Directory of Open Access Journals (Sweden)
Geoffrey Fucile
2008-12-01
Full Text Available Shikimate kinase (SK; EC 2.7.1.71 catalyzes the fifth reaction of the shikimate pathway, which directs carbon from the central metabolism pool to a broad range of secondary metabolites involved in plant development, growth, and stress responses. In this study, we demonstrate the role of plant SK gene duplicate evolution in the diversification of metabolic regulation and the acquisition of novel and physiologically essential function. Phylogenetic analysis of plant SK homologs resolves an orthologous cluster of plant SKs and two functionally distinct orthologous clusters. These previously undescribed genes, shikimate kinase-like 1 (SKL1 and -2 (SKL2, do not encode SK activity, are present in all major plant lineages, and apparently evolved under positive selection following SK gene duplication over 400 MYA. This is supported by functional assays using recombinant SK, SKL1, and SKL2 from Arabidopsis thaliana (At and evolutionary analyses of the diversification of SK-catalytic and -substrate binding sites based on theoretical structure models. AtSKL1 mutants yield albino and novel variegated phenotypes, which indicate SKL1 is required for chloroplast biogenesis. Extant SKL2 sequences show a strong genetic signature of positive selection, which is enriched in a protein-protein interaction module not found in other SK homologs. We also report the first kinetic characterization of plant SKs and show that gene expression diversification among the AtSK inparalogs is correlated with developmental processes and stress responses. This study examines the functional diversification of ancient and recent plant SK gene duplicates and highlights the utility of SKs as scaffolds for functional innovation.
Energy Technology Data Exchange (ETDEWEB)
Yang, Jianming [Key Lab of Applied Mycology, College of Life Sciences, Qingdao Agricultural University, Qingdao Shandong Province People' s Republic of China; Department of Microbiology, University of Washington, Seattle WA USA; Yin, Liang [Department of Microbiology, University of Washington, Seattle WA USA; Lessner, Faith H. [Department of Biological Sciences, University of Arkansas, Fayetteville AR USA; Nakayasu, Ernesto S. [Biological Sciences Division, Pacific Northwest National Laboratory, Richland WA USA; Payne, Samuel H. [Biological Sciences Division, Pacific Northwest National Laboratory, Richland WA USA; Fixen, Kathryn R. [Department of Microbiology, University of Washington, Seattle WA USA; Gallagher, Larry [Department of Genome Sciences, University of Washington, Seattle WA USA; Harwood, Caroline S. [Department of Microbiology, University of Washington, Seattle WA USA
2017-07-24
Anoxygenic purple phototrophic bacteria have served as important models for studies of photophosphorylation. The pigment-protein complexes responsible for converting light energy to ATP are relatively simple and these bacteria can grow heterotrophically under aerobic conditions, thus allowing for the study of mutants defective in photophosphorylation. In the past, genes responsible for anoxygenic phototrophic growth have been identified in a number of different bacterial species. Here we systematically studied the genetic basis for this metabolism by using Tn-seq to identify genes essential for the anaerobic growth of the purple bacterium Rhodopseudomonas palustris on acetate in light. We identified 171 genes required for growth in this condition, 35 of which are annotated as photosynthesis genes. Among these are a few new genes not previously shown to be essential for phototrophic growth. We verified the essentiality of many of the genes we identified by analyzing the phenotypes of mutants we generated by Tn mutagenesis that had altered pigmentation. We used directed mutagenesis to verify that the R. palustris NADH:quinone oxidoreductase complex IE is essential for phototrophic growth. As a complement to the genetic data, we carried out proteomics experiments in which we found that 429 proteins were present in significantly higher amounts in cells grown anaerobically in light compared to aerobically. Among these were proteins encoded by subset of the phototrophic growth-essential genes.
Directory of Open Access Journals (Sweden)
DasSarma Shiladitya
2007-06-01
Full Text Available Abstract Background Information transfer systems in Archaea, including many components of the DNA replication machinery, are similar to those found in eukaryotes. Functional assignments of archaeal DNA replication genes have been primarily based upon sequence homology and biochemical studies of replisome components, but few genetic studies have been conducted thus far. We have developed a tractable genetic system for knockout analysis of genes in the model halophilic archaeon, Halobacterium sp. NRC-1, and used it to determine which DNA replication genes are essential. Results Using a directed in-frame gene knockout method in Halobacterium sp. NRC-1, we examined nineteen genes predicted to be involved in DNA replication. Preliminary bioinformatic analysis of the large haloarchaeal Orc/Cdc6 family, related to eukaryotic Orc1 and Cdc6, showed five distinct clades of Orc/Cdc6 proteins conserved in all sequenced haloarchaea. Of ten orc/cdc6 genes in Halobacterium sp. NRC-1, only two were found to be essential, orc10, on the large chromosome, and orc2, on the minichromosome, pNRC200. Of the three replicative-type DNA polymerase genes, two were essential: the chromosomally encoded B family, polB1, and the chromosomally encoded euryarchaeal-specific D family, polD1/D2 (formerly called polA1/polA2 in the Halobacterium sp. NRC-1 genome sequence. The pNRC200-encoded B family polymerase, polB2, was non-essential. Accessory genes for DNA replication initiation and elongation factors, including the putative replicative helicase, mcm, the eukaryotic-type DNA primase, pri1/pri2, the DNA polymerase sliding clamp, pcn, and the flap endonuclease, rad2, were all essential. Targeted genes were classified as non-essential if knockouts were obtained and essential based on statistical analysis and/or by demonstrating the inability to isolate chromosomal knockouts except in the presence of a complementing plasmid copy of the gene. Conclusion The results showed that ten
Rosconi, Federico; de Vries, Stefan P W; Baig, Abiyad; Fabiano, Elena; Grant, Andrew J
2016-11-15
The interior of plants contains microorganisms (referred to as endophytes) that are distinct from those present at the root surface or in the surrounding soil. Herbaspirillum seropedicae strain SmR1, belonging to the betaproteobacteria, is an endophyte that colonizes crops, including rice, maize, sugarcane, and sorghum. Different approaches have revealed genes and pathways regulated during the interactions of H. seropedicae with its plant hosts. However, functional genomic analysis of transposon (Tn) mutants has been hampered by the lack of genetic tools. Here we successfully employed a combination of in vivo high-density mariner Tn mutagenesis and targeted Tn insertion site sequencing (Tn-seq) in H. seropedicae SmR1. The analysis of multiple gene-saturating Tn libraries revealed that 395 genes are essential for the growth of H. seropedicae SmR1 in tryptone-yeast extract medium. A comparative analysis with the Database of Essential Genes (DEG) showed that 25 genes are uniquely essential in H. seropedicae SmR1. The Tn mutagenesis protocol developed and the gene-saturating Tn libraries generated will facilitate elucidation of the genetic mechanisms of the H. seropedicae endophytic lifestyle. A focal point in the study of endophytes is the development of effective biofertilizers that could help to reduce the input of agrochemicals in croplands. Besides the ability to promote plant growth, a good biofertilizer should be successful in colonizing its host and competing against the native microbiota. By using a systematic Tn-based gene-inactivation strategy and massively parallel sequencing of Tn insertion sites (Tn-seq), it is possible to study the fitness of thousands of Tn mutants in a single experiment. We have applied the combination of these techniques to the plant-growth-promoting endophyte Herbaspirillum seropedicae SmR1. The Tn mutant libraries generated will enable studies into the genetic mechanisms of H. seropedicae-plant interactions. The approach that we
Müller, Sabine; Smertenko, Andrei; Wagner, Vera; Heinrich, Maria; Hussey, Patrick J; Hauser, Marie-Theres
2004-03-09
Directional cell expansion in interphase and nuclear and cell division in M-phase are mediated by four microtubule arrays, three of which are unique to plants: the interphase array, the preprophase band, and the phragmoplast. The plant microtubule-associated protein MAP65 has been identified as a key structural component in these arrays. The Arabidopsis genome has nine MAP65 genes, and here we show that one, AtMAP65-3/PLE, locates only to the mitotic arrays and is essential for cytokinesis. The Arabidopsis pleiade (ple) alleles are single recessive mutations, and we show that these mutations are in the AtMAP65-3 gene. Moreover, these mutations cause C-terminal truncations that abolish microtubule binding. In the ple mutants the anaphase spindle is normal, and the cytokinetic phragmoplast can form but is distorted; not only is it wider, but the midline, the region where oppositely oriented microtubules overlap, is unusually expanded. Here we present data that demonstrate an essential role for AtMAP65-3/PLE in cytokinesis in plant cells.
International Nuclear Information System (INIS)
Zhou, Qian; Yu, Yong-ming
2014-01-01
Essential genes are indispensable for the survival of an organism. Investigating features associated with gene essentiality is fundamental to the prediction and identification of the essential genes. Selecting features associated with gene essentiality is fundamental to predict essential genes with computational techniques. We use fractal theory to make comparative analysis of essential and nonessential genes in bacteria. The information dimensions of essential genes and nonessential genes available in the DEG database for 27 bacteria are calculated based on their gene chaos game representations (CGRs). It is found that weak positive linear correlation exists between information dimension and gene length. Moreover, for genes of similar length, the average information dimension of essential genes is larger than that of nonessential genes. This indicates that essential genes show less regularity and higher complexity than nonessential genes. Our results show that for bacterium with a similar number of essential genes and nonessential genes, the CGR information dimension is helpful for the classification of essential genes and nonessential genes. Therefore, the gene CGR information dimension is very probably a useful gene feature for a genetic algorithm predicting essential genes. (paper)
Systematic identification of novel, essential host genes affecting bromovirus RNA replication.
Directory of Open Access Journals (Sweden)
Brandi L Gancarz
Full Text Available Positive-strand RNA virus replication involves viral proteins and cellular proteins at nearly every replication step. Brome mosaic virus (BMV is a well-established model for dissecting virus-host interactions and is one of very few viruses whose RNA replication, gene expression and encapsidation have been reproduced in the yeast Saccharomyces cerevisiae. Previously, our laboratory identified ∼100 non-essential host genes whose loss inhibited or enhanced BMV replication at least 3-fold. However, our isolation of additional BMV-modulating host genes by classical genetics and other results underscore that genes essential for cell growth also contribute to BMV RNA replication at a frequency that may be greater than that of non-essential genes. To systematically identify novel, essential host genes affecting BMV RNA replication, we tested a collection of ∼900 yeast strains, each with a single essential gene promoter replaced by a doxycycline-repressible promoter, allowing repression of gene expression by adding doxycycline to the growth medium. Using this strain array of ∼81% of essential yeast genes, we identified 24 essential host genes whose depleted expression reproducibly inhibited or enhanced BMV RNA replication. Relevant host genes are involved in ribosome biosynthesis, cell cycle regulation and protein homeostasis, among other cellular processes. BMV 2a(Pol levels were significantly increased in strains depleted for a heat shock protein (HSF1 or proteasome components (PRE1 and RPT6, suggesting these genes may affect BMV RNA replication by directly or indirectly modulating 2a(Pol localization, post-translational modification or interacting partners. Investigating the diverse functions of these newly identified essential host genes should advance our understanding of BMV-host interactions and normal cellular pathways, and suggest new modes of virus control.
pGenN, a Gene Normalization Tool for Plant Genes and Proteins in Scientific Literature
Ding, Ruoyao; Arighi, Cecilia N.; Lee, Jung-Youn; Wu, Cathy H.; Vijay-Shanker, K.
2015-01-01
Background Automatically detecting gene/protein names in the literature and connecting them to databases records, also known as gene normalization, provides a means to structure the information buried in free-text literature. Gene normalization is critical for improving the coverage of annotation in the databases, and is an essential component of many text mining systems and database curation pipelines. Methods In this manuscript, we describe a gene normalization system specifically tailored for plant species, called pGenN (pivot-based Gene Normalization). The system consists of three steps: dictionary-based gene mention detection, species assignment, and intra species normalization. We have developed new heuristics to improve each of these phases. Results We evaluated the performance of pGenN on an in-house expertly annotated corpus consisting of 104 plant relevant abstracts. Our system achieved an F-value of 88.9% (Precision 90.9% and Recall 87.2%) on this corpus, outperforming state-of-art systems presented in BioCreative III. We have processed over 440,000 plant-related Medline abstracts using pGenN. The gene normalization results are stored in a local database for direct query from the pGenN web interface (proteininformationresource.org/pgenn/). The annotated literature corpus is also publicly available through the PIR text mining portal (proteininformationresource.org/iprolink/). PMID:26258475
Directory of Open Access Journals (Sweden)
Igor R. Costa
2014-12-01
Full Text Available Essential amino acids (EAA consist of a group of nine amino acids that animals are unable to synthesize via de novo pathways. Recently, it has been found that most metazoans lack the same set of enzymes responsible for the de novo EAA biosynthesis. Here we investigate the sequence conservation and evolution of all the metazoan remaining genes for EAA pathways. Initially, the set of all 49 enzymes responsible for the EAA de novo biosynthesis in yeast was retrieved. These enzymes were used as BLAST queries to search for similar sequences in a database containing 10 complete metazoan genomes. Eight enzymes typically attributed to EAA pathways were found to be ubiquitous in metazoan genomes, suggesting a conserved functional role. In this study, we address the question of how these genes evolved after losing their pathway partners. To do this, we compared metazoan genes with their fungal and plant orthologs. Using phylogenetic analysis with maximum likelihood, we found that acetolactate synthase (ALS and betaine-homocysteine S-methyltransferase (BHMT diverged from the expected Tree of Life (ToL relationships. High sequence conservation in the paraphyletic group Plant-Fungi was identified for these two genes using a newly developed Python algorithm. Selective pressure analysis of ALS and BHMT protein sequences showed higher non-synonymous mutation ratios in comparisons between metazoans/fungi and metazoans/plants, supporting the hypothesis that these two genes have undergone non-ToL evolution in animals.
Directory of Open Access Journals (Sweden)
Daniel Mihálik
2015-12-01
Full Text Available The artificial gene D6D encoding the enzyme ∆6desaturase was designed and synthesized using the sequence of the same gene from the fungus Thamnidium elegans. The original start codon was replaced by the signal sequence derived from the wheat gene for high-molecular-weight glutenin subunit and the codon usage was completely changed for optimal expression in wheat. Synthesized artificial D6D gene was delivered into plants of the spring wheat line CY-45 and the gene itself, as well as transcribed D6D mRNA were confirmed in plants of T0 and T1 generations. The desired product of the wheat genetic modification by artificial D6D gene was the γ-linolenic acid. Its presence was confirmed in mature grains of transgenic wheat plants in the amount 0.04%–0.32% (v/v of the total amount of fatty acids. Both newly synthesized γ-linolenic acid and stearidonic acid have been detected also in leaves, stems, roots, awns, paleas, rachillas, and immature grains of the T1 generation as well as in immature and mature grains of the T2 generation. Contents of γ-linolenic acid and stearidonic acid varied in range 0%–1.40% (v/v and 0%–1.53% (v/v from the total amount of fatty acids, respectively. This approach has opened the pathway of desaturation of fatty acids and production of essential polyunsaturated fatty acids in wheat.
Screening of Antibacterial Activities of Essential Oils from Selected Medicinal Plants
International Nuclear Information System (INIS)
Le Le Phyo; Moe Moe Thwe; Mar Lar Than
2010-12-01
Essential oils were extracted from the five medicinal plants (Syzygium aromaticum Linn, Cinnamoum tamala. Nees, Piper betle. Linn, Ocimum sanctum, Clausena exacavata Burn) by steam distillation method and percolation method with petroleum ether. These plants do not contain cyanogenic glycosides according to phytochemical tests. Essential oils from these plants were also tested on antimicrobial activity by agar well diffusion method. It was observed that essential oils extracted from these five plants have various effects on Gram-positive and Gram-negative bacteria and fungus. Among them, essential oils of Syzygium aromaticum possess the highest antimicrobial activity aganist all test organisms. B. pumalis and Calbican are the most susceptible to the five plants.
Screening of Antibacterial Activities of Essential Oils from Selected Medicinal Plants
Energy Technology Data Exchange (ETDEWEB)
Phyo, Le Le; Thwe, Moe Moe; Than, Mar Lar
2010-12-15
Essential oils were extracted from the five medicinal plants (Syzygium aromaticum Linn, Cinnamoum tamala. Nees, Piper betle. Linn, Ocimum sanctum, Clausena exacavata Burn) by steam distillation method and percolation method with petroleum ether. These plants do not contain cyanogenic glycosides according to phytochemical tests. Essential oils from these plants were also tested on antimicrobial activity by agar well diffusion method. It was observed that essential oils extracted from these five plants have various effects on Gram-positive and Gram-negative bacteria and fungus. Among them, essential oils of Syzygium aromaticum possess the highest antimicrobial activity aganist all test organisms. B. pumalis and Calbican are the most susceptible to the five plants.
Forrest, Kerrie L; Bhave, Mrinal
2007-10-01
The ubiquitous cell membrane proteins called aquaporins are now firmly established as channel proteins that control the specific transport of water molecules across cell membranes in all living organisms. The aquaporins are thus likely to be of fundamental significance to all facets of plant growth and development affected by plant-water relations. A majority of plant aquaporins have been found to share essential structural features with the human aquaporin and exhibit water-transporting ability in various functional assays, and some have been shown experimentally to be of critical importance to plant survival. Furthermore, substantial evidence is now available from a number of plant species that shows differential gene expression of aquaporins in response to abiotic stresses such as salinity, drought, or cold and clearly establishes the aquaporins as major players in the response of plants to conditions that affect water availability. This review summarizes the function and regulation of these genes to develop a greater understanding of the response of plants to water insufficiency, and particularly, to identify tolerant genotypes of major crop species including wheat and rice and plants that are important in agroforestry.
Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants
Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE
2007-07-10
Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.
ANTIMICROBIAL ACTIVITY OF ESSENTIAL OILS OF PLANTS BELONGING TO LAMIACEAE JUSS. FAMILY
Directory of Open Access Journals (Sweden)
Shanayda M.I.
2015-12-01
Full Text Available Introduction. One of the important sources of therapeutic and prophylactic agents of modern medicines are essential oils of medicinal plants. Essential oils are the main group of biologically active substances of a number of plants belonging to Lamiaceae Juss. Family. Antibacterial activity of medicinal plants belonging to Lamiaceae Family many scientists associated with containing of essential oils. In this regard, considerable interest presents the comparative analysis of the antimicrobial properties of essential oils of Lamiaceae Family representatives. Material and methods.The antimicrobial activity of essential oils of investigated plants was studied with using in vitro condition. The essential oils derived from the aerial parts of cultivated plants of Ocimum, Hyssopus, Dracocephalum, Lophanthus, Monarda and Satureja genus harvested during flowering period (in terms of Ternopil region. The antimicrobial activity of essential oils studied plants was studied by serial dilution method and disk diffusion assay. It has been applied on standard microorganism test strains: Bacillus subtilis ATCC 6633, Escherichia coli ATCC 25922, Staphylococcus aureus ATCC 6538, Pseudomonas aeruginosa ATCC 9027 and Candida albicans ATCC 885-653. Results and discussion. It was conducted a comparative study of the influence of some essential oils of cultivated plants belonging to Lamiaceae family on microorganisms in conditions in vitro. It was found that essential oils of the studied plants were most effective in the maximum concentration (1:10. Gram-positive cocci S. aureus and yeast C. albicans were the most sensitive to influence of investigated essential oils. It was analyzed the relationship of the biological activity with the component composition of essential oils of plants. Essential oils of L. anisatus, M. fistulosa and S. hortensis characterized by the dominance of aromatic compounds and had shown stronger antimicrobial activity than essential oils of
PlantTribes: a gene and gene family resource for comparative genomics in plants
Wall, P. Kerr; Leebens-Mack, Jim; Müller, Kai F.; Field, Dawn; Altman, Naomi S.; dePamphilis, Claude W.
2007-01-01
The PlantTribes database (http://fgp.huck.psu.edu/tribe.html) is a plant gene family database based on the inferred proteomes of five sequenced plant species: Arabidopsis thaliana, Carica papaya, Medicago truncatula, Oryza sativa and Populus trichocarpa. We used the graph-based clustering algorithm MCL [Van Dongen (Technical Report INS-R0010 2000) and Enright et al. (Nucleic Acids Res. 2002; 30: 1575–1584)] to classify all of these species’ protein-coding genes into putative gene families, ca...
Concurrent growth rate and transcript analyses reveal essential gene stringency in Escherichia coli.
Directory of Open Access Journals (Sweden)
Shan Goh
Full Text Available BACKGROUND: Genes essential for bacterial growth are of particular scientific interest. Many putative essential genes have been identified or predicted in several species, however, little is known about gene expression requirement stringency, which may be an important aspect of bacterial physiology and likely a determining factor in drug target development. METHODOLOGY/PRINCIPAL FINDINGS: Working from the premise that essential genes differ in absolute requirement for growth, we describe silencing of putative essential genes in E. coli to obtain a titration of declining growth rates and transcript levels by using antisense peptide nucleic acids (PNA and expressed antisense RNA. The relationship between mRNA decline and growth rate decline reflects the degree of essentiality, or stringency, of an essential gene, which is here defined by the minimum transcript level for a 50% reduction in growth rate (MTL(50. When applied to four growth essential genes, both RNA silencing methods resulted in MTL(50 values that reveal acpP as the most stringently required of the four genes examined, with ftsZ the next most stringently required. The established antibacterial targets murA and fabI were less stringently required. CONCLUSIONS: RNA silencing can reveal stringent requirements for gene expression with respect to growth. This method may be used to validate existing essential genes and to quantify drug target requirement.
Identifying essential genes in bacterial metabolic networks with machine learning methods
2010-01-01
Background Identifying essential genes in bacteria supports to identify potential drug targets and an understanding of minimal requirements for a synthetic cell. However, experimentally assaying the essentiality of their coding genes is resource intensive and not feasible for all bacterial organisms, in particular if they are infective. Results We developed a machine learning technique to identify essential genes using the experimental data of genome-wide knock-out screens from one bacterial organism to infer essential genes of another related bacterial organism. We used a broad variety of topological features, sequence characteristics and co-expression properties potentially associated with essentiality, such as flux deviations, centrality, codon frequencies of the sequences, co-regulation and phyletic retention. An organism-wise cross-validation on bacterial species yielded reliable results with good accuracies (area under the receiver-operator-curve of 75% - 81%). Finally, it was applied to drug target predictions for Salmonella typhimurium. We compared our predictions to the viability of experimental knock-outs of S. typhimurium and identified 35 enzymes, which are highly relevant to be considered as potential drug targets. Specifically, we detected promising drug targets in the non-mevalonate pathway. Conclusions Using elaborated features characterizing network topology, sequence information and microarray data enables to predict essential genes from a bacterial reference organism to a related query organism without any knowledge about the essentiality of genes of the query organism. In general, such a method is beneficial for inferring drug targets when experimental data about genome-wide knockout screens is not available for the investigated organism. PMID:20438628
Environmental control of plant nuclear gene expression by chloroplast redox signals
Directory of Open Access Journals (Sweden)
Jeannette ePfalz
2012-11-01
Full Text Available Plant photosynthesis takes place in specialised cell organelles, the chloroplasts, which perform all essential steps of this process. The proteins involved in photosynthesis are encoded by genes located on the plastid and nuclear genomes. Proper function and regulation of light harvesting and energy fixation thus requires a tight coordination of the gene expression machineries in the two genetic compartments. This is achieved by a bi-directional exchange of information between nucleus and plastids. Signals emerging from plastids report the functional and developmental state of the organelle to the nucleus and initiate distinct nuclear gene expression profiles, which trigger responses that support or improve plastid functions. Recent research indicated that this signalling is absolutely essential for plant growth and development. Reduction/oxidation (redox signals from photosynthesis are key players in this information network since they do report functional disturbances in photosynthesis, the primary energy source of plants. Such disturbances are caused by environmental fluctuations for instance in illumination, temperature or water availability. These environmental changes affect the linear electron flow of photosynthesis and result in changes of the redox state of the components involved (e.g. the plastoquinone pool or coupled to it (e.g. the thioredoxin pool. Thus, the changes in redox state directly reflect the environmental impact and serve as immediate plastidial signals to the nucleus. The triggered responses range from counterbalancing reactions within the physiological range up to severe stress responses including cell death. This review focuses on physiological redox signals from photosynthetic electron transport, their relation to the environment, potential transduction pathways to the nucleus and their impact on nuclear gene expression.
Killiny, N; Hernandez Martinez, R; Korsi Dumenyo, C; Cooksey, DA; Almeida, RPP
2013-01-01
Exopolysaccharides (EPS) synthesized by plant-pathogenic bacteria are generally essential for virulence. The role of EPS produced by the vector-transmitted bacterium Xylella fastidiosa was investigated by knocking out two genes implicated in the EPS biosynthesis, gumD and gumH. Mutant strains were affected in growth characteristics in vitro, including adhesion to surfaces and biofilm formation. In addition, different assays were used to demonstrate that the mutant strains produced significant...
Preliminary screening of plant essential oils against larvae of Culex ...
African Journals Online (AJOL)
Preliminary screenings of 22 plant essential oils were tested for mortality of the mosquito larvae Culex quinquefasciatus under laboratory conditions. Percent (%) mortality of the mosquito larvae were obtained for each essential oil. At different exposure periods, viz. 1, 3, 6, 12 and 24 h among the 22 plant oils tested, eight ...
Allelopatic effects of some medicinal plant essential oils on plant seeds germination
Directory of Open Access Journals (Sweden)
ALI SHOKOUHIAN
2016-04-01
Full Text Available The effect of essential oils from some medicinal plants on seed germination was studied with the aim of assessing their potential use as bioherbicides. The experiment was conducted as factorial based on completely randomized design (CRD with three replications. Seeds of 3 summer crops including lettuce (Lactuca sativa, pepper (Piper longum and tomato (Solanum lycopersicum were exposed to essential oils of rosemary (Rosmarinus officinalis, thyme (Thymus vulgaris and anise (Pimpinella anisum at 3 different concentrations (25 and 50% diluted and undiluted. Treated seeds were grown in a growth chamber at 25°C for 5 days. The number of germinated seeds in each Petri dish was daily counted. After five days seed germination percentage (Ge was calculated. Biplot analysis was performed using genotype plus genotype environment interaction (GGE method. Results showed that the allelopathic effect on Ge was varied among studied plants, which was mainly due to i differences in the composition of the studied essential oils and ii different allelopathic effects of the studied essential oils on Ge. Accordingly, compared to the individual use, combining several essential oils would have a greater inhibitory effect on Ge of weeds.
Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants
Energy Technology Data Exchange (ETDEWEB)
Somerville, Chris R.; Scieble, Wolf
2000-10-11
Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.
[Study on essential oils of medicinal plants in insect repellent].
Zhao, Hong-Zheng; Luo, Jiao-Yang; Liu, Qiu-Tao; Lv, Ze-Liang; Yang, Shi-Hai; Yang, Mei-Hua
2016-01-01
Mosquitoes are seriously harmful to human health for transmitting some mortal diseases. Among the methods of mosquito control, synthetical insecticides are the most popular. However, as a result of longterm use of these insecticides, high resistant mosquitos and heavy environmental pollution appear. Thus, eco-friendly prevention measures are taken into the agenda. Essential oils extracted from medicinal plants have repellent and smoked killing effects on mosquitoes. With abundant medical plants resources and low toxicity, they have the potential of being developed as a new type of mosquito and insect repellent agent. The recent application advances of essential oils of medicinal plants in insect repellent and its application limitations are overviewed. This review will provide references for the future development and in-depth study of essential oils. Copyright© by the Chinese Pharmaceutical Association.
Methylobacterium-plant interaction genes regulated by plant exudate and quorum sensing molecules
Directory of Open Access Journals (Sweden)
Manuella Nóbrega Dourado
2013-12-01
Full Text Available Bacteria from the genus Methylobacterium interact symbiotically (endophytically and epiphytically with different plant species. These interactions can promote plant growth or induce systemic resistance, increasing plant fitness. The plant colonization is guided by molecular communication between bacteria-bacteria and bacteria-plants, where the bacteria recognize specific exuded compounds by other bacteria (e.g. homoserine molecules and/or by the plant roots (e.g. flavonoids, ethanol and methanol, respectively. In this context, the aim of this study was to evaluate the effect of quorum sensing molecules (N-acyl-homoserine lactones and plant exudates (including ethanol in the expression of a series of bacterial genes involved in Methylobacterium-plant interaction. The selected genes are related to bacterial metabolism (mxaF, adaptation to stressful environment (crtI, phoU and sss, to interactions with plant metabolism compounds (acdS and pathogenicity (patatin and phoU. Under in vitro conditions, our results showed the differential expression of some important genes related to metabolism, stress and pathogenesis, thereby AHL molecules up-regulate all tested genes, except phoU, while plant exudates induce only mxaF gene expression. In the presence of plant exudates there is a lower bacterial density (due the endophytic and epiphytic colonization, which produce less AHL, leading to down regulation of genes when compared to the control. Therefore, bacterial density, more than plant exudate, influences the expression of genes related to plant-bacteria interaction.
Fabry, S; Müller, K; Lindauer, A; Park, P B; Cornelius, T; Schmitt, R
1995-09-01
The genome of the green alga Chlamydomonas reinhardtii contains approximately 15 gene clusters of the nucleosomal (or core) histone H2A, H2B, H3 and H4 genes and at least one histone H1 gene. Seven non-allelic histone gene loci were isolated from a genomic library, physically mapped, and the nucleotide sequences of three isotypes of each core histone gene species and one linked H1 gene determined. The core histone genes are organized in clusters of H2A-H2B and H3-H4 pairs, in which each gene pair shows outwardly divergent transcription from a short (< 300 bp) intercistronic region. These intercistronic regions contain typically conserved promoter elements, namely a TATA-box and the three motifs TGGCCAG-G(G/C)-CGAG, CGTTGACC and CGGTTG. Different from the genes of higher plants, but like those of animals and the related alga Volvox, the 3' untranslated regions contain no poly A signal, but a palindromic sequence (3' palindrome) essential for mRNA processing is present. One single H1 gene was found in close linkage to a H2A-H2B pair. The H1 upstream region contains the octameric promoter element GGTTGACC (also found upstream of the core histone genes) and two specific sequence motifs that are shared only with the Volvox H1 promoters. This suggests differential transcription of the H1 and the core histone genes. The H1 gene is interrupted by two introns. Unlike Volvox H3 genes, the three sequenced H3 isoforms are intron-free. Primer-directed PCR of genomic DNA demonstrated, however, that at least 8 of the about 15 H3 genes do contain one intron at a conserved position. In synchronized C. reinhardtii cells, H4 mRNA levels (representative of all core histone mRNAs) peak during cell division, suggesting strict replication-dependent gene control. The derived peptide sequences place C. reinhardtii core histones closer to plants than to animals, except that the H2A histones are more animal-like. The peptide sequence of histone H1 is closely related to the V. carteri VH1-II
Hong, Jeum Kyu; Yang, Hye Ji; Jung, Heesoo; Yoon, Dong June; Sang, Mee Kyung; Jeun, Yong-Chull
2015-09-01
Anthracnose caused by Colletotrichum gloeosporioides has been destructive during pepper fruit production in outdoor fields in Korea. In vitro antifungal activities of 15 different plant essential oils or its components were evaluated during conidial germination and mycelial growth of C. gloeosporioides. In vitro conidial germination was most drastically inhibited by vapour treatments with carvacrol, cinnamon oil, trans-cinnamaldehyde, citral, p-cymene and linalool. Inhibition of the mycelial growth by indirect vapour treatment with essential oils was also demonstrated compared with untreated control. Carvacrol, cinnamon oil, trans-cinnamaldehyde, citral and eugenol were among the most inhibitory plant essential oils by the indirect antifungal efficacies. Plant protection efficacies of the plant essential oils were demonstrated by reduced lesion diameter on the C. gloeosporioides-inoculated immature green pepper fruits compared to the inoculated control fruits without any plant essential oil treatment. In planta test showed that all plant essential oils tested in this study demonstrated plant protection efficacies against pepper fruit anthracnose with similar levels. Thus, application of different plant essential oils can be used for eco-friendly disease management of anthracnose during pepper fruit production.
Antibacterial activity of essential oils from Australian native plants.
Wilkinson, Jenny M; Cavanagh, Heather M A
2005-07-01
To date, of the Australian essential oils, only tea tree (Melaleuca alternifolia) and Eucalyptus spp. have undergone extensive investigation. In this study a range of Australian essential oils, including those from Anethole anisata, Callistris glaucophyllia, Melaleuca spp. and Thyptomine calycina, were assayed for in vitro antibacterial activity. M. alternifolia was also included for comparison purposes. Activity was determined using standard disc diffusion assays with each oil assayed at 100%, 10% and 1% against five bacteria (Escherichia coli, Salmonella typhimurium, Staphylococcus aureus, Pseudomonas aeruginosa and Alcaligenes faecalis) and the yeast, Candida albicans. All bacteria, with the exception of Ps. aeruginosa, were susceptible to one or more of the essential oils at 100%, with only Eremophilia mitchelli inhibiting the growth of any bacteria at 1% (inhibition of Sal. typhimurium). Where multiple samples of a single oil variety were tested variability in activity profiles were noted. This suggests that different methods of preparation of essential oils, together with variability in plant chemical profiles has an impact on whether or not the essential oil is of use as an antimicrobial agent. These results show that essential oils from Australian plants may be valuable antimicrobial agents for use alone or incorporated into cosmetics, cleaning agents and pharmaceutical products.
Plant Essential Oils Used Against Some Bee Diseases
Directory of Open Access Journals (Sweden)
Hidayet Tutun
2018-02-01
Full Text Available The most common honey bee diseases are American foulbrood (AFB caused by the bacterium Paenibacillus larvae, Chalkbrood caused by fungus Ascosphaera apis and diseases caused by parasitic mites such as Acarapis woodi, Varroa destructor. These diseases and pests not only cause economic loss but also cause ecological problems related to the role of honey bees, as the most important pollinators on Earth. Synthetic acaricides and antibiotics are used to keep the diseases and mites in control. Use of the drugs lead to the development of drug-resistant organisms, detrimental effect on non-target organisms and the residue problem in bee products. For this reasons, the need for alternative control methods has become compulsory in recent years. It has been known that some plant oils used widely in perfumery and food industry for flavor and smell have been used as repellent to certain insects, bactericide and fungicide. Therefore, intensive studies have been carried out on plants with anti-mites, antibacterial and antifungal potentials and these studies are still going on. Recently, studies in this area have shown that essential oils of plants such as thyme, cloves, mint, lemon grass, cinnamon, grapefruit, rosemary, marigold, are lethal to some mites, bacteria and fungi. In addition, it has been reported that some components, isolated from these plants such as sanguinarine, thymoquinone, capsaicin, carvacrol, citral, eugenol, thymol, show these effects on the organisms. As a result, in countries rich in biodiversity due to endemic plant species, the essential oils used in control of these diseases should be favored instead of or in combination with conventional drugs in integrated the disease management programs because of the lack of harmful effects of essential oils on non-target organisms and environment.
Energy Technology Data Exchange (ETDEWEB)
Kamei, Yuka; Tai, Akiko; Dakeyama, Shota; Yamamoto, Kaori; Inoue, Yamato; Kishimoto, Yoshifumi; Ohara, Hiroya; Mukai, Yukio, E-mail: y_mukai@nagahama-i-bio.ac.jp
2015-07-31
Many of the lifespan-related genes have been identified in eukaryotes ranging from the yeast to human. However, there is limited information available on the longevity genes that are essential for cell proliferation. Here, we investigated whether the essential genes encoding DNA-binding transcription factors modulated the replicative lifespan of Saccharomyces cerevisiae. Heterozygous diploid knockout strains for FHL1, RAP1, REB1, and MCM1 genes showed significantly short lifespan. {sup 1}H-nuclear magnetic resonance analysis indicated a characteristic metabolic profile in the Δfhl1/FHL1 mutant. These results strongly suggest that FHL1 regulates the transcription of lifespan related metabolic genes. Thus, heterozygous knockout strains could be the potential materials for discovering further novel lifespan genes. - Highlights: • Involvement of yeast TF genes essential for cell growth in lifespan was evaluated. • The essential TF genes, FHL1, RAP1, REB1, and MCM1, regulate replicative lifespan. • Heterozygous deletion of FHL1 changes cellular metabolism related to lifespan.
The Design and Manufacturing of Essential oil Distillation Plant for ...
African Journals Online (AJOL)
The Design and Manufacturing of Essential oil Distillation Plant for rural poverty ... The adaptation of oil distillation technology for essential oil production is ... based on local resources and the first prototype has been manufactured and tested.
Bauer, Christopher R; Li, Shuang; Siegal, Mark L
2015-01-01
The concept of robustness in biology has gained much attention recently, but a mechanistic understanding of how genetic networks regulate phenotypic variation has remained elusive. One approach to understand the genetic architecture of variability has been to analyze dispensable gene deletions in model organisms; however, the most important genes cannot be deleted. Here, we have utilized two systems in yeast whereby essential genes have been altered to reduce expression. Using high-throughput microscopy and image analysis, we have characterized a large number of morphological phenotypes, and their associated variation, for the majority of essential genes in yeast. Our results indicate that phenotypic robustness is more highly dependent upon the expression of essential genes than on the presence of dispensable genes. Morphological robustness appears to be a general property of a genotype that is closely related to pleiotropy. While the fitness profile across a range of expression levels is idiosyncratic to each gene, the global pattern indicates that there is a window in which phenotypic variation can be released before fitness effects are observable. PMID:25609648
JGI Plant Genomics Gene Annotation Pipeline
Energy Technology Data Exchange (ETDEWEB)
Shu, Shengqiang; Rokhsar, Dan; Goodstein, David; Hayes, David; Mitros, Therese
2014-07-14
Plant genomes vary in size and are highly complex with a high amount of repeats, genome duplication and tandem duplication. Gene encodes a wealth of information useful in studying organism and it is critical to have high quality and stable gene annotation. Thanks to advancement of sequencing technology, many plant species genomes have been sequenced and transcriptomes are also sequenced. To use these vastly large amounts of sequence data to make gene annotation or re-annotation in a timely fashion, an automatic pipeline is needed. JGI plant genomics gene annotation pipeline, called integrated gene call (IGC), is our effort toward this aim with aid of a RNA-seq transcriptome assembly pipeline. It utilizes several gene predictors based on homolog peptides and transcript ORFs. See Methods for detail. Here we present genome annotation of JGI flagship green plants produced by this pipeline plus Arabidopsis and rice except for chlamy which is done by a third party. The genome annotations of these species and others are used in our gene family build pipeline and accessible via JGI Phytozome portal whose URL and front page snapshot are shown below.
Plant Core Environmental Stress Response Genes Are Systemically Coordinated during Abiotic Stresses
Directory of Open Access Journals (Sweden)
Kenneth W. Berendzen
2013-04-01
Full Text Available Studying plant stress responses is an important issue in a world threatened by global warming. Unfortunately, comparative analyses are hampered by varying experimental setups. In contrast, the AtGenExpress abiotic stress experiment displays intercomparability. Importantly, six of the nine stresses (wounding, genotoxic, oxidative, UV-B light, osmotic and salt can be examined for their capacity to generate systemic signals between the shoot and root, which might be essential to regain homeostasis in Arabidopsis thaliana. We classified the systemic responses into two groups: genes that are regulated in the non-treated tissue only are defined as type I responsive and, accordingly, genes that react in both tissues are termed type II responsive. Analysis of type I and II systemic responses suggest distinct functionalities, but also significant overlap between different stresses. Comparison with salicylic acid (SA and methyl-jasmonate (MeJA responsive genes implies that MeJA is involved in the systemic stress response. Certain genes are predominantly responding in only one of the categories, e.g., WRKY genes respond mainly non-systemically. Instead, genes of the plant core environmental stress response (PCESR, e.g., ZAT10, ZAT12, ERD9 or MES9, are part of different response types. Moreover, several PCESR genes switch between the categories in a stress-specific manner.
Directory of Open Access Journals (Sweden)
Jeum Kyu Hong
2015-09-01
Full Text Available Anthracnose caused by Colletotrichum gloeosporioides has been destructive during pepper fruit production in outdoor fields in Korea. In vitro antifungal activities of 15 different plant essential oils or its components were evaluated during conidial germination and mycelial growth of C. gloeosporioides. In vitro conidial germination was most drastically inhibited by vapour treatments with carvacrol, cinnamon oil, trans-cinnamaldehyde, citral, p-cymene and linalool. Inhibition of the mycelial growth by indirect vapour treatment with essential oils was also demonstrated compared with untreated control. Carvacrol, cinnamon oil, trans-cinnamaldehyde, citral and eugenol were among the most inhibitory plant essential oils by the indirect antifungal efficacies. Plant protection efficacies of the plant essential oils were demonstrated by reduced lesion diameter on the C. gloeosporioides-inoculated immature green pepper fruits compared to the inoculated control fruits without any plant essential oil treatment. In planta test showed that all plant essential oils tested in this study demonstrated plant protection efficacies against pepper fruit anthracnose with similar levels. Thus, application of different plant essential oils can be used for eco-friendly disease management of anthracnose during pepper fruit production.
Anther-preferential expressing gene PMR is essential for the mitosis of pollen development in rice.
Liu, Yaqin; Xu, Ya; Ling, Sheng; Liu, Shasha; Yao, Jialing
2017-06-01
Phenotype identification, expression examination, and function prediction declared that the anther-preferential expressing gene PMR may participate in regulation of male gametophyte development in rice. Male germline development in flowering plants produces the pair of sperm cells for double fertilization and the pollen mitosis is a key process of it. Although the structural features of male gametophyte have been defined, the molecular mechanisms regulating the mitotic cell cycle are not well elucidated in rice. Here, we reported an anther-preferential expressing gene in rice, PMR (Pollen Mitosis Relative), playing an essential role in male gametogenesis. When PMR gene was suppressed via RNAi, the mitosis of microspore was severely damaged, and the plants formed unmatured pollens containing only one or two nucleuses at the anthesis, ultimately leading to serious reduction of pollen fertility and seed-setting. The CRISPR mutants, pmr-1 and pmr-2, both showed the similar defects as the PMR-RNAi lines. Further analysis revealed that PMR together with its co-expressing genes were liable to participate in the regulation of DNA metabolism in the nucleus, and affected the activities of some enzymes related to the cell cycle. We finally discussed that unknown protein PMR contained the PHD, SWIB and Plus-3 domains and they might have coordinating functions in regulation pathway of the pollen mitosis in rice.
Biological Activities of Essential Oils: From Plant Chemoecology to Traditional Healing Systems
Directory of Open Access Journals (Sweden)
Javad Sharifi-Rad
2017-01-01
Full Text Available Essential oils are complex mixtures of hydrocarbons and their oxygenated derivatives arising from two different isoprenoid pathways. Essential oils are produced by glandular trichomes and other secretory structures, specialized secretory tissues mainly diffused onto the surface of plant organs, particularly flowers and leaves, thus exerting a pivotal ecological role in plant. In addition, essential oils have been used, since ancient times, in many different traditional healing systems all over the world, because of their biological activities. Many preclinical studies have documented antimicrobial, antioxidant, anti-inflammatory and anticancer activities of essential oils in a number of cell and animal models, also elucidating their mechanism of action and pharmacological targets, though the paucity of in human studies limits the potential of essential oils as effective and safe phytotherapeutic agents. More well-designed clinical trials are needed in order to ascertain the real efficacy and safety of these plant products.
Plant Essential Oils from Apiaceae Family as Alternatives to Conventional Insecticides
Directory of Open Access Journals (Sweden)
Asgar Ebadollahi
2013-06-01
Full Text Available Main method to control insect pest is using synthetic insecticides, but the development of insect resistance to this products, the high operational cost, environmental pollution, toxicity to humans and harmful effect on non-target organisms have created the need for developing alternative approaches to control insect pest. Furthermore, the demand for organic crops, especially vegetables for the fresh market, has greatly increased worldwide. The ideal insecticide should control target pests adequately and should be target-specific, rapidly degradable, and low in toxicity to humans and other mammals. Plant essential oils could be an alternative source for insect pest control because they constitute a rich source of bioactive chemicals and are commonly used as flavoring agents in foods. These materials may be applied to food crops shortly before harvest without leaving excessive residues. Moreover, medically safe of these plant derivatives has emphasized also. For these reasons, much effort has been focused on plant essential oils or their constituents as potential sources of insect control agents. In this context, Apiaceae (Umbelliferae family would rank among the most important families of plants. In the last few years more and more studies on the insecticidal properties of essential oils from Apiaceae family have been published and it seemed worthwhile to compile them. The focus of this review lies on the lethal (ovicidal, larvicidal, pupicidal and adulticidal and sublethal (antifeedant, repellent, oviposition deterrent, Growth inhibitory and progeny production activities of plant essential oils and theirmain components from Apiaceae family. These features indicate that pesticides based on Apiaceae essential oils could be used in a variety of ways to control a large number of pests. It can be concluded that essential oils and phytochemicals isolated from Apiaceae family may be efficacious and safe replacements for conventional synthetic
Directory of Open Access Journals (Sweden)
Abinaya Manivannan
2017-08-01
Full Text Available Silicon (Si, the quasi-essential element occurs as the second most abundant element in the earth's crust. Biological importance of Si in plant kingdom has become inevitable particularly under stressed environment. In general, plants are classified as high, medium, and low silicon accumulators based on the ability of roots to absorb Si. The uptake of Si directly influence the positive effects attributed to the plant but Si supplementation proves to mitigate stress and recover plant growth even in low accumulating plants like tomato. The application of Si in soil as well as soil-less cultivation systems have resulted in the enhancement of quantitative and qualitative traits of plants even under stressed environment. Silicon possesses several mechanisms to regulate the physiological, biochemical, and antioxidant metabolism in plants to combat abiotic and biotic stresses. Nevertheless, very few reports are available on the aspect of Si-mediated molecular regulation of genes with potential role in stress tolerance. The recent advancements in the era of genomics and transcriptomics have opened an avenue for the determination of molecular rationale associated with the Si amendment to the stress alleviation in plants. Therefore, the present endeavor has attempted to describe the recent discoveries related to the regulation of vital genes involved in photosynthesis, transcription regulation, defense, water transport, polyamine synthesis, and housekeeping genes during abiotic and biotic stress alleviation by Si. Furthermore, an overview of Si-mediated modulation of multiple genes involved in stress response pathways such as phenylpropanoid pathway, jasmonic acid pathway, ABA-dependent or independent regulatory pathway have been discussed in this review.
Antifungal Effect of Plant Essential Oils on Controlling Phytophthora Species
Directory of Open Access Journals (Sweden)
Jahanshir Amini
2016-02-01
Full Text Available In this study, antifungal activity of essential oils of Cymbopogon citratus and Ocimum basilicum and two fungicides Mancozeb and Metalaxyl-Mancozeb in six different concentrations were investigated for controlling three species of Phytophthora, including P. capsici, P. drechsleri and P. melonis on pepper, cucumber and melon under in vitro and greenhouse conditions, respectively. Under the in vitro condition, the median effective concen- tration (EC₅₀ values (ppm of plant essential oils and fungicides were measured. In greenhouse, soil infested with Phytophthora species was treated by adding 50 ml of essential oils and fungicides (100 ppm. Disease severity was determined after 28 days. Among two tested plant essential oils, C. citratus had the lowest EC₅₀ values for inhibition of the mycelial growth of P. capsici (31.473, P. melonis (33.097 and P. drechsleri (69.112, respectively. The mean EC₅₀ values for Metalaxyl-Mancozeb on these pathogens were 20.87, 20.06 and 17.70, respectively. Chemical analysis of plant essential oils by GC-MS showed that, among 42 compounds identified from C. citratus, two compounds β-geranial (α-citral (39.16% and z-citral (30.95% were the most abundant. Under the greenhouse condition, Metalaxyl-Mancozeb caused the greatest reduction in disease severity, 84.2%, 86.8% and 92.1% on melon, cucumber, and pepper, respectively. The C. citratus essential oil reduced disease severity from 47.4% to 60.5% compared to the untreated control (p≤0.05. Essential oils of O. basilicum had the lowest effects on the pathogens under in vitro and greenhouse conditions. These results show that essential oils may contribute to the development of new antifungal agents to protect the crops from Phytophthora diseases.
Genes under positive selection in a model plant pathogenic fungus, Botrytis.
Aguileta, Gabriela; Lengelle, Juliette; Chiapello, Hélène; Giraud, Tatiana; Viaud, Muriel; Fournier, Elisabeth; Rodolphe, François; Marthey, Sylvain; Ducasse, Aurélie; Gendrault, Annie; Poulain, Julie; Wincker, Patrick; Gout, Lilian
2012-07-01
The rapid evolution of particular genes is essential for the adaptation of pathogens to new hosts and new environments. Powerful methods have been developed for detecting targets of selection in the genome. Here we used divergence data to compare genes among four closely related fungal pathogens adapted to different hosts to elucidate the functions putatively involved in adaptive processes. For this goal, ESTs were sequenced in the specialist fungal pathogens Botrytis tulipae and Botrytis ficariarum, and compared with genome sequences of Botrytis cinerea and Sclerotinia sclerotiorum, responsible for diseases on over 200 plant species. A maximum likelihood-based analysis of 642 predicted orthologs detected 21 genes showing footprints of positive selection. These results were validated by resequencing nine of these genes in additional Botrytis species, showing they have also been rapidly evolving in other related species. Twenty of the 21 genes had not previously been identified as pathogenicity factors in B. cinerea, but some had functions related to plant-fungus interactions. The putative functions were involved in respiratory and energy metabolism, protein and RNA metabolism, signal transduction or virulence, similarly to what was detected in previous studies using the same approach in other pathogens. Mutants of B. cinerea were generated for four of these genes as a first attempt to elucidate their functions. Copyright © 2012 Elsevier B.V. All rights reserved.
Gene stacking of multiple traits for high yield of fermentable sugars in plant biomass
DEFF Research Database (Denmark)
Aznar, Aude; Chalvin, Camille; Shih, Patrick M.
2018-01-01
the ratio of C6 to C5 sugars in the cell wall and decreasing the lignin content are two important targets in engineering of plants that are more suitable for downstream processing for second-generation biofuel production.Results: We have studied the basic mechanisms of cell wall biosynthesis and identified...... genes involved in biosynthesis of pectic galactan, including the GALS1 galactan synthase and the UDP-galactose/UDP-rhamnose transporter URGT1. We have engineered plants with a more suitable biomass composition by applying these findings, in conjunction with synthetic biology and gene stacking tools...... to vessels where this polysaccharide is essential. Finally, the high galactan and low xylan traits were stacked with the low lignin trait obtained by expressing the QsuB gene encoding dehydroshikimate dehydratase in lignifying cells.Conclusion: The results show that approaches to increasing C6 sugar content...
Directory of Open Access Journals (Sweden)
Burgis Timothy A
2009-07-01
Full Text Available Abstract Background In recent years there has been an increasing problem with Staphylococcus aureus strains that are resistant to treatment with existing antibiotics. An important starting point for the development of new antimicrobial drugs is the identification of "essential" genes that are important for bacterial survival and growth. Results We have developed a robust microarray and PCR-based method, Transposon-Mediated Differential Hybridisation (TMDH, that uses novel bioinformatics to identify transposon inserts in genome-wide libraries. Following a microarray-based screen, genes lacking transposon inserts are re-tested using a PCR and sequencing-based approach. We carried out a TMDH analysis of the S. aureus genome using a large random mariner transposon library of around a million mutants, and identified a total of 351 S. aureus genes important for survival and growth in culture. A comparison with the essential gene list experimentally derived for Bacillus subtilis highlighted interesting differences in both pathways and individual genes. Conclusion We have determined the first comprehensive list of S. aureus essential genes. This should act as a useful starting point for the identification of potential targets for novel antimicrobial compounds. The TMDH methodology we have developed is generic and could be applied to identify essential genes in other bacterial pathogens.
Evolutionary conservation of essential and highly expressed genes in Pseudomonas aeruginosa
Directory of Open Access Journals (Sweden)
Scharfe Maren
2010-04-01
Full Text Available Abstract Background The constant increase in development and spread of bacterial resistance to antibiotics poses a serious threat to human health. New sequencing technologies are now on the horizon that will yield massive increases in our capacity for DNA sequencing and will revolutionize the drug discovery process. Since essential genes are promising novel antibiotic targets, the prediction of gene essentiality based on genomic information has become a major focus. Results In this study we demonstrate that pooled sequencing is applicable for the analysis of sequence variations of strain collections with more than 10 individual isolates. Pooled sequencing of 36 clinical Pseudomonas aeruginosa isolates revealed that essential and highly expressed proteins evolve at lower rates, whereas extracellular proteins evolve at higher rates. We furthermore refined the list of experimentally essential P. aeruginosa genes, and identified 980 genes that show no sequence variation at all. Among the conserved nonessential genes we found several that are involved in regulation, motility and virulence, indicating that they represent factors of evolutionary importance for the lifestyle of a successful environmental bacterium and opportunistic pathogen. Conclusion The detailed analysis of a comprehensive set of P. aeruginosa genomes in this study clearly disclosed detailed information of the genomic makeup and revealed a large set of highly conserved genes that play an important role for the lifestyle of this microorganism. Sequencing strain collections enables for a detailed and extensive identification of sequence variations as potential bacterial adaptation processes, e.g., during the development of antibiotic resistance in the clinical setting and thus may be the basis to uncover putative targets for novel treatment strategies.
In vitro antimicrobial activity and antagonistic effect of essential oils from plant species.
Toroglu, Sevil
2007-07-01
Kahramanmaras, is a developing city located in the southern part of Turkey Thymus eigii (M. Zohary and RH. Davis) Jalas, Pinus nigraAm. sub sp pallasiana and Cupressus sempervirens L. are the useful plants of the Kahramanmaras province and have been understudy since 2004 for the traditional uses of plants empiric drug, spice, herbal tea industry herbal gum and fuel. The study was designed to examine the antimicrobial activities of essential oils of these plants by the disc diffusion and minimum inhibitory concentration (MIC) methods. In addition, antimicrobial activity of Thymus eigii was researched by effects when it was used together with antibiotics and even when it was combined with other essential oils. When the results of this study were compared with vancomycin (30 mcg) and erytromycin (15 mcg) standards, it was found that Thymus eigii essential oil was particularly found to possess strongerantimicrobial activity whereas other essential oils showed susceptible or moderate activity However, antimicrobial activity changed also by in vitro interactions between antibiotics and Thymus eigii essential oil, also between essential oils of these plants and that of Thymus eigii causing synergic, additive, antagonist effect.
International Nuclear Information System (INIS)
Salem, Tamer Z.; Zhang, Fengrui; Thiem, Suzanne M.
2013-01-01
Autographa californica multiple nucleopolyhedrovirus ORF34 is part of a transcriptional unit that includes ORF32, encoding a viral fibroblast growth factor (FGF) and ORF33. We identified ORF34 as a candidate for deletion to improve protein expression in the baculovirus expression system based on enhanced reporter gene expression in an RNAi screen of virus genes. However, ORF34 was shown to be an essential gene. To explore ORF34 function, deletion (KO34) and rescue bacmids were constructed and characterized. Infection did not spread from primary KO34 transfected cells and supernatants from KO34 transfected cells could not infect fresh Sf21 cells whereas the supernatant from the rescue bacmids transfection could recover the infection. In addition, budded viruses were not observed in KO34 transfected cells by electron microscopy, nor were viral proteins detected from the transfection supernatants by western blots. These demonstrate that ORF34 is an essential gene with a possible role in infectious virus production.
Energy Technology Data Exchange (ETDEWEB)
Salem, Tamer Z. [Department of Entomology, Michigan State University, East Lansing, MI 48824 (United States); Department of Microbial Molecular Biology, AGERI, Agricultural Research Center, Giza 12619 (Egypt); Division of Biomedical Sciences, Zewail University, Zewail City of Science and Technology, Giza 12588 (Egypt); Zhang, Fengrui [Department of Entomology, Michigan State University, East Lansing, MI 48824 (United States); Thiem, Suzanne M., E-mail: smthiem@msu.edu [Department of Entomology, Michigan State University, East Lansing, MI 48824 (United States); Department of Microbiology and Molecular Genetics, Michigan State University, East Lansing, MI 48824 (United States)
2013-01-20
Autographa californica multiple nucleopolyhedrovirus ORF34 is part of a transcriptional unit that includes ORF32, encoding a viral fibroblast growth factor (FGF) and ORF33. We identified ORF34 as a candidate for deletion to improve protein expression in the baculovirus expression system based on enhanced reporter gene expression in an RNAi screen of virus genes. However, ORF34 was shown to be an essential gene. To explore ORF34 function, deletion (KO34) and rescue bacmids were constructed and characterized. Infection did not spread from primary KO34 transfected cells and supernatants from KO34 transfected cells could not infect fresh Sf21 cells whereas the supernatant from the rescue bacmids transfection could recover the infection. In addition, budded viruses were not observed in KO34 transfected cells by electron microscopy, nor were viral proteins detected from the transfection supernatants by western blots. These demonstrate that ORF34 is an essential gene with a possible role in infectious virus production.
Zhang, Xue; Acencio, Marcio Luis; Lemke, Ney
2016-01-01
Essential proteins/genes are indispensable to the survival or reproduction of an organism, and the deletion of such essential proteins will result in lethality or infertility. The identification of essential genes is very important not only for understanding the minimal requirements for survival of an organism, but also for finding human disease genes and new drug targets. Experimental methods for identifying essential genes are costly, time-consuming, and laborious. With the accumulation of sequenced genomes data and high-throughput experimental data, many computational methods for identifying essential proteins are proposed, which are useful complements to experimental methods. In this review, we show the state-of-the-art methods for identifying essential genes and proteins based on machine learning and network topological features, point out the progress and limitations of current methods, and discuss the challenges and directions for further research. PMID:27014079
Three essential management processes of nuclear power plant operators
International Nuclear Information System (INIS)
Qi Tunfeng
2010-01-01
The paper takes the operation and management of Qinshan NPP Phase II as an example, focusing on the implementation of the essential process from the following three aspects the NPP production organization, training, examination and authorization for safety-related personnel, and financing budge management. A better understanding and implementation of the essential process will enable nuclear power plants to effectively control the nuclear safety from the most fundamental managerial level. (author)
Abdollahi Mandoulakani, Babak; Eyvazpour, Elham; Ghadimzadeh, Morteza
2017-07-01
Basil (Ocimum basilicum L.), a medicinal plant of the Lamiaceae family, is used in traditional medicine; its essential oil is a rich source of phenylpropanoids. Methylchavicol and methyleugenol are the most important constituents of basil essential oil. Drought stress is proposed to enhance the essential oil composition and expression levels of the genes involved in its biosynthesis. In the current investigation, an experiment based on a completely randomized design (CRD) with three replications was conducted in the greenhouse to study the effect of drought stress on the expression level of four genes involved in the phenylpropanoid biosynthesis pathway in O. basilicum c.v. Keshkeni luvelou. The genes studied were chavicol O-methyl transferase (CVOMT), eugenol O-methyl transferase (EOMT), cinnamate 4-hydroxylase (C4H), 4-coumarate coA ligase (4CL), and cinnamyl alcohol dehydrogenase (CAD). The effect of drought stress on the essential oil compounds and their relationship with the expression levels of the studied genes were also investigated. Plants were subjected to levels of 100%, 75%, and 50% of field capacity (FC) at the 6-8 leaf stage. Essential oil compounds were identified by gas chromatography/mass spectrometry (GC-MS) at flowering stage and the levels of gene expression were determind by real time PCR in plant leaves at the same stage. Results showed that drought stress increased the amount of methylchavicol, methyleugenol, β-Myrcene and α-bergamotene. The maximum amount of these compounds was observed at 50% FC. Real-time PCR analysis revealed that severe drought stress (50% FC) increased the expression level of CVOMT and EOMT by about 6.46 and 46.33 times, respectively, whereas those of CAD relatively remained unchanged. The expression level of 4CL and C4H reduced under drought stress conditions. Our results also demonstrated that changes in the expression levels of CVOMT and EOMT are significantly correlated with methylchavicol (r = 0.94, P ≤ 0
Directory of Open Access Journals (Sweden)
Lemke Ney
2009-09-01
Full Text Available Abstract Background The identification of essential genes is important for the understanding of the minimal requirements for cellular life and for practical purposes, such as drug design. However, the experimental techniques for essential genes discovery are labor-intensive and time-consuming. Considering these experimental constraints, a computational approach capable of accurately predicting essential genes would be of great value. We therefore present here a machine learning-based computational approach relying on network topological features, cellular localization and biological process information for prediction of essential genes. Results We constructed a decision tree-based meta-classifier and trained it on datasets with individual and grouped attributes-network topological features, cellular compartments and biological processes-to generate various predictors of essential genes. We showed that the predictors with better performances are those generated by datasets with integrated attributes. Using the predictor with all attributes, i.e., network topological features, cellular compartments and biological processes, we obtained the best predictor of essential genes that was then used to classify yeast genes with unknown essentiality status. Finally, we generated decision trees by training the J48 algorithm on datasets with all network topological features, cellular localization and biological process information to discover cellular rules for essentiality. We found that the number of protein physical interactions, the nuclear localization of proteins and the number of regulating transcription factors are the most important factors determining gene essentiality. Conclusion We were able to demonstrate that network topological features, cellular localization and biological process information are reliable predictors of essential genes. Moreover, by constructing decision trees based on these data, we could discover cellular rules governing
Plant gene technology: social considerations
African Journals Online (AJOL)
Administrator
The genetic modification of plants by gene technology is of immense potential benefits, but there may be possible risks. ... As a new endeavour, however, people have a mixed ... reality by gene biotechnology (Watson, 1997). Industrial ...
Analysis of pan-genome to identify the core genes and essential genes of Brucella spp.
Yang, Xiaowen; Li, Yajie; Zang, Juan; Li, Yexia; Bie, Pengfei; Lu, Yanli; Wu, Qingmin
2016-04-01
Brucella spp. are facultative intracellular pathogens, that cause a contagious zoonotic disease, that can result in such outcomes as abortion or sterility in susceptible animal hosts and grave, debilitating illness in humans. For deciphering the survival mechanism of Brucella spp. in vivo, 42 Brucella complete genomes from NCBI were analyzed for the pan-genome and core genome by identification of their composition and function of Brucella genomes. The results showed that the total 132,143 protein-coding genes in these genomes were divided into 5369 clusters. Among these, 1710 clusters were associated with the core genome, 1182 clusters with strain-specific genes and 2477 clusters with dispensable genomes. COG analysis indicated that 44 % of the core genes were devoted to metabolism, which were mainly responsible for energy production and conversion (COG category C), and amino acid transport and metabolism (COG category E). Meanwhile, approximately 35 % of the core genes were in positive selection. In addition, 1252 potential essential genes were predicted in the core genome by comparison with a prokaryote database of essential genes. The results suggested that the core genes in Brucella genomes are relatively conservation, and the energy and amino acid metabolism play a more important role in the process of growth and reproduction in Brucella spp. This study might help us to better understand the mechanisms of Brucella persistent infection and provide some clues for further exploring the gene modules of the intracellular survival in Brucella spp.
Functional conservation of coenzyme Q biosynthetic genes among yeasts, plants, and humans.
Directory of Open Access Journals (Sweden)
Kazuhiro Hayashi
Full Text Available Coenzyme Q (CoQ is an essential factor for aerobic growth and oxidative phosphorylation in the electron transport system. The biosynthetic pathway for CoQ has been proposed mainly from biochemical and genetic analyses of Escherichia coli and Saccharomyces cerevisiae; however, the biosynthetic pathway in higher eukaryotes has been explored in only a limited number of studies. We previously reported the roles of several genes involved in CoQ synthesis in the fission yeast Schizosaccharomyces pombe. Here, we expand these findings by identifying ten genes (dps1, dlp1, ppt1, and coq3-9 that are required for CoQ synthesis. CoQ10-deficient S. pombe coq deletion strains were generated and characterized. All mutant fission yeast strains were sensitive to oxidative stress, produced a large amount of sulfide, required an antioxidant to grow on minimal medium, and did not survive at the stationary phase. To compare the biosynthetic pathway of CoQ in fission yeast with that in higher eukaryotes, the ability of CoQ biosynthetic genes from humans and plants (Arabidopsis thaliana to functionally complement the S. pombe coq deletion strains was determined. With the exception of COQ9, expression of all other human and plant COQ genes recovered CoQ10 production by the fission yeast coq deletion strains, although the addition of a mitochondrial targeting sequence was required for human COQ3 and COQ7, as well as A. thaliana COQ6. In summary, this study describes the functional conservation of CoQ biosynthetic genes between yeasts, humans, and plants.
Dadaşoǧlu, Fatih; Kotan, Recep; Karagöz, Kenan; Dikbaş, Neslihan; Ćakmakçi, Ramazan; Ćakir, Ahmet; Kordali, Şaban; Özer, Hakan
2016-04-01
The aim of this study is to determine effect of Origanum rotundifolium's essential oil on some plant pathogenic bacterias, seed germination and plant growth of tomato. Xanthomonas axanopodis pv. vesicatoria strain (Xcv-761) and Clavibacter michiganensis ssp. michiganensis strain (Cmm) inoculated to tomato seed. The seeds were tested for germination in vitro and disease severity and some plant growth parameters in vivo. In vitro assay, maximum seed germination was observed at 62,5 µl/ml essential oil treatment in seeds inoculated with Xcv-761 and at 62,5 µl/ml essential oil and streptomycin treatment in seeds inoculated with Cmm. The least infected cotiledon number was observed at 500 µg/ml streptomycin treatment in seeds inoculated with Cmm. In vivo assay, maximum seed germination was observed at 250 µl/ml essential oil teratment in tomato inoculated with Cmm. Lowest disease severity, is seen in the CMM infected seeds with 250 µl/ml essential oil application these results were statistically significant when compared with pathogen infected seeds. Similarly, in application conducted with XCV-761 infected seed, the lowest disease severity was observed for seeds as a result of 250 µl/ml essential oil application. Also according to the results obtained from essential oil application of CMM infected seeds conducted with 62,5 µl/ml dose; while disease severity was found statistically insignificant compared to 250 µl/ml to essential oil application, ıt was found statistically significant compared to pathogen infected seeds. The results showed that essential oil of O. rotundifolium has a potential for some suppressed plant disease when it is used in appropriate dose.
Candidate Essential Genes in Burkholderia cenocepacia J2315 Identified by Genome-Wide TraDIS
Wong, Yee-Chin
2016-08-22
Burkholderia cenocepacia infection often leads to fatal cepacia syndrome in cystic fibrosis patients. However, antibiotic therapy rarely results in complete eradication of the pathogen due to its intrinsic resistance to many clinically available antibiotics. Recent attention has turned to the identification of essential genes as the proteins encoded by these genes may serve as potential targets for development of novel antimicrobials. In this study, we utilized TraDIS (Transposon Directed Insertion-site Sequencing) as a genome-wide screening tool to facilitate the identification of B. cenocepacia genes essential for its growth and viability. A transposon mutant pool consisting of approximately 500,000 mutants was successfully constructed, with more than 400,000 unique transposon insertion sites identified by computational analysis of TraDIS datasets. The saturated library allowed for the identification of 383 genes that were predicted to be essential in B. cenocepacia. We extended the application of TraDIS to identify conditionally essential genes required for in vitro growth and revealed an additional repertoire of 439 genes to be crucial for B. cenocepacia growth under nutrient-depleted conditions. The library of B. cenocepacia mutants can subsequently be subjected to various biologically related conditions to facilitate the discovery of genes involved in niche adaptation as well as pathogenicity and virulence.
Candidate Essential Genes in Burkholderia cenocepacia J2315 Identified by Genome-Wide TraDIS
Wong, Yee-Chin; Abd El Ghany, Moataz; Naeem, Raeece; Lee, Kok-Wei; Tan, Yung-Chie; Pain, Arnab; Nathan, Sheila
2016-01-01
Burkholderia cenocepacia infection often leads to fatal cepacia syndrome in cystic fibrosis patients. However, antibiotic therapy rarely results in complete eradication of the pathogen due to its intrinsic resistance to many clinically available antibiotics. Recent attention has turned to the identification of essential genes as the proteins encoded by these genes may serve as potential targets for development of novel antimicrobials. In this study, we utilized TraDIS (Transposon Directed Insertion-site Sequencing) as a genome-wide screening tool to facilitate the identification of B. cenocepacia genes essential for its growth and viability. A transposon mutant pool consisting of approximately 500,000 mutants was successfully constructed, with more than 400,000 unique transposon insertion sites identified by computational analysis of TraDIS datasets. The saturated library allowed for the identification of 383 genes that were predicted to be essential in B. cenocepacia. We extended the application of TraDIS to identify conditionally essential genes required for in vitro growth and revealed an additional repertoire of 439 genes to be crucial for B. cenocepacia growth under nutrient-depleted conditions. The library of B. cenocepacia mutants can subsequently be subjected to various biologically related conditions to facilitate the discovery of genes involved in niche adaptation as well as pathogenicity and virulence.
Candidate essential genes in Burkholderia cenocepacia J2315 identified by genome-wide TraDIS
Directory of Open Access Journals (Sweden)
Yee-Chin Wong
2016-08-01
Full Text Available Burkholderia cenocepacia infection often leads to fatal cepacia syndrome in cystic fibrosis patients. However, antibiotic therapy rarely results in complete eradication of the pathogen due to its intrinsic resistance to many clinically available antibiotics. Recent attention has turned to the identification of essential genes as the proteins encoded by these genes may serve as potential targets for development of novel antimicrobials. In this study, we utilized TraDIS (Transposon Directed Insertion-site Sequencing as a genome-wide screening tool to facilitate the identification of B. cenocepacia genes essential for its growth and viability. A transposon mutant pool consisting of approximately 500,000 mutants was successfully constructed, with more than 400,000 unique transposon insertion sites identified by computational analysis of TraDIS datasets. The saturated library allowed for the identification of 383 genes that were predicted to be essential in B. cenocepacia. We extended the application of TraDIS to identify conditionally essential genes required for in vitro growth and revealed an additional repertoire of 439 genes to be crucial for B. cenocepacia growth under nutrient-depleted conditions. The library of B. cenocepacia mutants can subsequently be subjected to various biologically related conditions to facilitate the discovery of genes involved in niche adaptation as well as pathogenicity and virulence.
Khan, Madiha; Ragni, Laura; Tabb, Paul; Salasini, Brenda C; Chatfield, Steven; Datla, Raju; Lock, John; Kuai, Xiahezi; Després, Charles; Proveniers, Marcel; Yongguo, Cao; Xiang, Daoquan; Morin, Halima; Rullière, Jean-Pierre; Citerne, Sylvie; Hepworth, Shelley R; Pautot, Véronique
2015-11-01
In the model plant Arabidopsis (Arabidopsis thaliana), endogenous and environmental signals acting on the shoot apical meristem cause acquisition of inflorescence meristem fate. This results in changed patterns of aerial development seen as the transition from making leaves to the production of flowers separated by elongated internodes. Two related BEL1-like homeobox genes, PENNYWISE (PNY) and POUND-FOOLISH (PNF), fulfill this transition. Loss of function of these genes impairs stem cell maintenance and blocks internode elongation and flowering. We show here that pny pnf apices misexpress lateral organ boundary genes BLADE-ON-PETIOLE1/2 (BOP1/2) and KNOTTED-LIKE FROM ARABIDOPSIS THALIANA6 (KNAT6) together with ARABIDOPSIS THALIANA HOMEOBOX GENE1 (ATH1). Inactivation of genes in this module fully rescues pny pnf defects. We further show that BOP1 directly activates ATH1, whereas activation of KNAT6 is indirect. The pny pnf restoration correlates with renewed accumulation of transcripts conferring floral meristem identity, including FD, SQUAMOSA PROMOTER-BINDING PROTEIN LIKE genes, LEAFY, and APETALA1. To gain insight into how this module blocks flowering, we analyzed the transcriptome of BOP1-overexpressing plants. Our data suggest a central role for the microRNA156-SQUAMOSA PROMOTER BINDING PROTEIN-LIKE-microRNA172 module in integrating stress signals conferred in part by promotion of jasmonic acid biosynthesis. These data reveal a potential mechanism by which repression of lateral organ boundary genes by PNY-PNF is essential for flowering. © 2015 American Society of Plant Biologists. All Rights Reserved.
Evolution of the YABBY gene family in seed plants.
Finet, Cédric; Floyd, Sandra K; Conway, Stephanie J; Zhong, Bojian; Scutt, Charles P; Bowman, John L
2016-01-01
Members of the YABBY gene family of transcription factors in angiosperms have been shown to be involved in the initiation of outgrowth of the lamina, the maintenance of polarity, and establishment of the leaf margin. Although most of the dorsal-ventral polarity genes in seed plants have homologs in non-spermatophyte lineages, the presence of YABBY genes is restricted to seed plants. To gain insight into the origin and diversification of this gene family, we reconstructed the evolutionary history of YABBY gene lineages in seed plants. Our findings suggest that either one or two YABBY genes were present in the last common ancestor of extant seed plants. We also examined the expression of YABBY genes in the gymnosperms Ephedra distachya (Gnetales), Ginkgo biloba (Ginkgoales), and Pseudotsuga menziesii (Coniferales). Our data indicate that some YABBY genes are expressed in a polar (abaxial) manner in leaves and female cones in gymnosperms. We propose that YABBY genes already acted as polarity genes in the last common ancestor of extant seed plants. © 2016 Wiley Periodicals, Inc.
Plant responses to environmental stresses-from gene to biotechnology.
Ahanger, Mohammad Abass; Akram, Nudrat Aisha; Ashraf, Muhammad; Alyemeni, Mohammed Nasser; Wijaya, Leonard; Ahmad, Parvaiz
2017-07-01
Increasing global population, urbanization and industrialization are increasing the rate of conversion of arable land into wasteland. Supplying food to an ever-increasing population is one of the biggest challenges that agriculturalists and plant scientists are currently confronting. Environmental stresses make this situation even graver. Despite the induction of several tolerance mechanisms, sensitive plants often fail to survive under environmental extremes. New technological approaches are imperative. Conventional breeding methods have a limited potential to improve plant genomes against environmental stress. Recently, genetic engineering has contributed enormously to the development of genetically modified varieties of different crops such as cotton, maize, rice, canola and soybean. The identification of stress-responsive genes and their subsequent introgression or overexpression within sensitive crop species are now being widely carried out by plant scientists. Engineering of important tolerance pathways, like antioxidant enzymes, osmolyte accumulation, membrane-localized transporters for efficient compartmentation of deleterious ions and accumulation of essential elements and resistance against pests or pathogens is also an area that has been intensively researched. In this review, the role of biotechnology and its successes, prospects and challenges in developing stress-tolerant crop cultivars are discussed.
Cotton plants export microRNAs to inhibit virulence gene expression in a fungal pathogen.
Zhang, Tao; Zhao, Yun-Long; Zhao, Jian-Hua; Wang, Sheng; Jin, Yun; Chen, Zhong-Qi; Fang, Yuan-Yuan; Hua, Chen-Lei; Ding, Shou-Wei; Guo, Hui-Shan
2016-09-26
Plant pathogenic fungi represent the largest group of disease-causing agents on crop plants, and are a constant and major threat to agriculture worldwide. Recent studies have shown that engineered production of RNA interference (RNAi)-inducing dsRNA in host plants can trigger specific fungal gene silencing and confer resistance to fungal pathogens 1-7 . Although these findings illustrate efficient uptake of host RNAi triggers by pathogenic fungi, it is unknown whether or not such an uptake mechanism has been evolved for a natural biological function in fungus-host interactions. Here, we show that in response to infection with Verticillium dahliae (a vascular fungal pathogen responsible for devastating wilt diseases in many crops) cotton plants increase production of microRNA 166 (miR166) and miR159 and export both to the fungal hyphae for specific silencing. We found that two V. dahliae genes encoding a Ca 2+ -dependent cysteine protease (Clp-1) and an isotrichodermin C-15 hydroxylase (HiC-15), and targeted by miR166 and miR159, respectively, are both essential for fungal virulence. Notably, V. dahliae strains expressing either Clp-1 or HiC-15 rendered resistant to the respective miRNA exhibited drastically enhanced virulence in cotton plants. Together, our findings identify a novel defence strategy of host plants by exporting specific miRNAs to induce cross-kingdom gene silencing in pathogenic fungi and confer disease resistance.
Diversification of Root Hair Development Genes in Vascular Plants.
Huang, Ling; Shi, Xinhui; Wang, Wenjia; Ryu, Kook Hui; Schiefelbein, John
2017-07-01
The molecular genetic program for root hair development has been studied intensively in Arabidopsis ( Arabidopsis thaliana ). To understand the extent to which this program might operate in other plants, we conducted a large-scale comparative analysis of root hair development genes from diverse vascular plants, including eudicots, monocots, and a lycophyte. Combining phylogenetics and transcriptomics, we discovered conservation of a core set of root hair genes across all vascular plants, which may derive from an ancient program for unidirectional cell growth coopted for root hair development during vascular plant evolution. Interestingly, we also discovered preferential diversification in the structure and expression of root hair development genes, relative to other root hair- and root-expressed genes, among these species. These differences enabled the definition of sets of genes and gene functions that were acquired or lost in specific lineages during vascular plant evolution. In particular, we found substantial divergence in the structure and expression of genes used for root hair patterning, suggesting that the Arabidopsis transcriptional regulatory mechanism is not shared by other species. To our knowledge, this study provides the first comprehensive view of gene expression in a single plant cell type across multiple species. © 2017 American Society of Plant Biologists. All Rights Reserved.
Human error: An essential problem of nuclear power plants
International Nuclear Information System (INIS)
Smidt, D.
1981-01-01
The author first defines the part played by man in the nuclear power plant and then deals in more detail with the structure of his valse behavior in tactical and strategic repect. The dicussion of tactical errors and their avoidance is follwed by a report on the actual state of plant technology and possible improvements. Subsequently a study of the strategic errors including the conclusion to be drawn until now (joint between plant and man, personal selection and education) is made. If the joints between man and machine are designed according and physiological strenghts and weaknesses of man are fully realized and taken into account human errors not be essential problem in nuclear power plant. (GL) [de
International Nuclear Information System (INIS)
Mufti, F.U.D.; Banaras, S.
2015-01-01
Internal control genes are the constitutive genes which maintain the basic cellular functions and regularly express in both normal and stressed conditions in living organisms. They are used in normalization of gene expression studies in comparative analysis of target genes, as their expression remains comparatively unchanged in all varied conditions. Among internal control genes, actin is considered as a candidate gene for expression studies due to its vital role in shaping cytoskeleton and plant physiology. Unfortunately most of such knowledge is limited to only model plants or crops, not much is known about important medicinal plants. Therefore, we selected seven important medicinal wild plants for molecular identification of actin gene. We used gene specific primers designed from the conserved regions of several known orthologues or homologues of actin genes from other plants. The amplified products of 370-380 bp were sequenced and submitted to GeneBank after their confirmation using different bioinformatics tools. All the novel partial sequences of putative actin genes were submitted to GeneBank (Parthenium hysterophorus (KJ774023), Fagonia indica (KJ774024), Rhazya stricta (KJ774025), Whithania coagulans (KJ774026), Capparis decidua (KJ774027), Verbena officinalis (KJ774028) and Aerva javanica (KJ774029)). The comparisons of these partial sequences by Basic Local Alignment Search Tool (BLAST) and phylogenetic trees demonstrated high similarity with known actin genes of other plants. Our findings illustrated highly conserved nature of actin gene among these selected plants. These novel partial fragments of actin genes from these wild medicinal plants can be used as internal controls for future gene expression studies of these important plants after precise validations of their stable expression in such plants. (author)
Directory of Open Access Journals (Sweden)
S.Ali Tabatabaei
2017-08-01
Full Text Available Introduction: Ajowan (Carum copticum Benth. & Hook. is an annual herbaceous essential oil bearing plant belonging to the Apiaceae family, which grows in India, Iran, and Egypt. Ajowan seeds have essential oil as an active substance, which is used in pharmaceutical industry as a diuretic, antivomiting, analgesic, antiasthma, antispasmodic and a carminative. Nitrogen is a part of all living cells and is a necessary part of all proteins, enzymes and metabolic processes involved in the synthesis and transfer of energy. Also, nitrogen is a part of chlorophyll, the green pigment of the plant that is responsible for photosynthesis. Generally, proper agronomic management including suitable plant density has a high influence on growth and yield of medicinal plants. In this regard, Kloss et al., (2012 highlighted the need for strategies to improve crop growth, make irrigation more efficient and sustainable and conserve farmlands. In addition, yield is influenced by inter-row spacing and sowing density. Ghilavizadeh et al., (2013 have reported that application of suitable amount of nitrogen fertilizer and plant density of 25 plan/m2 increased seed yield, essential oil yield and essential oil content of ajowan. In another research, Borumand Rezazadeh et al., (2009 reported that the plant density of 50 plant/m2 have produced the highest seed yield, essential oil yield and essential oil content. Generally, with regard to importance of medicinal plants and the necessity of understanding their crop and the impact of plant density and nitrogen fertilizer on the performance of these plants, this study was conducted to investigate the impact of these factors on some traits of ajowan. Materials and Methods: In order to evaluate the effect of plant density and nitrogen fertilizer on different traits of ajowan (Carum copticum L., an experiment was conducted using factorial based on randomized complete block design with three replications at Agricultural and Natural
Miller, Andrew B; Cates, Rex G; Lawrence, Michael; Soria, J Alfonso Fuentes; Espinoza, Luis V; Martinez, Jose Vicente; Arbizú, Dany A
2015-04-01
Essential oils are prevalent in many medicinal plants used for oral hygiene and treatment of diseases. Medicinal plant species were extracted to determine the essential oil content. Those producing sufficient oil were screened for activity against Staphylococcus aureus, Escherichia coli, Streptococcus mutans, Lactobacillus acidophilus, and Candida albicans. Plant samples were collected, frozen, and essential oils were extracted by steam distillation. Minimum inhibitory concentrations (MIC) were determined using a tube dilution assay for those species yielding sufficient oil. Fifty-nine of the 141 plant species produced sufficient oil for collection and 12 species not previously reported to produce essential oils were identified. Essential oil extracts from 32 species exhibited activity against one or more microbes. Oils from eight species were highly inhibitory to S. mutans, four species were highly inhibitory to C. albicans, and 19 species yielded MIC values less than the reference drugs. RESULTS suggest that 11 species were highly inhibitory to the microbes tested and merit further investigation. Oils from Cinnamomum zeylanicum Blume (Lauraceae), Citrus aurantiifolia (Christm.) Swingle (Rutaceae), Lippia graveolens Kunth (Verbenaceae), and Origanum vulgare L. (Lamiaceae) yielded highly significant or moderate activity against all microbes and have potential as antimicrobial agents. Teas prepared by decoction or infusion are known methods for extracting essential oils. Oils from 11 species were highly active against the microbes tested and merit investigation as to their potential for addressing health-related issues and in oral hygiene.
Chemical composition and antioxidant activity of essential oils isolated from Colombian plants
Directory of Open Access Journals (Sweden)
Jesús Olivero-Verbel
Full Text Available Thirteen essential oils from Colombian plants, obtained by hydrodistillation or microwave-assisted hydrodistillation of total plant, stem, leaves, and flowers were analyzed by gas-chromatography-mass spectrometry techniques. Cytotoxicity of essential oils was assessed using the brine shrimp assay, and their antioxidant activities measuring their effects on the levels of thiobarbituric acid reactive substances on rat liver microsomes induced by Fe2+/H2O2. Five oils showed high cytotoxicity (LC501000 µg/mL.
Collonnier, Cécile; Guyon-Debast, Anouchka; Maclot, François; Mara, Kostlend; Charlot, Florence; Nogué, Fabien
2017-05-15
Beyond its predominant role in human and animal therapy, the CRISPR-Cas9 system has also become an essential tool for plant research and plant breeding. Agronomic applications rely on the mastery of gene inactivation and gene modification. However, if the knock-out of genes by non-homologous end-joining (NHEJ)-mediated repair of the targeted double-strand breaks (DSBs) induced by the CRISPR-Cas9 system is rather well mastered, the knock-in of genes by homology-driven repair or end-joining remains difficult to perform efficiently in higher plants. In this review, we describe the different approaches that can be tested to improve the efficiency of CRISPR-induced gene modification in plants, which include the use of optimal transformation and regeneration protocols, the design of appropriate guide RNAs and donor templates and the choice of nucleases and means of delivery. We also present what can be done to orient DNA repair pathways in the target cells, and we show how the moss Physcomitrella patens can be used as a model plant to better understand what DNA repair mechanisms are involved, and how this knowledge could eventually be used to define more performant strategies of CRISPR-induced gene knock-in. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Huang Hsien-Da
2008-11-01
Full Text Available Abstract Background The elucidation of transcriptional regulation in plant genes is important area of research for plant scientists, following the mapping of various plant genomes, such as A. thaliana, O. sativa and Z. mays. A variety of bioinformatic servers or databases of plant promoters have been established, although most have been focused only on annotating transcription factor binding sites in a single gene and have neglected some important regulatory elements (tandem repeats and CpG/CpNpG islands in promoter regions. Additionally, the combinatorial interaction of transcription factors (TFs is important in regulating the gene group that is associated with the same expression pattern. Therefore, a tool for detecting the co-regulation of transcription factors in a group of gene promoters is required. Results This study develops a database-assisted system, PlantPAN (Plant Promoter Analysis Navigator, for recognizing combinatorial cis-regulatory elements with a distance constraint in sets of plant genes. The system collects the plant transcription factor binding profiles from PLACE, TRANSFAC (public release 7.0, AGRIS, and JASPER databases and allows users to input a group of gene IDs or promoter sequences, enabling the co-occurrence of combinatorial transcription factor binding sites (TFBSs within a defined distance (20 bp to 200 bp to be identified. Furthermore, the new resource enables other regulatory features in a plant promoter, such as CpG/CpNpG islands and tandem repeats, to be displayed. The regulatory elements in the conserved regions of the promoters across homologous genes are detected and presented. Conclusion In addition to providing a user-friendly input/output interface, PlantPAN has numerous advantages in the analysis of a plant promoter. Several case studies have established the effectiveness of PlantPAN. This novel analytical resource is now freely available at http://PlantPAN.mbc.nctu.edu.tw.
Directory of Open Access Journals (Sweden)
Yi Xiong
2014-08-01
Full Text Available Filamentous fungi that thrive on plant biomass are the major producers of hydrolytic enzymes used to decompose lignocellulose for biofuel production. Although induction of cellulases is regulated at the transcriptional level, how filamentous fungi sense and signal carbon-limited conditions to coordinate cell metabolism and regulate cellulolytic enzyme production is not well characterized. By screening a transcription factor deletion set in the filamentous fungus Neurospora crassa for mutants unable to grow on cellulosic materials, we identified a role for the transcription factor, VIB1, as essential for cellulose utilization. VIB1 does not directly regulate hydrolytic enzyme gene expression or function in cellulosic inducer signaling/processing, but affects the expression level of an essential regulator of hydrolytic enzyme genes, CLR2. Transcriptional profiling of a Δvib-1 mutant suggests that it has an improper expression of genes functioning in metabolism and energy and a deregulation of carbon catabolite repression (CCR. By characterizing new genes, we demonstrate that the transcription factor, COL26, is critical for intracellular glucose sensing/metabolism and plays a role in CCR by negatively regulating cre-1 expression. Deletion of the major player in CCR, cre-1, or a deletion of col-26, did not rescue the growth of Δvib-1 on cellulose. However, the synergistic effect of the Δcre-1; Δcol-26 mutations circumvented the requirement of VIB1 for cellulase gene expression, enzyme secretion and cellulose deconstruction. Our findings support a function of VIB1 in repressing both glucose signaling and CCR under carbon-limited conditions, thus enabling a proper cellular response for plant biomass deconstruction and utilization.
Transfer of engineered genes from crop to wild plants
DEFF Research Database (Denmark)
Bagger Jørgensen, Rikke; Hauser, T.P.; Mikkelsen, T.R.
1996-01-01
The escape of engineered genes - genes inserted using recombinant DNA techniques - from cultivated plants to wild or weedy relatives has raised concern about possible risks to the environment or to health. The media have added considerably to public concern by suggesting that such gene escape...... is a new and rather unexpected phenomenon. However, transfer of engineered genes between plants is not at-all surprising, because it is mediated by exactly the same mechanisms as those responsible for transferring endogenous plant genes: it takes place by sexual crosses, with pollen as the carrier...
An Updated Collection of Sequence Barcoded Temperature-Sensitive Alleles of Yeast Essential Genes.
Kofoed, Megan; Milbury, Karissa L; Chiang, Jennifer H; Sinha, Sunita; Ben-Aroya, Shay; Giaever, Guri; Nislow, Corey; Hieter, Philip; Stirling, Peter C
2015-07-14
Systematic analyses of essential gene function using mutant collections in Saccharomyces cerevisiae have been conducted using collections of heterozygous diploids, promoter shut-off alleles, through alleles with destabilized mRNA, destabilized protein, or bearing mutations that lead to a temperature-sensitive (ts) phenotype. We previously described a method for construction of barcoded ts alleles in a systematic fashion. Here we report the completion of this collection of alleles covering 600 essential yeast genes. This resource covers a larger gene repertoire than previous collections and provides a complementary set of strains suitable for single gene and genomic analyses. We use deep sequencing to characterize the amino acid changes leading to the ts phenotype in half of the alleles. We also use high-throughput approaches to describe the relative ts behavior of the alleles. Finally, we demonstrate the experimental usefulness of the collection in a high-content, functional genomic screen for ts alleles that increase spontaneous P-body formation. By increasing the number of alleles and improving the annotation, this ts collection will serve as a community resource for probing new aspects of biology for essential yeast genes. Copyright © 2015 Kofoed et al.
Expression of streptavidin gene in bacteria and plants
International Nuclear Information System (INIS)
Guan, Xueni; Wurtele, E.S.; Nikolau, B.J.
1990-01-01
Six biotin-containing proteins are present in plants, representing at least four different biotin enzymes. The physiological function of these biotin enzymes is not understood. Streptavidin, a protein from Streptomyces avidinii, binds tightly and specifically to biotin causing inactivation of biotin enzymes. One approach to elucidating the physiological function of biotin enzymes in plant metabolism is to create transgenic plants expressing the streptavidin gene. A plasmid containing a fused streptavidin-beta-galactosidase gene has been expressed in E. coli. We also have constructed various fusion genes that include an altered CaMV 35S promoter, signal peptides to target the streptavidin protein to specific organelles, and the streptavidin coding gene. We are examining the expression of these genes in cells of carrot
Zhang, Dale; Qi, Jinfeng; Yue, Jipei; Huang, Jinling; Sun, Ting; Li, Suoping; Wen, Jian-Fan; Hettenhausen, Christian; Wu, Jinsong; Wang, Lei; Zhuang, Huifu; Wu, Jianqiang; Sun, Guiling
2014-01-13
Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts.
Hua, Hong-Li; Zhang, Fa-Zhan; Labena, Abraham Alemayehu; Dong, Chuan; Jin, Yan-Ting; Guo, Feng-Biao
Investigation of essential genes is significant to comprehend the minimal gene sets of cell and discover potential drug targets. In this study, a novel approach based on multiple homology mapping and machine learning method was introduced to predict essential genes. We focused on 25 bacteria which have characterized essential genes. The predictions yielded the highest area under receiver operating characteristic (ROC) curve (AUC) of 0.9716 through tenfold cross-validation test. Proper features were utilized to construct models to make predictions in distantly related bacteria. The accuracy of predictions was evaluated via the consistency of predictions and known essential genes of target species. The highest AUC of 0.9552 and average AUC of 0.8314 were achieved when making predictions across organisms. An independent dataset from Synechococcus elongatus , which was released recently, was obtained for further assessment of the performance of our model. The AUC score of predictions is 0.7855, which is higher than other methods. This research presents that features obtained by homology mapping uniquely can achieve quite great or even better results than those integrated features. Meanwhile, the work indicates that machine learning-based method can assign more efficient weight coefficients than using empirical formula based on biological knowledge.
Radioactive Study of Malagasy medicinal plants and essential oil by gamma spectrometry
International Nuclear Information System (INIS)
RAMAROSON, V.
1997-01-01
Medicinal plants and essential oil derived from environmental samples such as plants, flowers, bushes or wild trees. Then, it is normal that naturally occuring radionuclides from Thorium and Uranium series on the one hand, K-40, a primordial radionuclide and common for all the samples on the other hand have been identified in such samples. Their activity are very low as it was expected to be, and Pb-210, one of the most radiotoxic among all natural radionuclides was not detected. Particularly, for essential oil, only the light radionuclide K-40 remains in the obtained oil, it is estimated that heavy metals such as Pb-212, identified in plants could not follow the vapour phase during the distillation process. However, detected counts per second of K-40 decrease from plants to oil which are then non-radioactive [fr
Emerging use of gene expression microarrays in plant physiology.
Wullschleger, Stan D; Difazio, Stephen P
2003-01-01
Microarrays have become an important technology for the global analysis of gene expression in humans, animals, plants, and microbes. Implemented in the context of a well-designed experiment, cDNA and oligonucleotide arrays can provide highthroughput, simultaneous analysis of transcript abundance for hundreds, if not thousands, of genes. However, despite widespread acceptance, the use of microarrays as a tool to better understand processes of interest to the plant physiologist is still being explored. To help illustrate current uses of microarrays in the plant sciences, several case studies that we believe demonstrate the emerging application of gene expression arrays in plant physiology were selected from among the many posters and presentations at the 2003 Plant and Animal Genome XI Conference. Based on this survey, microarrays are being used to assess gene expression in plants exposed to the experimental manipulation of air temperature, soil water content and aluminium concentration in the root zone. Analysis often includes characterizing transcript profiles for multiple post-treatment sampling periods and categorizing genes with common patterns of response using hierarchical clustering techniques. In addition, microarrays are also providing insights into developmental changes in gene expression associated with fibre and root elongation in cotton and maize, respectively. Technical and analytical limitations of microarrays are discussed and projects attempting to advance areas of microarray design and data analysis are highlighted. Finally, although much work remains, we conclude that microarrays are a valuable tool for the plant physiologist interested in the characterization and identification of individual genes and gene families with potential application in the fields of agriculture, horticulture and forestry.
Growth regulating properties of isoprene and isoprenoid-based essential oils.
Jones, Andrew Maxwell P; Shukla, Mukund R; Sherif, Sherif M; Brown, Paula B; Saxena, Praveen K
2016-01-01
Essential oils have growth regulating properties comparable to the well-documented methyl jasmonate and may be involved in localized and/or airborne plant communication. Aromatic plants employ large amounts of resources to produce essential oils. Some essential oils are known to contain compounds with plant growth regulating activities. However, the potential capacity of essential oils as airborne molecules able to modulate plant growth/development has remained uninvestigated. Here, we demonstrate that essential oils from eight taxonomically diverse plants applied in their airborne state inhibited auxin-induced elongation of Pisum sativum hypocotyls and Avena sativa coleoptiles. This response was also observed using five monoterpenes commonly found in essential oils as well as isoprene, the basic building block of terpenes. Upon transfer to ambient conditions, A. sativa coleoptiles resumed elongation, demonstrating an antagonistic relationship rather than toxicity. Inclusion of essential oils, monoterpenes, or isoprene into the headspace of culture vessels induced abnormal cellular growth along hypocotyls of Arabidopsis thaliana. These responses were also elicited by methyl jasmonate (MeJA); however, where methyl jasmonate inhibited root growth essential oils did not. Gene expression studies in A. thaliana also demonstrated differences between the MeJA and isoprenoid responses. This series of experiments clearly demonstrate that essential oils and their isoprenoid components interact with endogenous plant growth regulators when applied directly or as volatile components in the headspace. The similarities between isoprenoid and MeJA responses suggest that they may act in plant defence signalling. While further studies are needed to determine the ecological and evolutionary significance, the results of this study and the specialized anatomy associated with aromatic plants suggest that essential oils may act as airborne signalling molecules.
Analysis of gene essentiality in Escherichia coli across strains and growth conditions
DEFF Research Database (Denmark)
Bonde, Ida; Lennen, Rebecca; Cardoso, Joao
are either essential or detrimental for growth in the test condition in question. In this study the TN-Seq method was used to investigate the differences in gene essentiality between four laboratory strains of E.coli subjected to four different growth conditions to investigate the reason for the differences...
Spatial analyses of mono, di and trinucleotide trends in plant genes.
Directory of Open Access Journals (Sweden)
Andrea Porceddu
Full Text Available Genomic DNA sequences display compositional heterogeneity on many scales. In this paper we analyzed tendencies and anomalies in the occurence of mono, di and trinucleotides in structural regions of plant genes. Representation of these trends as a function of position along genic sequences highlighted compositional features peculiar of either monocots or eudicots that were remarkably uniform within these two evolutionary clades. The most evident of these features appeared in the form of gradient of base content along the direction of transcription. The robustness of such a representation was validated in sequences sub-datasets generated considering structural and compositional features such as total length of cds, overall GC content and genic orientation in the genome. Piecewise regression analyses indicated that the gradients could be conveniently approximated to a two segmented model where a first region featuring a steep slope is followed by a second segment fitting a milder variation. In general, monocots species showed steeper segments than eudicots. The guanine gradient was the most distinctive feature between the two evolutionary clades, being moderately increasing in eudicots and firmly decreasing in monocots. Single gene investigation revealed that a high proportion of genes show compositional trends compatible with a segmented model suggesting that these features are essential attributes of gene organization. Dinucleotide and trinucleotide biases were referred to expectation based on a random union of the component elements. The average bias at dinucleotide level identified a significant undererpresentation of some dinucleotide and the overrepresention of others. The bias at trinucleotide level was on average low. Finally, the analysis of bryophyte coding sequences showed mononucleotide, dinucleotide and trinucleotide compositional trends resembling those of higher plants. This finding suggested that the emergenge of compositional bias
Fungal and plant gene expression in arbuscular mycorrhizal symbiosis.
Balestrini, Raffaella; Lanfranco, Luisa
2006-11-01
Arbuscular mycorrhizas (AMs) are a unique example of symbiosis between two eukaryotes, soil fungi and plants. This association induces important physiological changes in each partner that lead to reciprocal benefits, mainly in nutrient supply. The symbiosis results from modifications in plant and fungal cell organization caused by specific changes in gene expression. Recently, much effort has gone into studying these gene expression patterns to identify a wider spectrum of genes involved. We aim in this review to describe AM symbiosis in terms of current knowledge on plant and fungal gene expression profiles.
The Design and Manufacturing of Essential oil Distillation Plant for ...
African Journals Online (AJOL)
Choice-Academy
The paper presents economic value of the design and manufacturing of essential oil production plant ... system with the required precision for standard quality of oil at affordable cost. Thus, the ..... still, steam injection and distribution systems,.
Directory of Open Access Journals (Sweden)
A. S. IVANITSKIKH
2014-07-01
Full Text Available In plants grown with artificial lighting, variations in light spectral composition can be used for the directed biosynthesis of the target substances including essential oils, e.g. in plant factories. We studied the effect of light spectral quality on the essential oil composition in Ocimum basilicum and Salvia officinalis plants grown in controlled environment. The variable-spectrum light modules were designed using three types of high-power light-emitting diodes (LEDs with emission peaked in red, blue and red light, white LEDs, and high-pressure sodium lamps as reference. Qualitative and quantitative essential oil determinations were conducted using gas chromatography with mass selective detection and internal standard method.Sweet basil plant leaves contain essential oils (са. 1 % including linalool, pinene, eugenol, camphor, cineole, and other components. And within the genetic diversity of the species, several cultivar groups can be identified according to the flavor (aroma perceived by humans: eugenol, clove, camphor, vanilla basil. Essential oil components produce particular flavor of the basil leaves. In our studies, we are using two sweet basil varieties differing in the essential oil qualitative composition – “Johnsons Dwarf” (camphor as a major component of essential oils and “Johnsons Lemon Flavor” (contains large amount of citral defining its lemon flavor.In sage, essential oil composition is also very variable. As for the plant responses to the light environment, the highest amount of the essential oils was observed at the regimes with white and red + blue LED light. And it was three times less with red light LEDs alone. In the first two environments, thujone accumulation was higher in comparison with camphor, while red LED light and sodium lamp light favored camphor biosynthesis (three times more than thujone. The highest amount of eucalyptol was determined in plants grown with red LEDs.
From essential to persistent genes: a functional approach to constructing synthetic life
DEFF Research Database (Denmark)
Acevedo-Rocha, Carlos G.; Fang, Gang; Schmidt, Markus
2013-01-01
A central undertaking in synthetic biology (SB) is the quest for the ‘minimal genome’. However, ‘minimal sets’ of essential genes are strongly context-dependent and, in all prokaryotic genomes sequenced to date, not a single protein-coding gene is entirely conserved. Furthermore, a lack...
Emerging Use of Gene Expression Microarrays in Plant Physiology
Directory of Open Access Journals (Sweden)
Stephen P. Difazio
2006-04-01
Full Text Available Microarrays have become an important technology for the global analysis of gene expression in humans, animals, plants, and microbes. Implemented in the context of a well-designed experiment, cDNA and oligonucleotide arrays can provide highthroughput, simultaneous analysis of transcript abundance for hundreds, if not thousands, of genes. However, despite widespread acceptance, the use of microarrays as a tool to better understand processes of interest to the plant physiologist is still being explored. To help illustrate current uses of microarrays in the plant sciences, several case studies that we believe demonstrate the emerging application of gene expression arrays in plant physiology were selected from among the many posters and presentations at the 2003 Plant and Animal Genome XI Conference. Based on this survey, microarrays are being used to assess gene expression in plants exposed to the experimental manipulation of air temperature, soil water content and aluminium concentration in the root zone. Analysis often includes characterizing transcript profiles for multiple post-treatment sampling periods and categorizing genes with common patterns of response using hierarchical clustering techniques. In addition, microarrays are also providing insights into developmental changes in gene expression associated with fibre and root elongation in cotton and maize, respectively. Technical and analytical limitations of microarrays are discussed and projects attempting to advance areas of microarray design and data analysis are highlighted. Finally, although much work remains, we conclude that microarrays are a valuable tool for the plant physiologist interested in the characterization and identification of individual genes and gene families with potential application in the fields of agriculture, horticulture and forestry.
Dedrick, Rebekah M; Marinelli, Laura J; Newton, Gerald L; Pogliano, Kit; Pogliano, Joseph; Hatfull, Graham F
2013-05-01
Bacteriophages represent a majority of all life forms, and the vast, dynamic population with early origins is reflected in their enormous genetic diversity. A large number of bacteriophage genomes have been sequenced. They are replete with novel genes without known relatives. We know little about their functions, which genes are required for lytic growth, and how they are expressed. Furthermore, the diversity is such that even genes with required functions - such as virion proteins and repressors - cannot always be recognized. Here we describe a functional genomic dissection of mycobacteriophage Giles, in which the virion proteins are identified, genes required for lytic growth are determined, the repressor is identified, and the transcription patterns determined. We find that although all of the predicted phage genes are expressed either in lysogeny or in lytic growth, 45% of the predicted genes are non-essential for lytic growth. We also describe genes required for DNA replication, show that recombination is required for lytic growth, and that Giles encodes a novel repressor. RNAseq analysis reveals abundant expression of a small non-coding RNA in a lysogen and in late lytic growth, although it is non-essential for lytic growth and does not alter lysogeny. © 2013 Blackwell Publishing Ltd.
Divergence and Conservative Evolution of XTNX Genes in Land Plants
Directory of Open Access Journals (Sweden)
Yan-Mei Zhang
2017-10-01
Full Text Available The Toll-interleukin-1 receptor (TIR and Nucleotide-binding site (NBS domains are two major components of the TIR-NBS-leucine-rich repeat family plant disease resistance genes. Extensive functional and evolutionary studies have been performed on these genes; however, the characterization of a small group of genes that are composed of atypical TIR and NBS domains, namely XTNX genes, is limited. The present study investigated this specific gene family by conducting genome-wide analyses of 59 green plant genomes. A total of 143 XTNX genes were identified in 51 of the 52 land plant genomes, whereas no XTNX gene was detected in any green algae genomes, which indicated that XTNX genes originated upon emergence of land plants. Phylogenetic analysis revealed that the ancestral XTNX gene underwent two rounds of ancient duplications in land plants, which resulted in the formation of clades I/II and clades IIa/IIb successively. Although clades I and IIb have evolved conservatively in angiosperms, the motif composition difference and sequence divergence at the amino acid level suggest that functional divergence may have occurred since the separation of the two clades. In contrast, several features of the clade IIa genes, including the absence in the majority of dicots, the long branches in the tree, the frequent loss of ancestral motifs, and the loss of expression in all detected tissues of Zea mays, all suggest that the genes in this lineage might have undergone pseudogenization. This study highlights that XTNX genes are a gene family originated anciently in land plants and underwent specific conservative pattern in evolution.
Panwar, Vinay; Jordan, Mark; McCallum, Brent; Bakkeren, Guus
2018-05-01
Leaf rust, caused by the pathogenic fungus Puccinia triticina (Pt), is one of the most serious biotic threats to sustainable wheat production worldwide. This obligate biotrophic pathogen is prevalent worldwide and is known for rapid adaptive evolution to overcome resistant wheat varieties. Novel disease control approaches are therefore required to minimize the yield losses caused by Pt. Having shown previously the potential of host-delivered RNA interference (HD-RNAi) in functional screening of Pt genes involved in pathogenesis, we here evaluated the use of this technology in transgenic wheat plants as a method to achieve protection against wheat leaf rust (WLR) infection. Stable expression of hairpin RNAi constructs with sequence homology to Pt MAP-kinase (PtMAPK1) or a cyclophilin (PtCYC1) encoding gene in susceptible wheat plants showed efficient silencing of the corresponding genes in the interacting fungus resulting in disease resistance throughout the T 2 generation. Inhibition of Pt proliferation in transgenic lines by in planta-induced RNAi was associated with significant reduction in target fungal transcript abundance and reduced fungal biomass accumulation in highly resistant plants. Disease protection was correlated with the presence of siRNA molecules specific to targeted fungal genes in the transgenic lines harbouring the complementary HD-RNAi construct. This work demonstrates that generating transgenic wheat plants expressing RNAi-inducing transgenes to silence essential genes in rust fungi can provide effective disease resistance, thus opening an alternative way for developing rust-resistant crops. © 2017 Her Majesty the Queen in Right of Canada. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Yang, Zheng Rong; Bullifent, Helen L.; Moore, Karen; Paszkiewicz, Konrad; Saint, Richard J.; Southern, Stephanie J.; Champion, Olivia L.; Senior, Nicola J.; Sarkar-Tyson, Mitali; Oyston, Petra C. F.; Atkins, Timothy P.; Titball, Richard W.
2017-02-01
Massively parallel sequencing technology coupled with saturation mutagenesis has provided new and global insights into gene functions and roles. At a simplistic level, the frequency of mutations within genes can indicate the degree of essentiality. However, this approach neglects to take account of the positional significance of mutations - the function of a gene is less likely to be disrupted by a mutation close to the distal ends. Therefore, a systematic bioinformatics approach to improve the reliability of essential gene identification is desirable. We report here a parametric model which introduces a novel mutation feature together with a noise trimming approach to predict the biological significance of Tn5 mutations. We show improved performance of essential gene prediction in the bacterium Yersinia pestis, the causative agent of plague. This method would have broad applicability to other organisms and to the identification of genes which are essential for competitiveness or survival under a broad range of stresses.
Bioinformatics analysis of the predicted polyprenol reductase genes in higher plants
Basyuni, M.; Wati, R.
2018-03-01
The present study evaluates the bioinformatics methods to analyze twenty-four predicted polyprenol reductase genes from higher plants on GenBank as well as predicted the structure, composition, similarity, subcellular localization, and phylogenetic. The physicochemical properties of plant polyprenol showed diversity among the observed genes. The percentage of the secondary structure of plant polyprenol genes followed the ratio order of α helix > random coil > extended chain structure. The values of chloroplast but not signal peptide were too low, indicated that few chloroplast transit peptide in plant polyprenol reductase genes. The possibility of the potential transit peptide showed variation among the plant polyprenol reductase, suggested the importance of understanding the variety of peptide components of plant polyprenol genes. To clarify this finding, a phylogenetic tree was drawn. The phylogenetic tree shows several branches in the tree, suggested that plant polyprenol reductase genes grouped into divergent clusters in the tree.
Jasmonate is essential for insect defense in Arabidopsis.
McConn, M; Creelman, R A; Bell, E; Mullet, J E; Browse, J
1997-05-13
The signaling pathways that allow plants to mount defenses against chewing insects are known to be complex. To investigate the role of jasmonate in wound signaling in Arabidopsis and to test whether parallel or redundant pathways exist for insect defense, we have studied a mutant (fad3-2 fad7-2 fad8) that is deficient in the jasmonate precursor linolenic acid. Mutant plants contained negligible levels of jasmonate and showed extremely high mortality ( approximately 80%) from attack by larvae of a common saprophagous fungal gnat, Bradysia impatiens (Diptera: Sciaridae), even though neighboring wild-type plants were largely unaffected. Application of exogenous methyl jasmonate substantially protected the mutant plants and reduced mortality to approximately 12%. These experiments precisely define the role of jasmonate as being essential for the induction of biologically effective defense in this plant-insect interaction. The transcripts of three wound-responsive genes were shown not to be induced by wounding of mutant plants but the same transcripts could be induced by application of methyl jasmonate. By contrast, measurements of transcript levels for a gene encoding glutathione S-transferase demonstrated that wound induction of this gene is independent of jasmonate synthesis. These results indicate that the mutant will be a good genetic model for testing the practical effectiveness of candidate defense genes.
Plant essential oils potency as natural antibiotic in Indonesian medicinal herb of “jamu”
Soetjipto, H.; Martono, Y.
2017-02-01
The main purposes of this study are to compile antibacterial activity data of essential oils from Indonesian’s plants in order which can be used as a natural antibiotic in “jamu” to increase potential Indonesian medicinal herb. By using Agar Diffusing method, Bioautography and Gas Chromatography Mass Spectrum, respectively, antibacterial activity and chemical compounds of 12 plants essential oils were studied in the Natural Product Chemistry Laboratory, Department of Chemistry, Faculty of Science and Mathematics, Satya Wacana Christian University, Salatiga since 2007 until 2015. The results of this studies showed that all of the essential oils have a medium to a strong antibacterial activity which are in the range of 30 - 2,500 μg and 80-5,000 μg. Further on, the essential oils analyzed by GCMS showed that each essential oils have different dominant compounds. These data can be used as basic doses in the usage of essential oils as natural antibiotics.
Essential oil of Croton flavens L. (Welensali), a medicinal plant from Curacao
Woerdenbag, HJ; Bos, R; van Meeteren, HE; Baarslag, JJJ; de Jong-van den Berg, LTW; Pras, N; do Rego Kuster, G; Petronia, RRL
2000-01-01
The volatile constituents from aerial and underground parts of Croton flavens L., a medicinal plant from Curacao, were investigated by GC and GC/MS (EI) analysis. The various plant parts yielded 0.27-0.50%, (v/w) essential oil on a dry weight basis. There were only small differences in the
Increased burden of deleterious variants in essential genes in autism spectrum disorder.
Ji, Xiao; Kember, Rachel L; Brown, Christopher D; Bućan, Maja
2016-12-27
Autism spectrum disorder (ASD) is a heterogeneous, highly heritable neurodevelopmental syndrome characterized by impaired social interaction, communication, and repetitive behavior. It is estimated that hundreds of genes contribute to ASD. We asked if genes with a strong effect on survival and fitness contribute to ASD risk. Human orthologs of genes with an essential role in pre- and postnatal development in the mouse [essential genes (EGs)] are enriched for disease genes and under strong purifying selection relative to human orthologs of mouse genes with a known nonlethal phenotype [nonessential genes (NEGs)]. This intolerance to deleterious mutations, commonly observed haploinsufficiency, and the importance of EGs in development suggest a possible cumulative effect of deleterious variants in EGs on complex neurodevelopmental disorders. With a comprehensive catalog of 3,915 mammalian EGs, we provide compelling evidence for a stronger contribution of EGs to ASD risk compared with NEGs. By examining the exonic de novo and inherited variants from 1,781 ASD quartet families, we show a significantly higher burden of damaging mutations in EGs in ASD probands compared with their non-ASD siblings. The analysis of EGs in the developing brain identified clusters of coexpressed EGs implicated in ASD. Finally, we suggest a high-priority list of 29 EGs with potential ASD risk as targets for future functional and behavioral studies. Overall, we show that large-scale studies of gene function in model organisms provide a powerful approach for prioritization of genes and pathogenic variants identified by sequencing studies of human disease.
Lee, Hyo-Rim; Kim, Gil-Hah; Choi, Won-Sil; Park, Il-Kwon
2017-04-01
We evaluated the repellent activity of 12 Apiaceae plant essential oils and their components against male and female adult German cockroaches, Blattella germanica L., to find new natural repellents. Of all the plant essential oils tested, ajowan (Trachyspermum ammi Sprague) and dill (Anethum graveolens L.) essential oils showed the most potent repellent activity against male and female adult German cockroaches. Repellent activities of chemicals already identified in active oils were also investigated. Of the compounds identified, carvacrol, thymol, and R-(-)-carvone showed >80% repellent activity against male and female adult German cockroaches at 2.5 µg/cm2. S-(+)-Carvone, (+)-dihydrocarvone, and terpinen-4-ol showed >70% repellent activity against male and female adult German cockroaches at 10 µg/cm2. Our results indicated that Apiaceae plant essential oils and their constituents have good potential as natural repellents against adult German cockroaches. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Genomewide Identification of Essential Genes and Fitness Determinants of Streptococcus mutans UA159
Zeng, Lin; Culp, David J.
2018-01-01
ABSTRACT Transposon mutagenesis coupled with next-generation DNA sequencing (Tn-seq) is a powerful tool for discovering regions of the genome that are required for the survival of bacteria in different environments. We adapted this technique to the dental caries pathogen Streptococcus mutans UA159 and identified 11% of the genome as essential, with many genes encoding products required for replication, translation, lipid metabolism, and cell wall biogenesis. Comparison of the essential genome of S. mutans UA159 with those of selected other streptococci for which such information is available revealed several metabolic pathways and genes that are required in S. mutans, but not in some Streptococcus spp. We further identified genes that are essential for sustained growth in rich or defined medium, as well as for persistence in vivo in a rodent model of oral infection. Collectively, our results provide a novel and comprehensive view of the genes required for essential processes of S. mutans, many of which could represent potential targets for therapeutics. IMPORTANCE Tooth decay (dental caries) is a common cause of pain, impaired quality of life, and tooth loss in children and adults. It begins because of a compositional change in the microorganisms that colonize the tooth surface driven by repeated and sustained carbohydrate intake. Although several bacterial species are associated with tooth decay, Streptococcus mutans is the most common cause. Therefore, it is important to identify biological processes that contribute to the survival of S. mutans in the human mouth, with the aim of disrupting the processes with antimicrobial agents. We successfully applied Tn-seq to S. mutans, discovering genes that are required for survival, growth, and persistence, both in laboratory environments and in a mouse model of tooth decay. This work highlights new avenues for the control of an important human pathogen. PMID:29435491
2010-01-01
Background Horizontal gene transfer (HGT) is relatively common in plant mitochondrial genomes but the mechanisms, extent and consequences of transfer remain largely unknown. Previous results indicate that parasitic plants are often involved as either transfer donors or recipients, suggesting that direct contact between parasite and host facilitates genetic transfer among plants. Results In order to uncover the mechanistic details of plant-to-plant HGT, the extent and evolutionary fate of transfer was investigated between two groups: the parasitic genus Cuscuta and a small clade of Plantago species. A broad polymerase chain reaction (PCR) survey of mitochondrial genes revealed that at least three genes (atp1, atp6 and matR) were recently transferred from Cuscuta to Plantago. Quantitative PCR assays show that these three genes have a mitochondrial location in the one species line of Plantago examined. Patterns of sequence evolution suggest that these foreign genes degraded into pseudogenes shortly after transfer and reverse transcription (RT)-PCR analyses demonstrate that none are detectably transcribed. Three cases of gene conversion were detected between native and foreign copies of the atp1 gene. The identical phylogenetic distribution of the three foreign genes within Plantago and the retention of cytidines at ancestral positions of RNA editing indicate that these genes were probably acquired via a single, DNA-mediated transfer event. However, samplings of multiple individuals from two of the three species in the recipient Plantago clade revealed complex and perplexing phylogenetic discrepancies and patterns of sequence divergence for all three of the foreign genes. Conclusions This study reports the best evidence to date that multiple mitochondrial genes can be transferred via a single HGT event and that transfer occurred via a strictly DNA-level intermediate. The discovery of gene conversion between co-resident foreign and native mitochondrial copies suggests
Directory of Open Access Journals (Sweden)
Hao Weilong
2010-12-01
Full Text Available Abstract Background Horizontal gene transfer (HGT is relatively common in plant mitochondrial genomes but the mechanisms, extent and consequences of transfer remain largely unknown. Previous results indicate that parasitic plants are often involved as either transfer donors or recipients, suggesting that direct contact between parasite and host facilitates genetic transfer among plants. Results In order to uncover the mechanistic details of plant-to-plant HGT, the extent and evolutionary fate of transfer was investigated between two groups: the parasitic genus Cuscuta and a small clade of Plantago species. A broad polymerase chain reaction (PCR survey of mitochondrial genes revealed that at least three genes (atp1, atp6 and matR were recently transferred from Cuscuta to Plantago. Quantitative PCR assays show that these three genes have a mitochondrial location in the one species line of Plantago examined. Patterns of sequence evolution suggest that these foreign genes degraded into pseudogenes shortly after transfer and reverse transcription (RT-PCR analyses demonstrate that none are detectably transcribed. Three cases of gene conversion were detected between native and foreign copies of the atp1 gene. The identical phylogenetic distribution of the three foreign genes within Plantago and the retention of cytidines at ancestral positions of RNA editing indicate that these genes were probably acquired via a single, DNA-mediated transfer event. However, samplings of multiple individuals from two of the three species in the recipient Plantago clade revealed complex and perplexing phylogenetic discrepancies and patterns of sequence divergence for all three of the foreign genes. Conclusions This study reports the best evidence to date that multiple mitochondrial genes can be transferred via a single HGT event and that transfer occurred via a strictly DNA-level intermediate. The discovery of gene conversion between co-resident foreign and native
Directory of Open Access Journals (Sweden)
Eid I. Brima
2018-01-01
Full Text Available The objective of this study was to investigate the content of essential elements in medicinal plants in the Kingdom of Saudi Arabia (KSA. Five different medical plants (mahareeb (Cymbopogon schoenanthus, sheeh (Artemisia vulgaris, harjal (Cynanchum argel delile, nabipoot (Equisetum arvense, and cafmariam (Vitex agnus-castus were collected from Madina city in the KSA. Five elements Fe, Mn, Zn, Cu, and Se were determined by using inductively coupled plasma mass spectrometry (ICP-MS. Fe levels were the highest and Se levels were the lowest in all plants. The range levels of all elements in all plants were as follows: Fe 193.4–1757.9, Mn 23.6–143.7, Zn 15.4–32.7, Se 0.13–0.92, and Cu 11.3–21.8 µg/g. Intakes of essential elements from the medical plants in infusion were calculated: Fe 4.6–13.4, Mn 6.7–123.2, Zn 7.0–42.7, Se 0.14–1.5, and Cu 1.5–5.0 µg/dose. The calculated intakes of essential elements for all plants did not exceed the daily intake set by the World Health Organization (WHO and European Food Safety Authority (EFSA. These medicinal plants may be useful sources of essential elements, which are vital for health.
Directory of Open Access Journals (Sweden)
Nilufar Z. Mamadalieva
2017-02-01
Full Text Available Plants of the Lamiaceae family are important ornamental, medicinal, and aromatic plants, many of which produce essential oils that are used in traditional and modern medicine, and in the food, cosmetics, and pharmaceutical industry. Various species of the genera Hyssopus, Leonurus, Mentha, Nepeta, Origanum, Perovskia, Phlomis, Salvia, Scutellaria, and Ziziphora are widespread throughout the world, are the most popular plants in Uzbek traditional remedies, and are often used for the treatment of wounds, gastritis, infections, dermatitis, bronchitis, and inflammation. Extensive studies of the chemical components of these plants have led to the identification of many compounds, as well as essentials oils, with medicinal and other commercial values. The purpose of this review is to provide a critical overview of the literature surrounding the traditional uses, ethnopharmacology, biological activities, and essential oils composition of aromatic plants of the family Lamiaceae, from the Uzbek flora.
Plant ion channels: gene families, physiology, and functional genomics analyses.
Ward, John M; Mäser, Pascal; Schroeder, Julian I
2009-01-01
Distinct potassium, anion, and calcium channels in the plasma membrane and vacuolar membrane of plant cells have been identified and characterized by patch clamping. Primarily owing to advances in Arabidopsis genetics and genomics, and yeast functional complementation, many of the corresponding genes have been identified. Recent advances in our understanding of ion channel genes that mediate signal transduction and ion transport are discussed here. Some plant ion channels, for example, ALMT and SLAC anion channel subunits, are unique. The majority of plant ion channel families exhibit homology to animal genes; such families include both hyperpolarization- and depolarization-activated Shaker-type potassium channels, CLC chloride transporters/channels, cyclic nucleotide-gated channels, and ionotropic glutamate receptor homologs. These plant ion channels offer unique opportunities to analyze the structural mechanisms and functions of ion channels. Here we review gene families of selected plant ion channel classes and discuss unique structure-function aspects and their physiological roles in plant cell signaling and transport.
Regulation of meiotic gene expression in plants
Directory of Open Access Journals (Sweden)
Adele eZhou
2014-08-01
Full Text Available With the recent advances in genomics and sequencing technologies, databases of transcriptomes representing many cellular processes have been built. Meiotic transcriptomes in plants have been studied in Arabidopsis thaliana, rice (Oryza sativa, wheat (Triticum aestivum, petunia (Petunia hybrida, sunflower (Helianthus annuus, and maize (Zea mays. Studies in all organisms, but particularly in plants, indicate that a very large number of genes are expressed during meiosis, though relatively few of them seem to be required for the completion of meiosis. In this review, we focus on gene expression at the RNA level and analyze the meiotic transcriptome datasets and explore expression patterns of known meiotic genes to elucidate how gene expression could be regulated during meiosis. We also discuss mechanisms, such as chromatin organization and non-coding RNAs, that might be involved in the regulation of meiotic transcription patterns.
Effect of selected essential oil plants on bacterial wilt disease ...
African Journals Online (AJOL)
Objective: Bacterial wilt disease caused by Ralstonia solanacearum is a major constrain to production of potatoes (Solanum tuberosum). Control of bacterial wilt is very difficult as there are no effective curative chemicals. This study was aimed at investigating the potential roles of essential oil plants in control of the disease.
Directory of Open Access Journals (Sweden)
Wei Liu
Full Text Available Mycoplasma, the smallest self-replicating organism with a minimal metabolism and little genomic redundancy, is expected to be a close approximation to the minimal set of genes needed to sustain bacterial life. This study employs comparative evolutionary analysis of twenty Mycoplasma genomes to gain an improved understanding of essential genes. By analyzing the core genome of mycoplasmas, we finally revealed the conserved essential genes set for mycoplasma survival. Further analysis showed that the core genome set has many characteristics in common with experimentally identified essential genes. Several key genes, which are related to DNA replication and repair and can be disrupted in transposon mutagenesis studies, may be critical for bacteria survival especially over long period natural selection. Phylogenomic reconstructions based on 3,355 homologous groups allowed robust estimation of phylogenetic relatedness among mycoplasma strains. To obtain deeper insight into the relative roles of molecular evolution in pathogen adaptation to their hosts, we also analyzed the positive selection pressures on particular sites and lineages. There appears to be an approximate correlation between the divergence of species and the level of positive selection detected in corresponding lineages.
Repellence and toxicity of plant essential oils to the potato aphid, Macrosiphum euphorbiae
Munneke, M.E.; Bruin, de A.; Moskal, J.R.; Tol, van R.W.H.M.
2004-01-01
Several plant essential oils were tested for their effect on behaviour and mortality of M. euphorbiae. Olfactory and contact experiments were performed to study these effects. We found that host plant and formulation of the different oils have a strong influence on repellence and mortality of the
In silico identification and analysis of phytoene synthase genes in plants.
Han, Y; Zheng, Q S; Wei, Y P; Chen, J; Liu, R; Wan, H J
2015-08-14
In this study, we examined phytoene synthetase (PSY), the first key limiting enzyme in the synthesis of carotenoids and catalyzing the formation of geranylgeranyl pyrophosphate in terpenoid biosynthesis. We used known amino acid sequences of the PSY gene in tomato plants to conduct a genome-wide search and identify putative candidates in 34 sequenced plants. A total of 101 homologous genes were identified. Phylogenetic analysis revealed that PSY evolved independently in algae as well as monocotyledonous and dicotyledonous plants. Our results showed that the amino acid structures exhibited 5 motifs (motifs 1 to 5) in algae and those in higher plants were highly conserved. The PSY gene structures showed that the number of intron in algae varied widely, while the number of introns in higher plants was 4 to 5. Identification of PSY genes in plants and the analysis of the gene structure may provide a theoretical basis for studying evolutionary relationships in future analyses.
Directory of Open Access Journals (Sweden)
Zia BANIHASHEMI
2011-09-01
Full Text Available The contact and vapor effects of essential oils from different plants were studied in vitro for fungicidal and fungistatic activity towards different Basidiomycete, Ascomycete, Zygomycete and Oomycete taxa. Of nine essential oils tested, most were fungicidal at very low concentrations to most of the fungi. Hyphae were more sensitive than spores to the formulations. The essential oils citral, β-citronellol, geraniol and oil of lavender, at 1 μL mL-1 medium or 12 μL L-1 of air, inhibited growth and germination in the fungal species examined. Different species of fungal genera reacted differently to the formulations. Some of the formulations were fungistatic to spore germination.
Repressor-mediated tissue-specific gene expression in plants
Meagher, Richard B [Athens, GA; Balish, Rebecca S [Oxford, OH; Tehryung, Kim [Athens, GA; McKinney, Elizabeth C [Athens, GA
2009-02-17
Plant tissue specific gene expression by way of repressor-operator complexes, has enabled outcomes including, without limitation, male sterility and engineered plants having root-specific gene expression of relevant proteins to clean environmental pollutants from soil and water. A mercury hyperaccumulation strategy requires that mercuric ion reductase coding sequence is strongly expressed. The actin promoter vector, A2pot, engineered to contain bacterial lac operator sequences, directed strong expression in all plant vegetative organs and tissues. In contrast, the expression from the A2pot construct was restricted primarily to root tissues when a modified bacterial repressor (LacIn) was coexpressed from the light-regulated rubisco small subunit promoter in above-ground tissues. Also provided are analogous repressor operator complexes for selective expression in other plant tissues, for example, to produce male sterile plants.
Directory of Open Access Journals (Sweden)
JF Sanchez-Suarez
2013-03-01
Full Text Available Background: The leishmanicidal and cytotoxic activity of ten essential oils obtained from ten plant specimens were evaluated.Methods: Essential oils were obtained by the steam distillation of plant leaves without any prior processing. Cytotoxicity was tested on J774 macrophages and leishmanicidal activity was assessed against four species of Leishmania associated with cutaneous leishmaniasis. Results: Seven essential oils exhibited activity against Leishmania parasites, five of which were toxic against J774 macrophages. Selectivity indices of >6 and 13 were calculated for the essential oils of Ocimum basilicum and Origanum vulgare, respectively.Conclusion: The essential oil of Ocimum basilicum was active against promastigotes of Leishmania and innocuous to J774 macrophages at concentrations up to 1600 µg/mL and should be further investigated for leishmanicidal activity in others in vitro and in vivo experimental models.
Essential oil composition and nutrient analysis of selected medicinal plants in Sultanate of Oman
Directory of Open Access Journals (Sweden)
Javid Hussain
2013-12-01
Full Text Available Objective: To evaluate the nutrients and essential oils of five medicinal plants, Juniperus excelsa (J. excelsa, Dodonaea viscosa, Euryops pinifolius, Teucrium polium (T. polium, and Helianthemum lippii that were collected from Jabal Al Akhdar, Oman. Methods: Proximate parameters (moisture, dry matter, ash, crude fats, proteins, fibers, nitrogen, carbohydrates, and energy values and nutrient analysis (K, Na, Ca, Fe, P, Mg etc. were evaluated in the five medicinal plants using standard techniques. On the basis of these analysis, T. polium and J. excels were selected for essential oil analysis using a rapid solvent-free microwave extraction method and GC-MS. Results: The results showed that leaves of J. excelsa had highest proportion of crude fats, fibers and energy value while ash was highest in T. polium. J. excelsa was also rich in essential minerals such as calcium, magnesium, potassium and iron while the trace elements and heavy metals composition was marginal. A rapid solvent-free microwave extraction method to extract oil from medicinal plants species showed that only T. polium and J. excelsa yielded oil. The chemical composition of essential oils showed higher proportion of delta-3-carene, limonene, β-eudesmol, ledeneoxide (II, α-trans-bergamatene, linalyl acetate and germacrene. Conclusions: J. excelsa and T. polium are a good source of proximate, minerals and essential oils, which can be considered for healthy life besides their medicinal values.
Plant domestication and gene banks
International Nuclear Information System (INIS)
Perrino, P.
1989-01-01
At the time of the dawn of agriculture, plant domestication was very slow. As agriculture progressed, however, domestication began to evolve faster and reached its highest point with the advent of plant breeders who played a very important role in solving the world food problem. One of the fastest moving strategies was a better exploitation of genetic diversity, both natural and induced. However, intensive plant breeding activity caused a heavy fall in genetic variability. Gene banks then provided a further tool for modern agriculture, specifically to preserve genetic resources and to help breeders to further domesticate important crops and to introduce and domesticate new species. (author). 3 refs
Phylogenetics and evolution of Trx SET genes in fully sequenced land plants.
Zhu, Xinyu; Chen, Caoyi; Wang, Baohua
2012-04-01
Plant Trx SET proteins are involved in H3K4 methylation and play a key role in plant floral development. Genes encoding Trx SET proteins constitute a multigene family in which the copy number varies among plant species and functional divergence appears to have occurred repeatedly. To investigate the evolutionary history of the Trx SET gene family, we made a comprehensive evolutionary analysis on this gene family from 13 major representatives of green plants. A novel clustering (here named as cpTrx clade), which included the III-1, III-2, and III-4 orthologous groups, previously resolved was identified. Our analysis showed that plant Trx proteins possessed a variety of domain organizations and gene structures among paralogs. Additional domains such as PHD, PWWP, and FYR were early integrated into primordial SET-PostSET domain organization of cpTrx clade. We suggested that the PostSET domain was lost in some members of III-4 orthologous group during the evolution of land plants. At least four classes of gene structures had been formed at the early evolutionary stage of land plants. Three intronless orphan Trx SET genes from the Physcomitrella patens (moss) were identified, and supposedly, their parental genes have been eliminated from the genome. The structural differences among evolutionary groups of plant Trx SET genes with different functions were described, contributing to the design of further experimental studies.
The Design and Manufacturing of Essential oil Distillation Plant for ...
African Journals Online (AJOL)
Choice-Academy
industry in the country do not have the capacity to manufacture the complete distillation plant system with the required precision for standard quality of oil at affordable cost. Thus, the design and the experiment in the use of a prototype small size distillation unit showed that the technology is appropriate for essential oil ...
Research Concerning Antimicrobial Activities of Some Essential Oils Extracted from Plants
Directory of Open Access Journals (Sweden)
ADRIANA DALILA CRISTE
2014-10-01
Full Text Available The principal components of some essential oils extracted from plants have been found to have microbial activity. Depending on the concentration, the members of this class are known to be bactericide or bacteriostatic. Their action mechanism is unclear, but some studies suggest that the compounds penetrate the cell, where they interfere with cellular metabolism. The purpose of this study was to evaluate the antimicrobial activity of 5 essential oils extracted from plants on Escherichia coli, Pseudomonas aeruginosa, Salmonella enterica, Staphylococcus aureus and Bacillus cereus and to determinate how different amount of the used oils can influence the results of inhibition tests. These results showed that mainly all the natural extracts presented an antimicrobial effect. Thereby, some extracts were more efficient than another and the order is: Eucalyptus globulus (eucalyptus, Mentha piperita (mint, Lavandula angustifolia (lavender, Matricaria chamomilla (chamomile, Calendula officinalis (calendula.
Plant isoflavone and isoflavanone O-methyltransferase genes
Broeckling, Bettina E.; Liu, Chang-Jun; Dixon, Richard A.
2014-08-19
The invention provides enzymes that encode O-methyltransferases (OMTs) from Medicago truncatula that allow modification to plant (iso)flavonoid biosynthetic pathways. In certain aspects of the invention, the genes encoding these enzymes are provided. The invention therefore allows the modification of plants for isoflavonoid content. Transgenic plants comprising such enzymes are also provided, as well as methods for improving disease resistance in plants. Methods for producing food and nutraceuticals, and the resulting compositions, are also provided.
ORF18 is a transfactor that is essential for late gene transcription of a gammaherpesvirus.
Arumugaswami, Vaithilingaraja; Wu, Ting-Ting; Martinez-Guzman, DeeAnn; Jia, Qingmei; Deng, Hongyu; Reyes, Nichole; Sun, Ren
2006-10-01
Lytic replication of the tumor-associated human gammaherpesviruses Epstein-Barr virus and Kaposi's sarcoma-associated herpesvirus has important implications in pathogenesis and tumorigenesis. Herpesvirus lytic genes have been temporally classified as exhibiting immediate-early (IE), early, and late expression kinetics. Though the regulation of IE and early gene expression has been studied extensively, very little is known regarding the regulation of late gene expression. Late genes, which primarily encode virion structural proteins, require viral DNA replication for their expression. We have identified a murine gammaherpesvirus 68 (MHV-68) early lytic gene, ORF18, essential for viral replication. ORF18 is conserved in both beta- and gammaherpesviruses. By generating an MHV-68 ORF18-null virus, we characterized the stage of the virus lytic cascade that requires the function of ORF18. Gene expression profiling and quantitation of viral DNA synthesis of the ORF18-null virus revealed that the expression of early genes and viral DNA replication were not affected; however, the transcription of late genes was abolished. Hence, we have identified a gammaherpesvirus-encoded factor essential for the expression of late genes independently of viral DNA synthesis.
Proudhon, D; Wei, J; Briat, J; Theil, E C
1996-03-01
Ferritin, a protein widespread in nature, concentrates iron approximately 10(11)-10(12)-fold above the solubility within a spherical shell of 24 subunits; it derives in plants and animals from a common ancestor (based on sequence) but displays a cytoplasmic location in animals compared to the plastid in contemporary plants. Ferritin gene regulation in plants and animals is altered by development, hormones, and excess iron; iron signals target DNA in plants but mRNA in animals. Evolution has thus conserved the two end points of ferritin gene expression, the physiological signals and the protein structure, while allowing some divergence of the genetic mechanisms. Comparison of ferritin gene organization in plants and animals, made possible by the cloning of a dicot (soybean) ferritin gene presented here and the recent cloning of two monocot (maize) ferritin genes, shows evolutionary divergence in ferritin gene organization between plants and animals but conservation among plants or among animals; divergence in the genetic mechanism for iron regulation is reflected by the absence in all three plant genes of the IRE, a highly conserved, noncoding sequence in vertebrate animal ferritin mRNA. In plant ferritin genes, the number of introns (n = 7) is higher than in animals (n = 3). Second, no intron positions are conserved when ferritin genes of plants and animals are compared, although all ferritin gene introns are in the coding region; within kingdoms, the intron positions in ferritin genes are conserved. Finally, secondary protein structure has no apparent relationship to intron/exon boundaries in plant ferritin genes, whereas in animal ferritin genes the correspondence is high. The structural differences in introns/exons among phylogenetically related ferritin coding sequences and the high conservation of the gene structure within plant or animal kingdoms of the gene structure within plant or animal kingdoms suggest that kingdom-specific functional constraints may
Jasmonate is essential for insect defense in Arabidopsis
McConn, Michele; Creelman, Robert A.; Bell, Erin; Mullet, John E.; Browse, John
1997-01-01
The signaling pathways that allow plants to mount defenses against chewing insects are known to be complex. To investigate the role of jasmonate in wound signaling in Arabidopsis and to test whether parallel or redundant pathways exist for insect defense, we have studied a mutant (fad3–2 fad7–2 fad8) that is deficient in the jasmonate precursor linolenic acid. Mutant plants contained negligible levels of jasmonate and showed extremely high mortality (≈80%) from attack by larvae of a common saprophagous fungal gnat, Bradysia impatiens (Diptera: Sciaridae), even though neighboring wild-type plants were largely unaffected. Application of exogenous methyl jasmonate substantially protected the mutant plants and reduced mortality to ≈12%. These experiments precisely define the role of jasmonate as being essential for the induction of biologically effective defense in this plant–insect interaction. The transcripts of three wound-responsive genes were shown not to be induced by wounding of mutant plants but the same transcripts could be induced by application of methyl jasmonate. By contrast, measurements of transcript levels for a gene encoding glutathione S-transferase demonstrated that wound induction of this gene is independent of jasmonate synthesis. These results indicate that the mutant will be a good genetic model for testing the practical effectiveness of candidate defense genes. PMID:11038546
In vitro antibacterial activity of some plant essential oils
Directory of Open Access Journals (Sweden)
Ignacimuthu Savarimuthu
2006-11-01
Full Text Available Abstract Background: To evaluate the antibacterial activity of 21 plant essential oils against six bacterial species. Methods: The selected essential oils were screened against four gram-negative bacteria (Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, Proteus vulgaris and two gram-positive bacteria Bacillus subtilis and Staphylococcus aureus at four different concentrations (1:1, 1:5, 1:10 and 1:20 using disc diffusion method. The MIC of the active essential oils were tested using two fold agar dilution method at concentrations ranging from 0.2 to 25.6 mg/ml. Results: Out of 21 essential oils tested, 19 oils showed antibacterial activity against one or more strains. Cinnamon, clove, geranium, lemon, lime, orange and rosemary oils exhibited significant inhibitory effect. Cinnamon oil showed promising inhibitory activity even at low concentration, whereas aniseed, eucalyptus and camphor oils were least active against the tested bacteria. In general, B. subtilis was the most susceptible. On the other hand, K. pneumoniae exhibited low degree of sensitivity. Conclusion: Majority of the oils showed antibacterial activity against the tested strains. However Cinnamon, clove and lime oils were found to be inhibiting both gram-positive and gram-negative bacteria. Cinnamon oil can be a good source of antibacterial agents.
Anti-quorum sensing activity of essential oils from Colombian plants.
Jaramillo-Colorado, Beatriz; Olivero-Verbel, Jesus; Stashenko, Elena E; Wagner-Döbler, Irene; Kunze, Brigitte
2012-01-01
Essential oils from Colombian plants were characterised by GC-MS, and assayed for anti-quorum sensing activity in bacteria sensor strains. Two major chemotypes were found for Lippia alba, the limonene-carvone and the citral (geranial-neral). For other species, the main components included α-pinene (Ocotea sp.), β-pinene (Swinglea glutinosa), cineol (Elettaria cardamomun), α-zingiberene (Zingiber officinale) and pulegone (Minthostachys mollis). Several essential oils presented promising inhibitory properties for the short chain AHL quorum sensing (QS) system, in Escherichia coli containing the biosensor plasmid pJBA132, in particular Lippia alba. Moderate activity as anti-QS using the same plasmid, were also found for selected constituents of essential oils studied here, such as citral, carvone and α-pinene, although solely at the highest tested concentration (250 µg mL(-1)). Only citral presented some activity for the long chain AHL QS system, in Pseudomonas putida containing the plasmid pRK-C12. In short, essential oils from Colombian flora have promising properties as QS modulators.
Plant ABC transporters enable many unique aspects of a terrestrial plant's lifestyle
DEFF Research Database (Denmark)
Hwang, Jae-Ung; Song, Won-Yong; Hong, Daewoong
2016-01-01
Terrestrial plants have two to four times more ATP-binding cassette (ABC) transporter genes than other organisms, including their ancestral microalgae. Recent studies found that plants harboring mutations in these transporters exhibit dramatic phenotypes, many of which are related to developmental...... to propose that diverse ABC transporters enabled many unique and essential aspects of a terrestrial plant's lifestyle, by transporting various compounds across specific membranes of the plant....
New genes often acquire male-specific functions but rarely become essential in Drosophila.
Kondo, Shu; Vedanayagam, Jeffrey; Mohammed, Jaaved; Eizadshenass, Sogol; Kan, Lijuan; Pang, Nan; Aradhya, Rajaguru; Siepel, Adam; Steinhauer, Josefa; Lai, Eric C
2017-09-15
Relatively little is known about the in vivo functions of newly emerging genes, especially in metazoans. Although prior RNAi studies reported prevalent lethality among young gene knockdowns, our phylogenomic analyses reveal that young Drosophila genes are frequently restricted to the nonessential male reproductive system. We performed large-scale CRISPR/Cas9 mutagenesis of "conserved, essential" and "young, RNAi-lethal" genes and broadly confirmed the lethality of the former but the viability of the latter. Nevertheless, certain young gene mutants exhibit defective spermatogenesis and/or male sterility. Moreover, we detected widespread signatures of positive selection on young male-biased genes. Thus, young genes have a preferential impact on male reproductive system function. © 2017 Kondo et al.; Published by Cold Spring Harbor Laboratory Press.
Antioxidant Capacity of Selected Plant Extracts and Their Essential Oils
Directory of Open Access Journals (Sweden)
Charalampos Proestos
2013-01-01
Full Text Available The main objective of this study was the screening of some selected aromatic plants very popular in Greece, with respect to their total phenolic content, antioxidant capacity, reducing activity, and oxidative stability. All plants were extracted with the conventional method, reflux with methanol. The essential oils of the plants were also analyzed for their antioxidant properties. The total phenolic content was determined by the Folin-Ciocalteu method using gallic acid as the standard, while the phenolic substances were identified and quantified by High Performance Liquid Chromatography (HPLC coupled with a multi-wavelength ultraviolet-visible (UV-vis detector. The antioxidant capacity of the plant extracts was measured by their ability to scavenge free radicals such as (a DPPH (2,2-diphenyl-1-picrylhydrazyl and, (b ABTS (2,2′-azinobis-(3-ethylbenzothiaziline-6- sulfonate. The Folin-Ciocalteu method proved the existence of antioxidants in the aromatic plant extracts. Taking into account the results of the DPPH and ABTS methods, the free radical scavenging capacity was confirmed. Eventually, all plants exhibited low but noticeable protection levels against lipid oxidation, as determined by the Rancimat test.
Demonstration of Essential Reliability Services by a 300-MW Solar Photovoltaic Power Plant
Energy Technology Data Exchange (ETDEWEB)
Loutan, Clyde; Klauer, Peter; Chowdhury, Sirajul; Hall, Stephen; Morjaria, Mahesh; Chadliev, Vladimir; Milam, Nick; Milan, Christopher; Gevorgian, Vahan
2017-03-24
The California Independent System Operator (CAISO), First Solar, and the National Renewable Energy Laboratory (NREL) conducted a demonstration project on a large utility-scale photovoltaic (PV) power plant in California to test its ability to provide essential ancillary services to the electric grid. With increasing shares of solar- and wind-generated energy on the electric grid, traditional generation resources equipped with automatic governor control (AGC) and automatic voltage regulation controls -- specifically, fossil thermal -- are being displaced. The deployment of utility-scale, grid-friendly PV power plants that incorporate advanced capabilities to support grid stability and reliability is essential for the large-scale integration of PV generation into the electric power grid, among other technical requirements. A typical PV power plant consists of multiple power electronic inverters and can contribute to grid stability and reliability through sophisticated 'grid-friendly' controls. In this way, PV power plants can be used to mitigate the impact of variability on the grid, a role typically reserved for conventional generators. In August 2016, testing was completed on First Solar's 300-MW PV power plant, and a large amount of test data was produced and analyzed that demonstrates the ability of PV power plants to use grid-friendly controls to provide essential reliability services. These data showed how the development of advanced power controls can enable PV to become a provider of a wide range of grid services, including spinning reserves, load following, voltage support, ramping, frequency response, variability smoothing, and frequency regulation to power quality. Specifically, the tests conducted included various forms of active power control such as AGC and frequency regulation; droop response; and reactive power, voltage, and power factor controls. This project demonstrated that advanced power electronics and solar generation can be
International Nuclear Information System (INIS)
Yousaf, Sohail; Afzal, Muhammad; Reichenauer, Thomas G.; Brady, Carrie L.; Sessitsch, Angela
2011-01-01
The genus Enterobacter comprises a range of beneficial plant-associated bacteria showing plant growth promotion. Enterobacter ludwigii belongs to the Enterobacter cloacae complex and has been reported to include human pathogens but also plant-associated strains with plant beneficial capacities. To assess the role of Enterobacter endophytes in hydrocarbon degradation, plant colonization, abundance and expression of CYP153 genes in different plant compartments, three plant species (Italian ryegrass, birdsfoot trefoil and alfalfa) were grown in sterile soil spiked with 1% diesel and inoculated with three endophytic E. ludwigii strains. Results showed that all strains were capable of hydrocarbon degradation and efficiently colonized the rhizosphere and plant interior. Two strains, ISI10-3 and BRI10-9, showed highest degradation rates of diesel fuel up to 68% and performed best in combination with Italian ryegrass and alfalfa. All strains expressed the CYP153 gene in all plant compartments, indicating an active role in degradation of diesel in association with plants. - Highlights: → E. ludwigii strains efficiently colonized plants in a non-sterile soil environment. → E. ludwigii strains efficiently expressed alkane degradation genes in plants. → E. ludwigii efficiently degraded alkane contaminations and promoted plant growth. → E. ludwigii interacted more effectively with Italian ryegrass than with other plants. → Degradation activity varied with plant and microbial genotype as well as with time. - Enterobacter ludwigii strains belonging to the E. cloacae complex are able to efficiently degrade alkanes when associated with plants and to promote plant growth.
Energy Technology Data Exchange (ETDEWEB)
Yousaf, Sohail [AIT Austrian Institute of Technology GmbH, Bioresources Unit, A-2444 Seibersdorf (Austria); Afzal, Muhammad [AIT Austrian Institute of Technology GmbH, Bioresources Unit, A-2444 Seibersdorf (Austria); National Institute for Biotechnology and Genetic Engineering (NIBGE), Faisalabad (Pakistan); Reichenauer, Thomas G. [AIT Austrian Institute of Technology GmbH, Environmental Resources and Technologies Unit, A-2444 Seibersdorf (Austria); Brady, Carrie L. [Forestry and Agricultural Biotechnology Institute, Department of Microbiology and Plant Pathology, University of Pretoria, Pretoria (South Africa); Sessitsch, Angela, E-mail: angela.sessitsch@ait.ac.at [AIT Austrian Institute of Technology GmbH, Bioresources Unit, A-2444 Seibersdorf (Austria)
2011-10-15
The genus Enterobacter comprises a range of beneficial plant-associated bacteria showing plant growth promotion. Enterobacter ludwigii belongs to the Enterobacter cloacae complex and has been reported to include human pathogens but also plant-associated strains with plant beneficial capacities. To assess the role of Enterobacter endophytes in hydrocarbon degradation, plant colonization, abundance and expression of CYP153 genes in different plant compartments, three plant species (Italian ryegrass, birdsfoot trefoil and alfalfa) were grown in sterile soil spiked with 1% diesel and inoculated with three endophytic E. ludwigii strains. Results showed that all strains were capable of hydrocarbon degradation and efficiently colonized the rhizosphere and plant interior. Two strains, ISI10-3 and BRI10-9, showed highest degradation rates of diesel fuel up to 68% and performed best in combination with Italian ryegrass and alfalfa. All strains expressed the CYP153 gene in all plant compartments, indicating an active role in degradation of diesel in association with plants. - Highlights: > E. ludwigii strains efficiently colonized plants in a non-sterile soil environment. > E. ludwigii strains efficiently expressed alkane degradation genes in plants. > E. ludwigii efficiently degraded alkane contaminations and promoted plant growth. > E. ludwigii interacted more effectively with Italian ryegrass than with other plants. > Degradation activity varied with plant and microbial genotype as well as with time. - Enterobacter ludwigii strains belonging to the E. cloacae complex are able to efficiently degrade alkanes when associated with plants and to promote plant growth.
Actin is an essential component of plant gravitropic signaling pathways
Braun, Markus; Hauslage, Jens; Limbach, Christoph
2003-08-01
A role of the actin cytoskeleton in the different phases of gravitropism in higher plant organs seems obvious, but experimental evidence is still inconclusive and contradictory. In gravitropically tip-growing rhizoids and protonemata, however, it is well documented that actin is an essential component of the tip-growth machinery and is involved either in the cellular mechanisms that lead to gravity sensing and in the processes of the graviresponses that result in the reorientation of the growth direction. All these processes depend on a complexly organized and highly dynamic organization of actin filaments whose diverse functions are coordinated by numerous associated proteins. Actin filaments and myosins mediate the transport of secretory vehicles to the growing tip and precisely control the delivery of cell wall material. In addition, both cell types use a very efficient actomyosin-based system to control and correct the position of their statoliths and to direct sedimenting statoliths to confined graviperception sites at the plasma membrane. The studies presented in this paper provide evidence for the essential role of actin in plant gravity sensing and the gravitropic responses. A unique actin-organizing center exists in the tip of characean rhizoids and protonemata which is associated with and dynamically regulated by a specific set of actin-dynamizing proteins. It is concluded that this highly dynamic apical actin array is an essential prerequisite for gravity sensing and gravity-oriented tip growth.
Li, Kewei; Xu, Chang; Jin, Yongxin; Sun, Ziyu; Liu, Chang; Shi, Jing; Chen, Gukui; Chen, Ronghao; Jin, Shouguang; Wu, Weihui
2013-01-01
ABSTRACT During initial colonization and chronic infection, pathogenic bacteria encounter distinct host environments. Adjusting gene expression accordingly is essential for the pathogenesis. Pseudomonas aeruginosa has evolved complicated regulatory networks to regulate different sets of virulence factors to facilitate colonization and persistence. The type III secretion system (T3SS) and motility are associated with acute infections, while biofilm formation and the type VI secretion system (T6SS) are associated with chronic persistence. To identify novel regulatory genes required for pathogenesis, we screened a P. aeruginosa transposon (Tn) insertion library and found suhB to be an essential gene for the T3SS gene expression. The expression of suhB was upregulated in a mouse acute lung infection model, and loss of suhB resulted in avirulence. Suppression of T3SS gene expression in the suhB mutant is linked to a defective translation of the T3SS master regulator, ExsA. Further studies demonstrated that suhB mutation led to the upregulation of GacA and its downstream small RNAs, RsmY and RsmZ, triggering T6SS expression and biofilm formation while inhibiting the T3SS. Our results demonstrate that an in vivo-inducible gene, suhB, reciprocally regulates genes associated with acute and chronic infections and plays an essential role in the pathogenesis of P. aeruginosa. PMID:24169572
International Nuclear Information System (INIS)
Kim, Dong Sub; Kim, Jinbaek; Ha, Bokeun; Kim, Sang Hoon; Kim, Sunhee
2013-05-01
Physiological analysis of monocot model plant (rice) in response to ionizing radiation (cosmic-ray, gamma-ray, Ion beam). - Identification of antioxidant characters through cytochemical analysis. - Comparison of antioxidant activities in response to ionizing irradiation. - Evaluation of anthocyanin quantity in response to ionizing irradiation. Ionization energy response gene family analysis via bioinformatic validation. - Expression analysis of monocot and dicot gene families. - In silico and bioinformatic approach to elucidate gene function. Characterization and functional analysis of genes specifically expressed in response to ionizing irradiation (cosmic-ray, gamma-ray, Ion beam). - High throughput trancriptomic analysis of plants under ionizing radiation using microarray. - Promotor and cis-element analysis of genes specifically expressed in response to ionizing radiation. - Validation and function analysis of candidate genes. - Elucidation of plant mechanism of sensing and response to ionization energy. Development of bioindicator plants detecting ionization energy. - Cloning and identification of 'Radio marker genes (RMG)'. - Development of Over-expression (O/E) or Knock-out (K/O) plant using RMG. Development of Genechip as an ionization energy detector. - Expression profiling analysis of genes specifically expression in response to ionization energy. - Prepare high-conserved gene specific oligomer. - Development of ionization energy monitoring Genechip and application
Energy Technology Data Exchange (ETDEWEB)
Kim, Dong Sub; Kim, Jinbaek; Ha, Bokeun; Kim, Sang Hoon; Kim, Sunhee
2013-05-15
Physiological analysis of monocot model plant (rice) in response to ionizing radiation (cosmic-ray, gamma-ray, Ion beam). - Identification of antioxidant characters through cytochemical analysis. - Comparison of antioxidant activities in response to ionizing irradiation. - Evaluation of anthocyanin quantity in response to ionizing irradiation. Ionization energy response gene family analysis via bioinformatic validation. - Expression analysis of monocot and dicot gene families. - In silico and bioinformatic approach to elucidate gene function. Characterization and functional analysis of genes specifically expressed in response to ionizing irradiation (cosmic-ray, gamma-ray, Ion beam). - High throughput trancriptomic analysis of plants under ionizing radiation using microarray. - Promotor and cis-element analysis of genes specifically expressed in response to ionizing radiation. - Validation and function analysis of candidate genes. - Elucidation of plant mechanism of sensing and response to ionization energy. Development of bioindicator plants detecting ionization energy. - Cloning and identification of 'Radio marker genes (RMG)'. - Development of Over-expression (O/E) or Knock-out (K/O) plant using RMG. Development of Genechip as an ionization energy detector. - Expression profiling analysis of genes specifically expression in response to ionization energy. - Prepare high-conserved gene specific oligomer. - Development of ionization energy monitoring Genechip and application.
Effects of mycorrhiza on growth and essential oil production in selected aromatic plants
Directory of Open Access Journals (Sweden)
Waed Tarraf
2015-09-01
Full Text Available Arbuscular mycorrhizal (AM symbiosis is widely investigated in aromatic herbs. Several studies have shown different effects on secondary metabolites, biomass production, as well as oil quantitative and qualitative aspects. The seeking to increase the yield of plants and their oils is an interesting topic in the world of medicinal and aromatic plant production. In tune with that, this study evaluated the effectiveness of two mycorrhiza fungi, Funneliformis mosseae (syn. Glomus mosseae and Septoglomus viscosum (syn. Glomus viscosum, on three species from Lamiaceae family: Salvia officinalis L., Origanum vulgare L., and Thymus vulgaris L. besides untreated control. It was found that the effect of symbiosis on growth was more favourable with S. viscosum than other AM fungus. The S. viscosum inoculation raised the yield of essential oil in oregano. Analysis of gas chromatography/mass spectrometry showed that manool obtained the highest abundance in leaf essential oil of inoculated sage; thymol was the major component whatever the treatment in thyme and lower relative content of carvacrol was reported with arbuscular mycorrhizal fungi inoculation in oregano. The results suggest the mycorrhizal inoculation as a promising technology in sustainable agricultural system to improve the plant productivity performance. Specific inocula are strategic to enhance the chemical profile of essential oils.
Directory of Open Access Journals (Sweden)
Andréa Roveré Franz
2011-03-01
Full Text Available Toxic effects of essential plant oils in adult Sitophilus oryzae (Linnaeus (Coleoptera, Curculionidae. Stored grains are subject to losses in quality nutritional value and in sanitation from the time they are stored to the time they are consumed. Botanical insecticides may offer an alternative solution for pest control. The objective was to test the insecticidal properties of the essential oils of Cymbopogon citratus (leaf, Zingiber officinale (root and Mentha sp. (leaf. The efficacy of these oils was tested to control the rice weevil, S. oryzae, using hydrodistillation. Chemical analysis of the essential oils was carried out by gas chromatography. Major components of C. citratus were geranial (48% and neral (31%, of Z. officinale were α-zingibereno (13%, geranial (16%, neral (10% and α-farneseno (5% and of Mentha sp. was menthol (92%. Bioassays were carried out by fumigation and topical application. In topical application assays, the essential oil of C. citratus had greater toxicity (LC50 0.027 µL mL-1 and shorter exposure time than the oils of the other two plants. After 24 h and 48 h, 70% and 100% mortality of S. oryzae occurred, respectively. In fumigation assays, essential oil of Z. officinale had a lower LC50 (1.18 µL cm-2 and 70% mortality after 24 h exposure. Therefore, we recommend the use of essential oils of C. citratus and Z. officinale to control the rice weevil S. oryzae.
Armijos Jaramillo, Vinicio Danilo; Vargas, Walter Alberto; Sukno, Serenella Ana; Thon, Michael R
2013-01-01
The genus Colletotrichum contains a large number of phytopathogenic fungi that produce enormous economic losses around the world. The effect of horizontal gene transfer (HGT) has not been studied yet in these organisms. Inter-Kingdom HGT into fungal genomes has been reported in the past but knowledge about the HGT between plants and fungi is particularly limited. We describe a gene in the genome of several species of the genus Colletotrichum with a strong resemblance to subtilisins typically found in plant genomes. Subtilisins are an important group of serine proteases, widely distributed in all of the kingdoms of life. Our hypothesis is that the gene was acquired by Colletotrichum spp. through (HGT) from plants to a Colletotrichum ancestor. We provide evidence to support this hypothesis in the form of phylogenetic analyses as well as a characterization of the similarity of the subtilisin at the primary, secondary and tertiary structural levels. The remarkable level of structural conservation of Colletotrichum plant-like subtilisin (CPLS) with plant subtilisins and the differences with the rest of Colletotrichum subtilisins suggests the possibility of molecular mimicry. Our phylogenetic analysis indicates that the HGT event would have occurred approximately 150-155 million years ago, after the divergence of the Colletotrichum lineage from other fungi. Gene expression analysis shows that the gene is modulated during the infection of maize by C. graminicola suggesting that it has a role in plant disease. Furthermore, the upregulation of the CPLS coincides with the downregulation of several plant genes encoding subtilisins. Based on the known roles of subtilisins in plant pathogenic fungi and the gene expression pattern that we observed, we postulate that the CPLSs have an important role in plant infection.
Molecular Evolution and Expression Divergence of HMT Gene Family in Plants
Directory of Open Access Journals (Sweden)
Man Zhao
2018-04-01
Full Text Available Homocysteine methyltransferase (HMT converts homocysteine to methionine using S-methylmethionine (SMM or S-adenosylmethionine (SAM as methyl donors in organisms, playing an important role in supplying methionine for the growth and the development of plants. To better understand the functions of the HMT genes in plants, we conducted a wide evolution and expression analysis of these genes. Reconstruction of the phylogenetic relationship showed that the HMT gene family was divided into Class 1 and Class 2. In Class 1, HMTs were only found in seed plants, while Class 2 presented in all land plants, which hinted that the HMT genes might have diverged in seed plants. The analysis of gene structures and selection pressures showed that they were relatively conserved during evolution. However, type I functional divergence had been detected in the HMTs. Furthermore, the expression profiles of HMTs showed their distinct expression patterns in different tissues, in which some HMTs were widely expressed in various organs, whereas the others were highly expressed in some specific organs, such as seeds or leaves. Therefore, according to our results in the evolution, functional divergence, and expression, the HMT genes might have diverged during evolution. Further analysis in the expression patterns of AthHMTs with their methyl donors suggested that the diverged HMTs might be related to supply methionine for the development of plant seeds.
El-Seedi, Hesham R; Azeem, Muhammad; Khalil, Nasr S; Sakr, Hanem H; Khalifa, Shaden A M; Awang, Khalijah; Saeed, Aamer; Farag, Mohamed A; AlAjmi, Mohamed F; Pålsson, Katinka; Borg-Karlson, Anna-Karin
2017-09-01
Due to the role of Ixodes ricinus (L.) (Acari: Ixodidae) in the transmission of many serious pathogens, personal protection against bites of this tick is essential. In the present study the essential oils from 11 aromatic Egyptian plants were isolated and their repellent activity against I. ricinus nymphs was evaluated Three oils (i.e. Conyza dioscoridis L., Artemisia herba-alba Asso and Calendula officinalis L.) elicited high repellent activity in vitro of 94, 84.2 and 82%, respectively. The most active essential oil (C. dioscoridis) was applied in the field at a concentration of 6.5 µg/cm 2 and elicited a significant repellent activity against I. ricinus nymphs by 61.1%. The most repellent plants C. dioscoridis, C. officinalis and A. herba-alba yielded essential oils by 0.17, 0.11 and 0.14%, respectively. These oils were further investigated using gas chromatography-mass spectrometry analysis. α-Cadinol (10.7%) and hexadecanoic acid (10.5%) were the major components of C. dioscoridis whereas in C. officinalis, α-cadinol (21.2%) and carvone (18.2%) were major components. Artemisia herba-alba contained piperitone (26.5%), ethyl cinnamate (9.5%), camphor (7.7%) and hexadecanoic acid (6.9%). Essential oils of these three plants have a potential to be used for personal protection against tick bites.
Lilley, Catherine J.; Maqbool, Abbas; Wu, Duqing; Yusup, Hazijah B.; Jones, Laura M.; Birch, Paul R. J.; Urwin, Peter E.
2018-01-01
Plant pathogens and parasites are a major threat to global food security. Plant parasitism has arisen four times independently within the phylum Nematoda, resulting in at least one parasite of every major food crop in the world. Some species within the most economically important order (Tylenchida) secrete proteins termed effectors into their host during infection to re-programme host development and immunity. The precise detail of how nematodes evolve new effectors is not clear. Here we reconstruct the evolutionary history of a novel effector gene family. We show that during the evolution of plant parasitism in the Tylenchida, the housekeeping glutathione synthetase (GS) gene was extensively replicated. New GS paralogues acquired multiple dorsal gland promoter elements, altered spatial expression to the secretory dorsal gland, altered temporal expression to primarily parasitic stages, and gained a signal peptide for secretion. The gene products are delivered into the host plant cell during infection, giving rise to “GS-like effectors”. Remarkably, by solving the structure of GS-like effectors we show that during this process they have also diversified in biochemical activity, and likely represent the founding members of a novel class of GS-like enzyme. Our results demonstrate the re-purposing of an endogenous housekeeping gene to form a family of effectors with modified functions. We anticipate that our discovery will be a blueprint to understand the evolution of other plant-parasitic nematode effectors, and the foundation to uncover a novel enzymatic function. PMID:29641602
Activity of Six Essential Oils Extracted from Tunisian Plants against Legionella pneumophila.
Chaftar, Naouel; Girardot, Marion; Quellard, Nathalie; Labanowski, Jérôme; Ghrairi, Tawfik; Hani, Khaled; Frère, Jacques; Imbert, Christine
2015-10-01
The aim of this study was to investigate the composition of six essential oils extracted from Tunisian plants, i.e., Artemisia herba-alba Asso, Citrus sinensis (L.) Osbeck, Juniperus phoenicea L., Rosmarinus officinalis L., Ruta graveolens L., and Thymus vulgaris L., and to evaluate their activity against Legionella pneumophila (microdilution assays). Eight Legionella pneumophila strains were studied, including the two well-known serogroup 1 Lens and Paris strains as controls and six environmental strains isolated from Tunisian spas belonging to serogroups 1, 4, 5, 6, and 8. The essential oils were generally active against L. pneumophila. The activities of the A. herba-alba, C. sinensis, and R. officinalis essential oils were strain-dependent, whereas those of the J. phoenicea and T. vulgaris oils, showing the highest anti-Legionella activities, with minimum inhibitory concentrations (MICs) lower than 0.03 and lower than or equal to 0.07 mg/ml, respectively, were independent of the strains' serogroup. Moreover, the microorganisms treated with T. vulgaris essential oil were shorter, swollen, and less electron-dense compared to the untreated controls. Isoborneol (20.91%), (1S)-α-pinene (18.30%) β-phellandrene (8.08%), α-campholenal (7.91%), and α-phellandrene (7.58%) were the major components isolated from the J. phoenicea oil, while carvacrol (88.50%) was the main compound of the T. vulgaris oil, followed by p-cymene (7.86%). This study highlighted the potential interest of some essential oils extracted from Tunisian plants as biocides to prevent the Legionella risk. Copyright © 2015 Verlag Helvetica Chimica Acta AG, Zürich.
Phylogenomic detection and functional prediction of genes potentially important for plant meiosis.
Zhang, Luoyan; Kong, Hongzhi; Ma, Hong; Yang, Ji
2018-02-15
Meiosis is a specialized type of cell division necessary for sexual reproduction in eukaryotes. A better understanding of the cytological procedures of meiosis has been achieved by comprehensive cytogenetic studies in plants, while the genetic mechanisms regulating meiotic progression remain incompletely understood. The increasing accumulation of complete genome sequences and large-scale gene expression datasets has provided a powerful resource for phylogenomic inference and unsupervised identification of genes involved in plant meiosis. By integrating sequence homology and expression data, 164, 131, 124 and 162 genes potentially important for meiosis were identified in the genomes of Arabidopsis thaliana, Oryza sativa, Selaginella moellendorffii and Pogonatum aloides, respectively. The predicted genes were assigned to 45 meiotic GO terms, and their functions were related to different processes occurring during meiosis in various organisms. Most of the predicted meiotic genes underwent lineage-specific duplication events during plant evolution, with about 30% of the predicted genes retaining only a single copy in higher plant genomes. The results of this study provided clues to design experiments for better functional characterization of meiotic genes in plants, promoting the phylogenomic approach to the evolutionary dynamics of the plant meiotic machineries. Copyright © 2017 Elsevier B.V. All rights reserved.
Investigating Gene Function in Cereal Rust Fungi by Plant-Mediated Virus-Induced Gene Silencing.
Panwar, Vinay; Bakkeren, Guus
2017-01-01
Cereal rust fungi are destructive pathogens, threatening grain production worldwide. Targeted breeding for resistance utilizing host resistance genes has been effective. However, breakdown of resistance occurs frequently and continued efforts are needed to understand how these fungi overcome resistance and to expand the range of available resistance genes. Whole genome sequencing, transcriptomic and proteomic studies followed by genome-wide computational and comparative analyses have identified large repertoire of genes in rust fungi among which are candidates predicted to code for pathogenicity and virulence factors. Some of these genes represent defence triggering avirulence effectors. However, functions of most genes still needs to be assessed to understand the biology of these obligate biotrophic pathogens. Since genetic manipulations such as gene deletion and genetic transformation are not yet feasible in rust fungi, performing functional gene studies is challenging. Recently, Host-induced gene silencing (HIGS) has emerged as a useful tool to characterize gene function in rust fungi while infecting and growing in host plants. We utilized Barley stripe mosaic virus-mediated virus induced gene silencing (BSMV-VIGS) to induce HIGS of candidate rust fungal genes in the wheat host to determine their role in plant-fungal interactions. Here, we describe the methods for using BSMV-VIGS in wheat for functional genomics study in cereal rust fungi.
Comparing insertion libraries in two Pseudomonas aeruginosa strains to assess gene essentiality.
Liberati, Nicole T; Urbach, Jonathan M; Thurber, Tara K; Wu, Gang; Ausubel, Frederick M
2008-01-01
Putative essential genes can be identified by comparing orthologs not disrupted in multiple near-saturated transposon insertion mutation libraries in related strains of the same bacterial species. Methods for identifying all orthologs between two bacterial strains and putative essential orthologs are described. In addition, protocols detailing near-saturation transposon insertion mutagenesis of bacteria are presented, including (1) conjugation-mediated mutagenesis, (2) automated colony picking and liquid handling of mutant cultures, and (3) arbitrary polymerase chain reaction amplification and sequencing of genomic DNA adjacent to transposon insertion sites.
Plants' essential chemical elements
Kevin T. Smith
2007-01-01
Every garden center and hardware store sells fertilizer guaranteed to "feed" plants. In a strict sense, we can't feed plants. Food contains an energy source. Green plants capture solar energy and make their own food through photosynthesis! Photosynthesis and other metabolic processes require chemical elements in appropriate doses for plants to survive...
Divergence and adaptive evolution of the gibberellin oxidase genes in plants.
Huang, Yuan; Wang, Xi; Ge, Song; Rao, Guang-Yuan
2015-09-29
The important phytohormone gibberellins (GAs) play key roles in various developmental processes. GA oxidases (GAoxs) are critical enzymes in GA synthesis pathway, but their classification, evolutionary history and the forces driving the evolution of plant GAox genes remain poorly understood. This study provides the first large-scale evolutionary analysis of GAox genes in plants by using an extensive whole-genome dataset of 41 species, representing green algae, bryophytes, pteridophyte, and seed plants. We defined eight subfamilies under the GAox family, namely C19-GA2ox, C20-GA2ox, GA20ox,GA3ox, GAox-A, GAox-B, GAox-C and GAox-D. Of these, subfamilies GAox-A, GAox-B, GAox-C and GAox-D are described for the first time. On the basis of phylogenetic analyses and characteristic motifs of GAox genes, we demonstrated a rapid expansion and functional divergence of the GAox genes during the diversification of land plants. We also detected the subfamily-specific motifs and potential sites of some GAox genes, which might have evolved under positive selection. GAox genes originated very early-before the divergence of bryophytes and the vascular plants and the diversification of GAox genes is associated with the functional divergence and could be driven by positive selection. Our study not only provides information on the classification of GAox genes, but also facilitates the further functional characterization and analysis of GA oxidases.
Prediction of essential proteins based on subcellular localization and gene expression correlation.
Fan, Yetian; Tang, Xiwei; Hu, Xiaohua; Wu, Wei; Ping, Qing
2017-12-01
Essential proteins are indispensable to the survival and development process of living organisms. To understand the functional mechanisms of essential proteins, which can be applied to the analysis of disease and design of drugs, it is important to identify essential proteins from a set of proteins first. As traditional experimental methods designed to test out essential proteins are usually expensive and laborious, computational methods, which utilize biological and topological features of proteins, have attracted more attention in recent years. Protein-protein interaction networks, together with other biological data, have been explored to improve the performance of essential protein prediction. The proposed method SCP is evaluated on Saccharomyces cerevisiae datasets and compared with five other methods. The results show that our method SCP outperforms the other five methods in terms of accuracy of essential protein prediction. In this paper, we propose a novel algorithm named SCP, which combines the ranking by a modified PageRank algorithm based on subcellular compartments information, with the ranking by Pearson correlation coefficient (PCC) calculated from gene expression data. Experiments show that subcellular localization information is promising in boosting essential protein prediction.
Alteration of plant meristem function by manipulation of the Retinoblastoma-like plant RRB gene
Durfee, Tim [Madison, WI; Feiler, Heidi [Albany, CA; Gruissem, Wilhelm [Forch, CH; Jenkins, Susan [Martinez, CA; Roe, Judith [Manhattan, KS; Zambryski, Patricia [Berkeley, CA
2007-01-16
This invention provides methods and compositions for altering the growth, organization, and differentiation of plant tissues. The invention is based on the discovery that, in plants, genetically altering the levels of Retinoblastoma-related gene (RRB) activity produces dramatic effects on the growth, proliferation, organization, and differentiation of plant meristem.
Transfer of 210Po, 210Pb and 238U from some medicinal plants to their essential oils
International Nuclear Information System (INIS)
Al-Masri, M.S.; Amin, Y.; Ibrahim, S.; Nassri, M.
2015-01-01
Essential oils were extracted from 35 medicinal plants used by Syrians, organic compounds were determined in these oils and concentrations of 210 Po 210 Pb and 238 U were determined in the original plants and in the essential oils. The results showed that the highest activity concentrations of 210 Po and 210 Pb were found in leaves with large surfaces and in Sage were as high as 73.5 Bq kg −1 and 73.2 Bq kg −1 , respectively. The activity concentration of 238 U was as high as 4.26 Bq kg −1 in Aloe. On the other hand, activity concentrations of 210 Po ranged between 0.2 and 71.1 Bq kg −1 in extracted essential oils for Rosemary and False yellowhead, respectively. The activity concentration of 210 Pb reached 63.7 Bq kg −1 in Aloe oil. The activity concentrations of 238 U were very low in all extracted oils; the highest value was 0.31 Bq kg −1 in peel of Orange oil. The transfer of 210 Po and 210 Pb from plant to its oil was the highest for Eugenia; 7.1% and 5.5% for 210 Po and 210 Pb, respectively. A linear relationship was found between the transfer factor of radionuclides from plant to its essential oil and the chemical content of this oil. - Highlights: • Natural radionuclides 210 Po, 210 Pb and 238 U were determined in 35 medicinal plants and their essential oils. • The highest activity concentration of 210 Po and 210 Pb were 73.5 Bq kg −1 and 73.2 Bq kg −1 in Sage, respectively. • The transfer of 210 Po and 210 Pb from Eugenia plant to its oil was the highest amongst other plants. • The data obtained in this study can be considered the first reported data for medicinal plants and their oils in Syria
Directory of Open Access Journals (Sweden)
Mallappa Kumara Swamy
2016-01-01
Full Text Available A wide range of medicinal and aromatic plants (MAPs have been explored for their essential oils in the past few decades. Essential oils are complex volatile compounds, synthesized naturally in different plant parts during the process of secondary metabolism. Essential oils have great potential in the field of biomedicine as they effectively destroy several bacterial, fungal, and viral pathogens. The presence of different types of aldehydes, phenolics, terpenes, and other antimicrobial compounds means that the essential oils are effective against a diverse range of pathogens. The reactivity of essential oil depends upon the nature, composition, and orientation of its functional groups. The aim of this article is to review the antimicrobial potential of essential oils secreted from MAPs and their possible mechanisms of action against human pathogens. This comprehensive review will benefit researchers who wish to explore the potential of essential oils in the development of novel broad-spectrum key molecules against a broad range of drug-resistant pathogenic microbes.
2016-01-01
A wide range of medicinal and aromatic plants (MAPs) have been explored for their essential oils in the past few decades. Essential oils are complex volatile compounds, synthesized naturally in different plant parts during the process of secondary metabolism. Essential oils have great potential in the field of biomedicine as they effectively destroy several bacterial, fungal, and viral pathogens. The presence of different types of aldehydes, phenolics, terpenes, and other antimicrobial compounds means that the essential oils are effective against a diverse range of pathogens. The reactivity of essential oil depends upon the nature, composition, and orientation of its functional groups. The aim of this article is to review the antimicrobial potential of essential oils secreted from MAPs and their possible mechanisms of action against human pathogens. This comprehensive review will benefit researchers who wish to explore the potential of essential oils in the development of novel broad-spectrum key molecules against a broad range of drug-resistant pathogenic microbes. PMID:28090211
Chiappino-Pepe, Anush; Ataman, Meriç
2017-01-01
Novel antimalarial therapies are urgently needed for the fight against drug-resistant parasites. The metabolism of malaria parasites in infected cells is an attractive source of drug targets but is rather complex. Computational methods can handle this complexity and allow integrative analyses of cell metabolism. In this study, we present a genome-scale metabolic model (iPfa) of the deadliest malaria parasite, Plasmodium falciparum, and its thermodynamics-based flux analysis (TFA). Using previous absolute concentration data of the intraerythrocytic parasite, we applied TFA to iPfa and predicted up to 63 essential genes and 26 essential pairs of genes. Of the 63 genes, 35 have been experimentally validated and reported in the literature, and 28 have not been experimentally tested and include previously hypothesized or novel predictions of essential metabolic capabilities. Without metabolomics data, four of the genes would have been incorrectly predicted to be non-essential. TFA also indicated that substrate channeling should exist in two metabolic pathways to ensure the thermodynamic feasibility of the flux. Finally, analysis of the metabolic capabilities of P. falciparum led to the identification of both the minimal nutritional requirements and the genes that can become indispensable upon substrate inaccessibility. This model provides novel insight into the metabolic needs and capabilities of the malaria parasite and highlights metabolites and pathways that should be measured and characterized to identify potential thermodynamic bottlenecks and substrate channeling. The hypotheses presented seek to guide experimental studies to facilitate a better understanding of the parasite metabolism and the identification of targets for more efficient intervention. PMID:28333921
Directory of Open Access Journals (Sweden)
Anush Chiappino-Pepe
2017-03-01
Full Text Available Novel antimalarial therapies are urgently needed for the fight against drug-resistant parasites. The metabolism of malaria parasites in infected cells is an attractive source of drug targets but is rather complex. Computational methods can handle this complexity and allow integrative analyses of cell metabolism. In this study, we present a genome-scale metabolic model (iPfa of the deadliest malaria parasite, Plasmodium falciparum, and its thermodynamics-based flux analysis (TFA. Using previous absolute concentration data of the intraerythrocytic parasite, we applied TFA to iPfa and predicted up to 63 essential genes and 26 essential pairs of genes. Of the 63 genes, 35 have been experimentally validated and reported in the literature, and 28 have not been experimentally tested and include previously hypothesized or novel predictions of essential metabolic capabilities. Without metabolomics data, four of the genes would have been incorrectly predicted to be non-essential. TFA also indicated that substrate channeling should exist in two metabolic pathways to ensure the thermodynamic feasibility of the flux. Finally, analysis of the metabolic capabilities of P. falciparum led to the identification of both the minimal nutritional requirements and the genes that can become indispensable upon substrate inaccessibility. This model provides novel insight into the metabolic needs and capabilities of the malaria parasite and highlights metabolites and pathways that should be measured and characterized to identify potential thermodynamic bottlenecks and substrate channeling. The hypotheses presented seek to guide experimental studies to facilitate a better understanding of the parasite metabolism and the identification of targets for more efficient intervention.
Directory of Open Access Journals (Sweden)
Stanslas Johnson
2009-02-01
Full Text Available Abstract Background The renin-angiotensin aldosterone system (RAAS plays an important role in regulating the blood pressure and the genetic polymorphisms of RAAS genes has been extensively studied in relation to the cardiovascular diseases in various populations with conflicting results. The aim of this study was to determine the association of five genetic polymorphisms (A6G and A20C of angiotensinogen (AGT, MboI of renin, Gly460Trp of aldosterone synthase and Lys173Arg of adducin of RAAS genes in Malaysian essential hypertensive and type 2 diabetic subjects. Methods RAAS gene polymorphisms were determined using mutagenically separated PCR and PCR-RFLP method in a total of 270 subjects consisting of 70 hypertensive subjects without type 2 diabetes mellitus (T2DM, 60 T2DM, 65 hypertensive subjects with T2DM and 75 control subjects. Results There was significant difference found in age, body mass index, systolic/diastolic blood pressure, fasting plasma glucose and high density lipoprotein cholesterol levels between the hypertensive subjects with or without T2DM and control subjects. No statistically significant differences between groups were found in the allele frequency and genotype distribution for A20C variant of AGT gene, MboI of renin, Gly460Trp of aldosterone and Lys173Arg of adducin (p > 0.05. However, the results for A6G of AGT gene revealed significant differences in allele and genotype frequencies in essential hypertension with or without T2DM (p Conclusion Among the five polymorphisms of RAAS genes only A6G variant of AGT gene was significantly associated in Malaysian essential hypertensive and type 2 diabetic subjects. Therefore, A6G polymorphism of the AGT gene could be a potential genetic marker for increased susceptibility to essential hypertension with or without T2DMin Malaysian subjects.
Lactococcus lactis Metabolism and Gene Expression during Growth on Plant Tissues
Golomb, Benjamin L.
2014-01-01
Lactic acid bacteria have been isolated from living, harvested, and fermented plant materials; however, the adaptations these bacteria possess for growth on plant tissues are largely unknown. In this study, we investigated plant habitat-specific traits of Lactococcus lactis during growth in an Arabidopsis thaliana leaf tissue lysate (ATL). L. lactis KF147, a strain originally isolated from plants, exhibited a higher growth rate and reached 7.9-fold-greater cell densities during growth in ATL than the dairy-associated strain L. lactis IL1403. Transcriptome profiling (RNA-seq) of KF147 identified 853 induced and 264 repressed genes during growth in ATL compared to that in GM17 laboratory culture medium. Genes induced in ATL included those involved in the arginine deiminase pathway and a total of 140 carbohydrate transport and metabolism genes, many of which are involved in xylose, arabinose, cellobiose, and hemicellulose metabolism. The induction of those genes corresponded with L. lactis KF147 nutrient consumption and production of metabolic end products in ATL as measured by gas chromatography-time of flight mass spectrometry (GC-TOF/MS) untargeted metabolomic profiling. To assess the importance of specific plant-inducible genes for L. lactis growth in ATL, xylose metabolism was targeted for gene knockout mutagenesis. Wild-type L. lactis strain KF147 but not an xylA deletion mutant was able to grow using xylose as the sole carbon source. However, both strains grew to similarly high levels in ATL, indicating redundancy in L. lactis carbohydrate metabolism on plant tissues. These findings show that certain strains of L. lactis are well adapted for growth on plants and possess specific traits relevant for plant-based food, fuel, and feed fermentations. PMID:25384484
Directory of Open Access Journals (Sweden)
Queiroux Clothilde
2012-05-01
Full Text Available Abstract Background We have used the genomic data in the Integrated Microbial Genomes system of the Department of Energy’s Joint Genome Institute to make predictions about rhizobial open reading frames that play a role in nodulation of host plants. The genomic data was screened by searching for ORFs conserved in α-proteobacterial rhizobia, but not conserved in closely-related non-nitrogen-fixing α-proteobacteria. Results Using this approach, we identified many genes known to be involved in nodulation or nitrogen fixation, as well as several new candidate genes. We knocked out selected new genes and assayed for the presence of nodulation phenotypes and/or nodule-specific expression. One of these genes, SMc00911, is strongly expressed by bacterial cells within host plant nodules, but is expressed minimally by free-living bacterial cells. A strain carrying an insertion mutation in SMc00911 is not defective in the symbiosis with host plants, but in contrast to expectations, this mutant strain is able to out-compete the S. meliloti 1021 wild type strain for nodule occupancy in co-inoculation experiments. The SMc00911 ORF is predicted to encode a “SodM-like” (superoxide dismutase-like protein containing a rhodanese sulfurtransferase domain at the N-terminus and a chromate-resistance superfamily domain at the C-terminus. Several other ORFs (SMb20360, SMc01562, SMc01266, SMc03964, and the SMc01424-22 operon identified in the screen are expressed at a moderate level by bacteria within nodules, but not by free-living bacteria. Conclusions Based on the analysis of ORFs identified in this study, we conclude that this comparative genomics approach can identify rhizobial genes involved in the nitrogen-fixing symbiosis with host plants, although none of the newly identified genes were found to be essential for this process.
Directory of Open Access Journals (Sweden)
A.N. Deryabin
2016-05-01
Full Text Available The expression of heterologous genes in plants is an effective method to improve our understanding of plant resistance mechanisms. The purpose of this work was to investigate the involvement of cell-wall invertase and apoplastic sugars into constitutive cold resistance of potato (Solanum tuberosum L., cv. Dйsirйe plants, which expressed the yeast SUC2 gene encoding apoplastic invertase. WT-plants of a potato served as the control. The increase in the essential cell-wall invertase activity in the leaves of transformed plants indicates significant changes in the cellular carbohydrate metabolism and regulatory function of this enzyme. The activity of yeast invertase changed the composition of intracellular sugars in the leaves of the transformed potato plant. The total content of sugars (sucrose, glucose, fructose in the leaves and apoplast was higher in the transformants, in comparison by WT-plants. Our data indicate higher constitutive resistance of transformants to severe hypothermia conditions compared to WT-plants. This fact allows us to consider cell-wall invertase as a enzyme of carbohydrate metabolism playing an important regulatory role in the metabolic signaling upon forming increased plant resistance to low temperature. Thus, the potato line with the integrated SUC2 gene is a convenient tool to study the role of the apoplastic invertase and the products of its activity during growth, development and formation constitutive resistance to hypothermia.
The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion
Directory of Open Access Journals (Sweden)
Tran Lan T
2012-08-01
Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic
Directory of Open Access Journals (Sweden)
Ané Jean-Michel
2002-01-01
Full Text Available Abstract Background The legume Medicago truncatula has emerged as a model plant for the molecular and genetic dissection of various plant processes involved in rhizobial, mycorrhizal and pathogenic plant-microbe interactions. Aiming to develop essential tools for such genetic approaches, we have established the first genetic map of this species. Two parental homozygous lines were selected from the cultivar Jemalong and from the Algerian natural population (DZA315 on the basis of their molecular and phenotypic polymorphism. Results An F2 segregating population of 124 individuals between these two lines was obtained using an efficient manual crossing technique established for M. truncatula and was used to construct a genetic map. This map spans 1225 cM (average 470 kb/cM and comprises 289 markers including RAPD, AFLP, known genes and isoenzymes arranged in 8 linkage groups (2n = 16. Markers are uniformly distributed throughout the map and segregation distortion is limited to only 3 linkage groups. By mapping a number of common markers, the eight linkage groups are shown to be homologous to those of diploid alfalfa (M. sativa, implying a good level of macrosynteny between the two genomes. Using this M. truncatula map and the derived F3 populations, we were able to map the Mtsym6 symbiotic gene on linkage group 8 and the SPC gene, responsible for the direction of pod coiling, on linkage group 7. Conclusions These results demonstrate that Medicago truncatula is amenable to diploid genetic analysis and they open the way to map-based cloning of symbiotic or other agronomically-important genes using this model plant.
Directory of Open Access Journals (Sweden)
Craxton Molly
2007-07-01
Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances
Domestication of transposable elements into MicroRNA genes in plants.
Directory of Open Access Journals (Sweden)
Yang Li
Full Text Available Transposable elements (TE usually take up a substantial portion of eukaryotic genome. Activities of TEs can cause genome instability or gene mutations that are harmful or even disastrous to the host. TEs also contribute to gene and genome evolution at many aspects. Part of miRNA genes in mammals have been found to derive from transposons while convincing evidences are absent for plants. We found that a considerable number of previously annotated plant miRNAs are identical or homologous to transposons (TE-MIR, which include a small number of bona fide miRNA genes that conform to generally accepted plant miRNA annotation rules, and hairpin derived siRNAs likely to be pre-evolved miRNAs. Analysis of these TE-MIRs indicate that transitions from the medium to high copy TEs into miRNA genes may undergo steps such as inverted repeat formation, sequence speciation and adaptation to miRNA biogenesis. We also identified initial target genes of the TE-MIRs, which contain homologous sequences in their CDS as consequence of cognate TE insertions. About one-third of the initial target mRNAs are supported by publicly available degradome sequencing data for TE-MIR sRNA induced cleavages. Targets of the TE-MIRs are biased to non-TE related genes indicating their penchant to acquire cellular functions during evolution. Interestingly, most of these TE insertions span boundaries between coding and non-coding sequences indicating their incorporation into CDS through alteration of splicing or translation start or stop signals. Taken together, our findings suggest that TEs in gene rich regions can form foldbacks in non-coding part of transcripts that may eventually evolve into miRNA genes or be integrated into protein coding sequences to form potential targets in a "temperate" manner. Thus, transposons may supply as resources for the evolution of miRNA-target interactions in plants.
Antibacterial and Anticandidal Activity of Essential Oils of some Medicinal Plants in Saudi Arabia
International Nuclear Information System (INIS)
Abed, Kawther F
2007-01-01
The antibacterial and anticandidal properties of essential oils obtained from 7 plant species used in traditional medicine in Saudi Arabia and other Middle East countries were evaluated for activity against test bacteria; Staphylococcus aureus, Bacillus subtilis, Escherichia coli, Pseudomonas aeruginosa and Candida albicans using an agar dilution method. Our results showed that oils from Azadirachta indica, Ziziphus spine, Matricaria chamomilla, Agrimonia eupatoria and Lupinus albus, even at the highest concentration did not inhibit any of the tested organisms. The essential oil extracted from Juniperus communis and Lavandula hybrida plants did not show any antibacterial activities. However, essential oil extracts from Juniperus communis and Lavandula hybrida exhibited varying degrees of growth inhibition of Candida albicans. The minimum inhibitory concentrations were 2.0%( v/v) of Juniper oil and 0.5% (v/v) for Lavender oil against Candida albicans. Our results suggest that the anticandidal properties of Juniper and Lavender oils may be further investigated to explore the possibility of using them in the treatment of candidal infections. (author)
Sharopov, Farukh; Braun, Markus Santhosh; Gulmurodov, Isomiddin; Khalifaev, Davlat; Isupov, Salomiddin; Wink, Michael
2015-01-01
Antimicrobial, antioxidant, and anti-inflammatory activities of the essential oils of 18 plant species from Tajikistan (Central Asia) were investigated. The essential oil of Origanum tyttanthum showed a strong antibacterial activity with both minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) values of 312.5 µg/mL for E. coli, 625 µg/mL (MIC) and 1250 µg/mL (MBC) for MRSA (methicillin-resistant Staphylococcus aureus), respectively. The essential oil of Galagan...
Emiliani, Giovanni; Fondi, Marco; Fani, Renato; Gribaldo, Simonetta
2009-02-16
The pioneering ancestor of land plants that conquered terrestrial habitats around 500 million years ago had to face dramatic stresses including UV radiation, desiccation, and microbial attack. This drove a number of adaptations, among which the emergence of the phenylpropanoid pathway was crucial, leading to essential compounds such as flavonoids and lignin. However, the origin of this specific land plant secondary metabolism has not been clarified. We have performed an extensive analysis of the taxonomic distribution and phylogeny of Phenylalanine Ammonia Lyase (PAL), which catalyses the first and essential step of the general phenylpropanoid pathway, leading from phenylalanine to p-Coumaric acid and p-Coumaroyl-CoA, the entry points of the flavonoids and lignin routes. We obtained robust evidence that the ancestor of land plants acquired a PAL via horizontal gene transfer (HGT) during symbioses with soil bacteria and fungi that are known to have established very early during the first steps of land colonization. This horizontally acquired PAL represented then the basis for further development of the phenylpropanoid pathway and plant radiation on terrestrial environments. Our results highlight a possible crucial role of HGT from soil bacteria in the path leading to land colonization by plants and their subsequent evolution. The few functional characterizations of sediment/soil bacterial PAL (production of secondary metabolites with powerful antimicrobial activity or production of pigments) suggest that the initial advantage of this horizontally acquired PAL in the ancestor of land plants might have been either defense against an already developed microbial community and/or protection against UV.
Directory of Open Access Journals (Sweden)
Sophie eVergnes
2014-09-01
Full Text Available Essential oil from Gaultheria procumbens is mainly composed of methylsalicylate (>96%, a compound which can be metabolized in plant tissues to salicylic acid, a phytohormone inducing plant immunity against microbial pathogens. The potential use of G. procumbens essential oil as a biocontrol agent was evaluated on the model plant Arabidopsis thaliana. Expression of a selection of defence genes was detected 1, 6 and 24 hours after essential oil treatment (0.1 ml/L using a high-throughput qPCR-based microfluidic technology. Control treatments included methyl jasmonate and a commercialized salicylic acid analog, benzo(1,2,3-thiadiazole-7carbothiolic acid (BTH. Strong induction of defence markers known to be regulated by the salicylic acid pathway was observed after the treatment with G. procumbens essential oil. Treatment induced the accumulation of total salicylic acid in the wild -type Arabidopsis line Col-0 and analysis of the Arabidopsis line sid2, mutated in a salicylic acid biosynthetic gene, revealed that approximately 30% of methylsalicylate sprayed on the leaves penetrated inside plant tissues and was demethylated by endogenous esterases. Induction of plant resistance by G. procumbens essential oil was tested following inoculation with a GFP-expressing strain of the Arabidopsis fungal pathogen Colletotrichum higginsianum. Flurorescence measurement of infected tissues revealed that treatments led to a strong reduction (60% of pathogen development and that the efficacy of the G. procumbens essential oil was similar to the commercial product BION®. Together, these results show that the G. procubens essential oil is a natural source of methylsalicylate which can be formulated to develop new biocontrol products.
In Silico Identification, Phylogenetic and Bioinformatic Analysis of Argonaute Genes in Plants
Directory of Open Access Journals (Sweden)
Khaled Mirzaei
2014-01-01
Full Text Available Argonaute protein family is the key players in pathways of gene silencing and small regulatory RNAs in different organisms. Argonaute proteins can bind small noncoding RNAs and control protein synthesis, affect messenger RNA stability, and even participate in the production of new forms of small RNAs. The aim of this study was to characterize and perform bioinformatic analysis of Argonaute proteins in 32 plant species that their genome was sequenced. A total of 437 Argonaute genes were identified and were analyzed based on lengths, gene structure, and protein structure. Results showed that Argonaute proteins were highly conserved across plant kingdom. Phylogenic analysis divided plant Argonautes into three classes. Argonaute proteins have three conserved domains PAZ, MID and PIWI. In addition to three conserved domains namely, PAZ, MID, and PIWI, we identified few more domains in AGO of some plant species. Expression profile analysis of Argonaute proteins showed that expression of these genes varies in most of tissues, which means that these proteins are involved in regulation of most pathways of the plant system. Numbers of alternative transcripts of Argonaute genes were highly variable among the plants. A thorough analysis of large number of putative Argonaute genes revealed several interesting aspects associated with this protein and brought novel information with promising usefulness for both basic and biotechnological applications.
Park, Jeong-Mi; Manen, Jean-François; Schneeweiss, Gerald M
2007-06-01
Plastid sequences are among the most widely used in phylogenetic and phylogeographic studies in flowering plants, where they are usually assumed to evolve like non-recombining, uniparentally transmitted, single-copy genes. Among others, this assumption can be violated by intracellular gene transfer (IGT) within cells or by the exchange of genes across mating barriers (horizontal gene transfer, HGT). We report on HGT of a plastid region including rps2, trnL-F, and rbcL in a group of non-photosynthetic flowering plants. Species of the parasitic broomrape genus Phelipanche harbor two copies of rps2, a plastid ribosomal gene, one corresponding to the phylogenetic position of the respective species, the other being horizontally acquired from the related broomrape genus Orobanche. While the vertically transmitted copies probably reside within the plastid genome, the localization of the horizontally acquired copies is not known. With both donor and recipient being parasitic plants, a possible pathway for the exchange of genetic material is via a commonly attacked host.
Localizing genes using linkage disequilibrium in plants: integrating ...
African Journals Online (AJOL)
GREGO
2007-03-19
Mar 19, 2007 ... Localizing genes using linkage disequilibrium in plants: integrating lessons ... reduce that association as a function of the marker distance from the QTL. ..... the gene locus enhanced the resolution power of asso- ciation tests .... agents, such as insects, birds, water and wind, so mating is determined by a ...
Wei, Hai-Lei; Collmer, Alan
2017-12-25
Pseudomonas syringae pv. tomato DC3000 and its derivatives cause disease in tomato, Arabidopsis and Nicotiana benthamiana. The primary virulence factors include a repertoire of 29 effector proteins injected into plant cells by the type III secretion system and the phytotoxin coronatine. The complete repertoire of effector genes and key coronatine biosynthesis genes have been progressively deleted and minimally reassembled to reconstitute basic pathogenic ability in N. benthamiana, and in Arabidopsis plants that have mutations in target genes that mimic effector actions. This approach and molecular studies of effector activities and plant immune system targets have highlighted a small subset of effectors that contribute to essential processes in pathogenesis. Most notably, HopM1 and AvrE1 redundantly promote an aqueous apoplastic environment, and AvrPtoB and AvrPto redundantly block early immune responses, two conditions that are sufficient for substantial bacterial growth in planta. In addition, disarmed DC3000 polymutants have been used to identify the individual effectors responsible for specific activities of the complete repertoire and to more effectively study effector domains, effector interplay and effector actions on host targets. Such work has revealed that AvrPtoB suppresses cell death elicitation in N. benthamiana that is triggered by another effector in the DC3000 repertoire, highlighting an important aspect of effector interplay in native repertoires. Disarmed DC3000 polymutants support the natural delivery of test effectors and infection readouts that more accurately reveal effector functions in key pathogenesis processes, and enable the identification of effectors with similar activities from a broad range of other pathogens that also defeat plants with cytoplasmic effectors. © 2017 BSPP AND JOHN WILEY & SONS LTD.
Distillation Parameters for Pilot Plant Production of Laurus nobilis Essential oil
Directory of Open Access Journals (Sweden)
Temel Özek
2012-01-01
Full Text Available Essential oils have increasing importance in flavour and fragrance industries. They are obtained by distillation techniques. In order to produce an oil with market potential its optimum production parameters have to be well known prior to its commercial production. Determination of the steam distillation parameters of commercially available Laurel leaves oil in pilot plant scale is described. The effect of steam rate and processing time play a major role in distillation of essential oils. Distillation speed was high in the beginning of the process, then gradually reduced as the distillation proceeded. The main component of the oil of Laurel leaf oil was 1,8-cineole accumulating significantly in the early fractions.
Ancient signals: comparative genomics of plant MAPK and MAPKK gene families
DEFF Research Database (Denmark)
Hamel, Louis-Philippe; Nicole, Marie-Claude; Sritubtim, Somrudee
2006-01-01
MAPK signal transduction modules play crucial roles in regulating many biological processes in plants, and their components are encoded by highly conserved genes. The recent availability of genome sequences for rice and poplar now makes it possible to examine how well the previously described...... Arabidopsis MAPK and MAPKK gene family structures represent the broader evolutionary situation in plants, and analysis of gene expression data for MPK and MKK genes in all three species allows further refinement of those families, based on functionality. The Arabidopsis MAPK nomenclature appears sufficiently...
Are commercially available essential oils from Australian native plants repellent to mosquitoes?
Maguranyi, Suzann K; Webb, Cameron E; Mansfield, Sarah; Russell, Richard C
2009-09-01
While the use of topical insect repellents, particularly those containing synthetic active ingredients such as deet (N,N-diethyl-3-methylbenzamide), are a mainstay in personal protection strategies emphasized in public health messages, there is a growing demand in the community for alternative repellents, particularly those of botanical origin and thus deemed to be "natural." This study evaluated the repellency of essential oils from 11 Australian native plants in 5% v/v formulations against Aedes aegypti, Culex quinquefasciatus, and Culex annulirostris under laboratory conditions. A blend of the top 3 performing oils was then compared with deet and a commercially available botanical insect repellent. All essential oils provided at least some protection against the 3 mosquito species, with the longest protection time (110 min) afforded by Prostanthera melissifolia against Cx. quinquefasciatus. Mean protection times against Ae. aegypti were substantially lower than those for the Culex spp. tested. Deet provided significantly longer protection against Ae. aegypti than both the 5% v/v blend of Leptospermum petersonii, Prostanthera melissifolia, and Melaleuca alternifolia (the 3 most effective oils) and the commercial botanical repellent. The results of this study indicate that these essential oils from Australian native plants offer limited protection against biting mosquitoes and that a blend of essential oils holds may offer commercial potential as a short-period repellent or under conditions of low mosquito abundance. However, it is important that public health messages continue to emphasize the greater effectiveness of deet-based repellents in areas with risks of mosquito-borne disease.
Larvicidal Activity of essential oils from Brazilian plants against Aedes aegypti L.
Directory of Open Access Journals (Sweden)
Eveline Solon Barreira Cavalcanti
2004-08-01
Full Text Available Aedes aegypti L. is the major vector of dengue fever, an endemic disease in Brazil. In an effort to find effective and affordable ways to control this mosquito, the larvicidal activities of essential oils from nine plants widely found in the Northeast of Brazil were analyzed by measurement of their LC50. The essential oils were extracted by steam distillation and their chemical composition determined by GL-chromatography coupled to mass spectroscopy. The essential oils from Cymbopogon citratus and Lippia sidoides, reported in the literature to have larvicidal properties against A. aegypti, were used for activity comparison. The results show that Ocimum americanum and Ocimum gratissimum have LC50 of 67 ppm and 60 ppm respectively, compared to 63 ppm for L. sidoides and 69 ppm for C. citratus. These results suggest a potential utilization of the essential oil of these two Ocimum species for the control of A. aegypti.
Bio-accumulation of essential and heavy metals in plant food
Balabanova, Biljana; Stafilov, Trajče
2017-01-01
The contamination of soils due to the presence of toxic metals can result in serious negative consequences, such as damage of ecosystems and of agricultural productivity, deterioration of food chain and serious human and animal health problems. The impact of soil pollution (due to urban and mining areas) on the food chain presents a challenge for many investigations. Availability of essential and potentially toxic metals in polluted soil and their possible transfer in various plant foods were...
International Nuclear Information System (INIS)
Ameri, A.A.; Nasiri Mahalati, M.
2010-01-01
Efficient use of radiation for medicinal plants production, might increase flower yield, essential oils and extract yield .A split plot design.was used in a two years (2005 and 2006) field study in Torogh region(36,10° N,59.33° E and 1300 m altitude) of Mashhad, Iran, to observe the effects of different nitrogen application and plants densities on flower dry matter production, essential oils, and radiation use efficiency in a multi-harvested Marigold (Calendula officinalis). The levels of nitrogen fertilizer were 0, 50, 100 and 150 kg ha-1 and levels of density were 20, 40, 60 and 80 plant m-2. The combined analysis results revealed significant effects of nitrogen and density levels on flower dry matter production, essential oils, and radiation use efficiency of Marigold. The highest dry flower production obtained by 150 kg ha-1 N and 80 plant m-2 plant population (102.86 g m-2). The higher flower dry matter production caused more essential oils and extract production in high nitrogen and density levels. The amount of essential oils and extract per 100g flower dry matter decreased during the flower harvesting period. The higher amount of essential oil and extract obtained at early flowering season. The essential oil and extract ranged from 0.22 to 0.12 (ml. per 100g flower dry matter) and 2.74 to 2.13 (g per 100g flower dry matter) respectively. Increase of both nitrogen and density caused higher radiation use efficiency. The most radiation use efficiency obtained at 150 kg ha-1 nitrogen and 80 Plant m-2desity treatments. In 150 kg ha-1 nitrogen treatment, increase of density levels from 20 plant m-2 to 80 Plant m-2 caused increase in radiation use efficiency from 1.41 g MJ-1 to 1.44 g MJ-1 respectively
Norris, Edmund J; Gross, Aaron D; Dunphy, Brendan M; Bessette, Steven; Bartholomay, Lyric; Coats, Joel R
2015-09-01
Aedes aegypti and Anopheles gambiae are two mosquito species that represent significant threats to global public health as vectors of Dengue virus and malaria parasites, respectively. Although mosquito populations have been effectively controlled through the use of synthetic insecticides, the emergence of widespread insecticide-resistance in wild mosquito populations is a strong motivation to explore new insecticidal chemistries. For these studies, Ae. aegypti and An. gambiae were treated with commercially available plant essential oils via topical application. The relative toxicity of each essential oil was determined, as measured by the 24-h LD(50) and percentage knockdown at 1 h, as compared with a variety of synthetic pyrethroids. For Ae. aegypti, the most toxic essential oil (patchouli oil) was ∼1,700-times less toxic than the least toxic synthetic pyrethroid, bifenthrin. For An. gambiae, the most toxic essential oil (patchouli oil) was ∼685-times less toxic than the least toxic synthetic pyrethroid. A wide variety of toxicities were observed among the essential oils screened. Also, plant essential oils were analyzed via gas chromatography/mass spectrometry (GC/MS) to identify the major components in each of the samples screened in this study. While the toxicities of these plant essential oils were demonstrated to be lower than those of the synthetic pyrethroids tested, the large amount of GC/MS data and bioactivity data for each essential oil presented in this study will serve as a valuable resource for future studies exploring the insecticidal quality of plant essential oils. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Faraone, Nicoletta; Hillier, N. Kirk; Cutler, G. Christopher
2015-01-01
Plant-derived products can play an important role in pest management programs. Essential oils from Lavandula angustifolia (lavender) and Thymus vulgaris (thyme) and their main constituents, linalool and thymol, respectively, were evaluated for insecticidal activity and synergistic action in combination with insecticides against green peach aphid, Myzus persicae (Sulzer) (Hemiptera: Aphididae). The essential oils and their main constituents exerted similar insecticidal activity when aphids were exposed by direct sprays, but were non-toxic by exposure to treated leaf discs. In synergism experiments, the toxicity of imidacloprid was synergized 16- to 20-fold by L. angustifolia and T. vulgaris essential oils, but far less synergism occurred with linalool and thymol, indicating that secondary constituents of the oils were probably responsible for the observed synergism. In contrast to results with imidacloprid, the insecticidal activity of spirotetramat was antagonized by L. angustifolia and T. vulgaris essential oils, and linalool and thymol. Our results demonstrate the potential of plant essential oils as synergists of insecticides, but show that antagonistic action against certain insecticides may occur. PMID:26010088
Energy Technology Data Exchange (ETDEWEB)
Abi Chahine, M [Lebanese Agricultural Research Institute, Jdeidet el-Metn (Lebanon); Khoury, N; Webeh, E [Lebanese Agricultural Research Institute, Jdeidet el-Metn (Lebanon)
2005-07-01
Full text: The excessive use of chemical pesticides to control agricultural pests is becoming alarming. The objective of this study is to search for biopesticides of plant origin that could be used to control one of the major pest of fruit production; the Mediterranean fruit fly (Ceratitis capitata Wied.). A colony of the Lebanese wild strain of this insect was reared under laboratory condition to provide biological material. The insecticidal activity of the essential oils extracted from aromatic plants in Lebanon was assessed. The tested plants are: Foeniculum vulgare, Thymbra spicata, Artemisia herba alba, Origanum syriacum, Ruta chalepensis, Lavandula stoechas, Salvia fruticosa, Mentha microphylla, Juniperus oxycedrus, Rosmarinus officinalis, Myrtus communis, Laurus nobilis and Ocimum gratissimum. Results show that essential oils isolated from F. vulgare, T. spicata, A. herba alba, O. syriacum and R. chalepensis have promising insecticidal potential. (author)
Cell-specific expression of plant nutrient transporter genes in orchid mycorrhizae.
Fochi, Valeria; Falla, Nicole; Girlanda, Mariangela; Perotto, Silvia; Balestrini, Raffaella
2017-10-01
Orchid mycorrhizal protocorms and roots are heterogeneous structures composed of different plant cell-types, where cells colonized by intracellular fungal coils (the pelotons) are close to non-colonized plant cells. Moreover, the fungal coils undergo rapid turnover inside the colonized cells, so that plant cells containing coils at different developmental stages can be observed in the same tissue section. Here, we have investigated by laser microdissection (LMD) the localization of specific plant gene transcripts in different cell-type populations collected from mycorrhizal protocorms and roots of the Mediterranean orchid Serapias vomeracea colonized by Tulasnella calospora. RNAs extracted from the different cell-type populations have been used to study plant gene expression, focusing on genes potentially involved in N uptake and transport and previously identified as up-regulated in symbiotic protocorms. Results clearly showed that some plant N transporters are differentially expressed in cells containing fungal coils at different developmental stages, as well as in non-colonized cells, and allowed the identification of new functional markers associated to coil-containing cells. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Hamna Saleem
2016-01-01
Full Text Available Petroleum hydrocarbons are harmful to living organisms when they are exposed in natural environment. Once they come in contact, it is not an easy to remove them because many of their constituents are persistent in nature. To achieve this target, different approaches have been exploited by using plants, bacteria, and plant-bacteria together. Among them, combined use of plants and bacteria has gained tremendous attention as bacteria possess set of catabolic genes which produce catabolic enzymes to decontaminate hydrocarbons. In return, plant ooze out root exudates containing nutrients and necessary metabolites which facilitate the microbial colonization in plant rhizosphere. This results into high gene abundance and gene expression in the rhizosphere and, thus, leads to enhanced degradation. Moreover, high proportions of beneficial bacteria helps plant to gain more biomass due to their plant growth promoting activities and production of phytohromones. This review focuses functioning and mechanisms of catabolic genes responsible for degradation of straight chain and aromatic hydrocarbons with their potential of degradation in bioremediation. With the understanding of expression mechanisms, rate of degradation can be enhanced by adjusting environmental factors and acclimatizing plant associated bacteria in plant rhizosphere.
Antimicrobial Effect of Escherichia Coli on Essential Oils Derived from Romanian Aromatic Plants
Directory of Open Access Journals (Sweden)
Şandru Daniela Maria
2015-07-01
Full Text Available This paper investigates the antimicrobial action of Escherichia coli ATCCR CRM-8739TM on the following essential oils: Teucrium marum, Pinus sylwestris, Thymus vulgaris, Salviae aethedaroleum, Cinnamomum aromaticum, Hippophae rhamnoides, Lavandula angustifolia, Abies alba, Zingiber officinale, Anethum graveolens, Coriandrum sativum, Origanum vulgare, extracted industrialy from romanian plants, using the diffusion disc method. The most intense activity was observed at the essential oil of Cinnamomum aromaticum (cinnamon and the mildest activity was observed at Zingiber officinale (ginger. Many of the essential oils tested exhibited moderate antimicrobial activity, as Teucrium marum, Thymus vulgaris, Hippophae rhamnoides, Lavandula angustifolia,Coriandrum sativum. The lowest antibacterial activity was exhibited on Pinus sylwestris, Salviae aethedaroleum, Zingiber officinale and Anethum graveolens.
DEFF Research Database (Denmark)
Brown, S; Brickman, E R; Beckwith, J
1981-01-01
We describe a technique which permits an easy screening for amber mutants defective in essential genes of Escherichia coli. Using this approach, we have isolated three amber mutants defective in the rho gene. An extension of the technique allows the detection of ochre mutants and transposon inser...
Song, Guo-Qing; Gao, Xuan
2017-06-19
Constitutive expression of the CBF/DREB1 for increasing freezing tolerance in woody plants is often associated with other phenotypic changes including dwarf plant and delayed flowering. These phenotypic changes have been observed when Arabidopsis DWARF AND DELAYED FLOWERING 1 (DDF1) was overexpressed in A. thaliana plants. To date, the DDF1 orthologues have not been studied in woody plants. The aim of this study is to investigate transcriptomic responses to the overexpression of blueberry (Vaccinium corymbosum) DDF1 (herein, VcDDF1-OX). The VcDDF1-OX resulted in enhanced freezing tolerance in tetraploid blueberry plants and did not result in significant changes in plant size, chilling requirement, and flowering time. Comparative transcriptome analysis of transgenic 'Legacy-VcDDF1-OX' plants containing an overexpressed VcDDF1 with non-transgenic highbush blueberry 'Legacy' plants revealed the VcDDF1-OX derived differentially expressed (DE) genes and transcripts in the pathways of cold-response, plant flowering, DELLA proteins, and plant phytohormones. The increase in freezing tolerance was associated to the expression of cold-regulated genes (CORs) and the ethylene pathway genes. The unchanged plant size, dormancy and flowering were due to the minimal effect of the VcDDF1-OX on the expression of DELLA proteins, flowering pathway genes, and the other phytohormone genes related to plant growth and development. The DE genes in auxin and cytokinin pathways suggest that the VcDDF1-OX has also altered plant tolerance to drought and high salinity. A DDF1 orthologue in blueberry functioned differently from the DDF1 reported in Arabidopsis. The overexpression of VcDDF1 or its orthologues is a new approach to increase freezing tolerance of deciduous woody plant species with no obvious effect on plant size and plant flowering time.
Agrobacterium-mediated gene transfer in plants and biosafety considerations.
Mehrotra, Shweta; Goyal, Vinod
2012-12-01
Agrobacterium, the natures' genetic engineer, has been used as a vector to create transgenic plants. Agrobacterium-mediated gene transfer in plants is a highly efficient transformation process which is governed by various factors including genotype of the host plant, explant, vector, plasmid, bacterial strain, composition of culture medium, tissue damage, and temperature of co-cultivation. Agrobacterium has been successfully used to transform various economically and horticulturally important monocot and dicot species by standard tissue culture and in planta transformation techniques like floral or seedling infilteration, apical meristem transformation, and the pistil drip methods. Monocots have been comparatively difficult to transform by Agrobacterium. However, successful transformations have been reported in the last few years based on the adjustment of the parameters that govern the responses of monocots to Agrobacterium. A novel Agrobacterium transferred DNA-derived nanocomplex method has been developed which will be highly valuable for plant biology and biotechnology. Agrobacterium-mediated genetic transformation is known to be the preferred method of creating transgenic plants from a commercial and biosafety perspective. Agrobacterium-mediated gene transfer predominantly results in the integration of foreign genes at a single locus in the host plant, without associated vector backbone and is also known to produce marker free plants, which are the prerequisites for commercialization of transgenic crops. Research in Agrobacterium-mediated transformation can provide new and novel insights into the understanding of the regulatory process controlling molecular, cellular, biochemical, physiological, and developmental processes occurring during Agrobacterium-mediated transformation and also into a wide range of aspects on biological safety of transgenic crops to improve crop production to meet the demands of ever-growing world's population.
Cysteine homeostasis plays an essential role in plant immunity.
Álvarez, Consolación; Bermúdez, M Ángeles; Romero, Luis C; Gotor, Cecilia; García, Irene
2012-01-01
• Cysteine is the metabolic precursor of essential biomolecules such as vitamins, cofactors, antioxidants and many defense compounds. The last step of cysteine metabolism is catalysed by O-acetylserine(thiol)lyase (OASTL), which incorporates reduced sulfur into O-acetylserine to produce cysteine. In Arabidopsis thaliana, the main OASTL isoform OAS-A1 and the cytosolic desulfhydrase DES1, which degrades cysteine, contribute to the cytosolic cysteine homeostasis. • Meta-analysis of the transcriptomes of knockout plants for OAS-A1 and for DES1 show a high correlation with the biotic stress series in both cases. • The study of the response of knockout mutants to plant pathogens shows that des1 mutants behave as constitutive systemic acquired resistance mutants, with high resistance to biotrophic and necrotrophic pathogens, salicylic acid accumulation and WRKY54 and PR1 induction, while oas-a1 knockout mutants are more sensitive to biotrophic and necrotrophic pathogens. However, oas-a1 knockout mutants lack the hypersensitive response associated with the effector-triggered immunity elicited by Pseudomonas syringae pv. tomato DC3000 avrRpm1. • Our results highlight the role of cysteine as a crucial metabolite in the plant immune response. © 2011 The Authors. New Phytologist © 2011 New Phytologist Trust.
Imran, Muhammad; Asad, Shaheen; Barboza, Andre Luiz; Galeano, Esteban; Carrer, Helaine; Mukhtar, Zahid
2017-04-01
Glyphosate quashes the synthesis of 5-enolpyruvylshikimate-3- phosphate synthase (EPSPS) enzyme which intercedes the functioning of shikimate pathway for the production of aromatic amino acids. Herbicide resistant crops are developed using glyphosate insensitive EPSPS gene isolated from Agrobacterium sp. strain CP4, which give farmers a sustainable weed control option. Intentions behind this study were to design and characterize the synthetic herbicide resistant CP4 - EPSPS gene in a model plant system and check the effectiveness of transformed tobacco against application of glyphosate. Putative transgenic plants were obtained from independent transformation events, and stable plant transformation, transgene expression and integration were demonstrated respectively by PCR, qRT-PCR and Southern hybridization. Gene transcript level and gene copy number (1-4) varied among the tested transgenic tobacco lines. Herbicide assays showed that transgenic plants were resistant to glyphosate after 12 days of spraying with glyphosate, and EPSPS activity remained at sufficient level to withstand the spray at 1000 ppm of the chemical. T 1 plants analyzed through immunoblot strips and PCR showed that the gene was being translated into protein and transmitted to the next generation successfully. This codon optimized synthetic CP4 - EPSPS gene is functionally equivalent to the gene for glyphosate resistance available in the commercial crops and hence we recommend this gene for transformation into commercial crops.
The 5th Symposium on Post-Transcriptional Regulation of Plant Gene Expression (PTRoPGE)
Energy Technology Data Exchange (ETDEWEB)
Karen S. Browning; Marie Petrocek; Bonnie Bartel
2006-06-01
The 5th Symposium on Post-Transcriptional Regulation of Plant Gene Expression (PTRoPGE) will be held June 8-12, 2005 at the University of Texas at Austin. Exciting new and ongoing discoveries show significant regulation of gene expression occurs after transcription. These post-transcriptional control events in plants range from subtle regulation of transcribed genes and phosphorylation, to the processes of gene regulation through small RNAs. This meeting will focus on the regulatory role of RNA, from transcription, through translation and finally degradation. The cross-disciplinary design of this meeting is necessary to encourage interactions between researchers that have a common interest in post-transcriptional gene expression in plants. By bringing together a diverse group of plant molecular biologist and biochemists at all careers stages from across the world, this meeting will bring about more rapid progress in understanding how plant genomes work and how genes are finely regulated by post-transcriptional processes to ultimately regulate cells.
Endophytic Herbaspirillum seropedicae expresses nif genes in gramineous plants.
Roncato-Maccari, Lauren D B; Ramos, Humberto J O; Pedrosa, Fabio O; Alquini, Yedo; Chubatsu, Leda S; Yates, Marshall G; Rigo, Liu U; Steffens, Maria Berenice R; Souza, Emanuel M
2003-07-01
Abstract The interactions between maize, sorghum, wheat and rice plants and Herbaspirillum seropedicae were examined microscopically following inoculation with the H. seropedicae LR15 strain, a Nif(+) (Pnif::gusA) mutant obtained by the insertion of a gusA-kanamycin cassette into the nifH gene of the H. seropedicae wild-type strain. The expression of the Pnif::gusA fusion was followed during the association of the diazotroph with the gramineous species. Histochemical analysis of seedlings of maize, sorghum, wheat and rice grown in vermiculite showed that strain LR15 colonized root surfaces and inner tissues. In early steps of the endophytic association, H. seropedicae colonized root exudation sites, such as axils of secondary roots and intercellular spaces of the root cortex; it then occupied the vascular tissue and there expressed nif genes. The expression of nif genes occurred in roots, stems and leaves as detected by the GUS reporter system. The expression of nif genes was also observed in bacterial colonies located in the external mucilaginous root material, 8 days after inoculation. Moreover, the colonization of plant tissue by H. seropedicae did not depend on the nitrogen-fixing ability, since similar numbers of cells were isolated from roots or shoots of the plants inoculated with Nif(+) or Nif(-) strains.
New insights on the evolution of Leafy cotyledon1 (LEC1) type genes in vascular plants.
Cagliari, Alexandro; Turchetto-Zolet, Andreia Carina; Korbes, Ana Paula; Maraschin, Felipe Dos Santos; Margis, Rogerio; Margis-Pinheiro, Marcia
2014-01-01
NF-Y is a conserved oligomeric transcription factor found in all eukaryotes. In plants, this regulator evolved with a broad diversification of the genes coding for its three subunits (NF-YA, NF-YB and NF-YC). The NF-YB members can be divided into Leafy Cotyledon1 (LEC1) and non-LEC1 types. Here we presented a comparative genomic study using phylogenetic analyses to validate an evolutionary model for the origin of LEC-type genes in plants and their emergence from non-LEC1-type genes. We identified LEC1-type members in all vascular plant genomes, but not in amoebozoa, algae, fungi, metazoa and non-vascular plant representatives, which present exclusively non-LEC1-type genes as constituents of their NF-YB subunits. The non-synonymous to synonymous nucleotide substitution rates (Ka/Ks) between LEC1 and non-LEC1-type genes indicate the presence of positive selection acting on LEC1-type members to the fixation of LEC1-specific amino acid residues. The phylogenetic analyses demonstrated that plant LEC1-type genes are evolutionary divergent from the non-LEC1-type genes of plants, fungi, amoebozoa, algae and animals. Our results point to a scenario in which LEC1-type genes have originated in vascular plants after gene expansion in plants. We suggest that processes of neofunctionalization and/or subfunctionalization were responsible for the emergence of a versatile role for LEC1-type genes in vascular plants, especially in seed plants. LEC1-type genes besides being phylogenetic divergent also present different expression profile when compared with non-LEC1-type genes. Altogether, our data provide new insights about the LEC1 and non-LEC1 evolutionary relationship during the vascular plant evolution. Copyright © 2014 Elsevier Inc. All rights reserved.
A novel gene of Kalanchoe daigremontiana confers plant drought resistance.
Wang, Li; Zhu, Chen; Jin, Lin; Xiao, Aihua; Duan, Jie; Ma, Luyi
2018-02-07
Kalanchoe (K.) daigremontiana is important for studying asexual reproduction under different environmental conditions. Here, we describe a novel KdNOVEL41 (KdN41) gene that may confer drought resistance and could thereby affect K. daigremontiana development. The detected subcellular localization of a KdN41/Yellow Fluorescent Protein (YFP) fusion protein was in the nucleus and cell membrane. Drought, salt, and heat stress treatment in tobacco plants containing the KdN41 gene promoter driving β-glucuronidase (GUS) gene transcription revealed that only drought stress triggered strong GUS staining in the vascular tissues. Overexpression (OE) of the KdN41 gene conferred improved drought resistance in tobacco plants compared to wild-type and transformed with empty vector plants by inducing higher antioxidant enzyme activities, decreasing cell membrane damage, increasing abscisic acid (ABA) content, causing reinforced drought resistance related gene expression profiles. The 3,3'-diaminobenzidine (DAB) and nitroblue tetrazolium (NBT) staining results also showed less relative oxygen species (ROS) content in KdN41-overexpressing tobacco leaf during drought stress. Surprisingly, by re-watering after drought stress, KdN41-overexpressing tobacco showed earlier flowering. Overall, the KdN41 gene plays roles in ROS scavenging and osmotic damage reduction to improve tobacco drought resistance, which may increase our understanding of the molecular network involved in developmental manipulation under drought stress in K. daigremontiana.
Abbas, Shania; Raza, Syed Tasleem; Chandra, Anu; Rizvi, Saliha; Ahmed, Faisal; Eba, Ale; Mahdi, Farzana
2015-01-01
Hypertension has a multi-factorial background based on genetic and environmental interactive factors. ACE, FABP2 and GST genes have been suggested to be involved in the development of hypertension. However, the results have been inconsistent. The present study was carried out to investigate the association of ACE (rs4646994), FABP2 (rs1799883) and GST (GSTM1 null or positive genotype and GSTT1 null or positive genotype) genes polymorphism with essential HTN cases and controls. This study includes 138 essential hypertension (HTN) patients and 116 age-, sex- and ethnicity-matched control subjects. GST (GSTM1 null or positive genotype and GSTT1 null or positive genotype) genes polymorphisms were evaluated by multiplex PCR, ACE (rs4646994) gene polymorphisms by PCR and FABP2 (rs1799883) gene polymorphisms by PCR-RFLP method. Significant differences were obtained in the frequencies of ACE DD, II genotype (p = 0.006, 0.003), GSTT1 null, GSTM1 positive genotype (p = 0.048, 0.010) and FABP2 Ala54/Ala54 genotype (p = 0.049) between essential HTN cases and controls. It is concluded that ACE (rs 4646994), FABP2 (rs1799883) and GST (GSTM1 null or positive genotype and GSTT1 null or positive genotype) genes polymorphism are associated with HTN. Further investigation with a larger sample size may be required to validate this study.
Duan, X; Li, X; Xue, Q; Abo-el-Saad, M; Xu, D; Wu, R
1996-04-01
We introduced the potato proteinase inhibitor II (PINII) gene (pin2) into several Japonica rice varieties, and regenerated a large number of transgenic rice plants. Wound-inducible expression of the pin2 gene driven by its own promoter, together with the first intron of the rice actin 1 gene (act1), resulted in high-level accumulation of the PINII protein in the transgenic plants. The introduced pin2 gene was stably inherited in the second, third, and fourth generations, as shown by molecular analyses. Based on data from the molecular analyses, several homozygous transgenic lines were obtained. Bioassay for insect resistance with the fifth-generation transgenic rice plants showed that transgenic rice plants had increased resistance to a major rice insect pest, pink stem borer (Sesamia inferens). Thus, introduction of an insecticidal proteinase inhibitor gene into cereal plants can be used as a general strategy for control of insect pests.
Benedito, V.A.; Visser, P.B.; Angenent, G.C.; Krens, F.A.
2004-01-01
Virus-induced gene silencing (VIGS) has been shown to be of great potential in plant reverse genetics. Advantages of VIGS over other approaches, such as T-DNA or transposon tagging, include the circumvention of plant transformation, methodological simplicity and robustness, and speedy results. These
Gene expression in mycorrhizal orchid protocorms suggests a friendly plant-fungus relationship.
Perotto, Silvia; Rodda, Marco; Benetti, Alex; Sillo, Fabiano; Ercole, Enrico; Rodda, Michele; Girlanda, Mariangela; Murat, Claude; Balestrini, Raffaella
2014-06-01
Orchids fully depend on symbiotic interactions with specific soil fungi for seed germination and early development. Germinated seeds give rise to a protocorm, a heterotrophic organ that acquires nutrients, including organic carbon, from the mycorrhizal partner. It has long been debated if this interaction is mutualistic or antagonistic. To investigate the molecular bases of the orchid response to mycorrhizal invasion, we developed a symbiotic in vitro system between Serapias vomeracea, a Mediterranean green meadow orchid, and the rhizoctonia-like fungus Tulasnella calospora. 454 pyrosequencing was used to generate an inventory of plant and fungal genes expressed in mycorrhizal protocorms, and plant genes could be reliably identified with a customized bioinformatic pipeline. A small panel of plant genes was selected and expression was assessed by real-time quantitative PCR in mycorrhizal and non-mycorrhizal protocorm tissues. Among these genes were some markers of mutualistic (e.g. nodulins) as well as antagonistic (e.g. pathogenesis-related and wound/stress-induced) genes. None of the pathogenesis or wound/stress-related genes were significantly up-regulated in mycorrhizal tissues, suggesting that fungal colonization does not trigger strong plant defence responses. In addition, the highest expression fold change in mycorrhizal tissues was found for a nodulin-like gene similar to the plastocyanin domain-containing ENOD55. Another nodulin-like gene significantly more expressed in the symbiotic tissues of mycorrhizal protocorms was similar to a sugar transporter of the SWEET family. Two genes coding for mannose-binding lectins were significantly up-regulated in the presence of the mycorrhizal fungus, but their role in the symbiosis is unclear.
Plant Genes Involved in Symbiotic Sinal Perception/Signal Transduction
DEFF Research Database (Denmark)
Binder, A; Soyano, T; Hayashi, H
2014-01-01
to nodule primordia formation, and the infection thread initiation in the root hairs guiding bacteria towards dividing cortical cells. This chapter focuses on the plant genes involved in the recognition of the symbiotic signal produced by rhizobia, and the downstream genes, which are part of a complex...... symbiotic signalling pathway that leads to the generation of calcium spiking in the nuclear regions and activation of transcription factors controlling symbiotic genes induction...
Meiyalaghan, Sathiyamoorthy; Thomson, Susan J; Fiers, Mark W E J; Barrell, Philippa J; Latimer, Julie M; Mohan, Sara; Jones, E Eirian; Conner, Anthony J; Jacobs, Jeanne M E
2014-01-02
-down expression of GSL1 and GSL2, coupled with the rare incidence of SNPs in these genes, suggests an essential role for this gene family. These features are consistent with the GSL protein family playing a role in several aspects of plant development in addition to plant defence against biotic stresses.
Jin, Yue; Yang, Cheng-Min; Wei, Jian-He
2016-05-01
In order to evaluate seed viability of Platycodon grandiflorum, Schizonepeta tenuifolia, Andrographis paniculat, Codonopsis pilosula, Scutellaria baicalensis, Leonurus japonicus, Rabdosia rubescens, stored in the medium-term gene bank of the National Medicinal Plant Gene Bank for 4 years, we tested seed germination rate of 7 species of medicinal plant and analyzed the change of significance of levels of the germination rate in pre and post store. Seed germination rates of 7 species of medicinal plants were all decreased after 4 years, and the decrease of S. tenuifolia and S. baicalensis germination rates were much smaller than other species. The higher initial germination rate of P. grandiflorum, C. pilosula, R. rubescens seed has the smaller decline of germination rate, but the data of A. paniculata showed the opposite trend. The rate decline of the germination of S. tenuifolia and S. baicalensis was roughly the same in different germination rate interval. The results showed that low temperature storage could effectively prolong the seed longevity, and maintain the seed vigor. Moreover, it is necessary to study on the storage characteristics of the main medicinal plant seeds, and establish the monitoring plan and regeneration standard. Copyright© by the Chinese Pharmaceutical Association.
Directory of Open Access Journals (Sweden)
Saliou Ngom
2018-01-01
Full Text Available Objective: To evaluate the insecticide, larvicidal and repellent activity of the essential oils from Callistemon viminalis, Melaleuca leucadendron, and Hyptis suaveolens against Chrysodeixis chalcites and to compare it with neem oil (Azadirachta indica. Methods: The essential oils of the leaves of these aromatiques plants were extracted by steam distillation and contacts tests were carried out. Results: Essential oils in ethanol from Callistemon viminalis showed a higher biological activity than the neem with 100% larval mortality at the concentration of 2 μg/mL for 6 h, 100% and 90% in ethanol from Melaleuca leucadendron and Hyptis suaveolens, respectively at the concentration of 4 μg/mL for 24 h. By inhalation, the essential oils from Melaleuca leucadendron and of Hyptis suaveolens were more effective with mortality rates of larvae 100% and 50% respectively at 2 μg/L air applied after 24 h. Nevertheless, the neem has shown to be a repulsive plant and anti-nutritional plant. A significant difference in the percentages of consumption between leaves treated with neem oil and the control samples was observed (Newman-Keuls test except for Melaleuca leucadendron. Conclusions: The results of the study highlight remarkable biocide, properties of tested extracts, which provides important opportunities for the development of biopesticides.
The 4.5 S RNA gene of Escherichia coli is essential for cell growth
DEFF Research Database (Denmark)
Brown, S; Fournier, M J
1984-01-01
The Escherichia coli gene coding for the metabolically stable 4.5 S RNA (ffs) has been shown to be required for cell viability. Essentiality was demonstrated by examining the recombination behavior of substitution mutations of ffs generated in vitro. Substitution mutants of ffs are able to replace...... the chromosomal allele only in the presence of a second, intact copy of ffs. Independent evidence of essentiality and the finding that 4.5 S RNA is important for protein synthetic activity came from characterization of cells dependent on the lac operon inducer isopropyl-beta-D-thiogalactoside for ffs gene...... expression. Here, a strain dependent on isopropyl-beta-D-thiogalactoside for 4.5 S RNA synthesis was developed by inactivation of the chromosomal ffs allele and lysogenization by a lambda phage containing 4.5 S DNA fused to a hybrid trp-lac promoter. Withdrawal of the thiogalactoside leads to a deficiency...
Marcial, Guillermo; de Lampasona, Marina P; Vega, Marta I; Lizarraga, Emilio; Viturro, Carmen I; Slanis, Alberto; Juárez, Miguel A; Elechosa, Miguel A; Catalán, César A N
2016-02-01
The aerial parts of Lippia integrifolia (incayuyo) are widely used in northwestern and central Argentina for their medicinal and aromatic properties. The essential oil composition of thirty-one wild populations of L. integrifolia covering most of its natural range was analyzed by GC and GC-MS. A total of one hundred and fifty two terpenoids were identified in the essential oils. Sesquiterpenoids were the dominant components in all but one of the collections analyzed, the only exception being a sample collected in San Juan province where monoterpenoids amounted to 51%. Five clearly defined chemotypes were observed. One possessed an exquisite and delicate sweet aroma with trans-davanone as dominant component (usually above 80%). Another with an exotic floral odour was rich in oxygenated sesquiterpenoids based on the rare lippifoliane and africanane skeletons. The trans-davanone chemotype is the first report of an essential oil containing that sesquiterpene ketone as the main constituent. The absolute configuration of trans-davanone from L. integrifolia was established as 6S, 7S, 10S, the enantiomer of trans-davanone from 'davana oil' (Artemisia pallens). Wild plants belonging to trans-davanone and lippifolienone chemotypes were propagated and cultivated in the same parcel of land in Santa Maria, Catamarca. The essential oil compositions of the cultivated plants were essentially identical to the original plants in the wild, indicating that the essential oil composition is largely under genetic control. Specimens collected near the Bolivian border that initially were identified as L. boliviana Rusby yielded an essential oil practically identical to the trans-davanone chemotype of L. integrifolia supporting the recent view that L. integrifolia (Gris.) Hieron. and L. boliviana Rusby are synonymous. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Madlen Pogoda
Full Text Available Inactivation of gene products by dominant negative mutants is a valuable tool to assign functions to yet uncharacterized proteins, to map protein-protein interactions or to dissect physiological pathways. Detailed functional and structural knowledge about the target protein would allow the construction of inhibitory mutants by targeted mutagenesis. Yet, such data are limited for the majority of viral proteins, so that the target gene needs to be subjected to random mutagenesis to identify suitable mutants. However, for cytomegaloviruses this requires a two-step screening approach, which is time-consuming and labor-intensive. Here, we report the establishment of a high-throughput suitable screening system for the identification of inhibitory alleles of essential genes of the murine cytomegalovirus (MCMV. In this screen, the site-specific recombination of a specifically modified MCMV genome was transferred from the bacterial background to permissive host cells, thereby combining the genetic engineering and the rescue test in one step. Using a reference set of characterized pM53 mutants it was shown that the novel system is applicable to identify non-complementing as well as inhibitory mutants in a high-throughput suitable setup. The new cis-complementation assay was also applied to a basic genetic characterization of pM99, which was identified as essential for MCMV growth. We believe that the here described novel genetic screening approach can be adapted for the genetic characterization of essential genes of any large DNA viruses.
PRGdb 3.0: a comprehensive platform for prediction and analysis of plant disease resistance genes.
Osuna-Cruz, Cristina M; Paytuvi-Gallart, Andreu; Di Donato, Antimo; Sundesha, Vicky; Andolfo, Giuseppe; Aiese Cigliano, Riccardo; Sanseverino, Walter; Ercolano, Maria R
2018-01-04
The Plant Resistance Genes database (PRGdb; http://prgdb.org) has been redesigned with a new user interface, new sections, new tools and new data for genetic improvement, allowing easy access not only to the plant science research community but also to breeders who want to improve plant disease resistance. The home page offers an overview of easy-to-read search boxes that streamline data queries and directly show plant species for which data from candidate or cloned genes have been collected. Bulk data files and curated resistance gene annotations are made available for each plant species hosted. The new Gene Model view offers detailed information on each cloned resistance gene structure to highlight shared attributes with other genes. PRGdb 3.0 offers 153 reference resistance genes and 177 072 annotated candidate Pathogen Receptor Genes (PRGs). Compared to the previous release, the number of putative genes has been increased from 106 to 177 K from 76 sequenced Viridiplantae and algae genomes. The DRAGO 2 tool, which automatically annotates and predicts (PRGs) from DNA and amino acid with high accuracy and sensitivity, has been added. BLAST search has been implemented to offer users the opportunity to annotate and compare their own sequences. The improved section on plant diseases displays useful information linked to genes and genomes to connect complementary data and better address specific needs. Through, a revised and enlarged collection of data, the development of new tools and a renewed portal, PRGdb 3.0 engages the plant science community in developing a consensus plan to improve knowledge and strategies to fight diseases that afflict main crops and other plants. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Comparative Genomics of Non-TNL Disease Resistance Genes from Six Plant Species.
Nepal, Madhav P; Andersen, Ethan J; Neupane, Surendra; Benson, Benjamin V
2017-09-30
Disease resistance genes (R genes), as part of the plant defense system, have coevolved with corresponding pathogen molecules. The main objectives of this project were to identify non-Toll interleukin receptor, nucleotide-binding site, leucine-rich repeat (nTNL) genes and elucidate their evolutionary divergence across six plant genomes. Using reference sequences from Arabidopsis , we investigated nTNL orthologs in the genomes of common bean, Medicago , soybean, poplar, and rice. We used Hidden Markov Models for sequence identification, performed model-based phylogenetic analyses, visualized chromosomal positioning, inferred gene clustering, and assessed gene expression profiles. We analyzed 908 nTNL R genes in the genomes of the six plant species, and classified them into 12 subgroups based on the presence of coiled-coil (CC), nucleotide binding site (NBS), leucine rich repeat (LRR), resistance to Powdery mildew 8 (RPW8), and BED type zinc finger domains. Traditionally classified CC-NBS-LRR (CNL) genes were nested into four clades (CNL A-D) often with abundant, well-supported homogeneous subclades of Type-II R genes. CNL-D members were absent in rice, indicating a unique R gene retention pattern in the rice genome. Genomes from Arabidopsis , common bean, poplar and soybean had one chromosome without any CNL R genes. Medicago and Arabidopsis had the highest and lowest number of gene clusters, respectively. Gene expression analyses suggested unique patterns of expression for each of the CNL clades. Differential gene expression patterns of the nTNL genes were often found to correlate with number of introns and GC content, suggesting structural and functional divergence.
Levels of Essential and Non-Essential Elements in Commercially ...
African Journals Online (AJOL)
Enebi Jasper
INTRODUCTION. Plants have been ... plant metabolism and biosynthesis and act as cofactors for ... plant body. 3 . Some metals are essential nutrients (zinc, iron, copper, and chromium), ... non-destructive analysis, increased total speed, ... oleifera play both a curative and preventive ... maintenance of cardiac rhythm. 16.
Coordinations between gene modules control the operation of plant amino acid metabolic networks
Directory of Open Access Journals (Sweden)
Galili Gad
2009-01-01
Full Text Available Abstract Background Being sessile organisms, plants should adjust their metabolism to dynamic changes in their environment. Such adjustments need particular coordination in branched metabolic networks in which a given metabolite can be converted into multiple other metabolites via different enzymatic chains. In the present report, we developed a novel "Gene Coordination" bioinformatics approach and use it to elucidate adjustable transcriptional interactions of two branched amino acid metabolic networks in plants in response to environmental stresses, using publicly available microarray results. Results Using our "Gene Coordination" approach, we have identified in Arabidopsis plants two oppositely regulated groups of "highly coordinated" genes within the branched Asp-family network of Arabidopsis plants, which metabolizes the amino acids Lys, Met, Thr, Ile and Gly, as well as a single group of "highly coordinated" genes within the branched aromatic amino acid metabolic network, which metabolizes the amino acids Trp, Phe and Tyr. These genes possess highly coordinated adjustable negative and positive expression responses to various stress cues, which apparently regulate adjustable metabolic shifts between competing branches of these networks. We also provide evidence implying that these highly coordinated genes are central to impose intra- and inter-network interactions between the Asp-family and aromatic amino acid metabolic networks as well as differential system interactions with other growth promoting and stress-associated genome-wide genes. Conclusion Our novel Gene Coordination elucidates that branched amino acid metabolic networks in plants are regulated by specific groups of highly coordinated genes that possess adjustable intra-network, inter-network and genome-wide transcriptional interactions. We also hypothesize that such transcriptional interactions enable regulatory metabolic adjustments needed for adaptation to the stresses.
Xu, Wei; Wang, Ting; Xu, Shaoxin; Li, Fanghua; Deng, Chenguang; Wu, Lijun; Wu, Yuejin; Bian, Po
2016-08-01
Plant stress responses at the epigenetic level are expected to allow more permanent changes of gene expression and potentially long-term adaptation. While it has been reported that plants subjected to adverse environments initiate various stress responses in their neighboring plants, little is known regarding epigenetic responses to external stresses mediated by plant-plant communication. In this study, we show that DNA repetitive elements of Arabidopsis thaliana, whose expression is inhibited epigenetically by transcriptional gene silencing (TGS) mechanism, are activated by UV-C irradiation through airborne plant-plant and plant-plant-plant communications, accompanied by DNA demethylation at CHH sites. Moreover, the TGS is alleviated by direct treatments with exogenous methyl jasmonate (MeJA) and methyl salicylate (MeSA). Further, the plant-plant and plant-plant-plant communications are blocked by mutations in the biosynthesis or signaling of jasmonic acid (JA) or salicylic acid (SA), indicating that JA and SA pathways are involved in the interplant communication for epigenetic responses. For the plant-plant-plant communication, stress cues are relayed to the last set of receiver plants by promoting the production of JA and SA signals in relaying plants, which exhibit upregulated expression of genes for JA and SA biosynthesis and enhanced emanation of MeJA and MeSA. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Gribaldo Simonetta
2009-02-01
Full Text Available Abstract Background The pioneering ancestor of land plants that conquered terrestrial habitats around 500 million years ago had to face dramatic stresses including UV radiation, desiccation, and microbial attack. This drove a number of adaptations, among which the emergence of the phenylpropanoid pathway was crucial, leading to essential compounds such as flavonoids and lignin. However, the origin of this specific land plant secondary metabolism has not been clarified. Results We have performed an extensive analysis of the taxonomic distribution and phylogeny of Phenylalanine Ammonia Lyase (PAL, which catalyses the first and essential step of the general phenylpropanoid pathway, leading from phenylalanine to p-Coumaric acid and p-Coumaroyl-CoA, the entry points of the flavonoids and lignin routes. We obtained robust evidence that the ancestor of land plants acquired a PAL via horizontal gene transfer (HGT during symbioses with soil bacteria and fungi that are known to have established very early during the first steps of land colonization. This horizontally acquired PAL represented then the basis for further development of the phenylpropanoid pathway and plant radiation on terrestrial environments. Conclusion Our results highlight a possible crucial role of HGT from soil bacteria in the path leading to land colonization by plants and their subsequent evolution. The few functional characterizations of sediment/soil bacterial PAL (production of secondary metabolites with powerful antimicrobial activity or production of pigments suggest that the initial advantage of this horizontally acquired PAL in the ancestor of land plants might have been either defense against an already developed microbial community and/or protection against UV. Reviewers This article was reviewed by Purificación López-García, Janet Siefert, and Eugene Koonin.
Vetchinkina, E M; Komakhina, V V; Vysotskii, D A; Zaitsev, D V; Smirnov, A N; Babakov, A V; Komakhin, R A
2016-09-01
The chickweed (Stellaria media L.) pro-SmAMP2 gene encodes the hevein-like peptides that have in vitro antimicrobial activity against certain harmful microorganisms. These peptides play an important role in protecting the chickweed plants from infection, and the pro-SmAMP2 gene was previously used to protect transgenic tobacco and Arabidopsis plants from phytopathogens. In this study, the pro-SmAMP2 gene under control of viral CaMV35S promoter or under control of its own pro-SmAMP2 promoter was transformed into cultivated potato plants of two cultivars, differing in the resistance to Alternaria: Yubiley Zhukova (resistant) and Skoroplodny (susceptible). With the help of quantitative real-time PCR, it was demonstrated that transgenic potato plants expressed the pro-SmAMP2 gene under control of both promoters at the level comparable to or exceeding the level of the potato actin gene. Assessment of the immune status of the transformants demonstrated that expression of antimicrobial peptide pro-SmAMP2 gene was able to increase the resistance to a complex of Alternaria sp. and Fusarium sp. phytopathogens only in potato plants of the Yubiley Zhukova cultivar. The possible role of the pro-SmAMP2 products in protecting potatoes from Alternaria sp. and Fusarium sp. is discussed.
Endogenous small RNAs and antibacterial immunity in plants.
Jin, Hailing
2008-08-06
Small RNAs are non-coding regulatory RNA molecules that control gene expression by mediating mRNA degradation, translational inhibition, or chromatin modification. Virus-derived small RNAs induce silencing of viral RNAs and are essential for antiviral defense in both animal and plant systems. The role of host endogenous small RNAs on antibacterial immunity has only recently been recognized. Host disease resistance and defense responses are achieved by activation and repression of a large array of genes. Certain endogenous small RNAs in plants, including microRNAs (miRNAs) and small interfering RNAs (siRNAs), are induced or repressed in response to pathogen attack and subsequently regulate the expression of genes involved in disease resistance and defense responses by mediating transcriptional or post-transcriptional gene silencing. Thus, these small RNAs play an important role in gene expression reprogramming in plant disease resistance and defense responses. This review focuses on the recent findings of plant endogenous small RNAs in antibacterial immunity.
Gramzow, Lydia; Weilandt, Lisa; Theißen, Günter
2014-11-01
MADS-box genes comprise a gene family coding for transcription factors. This gene family expanded greatly during land plant evolution such that the number of MADS-box genes ranges from one or two in green algae to around 100 in angiosperms. Given the crucial functions of MADS-box genes for nearly all aspects of plant development, the expansion of this gene family probably contributed to the increasing complexity of plants. However, the expansion of MADS-box genes during one important step of land plant evolution, namely the origin of seed plants, remains poorly understood due to the previous lack of whole-genome data for gymnosperms. The newly available genome sequences of Picea abies, Picea glauca and Pinus taeda were used to identify the complete set of MADS-box genes in these conifers. In addition, MADS-box genes were identified in the growing number of transcriptomes available for gymnosperms. With these datasets, phylogenies were constructed to determine the ancestral set of MADS-box genes of seed plants and to infer the ancestral functions of these genes. Type I MADS-box genes are under-represented in gymnosperms and only a minimum of two Type I MADS-box genes have been present in the most recent common ancestor (MRCA) of seed plants. In contrast, a large number of Type II MADS-box genes were found in gymnosperms. The MRCA of extant seed plants probably possessed at least 11-14 Type II MADS-box genes. In gymnosperms two duplications of Type II MADS-box genes were found, such that the MRCA of extant gymnosperms had at least 14-16 Type II MADS-box genes. The implied ancestral set of MADS-box genes for seed plants shows simplicity for Type I MADS-box genes and remarkable complexity for Type II MADS-box genes in terms of phylogeny and putative functions. The analysis of transcriptome data reveals that gymnosperm MADS-box genes are expressed in a great variety of tissues, indicating diverse roles of MADS-box genes for the development of gymnosperms. This study is
Implication of the changing concept of genes on plant breeder’s work
Directory of Open Access Journals (Sweden)
Marco Aurélio D. Dias
2011-01-01
Full Text Available The recent genome sequencing of some species has accumulated evidence that for a large number of traits, thecontrol and action of genes are far more complex than previously thought. This article discusses possible implications of newinsights into the gene concept on the work of plant breeders. Apparently, the successful application of biotechnological techniques is not as simple as once assumed. The evident changes in the available concept of genes confirmed what the past experience had shown,i.e, selection should focus on the phenotype, under the same conditions as the plant is to be cultivated in. Advanced vocationaltraining of plant breeders must be continuously maintained, focusing on phenotype-based selection in as accurate as possibleexperiments.
Directory of Open Access Journals (Sweden)
Marek eMutwil
2014-08-01
Full Text Available The analysis of gene expression data has shown that transcriptionally coordinated (co-expressed genes are often functionally related, enabling scientists to use expression data in gene function prediction. This Focused Review discusses our original paper (Large-scale co-expression approach to dissect secondary cell wall formation across plant species, Frontiers in Plant Science 2:23. In this paper we applied cross-species analysis to co-expression networks of genes involved in cellulose biosynthesis. We show that the co-expression networks from different species are highly similar, indicating that whole biological pathways are conserved across species. This finding has two important implications. First, the analysis can transfer gene function annotation from well-studied plants, such as Arabidopsis, to other, uncharacterized plant species. As the analysis finds genes that have similar sequence and similar expression pattern across different organisms, functionally equivalent genes can be identified. Second, since co-expression analyses are often noisy, a comparative analysis should have higher performance, as parts of co-expression networks that are conserved are more likely to be functionally relevant. In this Focused Review, we outline the comparative analysis done in the original paper and comment on the recent advances and approaches that allow comparative analyses of co-function networks. We hypothesize that, in comparison to simple co-expression analysis, comparative analysis would yield more accurate gene function predictions. Finally, by combining comparative analysis with genomic information of green plants, we propose a possible composition of cellulose biosynthesis machinery during earlier stages of plant evolution.
Aux/IAA Gene Family in Plants: Molecular Structure, Regulation, and Function
Directory of Open Access Journals (Sweden)
Jie Luo
2018-01-01
Full Text Available Auxin plays a crucial role in the diverse cellular and developmental responses of plants across their lifespan. Plants can quickly sense and respond to changes in auxin levels, and these responses involve several major classes of auxin-responsive genes, including the Auxin/Indole-3-Acetic Acid (Aux/IAA family, the auxin response factor (ARF family, small auxin upregulated RNA (SAUR, and the auxin-responsive Gretchen Hagen3 (GH3 family. Aux/IAA proteins are short-lived nuclear proteins comprising several highly conserved domains that are encoded by the auxin early response gene family. These proteins have specific domains that interact with ARFs and inhibit the transcription of genes activated by ARFs. Molecular studies have revealed that Aux/IAA family members can form diverse dimers with ARFs to regulate genes in various ways. Functional analyses of Aux/IAA family members have indicated that they have various roles in plant development, such as root development, shoot growth, and fruit ripening. In this review, recently discovered details regarding the molecular characteristics, regulation, and protein–protein interactions of the Aux/IAA proteins are discussed. These details provide new insights into the molecular basis of the Aux/IAA protein functions in plant developmental processes.
Directory of Open Access Journals (Sweden)
Zhihua Hua
Full Text Available The emergence of multigene families has been hypothesized as a major contributor to the evolution of complex traits and speciation. To help understand how such multigene families arose and diverged during plant evolution, we examined the phylogenetic relationships of F-Box (FBX genes, one of the largest and most polymorphic superfamilies known in the plant kingdom. FBX proteins comprise the target recognition subunit of SCF-type ubiquitin-protein ligases, where they individually recruit specific substrates for ubiquitylation. Through the extensive analysis of 10,811 FBX loci from 18 plant species, ranging from the alga Chlamydomonas reinhardtii to numerous monocots and eudicots, we discovered strikingly diverse evolutionary histories. The number of FBX loci varies widely and appears independent of the growth habit and life cycle of land plants, with a little as 198 predicted for Carica papaya to as many as 1350 predicted for Arabidopsis lyrata. This number differs substantially even among closely related species, with evidence for extensive gains/losses. Despite this extraordinary inter-species variation, one subset of FBX genes was conserved among most species examined. Together with evidence of strong purifying selection and expression, the ligases synthesized from these conserved loci likely direct essential ubiquitylation events. Another subset was much more lineage specific, showed more relaxed purifying selection, and was enriched in loci with little or no evidence of expression, suggesting that they either control more limited, species-specific processes or arose from genomic drift and thus may provide reservoirs for evolutionary innovation. Numerous FBX loci were also predicted to be pseudogenes with their numbers tightly correlated with the total number of FBX genes in each species. Taken together, it appears that the FBX superfamily has independently undergone substantial birth/death in many plant lineages, with its size and rapid
Directory of Open Access Journals (Sweden)
Gh. Sharafi
2013-06-01
Full Text Available Chamomile is a valuable medicinal plant and is used as spice and herbal medicine. Application of agronomical methods has important role in increasing quantitative and qualitative traits of this medicinal plant. Fertilizer management is an important factor in successful cultivation of medicinal plants, which could have positive effects on their quantitative and qualitative indices. This experiment was conducted in order to determine the effects of plant density and nitrogen (N fertilizer on dry flower yield and essential oil content of chamomile (Matricaria chamomilla using factorial randomized complete blocks design with three replications. Three N rates from urea source (0, 100 and 200 kg/ha and three plant densities (28.6, 40 and 66.7 plants per m2 were considered. The results showed that the highest single plant yield was produced in the lowest plant density (28.6 plants per m2 and application of 100 kg/ha N. The highest dry flower yield of 474.1 kg/ha and essential oil content of 0.2% was produced in 25 cm row width and fixed plant spacing of 10 cm (40 plants per m2 and application of 100 kg/ha N.
Ndoye Foe, Florentine Marie-Chantal; Tchinang, Tatiana Flore Kemegni; Nyegue, Ascencion Maximilienne; Abdou, Jean-Pierre; Yaya, Abel Joel Gbaweng; Tchinda, Alembert Tiabou; Essame, Jean-Louis Oyono; Etoa, François-Xavier
2016-04-07
In the Cameroonian traditional medicine, plants of the Capparidaceae, Euphorbiaceae and Liliaceae families are used to treat several metabolic diseases. These plants are rich in various compounds belonging to the glucosinolates and thiosulfinates family. Till date, very little studies have been done aiming at assessing the antioxidant and inflammatory properties of the essential oils (EOs) of these plants. Essential oils are volatile extracts produced by secondary metabolism. They are usually constituted of terpens and may also contain specific non terpenic components such as glucosinolates and thiosulfinates for the species that are being considered in the present study. This study highlights and compares the chemical composition, antioxidant and anti-inflammatory properties of the essential oils of the stem barks of Drypetes gossweileri (Euphorbiaceae), roots of Pentadiplandra brazzeana (Capparidaceae), red bulbs of Allium cepa and Alium sativum (Liliaceae) collected in Cameroon (Central Africa). The essential oils were extracted by hydrodistillation and analyzed by gas chromatography (GC) and gas chromatography coupled to mass spectrometry (GC-MS). In vitro antioxidant activities were determined using the radical scavenging assay, total phenolic content, ferric reducing antioxidant power (FRAP) assay and determination of antioxidant activity index (AAI) according to the method described by Scherer and Godoy. The anti-inflammatory activities were evaluated using albumin denaturation method. Differences (p essential oil were diallyl trisulfide (41.62 %), diallyl disulfide (19.74 %), allyl methyl trisulfide (12.95 %), diallyl sulfide (7.1 %) and diallyl tetrasulfide (4.22 %). Those of Allium cepa essential oil were diallyl trisulfide (22.17 %), dipropyl trisulfide (11.11 %), 2-methyl-3,4-dithiaheptane (9.88 %), methyl propyl trisulfide (8.14 %), dipropyl tetrasulfide (8.07 %) and 2-propenyl propyl disulfide (5.15 %). Drypetes gossweileri and Pentadiplandra
An ant-plant mutualism through the lens of cGMP-dependent kinase genes.
Malé, Pierre-Jean G; Turner, Kyle M; Doha, Manjima; Anreiter, Ina; Allen, Aaron M; Sokolowski, Marla B; Frederickson, Megan E
2017-09-13
In plant-animal mutualisms, how an animal forages often determines how much benefit its plant partner receives. In many animals, foraging behaviour changes in response to foraging gene expression or activation of the cGMP-dependent protein kinase (PKG) that foraging encodes. Here, we show that this highly conserved molecular mechanism affects the outcome of a plant-animal mutualism. We studied the two PKG genes of Allomerus octoarticulatus, an Amazonian ant that defends the ant-plant Cordia nodosa against herbivores. Some ant colonies are better 'bodyguards' than others. Working in the field in Peru, we found that colonies fed with a PKG activator recruited more workers to attack herbivores than control colonies. This resulted in less herbivore damage. PKG gene expression in ant workers correlated with whether an ant colony discovered an herbivore and how much damage herbivores inflicted on leaves in a complex way; natural variation in expression levels of the two genes had significant interaction effects on ant behaviour and herbivory. Our results suggest a molecular basis for ant protection of plants in this mutualism. © 2017 The Author(s).
The essential function of B. subtilis RNase III is to silence foreign toxin genes.
Directory of Open Access Journals (Sweden)
Sylvain Durand
Full Text Available RNase III-related enzymes play key roles in cleaving double-stranded RNA in many biological systems. Among the best-known are RNase III itself, involved in ribosomal RNA maturation and mRNA turnover in bacteria, and Drosha and Dicer, which play critical roles in the production of micro (mi-RNAs and small interfering (si-RNAs in eukaryotes. Although RNase III has important cellular functions in bacteria, its gene is generally not essential, with the remarkable exception of that of Bacillus subtilis. Here we show that the essential role of RNase III in this organism is to protect it from the expression of toxin genes borne by two prophages, Skin and SPβ, through antisense RNA. Thus, while a growing number of organisms that use RNase III or its homologs as part of a viral defense mechanism, B. subtilis requires RNase III for viral accommodation to the point where the presence of the enzyme is essential for cell survival. We identify txpA and yonT as the two toxin-encoding mRNAs of Skin and SPβ that are sensitive to RNase III. We further explore the mechanism of RNase III-mediated decay of the txpA mRNA when paired to its antisense RNA RatA, both in vivo and in vitro.
QUANTIFICATION OF TRANSGENIC PLANT MARKER GENE PERSISTENCE IN THE FIELD
Methods were developed to monitor persistence of genomic DNA in decaying plants in the field. As a model, we used recombinant neomycin phosphotransferase II (rNPT-II) marker genes present in genetically engineered plants. Polymerase chain reaction (PCR) primers were designed, com...
ISOLATION AND CHARACTERIZATION OF CHITINASE GENE FROM THE UNTRADITIONAL PLANT SPECIES
Directory of Open Access Journals (Sweden)
Dominika Ďurechová
2013-02-01
Full Text Available Round-leaf sundew (Drosera rotundifolia L. from Droseraceae family belongs among a few plant species with strong antifungal potential. It was previously shown that chitinases of carnivorous plant species may play role during the insect prey digestion, when hard chitin skeleton is being decomposed. As many phytopathogenic fungi contain chitin in their cell wall our attention in this work was focused on isolation and in silico characterization of genomic DNA sequence of sundew chitinase gene. Subsequently this gene was fused to strong constitutive CaMV35S promoter and cloned into the plant binary vector pBinPlus and tested in A. tumefaciens LBA 4404 for its stability. Next, when transgenic tobacco plants are obtained, increasing of their antifungal potential will be tested.
Induced mutations - a tool in plant research
International Nuclear Information System (INIS)
1981-01-01
These proceedings include 34 papers and 18 brief descriptions of poster presentations in the following areas as they are affected by induced mutations: advancement of genetics, plant evolution, plant physiology, plant parasites, plant symbioses, in vitro culture, gene ecology and plant breeding. Only a relatively small number of papers are of direct nuclear interest essentially in view of the mutations being induced by ionizing radiations. The papers of nuclear interest have been entered as separate and individual items of input
Opalińska, Magdalena; Parys, Katarzyna; Murcha, Monika W; Jańska, Hanna
2018-01-29
Mitochondria are multifunctional organelles that play a central role in energy metabolism. Owing to the life-essential functions of these organelles, mitochondrial content, quality and dynamics are tightly controlled. Across the species, highly conserved ATP-dependent proteases prevent malfunction of mitochondria through versatile activities. This study focuses on a molecular function of the plant mitochondrial inner membrane-embedded AAA protease (denoted i -AAA) FTSH4, providing its first bona fide substrate. Here, we report that the abundance of the Tim17-2 protein, an essential component of the TIM17:23 translocase (Tim17-2 together with Tim50 and Tim23), is directly controlled by the proteolytic activity of FTSH4. Plants that are lacking functional FTSH4 protease are characterized by significantly enhanced capacity of preprotein import through the TIM17:23-dependent pathway. Taken together, with the observation that FTSH4 prevents accumulation of Tim17-2, our data point towards the role of this i -AAA protease in the regulation of mitochondrial biogenesis in plants. © 2018. Published by The Company of Biologists Ltd.
Nieves, Elsa; Fernández Méndez, Janett; Lias, José; Rondón, Maritza; Briceño, Benito
2010-12-01
Natural repellents from plant extracts have demonstrated good efficacy against bites of some insect species. The present study evaluated the repellent effect of essential oils extracted from 8 plants species against bites of Lutzomyia migonei, the Leishmania vector. The essential oils were extracted by steam destillation in Clevenger chamber, from the following plants: Hyptis suaveolens, Pimenta racemosa, Piper marginatum, Monticalia imbricatifolia, Pseudognaphalium caeruleocanum, Espeletia shultzii, Plecthranthus amboinicus and Cinnamomun zeylanicum. Repellency tests were performed under laboratory conditions by the human hand method in cage assays, using female colonies of L. migonei. The more effective oils were tested at variable concentrations on different volunteers. The protection percentage and time were calculated. The results showed what oils of P. caeruleocanum and C. zeylanicum were the most effective. Although P. amboinicus oil also had repellent effect showed an irritant effect. The oils P. marginatum, H. suaveolens and P. racemosa showed no repellent effect, while the rest of oil extracts showed significant repellency in variable degrees. P. caeruleocanum and C. zeylanicum oils provided the 95% protection against bites of L. migonei for 3 h. The P. caeruleocanum oil showed the greatest protection time, with a mean over 4h and 3h at concentrations of 50% and 10% respectively. The results suggest that the P. caeruleocanum oil could represent a potential natural repellent against Leishmania vectors.
Roldán, Lina P; Díaz, Gonzalo J; Duringer, Jennifer M
2010-01-01
The qualitative composition and antibacterial activity of six essential oils obtained from plants cultivated in the Colombian Andes (Mentha spicata, Mentha piperita, Ocimum basilicum, Salvia officinalis, Rosmarinus officinalis and Thymus vulgaris) and a commercial essential oil of Origanum vulgare subsp. hirtum were investigated. The essential oil composition was determined by gas chromatography-mass spectrometry (GC-MS), while the antibacterial activity of the essential oils against Escheric...
MicroRNA-Mediated Gene Silencing in Plant Defense and Viral Counter-Defense
Directory of Open Access Journals (Sweden)
Sheng-Rui Liu
2017-09-01
Full Text Available MicroRNAs (miRNAs are non-coding RNAs of approximately 20–24 nucleotides in length that serve as central regulators of eukaryotic gene expression by targeting mRNAs for cleavage or translational repression. In plants, miRNAs are associated with numerous regulatory pathways in growth and development processes, and defensive responses in plant–pathogen interactions. Recently, significant progress has been made in understanding miRNA-mediated gene silencing and how viruses counter this defense mechanism. Here, we summarize the current knowledge and recent advances in understanding the roles of miRNAs involved in the plant defense against viruses and viral counter-defense. We also document the application of miRNAs in plant antiviral defense. This review discusses the current understanding of the mechanisms of miRNA-mediated gene silencing and provides insights on the never-ending arms race between plants and viruses.
Signal Network Analysis of Plant Genes Responding to Ionizing Radiation
International Nuclear Information System (INIS)
Kim, Dong Sub; Kim, Jinbaek; Kim, Sang Hoon
2012-12-01
In this project, we irradiated Arabidopsis plants with various doses of gamma-rays at the vegetative and reproductive stages to assess their radiation sensitivity. After the gene expression profiles and an analysis of the antioxidant response, we selected several Arabidopsis genes for uses of 'Radio marker genes (RMG)' and conducted over-expression and knock-down experiments to confirm the radio sensitivity. Based on these results, we applied two patents for the detection of two RMG (At3g28210 and At4g37990) and development of transgenic plants. Also, we developed a Genechip for use of high-throughput screening of Arabidopsis genes responding only to ionizing radiation and identified RMG to detect radiation leaks. Based on these results, we applied two patents associated with the use of Genechip for different types of radiation and different growth stages. Also, we conducted co-expression network study of specific expressed probes against gamma-ray stress and identified expressed patterns of duplicated genes formed by whole/500kb segmental genome duplication
International Nuclear Information System (INIS)
Wang, Zhenyu; Zhao, Xiuyang; Wang, Bing; Liu, Erlong; Chen, Ni; Zhang, Wei; Liu, Heng
2016-01-01
Heterogeneous nuclear ribonucleoproteins (hnRNPs) participate in diverse regulations of plant growth and environmental stress responses. In this work, an Arabidopsis hnRNP of unknown function, AtRNP1, was investigated. We found that AtRNP1 gene is highly expressed in rosette and cauline leaves, and slightly induced under drought, salt, osmotic and ABA stresses. AtRNP1 protein is localized to both the nucleus and cytoplasm. We performed homologous overexpression of AtRNP1 and found that the transgenic plants showed shortened root length and plant height, and accelerated flowering. In addition, the transgenic plants also showed reduced tolerance to drought, salt, osmotic and ABA stresses. Further studies revealed that under both normal and stress conditions, the proline contents in the transgenic plants are markedly decreased, associated with reduced expression levels of a proline synthase gene and several stress-responsive genes. These results suggested that the overexpression of AtRNP1 negatively affects plant growth and abiotic stress tolerance. - Highlights: • AtRNP1 is a widely expressed gene and its expression is slightly induced under abiotic stresses. • AtRNP1 protein is localized to both the nucleus and cytoplasm. • Overexpression of AtRNP1 affects plant growth. • Overexpression of AtRNP1 reduces plant tolerance to drought and salt stresses. • AtRNP1 overexpression plants show decreased proline accumulation and stress-responsive gene expressions.
Energy Technology Data Exchange (ETDEWEB)
Wang, Zhenyu, E-mail: wzy72609@163.com [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China); Zhao, Xiuyang, E-mail: xiuzh@psb.vib-ugent.be [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China); Wang, Bing, E-mail: wangbing@ibcas.ac.cn [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China); Liu, Erlong, E-mail: liuel14@lzu.edu.cn [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China); Chen, Ni, E-mail: 63710156@qq.com [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China); Zhang, Wei, E-mail: wzhang1216@yahoo.com [Shanghai Key Laboratory of Bio-Energy Crops, School of Life Sciences, Shanghai University, Shanghai 200444 (China); Liu, Heng, E-mail: hengliu@lzu.edu.cn [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China)
2016-04-01
Heterogeneous nuclear ribonucleoproteins (hnRNPs) participate in diverse regulations of plant growth and environmental stress responses. In this work, an Arabidopsis hnRNP of unknown function, AtRNP1, was investigated. We found that AtRNP1 gene is highly expressed in rosette and cauline leaves, and slightly induced under drought, salt, osmotic and ABA stresses. AtRNP1 protein is localized to both the nucleus and cytoplasm. We performed homologous overexpression of AtRNP1 and found that the transgenic plants showed shortened root length and plant height, and accelerated flowering. In addition, the transgenic plants also showed reduced tolerance to drought, salt, osmotic and ABA stresses. Further studies revealed that under both normal and stress conditions, the proline contents in the transgenic plants are markedly decreased, associated with reduced expression levels of a proline synthase gene and several stress-responsive genes. These results suggested that the overexpression of AtRNP1 negatively affects plant growth and abiotic stress tolerance. - Highlights: • AtRNP1 is a widely expressed gene and its expression is slightly induced under abiotic stresses. • AtRNP1 protein is localized to both the nucleus and cytoplasm. • Overexpression of AtRNP1 affects plant growth. • Overexpression of AtRNP1 reduces plant tolerance to drought and salt stresses. • AtRNP1 overexpression plants show decreased proline accumulation and stress-responsive gene expressions.
Spectroscopic detection of fluorescent protein marker gene activity in genetically modified plants
Liew, O. W.; Chong, Jenny P. C.; Asundi, Anand K.
2005-04-01
This work focuses on developing a portable fibre optic fluorescence analyser for rapid identification of genetically modified plants tagged with a fluorescent marker gene. Independent transgenic tobacco plant lines expressing the enhanced green fluorescence protein (EGFP) gene were regenerated following Agrobacterium-mediated gene transfer. Molecular characterisation of these plant lines was carried out at the DNA level by PCR screening to confirm their transgenic status. Conventional transgene expression analysis was then carried out at the RNA level by RT-PCR and at the protein level by Western blotting using anti-GFP rabbit antiserum. The amount of plant-expressed EGFP on a Western blot was quantified against known amounts of purified EGFP by scanning densitometry. The expression level of EGFP in transformed plants was found to range from 0.1 - 0.6% of total extractable protein. A comparison between conventional western analysis of transformants and direct spectroscopic quantification using the fibre optic fluorescence analyser was made. The results showed that spectroscopic measurements of fluorescence emission from strong EGFP expressors correlated positively with Western blot data. However, the fluorescence analyser was also able to identify weakly expressing plant transformants below the detection limit of colorimetric Western blotting.
Expression of TLP-3 gene without signal peptide in tobacco plants ...
African Journals Online (AJOL)
Expression of TLP-3 gene without signal peptide in tobacco plants using Agrobacterium mediated transformation. ... Plants are exploited as a source of food by a wide range of parasites, including viruses, bacteria, fungi, nematodes, insects and even other plants. So paying attention to their protection is very important.
Plant essential oils have a number of roles in insect pest management. For male Ceratitis capitata, this includes use of angelica seed oil as long range attractants and ginger root oil as aromatherapy, which is exposure to sterile males to increase mating success. Neither of these plants are hosts f...
Hua, Zhi-Gang; Lin, Yan; Yuan, Ya-Zhou; Yang, De-Chang; Wei, Wen; Guo, Feng-Biao
2015-01-01
In 2003, we developed an ab initio program, ZCURVE 1.0, to find genes in bacterial and archaeal genomes. In this work, we present the updated version (i.e. ZCURVE 3.0). Using 422 prokaryotic genomes, the average accuracy was 93.7% with the updated version, compared with 88.7% with the original version. Such results also demonstrate that ZCURVE 3.0 is comparable with Glimmer 3.02 and may provide complementary predictions to it. In fact, the joint application of the two programs generated better results by correctly finding more annotated genes while also containing fewer false-positive predictions. As the exclusive function, ZCURVE 3.0 contains one post-processing program that can identify essential genes with high accuracy (generally >90%). We hope ZCURVE 3.0 will receive wide use with the web-based running mode. The updated ZCURVE can be freely accessed from http://cefg.uestc.edu.cn/zcurve/ or http://tubic.tju.edu.cn/zcurveb/ without any restrictions. PMID:25977299
Pei, Wuhong; Xu, Lisha; Huang, Sunny C; Pettie, Kade; Idol, Jennifer; Rissone, Alberto; Jimenez, Erin; Sinclair, Jason W; Slevin, Claire; Varshney, Gaurav K; Jones, MaryPat; Carrington, Blake; Bishop, Kevin; Huang, Haigen; Sood, Raman; Lin, Shuo; Burgess, Shawn M
2018-01-01
Regenerative medicine holds great promise for both degenerative diseases and traumatic tissue injury which represent significant challenges to the health care system. Hearing loss, which affects hundreds of millions of people worldwide, is caused primarily by a permanent loss of the mechanosensory receptors of the inner ear known as hair cells. This failure to regenerate hair cells after loss is limited to mammals, while all other non-mammalian vertebrates tested were able to completely regenerate these mechanosensory receptors after injury. To understand the mechanism of hair cell regeneration and its association with regeneration of other tissues, we performed a guided mutagenesis screen using zebrafish lateral line hair cells as a screening platform to identify genes that are essential for hair cell regeneration, and further investigated how genes essential for hair cell regeneration were involved in the regeneration of other tissues. We created genetic mutations either by retroviral insertion or CRISPR/Cas9 approaches, and developed a high-throughput screening pipeline for analyzing hair cell development and regeneration. We screened 254 gene mutations and identified 7 genes specifically affecting hair cell regeneration. These hair cell regeneration genes fell into distinct and somewhat surprising functional categories. By examining the regeneration of caudal fin and liver, we found these hair cell regeneration genes often also affected other types of tissue regeneration. Therefore, our results demonstrate guided screening is an effective approach to discover regeneration candidates, and hair cell regeneration is associated with other tissue regeneration.
Firnhaber, Christopher; Hammarlund, Marc
2013-11-01
Forward genetic screens are important tools for exploring the genetic requirements for neuronal function. However, conventional forward screens often have difficulty identifying genes whose relevant functions are masked by pleiotropy. In particular, if loss of gene function results in sterility, lethality, or other severe pleiotropy, neuronal-specific functions cannot be readily analyzed. Here we describe a method in C. elegans for generating cell-specific knockdown in neurons using feeding RNAi and its application in a screen for the role of essential genes in GABAergic neurons. We combine manipulations that increase the sensitivity of select neurons to RNAi with manipulations that block RNAi in other cells. We produce animal strains in which feeding RNAi results in restricted gene knockdown in either GABA-, acetylcholine-, dopamine-, or glutamate-releasing neurons. In these strains, we observe neuron cell-type specific behavioral changes when we knock down genes required for these neurons to function, including genes encoding the basal neurotransmission machinery. These reagents enable high-throughput, cell-specific knockdown in the nervous system, facilitating rapid dissection of the site of gene action and screening for neuronal functions of essential genes. Using the GABA-specific RNAi strain, we screened 1,320 RNAi clones targeting essential genes on chromosomes I, II, and III for their effect on GABA neuron function. We identified 48 genes whose GABA cell-specific knockdown resulted in reduced GABA motor output. This screen extends our understanding of the genetic requirements for continued neuronal function in a mature organism.
A CRISPR-Based Screen Identifies Genes Essential for West-Nile-Virus-Induced Cell Death.
Ma, Hongming; Dang, Ying; Wu, Yonggan; Jia, Gengxiang; Anaya, Edgar; Zhang, Junli; Abraham, Sojan; Choi, Jang-Gi; Shi, Guojun; Qi, Ling; Manjunath, N; Wu, Haoquan
2015-07-28
West Nile virus (WNV) causes an acute neurological infection attended by massive neuronal cell death. However, the mechanism(s) behind the virus-induced cell death is poorly understood. Using a library containing 77,406 sgRNAs targeting 20,121 genes, we performed a genome-wide screen followed by a second screen with a sub-library. Among the genes identified, seven genes, EMC2, EMC3, SEL1L, DERL2, UBE2G2, UBE2J1, and HRD1, stood out as having the strongest phenotype, whose knockout conferred strong protection against WNV-induced cell death with two different WNV strains and in three cell lines. Interestingly, knockout of these genes did not block WNV replication. Thus, these appear to be essential genes that link WNV replication to downstream cell death pathway(s). In addition, the fact that all of these genes belong to the ER-associated protein degradation (ERAD) pathway suggests that this might be the primary driver of WNV-induced cell death. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Divergence of gene body DNA methylation and evolution of plant duplicate genes.
Directory of Open Access Journals (Sweden)
Jun Wang
Full Text Available It has been shown that gene body DNA methylation is associated with gene expression. However, whether and how deviation of gene body DNA methylation between duplicate genes can influence their divergence remains largely unexplored. Here, we aim to elucidate the potential role of gene body DNA methylation in the fate of duplicate genes. We identified paralogous gene pairs from Arabidopsis and rice (Oryza sativa ssp. japonica genomes and reprocessed their single-base resolution methylome data. We show that methylation in paralogous genes nonlinearly correlates with several gene properties including exon number/gene length, expression level and mutation rate. Further, we demonstrated that divergence of methylation level and pattern in paralogs indeed positively correlate with their sequence and expression divergences. This result held even after controlling for other confounding factors known to influence the divergence of paralogs. We observed that methylation level divergence might be more relevant to the expression divergence of paralogs than methylation pattern divergence. Finally, we explored the mechanisms that might give rise to the divergence of gene body methylation in paralogs. We found that exonic methylation divergence more closely correlates with expression divergence than intronic methylation divergence. We show that genomic environments (e.g., flanked by transposable elements and repetitive sequences of paralogs generated by various duplication mechanisms are associated with the methylation divergence of paralogs. Overall, our results suggest that the changes in gene body DNA methylation could provide another avenue for duplicate genes to develop differential expression patterns and undergo different evolutionary fates in plant genomes.
Inhibition of cholinesterase by essential oil from food plant.
Chaiyana, Wantida; Okonogi, Siriporn
2012-06-15
Inhibition of cholinesterase has attracted much attention recently because of its potential for the treatment of Alzheimer's disease. In this work, the anticholinesterase activities of plant oils were investigated using Ellman's colorimetric method. The results indicate that essential oils obtained from Melissa officinalis leaf and Citrus aurantifolia leaf showed high acetylcholinesterase and butyrylcholinesterase co-inhibitory activities. C. aurantifolia leaf oil revealed in this study has an IC(50) value on acetylcholinesterase and butyrylcholinesterase of 139 ± 35 and 42 ± 5 μg/ml, respectively. GC/MS analysis revealed that the major constituents of C. aurantifolia leaf oil are monoterpenoids including limonene, l-camphor, citronellol, o-cymene and 1,8-cineole. Copyright © 2012 Elsevier GmbH. All rights reserved.
Functional evolution in the plant SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL gene family
Directory of Open Access Journals (Sweden)
Jill Christine Preston
2013-04-01
Full Text Available The SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL family of transcription factors is functionally diverse, controlling a number of fundamental aspects of plant growth and development, including vegetative phase change, flowering time, branching, and leaf initiation rate. In natural plant populations, variation in flowering time and shoot architecture have major consequences for fitness. Likewise, in crop species, variation in branching and developmental rate impact biomass and yield. Thus, studies aimed at dissecting how the various functions are partitioned among different SPL genes in diverse plant lineages are key to providing insight into the genetic basis of local adaptation and have already garnered attention by crop breeders. Here we use phylogenetic reconstruction to reveal nine major SPL gene lineages, each of which is described in terms of function and diversification. To assess evidence for ancestral and derived functions within each SPL gene lineage, we use ancestral character state reconstructions. Our analyses suggest an emerging pattern of sub-functionalization, neo-functionalization, and possible convergent evolution following both ancient and recent gene duplication. Based on these analyses we suggest future avenues of research that may prove fruitful for elucidating the importance of SPL gene evolution in plant growth and development.
Borges, Andrezza Raposo; Aires, Juliana Ramos de Albuquerque; Higino, Taciana Mirely Maciel; de Medeiros, Maria das Graças Freire; Citó, Antonia Maria das Graças Lopes; Lopes, José Arimatéia Dantas; de Figueiredo, Regina Celia Bressan Queiroz
2012-10-01
Chagas disease, caused by Trypanosoma cruzi, is an important cause of mortality and morbidity in Latin America. There are no vaccines available, the chemotherapy used to treat this illness has serious side effects and its efficacy on the chronic phase of disease is still a matter of debate. In a search for alternative treatment for Chagas disease, essential oils extracted from traditional medicinal plants Lippia sidoides, Lippia origanoides, Chenopodium ambrosioides, Ocimum gratissimum, Justicia pectorales and Vitex agnus-castus were investigated in vitro for trypanocidal and cytotoxic activities. Essential Oils were extracted by hydrodistillation and submitted to chemical analysis by gas chromatography/mass spectrometry. The concentration of essential oils necessary to inhibit 50% of the epimastigotes or amastigotes growth (IC(50)) and to kill 50% of trypomastigote forms (LC(50)) was estimated. The most prevalent chemical constituents of these essential oils were monoterpenes and sesquiterpenes. All essential oils tested demonstrated an inhibitory effect on the parasite growth and survival. L. sidoides and L. origanoides essential oils were the most effective against trypomastigote and amastigote forms respectively. No significant cytotoxic effects were observed in mouse peritoneal macrophages incubated with essential oils which were more selective against the parasites than mammalian cells. Taken together, our results point towards the use of these essential oils as potential chemotherapeutic agent against T. cruzi. Copyright © 2012 Elsevier Inc. All rights reserved.
A Comprehensive Classification and Evolutionary Analysis of Plant Homeobox Genes
Mukherjee, Krishanu; Brocchieri, Luciano; B?rglin, Thomas R.
2009-01-01
The full complement of homeobox transcription factor sequences, including genes and pseudogenes, was determined from the analysis of 10 complete genomes from flowering plants, moss, Selaginella, unicellular green algae, and red algae. Our exhaustive genome-wide searches resulted in the discovery in each class of a greater number of homeobox genes than previously reported. All homeobox genes can be unambiguously classified by sequence evolutionary analysis into 14 distinct classes also charact...
Richards, Thomas A; Soanes, Darren M; Foster, Peter G; Leonard, Guy; Thornton, Christopher R; Talbot, Nicholas J
2009-07-01
Horizontal gene transfer (HGT) describes the transmission of genetic material across species boundaries and is an important evolutionary phenomenon in the ancestry of many microbes. The role of HGT in plant evolutionary history is, however, largely unexplored. Here, we compare the genomes of six plant species with those of 159 prokaryotic and eukaryotic species and identify 1689 genes that show the highest similarity to corresponding genes from fungi. We constructed a phylogeny for all 1689 genes identified and all homolog groups available from the rice (Oryza sativa) genome (3177 gene families) and used these to define 14 candidate plant-fungi HGT events. Comprehensive phylogenetic analyses of these 14 data sets, using methods that account for site rate heterogeneity, demonstrated support for nine HGT events, demonstrating an infrequent pattern of HGT between plants and fungi. Five HGTs were fungi-to-plant transfers and four were plant-to-fungi HGTs. None of the fungal-to-plant HGTs involved angiosperm recipients. These results alter the current view of organismal barriers to HGT, suggesting that phagotrophy, the consumption of a whole cell by another, is not necessarily a prerequisite for HGT between eukaryotes. Putative functional annotation of the HGT candidate genes suggests that two fungi-to-plant transfers have added phenotypes important for life in a soil environment. Our study suggests that genetic exchange between plants and fungi is exceedingly rare, particularly among the angiosperms, but has occurred during their evolutionary history and added important metabolic traits to plant lineages.
Lee, Karen J I; Calder, Grant M; Hindle, Christopher R; Newman, Jacob L; Robinson, Simon N; Avondo, Jerome J H Y; Coen, Enrico S
2017-01-01
Optical projection tomography (OPT) is a well-established method for visualising gene activity in plants and animals. However, a limitation of conventional OPT is that the specimen upper size limit precludes its application to larger structures. To address this problem we constructed a macro version called Macro OPT (M-OPT). We apply M-OPT to 3D live imaging of gene activity in growing whole plants and to visualise structural morphology in large optically cleared plant and insect specimens up to 60 mm tall and 45 mm deep. We also show how M-OPT can be used to image gene expression domains in 3D within fixed tissue and to visualise gene activity in 3D in clones of growing young whole Arabidopsis plants. A further application of M-OPT is to visualise plant-insect interactions. Thus M-OPT provides an effective 3D imaging platform that allows the study of gene activity, internal plant structures and plant-insect interactions at a macroscopic scale. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Directory of Open Access Journals (Sweden)
O.I. Grabelnych
2017-02-01
Full Text Available It is known that regulation of plant tolerance to adverse environmental factors is connected with short term increase of the concentration of endogenous reactive oxygen species (ROS, which are signalling molecules for the induction of protective mechanisms. Introduction and expression of heterologous gox gene, which encodes glucose oxidase enzyme in plant genome, induce constantly higher content of hydrogen peroxide in plant tissues. It is not known how the introduction of native or modified gox gene affects the plant resistance to high-temperature stress, one of the most commonly used model for the study of stress response and thermal tolerance. In this study, we investigated biological effects of transformation and evaluated the resistance to temperature stress of potato plants with altered levels of glucose oxidase expression. Transformation of potato plants by gox gene led to the more early coming out from tuber dormancy of transformed plants and slower growth rate. Transformants containing the glucose oxidase gene were more sensitive to lethal thermal shock (50 °C, 90 min than the transformant with the empty vector (pBI or untransformed plants (CK. Pre-heating of plants at 37 °C significantly weakened the damaging effect of lethal thermal shock. This attenuation was more significant in the non-transformed plants.
Ibrahim, Taghreed A; El-Hela, Atef A; El-Hefnawy, Hala M; Al-Taweel, Areej M; Perveen, Shagufta
2017-01-01
Family Cupressaceae is the largest coniferous plant family. Essential oils of many species belonging to family Cupressaceae are known to have several biological activities specially antimicrobial activity. The essential oils from aerial parts of Calocedrus decurrens Torr., Cupressus sempervirens stricta L. and Tetraclinis articulata (Vahl) Mast. were prepared by hydrodistillation. The chemical composition of the essential oils has been elucidated by gas chromatography-mass spectroscopy analysis. The prepared essential oils were examined against selected species of Gram-positive, Gram-negative bacteria and Candida species. Broth dilution methods were used to detect minimum inhibitory concentration (MIC), minimum bactericidal concentration (MBC) and minimum fungicidal concentration (MFC). Sixteen compounds were identified in the essential oils of both Calocedrus decurrens and Cupressus sempervirens L. and fifteen compounds were identified in the essential oil of Tetraclinis articulata . δ-3-Carene (43.10%), (+)-Cedrol (74.03%) and Camphor (21.23%) were the major constituents in the essential oils of Calocedrus decurrens , Cupressus sempervirens L. and Tetraclinis articulata , respectively. The essential oils showed strong antimicrobial activities against the selected microorganisms in concentration range 0.02 3- 3.03 µL/mL. This study could contribute to the chemotaxonomic characterization of family Cupressaceae. In addition, it proved that the essential oils under investigation possess potential antimicrobial properties.
Directory of Open Access Journals (Sweden)
Masayoshi Hashimoto
2016-10-01
Full Text Available The ability of plant viruses to propagate their genomes in host cells depends on many host factors. In the absence of an agrochemical that specifically targets plant viral infection cycles, one of the most effective methods for controlling viral diseases in plants is taking advantage of the host plant’s resistance machinery. Recessive resistance is conferred by a recessive gene mutation that encodes a host factor critical for viral infection. It is a branch of the resistance machinery and, as an inherited characteristic, is very durable. Moreover, recessive resistance may be acquired by a deficiency in a negative regulator of plant defense responses, possibly due to the autoactivation of defense signaling. Eukaryotic translation initiation factor (eIF 4E and eIF4G and their isoforms are the most widely exploited recessive resistance genes in several crop species, and they are effective against a subset of viral species. However, the establishment of efficient, recessive resistance-type antiviral control strategies against a wider range of plant viral diseases requires genetic resources other than eIF4Es. In this review, we focus on recent advances related to antiviral recessive resistance genes evaluated in model plants and several crop species. We also address the roles of next-generation sequencing and genome editing technologies in improving plant genetic resources for recessive resistance-based antiviral breeding in various crop species.
Dugdale, Benjamin; Mortimer, Cara L.; Kato, Maiko; James, Tess A.; Harding, Robert M.; Dale, James L.
2013-01-01
In this study, we describe a novel protein production platform that provides both activation and amplification of transgene expression in planta. The In Plant Activation (INPACT) system is based on the replication machinery of tobacco yellow dwarf mastrevirus (TYDV) and is essentially transient gene expression from a stably transformed plant, thus combining the advantages of both means of expression. The INPACT cassette is uniquely arranged such that the gene of interest is split and only reconstituted in the presence of the TYDV-encoded Rep/RepA proteins. Rep/RepA expression is placed under the control of the AlcA:AlcR gene switch, which is responsive to trace levels of ethanol. Transgenic tobacco (Nicotiana tabacum cv Samsun) plants containing an INPACT cassette encoding the β-glucuronidase (GUS) reporter had negligible background expression but accumulated very high GUS levels (up to 10% total soluble protein) throughout the plant, within 3 d of a 1% ethanol application. The GUS reporter was replaced with a gene encoding a lethal ribonuclease, barnase, demonstrating that the INPACT system provides exquisite control of transgene expression and can be adapted to potentially toxic or inhibitory compounds. The INPACT gene expression platform is scalable, not host-limited, and has been used to express both a therapeutic and an industrial protein. PMID:23839786
Viral vectors for gene modification of plants as chem/bio sensors.
Energy Technology Data Exchange (ETDEWEB)
Manginell, Monica; Harper, Jason C.; Arango, Dulce C.; Brozik, Susan Marie; Dolan, Patricia L.
2006-11-01
Chemical or biological sensors that are specific, sensitive, and robust allowing intelligence gathering for verification of nuclear non-proliferation treaty compliance and detouring production of weapons of mass destruction are sorely needed. Although much progress has been made in the area of biosensors, improvements in sensor lifetime, robustness, and device packaging are required before these devices become widely used. Current chemical and biological detection and identification techniques require less-than-covert sample collection followed by transport to a laboratory for analysis. In addition to being expensive and time consuming, results can often be inconclusive due to compromised sample integrity during collection and transport. We report here a demonstration of a plant based sensor technology which utilizes mature and seedling plants as chemical sensors. One can envision genetically modifying native plants at a site of interest that can report the presence of specific toxins or chemicals. In this one year project we used a developed inducible expression system to show the feasibility of plant sensors. The vector was designed as a safe, non-infectious vector which could be used to invade, replicate, and introduce foreign genes into mature host plants that then allow the plant to sense chem/bio agents. The genes introduced through the vector included a reporter gene that encodes for green fluorescent protein (GFP) and a gene that encodes for a mammalian receptor that recognizes a chemical agent. Specifically, GFP was induced by the presence of 17-{beta}-Estradiol (estrogen). Detection of fluorescence indicated the presence of the target chemical agent. Since the sensor is a plant, costly device packaging development or manufacturing of the sensor were not required. Additionally, the biological recognition and reporting elements are maintained in a living, natural environment and therefore do not suffer from lifetime disadvantages typical of most biosensing
The Role of Tomato WRKY Genes in Plant Responses to Combined Abiotic and Biotic Stresses
Directory of Open Access Journals (Sweden)
Yuling Bai
2018-06-01
Full Text Available In the field, plants constantly face a plethora of abiotic and biotic stresses that can impart detrimental effects on plants. In response to multiple stresses, plants can rapidly reprogram their transcriptome through a tightly regulated and highly dynamic regulatory network where WRKY transcription factors can act as activators or repressors. WRKY transcription factors have diverse biological functions in plants, but most notably are key players in plant responses to biotic and abiotic stresses. In tomato there are 83 WRKY genes identified. Here we review recent progress on functions of these tomato WRKY genes and their homologs in other plant species, such as Arabidopsis and rice, with a special focus on their involvement in responses to abiotic and biotic stresses. In particular, we highlight WRKY genes that play a role in plant responses to a combination of abiotic and biotic stresses.
Liao, Min; Xiao, Jin-Jing; Zhou, Li-Jun; Liu, Yang; Wu, Xiang-Wei; Hua, Ri-Mao; Wang, Gui-Rong; Cao, Hai-Qun
2016-01-01
The cereal weevil, Sitophilus zeamais is one of the most destructive pests of stored cereals worldwide. Frequent use of fumigants for managing stored-product insects has led to the development of resistance in insects. Essential oils from aromatic plants including the tea oil plant, Melaleuca alternifolia may provide environmentally friendly alternatives to currently used pest control agents. However, little is known about molecular events involved in stored-product insects in response to plant essential oil fumigation. M. alternifolia essential oil was shown to possess the fumigant toxicity against S. zeamais. The constituent, terpinen-4-ol was the most effective compound for fumigant toxicity. M. alternifolia essential oil significantly inhibited the activity of three enzymes in S. zeamais, including two detoxifying enzymes, glutathione S-transferase (GST), and carboxylesterase (CarE), as well as a nerve conduction enzyme, acetylcholinesterase (AChE). Comparative transcriptome analysis of S. zeamais through RNA-Seq identified a total of 3,562 differentially expressed genes (DEGs), of which 2,836 and 726 were up-regulated and down-regulated in response to M. alternifolia essential oil fumigation, respectively. Based on gene ontology (GO) analysis, the majority of DEGs were involved in insecticide detoxification and mitochondrial function. Furthermore, an abundance of DEGs mapped into the metabolism pathway in the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway database were associated with respiration and metabolism of xenobiotics, including cytochrome P450s, CarEs, GSTs, and ATP-binding cassette transporters (ABC transporters). Some DEGs mapped into the proteasome and phagosome pathway were found to be significantly enriched. These results led us to propose a model of insecticide action that M. alternifolia essential oil likely directly affects the hydrogen carrier to block the electron flow and interfere energy synthesis in mitochondrial respiratory chain
Jiang, Wen-kai; Liu, Yun-long; Xia, En-hua; Gao, Li-zhi
2013-01-01
The evolution of genes and genomes after polyploidization has been the subject of extensive studies in evolutionary biology and plant sciences. While a significant number of duplicated genes are rapidly removed during a process called fractionation, which operates after the whole-genome duplication (WGD), another considerable number of genes are retained preferentially, leading to the phenomenon of biased gene retention. However, the evolutionary mechanisms underlying gene retention after WGD remain largely unknown. Through genome-wide analyses of sequence and functional data, we comprehensively investigated the relationships between gene features and the retention probability of duplicated genes after WGDs in six plant genomes, Arabidopsis (Arabidopsis thaliana), poplar (Populus trichocarpa), soybean (Glycine max), rice (Oryza sativa), sorghum (Sorghum bicolor), and maize (Zea mays). The results showed that multiple gene features were correlated with the probability of gene retention. Using a logistic regression model based on principal component analysis, we resolved evolutionary rate, structural complexity, and GC3 content as the three major contributors to gene retention. Cluster analysis of these features further classified retained genes into three distinct groups in terms of gene features and evolutionary behaviors. Type I genes are more prone to be selected by dosage balance; type II genes are possibly subject to subfunctionalization; and type III genes may serve as potential targets for neofunctionalization. This study highlights that gene features are able to act jointly as primary forces when determining the retention and evolution of WGD-derived duplicated genes in flowering plants. These findings thus may help to provide a resolution to the debate on different evolutionary models of gene fates after WGDs. PMID:23396833
Lotus japonicus NOOT-BOP-COCH-LIKE1 is essential for nodule, nectary, leaf and flower development
DEFF Research Database (Denmark)
Magne, Kévin; George, Jeoffrey; Berbel Tornero, Ana
2018-01-01
The NOOT-BOP-COCH-LIKE (NBCL) genes are orthologs of Arabidopsis thaliana BLADE-ON-PETIOLE1/2. NBCLs are developmental regulators essential for plant shaping mainly through the regulation of organ boundaries, the promotion of lateral organ differentiation and the acquisition of organ identity. In...
Plant Responses to Abiotic Stress Regulated by Histone Deacetylases
Directory of Open Access Journals (Sweden)
Ming Luo
2017-12-01
Full Text Available In eukaryotic cells, histone acetylation and deacetylation play an important role in the regulation of gene expression. Histone acetylation levels are modulated by histone acetyltransferases and histone deacetylases (HDACs. Recent studies indicate that HDACs play essential roles in the regulation of gene expression in plant response to environmental stress. In this review, we discussed the recent advance regarding the plant HDACs and their functions in the regulation of abiotic stress responses. The role of HDACs in autophagy was also discussed.
International Nuclear Information System (INIS)
Ratna Raju, M.; Madhusudhana Rao, P.V.; Vijayalakshmi, D.; Raju, M.K.; Brahmaji Rao, J.S.; Seshadreesan, N.P.; Venkatasubramani, C.R.
2014-01-01
In this study, the essential elements for humans in selected medicinal plants and their respective growing soils are measured by Neutron Activation Analysis. The concentrations of Na, K, Fe, Br, Al, Mn, Cl, Ca and Mg were analyzed using 20 kW KAMINI Reactor, Indira Gandhi Centre for Atomic Research (IGCAR), Kalpakkam. Results show that justification for the usage of these medicinal plants in the treatment of various diseases. Moreover, these results can be useful for preparing dosage of the herbal formulations. (author)
Transcript Profile of Flowering Regulatory Genes in VcFT-Overexpressing Blueberry Plants.
Walworth, Aaron E; Chai, Benli; Song, Guo-Qing
2016-01-01
In order to identify genetic components in flowering pathways of highbush blueberry (Vaccinium corymbosum L.), a transcriptome reference composed of 254,396 transcripts and 179,853 gene contigs was developed by assembly of 72.7 million reads using Trinity. Using this transcriptome reference and a query of flowering pathway genes of herbaceous plants, we identified potential flowering pathway genes/transcripts of blueberry. Transcriptome analysis of flowering pathway genes was then conducted on leaf tissue samples of transgenic blueberry cv. Aurora ('VcFT-Aurora'), which overexpresses a blueberry FLOWERING LOCUS T-like gene (VcFT). Sixty-one blueberry transcripts of 40 genes showed high similarities to 33 known flowering-related genes of herbaceous plants, of which 17 down-regulated and 16 up-regulated genes were identified in 'VcFT-Aurora'. All down-regulated genes encoded transcription factors/enzymes upstream in the signaling pathway containing VcFT. A blueberry CONSTANS-LIKE 5-like (VcCOL5) gene was down-regulated and associated with five other differentially expressed (DE) genes in the photoperiod-mediated flowering pathway. Three down-regulated genes, i.e., a MADS-AFFECTING FLOWERING 2-like gene (VcMAF2), a MADS-AFFECTING FLOWERING 5-like gene (VcMAF5), and a VERNALIZATION1-like gene (VcVRN1), may function as integrators in place of FLOWERING LOCUS C (FLC) in the vernalization pathway. Because no CONSTAN1-like or FLOWERING LOCUS C-like genes were found in blueberry, VcCOL5 and VcMAF2/VcMAF5 or VRN1 might be the major integrator(s) in the photoperiod- and vernalization-mediated flowering pathway, respectively. The major down-stream genes of VcFT, i.e., SUPPRESSOR of Overexpression of Constans 1-like (VcSOC1), LEAFY-like (VcLFY), APETALA1-like (VcAP1), CAULIFLOWER 1-like (VcCAL1), and FRUITFULL-like (VcFUL) genes were present and showed high similarity to their orthologues in herbaceous plants. Moreover, overexpression of VcFT promoted expression of all of these
Transcript Profile of Flowering Regulatory Genes in VcFT-Overexpressing Blueberry Plants.
Directory of Open Access Journals (Sweden)
Aaron E Walworth
Full Text Available In order to identify genetic components in flowering pathways of highbush blueberry (Vaccinium corymbosum L., a transcriptome reference composed of 254,396 transcripts and 179,853 gene contigs was developed by assembly of 72.7 million reads using Trinity. Using this transcriptome reference and a query of flowering pathway genes of herbaceous plants, we identified potential flowering pathway genes/transcripts of blueberry. Transcriptome analysis of flowering pathway genes was then conducted on leaf tissue samples of transgenic blueberry cv. Aurora ('VcFT-Aurora', which overexpresses a blueberry FLOWERING LOCUS T-like gene (VcFT. Sixty-one blueberry transcripts of 40 genes showed high similarities to 33 known flowering-related genes of herbaceous plants, of which 17 down-regulated and 16 up-regulated genes were identified in 'VcFT-Aurora'. All down-regulated genes encoded transcription factors/enzymes upstream in the signaling pathway containing VcFT. A blueberry CONSTANS-LIKE 5-like (VcCOL5 gene was down-regulated and associated with five other differentially expressed (DE genes in the photoperiod-mediated flowering pathway. Three down-regulated genes, i.e., a MADS-AFFECTING FLOWERING 2-like gene (VcMAF2, a MADS-AFFECTING FLOWERING 5-like gene (VcMAF5, and a VERNALIZATION1-like gene (VcVRN1, may function as integrators in place of FLOWERING LOCUS C (FLC in the vernalization pathway. Because no CONSTAN1-like or FLOWERING LOCUS C-like genes were found in blueberry, VcCOL5 and VcMAF2/VcMAF5 or VRN1 might be the major integrator(s in the photoperiod- and vernalization-mediated flowering pathway, respectively. The major down-stream genes of VcFT, i.e., SUPPRESSOR of Overexpression of Constans 1-like (VcSOC1, LEAFY-like (VcLFY, APETALA1-like (VcAP1, CAULIFLOWER 1-like (VcCAL1, and FRUITFULL-like (VcFUL genes were present and showed high similarity to their orthologues in herbaceous plants. Moreover, overexpression of VcFT promoted expression of all of
Transcript Profile of Flowering Regulatory Genes in VcFT-Overexpressing Blueberry Plants
Walworth, Aaron E.; Chai, Benli; Song, Guo-qing
2016-01-01
In order to identify genetic components in flowering pathways of highbush blueberry (Vaccinium corymbosum L.), a transcriptome reference composed of 254,396 transcripts and 179,853 gene contigs was developed by assembly of 72.7 million reads using Trinity. Using this transcriptome reference and a query of flowering pathway genes of herbaceous plants, we identified potential flowering pathway genes/transcripts of blueberry. Transcriptome analysis of flowering pathway genes was then conducted on leaf tissue samples of transgenic blueberry cv. Aurora (‘VcFT-Aurora’), which overexpresses a blueberry FLOWERING LOCUS T-like gene (VcFT). Sixty-one blueberry transcripts of 40 genes showed high similarities to 33 known flowering-related genes of herbaceous plants, of which 17 down-regulated and 16 up-regulated genes were identified in ‘VcFT-Aurora’. All down-regulated genes encoded transcription factors/enzymes upstream in the signaling pathway containing VcFT. A blueberry CONSTANS-LIKE 5-like (VcCOL5) gene was down-regulated and associated with five other differentially expressed (DE) genes in the photoperiod-mediated flowering pathway. Three down-regulated genes, i.e., a MADS-AFFECTING FLOWERING 2-like gene (VcMAF2), a MADS-AFFECTING FLOWERING 5-like gene (VcMAF5), and a VERNALIZATION1-like gene (VcVRN1), may function as integrators in place of FLOWERING LOCUS C (FLC) in the vernalization pathway. Because no CONSTAN1-like or FLOWERING LOCUS C-like genes were found in blueberry, VcCOL5 and VcMAF2/VcMAF5 or VRN1 might be the major integrator(s) in the photoperiod- and vernalization-mediated flowering pathway, respectively. The major down-stream genes of VcFT, i.e., SUPPRESSOR of Overexpression of Constans 1-like (VcSOC1), LEAFY-like (VcLFY), APETALA1-like (VcAP1), CAULIFLOWER 1-like (VcCAL1), and FRUITFULL-like (VcFUL) genes were present and showed high similarity to their orthologues in herbaceous plants. Moreover, overexpression of VcFT promoted expression of all
Ayvaz, Abdurrahman; Sagdic, Osman; Karaborklu, Salih; Ozturk, Ismet
2010-01-01
This study was conducted to determine the insecticidal activity of essential oils from oregano, Origanum onites L. (Lamiales: Lamiaceae), savory, Satureja thymbra L. (Lamiales: Lamiaceae), and myrtle, Myrtus communis L. (Rosales: Myrtaceae) against three stored-product insects. Essential oils from three species of plants were obtained by Clevenger-type water distillation. The major compounds in these essential oils were identified using gas chromatography-mass spectrometry and their insecticidal activity was tested against adults of the Mediterranean flour moth Ephestia kuehniella Zeller (Lepidoptera: Pyralidae), the Indian meal moth Plodia interpunctella Hübner (Lepidoptera: Pyralidae) and the bean weevil Acanthoscelides obtectus Say (Coleoptera: Bruchidae). While the major compound found in oregano and savory was carvacrol, the main constituent of the myrtle was linalool. Among the tested insects, A. obtectus was the most tolerant species against the essential oils. However, the insecticidal activity of the myrtle oil was more pronounced than other oils tested against A. obtectus adults. The essential oils of oregano and savory were highly effective against P. interpunctella and E. kuehniella, with 100% mortality obtained after 24 h at 9 and 25 microl/l air for P. interpunctella and E. kuehniella, respectively. LC(50) and LC(99) values of each essential oil were estimated for each insect species.
An attempt of postharvest orange fruit rot control using essential oils from Mediterranean plants.
Camele, Ippolito; De Feo, Vincenzo; Altieri, Luciana; Mancini, Emilia; De Martino, Laura; Luigi Rana, Gian
2010-12-01
Twelve essential oils from Mediterranean aromatic plants were tested at different doses against four fungi known as causal agents of post-harvest orange fruit rot: Botrytis cinerea, Penicillium italicum, Phytophthora citrophthora, and Rhizopus stolonifer. Essential oils were obtained from Hyssopus officinalis, Lavandula angustifolia, Majorana hortensis, Melissa officinalis, Ocimum basilicum, Origanum vulgare, Salvia officinalis, and Thymus vulgaris (Family Lamiaceae), Verbena officinalis (Family Verbenaceae), and Pimpinella anisum, Foeniculum vulgare, and Carum carvi (Family Apiaceae). Because preliminary in vitro experiments showed that only the oils from V. officinalis, T. vulgaris, and O. vulgare exhibited some fungistatic activity against the above-named fungi, these three essential oils were used in successive in vivo tests carried out to protect healthy "Washington navel" orange fruits from artificial infection by the same micromycetes. The essential oil of T. vulgaris, at a 2,000 ppm dose, controlled fruit rot by B. cinerea, P. citrophthora, and R. stolonifer but was ineffective against P. italicum. Essential oils of V. officinalis and O. vulgare inhibited infection by the first two fungi and only by P. citrophthora, respectively. This finding represents an important result, with the goal of using the essential oils as natural preservatives for food products, due to their positive effect on their safety and shelf life.
A forward genetic screen reveals essential and non-essential RNAi factors in Paramecium tetraurelia
Marker, Simone; Carradec, Quentin; Tanty, Véronique; Arnaiz, Olivier; Meyer, Eric
2014-01-01
In most eukaryotes, small RNA-mediated gene silencing pathways form complex interacting networks. In the ciliate Paramecium tetraurelia, at least two RNA interference (RNAi) mechanisms coexist, involving distinct but overlapping sets of protein factors and producing different types of short interfering RNAs (siRNAs). One is specifically triggered by high-copy transgenes, and the other by feeding cells with double-stranded RNA (dsRNA)-producing bacteria. In this study, we designed a forward genetic screen for mutants deficient in dsRNA-induced silencing, and a powerful method to identify the relevant mutations by whole-genome sequencing. We present a set of 47 mutant alleles for five genes, revealing two previously unknown RNAi factors: a novel Paramecium-specific protein (Pds1) and a Cid1-like nucleotidyl transferase. Analyses of allelic diversity distinguish non-essential and essential genes and suggest that the screen is saturated for non-essential, single-copy genes. We show that non-essential genes are specifically involved in dsRNA-induced RNAi while essential ones are also involved in transgene-induced RNAi. One of the latter, the RNA-dependent RNA polymerase RDR2, is further shown to be required for all known types of siRNAs, as well as for sexual reproduction. These results open the way for the dissection of the genetic complexity, interconnection, mechanisms and natural functions of RNAi pathways in P. tetraurelia. PMID:24860163
Viuda-Martos, Manuel; El Gendy, Abd El-Nasser G S; Sendra, Esther; Fernández-López, Juana; Abd El Razik, K A; Omer, Elsayed A; Pérez-Alvarez, Jose A
2010-08-25
The aim of this work was to (i) determine the chemical composition of the essential oils of six spices widely cultivated in Egypt (Origanum syriacum, Majorana hortensis, Rosmarinus officinalis, Cymbopogon citratus, Thymus vulgaris, and Artemisia annua); (ii) determine the antioxidant activity of the Egyptian essential oils by means of five different antioxidant tests; and (iii) determine the effectiveness of these essential oils on the inhibition of Listeria innocua CECT 910. There is a great variability in the chemical composition of essential oils obtained from the six Egyptian aromatic plants. Overall, thyme (highest percentage of inhibition of DPPH radical: 89.40%) and oregano (highest percentage of inhibition of TBARS: 85.79) essential oils presented the best antioxidant profiles, whereas marjoram, lemongrass, and artemisia were highly effective in metal chelating but had a pro-oxidative behavior by Rancimat induction test. Lemongrass essential oil showed the highest antibacterial activity against L. innocua with an inhibition zone of 49.00 mm, followed in effectiveness by thyme, marjoram, and oregano.
Use of NAP gene to manipulate leaf senescence in plants
Gan, Susheng; Guo, Yongfeng
2013-04-16
The present invention discloses transgenic plants having an altered level of NAP protein compared to that of a non-transgenic plant, where the transgenic plants display an altered leaf senescence phenotype relative to a non-transgenic plant, as well as mutant plants comprising an inactivated NAP gene, where mutant plants display a delayed leaf senescence phenotype compared to that of a non-mutant plant. The present invention also discloses methods for delaying leaf senescence in a plant, as well as methods of making a mutant plant having a decreased level of NAP protein compared to that of a non-mutant plant, where the mutant plant displays a delayed leaf senescence phenotype relative to a non-mutant plant. Methods for causing precocious leaf senescence or promoting leaf senescence in a plant are also disclosed. Also disclosed are methods of identifying a candidate plant suitable for breeding that displays a delayed leaf senescence and/or enhanced yield phenotype.
Directory of Open Access Journals (Sweden)
Xiao-Qin Sun
Full Text Available Plants have evolved complex processes to ward off attacks by insects. In parallel, insects have evolved mechanisms to thwart these plant defenses. To gain insight into mechanisms that mediate this arms race between plants and herbivorous insects, we investigated the interactions between gramine, a toxin synthesized by plants of the family Gramineae, and glutathione S transferase (GST, an enzyme found in insects that is known to detoxify xenobiotics. Here, we demonstrate that rice (Oryza sativa, a hydrophytic plant, also produces gramine and that rice resistance to brown planthoppers (Nilaparvata lugens, BPHs is highly associated with in planta gramine content. We also show that gramine is a toxicant that causes BPH mortality in vivo and that knockdown of BPH GST gene nlgst1-1 results in increased sensitivity to diets containing gramine. These results suggest that the knockdown of key detoxification genes in sap-sucking insects may provide an avenue for increasing their sensitivity to natural plant-associated defense mechanisms.
Sun, Xiao-Qin; Zhang, Mao-Xin; Yu, Jing-Ya; Jin, Yu; Ling, Bing; Du, Jin-Ping; Li, Gui-Hua; Qin, Qing-Ming; Cai, Qing-Nian
2013-01-01
Plants have evolved complex processes to ward off attacks by insects. In parallel, insects have evolved mechanisms to thwart these plant defenses. To gain insight into mechanisms that mediate this arms race between plants and herbivorous insects, we investigated the interactions between gramine, a toxin synthesized by plants of the family Gramineae, and glutathione S transferase (GST), an enzyme found in insects that is known to detoxify xenobiotics. Here, we demonstrate that rice (Oryza sativa), a hydrophytic plant, also produces gramine and that rice resistance to brown planthoppers (Nilaparvata lugens, BPHs) is highly associated with in planta gramine content. We also show that gramine is a toxicant that causes BPH mortality in vivo and that knockdown of BPH GST gene nlgst1-1 results in increased sensitivity to diets containing gramine. These results suggest that the knockdown of key detoxification genes in sap-sucking insects may provide an avenue for increasing their sensitivity to natural plant-associated defense mechanisms.
Cloning and sequencing of Staphylococcus aureus murC, a gene essential for cell wall biosynthesis.
Lowe, A M; Deresiewicz, R L
1999-01-01
Staphylococcus aureus is a major human pathogen that is increasingly resistant to clinically useful antimicrobial agents. While screening for S. aureus genes expressed during mammalian infection, we isolated murC. This gene encodes UDP-N-acetylmuramoyl-L-alanine synthetase, an enzyme essential for cell wall biosynthesis in a number of bacteria. S. aureus MurC has a predicted mass 49,182 Da and complements the temperature-sensitive murC mutation of E. coli ST222. Sequence data on the DNA flanking staphylococcal murC suggests that the local gene organization there parallels that found in B. subtilis, but differs from that found in gram-negative bacterial pathogens. MurC proteins represent promising targets for broad spectrum antimicrobial drug development.
A nucleotide metabolite controls stress-responsive gene expression and plant development.
Directory of Open Access Journals (Sweden)
Hao Chen
Full Text Available Abiotic stress, such as drought and high salinity, activates a network of signaling cascades that lead to the expression of many stress-responsive genes in plants. The Arabidopsis FIERY1 (FRY1 protein is a negative regulator of stress and abscisic acid (ABA signaling and exhibits both an inositol polyphosphatase and a 3',5'-bisphosphate nucleotidase activity in vitro. The FRY1 nucleotidase degrades the sulfation byproduct 3'-phosphoadenosine-5'-phosphate (PAP, yet its in vivo functions and particularly its roles in stress gene regulation remain unclear. Here we developed a LC-MS/MS method to quantitatively measure PAP levels in plants and investigated the roles of this nucleotidase activity in stress response and plant development. It was found that PAP level was tightly controlled in plants and did not accumulate to any significant level either under normal conditions or under NaCl, LiCl, cold, or ABA treatments. In contrast, high levels of PAP were detected in multiple mutant alleles of FRY1 but not in mutants of other FRY1 family members, indicating that FRY1 is the major enzyme that hydrolyzes PAP in vivo. By genetically reducing PAP levels in fry1 mutants either through overexpression of a yeast PAP nucleotidase or by generating a triple mutant of fry1 apk1 apk2 that is defective in the biosynthesis of the PAP precursor 3'-phosphoadenosine-5'-phosphosulfate (PAPS, we demonstrated that the developmental defects and superinduction of stress-responsive genes in fry1 mutants correlate with PAP accumulation in planta. We also found that the hypersensitive stress gene regulation in fry1 requires ABH1 but not ABI1, two other negative regulators in ABA signaling pathways. Unlike in yeast, however, FRY1 overexpression in Arabidopsis could not enhance salt tolerance. Taken together, our results demonstrate that PAP is critical for stress gene regulation and plant development, yet the FRY1 nucleotidase that catabolizes PAP may not be an in vivo salt
A nucleotide metabolite controls stress-responsive gene expression and plant development
Chen, Hao
2011-10-19
Abiotic stress, such as drought and high salinity, activates a network of signaling cascades that lead to the expression of many stress-responsive genes in plants. The Arabidopsis FIERY1 (FRY1) protein is a negative regulator of stress and abscisic acid (ABA) signaling and exhibits both an inositol polyphosphatase and a 3?,5?-bisphosphate nucleotidase activity in vitro. The FRY1 nucleotidase degrades the sulfation byproduct 3?-phosphoadenosine-5?-phosphate (PAP), yet its in vivo functions and particularly its roles in stress gene regulation remain unclear. Here we developed a LC-MS/MS method to quantitatively measure PAP levels in plants and investigated the roles of this nucleotidase activity in stress response and plant development. It was found that PAP level was tightly controlled in plants and did not accumulate to any significant level either under normal conditions or under NaCl, LiCl, cold, or ABA treatments. In contrast, high levels of PAP were detected in multiple mutant alleles of FRY1 but not in mutants of other FRY1 family members, indicating that FRY1 is the major enzyme that hydrolyzes PAP in vivo. By genetically reducing PAP levels in fry1 mutants either through overexpression of a yeast PAP nucleotidase or by generating a triple mutant of fry1 apk1 apk2 that is defective in the biosynthesis of the PAP precursor 3?-phosphoadenosine-5?-phosphosulfate (PAPS), we demonstrated that the developmental defects and superinduction of stress-responsive genes in fry1 mutants correlate with PAP accumulation in planta. We also found that the hypersensitive stress gene regulation in fry1 requires ABH1 but not ABI1, two other negative regulators in ABA signaling pathways. Unlike in yeast, however, FRY1 overexpression in Arabidopsis could not enhance salt tolerance. Taken together, our results demonstrate that PAP is critical for stress gene regulation and plant development, yet the FRY1 nucleotidase that catabolizes PAP may not be an in vivo salt toxicity target
Gene Overexpression Resources in Cereals for Functional Genomics and Discovery of Useful Genes
Directory of Open Access Journals (Sweden)
Kiyomi Abe
2016-09-01
Full Text Available Identification and elucidation of functions of plant genes is valuable for both basic and applied research. In addition to natural variation in model plants, numerous loss-of-function resources have been produced by mutagenesis with chemicals, irradiation, or insertions of transposable elements or T-DNA. However, we may be unable to observe loss-of-function phenotypes for genes with functionally redundant homologs, and for those essential for growth and development. To offset such disadvantages, gain-of-function transgenic resources have been exploited. Activation-tagged lines have been generated using obligatory overexpression of endogenous genes by random insertion of an enhancer. Recent progress in DNA sequencing technology and bioinformatics has enabled the preparation of genomewide collections of full-length cDNAs (fl-cDNAs in some model species. Using the fl-cDNA clones, a novel gain-of-function strategy, Fl-cDNA OvereXpressor gene (FOX-hunting system, has been developed. A mutant phenotype in a FOX line can be directly attributed to the overexpressed fl-cDNA. Investigating a large population of FOX lines could reveal important genes conferring favorable phenotypes for crop breeding. Alternatively, a unique loss-of-function approach Chimeric REpressor gene Silencing Technology (CRES-T has been developed. In CRES-T, overexpression of a chimeric repressor, composed of the coding sequence of a transcription factor (TF and short peptide designated as the repression domain, could interfere with the action of endogenous TF in plants. Although plant TFs usually consist of gene families, CRES-T is effective, in principle, even for the TFs with functional redundancy. In this review, we focus on the current status of the gene-overexpression strategies and resources for identifying and elucidating novel functions of cereal genes. We discuss the potential of these research tools for identifying useful genes and phenotypes for application in crop
González-Plaza, Juan J; Ortiz-Martín, Inmaculada; Muñoz-Mérida, Antonio; García-López, Carmen; Sánchez-Sevilla, José F; Luque, Francisco; Trelles, Oswaldo; Bejarano, Eduardo R; De La Rosa, Raúl; Valpuesta, Victoriano; Beuzón, Carmen R
2016-01-01
Plant architecture is a critical trait in fruit crops that can significantly influence yield, pruning, planting density and harvesting. Little is known about how plant architecture is genetically determined in olive, were most of the existing varieties are traditional with an architecture poorly suited for modern growing and harvesting systems. In the present study, we have carried out microarray analysis of meristematic tissue to compare expression profiles of olive varieties displaying differences in architecture, as well as seedlings from their cross pooled on the basis of their sharing architecture-related phenotypes. The microarray used, previously developed by our group has already been applied to identify candidates genes involved in regulating juvenile to adult transition in the shoot apex of seedlings. Varieties with distinct architecture phenotypes and individuals from segregating progenies displaying opposite architecture features were used to link phenotype to expression. Here, we identify 2252 differentially expressed genes (DEGs) associated to differences in plant architecture. Microarray results were validated by quantitative RT-PCR carried out on genes with functional annotation likely related to plant architecture. Twelve of these genes were further analyzed in individual seedlings of the corresponding pool. We also examined Arabidopsis mutants in putative orthologs of these targeted candidate genes, finding altered architecture for most of them. This supports a functional conservation between species and potential biological relevance of the candidate genes identified. This study is the first to identify genes associated to plant architecture in olive, and the results obtained could be of great help in future programs aimed at selecting phenotypes adapted to modern cultivation practices in this species.
Dadaşoǧlu, Fatih
2017-04-01
In this study, it is aimmed to be determined the antimicrobial effects of the essential oil in vitro conditions, extracted from wild forms of plant which is known as Satureja hortensis around the world and grows naturally at Erzurum province of Turkey against Bacillus pumilus isolates, which are the agent of Soft Rot for some fruits and vegetables. For this purpose, 18 isolates of B. pumilus which have been determined as the agent of Soft Rot in previous studies performed in plants such as potatos, onions, strawberries, melons and watermelons. As the positive control, Streptomycin antibiotics sold as ready produce were used. According to the obtained results, the essential oil have the antibactericidal effect of 19-29 mm against 18 isolates of B. pumilus. It has been observed that the antibiotics used as the positive control has the antibacterial effect of 16-22 mm. In conclusion, the essential oil has the lethal effect against 18 B. pumilus isolates which are agents of Soft Rot. It is assesed that these essential oil extracted from Satureja hortensis can be used against these Soft Rot pathogens.
Hua, Zhi-Gang; Lin, Yan; Yuan, Ya-Zhou; Yang, De-Chang; Wei, Wen; Guo, Feng-Biao
2015-07-01
In 2003, we developed an ab initio program, ZCURVE 1.0, to find genes in bacterial and archaeal genomes. In this work, we present the updated version (i.e. ZCURVE 3.0). Using 422 prokaryotic genomes, the average accuracy was 93.7% with the updated version, compared with 88.7% with the original version. Such results also demonstrate that ZCURVE 3.0 is comparable with Glimmer 3.02 and may provide complementary predictions to it. In fact, the joint application of the two programs generated better results by correctly finding more annotated genes while also containing fewer false-positive predictions. As the exclusive function, ZCURVE 3.0 contains one post-processing program that can identify essential genes with high accuracy (generally >90%). We hope ZCURVE 3.0 will receive wide use with the web-based running mode. The updated ZCURVE can be freely accessed from http://cefg.uestc.edu.cn/zcurve/ or http://tubic.tju.edu.cn/zcurveb/ without any restrictions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael
2017-07-01
The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Aging assessment of essential HVAC chillers used in nuclear power plants
International Nuclear Information System (INIS)
Blahnik, D.E.; Camp, T.W.
1996-09-01
The Pacific Northwest Laboratory conducted a comprehensive aging assessment of chillers used in the essential safety air-conditioning systems in nuclear power plants (NPPs). The chillers used, and air-conditioning systems served, vary in design from plant to plant. The review of operating experience indicated that chillers experience aging degradation and failures. The primary aging factors of concern for chillers include vibration, excessive temperatures and pressures, thermal cycling, chemical attack, and poor quality cooling water. The evaluation of Licensee Event Reports (LERs) indicated that about 38% of the failures were primarily related to aging, 55% were partially aging related, and 7% of the failures were unassignable. About 25% of the failures were primarily caused by human, design, procedure, and other errors. The large number of errors is probably directly related to the complexity of chillers and their interfacing systems. Nearly all of the LERs were the result of entering plant Technical Specification Limiting Condition for Operation (LCO) that initiated remedial actions like plant shutdown procedures. The trend for chiller-related LERs has stabilized at about 0.13 LERs per plant year since 1988. Carefully following the vendor procedures and monitoring the equipment can help to minimize and/or eliminate most of the premature failures. Recording equipment performance can be useful for trending analysis. Periodic operation for a few hours on a weekly or monthly basis is useful to remove moisture and non-condensable gases that gradually build up inside the chiller. Chiller pressurization kits are available that will help minimize the amount of moisture and air ingress to low-pressure chillers during standby periods. The assessment of service life condition monitoring of chillers indicated there are many simple to sophisticated methods available that can help in chiller surveillance and monitoring
Aging assessment of essential HVAC chillers used in nuclear power plants
Energy Technology Data Exchange (ETDEWEB)
Blahnik, D.E.; Camp, T.W.
1996-09-01
The Pacific Northwest Laboratory conducted a comprehensive aging assessment of chillers used in the essential safety air-conditioning systems in nuclear power plants (NPPs). The chillers used, and air-conditioning systems served, vary in design from plant to plant. The review of operating experience indicated that chillers experience aging degradation and failures. The primary aging factors of concern for chillers include vibration, excessive temperatures and pressures, thermal cycling, chemical attack, and poor quality cooling water. The evaluation of Licensee Event Reports (LERs) indicated that about 38% of the failures were primarily related to aging, 55% were partially aging related, and 7% of the failures were unassignable. About 25% of the failures were primarily caused by human, design, procedure, and other errors. The large number of errors is probably directly related to the complexity of chillers and their interfacing systems. Nearly all of the LERs were the result of entering plant Technical Specification Limiting Condition for Operation (LCO) that initiated remedial actions like plant shutdown procedures. The trend for chiller-related LERs has stabilized at about 0.13 LERs per plant year since 1988. Carefully following the vendor procedures and monitoring the equipment can help to minimize and/or eliminate most of the premature failures. Recording equipment performance can be useful for trending analysis. Periodic operation for a few hours on a weekly or monthly basis is useful to remove moisture and non-condensable gases that gradually build up inside the chiller. Chiller pressurization kits are available that will help minimize the amount of moisture and air ingress to low-pressure chillers during standby periods. The assessment of service life condition monitoring of chillers indicated there are many simple to sophisticated methods available that can help in chiller surveillance and monitoring.
The sieve element occlusion gene family in dicotyledonous plants.
Ernst, Antonia M; Rüping, Boris; Jekat, Stephan B; Nordzieke, Steffen; Reineke, Anna R; Müller, Boje; Bornberg-Bauer, Erich; Prüfer, Dirk; Noll, Gundula A
2011-01-01
Sieve element occlusion (SEO) genes encoding forisome subunits have been identified in Medicago truncatula and other legumes. Forisomes are structural phloem proteins uniquely found in Fabaceae sieve elements. They undergo a reversible conformational change after wounding, from a condensed to a dispersed state, thereby blocking sieve tube translocation and preventing the loss of photoassimilates. Recently, we identified SEO genes in several non-Fabaceae plants (lacking forisomes) and concluded that they most probably encode conventional non-forisome P-proteins. Molecular and phylogenetic analysis of the SEO gene family has identified domains that are characteristic for SEO proteins. Here, we extended our phylogenetic analysis by including additional SEO genes from several diverse species based on recently published genomic data. Our results strengthen the original assumption that SEO genes seem to be widespread in dicotyledonous angiosperms, and further underline the divergent evolution of SEO genes within the Fabaceae.
Directory of Open Access Journals (Sweden)
Srećko Jelenić
2003-01-01
Full Text Available Plant genetic engineering is a powerful tool for producing crops resistant to pests, diseases and abiotic stress or crops with improved nutritional value or better quality products. Currently over 70 genetically modified (GM crops have been approved for use in different countries. These cover a wide range of plant species with significant number of different modified traits. However, beside the technology used for their improvement, the common component of most GM crops is the neomycin phosphotransferase II gene (nptII, which confers resistance to the antibiotics kanamycin and neomycin. The nptII gene is present in GM crops as a marker gene to select transformed plant cells during the first steps of the transformation process. The use of antibiotic-resistance genes is subject to controversy and intense debate, because of the likelihood that clinical therapy could be compromised due to inactivation of the oral dose of the antibiotic from consumption of food derived from the transgenic plant, and because of the risk of gene transfer from plants to gut and soil microorganisms or to consumer’s cells. The present article discusses these possibilities in the light of current scientific knowledge.
Silencing of meiosis-critical genes for engineering male sterility in plants
Engineering sterile traits in plants through the tissue-specific expression of a cytotoxic gene provides an effective way for containing transgene flow; however, the microbial origin of cytotoxic genes has raised concerns. In an attempt to develop a safe alternative, we have chosen the meiosis-crit...
Liu, Ping-Li; Du, Liang; Huang, Yuan; Gao, Shu-Min; Yu, Meng
2017-01-01
Background Leucine-rich repeat receptor-like protein kinases (LRR-RLKs) are the largest group of receptor-like kinases in plants and play crucial roles in development and stress responses. The evolutionary relationships among LRR-RLK genes have been investigated in flowering plants; however, no comprehensive studies have been performed for these genes in more ancestral groups. The subfamily classification of LRR-RLK genes in plants, the evolutionary history and driving force for the evolution...
de Groot, Peter; Weterings, Koen; de Been, Mark; Wittink, Floyd; Hulzink, Raymond; Custers, Jan; van Herpen, Marinus; Wullems, George
2004-07-01
In seed plants, successful fertilization requires correct regulation of pollen tube growth. At germination and during growth, the pollen tube interacts with tissues from the pistil while the pollen tube extends via tip growth. Despite the fact that much research has been devoted to the mechanisms regulating pollen tube growth, many aspects are currently unknown. Previously, we have isolated a pollen-specific gene from tobacco--NTP303--that probably functions during pollen tube growth. NTP303 is part of a family of five members. Its expression is regulated both at the transcriptional and at the translational level. While NTP303 transcripts accumulate to high levels between early bi-cellular and mature pollen stages, NTP303 protein is hardly detectable until germination and pollen tube growth. In order to elucidate the role and function of NTP303 in the pollen tube, we studied the effect of NTP303 gene silencing on pollen function. Therefore, we have transformed tobacco plants with NTP303 co-suppression and anti-sense gene constructs. In these plants, the kanamycin resistance trait--which was linked to the NTP303-silencing gene--was not transmitted through the male gametophyte. This indicated that lowering the transcript level of NTP303 and/or its family members interferes with pollen function. Because we could not find a readily distinguishable phenotype in pollen from the hemizygous anti-sense and co-suppression plants, we rescued the defective pollen to produce doubled haploid plants that were homozygous for the NTP303 anti-sense gene. We found that in pollen from these plants the transcript levels of all NTP303 family members were reduced. Although pollen and pollen tubes from these plants appeared completely normal in vitro, the pollen tubes showed slower growth rates in vivo and arrested in the style before they reached the ovary, so that fertilization failed. These data demonstrate that NTP303 and its family members are essential for normal pollen tube growth
Davin, Nicolas; Edger, Patrick P; Hefer, Charles A; Mizrachi, Eshchar; Schuetz, Mathias; Smets, Erik; Myburg, Alexander A; Douglas, Carl J; Schranz, Michael E; Lens, Frederic
2016-06-01
Many plant genes are known to be involved in the development of cambium and wood, but how the expression and functional interaction of these genes determine the unique biology of wood remains largely unknown. We used the soc1ful loss of function mutant - the woodiest genotype known in the otherwise herbaceous model plant Arabidopsis - to investigate the expression and interactions of genes involved in secondary growth (wood formation). Detailed anatomical observations of the stem in combination with mRNA sequencing were used to assess transcriptome remodeling during xylogenesis in wild-type and woody soc1ful plants. To interpret the transcriptome changes, we constructed functional gene association networks of differentially expressed genes using the STRING database. This analysis revealed functionally enriched gene association hubs that are differentially expressed in herbaceous and woody tissues. In particular, we observed the differential expression of genes related to mechanical stress and jasmonate biosynthesis/signaling during wood formation in soc1ful plants that may be an effect of greater tension within woody tissues. Our results suggest that habit shifts from herbaceous to woody life forms observed in many angiosperm lineages could have evolved convergently by genetic changes that modulate the gene expression and interaction network, and thereby redeploy the conserved wood developmental program. © 2016 The Authors. The Plant Journal published by Society for Experimental Biology and John Wiley & Sons Ltd.
Zhu, Yu Cheng; Luttrell, Randall
2015-01-01
Chemical spray on cotton is almost an exclusive method for controlling tarnished plant bug (TPB), Lygus lineolaris. Frequent use of imidacloprid is a concern for neonicotinoid resistance in this key pest. Information of how and why TPB becomes less susceptible to imidacloprid is essential for effective monitoring and managing resistance. Microarray analysis of 6688 genes in imidacloprid-selected TPB (Im1500FF) revealed 955 upregulated and 1277 downregulated (≥twofold) genes in Im1500FF, with 369 and 485 of them annotated. Five P450 and nine esterase genes were significantly upregulated, and only one esterase gene and no P450 genes were downregulated. Other upregulated genes include helicases, phosphodiesterases, ATPases and kinases. Pathway analyses identified 65 upregulated cDNAs that encode 51 different enzymes involved in 62 different pathways, including P450 and esterase genes for drug and xenobiotic metabolisms. Sixty-four downregulated cDNAs code only 17 enzymes that are associated with only 23 pathways mostly related to food digestion. This study demonstrated a significant change in gene expression related to metabolic processes in imidacloprid-selected TPB, resulting in overexpression of P450 and esterase genes for potential excess detoxification and cross/multiple resistance development. The identification of these and other enzyme genes establishes a foundation to explore the complicity of potential imidacloprid resistance in TPB. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.
Construction and comparison of gene co-expression networks shows complex plant immune responses
Directory of Open Access Journals (Sweden)
Luis Guillermo Leal
2014-10-01
Full Text Available Gene co-expression networks (GCNs are graphic representations that depict the coordinated transcription of genes in response to certain stimuli. GCNs provide functional annotations of genes whose function is unknown and are further used in studies of translational functional genomics among species. In this work, a methodology for the reconstruction and comparison of GCNs is presented. This approach was applied using gene expression data that were obtained from immunity experiments in Arabidopsis thaliana, rice, soybean, tomato and cassava. After the evaluation of diverse similarity metrics for the GCN reconstruction, we recommended the mutual information coefficient measurement and a clustering coefficient-based method for similarity threshold selection. To compare GCNs, we proposed a multivariate approach based on the Principal Component Analysis (PCA. Branches of plant immunity that were exemplified by each experiment were analyzed in conjunction with the PCA results, suggesting both the robustness and the dynamic nature of the cellular responses. The dynamic of molecular plant responses produced networks with different characteristics that are differentiable using our methodology. The comparison of GCNs from plant pathosystems, showed that in response to similar pathogens plants could activate conserved signaling pathways. The results confirmed that the closeness of GCNs projected on the principal component space is an indicative of similarity among GCNs. This also can be used to understand global patterns of events triggered during plant immune responses.
A Caenorhabditis elegans RNA polymerase II gene, ama-1 IV, and nearby essential genes.
Rogalski, T M; Riddle, D L
1988-01-01
The amanitin-binding subunit of RNA polymerase II in Caenorhabditis elegans is encoded by the ama-1 gene, located approximately 0.05 map unit to the right of dpy-13 IV. Using the amanitin-resistant ama-1(m118) strain as a parent, we have isolated amanitin-sensitive mutants that carry recessive-lethal ama-1 alleles. Of the six ethyl methanesulfonate-induced mutants examined, two are arrested late in embryogenesis. One of these is a large deficiency, mDf9, but the second may be a novel point mutation. The four other mutants are hypomorphs, and presumably produce altered RNA polymerase II enzymes with some residual function. Two of these mutants develop into sterile adults at 20 degrees but are arrested as larvae at 25 degrees, and two others are fertile at 20 degrees and sterile at 25 degrees. Temperature-shift experiments performed with the adult sterile mutant, ama-1(m118m238ts), have revealed a temperature-sensitive period that begins late in gonadogenesis and is centered around the initiation of egg-laying. Postembryonic development at 25 degrees is slowed by 30%. By contrast, the amanitin-resistant allele of ama-1 has very little effect on developmental rate or fertility. We have identified 15 essential genes in an interval of 4.5 map units surrounding ama-1, as well as four gamma-ray-induced deficiencies and two duplications that include the ama-1 gene. The larger duplication, mDp1, may include the entire left arm of chromosome IV, and it recombines with the normal homologue at a low frequency. The smallest deficiency, mDf10, complements all but three identified genes: let-278, dpy-13 and ama-1, which define an interval of only 0.1 map unit. The terminal phenotype of mDf10 homozygotes is developmental arrest during the first larval stage, suggesting that there is sufficient maternal RNA polymerase II to complete embryonic development.
Directory of Open Access Journals (Sweden)
S.K. Ibrahim.
2006-12-01
Full Text Available The nematicidal activity of the essential oil/pure components and plant extracts of naturally grown aromatic plant species against hatching, migration and mortality of the root knot nematode Meloidogyne incognita was investigated. The pure components carvacrol, thymol, and linalool at 1, 2 and 4 mg liter-1 concentrations were the most toxic against M. incognita second-stage juveniles (J2s followed by terpineol and menthone. Hatching was completely inhibited at low concentrations (2, 4 mg liter-1 of carvacrol, thymol, and linalool. Clove extracts (1 mg liter-1 of Allium sativum significantly reduced hatching activity to below 8%, followed by flower extracts of Foeniculum vulgare which reduced hatching to below 25%. These extracts were also toxic against J2s of M. incognita (LC50 43 followed by leaf extracts of Pinus pinea, Origanum syriacum, Mentha microcorphylla, Eucalyptus spp. and Citrus sinensis with an estimated LC50 of 44, 50, 65, 66 and 121 ppm respectively. Flower extracts of F. vulgare had the highest effect on J2 mortality in sand (86%. The highest concentration of essential oils (6% was detected in leaf extracts of Origanium syriacum. Over 30 major components were identified in all the plant extracts tested.
Mukherjee, Dola; Mukherjee, Ashutosh; Ghosh, Tapash Chandra
2015-11-10
Primary metabolism is essential to plants for growth and development, and secondary metabolism helps plants to interact with the environment. Many plant metabolites are industrially important. These metabolites are produced by plants through complex metabolic pathways. Lack of knowledge about these pathways is hindering the successful breeding practices for these metabolites. For a better knowledge of the metabolism in plants as a whole, evolutionary rate variation of primary and secondary metabolic pathway genes is a prerequisite. In this study, evolutionary rate variation of primary and secondary metabolic pathway genes has been analyzed in the model plant Arabidopsis thaliana. Primary metabolic pathway genes were found to be more conserved than secondary metabolic pathway genes. Several factors such as gene structure, expression level, tissue specificity, multifunctionality, and domain number are the key factors behind this evolutionary rate variation. This study will help to better understand the evolutionary dynamics of plant metabolism. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Aging assessment of essential HVAC chillers used in nuclear power plants
International Nuclear Information System (INIS)
Blahnik, D.E.; Klein, R.F.
1993-09-01
The Pacific Northwest Laboratory conducted a Phase I aging assessment of chillers used in the essential safety air-conditioning systems of nuclear power plants. Centrifugal chillers in the 75- to 750-ton refrigeration capacity range are the predominant type used. The chillers used, and air-conditioning systems served, vary in design from plant-to-plant. It is crucial to keep chiller internals very clean and to prevent the leakage of water, air, and other contaminants into the refrigerant containment system. Periodic operation on a weekly or monthly basis is necessary to remove moisture and noncondensable gases that gradually build up inside the chiller. This is especially desirable if a chiller is required to operate only as an emergency standby unit. The primary stressors and aging mechanisms that affect chillers include vibration, excessive temperatures and pressures, thermal cycling, chemical attack, and poor quality cooling water. Aging is accelerated by moisture, non-condensable gases (e.g., air), dirt, and other contamination within the refrigerant containment system, excessive start/stop cycling, and operating below the rated capacity. Aging is also accelerated by corrosion and fouling of the condenser and evaporator tubes. The principal cause of chiller failures is lack of adequate monitoring. Lack of performing scheduled maintenance and human errors also contribute to failures
Verma, Jitendra Kumar; Wardhan, Vijay; Singh, Deepali; Chakraborty, Subhra; Chakraborty, Niranjan
2018-03-28
Architectural proteins play key roles in genome construction and regulate the expression of many genes, albeit the modulation of genome plasticity by these proteins is largely unknown. A critical screening of the architectural proteins in five crop species, viz., Oryza sativa , Zea mays , Sorghum bicolor , Cicer arietinum , and Vitis vinifera , and in the model plant Arabidopsis thaliana along with evolutionary relevant species such as Chlamydomonas reinhardtii , Physcomitrella patens , and Amborella trichopoda , revealed 9, 20, 10, 7, 7, 6, 1, 4, and 4 Alba (acetylation lowers binding affinity) genes, respectively. A phylogenetic analysis of the genes and of their counterparts in other plant species indicated evolutionary conservation and diversification. In each group, the structural components of the genes and motifs showed significant conservation. The chromosomal location of the Alba genes of rice ( OsAlba ), showed an unequal distribution on 8 of its 12 chromosomes. The expression profiles of the OsAlba genes indicated a distinct tissue-specific expression in the seedling, vegetative, and reproductive stages. The quantitative real-time PCR (qRT-PCR) analysis of the OsAlba genes confirmed their stress-inducible expression under multivariate environmental conditions and phytohormone treatments. The evaluation of the regulatory elements in 68 Alba genes from the 9 species studied led to the identification of conserved motifs and overlapping microRNA (miRNA) target sites, suggesting the conservation of their function in related proteins and a divergence in their biological roles across species. The 3D structure and the prediction of putative ligands and their binding sites for OsAlba proteins offered a key insight into the structure-function relationship. These results provide a comprehensive overview of the subtle genetic diversification of the OsAlba genes, which will help in elucidating their functional role in plants.
Using a periclinal chimera to unravel layer-specific gene expression in plants.
Filippis, Ioannis; Lopez-Cobollo, Rosa; Abbott, James; Butcher, Sarah; Bishop, Gerard J
2013-09-01
Plant organs are made from multiple cell types, and defining the expression level of a gene in any one cell or group of cells from a complex mixture is difficult. Dicotyledonous plants normally have three distinct layers of cells, L1, L2 and L3. Layer L1 is the single layer of cells making up the epidermis, layer L2 the single cell sub-epidermal layer and layer L3 constitutes the rest of the internal cells. Here we show how it is possible to harvest an organ and characterise the level of layer-specific expression by using a periclinal chimera that has its L1 layer from Solanum pennellii and its L2 and L3 layers from Solanum lycopersicum. This is possible by measuring the level of the frequency of species-specific transcripts. RNA-seq analysis enabled the genome-wide assessment of whether a gene is expressed in the L1 or L2/L3 layers. From 13 277 genes that are expressed in both the chimera and the parental lines and with at least one polymorphism between the parental alleles, we identified 382 genes that are preferentially expressed in L1 in contrast to 1159 genes in L2/L3. Gene ontology analysis shows that many genes preferentially expressed in L1 are involved in cutin and wax biosynthesis, whereas numerous genes that are preferentially expressed in L2/L3 tissue are associated with chloroplastic processes. These data indicate the use of such chimeras and provide detailed information on the level of layer-specific expression of genes. © 2013 East Malling Research The Plant Journal © 2013 John Wiley & Sons Ltd.
Elías, J M; Guerrero-Molina, M F; Martínez-Zamora, M G; Díaz-Ricci, J C; Pedraza, R O
2018-05-01
Induced systemic resistance (ISR) is one of the indirect mechanisms of growth promotion exerted by plant growth-promoting bacteria, and can be mediated by ethylene (ET). We assessed ET production and the expression of related genes in the Azospirillum-strawberry plant interaction. Ethylene production was evaluated by gas chromatography in plants inoculated or not with A. brasilense REC3. Also, plants were treated with AgNO 3 , an inhibitor of ET biosynthesis; with 1-aminocyclopropane-1-carboxylic acid (ACC), a precursor of ET biosynthesis; and with indole acetic acid (IAA). Plant dry biomass and the growth index were determined to assess the growth-promoting effect of A. brasilense REC3 in strawberry plants. Quantitative real time PCR (qRT-PCR) was performed to analyse relative expression of the genes Faetr1, Faers1 and Faein4, which encode ET receptors; Factr1 and Faein2, involved in the ET signalling pathway; Faacs1 encoding ACC synthase; Faaco1 encoding ACC oxidase; and Faaux1 and Faami1 for IAA synthesis enzymes. Results showed that ET acts as a rapid and transient signal in the first 12 h post-treatment. A. brasilense REC3-inoculated plants had a significantly higher growth index compared to control plants. Modulation of the genes Faetr1, Faers1, Faein4, Factr1, Faein2 and Faaco1 indicated activation of ET synthesis and signalling pathways. The up-regulation of Faaux1 and Faami1 involved in IAA synthesis suggested that inoculation with A. brasilense REC3 induces production of this auxin, modulating ET signalling. Ethylene production and up-regulation of genes associated with ET signalling in strawberry plants inoculated with A. brasilense REC3 support the priming activation characteristic of ISR. This type of resistance and the activation of systemic acquired resistance previously observed in this interaction indicate that both are present in strawberry plants, could act synergistically and increase protection against pathogens. © 2018 German Society
Cadmium resistance in tobacco plants expressing the MuSI gene
Kim, Young-Nam; Kim, Ji-Seoung; Seo, Sang-Gyu; Lee, Youngwoo; Baek, Seung-Woo; Kim, Il-Sup; Yoon, Ho-Sung; Kim, Kwon-Rae; Kim, Sun-Hyung; Kim, Kye-Hoon
2011-01-01
MuSI, a gene that corresponds to a domain that contains the rubber elongation factor (REF), is highly homologous to many stress-related proteins in plants. Since MuSI is up-regulated in the roots of plants treated with cadmium or copper, the involvement of MuSI in cadmium tolerance was investigated in this study. Escherichia coli cells overexpressing MuSI were more resistant to Cd than wild-type cells transfected with vector alone. MuSI transgenic plants were also more resistant to Cd. MuSI t...
Renkema, Justin M.; Wright, Derek; Buitenhuis, Rose; Hallett, Rebecca H.
2016-01-01
Spotted wing drosophila, Drosophila suzukii, is a globally invasive pest of soft-skinned fruit. Females oviposit into ripening fruit and larvae cause direct destruction of tissues. As many plant essential oils are permitted food additives, they may provide a safe means of protecting fruit from D. suzukii infestation in both conventional and organic production systems. Twelve oils and potassium metabisulfite (KMS) were screened in the laboratory as repellents for D. suzukii flies. Most essential oils deterred D. suzukii flies from cotton wicks containing attractive raspberry juice. Peppermint oil was particularly effective, preventing almost all flies from contacting treated wicks and remaining 100% repellent for 6 d post-application. Thyme oil was unique because it caused high male mortality and reduced the number of responding flies compared to other oils. KMS was not found to be repellent to D. suzukii, but may have fumigant properties, particularly at high concentrations. Peppermint oil appears to be the best candidate for field testing to determine the effectiveness and feasibility of using essential oils as part of a push-pull management strategy against D. suzukii. This is the first time that essential oils have been evaluated and proven effective in preventing fruit-infesting flies from contacting attractive stimuli. PMID:26893197
Zhao, Yanhong; Liao, Xiaofang; Huang, Zhipeng; Chen, Peng; Zhou, Bujin; Liu, Dongmei; Kong, Xiangjun; Zhou, Ruiyang
2015-08-01
Chimeric genes resulting from the rearrangement of a mitochondrial genome were generally thought to be a causal factor in the occurrence of cytoplasmic male sterility (CMS). In the study, earlier we reported that identifying a 47 bp deletion at 3'- flanking of atp9 that was linked to male sterile cytoplasm in kenaf. The truncated fragment was fused with atp9, a mitochondrial transit signal (MTS) and/or GFP, comprised two chimeric genes MTS-HM184-GFP and MTS-HM184. The plant expression vector pBI121 containing chimeric genes were then introduced to tobacco plants by Agrobacterium-mediated T-DNA transformation. The result showed that certain transgenic plants were male sterility or semi-sterility, while some were not. The expression analysis further demonstrated that higher level of expression were showed in the sterility plants, while no expression or less expression in fertility plants, the levels of expression of semi-sterility were in between. And the sterile plant (containing MTS-HM184-GFP) had abnormal anther produced malformed/shriveled pollen grains stained negative that failed to germinate (0%), the corresponding fruits was shrunken, the semi-sterile plants having normal anther shape produced about 10-50% normal pollen grains, the corresponding fruits were not full, and the germination rate was 58%. Meanwhile these transgenic plants which altered on fertility were further analyzed in phenotype. As a result, the metamorphosis leaves were observed in the seedling stage, the plant height of transgenic plants was shorter than wild type. The growth duration of transgenic tobacco was delayed 30-45 days compared to the wild type. The copy numbers of target genes of transgenic tobacco were analyzed using the real-time quantitative method. The results showed that these transgenic plants targeting-expression in mitochondrial containing MTS-HM184-GFP had 1 copy and 2 copies, the other two plants containing MTS-HM184 both had 3 copies, but 0 copy in wild type. In
Thioredoxin-2 (TRX-2) is an essential gene regulating mitochondria-dependent apoptosis.
Tanaka, Toru; Hosoi, Fumihito; Yamaguchi-Iwai, Yuko; Nakamura, Hajime; Masutani, Hiroshi; Ueda, Shugo; Nishiyama, Akira; Takeda, Shunichi; Wada, Hiromi; Spyrou, Giannis; Yodoi, Junji
2002-04-02
Thioredoxin-2 (Trx-2) is a mitochondria-specific member of the thioredoxin superfamily. Mitochondria have a crucial role in the signal transduction for apoptosis. To investigate the biological significance of Trx-2, we cloned chicken TRX-2 cDNA and generated clones of the conditional Trx-2-deficient cells using chicken B-cell line, DT40. Here we show that TRX-2 is an essential gene and that Trx-2-deficient cells undergo apoptosis upon repression of the TRX-2 transgene, showing an accumulation of intracellular reactive oxygen species (ROS). Cytochrome c is released from mitochondria, while caspase-9 and caspase-3, but not caspase-8, are activated upon inhibition of the TRX-2 transgene. In addition, Trx-2 and cytochrome c are co-immunoprecipitated in an in vitro assay. These results suggest that mitochondrial Trx-2 is essential for cell viability, playing a crucial role in the scavenging ROS in mitochondria and regulating the mitochondrial apoptosis signaling pathway.
Foureau, E; Carqueijeiro, I; Dugé de Bernonville, T; Melin, C; Lafontaine, F; Besseau, S; Lanoue, A; Papon, N; Oudin, A; Glévarec, G; Clastre, M; St-Pierre, B; Giglioli-Guivarc'h, N; Courdavault, V
2016-01-01
Natural compounds extracted from microorganisms or plants constitute an inexhaustible source of valuable molecules whose supply can be potentially challenged by limitations in biological sourcing. The recent progress in synthetic biology combined to the increasing access to extensive transcriptomics and genomics data now provide new alternatives to produce these molecules by transferring their whole biosynthetic pathway in heterologous production platforms such as yeasts or bacteria. While the generation of high titer producing strains remains per se an arduous field of investigation, elucidation of the biosynthetic pathways as well as characterization of their complex subcellular organization are essential prequels to the efficient development of such bioengineering approaches. Using examples from plants and yeasts as a framework, we describe potent methods to rationalize the study of partially characterized pathways, including the basics of computational applications to identify candidate genes in transcriptomics data and the validation of their function by an improved procedure of virus-induced gene silencing mediated by direct DNA transfer to get around possible resistance to Agrobacterium-delivery of viral vectors. To identify potential alterations of biosynthetic fluxes resulting from enzyme mislocalizations in reconstituted pathways, we also detail protocols aiming at characterizing subcellular localizations of protein in plant cells by expression of fluorescent protein fusions through biolistic-mediated transient transformation, and localization of transferred enzymes in yeast using similar fluorescence procedures. Albeit initially developed for the Madagascar periwinkle, these methods may be applied to other plant species or organisms in order to establish synthetic biology platform. © 2016 Elsevier Inc. All rights reserved.
Herman, Anna
2014-09-01
The aim of the study was to compare the preservative effectiveness of plant extracts (Matricaria chamomilla, Aloe vera, Calendula officinalis) and essential oils (Lavandulla officinalis, Melaleuca alternifolia, Cinnamomum zeylanicum) with methylparaben in cosmetic emulsions against skin microflora during 2 months of application by volunteers. Cosmetic emulsions with extracts (2.5 %), essential oils (2.5 %), methylparaben (0.4 %) or placebo were tested by 40 volunteers during 2 months of treatment. In order to determine microbial purity of the emulsions, the samples were taken after 0, 2, 4, 6 and 8 weeks of application. Throughout the trial period it was revealed that only cinnamon oil completely inhibited the growth of bacteria, yeast and mould, as compared to all other essential oils, plant extracts and methylparaben in the tested emulsions. This result shows that cinnamon oil could successfully replace the use of methylparaben in cosmetics, at the same time ensuring microbiological purity of a cosmetic product under its in-use and storage conditions.
Trace elements and essential oil composition in chemotypes of the aromatic plant Origanum vulgare
International Nuclear Information System (INIS)
Kanias, G.D.
1998-01-01
Trace elements, essential oil yield and its percentage composition were determined by neutron activation analysis, hydrodistillation and gas chromatography in two chemotypes of Origanum vulgare L. cultivated in the same field. Statistical tests such as analysis of variance, correlation coefficient, t-test, and multiple correlation were applied. The results showed that the samples contain the highest recorded oil yield for aromatic plants. Also, there is a statistically significant difference between the chemotypes of the plant not only in the predominant compound but in a number of other components. Iron, chromium and scandium showed a negative significant correlation with carvacrol and a positive one with thymol. Europium shows characteristic correlations with chromium, cobalt, iron and scandium within each chemotype of the plant. These correlations could make probable a role of this element in the biosynthesis of the predominant compounds. (author)
Plant surface cues prime Ustilago maydis for biotrophic development.
Directory of Open Access Journals (Sweden)
Daniel Lanver
2014-07-01
Full Text Available Infection-related development of phytopathogenic fungi is initiated by sensing and responding to plant surface cues. This response can result in the formation of specialized infection structures, so-called appressoria. To unravel the program inducing filaments and appressoria in the biotrophic smut fungus Ustilago maydis, we exposed cells to a hydrophobic surface and the cutin monomer 16-hydroxy hexadecanoic acid. Genome-wide transcriptional profiling at the pre-penetration stage documented dramatic transcriptional changes in almost 20% of the genes. Comparisons with the U. maydis sho1 msb2 double mutant, lacking two putative sensors for plant surface cues, revealed that these plasma membrane receptors regulate a small subset of the surface cue-induced genes comprising mainly secreted proteins including potential plant cell wall degrading enzymes. Targeted gene deletion analysis ascribed a role to up-regulated GH51 and GH62 arabinofuranosidases during plant penetration. Among the sho1/msb2-dependently expressed genes were several secreted effectors that are essential for virulence. Our data also demonstrate specific effects on two transcription factors that redirect the transcriptional regulatory network towards appressorium formation and plant penetration. This shows that plant surface cues prime U. maydis for biotrophic development.
Advances in plant gene-targeted and functional markers: a review
Directory of Open Access Journals (Sweden)
Poczai Péter
2013-02-01
Full Text Available Abstract Public genomic databases have provided new directions for molecular marker development and initiated a shift in the types of PCR-based techniques commonly used in plant science. Alongside commonly used arbitrarily amplified DNA markers, other methods have been developed. Targeted fingerprinting marker techniques are based on the well-established practices of arbitrarily amplified DNA methods, but employ novel methodological innovations such as the incorporation of gene or promoter elements in the primers. These markers provide good reproducibility and increased resolution by the concurrent incidence of dominant and co-dominant bands. Despite their promising features, these semi-random markers suffer from possible problems of collision and non-homology analogous to those found with randomly generated fingerprints. Transposable elements, present in abundance in plant genomes, may also be used to generate fingerprints. These markers provide increased genomic coverage by utilizing specific targeted sites and produce bands that mostly seem to be homologous. The biggest drawback with most of these techniques is that prior genomic information about retrotransposons is needed for primer design, prohibiting universal applications. Another class of recently developed methods exploits length polymorphism present in arrays of multi-copy gene families such as cytochrome P450 and β-tubulin genes to provide cross-species amplification and transferability. A specific class of marker makes use of common features of plant resistance genes to generate bands linked to a given phenotype, or to reveal genetic diversity. Conserved DNA-based strategies have limited genome coverage and may fail to reveal genetic diversity, while resistance genes may be under specific evolutionary selection. Markers may also be generated from functional and/or transcribed regions of the genome using different gene-targeting approaches coupled with the use of RNA information
Advances in plant gene-targeted and functional markers: a review
2013-01-01
Public genomic databases have provided new directions for molecular marker development and initiated a shift in the types of PCR-based techniques commonly used in plant science. Alongside commonly used arbitrarily amplified DNA markers, other methods have been developed. Targeted fingerprinting marker techniques are based on the well-established practices of arbitrarily amplified DNA methods, but employ novel methodological innovations such as the incorporation of gene or promoter elements in the primers. These markers provide good reproducibility and increased resolution by the concurrent incidence of dominant and co-dominant bands. Despite their promising features, these semi-random markers suffer from possible problems of collision and non-homology analogous to those found with randomly generated fingerprints. Transposable elements, present in abundance in plant genomes, may also be used to generate fingerprints. These markers provide increased genomic coverage by utilizing specific targeted sites and produce bands that mostly seem to be homologous. The biggest drawback with most of these techniques is that prior genomic information about retrotransposons is needed for primer design, prohibiting universal applications. Another class of recently developed methods exploits length polymorphism present in arrays of multi-copy gene families such as cytochrome P450 and β-tubulin genes to provide cross-species amplification and transferability. A specific class of marker makes use of common features of plant resistance genes to generate bands linked to a given phenotype, or to reveal genetic diversity. Conserved DNA-based strategies have limited genome coverage and may fail to reveal genetic diversity, while resistance genes may be under specific evolutionary selection. Markers may also be generated from functional and/or transcribed regions of the genome using different gene-targeting approaches coupled with the use of RNA information. Such techniques have the
DEFF Research Database (Denmark)
Kautsar, Satria A.; Suarez Duran, Hernando G.; Blin, Kai
2017-01-01
exploration of the nature and dynamics of gene clustering in plant metabolism. Moreover, spurred by the continuing decrease in costs of plant genome sequencing, they will allow genome mining technologies to be applied to plant natural product discovery. The plantiSMASH web server, precalculated results...
Molecular genetic analysis of a vaccinia virus gene with an essential role in DNA replication
International Nuclear Information System (INIS)
Evans, E.V.A.
1989-01-01
The poxvirus, vaccinia, is large DNA virus which replicates in the cytoplasma of the host cell. The virus is believed to encode most or all of the functions required for the temporally regulated transcription and replication of its 186 kilobase genome. Physical and genetic autonomy from the host make vaccinia a useful eukaryotic organism in which to study replication genes and proteins, using a combination of biochemical and genetic techniques. Essential viral functions for replication are identified by conditional lethal mutants that fail to synthesize DNA at the non-permissive temperatures. One such group contains the non-complementing alleles ts17, ts24, ts69 (WR strain). Studies were undertaken to define the phenotype of ts mutants, and to identify and characterize the affected gene and protein. Mutant infection was essentially normal at 32 degree C, but at 39 degree C the mutants did not incorporate 3 H-thymidine into nascent viral DNA or synthesize late viral proteins. If mutant cultures were shifted to non-permissive conditions at the height of replication, DNA synthesis was halted rapidly, implying that the mutants are defective in DNA elongation. The gene affected in the WR mutants and in ts6389, a DNA-minus mutant of the IHD strain, was mapped by marker rescue and corresponds to open reading frame 5 (orfD5) of the viral HindIII D fragment
Modified application of HS-SPME for quality evaluation of essential oil plant materials.
Dawidowicz, Andrzej L; Szewczyk, Joanna; Dybowski, Michal P
2016-01-01
The main limitation in the standard application of head space analysis employing solid phase microextraction (HS-SPME) for the evaluation of plants as sources of essential oils (EOs) are different quantitative relations of EO components from those obtained by direct analysis of EO which was got in the steam distillation (SD) process from the same plant (EO/SD). The results presented in the paper for thyme, mint, sage, basil, savory, and marjoram prove that the quantitative relations of EO components established by HS-SPME procedure and direct analysis of EO/SD are similar when the plant material in the HS-SPME process is replaced by its suspension in oil of the same physicochemical character as that of SPME fiber coating. The observed differences in the thyme EO composition estimated by both procedures are insignificant (F(exp)
Thakur, Nidhi; Upadhyay, Santosh Kumar; Verma, Praveen C; Chandrashekar, Krishnappa; Tuli, Rakesh; Singh, Pradhyumna K
2014-01-01
Expression of double strand RNA (dsRNA) designed against important insect genes in transgenic plants have been shown to give protection against pests through RNA interference (RNAi), thus opening the way for a new generation of insect-resistant crops. We have earlier compared the efficacy of dsRNAs/siRNAs, against a number of target genes, for interference in growth of whitefly (Bemisia tabaci) upon oral feeding. The v-ATPase subunit A (v-ATPaseA) coding gene was identified as a crucial target. We now report the effectiveness of transgenic tobacco plants expressing siRNA to silence v-ATPaseA gene expression for the control of whitefly infestation. Transgenic tobacco lines were developed for the expression of long dsRNA precursor to make siRNA and knock down the v-ATPaseA mRNA in whitefly. Molecular analysis and insecticidal properties of the transgenic plants established the formation of siRNA targeting the whitefly v-ATPaseA, in the leaves. The transcript level of v-ATPaseA in whiteflies was reduced up to 62% after feeding on the transgenic plants. Heavy infestation of whiteflies on the control plants caused significant loss of sugar content which led to the drooping of leaves. The transgenic plants did not show drooping effect. Host plant derived pest resistance was achieved against whiteflies by genetic transformation of tobacco which generated siRNA against the whitefly v-ATPaseA gene. Transgenic tobacco lines expressing dsRNA of v-ATPaseA, delivered sufficient siRNA to whiteflies feeding on them, mounting a significant silencing response, leading to their mortality. The transcript level of the target gene was reduced in whiteflies feeding on transgenic plants. The strategy can be taken up for genetic engineering of plants to control whiteflies in field crops.
Directory of Open Access Journals (Sweden)
Nidhi Thakur
Full Text Available BACKGROUND: Expression of double strand RNA (dsRNA designed against important insect genes in transgenic plants have been shown to give protection against pests through RNA interference (RNAi, thus opening the way for a new generation of insect-resistant crops. We have earlier compared the efficacy of dsRNAs/siRNAs, against a number of target genes, for interference in growth of whitefly (Bemisia tabaci upon oral feeding. The v-ATPase subunit A (v-ATPaseA coding gene was identified as a crucial target. We now report the effectiveness of transgenic tobacco plants expressing siRNA to silence v-ATPaseA gene expression for the control of whitefly infestation. METHODOLOGY/PRINCIPAL FINDINGS: Transgenic tobacco lines were developed for the expression of long dsRNA precursor to make siRNA and knock down the v-ATPaseA mRNA in whitefly. Molecular analysis and insecticidal properties of the transgenic plants established the formation of siRNA targeting the whitefly v-ATPaseA, in the leaves. The transcript level of v-ATPaseA in whiteflies was reduced up to 62% after feeding on the transgenic plants. Heavy infestation of whiteflies on the control plants caused significant loss of sugar content which led to the drooping of leaves. The transgenic plants did not show drooping effect. CONCLUSIONS/SIGNIFICANCE: Host plant derived pest resistance was achieved against whiteflies by genetic transformation of tobacco which generated siRNA against the whitefly v-ATPaseA gene. Transgenic tobacco lines expressing dsRNA of v-ATPaseA, delivered sufficient siRNA to whiteflies feeding on them, mounting a significant silencing response, leading to their mortality. The transcript level of the target gene was reduced in whiteflies feeding on transgenic plants. The strategy can be taken up for genetic engineering of plants to control whiteflies in field crops.
Kovi, Mallikarjuna Rao; Zhang, Yushan; Yu, Sibin; Yang, Gaiyu; Yan, Wenhao; Xing, Yongzhong
2011-09-01
Appropriate plant height is crucial for lodging resistance to improve the rice crop yield. The application of semi-dwarf 1 led to the green revolution in the 1960s, by predominantly increasing the rice yield. However, the frequent use of single sd1 gene sources may cause genetic vulnerability to pests and diseases. Identifying useful novel semi-dwarf genes is important for the genetic manipulation of plant architecture in practical rice breeding. In this study, introgression lines derived from two parents contrasting in plant height, Zhenshan 97 and Pokkali were employed to locate a gene with a large effect on plant height by the bulk segregant analysis method. A major gene, ph1, was mapped to a region closely linked to sd1 on chromosome 1; the additive effects of ph1 were more than 50 cm on the plant height and 2 days on the heading date in a BC(4)F(2) population and its progeny. ph1 was then fine mapped to BAC AP003227. Gene annotation indicated that LOC_OS01g65990 encoding a chitin-inducible gibberellin-responsive protein (CIGR), which belongs to the GRAS family, might be the right candidate gene of ph1. Co-segregation analysis of the candidate gene-derived marker finally confirmed its identity as the candidate gene. A higher expression level of the CIGR was detected in all the tested tissues in tall plants compared to those of short plants, especially in the young leaf sheath containing elongating tissues, which indicated its importance role in regulating plant height. ph1 showed a tremendous genetic effect on plant height, which is distinct from sd1 and could be a new resource for breeding semi-dwarf varieties.
Song, Xiaoming; Duan, Weike; Huang, Zhinan; Liu, Gaofeng; Wu, Peng; Liu, Tongkun; Li, Ying; Hou, Xilin
2015-09-01
In plants, flowering is the most important transition from vegetative to reproductive growth. The flowering patterns of monocots and eudicots are distinctly different, but few studies have described the evolutionary patterns of the flowering genes in them. In this study, we analysed the evolutionary pattern, duplication and expression level of these genes. The main results were as follows: (i) characterization of flowering genes in monocots and eudicots, including the identification of family-specific, orthologous and collinear genes; (ii) full characterization of CONSTANS-like genes in Brassica rapa (BraCOL genes), the key flowering genes; (iii) exploration of the evolution of COL genes in plant kingdom and construction of the evolutionary pattern of COL genes; (iv) comparative analysis of CO and FT genes between Brassicaceae and Grass, which identified several family-specific amino acids, and revealed that CO and FT protein structures were similar in B. rapa and Arabidopsis but different in rice; and (v) expression analysis of photoperiod pathway-related genes in B. rapa under different photoperiod treatments by RT-qPCR. This analysis will provide resources for understanding the flowering mechanisms and evolutionary pattern of COL genes. In addition, this genome-wide comparative study of COL genes may also provide clues for evolution of other flowering genes.
Is the plant-associated microbiota of Thymus spp. adapted to plant essential oil?
Checcucci, Alice; Maida, Isabel; Bacci, Giovanni; Ninno, Cristina; Bilia, Anna Rita; Biffi, Sauro; Firenzuoli, Fabio; Flamini, Guido; Fani, Renato; Mengoni, Alessio
2017-04-01
We examined whether the microbiota of two related aromatic thyme species, Thymus vulgaris and Thymus citriodorus, differs in relation to the composition of the respective essential oil (EO). A total of 576 bacterial isolates were obtained from three districts (leaves, roots and rhizospheric soil). They were taxonomically characterized and inspected for tolerance to the EO from the two thyme species. A district-related taxonomic pattern was found. In particular, high taxonomic diversity among the isolates from leaves was detected. Moreover, data obtained revealed a differential pattern of resistance of the isolates to EOs extracted from T. vulgaris and T. citriodorus, which was interpreted in terms of differing chemical composition of the EO of their respective host plants. In conclusion, we suggest that bacterial colonization of leaves in Thymus spp. is influenced by the EO present in leaf glandular tissue as one of the selective forces shaping endophytic community composition. Copyright © 2016 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
Structural evolution of the 4/1 genes and proteins in non-vascular and lower vascular plants.
Morozov, Sergey Y; Milyutina, Irina A; Bobrova, Vera K; Ryazantsev, Dmitry Y; Erokhina, Tatiana N; Zavriev, Sergey K; Agranovsky, Alexey A; Solovyev, Andrey G; Troitsky, Alexey V
2015-12-01
The 4/1 protein of unknown function is encoded by a single-copy gene in most higher plants. The 4/1 protein of Nicotiana tabacum (Nt-4/1 protein) has been shown to be alpha-helical and predominantly expressed in conductive tissues. Here, we report the analysis of 4/1 genes and the encoded proteins of lower land plants. Sequences of a number of 4/1 genes from liverworts, lycophytes, ferns and gymnosperms were determined and analyzed together with sequences available in databases. Most of the vascular plants were found to encode Magnoliophyta-like 4/1 proteins exhibiting previously described gene structure and protein properties. Identification of the 4/1-like proteins in hornworts, liverworts and charophyte algae (sister lineage to all land plants) but not in mosses suggests that 4/1 proteins are likely important for plant development but not required for a primary metabolic function of plant cell. Copyright © 2015 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
Less is more: strategies to remove marker genes from transgenic plants
2013-01-01
Selectable marker genes (SMGs) and selection agents are useful tools in the production of transgenic plants by selecting transformed cells from a matrix consisting of mostly untransformed cells. Most SMGs express protein products that confer antibiotic- or herbicide resistance traits, and typically reside in the end product of genetically-modified (GM) plants. The presence of these genes in GM plants, and subsequently in food, feed and the environment, are of concern and subject to special government regulation in many countries. The presence of SMGs in GM plants might also, in some cases, result in a metabolic burden for the host plants. Their use also prevents the re-use of the same SMG when a second transformation scheme is needed to be performed on the transgenic host. In recent years, several strategies have been developed to remove SMGs from GM products while retaining the transgenes of interest. This review describes the existing strategies for SMG removal, including the implementation of site specific recombination systems, TALENs and ZFNs. This review discusses the advantages and disadvantages of existing SMG-removal strategies and explores possible future research directions for SMG removal including emerging technologies for increased precision for genome modification. PMID:23617583
Less is more: strategies to remove marker genes from transgenic plants.
Yau, Yuan-Yeu; Stewart, C Neal
2013-04-23
Selectable marker genes (SMGs) and selection agents are useful tools in the production of transgenic plants by selecting transformed cells from a matrix consisting of mostly untransformed cells. Most SMGs express protein products that confer antibiotic- or herbicide resistance traits, and typically reside in the end product of genetically-modified (GM) plants. The presence of these genes in GM plants, and subsequently in food, feed and the environment, are of concern and subject to special government regulation in many countries. The presence of SMGs in GM plants might also, in some cases, result in a metabolic burden for the host plants. Their use also prevents the re-use of the same SMG when a second transformation scheme is needed to be performed on the transgenic host. In recent years, several strategies have been developed to remove SMGs from GM products while retaining the transgenes of interest. This review describes the existing strategies for SMG removal, including the implementation of site specific recombination systems, TALENs and ZFNs. This review discusses the advantages and disadvantages of existing SMG-removal strategies and explores possible future research directions for SMG removal including emerging technologies for increased precision for genome modification.
Abbaszadegan, Abbas; Sahebi, Safoora; Gholami, Ahmad; Delroba, Alireza; Kiani, Amin; Iraji, Aida; Abbott, Paul Vincent
2016-02-01
In the present in vitro study, we investigated the time-related antimicrobial efficacy of Aloe vera and Zataria multiflora (Z. multiflora) plant essential oils compared to calcium hydroxide ([Ca[OH]2 ) to eliminate Enterococcus faecalis (E. faecalis) from root canals. A new strain of E. faecalis (Enterococcus spp. AGH04) was isolated from a previously root-filled tooth with persistent apical periodontitis. The 16S rRNA sequence was analyzed and deposited in GeneBank under accession number KF465681. A total of 108 extracted human single-rooted teeth were contaminated with this bacterial strain and treated with Aloe vera essential oil, Z. multiflora essential oil, and Ca(OH)2 for 1, 7, and 14 days. Gas chromatography-mass spectrometry (GC-MS) was used to determine the chemical composition of the oils. The percentage reduction from initial c.f.u./mL counts were calculated and analyzed. Carvacrol, thymol, and linalool were the main constituents of both essential oils. The c.f.u./mL count reductions significantly increased for all three medicaments when the contact time was extended. A statistically-significant difference was observed between the medicaments after 1 and 7 days, but there was no significant difference after 14 days. Both medicinal herbs showed equal antimicrobial efficiency against E. faecalis, comparable to Ca(OH)2 for the prolonged contact time of 14 days. © 2014 Wiley Publishing Asia Pty Ltd.
Directory of Open Access Journals (Sweden)
Farukh Sharopov
2015-11-01
Full Text Available Antimicrobial, antioxidant, and anti-inflammatory activities of the essential oils of 18 plant species from Tajikistan (Central Asia were investigated. The essential oil of Origanum tyttanthum showed a strong antibacterial activity with both minimum inhibitory concentration (MIC and minimum bactericidal concentration (MBC values of 312.5 µg/mL for E. coli, 625 µg/mL (MIC and 1250 µg/mL (MBC for MRSA (methicillin-resistant Staphylococcus aureus, respectively. The essential oil of Galagania fragrantissima was highly active against MRSA at concentrations as low as 39.1 µg/mL and 78.2 µg/mL for MIC and MBC, respectively. Origanum tyttanthum essential oil showed the highest antioxidant activity with IC50 values of 0.12 mg/mL for ABTS (2,2′-azino-bis-(3-ethylbenzthiazoline-6-sulfonic acid and 0.28 mg/mL for DPPH (2,2-diphenyl-1-picrylhydrazyl. Galagania fragrantissima and Origanum tyttanthum essential oils showed the highest anti-inflammatory activity; IC50 values of 5-lipoxygenase (5-LOX inhibition were 7.34 and 14.78 µg/mL, respectively. In conclusion, essential oils of Origanum tyttanthum and Galagania fragrantissima exhibit substantial antimicrobial, antioxidant, and anti-inflammatory activities. They are interesting candidates in phytotherapy.
Sharopov, Farukh; Braun, Markus Santhosh; Gulmurodov, Isomiddin; Khalifaev, Davlat; Isupov, Salomiddin; Wink, Michael
2015-11-02
Antimicrobial, antioxidant, and anti-inflammatory activities of the essential oils of 18 plant species from Tajikistan (Central Asia) were investigated. The essential oil of Origanum tyttanthum showed a strong antibacterial activity with both minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) values of 312.5 µg/mL for E. coli , 625 µg/mL (MIC) and 1250 µg/mL (MBC) for MRSA (methicillin-resistant Staphylococcus aureus), respectively. The essential oil of Galagania fragrantissima was highly active against MRSA at concentrations as low as 39.1 µg/mL and 78.2 µg/mL for MIC and MBC, respectively. Origanum tyttanthum essential oil showed the highest antioxidant activity with IC 50 values of 0.12 mg/mL for ABTS (2,2'-azino-bis-(3-ethylbenzthiazoline-6-sulfonic acid)) and 0.28 mg/mL for DPPH (2,2-diphenyl-1-picrylhydrazyl) . Galagania fragrantissima and Origanum tyttanthum essential oils showed the highest anti-inflammatory activity; IC 50 values of 5-lipoxygenase (5-LOX) inhibition were 7.34 and 14.78 µg/mL, respectively. In conclusion, essential oils of Origanum tyttanthum and Galagania fragrantissima exhibit substantial antimicrobial, antioxidant, and anti-inflammatory activities. They are interesting candidates in phytotherapy.
Essential oil composition of some plants of family zygophyllaceae and euphorbiaceae
International Nuclear Information System (INIS)
Dastagir, G.
2014-01-01
Our objectives were to find out the chemical constituents of some selected plants of family Zygophyllaceae and Euphorbiaceae collected from Peshawar and Attock Hills during 2009, by GC/MS. The oil obtained from three analysed plants of family Zygophyllaceae showed that oxygenated monoterpenes were the highest (90.99%) in Tribulus terrestris, followed by Fagonia cretica (89.94%) and the lowest (36.01%) found in Peganum harmala. Peganum harmala had maximum esters (11.58%) followed by Tribulus terrestris (5.8%) and Fagonia cretica (5.5%). Monoterpenes hydrocarbons were the highest (1.22%) in Fagonia cretica followed by Peganum harmala and absent in Tribulus terrestris. Sesquiterpenes hydrocarbons were maximum (11.01%) in Peganum harmala and absent in Tribulus terrestris. The analysis of essential oils revealed that Fagonia cretica oils had 17 compounds that constituted 100% of the oil composition. Oxygenated monoterpenes (89.94%), were a major group of compounds. Peganum harmala oil had 18 compounds. There were 10 compounds in Tribulus terrestris oil that consisted 100% of the total oil composition. Eight compounds were identified in Chrozophora tinctoria oils giving complete oil composition. It had oxygenated monoterpenes (86.93%), constituting 2(4H) - Benzofuranone, 5, 6, 7, 7a tetrahydro-4, 4, 7a-trimethy (50.718%). Ricinus communis . oil had 8 compounds with 100% of the oil composition. The present study exhibited that phytochemical attributes and chemical composition of the studied plants have potential uses for food, pharmaceutical and cosmetic industry in future. Detailed research work on the antioxidant principles and biological activities of the studied plants is further recommended. (author)
The Roles of Mitochondrion in Intergenomic Gene Transfer in Plants: A Source and a Pool
Directory of Open Access Journals (Sweden)
Nan Zhao
2018-02-01
Full Text Available Intergenomic gene transfer (IGT is continuous in the evolutionary history of plants. In this field, most studies concentrate on a few related species. Here, we look at IGT from a broader evolutionary perspective, using 24 plants. We discover many IGT events by assessing the data from nuclear, mitochondrial and chloroplast genomes. Thus, we summarize the two roles of the mitochondrion: a source and a pool. That is, the mitochondrion gives massive sequences and integrates nuclear transposons and chloroplast tRNA genes. Though the directions are opposite, lots of likenesses emerge. First, mitochondrial gene transfer is pervasive in all 24 plants. Second, gene transfer is a single event of certain shared ancestors during evolutionary divergence. Third, sequence features of homologies vary for different purposes in the donor and recipient genomes. Finally, small repeats (or micro-homologies contribute to gene transfer by mediating recombination in the recipient genome.
Directory of Open Access Journals (Sweden)
Min Liao
Full Text Available The cereal weevil, Sitophilus zeamais is one of the most destructive pests of stored cereals worldwide. Frequent use of fumigants for managing stored-product insects has led to the development of resistance in insects. Essential oils from aromatic plants including the tea oil plant, Melaleuca alternifolia may provide environmentally friendly alternatives to currently used pest control agents. However, little is known about molecular events involved in stored-product insects in response to plant essential oil fumigation.M. alternifolia essential oil was shown to possess the fumigant toxicity against S. zeamais. The constituent, terpinen-4-ol was the most effective compound for fumigant toxicity. M. alternifolia essential oil significantly inhibited the activity of three enzymes in S. zeamais, including two detoxifying enzymes, glutathione S-transferase (GST, and carboxylesterase (CarE, as well as a nerve conduction enzyme, acetylcholinesterase (AChE. Comparative transcriptome analysis of S. zeamais through RNA-Seq identified a total of 3,562 differentially expressed genes (DEGs, of which 2,836 and 726 were up-regulated and down-regulated in response to M. alternifolia essential oil fumigation, respectively. Based on gene ontology (GO analysis, the majority of DEGs were involved in insecticide detoxification and mitochondrial function. Furthermore, an abundance of DEGs mapped into the metabolism pathway in the Kyoto Encyclopedia of Genes and Genomes (KEGG pathway database were associated with respiration and metabolism of xenobiotics, including cytochrome P450s, CarEs, GSTs, and ATP-binding cassette transporters (ABC transporters. Some DEGs mapped into the proteasome and phagosome pathway were found to be significantly enriched. These results led us to propose a model of insecticide action that M. alternifolia essential oil likely directly affects the hydrogen carrier to block the electron flow and interfere energy synthesis in mitochondrial
Evolutionary Trails of Plant Group II Pyridoxal Phosphate-Dependent Decarboxylase Genes.
Kumar, Rahul
2016-01-01
Type II pyridoxal phosphate-dependent decarboxylase (PLP_deC) enzymes play important metabolic roles during nitrogen metabolism. Recent evolutionary profiling of these genes revealed a sharp expansion of histidine decarboxylase genes in the members of Solanaceae family. In spite of the high sequence homology shared by PLP_deC orthologs, these enzymes display remarkable differences in their substrate specificities. Currently, limited information is available on the gene repertoires and substrate specificities of PLP_deCs which renders their precise annotation challenging and offers technical challenges in the immediate identification and biochemical characterization of their full gene complements in plants. Herein, we explored their evolutionary trails in a comprehensive manner by taking advantage of high-throughput data accessibility and computational approaches. We discussed the premise that has enabled an improved reconstruction of their evolutionary lineage and evaluated the factors offering constraints in their rapid functional characterization, till date. We envisage that the synthesized information herein would act as a catalyst for the rapid exploration of their biochemical specificity and physiological roles in more plant species.
Silva, Nuno; Alves, Sofia; Gonçalves, Alexandre; Amaral, Joana S; Poeta, Patrícia
2013-12-01
The antimicrobial activity of essential oils extracted from a variety of aromatic plants, often used in the Portuguese gastronomy was studied in vitro by the agar diffusion method. The essential oils of thyme, oregano, rosemary, verbena, basil, peppermint, pennyroyal and mint were tested against Gram-positive (Listeria monocytogenes, Clostridium perfringens, Bacillus cereus, Staphylococcus aureus, Enterococcus faecium, Enterococcus faecalis, and Staphylococcus epidermidis) and Gram-negative strains (Salmonella enterica, Escherichia coli, and Pseudomonas aeruginosa). For most essential oils examined, S. aureus, was the most susceptible bacteria, while P. aeruginosa showed, in general, least susceptibility. Among the eight essential oils evaluated, thyme, oregano and pennyroyal oils showed the greatest antimicrobial activity, followed by rosemary, peppermint and verbena, while basil and mint showed the weakest antimicrobial activity. Most of the essential oils considered in this study exhibited a significant inhibitory effect. Thyme oil showed a promising inhibitory activity even at low concentration, thus revealing its potential as a natural preservative in food products against several causal agents of foodborne diseases and food spoilage. In general, the results demonstrate that, besides flavoring the food, the use of aromatic herbs in gastronomy can also contribute to a bacteriostatic effect against pathogens.
Directory of Open Access Journals (Sweden)
Seema Meena
2016-07-01
Full Text Available Aromatic grasses of the genus Cymbopogon (Poaceae family represent unique group of plants that produce diverse composition of monoterpene rich essential oils, which have great value in flavour, fragrance, cosmetic and aromatherapy industries. Despite the commercial importance of these natural aromatic oils, their biosynthesis at the molecular level remains unexplored. As the first step towards understanding the essential oil biosynthesis, we performed de novo transcriptome assembly and analysis of C. flexuosus (lemongrass by employing Illumina sequencing. Mining of transcriptome data and subsequent phylogenetic analysis led to identification of terpene synthases (TPS, pyrophosphatases (PPase, alcohol dehydrogenases (ADH, aldo-keto reductases (AKR, carotenoid cleavage dioxygenases (CCD, alcohol acetyltransferases (AAT and aldehyde dehydrogenases (ALDH, which are potentially involved in essential oil biosynthesis. Comparative essential oil profiling and mRNA expression analysis in three Cymbopogon species (C. flexuosus, aldehyde type; C. martinii, alcohol type; and C. winterianus, intermediate type with varying essential oil composition indicated the involvement of identified candidate genes in the formation of alcohols, aldehydes and acetates. Molecular modeling and docking further supported the role of identified enzymes in aroma formation in Cymbopogon. Also, simple sequence repeats (SSRs were found in the transcriptome with many linked to terpene pathway genes including the genes potentially involved in aroma biosynthesis. This work provides the first insights into the essential oil biosynthesis of aromatic grasses, and the identified candidate genes and markers can be a great resource for biotechnological and molecular breeding approaches to modulate the essential oil composition.
Meena, Seema; Kumar, Sarma R.; Venkata Rao, D. K.; Dwivedi, Varun; Shilpashree, H. B.; Rastogi, Shubhra; Shasany, Ajit K.; Nagegowda, Dinesh A.
2016-01-01
Aromatic grasses of the genus Cymbopogon (Poaceae family) represent unique group of plants that produce diverse composition of monoterpene rich essential oils, which have great value in flavor, fragrance, cosmetic, and aromatherapy industries. Despite the commercial importance of these natural aromatic oils, their biosynthesis at the molecular level remains unexplored. As the first step toward understanding the essential oil biosynthesis, we performed de novo transcriptome assembly and analysis of C. flexuosus (lemongrass) by employing Illumina sequencing. Mining of transcriptome data and subsequent phylogenetic analysis led to identification of terpene synthases, pyrophosphatases, alcohol dehydrogenases, aldo-keto reductases, carotenoid cleavage dioxygenases, alcohol acetyltransferases, and aldehyde dehydrogenases, which are potentially involved in essential oil biosynthesis. Comparative essential oil profiling and mRNA expression analysis in three Cymbopogon species (C. flexuosus, aldehyde type; C. martinii, alcohol type; and C. winterianus, intermediate type) with varying essential oil composition indicated the involvement of identified candidate genes in the formation of alcohols, aldehydes, and acetates. Molecular modeling and docking further supported the role of identified protein sequences in aroma formation in Cymbopogon. Also, simple sequence repeats were found in the transcriptome with many linked to terpene pathway genes including the genes potentially involved in aroma biosynthesis. This work provides the first insights into the essential oil biosynthesis of aromatic grasses, and the identified candidate genes and markers can be a great resource for biotechnological and molecular breeding approaches to modulate the essential oil composition. PMID:27516768
Meena, Seema; Kumar, Sarma R; Venkata Rao, D K; Dwivedi, Varun; Shilpashree, H B; Rastogi, Shubhra; Shasany, Ajit K; Nagegowda, Dinesh A
2016-01-01
Aromatic grasses of the genus Cymbopogon (Poaceae family) represent unique group of plants that produce diverse composition of monoterpene rich essential oils, which have great value in flavor, fragrance, cosmetic, and aromatherapy industries. Despite the commercial importance of these natural aromatic oils, their biosynthesis at the molecular level remains unexplored. As the first step toward understanding the essential oil biosynthesis, we performed de novo transcriptome assembly and analysis of C. flexuosus (lemongrass) by employing Illumina sequencing. Mining of transcriptome data and subsequent phylogenetic analysis led to identification of terpene synthases, pyrophosphatases, alcohol dehydrogenases, aldo-keto reductases, carotenoid cleavage dioxygenases, alcohol acetyltransferases, and aldehyde dehydrogenases, which are potentially involved in essential oil biosynthesis. Comparative essential oil profiling and mRNA expression analysis in three Cymbopogon species (C. flexuosus, aldehyde type; C. martinii, alcohol type; and C. winterianus, intermediate type) with varying essential oil composition indicated the involvement of identified candidate genes in the formation of alcohols, aldehydes, and acetates. Molecular modeling and docking further supported the role of identified protein sequences in aroma formation in Cymbopogon. Also, simple sequence repeats were found in the transcriptome with many linked to terpene pathway genes including the genes potentially involved in aroma biosynthesis. This work provides the first insights into the essential oil biosynthesis of aromatic grasses, and the identified candidate genes and markers can be a great resource for biotechnological and molecular breeding approaches to modulate the essential oil composition.
Essential Oils and Antifungal Activity
Coppola, Raffaele; De Feo, Vincenzo
2017-01-01
Since ancient times, folk medicine and agro-food science have benefitted from the use of plant derivatives, such as essential oils, to combat different diseases, as well as to preserve food. In Nature, essential oils play a fundamental role in protecting the plant from biotic and abiotic attacks to which it may be subjected. Many researchers have analyzed in detail the modes of action of essential oils and most of their components. The purpose of this brief review is to describe the properties of essential oils, principally as antifungal agents, and their role in blocking cell communication mechanisms, fungal biofilm formation, and mycotoxin production. PMID:29099084
Essentiality, conservation, evolutionary pressure and codon bias in bacterial genomes.
Dilucca, Maddalena; Cimini, Giulio; Giansanti, Andrea
2018-07-15
Essential genes constitute the core of genes which cannot be mutated too much nor lost along the evolutionary history of a species. Natural selection is expected to be stricter on essential genes and on conserved (highly shared) genes, than on genes that are either nonessential or peculiar to a single or a few species. In order to further assess this expectation, we study here how essentiality of a gene is connected with its degree of conservation among several unrelated bacterial species, each one characterised by its own codon usage bias. Confirming previous results on E. coli, we show the existence of a universal exponential relation between gene essentiality and conservation in bacteria. Moreover, we show that, within each bacterial genome, there are at least two groups of functionally distinct genes, characterised by different levels of conservation and codon bias: i) a core of essential genes, mainly related to cellular information processing; ii) a set of less conserved nonessential genes with prevalent functions related to metabolism. In particular, the genes in the first group are more retained among species, are subject to a stronger purifying conservative selection and display a more limited repertoire of synonymous codons. The core of essential genes is close to the minimal bacterial genome, which is in the focus of recent studies in synthetic biology, though we confirm that orthologs of genes that are essential in one species are not necessarily essential in other species. We also list a set of highly shared genes which, reasonably, could constitute a reservoir of targets for new anti-microbial drugs. Copyright © 2018 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Gutiérrez Rodrigo A
2008-09-01
Full Text Available Abstract Background Microarray technology is a widely used approach for monitoring genome-wide gene expression. For Arabidopsis, there are over 1,800 microarray hybridizations representing many different experimental conditions on Affymetrix™ ATH1 gene chips alone. This huge amount of data offers a unique opportunity to infer the principles that govern the regulation of gene expression in plants. Results We used bioinformatics methods to analyze publicly available data obtained using the ATH1 chip from Affymetrix. A total of 1887 ATH1 hybridizations were normalized and filtered to eliminate low-quality hybridizations. We classified and compared control and treatment hybridizations and determined differential gene expression. The largest differences in gene expression were observed when comparing samples obtained from different organs. On average, ten-fold more genes were differentially expressed between organs as compared to any other experimental variable. We defined "gene responsiveness" as the number of comparisons in which a gene changed its expression significantly. We defined genes with the highest and lowest responsiveness levels as hypervariable and housekeeping genes, respectively. Remarkably, housekeeping genes were best distinguished from hypervariable genes by differences in methylation status in their transcribed regions. Moreover, methylation in the transcribed region was inversely correlated (R2 = 0.8 with gene responsiveness on a genome-wide scale. We provide an example of this negative relationship using genes encoding TCA cycle enzymes, by contrasting their regulatory responsiveness to nitrate and methylation status in their transcribed regions. Conclusion Our results indicate that the Arabidopsis transcriptome is largely established during development and is comparatively stable when faced with external perturbations. We suggest a novel functional role for DNA methylation in the transcribed region as a key determinant
Directory of Open Access Journals (Sweden)
Olivier J Becherel
2013-04-01
Full Text Available Senataxin, mutated in the human genetic disorder ataxia with oculomotor apraxia type 2 (AOA2, plays an important role in maintaining genome integrity by coordination of transcription, DNA replication, and the DNA damage response. We demonstrate that senataxin is essential for spermatogenesis and that it functions at two stages in meiosis during crossing-over in homologous recombination and in meiotic sex chromosome inactivation (MSCI. Disruption of the Setx gene caused persistence of DNA double-strand breaks, a defect in disassembly of Rad51 filaments, accumulation of DNA:RNA hybrids (R-loops, and ultimately a failure of crossing-over. Senataxin localised to the XY body in a Brca1-dependent manner, and in its absence there was incomplete localisation of DNA damage response proteins to the XY chromosomes and ATR was retained on the axial elements of these chromosomes, failing to diffuse out into chromatin. Furthermore persistence of RNA polymerase II activity, altered ubH2A distribution, and abnormal XY-linked gene expression in Setx⁻/⁻ revealed an essential role for senataxin in MSCI. These data support key roles for senataxin in coordinating meiotic crossing-over with transcription and in gene silencing to protect the integrity of the genome.
Energy Technology Data Exchange (ETDEWEB)
Lung, Ildikó [National Institute for Research and Development of Isotopic and Molecular Technologies, 67-103 Donat Street, Cluj-Napoca 400293 (Romania); Soran, Maria-Loredana, E-mail: loredana.soran@itim-cj.ro [National Institute for Research and Development of Isotopic and Molecular Technologies, 67-103 Donat Street, Cluj-Napoca 400293 (Romania); Opriş, Ocsana; Truşcă, Mihail Radu Cătălin [National Institute for Research and Development of Isotopic and Molecular Technologies, 67-103 Donat Street, Cluj-Napoca 400293 (Romania); Niinemets, Ülo [Institute of Agricultural and Environmental Sciences, Estonian University of Life Sciences, 1 Kreutzwaldi Street, Tartu 51014 (Estonia); Copolovici, Lucian [Institute of Agricultural and Environmental Sciences, Estonian University of Life Sciences, 1 Kreutzwaldi Street, Tartu 51014 (Estonia); Institute of Technical and Natural Sciences Research-Development of “Aurel Vlaicu” University, 2 Elena Drăgoi Street, Arad 310330 (Romania)
2016-11-01
Exposure to sustained low intensity microwaves can constitute a stress for the plants, but its effects on plant secondary chemistry are poorly known. We studied the influence of GSM and WLAN-frequency microwaves on emissions of volatile organic compounds and content of essential oil in the aromatic plant Ocimum basilicum L. hypothesizing that microwave exposure leads to enhanced emissions of stress volatiles and overall greater investment in secondary compounds. Compared to the control plants, microwave irradiation led to decreased emissions of β-pinene, α-phellandrene, bornyl acetate, β-myrcene, α-caryophyllene and benzaldehyde, but increased emissions of eucalyptol, estragole, caryophyllene oxide, and α-bergamotene. The highest increase in emission, 21 times greater compared to control, was observed for caryophyllene oxide. The irradiation resulted in increases in the essential oil content, except for the content of phytol which decreased by 41% in the case of GSM-frequency, and 82% in the case of WLAN-frequency microwave irradiation. The strongest increase in response to WLAN irradiation, > 17 times greater, was observed for hexadecane and octane contents. Comparisons of volatile compositions by multivariate analyses demonstrated a clear separation of different irradiance treatments, and according to the changes in the volatile emissions, the WLAN-frequency irradiation represented a more severe stress than the GSM-frequency irradiation. Overall, these results demonstrating important modifications in the emission rates, essential oil content and composition indicate that microwave irradiation influences the quality of herbage of this economically important spice plant. - Highlights: • Microwave irradiation represents a stress for the plants. • Microwave exposure leads to enhanced emissions of stress volatiles. • O. basilicum irradiation with microwaves increases the essential oil content. • Microwave pollution can constitute a threat to the
International Nuclear Information System (INIS)
Lung, Ildikó; Soran, Maria-Loredana; Opriş, Ocsana; Truşcă, Mihail Radu Cătălin; Niinemets, Ülo; Copolovici, Lucian
2016-01-01
Exposure to sustained low intensity microwaves can constitute a stress for the plants, but its effects on plant secondary chemistry are poorly known. We studied the influence of GSM and WLAN-frequency microwaves on emissions of volatile organic compounds and content of essential oil in the aromatic plant Ocimum basilicum L. hypothesizing that microwave exposure leads to enhanced emissions of stress volatiles and overall greater investment in secondary compounds. Compared to the control plants, microwave irradiation led to decreased emissions of β-pinene, α-phellandrene, bornyl acetate, β-myrcene, α-caryophyllene and benzaldehyde, but increased emissions of eucalyptol, estragole, caryophyllene oxide, and α-bergamotene. The highest increase in emission, 21 times greater compared to control, was observed for caryophyllene oxide. The irradiation resulted in increases in the essential oil content, except for the content of phytol which decreased by 41% in the case of GSM-frequency, and 82% in the case of WLAN-frequency microwave irradiation. The strongest increase in response to WLAN irradiation, > 17 times greater, was observed for hexadecane and octane contents. Comparisons of volatile compositions by multivariate analyses demonstrated a clear separation of different irradiance treatments, and according to the changes in the volatile emissions, the WLAN-frequency irradiation represented a more severe stress than the GSM-frequency irradiation. Overall, these results demonstrating important modifications in the emission rates, essential oil content and composition indicate that microwave irradiation influences the quality of herbage of this economically important spice plant. - Highlights: • Microwave irradiation represents a stress for the plants. • Microwave exposure leads to enhanced emissions of stress volatiles. • O. basilicum irradiation with microwaves increases the essential oil content. • Microwave pollution can constitute a threat to the
Fumigant toxicity of plant essential oils against Camptomyia corticalis (Diptera: Cecidomyiidae).
Kim, Jun-Ran; Haribalan, Perumalsamy; Son, Bong-Ki; Ahn, Young-Joon
2012-08-01
The toxicity of 98 plant essential oils against third instars of cecidomyiid gall midge Camptomyia corticalis (Loew) (Diptera: Cecidomyiidae) was examined using a vapor-phase mortality bioassay. Results were compared with that of a conventional insecticide dichlorvos. Based on 24-h LC50 values, all essential oils were less toxic than dichlorvos (LC50, 0.027 mg/cm3). The LC50 of caraway (Carum carvi L.) seed, armoise (Artemisia vulgaris L.), clary sage (Salvia sclarea L.), oregano (Origanum vulgare L.), lemongrass [Cymbopogon citratus (DC.) Stapf], niaouli (Melaleuca viridiflora Gaertner), spearmint (Mentha spicata L.), cassia especial (Cinnamomum cassia Nees ex Blume), Dalmatian sage (Salvia offcinalis L.), red thyme (Thymus vulgaris L.), bay [Pimenta racemosa (P. Mill.) J.W. Moore], garlic (Allium sativum L.), and pennyroyal (Mentha pulegium L.) oils is between 0.55 and 0.60 mg/cm3. The LC50 of cassia (C. cassia, pure and redistilled), white thyme (T. vulgaris), star anise (Illicium verum Hook.f.), peppermint (Mentha X piperita L.), wintergreen (Gaultheria procumbens L.), cinnamon (Cinnamomum zeylanicum Blume) bark, sweet marjoram (Origanum majorana L.), Roman chamomile [Chamaemelum nobile (L.) All.], eucalyptus (Eucalyptus globulus Labill.), rosemary (Rosmarinus officinalis L.),Virginian cedarwood (Juniperus virginiana L.), pimento berry [Pimenta dioica (L.) Merr.], summer savory (Satureja hortensis L.), lavender (Lavandula angustifolia Mill.), and coriander (Coriandrum sativum L.) oils is between 0.61 and 0.99 mg/cm3. All other essential oils tested exhibited low toxicity to the cecidomyiid larvae (LC50, >0.99 mg/cm3). Global efforts to reduce the level of highly toxic synthetic insecticides in the agricultural environment justify further studies on the active essential oils as potential larvicides for the control of C. corticalis populations as fumigants with contact action.
Directory of Open Access Journals (Sweden)
Francis Ocheng
2015-01-01
Full Text Available The study assessed the growth inhibitory effects of essential oils extracted from ten Ugandan medicinal plants (Bidens pilosa, Helichrysum odoratissimum, Vernonia amygdalina, Hoslundia opposita, Ocimum gratissimum, Cymbopogon citratus, Cymbopogon nardus, Teclea nobilis, Zanthoxylum chalybeum, and Lantana trifolia used traditionally in the management of oral diseases against oral pathogens. Chemical compositions of the oils were explored by GC-MS. Inhibitory effects of the oils were assessed on periodontopathic Porphyromonas gingivalis and Aggregatibacter actinomycetemcomitans and cariogenic Streptococcus mutans and Lactobacillus acidophilus using broth dilution methods at concentrations of 1%, 0.1%, and 0.01%. The most sensitive organism was A. actinomycetemcomitans. Its growth was markedly inhibited by six of the oils at all the concentrations tested. Essential oil from C. nardus exhibited the highest activity with complete growth inhibition of A. actinomycetemcomitans and P. gingivalis at all the three concentrations tested, the major constituents in the oil being mainly oxygenated sesquiterpenes. Most of the oils exhibited limited effects on L. acidophilus. We conclude that essential oils from the studied plants show marked growth inhibitory effects on periodontopathic A. actinomycetemcomitans and P. gingivalis, moderate effects on cariogenic S. mutans, and the least effect on L. acidophilus. The present study constitutes a basis for further investigations and development of certain oils into alternative antiplaque agents.
Ocheng, Francis; Bwanga, Freddie; Joloba, Moses; Softrata, Abier; Azeem, Muhammad; Pütsep, Katrin; Borg-Karlson, Anna-Karin; Obua, Celestino; Gustafsson, Anders
2015-01-01
The study assessed the growth inhibitory effects of essential oils extracted from ten Ugandan medicinal plants (Bidens pilosa, Helichrysum odoratissimum, Vernonia amygdalina, Hoslundia opposita, Ocimum gratissimum, Cymbopogon citratus, Cymbopogon nardus, Teclea nobilis, Zanthoxylum chalybeum, and Lantana trifolia) used traditionally in the management of oral diseases against oral pathogens. Chemical compositions of the oils were explored by GC-MS. Inhibitory effects of the oils were assessed on periodontopathic Porphyromonas gingivalis and Aggregatibacter actinomycetemcomitans and cariogenic Streptococcus mutans and Lactobacillus acidophilus using broth dilution methods at concentrations of 1%, 0.1%, and 0.01%. The most sensitive organism was A. actinomycetemcomitans. Its growth was markedly inhibited by six of the oils at all the concentrations tested. Essential oil from C. nardus exhibited the highest activity with complete growth inhibition of A. actinomycetemcomitans and P. gingivalis at all the three concentrations tested, the major constituents in the oil being mainly oxygenated sesquiterpenes. Most of the oils exhibited limited effects on L. acidophilus. We conclude that essential oils from the studied plants show marked growth inhibitory effects on periodontopathic A. actinomycetemcomitans and P. gingivalis, moderate effects on cariogenic S. mutans, and the least effect on L. acidophilus. The present study constitutes a basis for further investigations and development of certain oils into alternative antiplaque agents. PMID:26170872
Danchin, Etienne G.J.; Perfus-Barbeoch, Laetitia; Rancurel, Corinne; Thorpe, Peter; Da Rocha, Martine; Bajew, Simon; Neilson, Roy; Sokolova (Guzeeva), Elena; Da Silva, Corinne; Guy, Julie; Labadie, Karine; Esmenjaud, Daniel; Helder, Johannes; Jones, John T.
2017-01-01
Nematodes have evolved the ability to parasitize plants on at least four independent occasions, with plant parasites present in Clades 1, 2, 10 and 12 of the phylum. In the case of Clades 10 and 12, horizontal gene transfer of plant cell wall degrading enzymes from bacteria and fungi has been implicated in the evolution of plant parasitism. We have used ribonucleic acid sequencing (RNAseq) to generate reference transcriptomes for two economically important nematode species, Xiphinema index and Longidorus elongatus, representative of two genera within the early-branching Clade 2 of the phylum Nematoda. We used a transcriptome-wide analysis to identify putative horizontal gene transfer events. This represents the first in-depth transcriptome analysis from any plant-parasitic nematode of this clade. For each species, we assembled ~30 million Illumina reads into a reference transcriptome. We identified 62 and 104 transcripts, from X. index and L. elongatus, respectively, that were putatively acquired via horizontal gene transfer. By cross-referencing horizontal gene transfer prediction with a phylum-wide analysis of Pfam domains, we identified Clade 2-specific events. Of these, a GH12 cellulase from X. index was analysed phylogenetically and biochemically, revealing a likely bacterial origin and canonical enzymatic function. Horizontal gene transfer was previously shown to be a phenomenon that has contributed to the evolution of plant parasitism among nematodes. Our findings underline the importance and the extensiveness of this phenomenon in the evolution of plant-parasitic life styles in this speciose and widespread animal phylum. PMID:29065523
Danchin, Etienne G J; Perfus-Barbeoch, Laetitia; Rancurel, Corinne; Thorpe, Peter; Da Rocha, Martine; Bajew, Simon; Neilson, Roy; Guzeeva, Elena Sokolova; Da Silva, Corinne; Guy, Julie; Labadie, Karine; Esmenjaud, Daniel; Helder, Johannes; Jones, John T; den Akker, Sebastian Eves-van
2017-10-23
Nematodes have evolved the ability to parasitize plants on at least four independent occasions, with plant parasites present in Clades 1, 2, 10 and 12 of the phylum. In the case of Clades 10 and 12, horizontal gene transfer of plant cell wall degrading enzymes from bacteria and fungi has been implicated in the evolution of plant parasitism. We have used ribonucleic acid sequencing (RNAseq) to generate reference transcriptomes for two economically important nematode species, Xiphinema index and Longidorus elongatus , representative of two genera within the early-branching Clade 2 of the phylum Nematoda. We used a transcriptome-wide analysis to identify putative horizontal gene transfer events. This represents the first in-depth transcriptome analysis from any plant-parasitic nematode of this clade. For each species, we assembled ~30 million Illumina reads into a reference transcriptome. We identified 62 and 104 transcripts, from X. index and L. elongatus , respectively, that were putatively acquired via horizontal gene transfer. By cross-referencing horizontal gene transfer prediction with a phylum-wide analysis of Pfam domains, we identified Clade 2-specific events. Of these, a GH12 cellulase from X. index was analysed phylogenetically and biochemically, revealing a likely bacterial origin and canonical enzymatic function. Horizontal gene transfer was previously shown to be a phenomenon that has contributed to the evolution of plant parasitism among nematodes. Our findings underline the importance and the extensiveness of this phenomenon in the evolution of plant-parasitic life styles in this speciose and widespread animal phylum.
Directory of Open Access Journals (Sweden)
Etienne G.J. Danchin
2017-10-01
Full Text Available Nematodes have evolved the ability to parasitize plants on at least four independent occasions, with plant parasites present in Clades 1, 2, 10 and 12 of the phylum. In the case of Clades 10 and 12, horizontal gene transfer of plant cell wall degrading enzymes from bacteria and fungi has been implicated in the evolution of plant parasitism. We have used ribonucleic acid sequencing (RNAseq to generate reference transcriptomes for two economically important nematode species, Xiphinema index and Longidorus elongatus, representative of two genera within the early-branching Clade 2 of the phylum Nematoda. We used a transcriptome-wide analysis to identify putative horizontal gene transfer events. This represents the first in-depth transcriptome analysis from any plant-parasitic nematode of this clade. For each species, we assembled ~30 million Illumina reads into a reference transcriptome. We identified 62 and 104 transcripts, from X. index and L. elongatus, respectively, that were putatively acquired via horizontal gene transfer. By cross-referencing horizontal gene transfer prediction with a phylum-wide analysis of Pfam domains, we identified Clade 2-specific events. Of these, a GH12 cellulase from X. index was analysed phylogenetically and biochemically, revealing a likely bacterial origin and canonical enzymatic function. Horizontal gene transfer was previously shown to be a phenomenon that has contributed to the evolution of plant parasitism among nematodes. Our findings underline the importance and the extensiveness of this phenomenon in the evolution of plant-parasitic life styles in this speciose and widespread animal phylum.
Directory of Open Access Journals (Sweden)
Saminathan Subburaj
Full Text Available The rice gene seed dormancy 4 (OsSdr4 functions in seed dormancy and is a major factor associated with pre-harvest sprouting (PHS. Although previous studies of this protein family were reported for rice and other species, knowledge of the evolution of genes homologous to OsSdr4 in plants remains inadequate. Fifty four Sdr4-like (hereafter designated Sdr4L genes were identified in nine plant lineages including 36 species. Phylogenetic analysis placed these genes in eight subfamilies (I-VIII. Genes from the same lineage clustered together, supported by analysis of conserved motifs and exon-intron patterns. Segmental duplications were present in both dicot and monocot clusters, while tandemly duplicated genes occurred only in monocot clusters indicating that both tandem and segmental duplications contributed to expansion of the grass I and II subfamilies. Estimation of the approximate ages of the duplication events indicated that ancestral Sdr4 genes evolved from a common angiosperm ancestor, about 160 million years ago (MYA. Moreover, diversification of Sdr4L genes in mono and dicot plants was mainly associated with genome-wide duplication and speciation events. Functional divergence was observed in all subfamily pairs, except IV/VIIIa. Further analysis indicated that functional constraints between subfamily pairs I/II, I/VIIIb, II/VI, II/VIIIb, II/IV, and VI/VIIIb were statistically significant. Site and branch-site model analyses of positive selection suggested that these genes were under strong adaptive selection pressure. Critical amino acids detected for both functional divergence and positive selection were mostly located in the loops, pointing to functional importance of these regions in this protein family. In addition, differential expression studies by transcriptome atlas of 11 Sdr4L genes showed that the duplicated genes may have undergone divergence in expression between plant species. Our findings showed that Sdr4L genes are
Plants, genes and justice : an inquiry into fair and equitable benefit-sharing
Jonge, de B.
2009-01-01
Since the advent of biotechnology, plant genetic resources have become more valuable as possible sources for new products and inventions. With knowledge about the genetic make-up and functioning of a plant, biotechnologists can identify and isolate genes with interesting traits which, after long
Directory of Open Access Journals (Sweden)
Starović Mira
2017-01-01
Full Text Available Development of natural plant protection products as an alternative to synthetic fungicides is of significant importance regarding the environment. This study was carried out with an objective to investigate in vitro antifungal activities of several essential oils extracted from oregano, basil, myrtle and Turkish pickling herb, and the plant growth-promoting rhizobacteria in the genus Pseudomonas, against the phytopathogenic fungus Phomopsis theicola. Microdilution methods were used to determine the minimum inhibitory concentrations (MIC of selected antimicrobial essential oils (EOs. All EOs exhibited significant levels of antifungal activity against the tested fungal isolates. The oregano EO was found the most potent one (MIC - 5.5 µg/mL, followed by basil (MIC - 75.0µg/mL, myrtle (MIC - 775 µg/mL and Turkish pickling herb (MIC - 7750 µg/mL. Inhibition of Ph. theicola mycelial growth was observed for all tested Pseudomonas spp. strains. K113 and L1 strains were highly effective and achieved more than 60% of fungal growth inhibition using the overnight culture and more than 57% inhibition by applying cell-free supernatants of both strains. A future field trial with K113 and L1 cultures and cell-free supernatants, containing extracellular metabolites toward Ph. theicola, will estimate their effectiveness and applicability as an alternative to chemical protection of apple trees.
Chromatin changes in response to drought, salinity, heat, and cold stresses in plants
Directory of Open Access Journals (Sweden)
Jong-Myong eKim
2015-03-01
Full Text Available Chromatin regulation is essential to regulate genes and genome activities. In plants, the alteration of histone modification and DNA methylation are coordinated with changes in the expression of stress-responsive genes to adapt to environmental changes. Several chromatin regulators have been shown to be involved in the regulation of stress-responsive gene networks under abiotic stress conditions. Specific histone modification sites and the histone modifiers that regulate key stress-responsive genes have been identified by genetic and biochemical approaches, revealing the importance of chromatin regulation in plant stress responses. Recent studies have also suggested that histone modification plays an important role in plant stress memory. In this review, we summarize recent progress on the regulation and alteration of histone modification (acetylation, methylation, phosphorylation, and SUMOylation in response to the abiotic stresses, drought, high-salinity, heat, and cold in plants.
Using The Corngrass1 Gene To Enhance The Biofuel Properties Of Crop Plants
Energy Technology Data Exchange (ETDEWEB)
Hake, Sarah [USDA Agricultural Research Service, Washington DC (United States); Chuck, George [USDA Agricultural Research Service, Washington DC (United States)
2015-10-29
The development of novel plant germplasm is vital to addressing our increasing bioenergy demands. The major hurdle to digesting plant biomass is the complex structure of the cell walls, the substrate of fermentation. Plant cell walls are inaccessible matrices of macromolecules that are polymerized with lignin, making fermentation difficult. Overcoming this hurdle is a major goal toward developing usable bioenergy crop plants. Our project seeks to enhance the biofuel properties of perennial grass species using the Corngrass1 (Cg1) gene and its targets. Dominant maize Cg1 mutants produce increased biomass by continuously initiating extra axillary meristems and leaves. We cloned Cg1 and showed that its phenotype is caused by over expression of a unique miR156 microRNA gene that negatively regulates SPL transcription factors. We transferred the Cg1 phenotype to other plants by expressing the gene behind constitutive promoters in four different species, including the monocots, Brachypodium and switchgrass, and dicots, Arabidopsis and poplar. All transformants displayed a similar range of phenotypes, including increased biomass from extended leaf production, and increased vegetative branching. Field grown switchgrass transformants showed that overall lignin content was reduced, the ratio of glucans to xylans was increased, and surprisingly, that starch levels were greatly increased. The goals of this project are to control the tissue and temporal expression of Cg1 by using different promoters to drive its expression, elucidate the function of the SPL targets of Cg1 by generating gain and loss of function alleles, and isolate downstream targets of select SPL genes using deep sequencing and chromatin immunoprecipitation. We believe it is possible to control biomass accumulation, cell wall properties, and sugar levels through manipulation of either the Cg1 gene and/or its SPL targets.
Durantel, D; Croizier, L; Ayres, M D; Croizier, G; Possee, R D; López-Ferber, M
1998-03-01
Autographa californica nucleopolyhedrovirus (AcMNPV) ORF 86, located within the HindIII C fragment, potentially encodes a protein which shares sequence similarity with two T4 bacteriophage gene products, RNA ligase and polynucleotide kinase. This AcMNPV gene has been designated pnk/pnl but has yet to be assigned a function in virus replication. It has been classified as an immediate early virus gene, since the promoter was active in uninfected insect cells and mRNA transcripts were detectable from 4 to 48 h post-infection and in the presence of cycloheximide or aphidicolin in virus-infected cells. The extremities of the transcript have been mapped by primer extension and 3' RACE-PCR to positions -18 from the translational start codon and +15 downstream of the stop codon. The function of pnk/pnl was investigated by producing a recombinant virus (Acdel86lacZ) with the coding region replaced with that of lacZ. This virus replicated normally in Spodoptera frugiperda (Sf 21) cells, indicating that pnk/pnl is not essential for propagation in these cells. Virus protein production in Acdel86lacZ-infected Sf 21 cells also appeared to be unaffected, with normal synthesis of the IE-1, GP64, VP39 and polyhedrin proteins. Shut-down of host protein synthesis was not abolished in recombinant infection. When other baculovirus genomes were examined for the presence of pnk/pnl by restriction enzyme digestion and PCR, a deletion was found in AcMNPV 1.2, Galleria mellonella NPV (GmMNPV) and Bombyx mori NPV (BmNPV), suggesting that in many isolates this gene has either never been acquired or has been lost during genome evolution. This is one of the first baculovirus immediate early genes that appears to be nonessential for virus survival.
Wang, Yaqiong; Ma, Hong
2015-09-01
Proteins often function as complexes, yet little is known about the evolution of dissimilar subunits of complexes. DNA-directed RNA polymerases (RNAPs) are multisubunit complexes, with distinct eukaryotic types for different classes of transcripts. In addition to Pol I-III, common in eukaryotes, plants have Pol IV and V for epigenetic regulation. Some RNAP subunits are specific to one type, whereas other subunits are shared by multiple types. We have conducted extensive phylogenetic and sequence analyses, and have placed RNAP gene duplication events in land plant history, thereby reconstructing the subunit compositions of the novel RNAPs during land plant evolution. We found that Pol IV/V have experienced step-wise duplication and diversification of various subunits, with increasingly distinctive subunit compositions. Also, lineage-specific duplications have further increased RNAP complexity with distinct copies in different plant families and varying divergence for subunits of different RNAPs. Further, the largest subunits of Pol IV/V probably originated from a gene fusion in the ancestral land plants. We propose a framework of plant RNAP evolution, providing an excellent model for protein complex evolution. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.
Seeing the forest for the trees: annotating small RNA producing genes in plants.
Coruh, Ceyda; Shahid, Saima; Axtell, Michael J
2014-04-01
A key goal in genomics is the complete annotation of the expressed regions of the genome. In plants, substantial portions of the genome make regulatory small RNAs produced by Dicer-Like (DCL) proteins and utilized by Argonaute (AGO) proteins. These include miRNAs and various types of endogenous siRNAs. Small RNA-seq, enabled by cheap and fast DNA sequencing, has produced an enormous volume of data on plant miRNA and siRNA expression in recent years. In this review, we discuss recent progress in using small RNA-seq data to produce stable and reliable annotations of miRNA and siRNA genes in plants. In addition, we highlight key goals for the future of small RNA gene annotation in plants. Copyright © 2014 Elsevier Ltd. All rights reserved.
The YABBY Genes of Leaf and Leaf-Like Organ Polarity in Leafless Plant Monotropa hypopitys
Directory of Open Access Journals (Sweden)
Anna V. Shchennikova
2018-01-01
Full Text Available Monotropa hypopitys is a mycoheterotrophic, nonphotosynthetic plant acquiring nutrients from the roots of autotrophic trees through mycorrhizal symbiosis, and, similar to other extant plants, forming asymmetrical lateral organs during development. The members of the YABBY family of transcription factors are important players in the establishment of leaf and leaf-like organ polarity in plants. This is the first report on the identification of YABBY genes in a mycoheterotrophic plant devoid of aboveground vegetative organs. Seven M. hypopitys YABBY members were identified and classified into four clades. By structural analysis of putative encoded proteins, we confirmed the presence of YABBY-defining conserved domains and identified novel clade-specific motifs. Transcriptomic and qRT-PCR analyses of different tissues revealed MhyYABBY transcriptional patterns, which were similar to those of orthologous YABBY genes from other angiosperms. These data should contribute to the understanding of the role of the YABBY genes in the regulation of developmental and physiological processes in achlorophyllous leafless plants.
Viktorovtá, Jitka; Novakova, Martina; Trbolova, Ladislava; Vrchotova, Blanka; Lovecka, Petra; Mackova, Martina; Macek, Tomas
2014-01-01
Genetically modified plants can serve as an efficient tool for remediation of diverse dangerous pollutants of the environment such as pesticides, heavy metals, explosives and persistent organic compounds. Transgenic lines of Nicotiana tabacum containing bacterial bphC gene from the degradation pathway of polychlorinated biphenyls (PCBs) were tested. The product of the bphC gene - enzyme 2,3-dihydroxybiphenyl-1,2-dioxygenase is responsible for cleaving of the biphenyl ring. The presence of bphC gene in transgenic plants was detected on DNA, RNA and protein level. The expression of the bphC/His gene was verified afterpurification of the enzyme from plants by affinity chromatography followed by a Western blot and immunochemical assay. The enzyme activity of isolated protein was detected. Efficient transformation of 2,3-DHB by transgenic plants was achieved and the lines also exhibited high production of biomass. The transgenic plants were more tolerant to the commercial PCBs mixture Delor 103 than non-transgenic tobacco. And finally, the higher decrease of total PCB content and especially congener 28 in real contaminated soil from a dumpsite was determined after cultivation of transgenic plant in comparison with nontransgenic tobacco. The substrate specificity of transgenic plants was the same as substrate specificity of BphC enzyme.
Major gene mutations and domestication of plants
International Nuclear Information System (INIS)
Ashri, A.
1989-01-01
From the approximately 200,000 species of flowering plants known, only about 200 have been domesticated. The process has taken place in many regions over long periods. At present there is great interest in domesticating new species and developing new uses for existing ones in order to supply needed food, industrial raw materials, etc. It is proposed that major gene mutations were important in domestication; many key characters distinguishing cultivated from related wild species are controlled by one or very few major genes. The deliberate effort to domesticate new species requires at least the following: identification of needs and potential sources, establishment of suitable niches, choice of taxa to be domesticated, specification of the desired traits and key characters to be modified, as well as the potential role of induced mutations. (author). 14 refs
Directory of Open Access Journals (Sweden)
Aghil Sharifzadeh
2016-03-01
Full Text Available Objectives: The purpose of this study was to assay the antifungal activity of selected essential oils obtained from plants against both fluconazole (FLU-resistant and FLU-susceptible C. albicans strains isolated from HIV positive patients with oropharyngeal candidiasis (OPC. Materials and Methods: The essential oils were obtained by hydrodistillation method from Myrtus communis (My. communis, Zingiber officinale roscoe (Z. officinale roscoe, Matricaria chamomilla (Ma. chamomilla, Trachyspermum ammi (T. ammi and Origanum vulgare (O. vulgare. The susceptibility test was based on the M27-A2 methodology. The chemical compositions of the essential oils were obtained by gas chromatography- mass spectroscopy (GC-MS. Results: In GC-MS analysis, thymol (63.40%, linalool (42%, α-pinene (27.87%, α-pinene (22.10%, and zingiberene (31.79% were found to be the major components of T. ammi, O. vulgare, My. communis, Ma. chamomilla and Z. officinale roscoe, respectively. The results showed that essential oils have different levels of antifungal activity. O. vulgare and T. ammi essential oils were found to be the most efficient (P
Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms.
Li, Zhen; Defoort, Jonas; Tasdighian, Setareh; Maere, Steven; Van de Peer, Yves; De Smet, Riet
2016-02-01
Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of "gene duplicability" is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. © 2016 American Society of Plant Biologists. All rights reserved.
Pierella Karlusich, Juan J; Ceccoli, Romina D; Graña, Martín; Romero, Héctor; Carrillo, Néstor
2015-02-16
Oxidative stress and iron limitation represent the grim side of life in an oxygen-rich atmosphere. The versatile electron transfer shuttle ferredoxin, an iron-sulfur protein, is particularly sensitive to these hardships, and its downregulation under adverse conditions severely compromises survival of phototrophs. Replacement of ferredoxin by a stress-resistant isofunctional carrier, flavin-containing flavodoxin, is a widespread strategy employed by photosynthetic microorganisms to overcome environmental adversities. The flavodoxin gene was lost in the course of plant evolution, but its reintroduction in transgenic plants confers increased tolerance to environmental stress and iron starvation, raising the question as to why a genetic asset with obvious adaptive value was not kept by natural selection. Phylogenetic analyses reveal that the evolutionary history of flavodoxin is intricate, with several horizontal gene transfer events between distant organisms, including Eukarya, Bacteria, and Archaea. The flavodoxin gene is unevenly distributed in most algal lineages, with flavodoxin-containing species being overrepresented in iron-limited regions and scarce or absent in iron-rich environments. Evaluation of cyanobacterial genomic and metagenomic data yielded essentially the same results, indicating that there was little selection pressure to retain flavodoxin in iron-rich coastal/freshwater phototrophs. Our results show a highly dynamic evolution pattern of flavodoxin tightly connected to the bioavailability of iron. Evidence presented here also indicates that the high concentration of iron in coastal and freshwater habitats may have facilitated the loss of flavodoxin in the freshwater ancestor of modern plants during the transition of photosynthetic organisms from the open oceans to the firm land. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Directory of Open Access Journals (Sweden)
Wagner L. Araújo
2012-09-01
Full Text Available The application of post-genomic techniques in plant respiration studies has greatly improved our ability to assign functions to gene products. In addition it has also revealed previously unappreciated interactions between distal elements of metabolism. Such results have reinforced the need to consider plant respiratory metabolism as part of a complex network and making sense of such interactions will ultimately require the construction of predictive and mechanistic models. Transcriptomics, proteomics, metabolomics and the quantification of metabolic flux will be of great value in creating such models both by facilitating the annotation of complex gene function, determining their structure and by furnishing the quantitative data required to test them. In this review we highlight how these experimental approaches have contributed to our current understanding of plant respiratory metabolism and its interplay with associated process (e.g. photosynthesis, photorespiration and nitrogen metabolism. We also discuss how data from these techniques may be integrated, with the ultimate aim of identifying mechanisms that control and regulate plant respiration and discovering novel gene functions with potential biotechnological implications.
Mosquito repellent activity of essential oils of aromatic plants growing in Argentina.
Gillij, Y G; Gleiser, R M; Zygadlo, J A
2008-05-01
Mosquitoes are important vectors of diseases and nuisance pests. Repellents minimize contact with mosquitoes. Repellents based on essential oils (EO) are being developed as an alternative to DEET (N,N-diethyl-m-methylbenzamide), an effective compound that has disadvantages including toxic reactions, and damage to plastic and synthetic fabric. This work evaluated the repellency against Aedes aegypti of EO from aromatic plants that grow in Argentina: Acantholippia seriphioides, Achyrocline satureioides, Aloysia citriodora, Anemia tomentosa, Baccharis spartioides, Chenopodium ambrosioides, Eucalyptus saligna, Hyptis mutabilis, Minthostachys mollis, Rosmarinus officinalis, Tagetes minuta and Tagetes pusilla. Most EO were effective. Variations depending on geographic origin of the plant were detected. At a 90% EO concentration, A. satureoides and T. pusilla were the least repellent. At concentrations of 12.5% B. spartioides, R. officinalis and A. citriodora showed the longest repellency times. Comparisons of the principal components of each EO suggest that limonene and camphor were the main components responsible for the repellent effects.
Directory of Open Access Journals (Sweden)
Mather A. Khan
2014-02-01
Full Text Available Plants and seeds are the main source of essential nutrients for humans and livestock. Many advances have recently been made in understanding the molecular mechanisms by which plants take up and accumulate micronutrients such as iron, zinc, copper and manganese. Some of these mechanisms however, also facilitate the accumulation of non-essential toxic elements such as cadmium (Cd and arsenic (As. In humans, Cd and As intake has been associated with multiple disorders including kidney failure, diabetes, cancer and mental health issues. Recent studies have shown that some transporters can discriminate between essential metals and non-essential elements. Furthermore, sequestration of non-essential elements in roots has been described in several plant species as a key process limiting the translocation of non-essential elements to aboveground edible tissues, including seeds. Increasing the concentration of bioavailable micronutrients (biofortification in grains while lowering the accumulation of non-essential elements will likely require the concerted action of several transporters. This review discusses the most recent advances on mineral nutrition that could be used to preferentially enrich seeds with micronutrients and also illustrates how precision breeding and transport engineering could be used to enhance the nutritional value of crops by re-routing essential and non-essential elements to separate sink tissues (roots and seeds.
Directory of Open Access Journals (Sweden)
Clélia Neves Afonso
2014-06-01
Full Text Available Coastal areas are highly complex and dynamic ecosystem of interface between land, sea and atmosphere, which also suffer biotic influences. These areas play several important ecological functions, and here we can find an enormous biodiversity. The coastline of Portugal features a high number of endemic flora and vegetation with the potential to provide functional compounds that may provide physiological benefits at nutritional and therapeutic levels, as sources of bioactive substances with antimicrobial, antioxidant, antifungal, antitumalr and anti-inflammatory activity. Among these compounds, we find essential oils, also known as volatile oils, which are a result of secondary metabolism of aromatic plants, containing a large number of substances with varied chemical composition that can be obtained by different methods of extraction. The aim of this study was to extract essential oils of native plants and seaweeds from the coast of Peniche by hydrodistillation in Clevenger apparatus, with optimization of the purification process. Extracted essential oils were tested as to their ability as antibacterial and antifungal agents, and also as antioxidants. The plants studied for this purpose were Inula chritmoides L., Juniperus phoenicea subsp. turbinata (Guss. Nyman, Daucus carota spp. halophilus and the seaweeds Fucus spiralis L., Codium tomentosum Stackhouse, Stypocaulon scoparium (Linnaeus Kützing and Plocamium cartilagineum (Linnaeus P.S.Dixon. The antimicrobial ability was tested in two bacteria species, Bacillus subtilis and Escherichia coli and in the yeast Saccharomyces cerevisiae, using standard procedures. The antioxidant potential was evaluated and from the results obtained, we can conclude that the essential oils extracted by the hydrodistillation method of plants and algae contain bioactive compounds present in its constitution with interesting bio-activity that can offer significant benefits and biotechnological relevance.
Bettini, Priscilla P; Marvasi, Massimiliano; Fani, Fabiola; Lazzara, Luigi; Cosi, Elena; Melani, Lorenzo; Mauro, Maria Luisa
2016-10-01
Insertion of Agrobacterium rhizogenes rolB gene into plant genome affects plant development, hormone balance and defence. However, beside the current research, the overall transcriptional response and gene expression of rolB as a modulator in plant is unknown. Transformed rolB tomato plant (Solanum lycopersicum L.) cultivar Tondino has been used to investigate the differential expression profile. Tomato is a well-known model organism both at the genetic and molecular level, and one of the most important commercial food crops in the world. Through the construction and characterization of a cDNA subtracted library, we have investigated the differential gene expression between transgenic clones of rolB and control tomato and have evaluated genes specifically transcribed in transgenic rolB plants. Among the selected genes, five genes encoding for chlorophyll a/b binding protein, carbonic anhydrase, cytochrome b 6 /f complex Fe-S subunit, potassium efflux antiporter 3, and chloroplast small heat-shock protein, all involved in chloroplast function, were identified. Measurement of photosynthesis efficiency by the level of three different photosynthetic parameters (F v /F m , rETR, NPQ) showed rolB significant increase in non-photochemical quenching and a, b chlorophyll content. Our results point to highlight the role of rolB on plant fitness by improving photosynthesis. Copyright © 2016 Elsevier GmbH. All rights reserved.
Chen, Hao
2010-08-01
The branched-chain amino acids (BCAAs) valine, leucine and isoleucine are essential amino acids that play critical roles in animal growth and development. Animals cannot synthesize these amino acids and must obtain them from their diet. Plants are the ultimate source of these essential nutrients, and they synthesize BCAAs through a conserved pathway that is inhibited by its end products. This feedback inhibition has prevented scientists from engineering plants that accumulate high levels of BCAAs by simply over-expressing the respective biosynthetic genes. To identify components critical for this feedback regulation, we performed a genetic screen for Arabidopsis mutants that exhibit enhanced resistance to BCAAs. Multiple dominant allelic mutations in the VALINE-TOLERANT 1 (VAT1) gene were identified that conferred plant resistance to valine inhibition. Map-based cloning revealed that VAT1 encodes a regulatory subunit of acetohydroxy acid synthase (AHAS), the first committed enzyme in the BCAA biosynthesis pathway. The VAT1 gene is highly expressed in young, rapidly growing tissues. When reconstituted with the catalytic subunit in vitro, the vat1 mutant-containing AHAS holoenzyme exhibits increased resistance to valine. Importantly, transgenic plants expressing the mutated vat1 gene exhibit valine tolerance and accumulate higher levels of BCAAs. Our studies not only uncovered regulatory characteristics of plant AHAS, but also identified a method to enhance BCAA accumulation in crop plants that will significantly enhance the nutritional value of food and feed. © 2010 Blackwell Publishing Ltd.
Growth enhancement and gene expression of Arabidopsis thaliana irradiated with active oxygen species
Watanabe, Satoshi; Ono, Reoto; Hayashi, Nobuya; Shiratani, Masaharu; Tashiro, Kosuke; Kuhara, Satoru; Inoue, Asami; Yasuda, Kaori; Hagiwara, Hiroko
2016-07-01
The characteristics of plant growth enhancement effect and the mechanism of the enhancement induced by plasma irradiation are investigated using various active species in plasma. Active oxygen species in oxygen plasma are effective for growth enhancement of plants. DNA microarray analysis of Arabidopsis thaliana indicates that the genes coding proteins that counter oxidative stresses by eliminating active oxygen species are expressed at significantly high levels. The size of plant cells increases owing to oxygen plasma irradiation. The increases in gene expression levels and cell size suggest that the increase in the expression level of the expansin protein is essential for plant growth enhancement phenomena.
Mottram, J C; McCready, B P; Brown, K G; Grant, K M
1996-11-01
The generation of homozygous null mutants for the crk1 Cdc2-Related Kinase of Leishmania mexicana was attempted using targeted gene disruption. Promastigote mutants heterozygous for crk1 were readily isolated with a hyg-targeting fragment, but attempts to create null mutants by second-round transfections with a bie-targeting fragment yielded two classes of mutant, neither of which was null. First, the transfected fragment formed an episome; second, the cloned transfectants were found to contain wild-type crk1 alleles as well as hyg and ble integrations. DNA-content analysis revealed that these mutants were triploid or tetraploid. Plasticity in chromosome number following targeting has been proposed as a means by which Leishmania avoids deletion of essential genes. These data support this theory and implicate crk1 as an essential gene, validating CRK1 as a potential drug target. L mexicana transfected with a Trypanosoma brucel homologue, tbcrk1, was shown to be viable in an immcrk1 null background, thus showing complementation of function between these trypanosomatid genes. The expression of crk1 was further manipulated by engineering a six-histidine tag at the C-terminus of the kinase, allowing purification of the active complex by affinity selection on Nl(2+)-nitriloacetic acid (NTA) agarose.
Differentially expressed genes in healthy and plum pox virus-infected Nicotiana benthamiana plants.
Vozárová, Z; Žilová, M; Šubr, Z
2015-12-01
Viruses use both material and energy sources of their hosts and redirect the production of disposable compounds in order to make viral replication more efficient. Metabolism of infected organisms is modified by these enhanced requirements as well by their own defense response. Resulting complex story consists of many regulation events on various gene expression levels. Elucidating these processes may contribute to the knowledge on virus-host interactions and to evolving new antiviral strategies. In our work we applied a subtractive cloning technique to compare the transcriptomes of healthy and plum pox virus (PPV)-infected Nicotiana benthamiana plants. Several genes were found to be induced or repressed by the PPV infection. The induced genes were mainly related to general stress response or photosynthesis, several repressed genes could be connected with growth defects evoked by the infection. Interestingly, some genes usually up-regulated by fungal or bacterial infection were found repressed in PPV-infected plants. Potential involvement of particular differently expressed genes in the process of PPV infection is discussed.
Zhu, Yan; Chen, Longxian; Zhang, Chengjun; Hao, Pei; Jing, Xinyun; Li, Xuan
2017-01-25
Selaginella moellendorffii, a lycophyte, is a model plant to study the early evolution and development of vascular plants. As the first and only sequenced lycophyte to date, the genome of S. moellendorffii revealed many conserved genes and pathways, as well as specialized genes different from flowering plants. Despite the progress made, little is known about long noncoding RNAs (lncRNA) and the alternative splicing (AS) of coding genes in S. moellendorffii. Its coding gene models have not been fully validated with transcriptome data. Furthermore, it remains important to understand whether the regulatory mechanisms similar to flowering plants are used, and how they operate in a non-seed primitive vascular plant. RNA-sequencing (RNA-seq) was performed for three S. moellendorffii tissues, root, stem, and leaf, by constructing strand-specific RNA-seq libraries from RNA purified using RiboMinus isolation protocol. A total of 176 million reads (44 Gbp) were obtained from three tissue types, and were mapped to S. moellendorffii genome. By comparing with 22,285 existing gene models of S. moellendorffii, we identified 7930 high-confidence novel coding genes (a 35.6% increase), and for the first time reported 4422 lncRNAs in a lycophyte. Further, we refined 2461 (11.0%) of existing gene models, and identified 11,030 AS events (for 5957 coding genes) revealed for the first time for lycophytes. Tissue-specific gene expression with functional implication was analyzed, and 1031, 554, and 269 coding genes, and 174, 39, and 17 lncRNAs were identified in root, stem, and leaf tissues, respectively. The expression of critical genes for vascular development stages, i.e. formation of provascular cells, xylem specification and differentiation, and phloem specification and differentiation, was compared in S. moellendorffii tissues, indicating a less complex regulatory mechanism in lycophytes than in flowering plants. The results were further strengthened by the evolutionary trend of
Manak, Michael S.; Paul, Anna-Lisa; Sehnke, Paul C.; Ferl, Robert J.
2002-01-01
Transgenic arabidopsis plants containing the alcohol dehydrogenase (Adh) gene promoter fused to the green fluorescent protein (GFP) reporter gene were developed as biological sensors for monitoring physiological responses to unique environments. Plants were monitored in vivo during exposure to hypoxia, high salt, cold, and abcissic acid in experiments designed to characterize the utility and responses of the Adh/GFP biosensors. Plants in the presence of environmental stimuli that induced the Adh promoter responded by expressing GFP, which in turn generated a detectable fluorescent signal. The GFP signal degraded when the inducing stimulus was removed. Digital imaging of the Adh/GFP plants exposed to each of the exogenous stresses demonstrated that the stress-induced gene expression could be followed in real time. The experimental results established the feasibility of using a digital monitoring system for collecting gene expression data in real time from Transgenic Arabidopsis Gene Expression System (TAGES) biosensor plants during space exploration experiments.
Phylogenetic detection of numerous gene duplications shared by animals, fungi and plants
Zhou, Xiaofan; Lin, Zhenguo; Ma, Hong
2010-01-01
Background Gene duplication is considered a major driving force for evolution of genetic novelty, thereby facilitating functional divergence and organismal diversity, including the process of speciation. Animals, fungi and plants are major eukaryotic kingdoms and the divergences between them are some of the most significant evolutionary events. Although gene duplications in each lineage have been studied extensively in various contexts, the extent of gene duplication prior to the split of pla...
Fortifying Horticultural Crops with Essential Amino Acids: A Review.
Wang, Guoping; Xu, Mengyun; Wang, Wenyi; Galili, Gad
2017-06-19
To feed the world's growing population, increasing the yield of crops is not the only important factor, improving crop quality is also important, and it presents a significant challenge. Among the important crops, horticultural crops (particularly fruits and vegetables) provide numerous health compounds, such as vitamins, antioxidants, and amino acids. Essential amino acids are those that cannot be produced by the organism and, therefore, must be obtained from diet, particularly from meat, eggs, and milk, as well as a variety of plants. Extensive efforts have been devoted to increasing the levels of essential amino acids in plants. Yet, these efforts have been met with very little success due to the limited genetic resources for plant breeding and because high essential amino acid content is generally accompanied by limited plant growth. With a deep understanding of the biosynthetic pathways of essential amino acids and their interactions with the regulatory networks in plants, it should be possible to use genetic engineering to improve the essential amino acid content of horticultural plants, rendering these plants more nutritionally favorable crops. In the present report, we describe the recent advances in the enhancement of essential amino acids in horticultural plants and possible future directions towards their bio-fortification.
In-vitro antibacterial activity of essential oils extracted from locally available medicinal plants
International Nuclear Information System (INIS)
Ara, G.; Shawar, D.; Akbar, A.; Kanwal, F.; Imran, M.
2011-01-01
Extraction of essential oils from locally available species of four plants, Nigella sativa, Syzygium aromaticum, Cinnamomum tenuis and Curcuma aromatica was carried out using steam distillation followed by ether extraction. Dried and purified extracted oils were screened for their antibacterial activity against three bacterial strains namely, Bacillus lichaniformis (Gram +ve), Micrococcus leutus (Gram +ve) and Salmonella Typhimurium (Gram -ve) using Mc. Cartney's method. Minimum Inhibition Concentration (MIC) values of these oils were also determined. It was observed that the oils extracted from Nigella sativa and Cinnamomum tenuis were found to be more potent as compared to other two species. With the exception of Nigella sativa, all the other oils showed bacterial inhibition at 50 mmol concentration. These results support that these plant oils can be used to cure bacterial infections and may also have role as pharmaceuticals and preservatives. (author)
Directory of Open Access Journals (Sweden)
Aristides M. Leite
Full Text Available This study aimed to evaluate the molluscicidal and larvicidal activity of some essential oils and phytochemicals from medicinal plants. Molluscicide and larvicidal activity were determined by, respectively, the lethality bioassays using Artemia salina Leach. Artemiidae and Aedes aegypti L. Culicidae larvae. Essential oils from Eugenia uniflora L. Myrtaceae, Laurus nobilis L. Lauraceae, Origanum vulgare L. Lamiaceae and the phytochemicals α-pinene and eugenol presented citotoxicity toward Artemia salina with CL50 values between 9.59 and 253.43 μL/mL. Essential oils from E. uniflora, M. piperita, O. vulgare and R. officinalis showed embryotoxicity on Aedes aegypti larvae with a viability inhibition between 40 and 100%. These results show the bioactivity of the assayed essential oils and phytochemicals and, partially, justify their insertion in further evaluation in order to establish a safe exploitation of their biological potentiality.
Directory of Open Access Journals (Sweden)
Bowen Xu
2018-03-01
Full Text Available Summary: Self-renewal and differentiation of adult stem cells are tightly regulated partly through configuration of chromatin structure by chromatin remodelers. Using knockout mice, we here demonstrate that bromodomain PHD finger transcription factor (BPTF, a component of the nucleosome remodeling factor (NURF chromatin-remodeling complex, is essential for maintaining the population size of hematopoietic stem/progenitor cells (HSPCs, including long-term hematopoietic stem cells (HSCs. Bptf-deficient HSCs are defective in reconstituted hematopoiesis, and hematopoietic-specific knockout of Bptf caused profound defects including bone marrow failure and anemia. Genome-wide transcriptome profiling revealed that BPTF loss caused downregulation of HSC-specific gene-expression programs, which contain several master transcription factors (Meis1, Pbx1, Mn1, and Lmo2 required for HSC maintenance and self-renewal. Furthermore, we show that BPTF potentiates the chromatin accessibility of key HSC “stemness” genes. These results demonstrate an essential requirement of the chromatin remodeler BPTF and NURF for activation of “stemness” gene-expression programs and proper function of adult HSCs. : Wang and colleagues show that a chromatin remodeler, BPTF, sustains appropriate functions of hematopoietic stem/progenitor cells (HSPCs. BPTF loss causes bone marrow failure and anemia. The authors further define a BPTF-dependent gene-expression program in HSPCs, which contains key HSC stemness factors. These results demonstrate an essential requirement of the BPTF-associated chromatin remodelers for HSC functionality and adult hematopoiesis. Keywords: Bptf, hematopoietic stem cells, chromatin remodeler, Meis1, Pbx1, Mn1, DNA accessibility, NURF, AP1 complex
Cadmium resistance in tobacco plants expressing the MuSI gene.
Kim, Young-Nam; Kim, Ji-Seoung; Seo, Sang-Gyu; Lee, Youngwoo; Baek, Seung-Woo; Kim, Il-Sup; Yoon, Ho-Sung; Kim, Kwon-Rae; Kim, Sun-Hyung; Kim, Kye-Hoon
2011-10-01
MuSI, a gene that corresponds to a domain that contains the rubber elongation factor (REF), is highly homologous to many stress-related proteins in plants. Since MuSI is up-regulated in the roots of plants treated with cadmium or copper, the involvement of MuSI in cadmium tolerance was investigated in this study. Escherichia coli cells overexpressing MuSI were more resistant to Cd than wild-type cells transfected with vector alone. MuSI transgenic plants were also more resistant to Cd. MuSI transgenic tobacco plants absorbed less Cd than wild-type plants. Cd translocation from roots to shoots was reduced in the transgenic plants, thereby avoiding Cd toxicity. The number of short trichomes in the leaves of wild-type tobacco plants was increased by Cd treatment, while this was unchanged in MuSI transgenic tobacco. These results suggest that MuSI transgenic tobacco plants have enhanced tolerance to Cd via reduced Cd uptake and/or increased Cd immobilization in the roots, resulting in less Cd translocation to the shoots.
Mining predicted essential genes of Brugia malayi for nematode drug targets.
Directory of Open Access Journals (Sweden)
Sanjay Kumar
Full Text Available We report results from the first genome-wide application of a rational drug target selection methodology to a metazoan pathogen genome, the completed draft sequence of Brugia malayi, a parasitic nematode responsible for human lymphatic filariasis. More than 1.5 billion people worldwide are at risk of contracting lymphatic filariasis and onchocerciasis, a related filarial disease. Drug treatments for filariasis have not changed significantly in over 20 years, and with the risk of resistance rising, there is an urgent need for the development of new anti-filarial drug therapies. The recent publication of the draft genomic sequence for B. malayi enables a genome-wide search for new drug targets. However, there is no functional genomics data in B. malayi to guide the selection of potential drug targets. To circumvent this problem, we have utilized the free-living model nematode Caenorhabditis elegans as a surrogate for B. malayi. Sequence comparisons between the two genomes allow us to map C. elegans orthologs to B. malayi genes. Using these orthology mappings and by incorporating the extensive genomic and functional genomic data, including genome-wide RNAi screens, that already exist for C. elegans, we identify potentially essential genes in B. malayi. Further incorporation of human host genome sequence data and a custom algorithm for prioritization enables us to collect and rank nearly 600 drug target candidates. Previously identified potential drug targets cluster near the top of our prioritized list, lending credibility to our methodology. Over-represented Gene Ontology terms, predicted InterPro domains, and RNAi phenotypes of C. elegans orthologs associated with the potential target pool are identified. By virtue of the selection procedure, the potential B. malayi drug targets highlight components of key processes in nematode biology such as central metabolism, molting and regulation of gene expression.
Wanzala, W.W.; Hassanali, A.; Mukabana, W.R.; Takken, W.
2014-01-01
Essential oils of eight plants, selected after an ethnobotanical survey conducted in Bukusu community in Bungoma County, western Kenya (Tagetes minuta, Tithonia diversifolia, Juniperus procera, Solanecio mannii, Senna didymobotrya, Lantana camara, Securidaca longepedunculata, and Hoslundia
Are common symbiosis genes required for endophytic rice-rhizobial interactions?
Chen, Caiyan; Zhu, Hongyan
2013-09-01
Legume plants are able to establish root nodule symbioses with nitrogen-fixing bacteria, called rhizobia. Recent studies revealed that the root nodule symbiosis has co-opted the signaling pathway that mediates the ancestral mycorrhizal symbiosis that occurs in most land plants. Despite being unable to induce nodulation, rhizobia have been shown to be able to infect and colonize the roots of non-legumes such as rice. One fascinating question is whether establishment of such associations requires the common symbiosis (Sym) genes that are essential for infection of plant cells by mycorrhizal fungi and rhizobia in legumes. Here, we demonstrated that the common Sym genes are not required for endophytic colonization of rice roots by nitrogen-fixing rhizobia.
Rijo, Patrícia; Garcia, Catarina; Kalemba, Danuta; Toma, Monika; Szemraj, Janusz; Pytel, Dariusz; Śliwiński, Tomasz
2016-01-01
The essential oils were isolated by hydrodistillation from the hairy roots (HR) and roots of soil-grown plants (SGR) of Rhaponticum carthamoides and were analyzed by GC-MS method. In the both essential oils 62 compounds were identified. The root essential oils showed the differences in the qualitative and quantitative composition. The sesquiterpene hydrocarbons (55–62%) dominated in both essential oils. The major compounds of HR essential oil were cyperene, 13-norcypera-1(5),11(12)-diene, and cadalene while aplotaxene, nardosina-1(10),11-diene, and dauca-4(11),8-diene dominated in SGR essential oil. Both essential oils showed antibacterial activity especially against Enterococcus faecalis (ATCC 29212) and Pseudomonas aeruginosa (ATCC 27853) (MIC value = 125 µg/mL). HR and SGR essential oils also decreased the expression of IL-1β, IL-6, and TNF-α and the ROS level in LPS-treatment astrocytes. This is the first report to describe the chemical composition of R. carthamoides essential oil from hairy roots, its protective effect against LPS-induced inflammation and ROS production in astrocytes, and its antimicrobial potential. The results show that R. carthamoides hairy roots may be a valuable source of the essential oil and may be an alternative to the roots of soil-grown plants. PMID:28074117
Skała, Ewa; Rijo, Patrícia; Garcia, Catarina; Sitarek, Przemysław; Kalemba, Danuta; Toma, Monika; Szemraj, Janusz; Pytel, Dariusz; Wysokińska, Halina; Śliwiński, Tomasz
2016-01-01
The essential oils were isolated by hydrodistillation from the hairy roots (HR) and roots of soil-grown plants (SGR) of Rhaponticum carthamoides and were analyzed by GC-MS method. In the both essential oils 62 compounds were identified. The root essential oils showed the differences in the qualitative and quantitative composition. The sesquiterpene hydrocarbons (55-62%) dominated in both essential oils. The major compounds of HR essential oil were cyperene, 13-norcypera-1(5),11(12)-diene, and cadalene while aplotaxene, nardosina-1(10),11-diene, and dauca-4(11),8-diene dominated in SGR essential oil. Both essential oils showed antibacterial activity especially against Enterococcus faecalis (ATCC 29212) and Pseudomonas aeruginosa (ATCC 27853) (MIC value = 125 µ g/mL). HR and SGR essential oils also decreased the expression of IL-1 β , IL-6, and TNF- α and the ROS level in LPS-treatment astrocytes. This is the first report to describe the chemical composition of R. carthamoides essential oil from hairy roots, its protective effect against LPS-induced inflammation and ROS production in astrocytes, and its antimicrobial potential. The results show that R. carthamoides hairy roots may be a valuable source of the essential oil and may be an alternative to the roots of soil-grown plants.
Chenthamara, Komal; Zhang, Jian; Atanasova, Lea; Yang, Dongqing; Miao, Youzhi; Grujic, Marica; Pourmehdi, Shadi; Pretzer, Carina; Kopchinskiy, Alexey G.; Hundley, Hope; Wang, Mei; Aerts, Andrea; Salamov, Asaf; Lipzen, Anna; Barry, Kerrie; Grigoriev, Igor V.; Shen, Qirong; Kubicek, Christian P.
2018-01-01
Unlike most other fungi, molds of the genus Trichoderma (Hypocreales, Ascomycota) are aggressive parasites of other fungi and efficient decomposers of plant biomass. Although nutritional shifts are common among hypocrealean fungi, there are no examples of such broad substrate versatility as that observed in Trichoderma. A phylogenomic analysis of 23 hypocrealean fungi (including nine Trichoderma spp. and the related Escovopsis weberi) revealed that the genus Trichoderma has evolved from an ancestor with limited cellulolytic capability that fed on either fungi or arthropods. The evolutionary analysis of Trichoderma genes encoding plant cell wall-degrading carbohydrate-active enzymes and auxiliary proteins (pcwdCAZome, 122 gene families) based on a gene tree / species tree reconciliation demonstrated that the formation of the genus was accompanied by an unprecedented extent of lateral gene transfer (LGT). Nearly one-half of the genes in Trichoderma pcwdCAZome (41%) were obtained via LGT from plant-associated filamentous fungi belonging to different classes of Ascomycota, while no LGT was observed from other potential donors. In addition to the ability to feed on unrelated fungi (such as Basidiomycota), we also showed that Trichoderma is capable of endoparasitism on a broad range of Ascomycota, including extant LGT donors. This phenomenon was not observed in E. weberi and rarely in other mycoparasitic hypocrealean fungi. Thus, our study suggests that LGT is linked to the ability of Trichoderma to parasitize taxonomically related fungi (up to adelphoparasitism in strict sense). This may have allowed primarily mycotrophic Trichoderma fungi to evolve into decomposers of plant biomass. PMID:29630596
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Ling, Jun; Wang, Hui; Wu, Ping; Li, Tao; Tang, Yu; Naseer, Nawar; Zheng, Huiming; Masson-Boivin, Catherine; Zhong, Zengtao; Zhu, Jun
2016-11-29
Horizontal gene transfer (HGT) of genomic islands is a driving force of bacterial evolution. Many pathogens and symbionts use this mechanism to spread mobile genetic elements that carry genes important for interaction with their eukaryotic hosts. However, the role of the host in this process remains unclear. Here, we show that plant compounds inducing the nodulation process in the rhizobium-legume mutualistic symbiosis also enhance the transfer of symbiosis islands. We demonstrate that the symbiosis island of the Sesbania rostrata symbiont, Azorhizobium caulinodans, is an 87.6-kb integrative and conjugative element (ICE Ac ) that is able to excise, form a circular DNA, and conjugatively transfer to a specific site of gly-tRNA gene of other rhizobial genera, expanding their host range. The HGT frequency was significantly increased in the rhizosphere. An ICE Ac -located LysR-family transcriptional regulatory protein AhaR triggered the HGT process in response to plant flavonoids that induce the expression of nodulation genes through another LysR-type protein, NodD. Our study suggests that rhizobia may sense rhizosphere environments and transfer their symbiosis gene contents to other genera of rhizobia, thereby broadening rhizobial host-range specificity.
A contribution to the study of plant development evolution based on gene co-expression networks
Directory of Open Access Journals (Sweden)
Francisco J. Romero-Campero
2013-08-01
Full Text Available Phototrophic eukaryotes are among the most successful organisms on Earth due to their unparalleled efficiency at capturing light energy and fixing carbon dioxide to produce organic molecules. A conserved and efficient network of light-dependent regulatory modules could be at the bases of this success. This regulatory system conferred early advantages to phototrophic eukaryotes that allowed for specialization, complex developmental processes and modern plant characteristics. We have studied light-dependent gene regulatory modules from algae to plants employing integrative-omics approaches based on gene co-expression networks. Our study reveals some remarkably conserved ways in which eukaryotic phototrophs deal with day length and light signaling. Here we describe how a family of Arabidopsis transcription factors involved in photoperiod response has evolved from a single algal gene according to the innovation, amplification and divergence theory of gene evolution by duplication. These modifications of the gene co-expression networks from the ancient unicellular green algae Chlamydomonas reinhardtii to the modern brassica Arabidopsis thaliana may hint on the evolution and specialization of plants and other organisms.
Enhanced salt tolerance of alfalfa (Medicago sativa) by rstB gene transformation.
Zhang, Wan-Jun; Wang, Tao
2015-05-01
Generating salt tolerance forage plant is essential for use of the land affected by high salinity. A salt tolerance gene rstB was used as a selectable marker gene in Agrobacterium-mediated transformation of tobacco under a selective regime of 170mM NaCl. The transgenic plants showed clear improvement in salt tolerance. To improve salt tolerance of alfalfa (Medicago sativa L.), rstB gene was introduced into alfalfa genome by Agrobacterium-mediated transformation. No abnormal phenotype was observed among the transgenic plants when compared with wild type (wt) plants. Significant enhancement of resistance to salt-shock treatment was noted on the rstB transgenic (T0) plants. Transgenic second-generation (T1) seeds showed improved germination rate and seedling growth under salt-stress condition. Hindered Na(+) accumulation, but enhanced Ca(2+) accumulation was observed on the rstB T1 plants when subjected to salt-stresses. Enhanced calcium accumulation in transgenic plants was also verified by cytohistochemical localization of calcium. Under salt-stress of 50mM NaCl, about 15% of the transgenic plants finished their life-cycle but the wt plants had no flower formation. The results demonstrated that the expression of rstB gene improved salt tolerance in transgenic alfalfa. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Bargsten, Joachim W; Folta, Adam; Mlynárová, Ludmila; Nap, Jan-Peter
2013-01-01
As part of large protein complexes, Snf2 family ATPases are responsible for energy supply during chromatin remodeling, but the precise mechanism of action of many of these proteins is largely unknown. They influence many processes in plants, such as the response to environmental stress. This analysis is the first comprehensive study of Snf2 family ATPases in plants. We here present a comparative analysis of 1159 candidate plant Snf2 genes in 33 complete and annotated plant genomes, including two green algae. The number of Snf2 ATPases shows considerable variation across plant genomes (17-63 genes). The DRD1, Rad5/16 and Snf2 subfamily members occur most often. Detailed analysis of the plant-specific DRD1 subfamily in related plant genomes shows the occurrence of a complex series of evolutionary events. Notably tomato carries unexpected gene expansions of DRD1 gene members. Most of these genes are expressed in tomato, although at low levels and with distinct tissue or organ specificity. In contrast, the Snf2 subfamily genes tend to be expressed constitutively in tomato. The results underpin and extend the Snf2 subfamily classification, which could help to determine the various functional roles of Snf2 ATPases and to target environmental stress tolerance and yield in future breeding.
The ERECTA gene regulates plant transpiration efficiency in Arabidopsis.
Masle, Josette; Gilmore, Scott R; Farquhar, Graham D
2005-08-11
Assimilation of carbon by plants incurs water costs. In the many parts of the world where water is in short supply, plant transpiration efficiency, the ratio of carbon fixation to water loss, is critical to plant survival, crop yield and vegetation dynamics. When challenged by variations in their environment, plants often seem to coordinate photosynthesis and transpiration, but significant genetic variation in transpiration efficiency has been identified both between and within species. This has allowed plant breeders to develop effective selection programmes for the improved transpiration efficiency of crops, after it was demonstrated that carbon isotopic discrimination, Delta, of plant matter was a reliable and sensitive marker negatively related to variation in transpiration efficiency. However, little is known of the genetic controls of transpiration efficiency. Here we report the isolation of a gene that regulates transpiration efficiency, ERECTA. We show that ERECTA, a putative leucine-rich repeat receptor-like kinase (LRR-RLK) known for its effects on inflorescence development, is a major contributor to a locus for Delta on Arabidopsis chromosome 2. Mechanisms include, but are not limited to, effects on stomatal density, epidermal cell expansion, mesophyll cell proliferation and cell-cell contact.
Wang, Feng; Liang, Yuting; Jiang, Yuji; Yang, Yunfeng; Xue, Kai; Xiong, Jinbo; Zhou, Jizhong; Sun, Bo
2015-09-23
Plants have an important impact on soil microbial communities and their functions. However, how plants determine the microbial composition and network interactions is still poorly understood. During a four-year field experiment, we investigated the functional gene composition of three types of soils (Phaeozem, Cambisols and Acrisol) under maize planting and bare fallow regimes located in cold temperate, warm temperate and subtropical regions, respectively. The core genes were identified using high-throughput functional gene microarray (GeoChip 3.0), and functional molecular ecological networks (fMENs) were subsequently developed with the random matrix theory (RMT)-based conceptual framework. Our results demonstrated that planting significantly (P soils and 83.5% of microbial alpha-diversity can be explained by the plant factor. Moreover, planting had significant impacts on the microbial community structure and the network interactions of the microbial communities. The calculated network complexity was higher under maize planting than under bare fallow regimes. The increase of the functional genes led to an increase in both soil respiration and nitrification potential with maize planting, indicating that changes in the soil microbial communities and network interactions influenced ecological functioning.
Energy Technology Data Exchange (ETDEWEB)
Tsai, Fongying; Coruzzi, G. (Rockefeller Univ., New York, NY (United States))
1991-10-01
Asparagine synthetase (AS) mRNA in Pisum sativum accumulates preferentially in plants grown in the dark. Nuclear run-on experiments demonstrate that expression of both the AS1 and AS2 genes is negatively regulated by light at the level of transcription. A decrease in the transcriptional rate of the AS1 gene can be detected as early as 20 min after exposure to light. Time course experiments reveal that the levels of AS mRNA fluctuate dramatically during a normal light/dark cycle. This is due to a direct effect of light and not to changes associated with circadian rhythm. A novel finding is that the light-repressed expression of the AS1 gene is as dramatic nonphotosynthetic organs such as roots as it is in leaves. Experiments demonstrate that the small amount of light which passes through the soil is sufficient to repress AS1 expression in roots, indicating that light has a direct effect on AS1 gene expression in roots. The negative regulation of AS gene expression by light was shown to be a general phenomenon in plants which also occurs in nonlegumes such as Nicotiana plumbaginifolia and Nicotiana tabacum. Thus, the AS genes can serve as a model with which to dissect the molecular basis for light-regulated transcriptional repression in plants.
International Nuclear Information System (INIS)
Arif, A.; Mohsin, A.M.; Shafiq, S.; Zafar, Y.; Hameed, S.M.; Arif, M.; Javed, M.; Gaxiola, R.A.
2005-01-01
Drought and salinity are global problems. In Pakistan these problems are increasing to an alarming situation due to low rain-fall and bad agricultural practices. Salt and drought stress shows a high degree of similarity with respect to physiological, biochemical, molecular and genetic effects. This is due to the fact that sub-lethal salt-stress condition is ultimately an osmotic effect which is apparently similar to that brought in by water deficit. Genetic engineering allows the re-introduction of plant genes into their genomes by increasing their expression level. Plant vacuoles play a central role in cellular mechanisms of adaptation to salinity and drought stresses. In principle, increased vacuolar solute accumulation should have a positive impact in the adaptation of plants to salinity and drought. The active transport of the solutes depends on the proton gradients established by proton pumps. We have over expressed Arabidopsis gene AVP1 (Arabidopsis thaliana vacuolar pyro phosphatase H/sup +/ pump) to increase drought/salt tolerance in tobacco. The AVP1 ORF with a tandem repeat of 358 promoter was cloned in pPZP212 vector and Agrobacterium-mediated transformation was performed. Transgenic plants were selected on plant nutrient agar medium supplemented with 50 mg/liter kanamycin. Transgenic plants were confirmed for transfer of genes by AVP1 and nptll gene specific PCR and Southern hybridization. AVP1 transgenic plants were screened for salt tolerance by providing NaCl solution in addition to nutrient solution. AVP1 transgenic plants showed tolerance up to 300 mM NaCl as compared to control which died ten days after 200 mM NaCl. Sodium and potassium were measured in salt treated and control plants. Results showed that sodium ion uptake in the salt treated transgenic plants was four times more as compared to wild type. This remarkable increase in Na/sup +/ ion uptake indicates that AVP1 vacuole proton pumps are actively involved in the transport of Na
Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants.
Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako
2009-02-01
Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.
Plant gene bank and vegetable varieties biodiversity in Smederevska Palanka
Directory of Open Access Journals (Sweden)
Pavlović Nenad
2011-01-01
Full Text Available Biodiversity protection and preservation of genetic variability is based on the fact that plant varieties are irreplaceable in production process and that they are more and more jeopardized by urban and industrial development. The most common way of preserving and at the same time the safest way is a storage in a gene bank. Prior to storage comes collecting, studying and replanting for Institute Gene Bank, Central State Gene Bank and for Regional Gene Banks. Institute for Vegetable Crops in Smederevska Palanka preserves a wide variety of vegetable germplasm. This is, so called, work collection, used as a gene resource for breeding purposes. Seed samples are stored at 4±2°C and 50% relative humidity. At the moment, the collection has 2265 samples. Almost all samples have the passport data, but only 10% of samples have been further characterized and evaluated.
The ALMT Gene Family Performs Multiple Functions in Plants
Directory of Open Access Journals (Sweden)
Jie Liu
2018-02-01
Full Text Available The aluminium activated malate transporter (ALMT gene family is named after the first member of the family identified in wheat (Triticum aestivum L.. The product of this gene controls resistance to aluminium (Al toxicity. ALMT genes encode transmembrane proteins that function as anion channels and perform multiple functions involving the transport of organic anions (e.g., carboxylates and inorganic anions in cells. They share a PF11744 domain and are classified in the Fusaric acid resistance protein-like superfamily, CL0307. The proteins typically have five to seven transmembrane regions in the N-terminal half and a long hydrophillic C-terminal tail but predictions of secondary structure vary. Although widely spread in plants, relatively little information is available on the roles performed by other members of this family. In this review, we summarized functions of ALMT gene families, including Al resistance, stomatal function, mineral nutrition, microbe interactions, fruit acidity, light response and seed development.
Directory of Open Access Journals (Sweden)
Alessandra Farias Millezi
2012-03-01
Full Text Available Several essential oils of condiment and medicinal plants possess proven antimicrobial activity and are of important interest for the food industry. Therefore, the Minimum Inhibitory Concentrations (MIC of those oils should be determined for various bacteria. MIC varies according to the oil used, the major compounds, and the physiology of the bacterium under study. In the present study, the essential oils of the plants Thymus vulgaris (time, Cymbopogon citratus (lemongrass and Laurus nobilis (bay were chemically quantified, and the MIC was determined on the bacteria Staphylococcus aureus ATCC 25923, Escherichia coli ATCC 25922, Listeria monocytogenes ATCC 19117, Salmonella enterica Enteritidis S64, and Pseudomonas aeruginosa ATCC 27853. The essential oil of C. citratus demonstrated bacterial activity at all concentrations tested and against all of the bacteria tested. The majority of essential oil compounds were geranial and neral. The major constituent of T. vulgaris was 1.8-cineol and of L. nobilis was linalool, which presented lower antibacterial activity, followed by 1.8-cineol. The Gram-negative bacteria demonstrated higher resistance to the use of the essential oils tested in this study. E. coli was the least sensitive and was inhibited only by the oils of C. citratus and L. nobilis.
DEFF Research Database (Denmark)
Panina, Svetlana; Stephan, Alexander; la Cour, Jonas Marstrand
2012-01-01
Calmodulin (CaM) was shown to be essential for survival of lower eukaryotes by gene deletion experiments. So far, no CaM gene deletion was reported in higher eukaryotes. In vertebrates, CaM is expressed from several genes, which encode an identical protein, making it difficult to generate a model...... system to study the effect ofCaMgene deletion. Here, we present a novel genetic system based on the chicken DT40 cell line, in which the two functional CaM genes were deleted and one allele replaced with a CaM transgene that can be artificially regulated.Weshow that CaM is essential for survival...
Gene Discovery and Functional Analyses in the Model Plant Arabidopsis
DEFF Research Database (Denmark)
Feng, Cai-ping; Mundy, J.
2006-01-01
The present mini-review describes newer methods and strategies, including transposon and T-DNA insertions, TILLING, Deleteagene, and RNA interference, to functionally analyze genes of interest in the model plant Arabidopsis. The relative advantages and disadvantages of the systems are also discus...
Directory of Open Access Journals (Sweden)
Francisco Torres-Avilés
2014-03-01
Conclusion: Application of different statistical analyses to detect potential resistance genes reliably has shown to conduct interesting results that improve knowledge on molecular mechanisms of plant resistance to pathogens.
Gene Delivery into Plant Cells for Recombinant Protein Production
Directory of Open Access Journals (Sweden)
Qiang Chen
2015-01-01
Full Text Available Recombinant proteins are primarily produced from cultures of mammalian, insect, and bacteria cells. In recent years, the development of deconstructed virus-based vectors has allowed plants to become a viable platform for recombinant protein production, with advantages in versatility, speed, cost, scalability, and safety over the current production paradigms. In this paper, we review the recent progress in the methodology of agroinfiltration, a solution to overcome the challenge of transgene delivery into plant cells for large-scale manufacturing of recombinant proteins. General gene delivery methodologies in plants are first summarized, followed by extensive discussion on the application and scalability of each agroinfiltration method. New development of a spray-based agroinfiltration and its application on field-grown plants is highlighted. The discussion of agroinfiltration vectors focuses on their applications for producing complex and heteromultimeric proteins and is updated with the development of bridge vectors. Progress on agroinfiltration in Nicotiana and non-Nicotiana plant hosts is subsequently showcased in context of their applications for producing high-value human biologics and low-cost and high-volume industrial enzymes. These new advancements in agroinfiltration greatly enhance the robustness and scalability of transgene delivery in plants, facilitating the adoption of plant transient expression systems for manufacturing recombinant proteins with a broad range of applications.
Sui, Jin-Lei; Xiao, Xiao-Hu; Qi, Ji-Yan; Fang, Yong-Jun; Tang, Chao-Rong
2017-12-01
SWEET proteins play an indispensable role as a sugar efflux transporter in plant development and stress responses. The SWEET genes have previously been characterized in several plants. Here, we present a comprehensive analysis of this gene family in the rubber tree, Hevea brasiliensis . There are 36 members of the SWEET gene family in this species, making it one of the largest families in plant genomes sequenced so far. Structure and phylogeny analyses of these genes in Hevea and in other species demonstrated broad evolutionary conservation. RNA-seq analyses revealed that SWEET2, 16, and 17 might represent the main evolutionary direction of SWEET genes in plants. Our results in Hevea suggested the involvement of HbSWEET1a , 2e , 2f , and 3b in phloem loading, HbSWEET10a and 16b in laticifer sugar transport , and HbSWEET9a in nectary-specific sugar transport. Parallel studies of RNA-seq analyses extended to three other plant species ( Manihot esculenta , Populus trichocarpa , and Arabidopsis thaliana ) produced findings which implicated MeSWEET10a, 3a, and 15b in M. esculenta storage root development, and the involvement of PtSWEET16b and PtSWEET16d in P. trichocarpa xylem development. RT-qPCR results further revealed that HbSWEET10a, 16b, and 1a play important roles in phloem sugar transport. The results from this study provide a foundation not only for further investigation into the functionality of the SWEET gene family in Hevea, especially in its sugar transport for latex production, but also for related studies of this gene family in the plant kingdom.
Directory of Open Access Journals (Sweden)
Li Min
2012-03-01
Full Text Available Abstract Background Identification of essential proteins is always a challenging task since it requires experimental approaches that are time-consuming and laborious. With the advances in high throughput technologies, a large number of protein-protein interactions are available, which have produced unprecedented opportunities for detecting proteins' essentialities from the network level. There have been a series of computational approaches proposed for predicting essential proteins based on network topologies. However, the network topology-based centrality measures are very sensitive to the robustness of network. Therefore, a new robust essential protein discovery method would be of great value. Results In this paper, we propose a new centrality measure, named PeC, based on the integration of protein-protein interaction and gene expression data. The performance of PeC is validated based on the protein-protein interaction network of Saccharomyces cerevisiae. The experimental results show that the predicted precision of PeC clearly exceeds that of the other fifteen previously proposed centrality measures: Degree Centrality (DC, Betweenness Centrality (BC, Closeness Centrality (CC, Subgraph Centrality (SC, Eigenvector Centrality (EC, Information Centrality (IC, Bottle Neck (BN, Density of Maximum Neighborhood Component (DMNC, Local Average Connectivity-based method (LAC, Sum of ECC (SoECC, Range-Limited Centrality (RL, L-index (LI, Leader Rank (LR, Normalized α-Centrality (NC, and Moduland-Centrality (MC. Especially, the improvement of PeC over the classic centrality measures (BC, CC, SC, EC, and BN is more than 50% when predicting no more than 500 proteins. Conclusions We demonstrate that the integration of protein-protein interaction network and gene expression data can help improve the precision of predicting essential proteins. The new centrality measure, PeC, is an effective essential protein discovery method.
Ning, Jue; Otto, Thomas D; Pfander, Claudia; Schwach, Frank; Brochet, Mathieu; Bushell, Ellen; Goulding, David; Sanders, Mandy; Lefebvre, Paul A; Pei, Jimin; Grishin, Nick V; Vanderlaan, Gary; Billker, Oliver; Snell, William J
2013-05-15
Fertilization is a crucial yet poorly characterized event in eukaryotes. Our previous discovery that the broadly conserved protein HAP2 (GCS1) functioned in gamete membrane fusion in the unicellular green alga Chlamydomonas and the malaria pathogen Plasmodium led us to exploit the rare biological phenomenon of isogamy in Chlamydomonas in a comparative transcriptomics strategy to uncover additional conserved sexual reproduction genes. All previously identified Chlamydomonas fertilization-essential genes fell into related clusters based on their expression patterns. Out of several conserved genes in a minus gamete cluster, we focused on Cre06.g280600, an ortholog of the fertilization-related Arabidopsis GEX1. Gene disruption, cell biological, and immunolocalization studies show that CrGEX1 functions in nuclear fusion in Chlamydomonas. Moreover, CrGEX1 and its Plasmodium ortholog, PBANKA_113980, are essential for production of viable meiotic progeny in both organisms and thus for mosquito transmission of malaria. Remarkably, we discovered that the genes are members of a large, previously unrecognized family whose first-characterized member, KAR5, is essential for nuclear fusion during yeast sexual reproduction. Our comparative transcriptomics approach provides a new resource for studying sexual development and demonstrates that exploiting the data can lead to the discovery of novel biology that is conserved across distant taxa.
Mutated genes as research tool
International Nuclear Information System (INIS)
1981-01-01
Green plants are the ultimate source of all resources required for man's life, his food, his clothes, and almost all his energy requirements. Primitive prehistoric man could live from the abundance of nature surrounding him. Man today, dominating nature in terms of numbers and exploiting its limited resources, cannot exist without employing his intelligence to direct natural evolution. Plant sciences, therefore, are not a matter of curiosity but an essential requirement. From such considerations, the IAEA and FAO jointly organized a symposium to assess the value of mutation research for various kinds of plant science, which directly or indirectly might contribute to sustaining and improving crop production. The benefit through developing better cultivars that plant breeders can derive from using the additional genetic resources resulting from mutation induction has been assessed before at other FAO/IAEA meetings (Rome 1964, Pullman 1969, Ban 1974, Ibadan 1978) and is also monitored in the Mutation Breeding Newsletter, published by IAEA twice a year. Several hundred plant cultivars which carry economically important characters because their genes have been altered by ionizing radiation or other mutagens, are grown by farmers and horticulturists in many parts of the world. But the benefit derived from such mutant varieties is without any doubt surpassed by the contribution which mutation research has made towards the advancement of genetics. For this reason, a major part of the papers and discussions at the symposium dealt with the role induced-mutation research played in providing insight into gene action and gene interaction, the organization of genes in plant chromosomes in view of homology and homoeology, the evolutionary role of gene duplication and polyploidy, the relevance of gene blocks, the possibilities for chromosome engineering, the functioning of cytroplasmic inheritance and the genetic dynamics of populations. In discussing the evolutionary role of
Directory of Open Access Journals (Sweden)
Fatiha Righi Assia
2014-07-01
Full Text Available Chickpea (Cicer arietinum L. is a valuable foodstuff but unfortunately this legume is prone to insect attacks from the chick pea weevil (Callosobruchus chinensis L.. This serious pest damages the chickpea and causes decreases in the yield and in the nutritional quality. Biological control is being used to deal with this problem. We tried different doses of the essential oils of three new medicinal plants, namely Salvia verbenaca L., Scilla maritima L., and Artemisia herba-alba Asso to limit the damage of the chick pea weevil pest, and to protect consumer’s health. To determine the effect and efficiency of the oil, the tests were conducted using the different biological parameters of fertility, longevity, and fecundity, under controlled temperature and relative humidity (28°C and 75%. The effectiveness of organic oils was demonstrated. We tested these oils on the germination of seeds. The obtained results showed that the tested plant oils have a real organic insecticide effect. The essential oil of Artemisia proved most effective as a biocide; achieving a mortality rate of 100%. A significant reduction in longevity was observed under the effect of 30 μl of S. maritima (1.3 days and S. verbenaca (2.8, 4.6 days, respectively, for males and females compared to 8 and 15 days for the control. For fecundity, an inhibition of oviposition was obtained using 30 μl of Salvia and Scilla essential oils. The test on the seed germination using different essential oils, showed no damage to the germinating seeds. The germination rate was 99%. These findings suggest that the tested plants can be used as a bioinsecticide for control of the C. chinensis pest of stored products.
Heendeniya, Ravindra G; Yu, Peiqiang
2017-03-20
Alfalfa ( Medicago sativa L.) genotypes transformed with Lc-bHLH and Lc transcription genes were developed with the intention of stimulating proanthocyanidin synthesis in the aerial parts of the plant. To our knowledge, there are no studies on the effect of single-gene and two-gene transformation on chemical functional groups and molecular structure changes in these plants. The objective of this study was to use advanced molecular spectroscopy with multivariate chemometrics to determine chemical functional group intensity and molecular structure changes in alfalfa plants when co-expressing Lc-bHLH and C1-MYB transcriptive flavanoid regulatory genes in comparison with non-transgenic (NT) and AC Grazeland (ACGL) genotypes. The results showed that compared to NT genotype, the presence of double genes ( Lc and C1 ) increased ratios of both the area and peak height of protein structural Amide I/II and the height ratio of α-helix to β-sheet. In carbohydrate-related spectral analysis, the double gene-transformed alfalfa genotypes exhibited lower peak heights at 1370, 1240, 1153, and 1020 cm -1 compared to the NT genotype. Furthermore, the effect of double gene transformation on carbohydrate molecular structure was clearly revealed in the principal component analysis of the spectra. In conclusion, single or double transformation of Lc and C1 genes resulted in changing functional groups and molecular structure related to proteins and carbohydrates compared to the NT alfalfa genotype. The current study provided molecular structural information on the transgenic alfalfa plants and provided an insight into the impact of transgenes on protein and carbohydrate properties and their molecular structure's changes.
Fertilization: a sticky sperm protein in plants.
Dresselhaus, Thomas; Snell, William J
2014-02-17
During fertilization in eukaryotes, gametes of the opposite sex undergo a complex series of interactions that culminate in cell fusion. A new study on gamete interaction in plants has identified the first protein in multicellular organisms shown by gene disruption to be essential for gamete membrane adhesion. Copyright © 2014 Elsevier Ltd. All rights reserved.
Evolutionary Fates and Dynamic Functionalization of Young Duplicate Genes in Arabidopsis Genomes.
Wang, Jun; Tao, Feng; Marowsky, Nicholas C; Fan, Chuanzhu
2016-09-01
Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. © 2016 American Society of Plant Biologists. All rights reserved.
Xu, Bowen; Cai, Ling; Butler, Jason M; Chen, Dongliang; Lu, Xiongdong; Allison, David F; Lu, Rui; Rafii, Shahin; Parker, Joel S; Zheng, Deyou; Wang, Gang Greg
2018-03-13
Self-renewal and differentiation of adult stem cells are tightly regulated partly through configuration of chromatin structure by chromatin remodelers. Using knockout mice, we here demonstrate that bromodomain PHD finger transcription factor (BPTF), a component of the nucleosome remodeling factor (NURF) chromatin-remodeling complex, is essential for maintaining the population size of hematopoietic stem/progenitor cells (HSPCs), including long-term hematopoietic stem cells (HSCs). Bptf-deficient HSCs are defective in reconstituted hematopoiesis, and hematopoietic-specific knockout of Bptf caused profound defects including bone marrow failure and anemia. Genome-wide transcriptome profiling revealed that BPTF loss caused downregulation of HSC-specific gene-expression programs, which contain several master transcription factors (Meis1, Pbx1, Mn1, and Lmo2) required for HSC maintenance and self-renewal. Furthermore, we show that BPTF potentiates the chromatin accessibility of key HSC "stemness" genes. These results demonstrate an essential requirement of the chromatin remodeler BPTF and NURF for activation of "stemness" gene-expression programs and proper function of adult HSCs. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Sahito, S.R.; Kazi, T.G.; Shar, G.Q.; Mangrio, A.M; Shaikh, M.S.
2004-01-01
The role of elements particularly trace elements in health and disease is well known. Present study has been undertaken in our laboratories to quantify the commonly occurring elements in three medicinal plans. Peganum harmala Linn, Phyllanthus emblica Linn, Tamarix dioca used for stomach problems using atomic absorption spectrophotometer. Wet digestion method has been used to extract the acid extractable metals. Samples were boiled in water to obtain water extractable metals. The validation of the method was checked with the NBS-1570 (Spinach) as Standard Reference Material. Levels of essential elements were found high as compared to concentration of toxic elements. The considerable amounts of essential such as calcium, magnesium, potassium, zinc and iron were found in all these plant samples. (author)
Molecular responses in root-associative rhizospheric bacteria to variations in plant exudates
Abdoun, Hamid; McMillan, Mary; Pereg, Lily
2015-04-01
Plant exudates are a major factor in the interface of plant-soil-microbe interactions and it is well documented that the microbial community structure in the rhizosphere is largely influenced by the particular exudates excreted by various plants. Azospirillum brasilense is a plant growth promoting rhizobacterium that is known to interact with a large number of plants, including important food crops. The regulatory gene flcA has an important role in this interaction as it controls morphological differentiation of the bacterium that is essential for attachment to root surfaces. Being a response regulatory gene, flcA mediates the response of the bacterial cell to signals from the surrounding rhizosphere. This makes this regulatory gene a good candidate for analysis of the response of bacteria to rhizospheric alterations, in this case, variations in root exudates. We will report on our studies on the response of Azospirillum, an ecologically, scientifically and agriculturally important bacterial genus, to variations in the rhizosphere.
Hackenberg, Claudia; Kern, Ramona; Hüge, Jan; Stal, Lucas J.; Tsuji, Yoshinori; Kopka, Joachim; Shiraiwa, Yoshihiro; Bauwe, Hermann; Hagemann, Martin
2011-01-01
Glycolate oxidase (GOX) is an essential enzyme involved in photorespiratory metabolism in plants. In cyanobacteria and green algae, the corresponding reaction is catalyzed by glycolate dehydrogenases (GlcD). The genomes of N2-fixing cyanobacteria, such as Nostoc PCC 7120 and green algae, appear to harbor genes for both GlcD and GOX proteins. The GOX-like proteins from Nostoc (No-LOX) and from Chlamydomonas reinhardtii showed high l-lactate oxidase (LOX) and low GOX activities, whereas glycolate was the preferred substrate of the phylogenetically related At-GOX2 from Arabidopsis thaliana. Changing the active site of No-LOX to that of At-GOX2 by site-specific mutagenesis reversed the LOX/GOX activity ratio of No-LOX. Despite its low GOX activity, No-LOX overexpression decreased the accumulation of toxic glycolate in a cyanobacterial photorespiratory mutant and restored its ability to grow in air. A LOX-deficient Nostoc mutant grew normally in nitrate-containing medium but died under N2-fixing conditions. Cultivation under low oxygen rescued this lethal phenotype, indicating that N2 fixation was more sensitive to O2 in the Δlox Nostoc mutant than in the wild type. We propose that LOX primarily serves as an O2-scavenging enzyme to protect nitrogenase in extant N2-fixing cyanobacteria, whereas in plants it has evolved into GOX, responsible for glycolate oxidation during photorespiration. PMID:21828292
Directory of Open Access Journals (Sweden)
Cíntia Alvarenga Santos Fraga de Miranda
2015-07-01
Full Text Available In recent years, essential oils have gained commercial interest in the agricultural area, mainly for their allelopathic, insecticidal, antifungal, antimicrobial and antioxidant properties, and, also for their natural compounds, which have generally displayed low toxicity, relatively low cost and rapid degradation in the environment. Medicinal plants have emerged as potential suppliers of essential oils because of their ethnopharmacological utility. The aim of this study was to evaluate the allelopathic potential of essential oils extracted from fresh leaves of lemon grass (Cymbopogon citratus, wild basil (Ocimum gratissimum L. and sweet basil (Ocimum basilicum L. with regard to their major constituents (citral, eugenol and cineol, respectively in different application forms (direct contact and the effect of volatile constituents on the germination and vigor of lettuce seeds (cultivar Regina SF 3500. The effects of the oils and their major components were evaluated with regard to the variables: first germination count, total germination, GVI (germination velocity index, seedling dry weight and average lengths of shoots and lettuce roots. The essential oils from lemon grass and basil displayed allelopathic potentials on seed germination and vigor of lettuce achenes that can be assigned to their respective major constituents citral and eugenol. On the other hand, the allelopathic effect of the essential oil from basil was a consequence of the combined effect of all the components, regardless the application method.
Global SUMO proteome responses guide gene regulation, mRNA biogenesis, and plant stress responses
Directory of Open Access Journals (Sweden)
Magdalena eMazur
2012-09-01
Full Text Available Small-ubiquitin-like MOdifier (SUMO is a key regulator of abiotic stress, disease resistance and development in plants. The identification of >350 plant SUMO targets has revealed many processes modulated by SUMO and potential consequences of SUMO on its targets. Importantly, highly related proteins are SUMO-modified in plants, yeast, and metazoans. Overlapping SUMO targets include heat-shock proteins, transcription regulators, histones, histone-modifying enzymes, proteins involved in DNA damage repair, but also proteins involved in mRNA biogenesis and nucleo-cytoplasmic transport. Proteomics studies indicate key roles for SUMO in gene repression by controlling histone (deacetylation activity at genomic loci. The responsible heavily sumoylated transcriptional repressor complexes are recruited by EAR (Ethylene-responsive element binding factor [ERF]-associated Amphiphilic Repression-motif containing transcription factors in plants. These transcription factors are not necessarily themselves a SUMO target. Conversely, SUMO acetylation prevents binding of downstream partners by preventing binding of SIMs (SUMO-interaction peptide motifs presents in these partners, while SUMO acetylation has emerged as mechanism to recruit specifically bromodomains; bromodomain are generally linked with gene activation. These findings strengthen the idea of a bidirectional sumo-/acetylation switch in gene regulation. Quantitative proteomics has highlighted that global sumoylation provides a dynamic response to protein damage involving SUMO chain-mediated protein degradation, but also SUMO E3 ligase-dependent transcription of HSP (Heat-shock protein genes. With these insights in SUMO function and novel technical advancements, we can now study SUMO dynamics in responses to (abiotic stress in plants.
Ranjan, Aashish; Ichihashi, Yasunori; Farhi, Moran; Zumstein, Kristina; Townsley, Brad; David-Schwartz, Rakefet; Sinha, Neelima R
2014-11-01
Parasitic flowering plants are one of the most destructive agricultural pests and have major impact on crop yields throughout the world. Being dependent on finding a host plant for growth, parasitic plants penetrate their host using specialized organs called haustoria. Haustoria establish vascular connections with the host, which enable the parasite to steal nutrients and water. The underlying molecular and developmental basis of parasitism by plants is largely unknown. In order to investigate the process of parasitism, RNAs from different stages (i.e. seed, seedling, vegetative strand, prehaustoria, haustoria, and flower) were used to de novo assemble and annotate the transcriptome of the obligate plant stem parasite dodder (Cuscuta pentagona). The assembled transcriptome was used to dissect transcriptional dynamics during dodder development and parasitism and identified key gene categories involved in the process of plant parasitism. Host plant infection is accompanied by increased expression of parasite genes underlying transport and transporter categories, response to stress and stimuli, as well as genes encoding enzymes involved in cell wall modifications. By contrast, expression of photosynthetic genes is decreased in the dodder infective stages compared with normal stem. In addition, genes relating to biosynthesis, transport, and response of phytohormones, such as auxin, gibberellins, and strigolactone, were differentially expressed in the dodder infective stages compared with stems and seedlings. This analysis sheds light on the transcriptional changes that accompany plant parasitism and will aid in identifying potential gene targets for use in controlling the infestation of crops by parasitic weeds. © 2014 American Society of Plant Biologists. All Rights Reserved.
Directory of Open Access Journals (Sweden)
Joachim W Bargsten
Full Text Available As part of large protein complexes, Snf2 family ATPases are responsible for energy supply during chromatin remodeling, but the precise mechanism of action of many of these proteins is largely unknown. They influence many processes in plants, such as the response to environmental stress. This analysis is the first comprehensive study of Snf2 family ATPases in plants. We here present a comparative analysis of 1159 candidate plant Snf2 genes in 33 complete and annotated plant genomes, including two green algae. The number of Snf2 ATPases shows considerable variation across plant genomes (17-63 genes. The DRD1, Rad5/16 and Snf2 subfamily members occur most often. Detailed analysis of the plant-specific DRD1 subfamily in related plant genomes shows the occurrence of a complex series of evolutionary events. Notably tomato carries unexpected gene expansions of DRD1 gene members. Most of these genes are expressed in tomato, although at low levels and with distinct tissue or organ specificity. In contrast, the Snf2 subfamily genes tend to be expressed constitutively in tomato. The results underpin and extend the Snf2 subfamily classification, which could help to determine the various functional roles of Snf2 ATPases and to target environmental stress tolerance and yield in future breeding.
Diversity of beetle genes encoding novel plant cell wall degrading enzymes.
Directory of Open Access Journals (Sweden)
Yannick Pauchet
Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.
Directory of Open Access Journals (Sweden)
Wentao Wu
2017-10-01
Full Text Available The plant hormone auxin plays pivotal roles in many aspects of plant growth and development. The auxin/indole-3-acetic acid (Aux/IAA gene family encodes short-lived nuclear proteins acting on auxin perception and signaling, but the evolutionary history of this gene family remains to be elucidated. In this study, the Aux/IAA gene family in 17 plant species covering all major lineages of plants is identified and analyzed by using multiple bioinformatics methods. A total of 434 Aux/IAA genes was found among these plant species, and the gene copy number ranges from three (Physcomitrella patens to 63 (Glycine max. The phylogenetic analysis shows that the canonical Aux/IAA proteins can be generally divided into five major clades, and the origin of Aux/IAA proteins could be traced back to the common ancestor of land plants and green algae. Many truncated Aux/IAA proteins were found, and some of these truncated Aux/IAA proteins may be generated from the C-terminal truncation of auxin response factor (ARF proteins. Our results indicate that tandem and segmental duplications play dominant roles for the expansion of the Aux/IAA gene family mainly under purifying selection. The putative nuclear localization signals (NLSs in Aux/IAA proteins are conservative, and two kinds of new primordial bipartite NLSs in P. patens and Selaginella moellendorffii were discovered. Our findings not only give insights into the origin and expansion of the Aux/IAA gene family, but also provide a basis for understanding their functions during the course of evolution.
Wu, Wentao; Liu, Yaxue; Wang, Yuqian; Li, Huimin; Liu, Jiaxi; Tan, Jiaxin; He, Jiadai; Bai, Jingwen; Ma, Haoli
2017-10-08
The plant hormone auxin plays pivotal roles in many aspects of plant growth and development. The auxin/indole-3-acetic acid (Aux/IAA) gene family encodes short-lived nuclear proteins acting on auxin perception and signaling, but the evolutionary history of this gene family remains to be elucidated. In this study, the Aux/IAA gene family in 17 plant species covering all major lineages of plants is identified and analyzed by using multiple bioinformatics methods. A total of 434 Aux/IAA genes was found among these plant species, and the gene copy number ranges from three ( Physcomitrella patens ) to 63 ( Glycine max ). The phylogenetic analysis shows that the canonical Aux/IAA proteins can be generally divided into five major clades, and the origin of Aux/IAA proteins could be traced back to the common ancestor of land plants and green algae. Many truncated Aux/IAA proteins were found, and some of these truncated Aux/IAA proteins may be generated from the C-terminal truncation of auxin response factor (ARF) proteins. Our results indicate that tandem and segmental duplications play dominant roles for the expansion of the Aux/IAA gene family mainly under purifying selection. The putative nuclear localization signals (NLSs) in Aux/IAA proteins are conservative, and two kinds of new primordial bipartite NLSs in P. patens and Selaginella moellendorffii were discovered. Our findings not only give insights into the origin and expansion of the Aux/IAA gene family, but also provide a basis for understanding their functions during the course of evolution.
Zhao, Jianfei; Favero, David S; Qiu, Jiwen; Roalson, Eric H; Neff, Michael M
2014-10-14
Members of the ancient land-plant-specific transcription factor AT-Hook Motif Nuclear Localized (AHL) gene family regulate various biological processes. However, the relationships among the AHL genes, as well as their evolutionary history, still remain unexplored. We analyzed over 500 AHL genes from 19 land plant species, ranging from the early diverging Physcomitrella patens and Selaginella to a variety of monocot and dicot flowering plants. We classified the AHL proteins into three types (Type-I/-II/-III) based on the number and composition of their functional domains, the AT-hook motif(s) and PPC domain. We further inferred their phylogenies via Bayesian inference analysis and predicted gene gain/loss events throughout their diversification. Our analyses suggested that the AHL gene family emerged in embryophytes and further evolved into two distinct clades, with Type-I AHLs forming one clade (Clade-A), and the other two types together diversifying in another (Clade-B). The two AHL clades likely diverged before the separation of Physcomitrella patens from the vascular plant lineage. In angiosperms, Clade-A AHLs expanded into 5 subfamilies; while, the ones in Clade-B expanded into 4 subfamilies. Examination of their expression patterns suggests that the AHLs within each clade share similar expression patterns with each other; however, AHLs in one monophyletic clade exhibit distinct expression patterns from the ones in the other clade. Over-expression of a Glycine max AHL PPC domain in Arabidopsis thaliana recapitulates the phenotype observed when over-expressing its Arabidopsis thaliana counterpart. This result suggests that the AHL genes from different land plant species may share conserved functions in regulating plant growth and development. Our study further suggests that such functional conservation may be due to conserved physical interactions among the PPC domains of AHL proteins. Our analyses reveal a possible evolutionary scenario for the AHL gene family
Bioinformatics approach of salt tolerance gene in mangrove plant Rhizophora stylosa
Basyuni, M.; Sumardi
2017-01-01
This study descibes bioinformatics approach on the analyze of the salt tolerance genes in mangrove plant, Rhizophora stylosa on DDBJ/EMBL/GenBank as well as similarity, phylogenetic, potential peptide, and subcellular localization. The DNA sequence between salt tolerance gene from R. stylosa exhibited 42-11% between themselves The target peptide value of mitochondria varied from 0.163 to 0.430, indicated it was possible to exist. These results suggested the importance of understanding the diversity and functional of properties of the different amino acids in mangrove OSC genes. To clarify the relationship among the salt-tolerant genes in R. stylosa, a phylogenetic tree was constructed. The phylogenetic tree shows that there are three clusters, first branch of Cu/Zn SOD and reverse transcriptase genes, the second branch consists of the majority genes and the last group was MAP3K alpha protein kinase only. The present study, therefore, suggested that salt tolerance genes form distinct clusters in the tree.
Directory of Open Access Journals (Sweden)
ali akbar ameri
2009-06-01
Full Text Available Efficient use of nitrogen for medicinal plants production, might increase flower dry matter, essential oil and extract yield and reduce cost of yield production. A two year (2005 and 2006 field study was conducted in Torogh region(36,10° N,59.33° E and 1300 m altitude of Mashhad, Iran, to observe the effects of different nitrogen and densities on flower dry matter, essential oil and extract production and nitrogen use efficiency (NUE in a multi-harvested Marigold (Calendula officinalis. The levels of Nitrogen fertilizer (N were 0, 50, 100 and 150 kg ha-1 and levels of density were 20, 40, 60 and 80 plant m-2. The combined analysis results revealed significant effects of N and density levels on flower dry matter, essential oil and extract production and NUE of Marigold. The highest dry flower production obtained by 150 kg ha-1 N and 80 plant m-2 plant population (102.86 g m-2. The higher flower dry matter production caused more essential oil and extract production in high nitrogen and density levels. Agronomic N-use efficiency (kg flower dry matter yield per kg N applied, physiological efficiency (kg flower dry matter yield per kg N absorbed and fertilizer N-recovery efficiency (kg N absorbed per kg N applied, expressed as % for marigold across treatments ranged from 6.8 to14.9, 12.3 to 33.6 and 55.5 to 77.6, respectively and all were greater for N application at 50 compared with150 kg N ha-1, and under high density than low density. The amount of essential oil and extract per 100g flower dry matter decreased during the flower harvesting period. The higher amount of essential oil and extract obtained at early flowering season. The essential oil and extract ranged from 0.22 to 0.12 (ml. per 100g flower dry matter and 2.74 to 2.13 (g per 100g flower dry matter respectively.
Directory of Open Access Journals (Sweden)
Hall Ross S
2010-04-01
Full Text Available Abstract Background New drug targets are urgently needed for parasites of socio-economic importance. Genes that are essential for parasite survival are highly desirable targets, but information on these genes is lacking, as gene knockouts or knockdowns are difficult to perform in many species of parasites. We examined the applicability of large-scale essentiality information from four model eukaryotes, Caenorhabditis elegans, Drosophila melanogaster, Mus musculus and Saccharomyces cerevisiae, to discover essential genes in each of their genomes. Parasite genes that lack orthologues in their host are desirable as selective targets, so we also examined prediction of essential genes within this subset. Results Cross-species analyses showed that the evolutionary conservation of genes and the presence of essential orthologues are each strong predictors of essentiality in eukaryotes. Absence of paralogues was also found to be a general predictor of increased relative essentiality. By combining several orthology and essentiality criteria one can select gene sets with up to a five-fold enrichment in essential genes compared with a random selection. We show how quantitative application of such criteria can be used to predict a ranked list of potential drug targets from Ancylostoma caninum and Haemonchus contortus - two blood-feeding strongylid nematodes, for which there are presently limited sequence data but no functional genomic tools. Conclusions The present study demonstrates the utility of using orthology information from multiple, diverse eukaryotes to predict essential genes. The data also emphasize the challenge of identifying essential genes among those in a parasite that are absent from its host.
Lebedev, V G; Faskhiev, V N; Kovalenko, N P; Shestibratov, K A; Miroshnikov, A I
2016-01-01
Obtaining herbicide resistant plants is an important task in the genetic engineering of forest trees. Transgenic European aspen plants (Populus tremula L.) expressing the bar gene for phosphinothricin resistance have been produced using Agrobacterium tumefaciens-mediated transformation. Successful genetic transformation was confirmed by PCR analysis for thirteen lines derived from two elite genotypes. In 2014-2015, six lines were evaluated for resistance to herbicide treatment under semi-natural conditions. All selected transgenic lines were resistant to the herbicide Basta at doses equivalent to 10 l/ha (twofold normal field dosage) whereas the control plants died at 2.5 l/ha. Foliar NH4-N concentrations in transgenic plants did not change after treatment. Extremely low temperatures in the third ten-day period of October 2014 revealed differences in freeze tolerance between the lines obtained from Pt of f2 aspen genotypes. Stable expression of the bar gene after overwintering outdoors was confirmed by RT-PCR. On the basis of the tests, four transgenic aspen lines were selected. The bar gene could be used for retransformation of transgenic forest trees expressing valuable traits, such as increased productivity.
Expression of TLP-3 gene without signal peptide in tobacco plants ...
African Journals Online (AJOL)
Administrator
2011-06-06
Jun 6, 2011 ... African Journal of Biotechnology Vol. ... group of plant proteins which accumulate as a result of different types ... across the plasma membranes, the rapid production of ..... transformation and RT-PCR analysis confirm the gene.
McNeal, Joel R; Kuehl, Jennifer V; Boore, Jeffrey L; de Pamphilis, Claude W
2007-10-24
Plastid genome content and protein sequence are highly conserved across land plants and their closest algal relatives. Parasitic plants, which obtain some or all of their nutrition through an attachment to a host plant, are often a striking exception. Heterotrophy can lead to relaxed constraint on some plastid genes or even total gene loss. We sequenced plastid genomes of two species in the parasitic genus Cuscuta along with a non-parasitic relative, Ipomoea purpurea, to investigate changes in the plastid genome that may result from transition to the parasitic lifestyle. Aside from loss of all ndh genes, Cuscuta exaltata retains photosynthetic and photorespiratory genes that evolve under strong selective constraint. Cuscuta obtusiflora has incurred substantially more change to its plastid genome, including loss of all genes for the plastid-encoded RNA polymerase. Despite extensive change in gene content and greatly increased rate of overall nucleotide substitution, C. obtusiflora also retains all photosynthetic and photorespiratory genes with only one minor exception. Although Epifagus virginiana, the only other parasitic plant with its plastid genome sequenced to date, has lost a largely overlapping set of transfer-RNA and ribosomal genes as Cuscuta, it has lost all genes related to photosynthesis and maintains a set of genes which are among the most divergent in Cuscuta. Analyses demonstrate photosynthetic genes are under the highest constraint of any genes within the plastid genomes of Cuscuta, indicating a function involving RuBisCo and electron transport through photosystems is still the primary reason for retention of the plastid genome in these species.
Directory of Open Access Journals (Sweden)
Kuehl Jennifer V
2007-10-01
Full Text Available Abstract Background Plastid genome content and protein sequence are highly conserved across land plants and their closest algal relatives. Parasitic plants, which obtain some or all of their nutrition through an attachment to a host plant, are often a striking exception. Heterotrophy can lead to relaxed constraint on some plastid genes or even total gene loss. We sequenced plastid genomes of two species in the parasitic genus Cuscuta along with a non-parasitic relative, Ipomoea purpurea, to investigate changes in the plastid genome that may result from transition to the parasitic lifestyle. Results Aside from loss of all ndh genes, Cuscuta exaltata retains photosynthetic and photorespiratory genes that evolve under strong selective constraint. Cuscuta obtusiflora has incurred substantially more change to its plastid genome, including loss of all genes for the plastid-encoded RNA polymerase. Despite extensive change in gene content and greatly increased rate of overall nucleotide substitution, C. obtusiflora also retains all photosynthetic and photorespiratory genes with only one minor exception. Conclusion Although Epifagus virginiana, the only other parasitic plant with its plastid genome sequenced to date, has lost a largely overlapping set of transfer-RNA and ribosomal genes as Cuscuta, it has lost all genes related to photosynthesis and maintains a set of genes which are among the most divergent in Cuscuta. Analyses demonstrate photosynthetic genes are under the highest constraint of any genes within the plastid genomes of Cuscuta, indicating a function involving RuBisCo and electron transport through photosystems is still the primary reason for retention of the plastid genome in these species.
Marker Removal in Transgenic Plants Using Cre Recombinase Delivered with Potato Virus X.
Kopertekh, Lilya; Schiemann, Joachim
2017-01-01
In this chapter we present an alternative method to develop marker-free transgenic plants. It makes use of the Cre/loxP recombination system from bacteriophage P1 and consists of two essential components. The first component is the transgenic plant containing a loxP-flanked marker gene. The second component is a cre transient expression vector based on potato virus X. The great benefit of this transient delivery method consists in the avoidance of stable integration of the cre recombinase gene into the plant genome. Upon infection of the loxP-target plant with PVX-Cre, the virus spreads systemically through the plant and causes the recombinase-mediated excision of the marker gene. Marker-free transgenic loci can be transmitted to the progeny by plant regeneration from PVX-Cre systemically infected leaves or self-pollination of virus-infected plants. The protocol covers generation of loxP-target transgenic plants, PVX-mediated delivery of Cre recombinase protein, phenotypic and molecular analysis of recombination events, and transmission of marker-free transgenic loci to the next generation. The transient expression system described in this chapter can be adapted for marker gene removal in other plant species that are amenable for virus infection.
Aromatic plants produce organic compounds that may be involved in the defense of plants against phytopathogenic insects, bacteria, fungi, and viruses. One of these compounds called carvacrol that is found in high concentrations in essential oils such as oregano has been reported to exhibit numerous...
Seo, Seon-Mi; Kim, Junheon; Kang, Jaesoon; Koh, Sang-Hyun; Ahn, Young-Joon; Kang, Kyu-Suk; Park, Il-Kwon
2014-07-01
This study investigated the fumigant toxicity of 4 Asteraceae plant essential oils and their constituents against the Japanese termite Reticulitermes speratus Kolbe. Fumigant toxicity varied with plant essential oils or constituents, exposure time, and concentration. Among the tested essential oils, those from Chamaemelum nobile exhibited the strongest fumigant toxicity, followed by those from Santolina chamaecyparissus, Ormenis multicaulis, and Eriocephalus punctulatus at 2 days after treatment. In all, 15, 24, 19, and 9 compounds were identified in the essential oils from C. nobile, E. punctulatus, O. multicaulis, and S. chamaecyparissus, respectively, by using gas chromatography, gas chromatography-mass spectrometry, or open-column chromatography. The identified compounds were tested individually for their fumigant toxicity against Japanese termites. Among the test compounds, trans-pinocarveol, caryophyllene oxide, sabinene hydrate, and santolina alcohol showed strong fumigant toxicity against Japanese termites. Acetylcholinesterase (AChE) inhibition activity of the identified compounds from C. nobile, E. punctulatus, O. multicaulis, and S. chamaecyparissus essential oils were tested to determine the mode of their action. The IC50 values of (+)-α-pinene, (-)-limonene, (-)-α-pinene, β-pinene, and β-phellandrene against Japanese termite AChE were 0.03, 0.13, 0.41, 0.42, and 0.67mg/mL, respectively. Further studies are warranted to determine the potential of these essential oils and their constituents as fumigants for termite control. Copyright © 2014 Elsevier Inc. All rights reserved.
Effect on tomato plant and fruit of the application of biopolymer-oregano essential oil coatings.
Perdones, Ángela; Tur, Núria; Chiralt, Amparo; Vargas, Maria
2016-10-01
Oregano essential oil (EO) was incorporated into film-forming dispersions (FFDs) based on biopolymers (chitosan and/or methylcellulose) at two different concentrations. The effect of the application of the FFDs was evaluated on tomato plants (cultivar Micro-Tom) at three different stages of development, and on pre-harvest and postharvest applications on tomato fruit. The application of the FFDs at '3 Leaves' stage caused phytotoxic problems, which were lethal when the EO was applied without biopolymers. Even though plant growth and development were delayed, the total biomass and the crop yield were not affected by biopolymer-EO treatments. When the FFDs were applied in the 'Fruit' stage the pre-harvest application of FFDs had no negative effects. All FFDs containing EO significantly reduced the respiration rate of tomato fruit and diminished weight loss during storage. Moreover, biopolymer-EO FFDs led to a decrease in the fungal decay of tomato fruit inoculated with Rhizopus stolonifer spores, as compared with non-treated tomato fruit and those coated with FFDs without EO. The application of biopolymer-oregano essential oil coatings has been proven to be an effective treatment to control R. stolonifer in tomato fruit. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
Schindler, Daniel; Nowrousian, Minou
2014-07-01
Filamentous ascomycetes have long been known as producers of a variety of secondary metabolites, many of which have toxic effects on other organisms. However, the role of these metabolites in the biology of the fungi that produce them remains in most cases enigmatic. A major group of fungal secondary metabolites are polyketides. They are chemically diverse, but have in common that their chemical scaffolds are synthesized by polyketide synthases (PKSs). In a previous study, we analyzed development-dependent expression of pks genes in the filamentous ascomycete Sordaria macrospora. Here, we show that a deletion mutant of the pks4 gene is sterile, producing only protoperithecia but no mature perithecia, whereas overexpression of pks4 leads to enlarged, malformed fruiting bodies. Thus, correct expression levels of pks4 are essential for wild type-like perithecia formation. The predicted PKS4 protein has a domain structure that is similar to homologs in other fungi, but conserved residues of a methyl transferase domain present in other fungi are mutated in PKS4. Expression of several developmental genes is misregulated in the pks4 mutant. Surprisingly, the development-associated app gene is not downregulated in the mutant, in contrast to all other previously studied mutants with a block at the protoperithecial stage. Our data show that the polyketide synthase gene pks4 is essential for sexual development and plays a role in regulating fruiting body morphology. Copyright © 2014 Elsevier Inc. All rights reserved.
Omoruyi, Beauty Etinosa; Afolayan, Anthony Jide; Bradley, Graeme
2014-01-01
Essential oil from Mesembryanthemum edule leaves have been used by the Eastern Cape traditional healers for the treatment of respiratory tract infections, tuberculosis, dysentery, diabetic mellitus, laryngitis and vaginal infections. The investigation of bioactive compounds in the essential oil of this plant could help to verify the efficacy of the plant in the management or treatment of these illnesses. Various concentrations of the hydro-distilled essential oil, ranging from 0.005-5 mg/ml, were tested against some fungal strains, using the micro-dilution method. Minimum inhibitory activity was compared with four other different crude extracts of hexane, acetone, ethanol and aqueous samples from the same plant. The chemical composition of the essential oil, hexane, acetone and ethanol extracts was determined using GC-MS. GC/MS analysis of the essential oil resulted in the identification of 28 compounds, representing 99.99% of the total oil. Phytoconstituents of hexane, acetone and ethanol extracts yielded a total peak chromatogram of fifty nine compounds. A total amount of 10.6% and 36.61% of the constituents were obtained as monoterpenes and oxygenated monoterpenes. Sesquiterpene hydrocarbons (3.58%) were relatively low compared to the oxygenated sesquiterpenes (9.28%), while the major concentrated diterpenes and oxygenated diterpenes were 1.43% and 19.24 %, respectively and phytol 12.41%. Total amount of fatty acids and their methyl esters content, present in the oil extract, were found to be 19.25 %. Antifungal activity of the oil extract and four solvent extracts were tested against five pathogenic fungal strains. The oil extract showed antifungal activity against Candida albican, Candida krusei, Candida rugosa, Candida glabrata and Cryptococcus neoformans with MIC ranges of 0.02 0.31 mg/ml. Hexane extract was active against the five fungal strains with MICs ranging between 0.02-1.25 mg/ml. Acetone extracts were active against C. krusei only at 0.04mg/ml. No
2011-01-01
Background Fundamental in traditional postpartum recovery in Lao PDR is the use of hotbeds, mother roasting, steam sauna and steam baths. During these treatments medicinal plants play a crucial role, but little has been published about how the treatments are carried out precisely, which species are used, the medicinal properties of these species, and the medicinal efficacy of their chemical constituents. Methods Sixty-five interviews, in 15 rural villages, with women of 4 different ethnic groups were conducted to survey confinement rituals, and postpartum plant use and salience. Essential oils from the main species used were extracted using steam distillation and the main chemical constituents characterized using gas chromatography-mass spectrometry (GC-MS). Results A total of 10 different species were used by three or more of the ethnic groups included in this study. All species were used in steam sauna and bath, but only 3 species were used in hotbed and mother roasting. Essential oils of Amomum villosum, Amomum microcarpum and Blumea balsamifera were found to contain significant amounts of the following terpenes: β-pinene, camphor, bornyl acetate, borneol, linalool, D-limonene, fenchone, terpinen-4-ol and α-terpinene. Conclusions Many of these terpenes have documented antimicrobial and analgesic properties, and some have also synergistic interactions with other terpenes. The mode of application in hotbed and mother roasting differs from the documented mechanisms of action of these terpenes. Plants in these two practices are likely to serve mainly hygienic purposes, by segregating the mother from infection sources such as beds, mats, stools, cloth and towels. Steam sauna medicinal plant use through inhalation of essential oils vapors can possibly have medicinal efficacy, but is unlikely to alleviate the ailments commonly encountered during postpartum convalescence. Steam sauna medicinal plant use through dermal condensation of essential oils, and steam bath
Zakharchenko, N S; Rukavtsova, E B; Shevchuk, T V; Furs, O V; Pigoleva, S V; Lebedeva, A A; Chulina, I A; Baidakova, L K; Bur'yanov, Ya I
2016-01-01
Kalanchoe pinnata L. plants bearing an artificial CP1 gene encoding the cecropin P1 antimicrobial peptide have been obtained. The presence of the CP1 gene in the plant genome has been confirmed by PCR. Cecropin P1 synthesis in transgenic plants has been shown by MALDI mass spectrometry and Western blotting. The obtained plants have been highly resistant to bacterial and fungal phytopathogens, and their extracts have demonstrated antimicrobial activity towards human and animal pathogens. It has been shown that transgenic plants bearing the CP1 gene can be colonized by the beneficial associative microorganisms Methylovorus mays.
Li, Jing; Zhou, Liantong; Zhang, Xiangyu; Xu, Caijia; Dong, Liming; Yao, Maosheng
2016-01-01
Air samples from twelve sampling sites (including seven intra-plant sites, one upwind site and four downwind sites) from a wastewater treatment plant (WWTP) in Beijing were collected using a Reuter Centrifugal Sampler High Flow (RCS); and their microbial fractions were studied using culturing and high throughput gene sequence. In addition, the viable (fluorescent) bioaerosol concentrations for 7 intra-plant sites were also monitored for 30 min each using an ultraviolet aerodynamic particle sizer (UV-APS). Both air and water samples collected from the plant were investigated for possible bacterial antibiotic resistance genes and integrons using polymerase chain reaction (PCR) coupled with gel electrophoresis. The results showed that the air near sludge thickening basin was detected to have the highest level of culturable bacterial aerosols (up to 1697 CFU/m3) and fungal aerosols (up to 930 CFU/m3). For most sampling sites, fluorescent peaks were observed at around 3-4 μm, except the office building with a peak at 1.5 μm, with a number concentration level up to 1233-6533 Particles/m3. About 300 unique bacterial species, including human opportunistic pathogens, such as Comamonas Testosteroni and Moraxella Osloensis, were detected from the air samples collected over the biological reaction basin. In addition, we have detected the sul2 gene resistant to cotrimoxazole (also known as septra, bactrim and TMP-SMX) and class 1 integrase gene from the air samples collected from the screen room and the biological reaction basin. Overall, the screen room, sludge thickening basin and biological reaction basin imposed significant microbial exposure risks, including those from airborne antibiotic resistance genes.
Kopečná, Martina; Vigouroux, Armelle; Vilím, Jan; Končitíková, Radka; Briozzo, Pierre; Hájková, Eva; Jašková, Lenka; von Schwartzenberg, Klaus; Šebela, Marek; Moréra, Solange; Kopečný, David
2017-10-01
Lower plant species including some green algae, non-vascular plants (bryophytes) as well as the oldest vascular plants (lycopods) and ferns (monilophytes) possess a unique aldehyde dehydrogenase (ALDH) gene named ALDH21, which is upregulated during dehydration. However, the gene is absent in flowering plants. Here, we show that ALDH21 from the moss Physcomitrella patens codes for a tetrameric NADP + -dependent succinic semialdehyde dehydrogenase (SSALDH), which converts succinic semialdehyde, an intermediate of the γ-aminobutyric acid (GABA) shunt pathway, into succinate in the cytosol. NAD + is a very poor coenzyme for ALDH21 unlike for mitochondrial SSALDHs (ALDH5), which are the closest related ALDH members. Structural comparison between the apoform and the coenzyme complex reveal that NADP + binding induces a conformational change of the loop carrying Arg-228, which seals the NADP + in the coenzyme cavity via its 2'-phosphate and α-phosphate groups. The crystal structure with the bound product succinate shows that its carboxylate group establishes salt bridges with both Arg-121 and Arg-457, and a hydrogen bond with Tyr-296. While both arginine residues are pre-formed for substrate/product binding, Tyr-296 moves by more than 1 Å. Both R121A and R457A variants are almost inactive, demonstrating a key role of each arginine in catalysis. Our study implies that bryophytes but presumably also some green algae, lycopods and ferns, which carry both ALDH21 and ALDH5 genes, can oxidize SSAL to succinate in both cytosol and mitochondria, indicating a more diverse GABA shunt pathway compared with higher plants carrying only the mitochondrial ALDH5. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.
Su, Junji; Li, Libei; Zhang, Chi; Wang, Caixiang; Gu, Lijiao; Wang, Hantao; Wei, Hengling; Liu, Qibao; Huang, Long; Yu, Shuxun
2018-06-01
Thirty significant associations between 22 SNPs and five plant architecture component traits in Chinese upland cotton were identified via GWAS. Four peak SNP loci located on chromosome D03 were simultaneously associated with more plant architecture component traits. A candidate gene, Gh_D03G0922, might be responsible for plant height in upland cotton. A compact plant architecture is increasingly required for mechanized harvesting processes in China. Therefore, cotton plant architecture is an important trait, and its components, such as plant height, fruit branch length and fruit branch angle, affect the suitability of a cultivar for mechanized harvesting. To determine the genetic basis of cotton plant architecture, a genome-wide association study (GWAS) was performed using a panel composed of 355 accessions and 93,250 single nucleotide polymorphisms (SNPs) identified using the specific-locus amplified fragment sequencing method. Thirty significant associations between 22 SNPs and five plant architecture component traits were identified via GWAS. Most importantly, four peak SNP loci located on chromosome D03 were simultaneously associated with more plant architecture component traits, and these SNPs were harbored in one linkage disequilibrium block. Furthermore, 21 candidate genes for plant architecture were predicted in a 0.95-Mb region including the four peak SNPs. One of these genes (Gh_D03G0922) was near the significant SNP D03_31584163 (8.40 kb), and its Arabidopsis homologs contain MADS-box domains that might be involved in plant growth and development. qRT-PCR showed that the expression of Gh_D03G0922 was upregulated in the apical buds and young leaves of the short and compact cotton varieties, and virus-induced gene silencing (VIGS) proved that the silenced plants exhibited increased PH. These results indicate that Gh_D03G0922 is likely the candidate gene for PH in cotton. The genetic variations and candidate genes identified in this study lay a foundation
Directory of Open Access Journals (Sweden)
Nooshin Ghodsian
2016-01-01
Full Text Available With-no-lysine (K Kinase-4 (WNK4 consisted of unique serine and threonine protein kinases, genetically associated with an autosomal dominant form of hypertension. Argumentative consequences have lately arisen on the association of specific single nucleotide polymorphisms of WNK4 gene and essential hypertension (EHT. The aim of this study was to determine the association of Ala589Ser polymorphism of WNK4 gene with essential hypertensive patients in Malaysia. WNK4 gene polymorphism was specified utilizing mutagenically separated polymerase chain reaction (PCR and restriction fragment length polymorphism (RFLP method in 320 subjects including 163 cases and 157 controls. Close relation between Ala589Ser polymorphism and elevated systolic and diastolic blood pressure (SBP and DBP was recognized. Sociodemographic factors including body mass index (BMI, age, the level of fasting blood sugar (FBS, low density lipoprotein (LDL, and triglyceride (TG in the cases and healthy subjects exhibited strong differences (p<0.05. The distribution of allele frequency and genotype of WNK4 gene Ala589Ser polymorphism showed significant differences (p<0.05 between EHT subjects with or without type 2 diabetes mellitus (T2DM and normotensive subjects, statistically. The WNK4 gene variation influences significantly blood pressure increase. Ala589Ser probably has effects on the enzymic activity leading to enhanced predisposition to the disorder.
Ruhlman, Tracey A; Chang, Wan-Jung; Chen, Jeremy J W; Huang, Yao-Ting; Chan, Ming-Tsair; Zhang, Jin; Liao, De-Chih; Blazier, John C; Jin, Xiaohua; Shih, Ming-Che; Jansen, Robert K; Lin, Choun-Sea
2015-04-11
Key innovations have facilitated novel niche utilization, such as the movement of the algal predecessors of land plants into terrestrial habitats where drastic fluctuations in light intensity, ultraviolet radiation and water limitation required a number of adaptations. The NDH (NADH dehydrogenase-like) complex of Viridiplantae plastids participates in adapting the photosynthetic response to environmental stress, suggesting its involvement in the transition to terrestrial habitats. Although relatively rare, the loss or pseudogenization of plastid NDH genes is widely distributed across diverse lineages of photoautotrophic seed plants and mutants/transgenics lacking NDH function demonstrate little difference from wild type under non-stressed conditions. This study analyzes large transcriptomic and genomic datasets to evaluate the persistence and loss of NDH expression across plants. Nuclear expression profiles showed accretion of the NDH gene complement at key transitions in land plant evolution, such as the transition to land and at the base of the angiosperm lineage. While detection of transcripts for a selection of non-NDH, photosynthesis related proteins was independent of the state of NDH, coordinate, lineage-specific loss of plastid NDH genes and expression of nuclear-encoded NDH subunits was documented in Pinaceae, gnetophytes, Orchidaceae and Geraniales confirming the independent and complete loss of NDH in these diverse seed plant taxa. The broad phylogenetic distribution of NDH loss and the subtle phenotypes of mutants suggest that the NDH complex is of limited biological significance in contemporary plants. While NDH activity appears dispensable under favorable conditions, there were likely sufficiently frequent episodes of abiotic stress affecting terrestrial habitats to allow the retention of NDH activity. These findings reveal genetic factors influencing plant/environment interactions in a changing climate through 450 million years of land plant
Overexpression of the AtSHI gene in poinsettia, Euphorbia pulcherrima, results in compact plants.
Directory of Open Access Journals (Sweden)
M Ashraful Islam
Full Text Available Euphorbia pulcherrima, poinsettia, is a non-food and non-feed vegetatively propagated ornamental plant. Appropriate plant height is one of the most important traits in poinsettia production and is commonly achieved by application of chemical growth retardants. To produce compact poinsettia plants with desirable height and reduce the utilization of growth retardants, the Arabidopsis SHORT INTERNODE (AtSHI gene controlled by the cauliflower mosaic virus 35S promoter was introduced into poinsettia by Agrobacterium-mediated transformation. Three independent transgenic lines were produced and stable integration of transgene was verified by PCR and Southern blot analysis. Reduced plant height (21-52% and internode lengths (31-49% were obtained in the transgenic lines compared to control plants. This correlates positively with the AtSHI transcript levels, with the highest levels in the most dwarfed transgenic line (TL1. The indole-3-acetic acid (IAA content appeared lower (11-31% reduction in the transgenic lines compared to the wild type (WT controls, with the lowest level (31% reduction in TL1. Total internode numbers, bract numbers and bract area were significantly reduced in all transgenic lines in comparison with the WT controls. Only TL1 showed significantly lower plant diameter, total leaf area and total dry weight, whereas none of the AtSHI expressing lines showed altered timing of flower initiation, cyathia abscission or bract necrosis. This study demonstrated that introduction of the AtSHI gene into poinsettia by genetic engineering can be an effective approach in controlling plant height without negatively affecting flowering time. This can help to reduce or avoid the use of toxic growth retardants of environmental and human health concern. This is the first report that AtSHI gene was overexpressed in poinsettia and transgenic poinsettia plants with compact growth were produced.
The CXCR2 Gene Polymorphism Is Associated with Stroke in Patients with Essential Hypertension
Directory of Open Access Journals (Sweden)
Yanina R. Timasheva
2015-10-01
Full Text Available Hypertension is the major risk factor for stroke, and genetic factors contribute to its development. Inflammation has been hypothesized to be the key link between blood pressure elevation and stroke. We performed an analysis of the association between inflammatory mediator gene polymorphisms and the incidence of stroke in patients with essential hypertension (EH. The study group consisted of 625 individuals (296 patients with noncomplicated EH, 71 hypertensive patients with ischemic stroke, and 258 control subjects. Both patients and controls were ethnic Tatars originating from the Republic of Bashkortostan (Russian Federation. The analysis has shown that the risk of ischemic stroke was associated with the CXCR2 rs1126579 polymorphism. Our results indicate that among patients with EH, the heterozygous genotype carriers had a higher risk of stroke (OR = 1.72, 95% CI 1.01-2.92, whereas the CXCR2*C/C genotype was protective against stroke (OR = 0.32, 95% CI 0.12-0.83. As shown by the gene-gene interaction analysis, the CXCR2 rs1126579 polymorphism was also present in all genotype/allele combinations associated with the risk of stroke. Genetic patterns associated with stroke also included polymorphisms in the CCL2, CCL18, CX3CR1, CCR5, and CXCL8(IL8 genes, although no association between these loci and stroke was detected by individual analysis.
Balestrini, Raffaella; Nerva, Luca; Sillo, Fabiano; Girlanda, Mariangela; Perotto, Silvia
2014-01-01
Little is known on the molecular bases of plant-fungal interactions in orchid mycorrhiza. We developed a model system to investigate gene expression in mycorrhizal protocorms of Serapias vomeracea colonised by Tulasnella calospora. Our recent results with a small panel of genes as indicators of plant response to mycorrhizal colonization indicate that genes related with plant defense were not significantly up-regulated in mycorrhizal tissues. Here, we used laser microdissection to investigate whether expression of some orchid genes was restricted to specific cell types. Results showed that SvNod1, a S. vomeracea nodulin-like protein containing a plastocyanin-like domain, is expressed only in protocorm cells containing intracellular fungal hyphae. In addition, we investigated a family of fungal zinc metallopeptidases (M36). This gene family has expanded in the T. calospora genome and RNA-Seq experiments indicate that some members of the M36 metallopeptidases family are differentially regulated in orchid mycorrhizal protocorms.
Bolton, M.D.; Thomma, B.P.H.J.
2008-01-01
Plant pathogens secrete effector molecules that contribute to the establishment of disease in their plant hosts. The identification of cellular cues that regulate effector gene expression is an important aspect of understanding the infection process. Nutritional status in the cell has been
Directory of Open Access Journals (Sweden)
Hadjira Guenane1
2017-10-01
Full Text Available The objective of the present study was to analyze the total antioxidant capacity, minerals contents of four plants (Juniperus oxycedrus, Thymus capitatus, Laurus nobilis and Eruca vesicaria and chemical composition of the essential oils of the aerial parts of T. capitatus. Their antioxidant activity was assessed by DPPH, ABTS and FRAPS assays. Total phenol and flavonoid contents of the extracts were also determined. The results showed that the L. nobilis extract had the highest total phenolic and flavonoids contents (19.11 ± 0.22 mg GAE•g-1 dw, 4.47 ± 0.12 mg QE•g-1 dw, respectively. The extract of E. vesicaria had the highest value of TEAC for scavenging DPPH, whereas L. nobilis extract was active for ABTS and FRAP. GC/MS analysis revealed that the essential oil from the aerial parts of T. capitatus contained thirty-seven compounds; thymol was the major constituent (82.79 %. Atomic absorption spectroscopy showed high levels of Ca, K, Mg and Fe, and trace amounts of Zn, Cu and Mn in all four extracts.
El-Seedi, Hesham R; Khalil, Nasr S; Azeem, Muhammad; Taher, Eman A; Göransson, Ulf; Pålsson, Katinka; Borg-Karlson, Anna-Karin
2012-09-01
In our search for effective tick repellents from plant origin, we investigated the effect of essential oils of four medicinal and culinary plants belonging to the family Lamiaceae on nymphs of the tick Ixodes ricinus (L.). The essential oils of the dry leaves of Rosmarinus officinalis (Rosemary) (L.), Mentha spicata (Spearmint) (L.), Origanum majorana (Majoram) (L.), and Ocimum basilicum (Basil) (L.) were isolated by steam distillation and 15 microg/cm2 concentration of oils was tested against ticks in a laboratory bioassay. The oils of R. officinalis, M. spicata, and O. majorana showed strong repellency against the ticks 100, 93.2, and 84.3%, respectively, whereas O. basilicum only showed 64.5% repellency. When tested in the field, the oils of R. officinalis and M. spicata showed 68.3 and 59.4% repellency at a concentration of 6.5 microg/cm2 on the test cloths. The oils were analyzed by gas chromatography mass spectrometry and the major compounds from the most repellent oils were 1,8-cineole, camphor, linalool, 4-terpineol, borneol, and carvone.
Walker, Peter J; Dietzgen, Ralf G; Joubert, D Albert; Blasdell, Kim R
2011-12-01
The Rhabdoviridae is one of the most ecologically diverse families of RNA viruses with members infecting a wide range of organisms including placental mammals, marsupials, birds, reptiles, fish, insects and plants. The availability of complete nucleotide sequences for an increasing number of rhabdoviruses has revealed that their ecological diversity is reflected in the diversity and complexity of their genomes. The five canonical rhabdovirus structural protein genes (N, P, M, G and L) that are shared by all rhabdoviruses are overprinted, overlapped and interspersed with a multitude of novel and diverse accessory genes. Although not essential for replication in cell culture, several of these genes have been shown to have roles associated with pathogenesis and apoptosis in animals, and cell-to-cell movement in plants. Others appear to be secreted or have the characteristics of membrane-anchored glycoproteins or viroporins. However, most encode proteins of unknown function that are unrelated to any other known proteins. Understanding the roles of these accessory genes and the strategies by which rhabdoviruses use them to engage, divert and re-direct cellular processes will not only present opportunities to develop new anti-viral therapies but may also reveal aspects of cellar function that have broader significance in biology, agriculture and medicine. Crown Copyright © 2011. Published by Elsevier B.V. All rights reserved.
Wu, B; Georgopoulos, C; Ang, D
1992-08-01
The grpE gene product is one of three Escherichia coli heat shock proteins (DnaK, DnaJ, and GrpE) that are essential for both bacteriophage lambda DNA replication and bacterial growth at all temperatures. In an effort to determine the role of GrpE and to identify other factors that it may interact with, we isolated multicopy suppressors of the grpE280 point mutation, as judged by their ability to reverse the temperature-sensitive phenotype of grpE280. Here we report the characterization of one of them, designated msgB. The msgB gene maps at approximately 53 min on the E. coli chromosome. The minimal gene possesses an open reading frame that encodes a protein with a predicted size of 41,269 M(r). This open reading frame was confirmed the correct one by direct amino-terminal sequence analysis of the overproduced msgB gene product. Genetic experiments demonstrated that msgB is essential for E. coli growth in the temperature range of 22 to 37 degrees C. Through a sequence homology search, MsgB was shown to be identical to N-succinyl-L-diaminopimelic acid desuccinylase (the dapE gene product), which participates in the diaminopimelic acid-lysine pathway involved in cell wall biosynthesis. Consistent with this finding, the msgB null allele mutant is viable only when the growth medium is supplemented with diaminopimelic acid. These results suggest that GrpE may have a previously unsuspected function(s) in cell wall biosynthesis in E. coli.
Wang, Di; Wang, Yunlong; Long, Wuhua; Niu, Mei; Zhao, Zhigang; Teng, Xuan; Zhu, Xiaopin; Zhu, Jianping; Hao, Yuanyuan; Wang, Yongfei; Liu, Yi; Jiang, Ling; Wang, Yihua; Wan, Jianmin
2017-07-01
Tocopherols, a group of Vitamin E compounds, are essential components of the human diet. In contrast to well documented roles in animals, the functions of tocopherols in plants are less understood. In this study, we characterized two allelic rice dwarf mutant lines designated sgd1-1 and sgd1-2 (small grain and dwarf1). Histological observations showed that the dwarf phenotypes were mainly due to cell elongation defects. A map-based cloning strategy and subsequent complementation test showed that SGD1 encodes homogentisate phytyltransferase (HPT), a key enzyme in tocopherol biosynthesis. Mutation of SGD1 resulted in tocopherol deficiency in both sgd1mutants. No oxidant damage was detected in the sgd1 mutants. Further analysis showed that sgd1-2 was hypersensitive to cold stress. Our results indicate that SGD1 is essential for plant development and cold tolerance in rice. Copyright © 2017 Elsevier B.V. All rights reserved.
Cytokinins, A classical multifaceted hormone in plant system
Directory of Open Access Journals (Sweden)
Mohd Mazid
2011-12-01
Full Text Available Today, owing to the versatile functionality and physiological importance of the phytohormone cytokinin (Ck is a major focus of attention in contemporary wide areas of plant science. Cytokinins (Cks have implicated in diverse essential processes of plant growth and development as well as in regulation of key genes responsible for the metabolism and activities of plants. Cytokinin interact in a complex manner to control a myriad of aspects related to growth, development and differentiation and its deficiency also causes pleiotropic developmental changes such as reduced shoot and increased root growth. Cytokinin signaling involves His Kinase receptors that perceive cytokinin and transmit the signal via a multi-step phosphorelay similar to bacterial two-component signaling system. Also, this review present a scheme for homeostatic regulation of endogenous cytokinins level in terms of the described mechanism of cytokinin action including its receptors and steps involved in regulation of gene expression at the post-transcriptional level and its role in whole plant as well as cell division. In addition, we also demonstrate a wide variety of biological effects including those on gene expression, inhibition of auxin action, stimulation of cell cycle etc.
Diverse roles of ERECTA family genes in plant development.
Shpak, Elena D
2013-12-01
Multiple receptor-like kinases (RLKs) enable intercellular communication that coordinates growth and development of plant tissues. ERECTA family receptors (ERfs) are an ancient family of leucine-rich repeat RLKs that in Arabidopsis consists of three genes: ERECTA, ERL1, and ERL2. ERfs sense secreted cysteine-rich peptides from the EPF/EPFL family and transmit the signal through a MAP kinase cascade. This review discusses the functions of ERfs in stomata development, in regulation of longitudinal growth of aboveground organs, during reproductive development, and in the shoot apical meristem. In addition the role of ERECTA in plant responses to biotic and abiotic factors is examined. Elena D. Shpak (Corresponding author). © 2013 Institute of Botany, Chinese Academy of Sciences.
Nickrent, D L; Parkinson, C L; Palmer, J D; Duff, R J
2000-12-01
A widely held view of land plant relationships places liverworts as the first branch of the land plant tree, whereas some molecular analyses and a cladistic study of morphological characters indicate that hornworts are the earliest land plants. To help resolve this conflict, we used parsimony and likelihood methods to analyze a 6, 095-character data set composed of four genes (chloroplast rbcL and small-subunit rDNA from all three plant genomes) from all major land plant lineages. In all analyses, significant support was obtained for the monophyly of vascular plants, lycophytes, ferns (including PSILOTUM: and EQUISETUM:), seed plants, and angiosperms. Relationships among the three bryophyte lineages were unresolved in parsimony analyses in which all positions were included and weighted equally. However, in parsimony and likelihood analyses in which rbcL third-codon-position transitions were either excluded or downweighted (due to apparent saturation), hornworts were placed as sister to all other land plants, with mosses and liverworts jointly forming the second deepest lineage. Decay analyses and Kishino-Hasegawa tests of the third-position-excluded data set showed significant support for the hornwort-basal topology over several alternative topologies, including the commonly cited liverwort-basal topology. Among the four genes used, mitochondrial small-subunit rDNA showed the lowest homoplasy and alone recovered essentially the same topology as the multigene tree. This molecular phylogeny presents new opportunities to assess paleontological evidence and morphological innovations that occurred during the early evolution of terrestrial plants.
Directory of Open Access Journals (Sweden)
Fengxi Yang
Full Text Available Cymbidium ensifolium belongs to the genus Cymbidium of the orchid family. Owing to its spectacular flower morphology, C. ensifolium has considerable ecological and cultural value. However, limited genetic data is available for this non-model plant, and the molecular mechanism underlying floral organ identity is still poorly understood. In this study, we characterize the floral transcriptome of C. ensifolium and present, for the first time, extensive sequence and transcript abundance data of individual floral organs. After sequencing, over 10 Gb clean sequence data were generated and assembled into 111,892 unigenes with an average length of 932.03 base pairs, including 1,227 clusters and 110,665 singletons. Assembled sequences were annotated with gene descriptions, gene ontology, clusters of orthologous group terms, the Kyoto Encyclopedia of Genes and Genomes, and the plant transcription factor database. From these annotations, 131 flowering-associated unigenes, 61 CONSTANS-LIKE (COL unigenes and 90 floral homeotic genes were identified. In addition, four digital gene expression libraries were constructed for the sepal, petal, labellum and gynostemium, and 1,058 genes corresponding to individual floral organ development were identified. Among them, eight MADS-box genes were further investigated by full-length cDNA sequence analysis and expression validation, which revealed two APETALA1/AGL9-like MADS-box genes preferentially expressed in the sepal and petal, two AGAMOUS-like genes particularly restricted to the gynostemium, and four DEF-like genes distinctively expressed in different floral organs. The spatial expression of these genes varied distinctly in different floral mutant corresponding to different floral morphogenesis, which validated the specialized roles of them in floral patterning and further supported the effectiveness of our in silico analysis. This dataset generated in our study provides new insights into the molecular mechanisms
Directory of Open Access Journals (Sweden)
Alessandra Chesi
Full Text Available YPK9 (Yeast PARK9; also known as YOR291W is a non-essential yeast gene predicted by sequence to encode a transmembrane P-type transport ATPase. However, its substrate specificity is unknown. Mutations in the human homolog of YPK9, ATP13A2/PARK9, have been linked to genetic forms of early onset parkinsonism. We previously described a strong genetic interaction between Ypk9 and another Parkinson's disease (PD protein α-synuclein in multiple model systems, and a role for Ypk9 in manganese detoxification in yeast. In humans, environmental exposure to toxic levels of manganese causes a syndrome similar to PD and is thus an environmental risk factor for the disease. How manganese contributes to neurodegeneration is poorly understood. Here we describe multiple genome-wide screens in yeast aimed at defining the cellular function of Ypk9 and the mechanisms by which it protects cells from manganese toxicity. In physiological conditions, we found that Ypk9 genetically interacts with essential genes involved in cellular trafficking and the cell cycle. Deletion of Ypk9 sensitizes yeast cells to exposure to excess manganese. Using a library of non-essential gene deletions, we screened for additional genes involved in tolerance to excess manganese exposure, discovering several novel pathways involved in manganese homeostasis. We defined the dependence of the deletion strain phenotypes in the presence of manganese on Ypk9, and found that Ypk9 deletion modifies the manganese tolerance of only a subset of strains. These results confirm a role for Ypk9 in manganese homeostasis and illuminates cellular pathways and biological processes in which Ypk9 likely functions.
Application of a scalable plant transient gene expression platform for malaria vaccine development
Directory of Open Access Journals (Sweden)
Holger eSpiegel
2015-12-01
Full Text Available Despite decades of intensive research efforts there is currently no vaccine that provides sustained sterile immunity against malaria. In this context, a large number of targets from the different stages of the Plasmodium falciparum life cycle have been evaluated as vaccine candidates. None of these candidates has fulfilled expectations, and as long as we lack a single target that induces strain-transcending protective immune responses, combining key antigens from different life cycle stages seems to be the most promising route towards the development of efficacious malaria vaccines. After the identification of potential targets using approaches such as omics-based technology and reverse immunology, the rapid expression, purification and characterization of these proteins, as well as the generation and analysis of fusion constructs combining different promising antigens or antigen domains before committing to expensive and time consuming clinical development, represents one of the bottlenecks in the vaccine development pipeline. The production of recombinant proteins by transient gene expression in plants is a robust and versatile alternative to cell-based microbial and eukaryotic production platforms. The transfection of plant tissues and/or whole plants using Agrobacterium tumefaciens offers a low technical entry barrier, low costs and a high degree of flexibility embedded within a rapid and scalable workflow. Recombinant proteins can easily be targeted to different subcellular compartments according to their physicochemical requirements, including post-translational modifications, to ensure optimal yields of high quality product, and to support simple and economical downstream processing. Here we demonstrate the use of a plant transient expression platform based on transfection with A. tumefaciens as essential component of a malaria vaccine development workflow involving screens for expression, solubility and stability using fluorescent fusion
Gene evolutionary trajectories and GC patterns driven by recombination in Zea mays
Recombination occurring during meiosis is critical for creating genetic variation and plays an essential role in plant evolution. In addition to creating novel gene combinations, recombination can affect genome structure through altering GC patterns. In maize (Zea mays) and other grasses, another in...
International Nuclear Information System (INIS)
Deveaux, Yves
1999-01-01
DNA damage, that can be experimentally introduced by ionizing radiation (IR), induces complex signal transduction pathways leading to cell recovery or, alternatively to programmed cell death if damages are too severe. To identify the inducible components of the response to genotoxic stress in plants, we have screened by Differential Display for mRNAs that rapidly and strongly accumulate after IR treatment in A. thaliana cells. We have characterized ATGR1, a new single copy Arabidopsis gene encoding a PEST-box protein of unknown function. In unstressed plant organs the ATGR1 mRNA is hardly detectable, whereas the protein is present in extracts prepared from roots, shoot meristems and inflorescences, that all contain large amounts of actively dividing cells. This pattern is confirmed by immuno localisation on tissue sections that shows constitutive ATGR1 protein expression covering the root elongation zone, the shoot meristem, leaf primordial and the ovules of developing flowers. Histochemical analysis of transgenic plants expressing the GUS reporter gene under the control of the ATGR1 promoter, demonstrate that the developmental and tissue-specific profile of ATGR1 protein expression is conferred by the gene promoter. The massive, transient and dose-dependent accumulation of ATGR1 transcripts after IR treatment observed in all plant organs does not lead to significant changes in ATGR1 protein pattern. Stable ATGR1 protein overexpression, as exemplified by transgenic A. thaliana plants that contain a 35S promoter-ATGR1 gene fusion, does not induce notable changes of the overall ATGR1 protein level, but leads to male and female sterility. The cause of sterility is a lack of correct chromosome assembly and distribution at the stage metaphase II of meiosis. Taken together our results show that i) ATGR1 gene expression is associated to cell division during plant development ii) the ATGR1 protein level is regulated at the transcriptional and post-transcriptional level iii
Growth regulators and essential oil production
Prins, Cláudia L; Vieira, Ivo J. C; Freitas, Silvério P
2010-01-01
The aroma and fragrance industry is a billion-dollar world market which grows annually. Essential oils comprise the majority of compounds used by these industries. These sets of metabolites are formed mainly by monoterpenes, which are products of the plants' secondary metabolism. Biosynthesized from mevalonate and methylerythitol phosphate, the essential oil production depends not only on genetic factors and the developmental stage of plants, but also on environmental factors which could resu...
Enhanced water stress tolerance of transgenic maize plants over-expressing LEA Rab28 gene.
Amara, Imen; Capellades, Montserrat; Ludevid, M Dolors; Pagès, Montserrat; Goday, Adela
2013-06-15
Late Embryogenesis Abundant (LEA) proteins participate in plant stress responses and contribute to the acquisition of desiccation tolerance. In this report Rab28 LEA gene has been over-expressed in maize plants under a constitutive maize promoter. The expression of Rab28 transcripts led to the accumulation and stability of Rab28 protein in the transgenic plants. Native Rab28 protein is localized to nucleoli in wild type maize embryo cells; here we find by whole-mount immunocytochemistry that in root cells of Rab28 transgenic and wild-type plants the protein is also associated to nucleolar structures. Transgenic plants were tested for stress tolerance and resulted in sustained growth under polyethyleneglycol (PEG)-mediated dehydration compared to wild-type controls. Under osmotic stress transgenic seedlings showed increased leaf and root areas, higher relative water content (RWC), reduced chlorophyll loss and lower Malondialdehyde (MDA) production in relation to wild-type plants. Moreover, transgenic seeds exhibited higher germination rates than wild-type seeds under water deficit. Overall, our results highlight the presence of transgenic Rab28 protein in nucleolar structures and point to the potential of group 5 LEA Rab28 gene as candidate to enhance stress tolerance in maize plants. Copyright © 2013 Elsevier GmbH. All rights reserved.
Bioaerosols from a Food Waste Composting Plant Affect Human Airway Epithelial Cell Remodeling Genes
Chang, Ming-Wei; Lee, Chung-Ru; Hung, Hsueh-Fen; Teng, Kuo-Sheng; Huang, Hsin; Chuang, Chun-Yu
2013-01-01
The composting procedure in food waste plants generates airborne bioaerosols that have the potential to damage human airway epithelial cells. Persistent inflammation and repair responses induce airway remodeling and damage to the respiratory system. This study elucidated the expression changes of airway remodeling genes in human lung mucoepidermoid NCI-H292 cells exposed to bioaerosols from a composting plant. Different types of microorganisms were detectable in the composting plant, using the agar culture method. Real-time polymerase chain reaction was used to quantify the level of Aspergillus fumigatus and the profile of remodeling genes. The real-time PCR results indicated that the amount of A. fumigatus in the composting hall was less than 102 conidia. The endotoxins in the field bioaerosols were determined using a limulus amebocyte lysate test. The endotoxin levels depended on the type of particulate matter (PM), with coarse particles (2.5–10 μm) having higher endotoxin levels than did fine particles (0.5–2.5 μm). After exposure to the conditioned medium of field bioaerosol samples, NCI-H292 cells showed increased pro-inflammatory interleukin (IL)-6 release and activated epidermal growth factor receptor (EGFR), transforming growth factor (TGF)-β1 and cyclin-dependent kinase inhibitor 1 (p21WAF1/CIP1) gene expression, but not of matrix metallopeptidase (MMP)-9. Airborne endotoxin levels were higher inside the composting hall than they were in other areas, and they were associated with PM. This suggested that airborne bioaerosols in the composting plant contained endotoxins and microorganisms besides A. fumigatus that cause the inflammatory cytokine secretion and augment the expression of remodeling genes in NCI-H292 cells. It is thus necessary to monitor potentially hazardous materials from bioaerosols in food composting plants, which could affect the health of workers. PMID:24368426
Bioaerosols from a food waste composting plant affect human airway epithelial cell remodeling genes.
Chang, Min-Wei; Lee, Chung-Ru; Hung, Hsueh-Fen; Teng, Kuo-Sheng; Huang, Hsin; Chuang, Chun-Yu
2013-12-24
The composting procedure in food waste plants generates airborne bioaerosols that have the potential to damage human airway epithelial cells. Persistent inflammation and repair responses induce airway remodeling and damage to the respiratory system. This study elucidated the expression changes of airway remodeling genes in human lung mucoepidermoid NCI-H292 cells exposed to bioaerosols from a composting plant. Different types of microorganisms were detectable in the composting plant, using the agar culture method. Real-time polymerase chain reaction was used to quantify the level of Aspergillus fumigatus and the profile of remodeling genes. The real-time PCR results indicated that the amount of A. fumigatus in the composting hall was less than 10(2) conidia. The endotoxins in the field bioaerosols were determined using a limulus amebocyte lysate test. The endotoxin levels depended on the type of particulate matter (PM), with coarse particles (2.5-10 μm) having higher endotoxin levels than did fine particles (0.5-2.5 μm). After exposure to the conditioned medium of field bioaerosol samples, NCI-H292 cells showed increased pro-inflammatory interleukin (IL)-6 release and activated epidermal growth factor receptor (EGFR), transforming growth factor (TGF)-β1 and cyclin-dependent kinase inhibitor 1 (p21 WAF1/CIP1) gene expression, but not of matrix metallopeptidase (MMP)-9. Airborne endotoxin levels were higher inside the composting hall than they were in other areas, and they were associated with PM. This suggested that airborne bioaerosols in the composting plant contained endotoxins and microorganisms besides A. fumigatus that cause the inflammatory cytokine secretion and augment the expression of remodeling genes in NCI-H292 cells. It is thus necessary to monitor potentially hazardous materials from bioaerosols in food composting plants, which could affect the health of workers.
Klix, V; Nowrousian, M; Ringelberg, C; Loros, J J; Dunlap, J C; Pöggeler, S
2010-06-01
Mating-type genes in fungi encode regulators of mating and sexual development. Heterothallic ascomycete species require different sets of mating-type genes to control nonself-recognition and mating of compatible partners of different mating types. Homothallic (self-fertile) species also carry mating-type genes in their genome that are essential for sexual development. To analyze the molecular basis of homothallism and the role of mating-type genes during fruiting-body development, we deleted each of the three genes, SmtA-1 (MAT1-1-1), SmtA-2 (MAT1-1-2), and SmtA-3 (MAT1-1-3), contained in the MAT1-1 part of the mating-type locus of the homothallic ascomycete species Sordaria macrospora. Phenotypic analysis of deletion mutants revealed that the PPF domain protein-encoding gene SmtA-2 is essential for sexual reproduction, whereas the alpha domain protein-encoding genes SmtA-1 and SmtA-3 play no role in fruiting-body development. By means of cross-species microarray analysis using Neurospora crassa oligonucleotide microarrays hybridized with S. macrospora targets and quantitative real-time PCR, we identified genes expressed under the control of SmtA-1 and SmtA-2. Both genes are involved in the regulation of gene expression, including that of pheromone genes.
International Nuclear Information System (INIS)
Ahmad, R.; Jabeen, R.
2005-01-01
Plants growing at saline substrate practice deficiencies in absorption of some essential mineral elements through roots due to presence of excessive sodium in rhizosphere. Sodium being antagonistic to other cations does not let them enter in roots and hence apart from its own toxicity in metabolism, the plants suffer with deficiencies of some mineral elements, which are necessary for growth. Potassium being essential mineral element is much effected due to this antagonistic behavior of sodium ion. Lagenaria siceraria (var. Loki) being a broad leaf vegetable was selected for these experiments. Plant growing at saline substrate was sprayed with specially prepared spray materials containing different dilutions of potassium nitrate. The anatomy of leaf with special reference to that of stomata was also studied to ensure absorption of required minerals. Growth of plants in terms of leaf area is being monitored at present. Some preliminary experiments show betterment in production of fruits in plants undergoing foliar spray. This hypothesis has opened a new chapter demanding series of experiments dealing with recipe of spray materials, mechanism of minerals uptake through stomata, participation of absorbed minerals in metabolic activities around palisade tissue probably by activating potassium dependent enzyme system which otherwise is blocked by replaced sodium, translocation of these minerals from leaves through petiole in rest of plants and overall effect of such spray on vegetative as well as reproductive growth in plants under saline environment. Some of this work is in progress. (author)
Directory of Open Access Journals (Sweden)
Jin-Hua Ran
Full Text Available Stomata play significant roles in plant evolution. A trio of closely related basic Helix-Loop-Helix (bHLH subgroup Ia genes, SPCH, MUTE and FAMA, mediate sequential steps of stomatal development, and their functions may be conserved in land plants. However, the evolutionary history of the putative SPCH/MUTE/FAMA genes is still greatly controversial, especially the phylogenetic positions of the bHLH Ia members from basal land plants. To better understand the evolutionary pattern and functional diversity of the bHLH genes involved in stomatal development, we made a comprehensive evolutionary analysis of the homologous genes from 54 species representing the major lineages of green plants. The phylogenetic analysis indicated: (1 All bHLH Ia genes from the two basal land plants Physcomitrella and Selaginella were closely related to the FAMA genes of seed plants; and (2 the gymnosperm 'SPCH' genes were sister to a clade comprising the angiosperm SPCH and MUTE genes, while the FAMA genes of gymnosperms and angiosperms had a sister relationship. The revealed phylogenetic relationships are also supported by the distribution of gene structures and previous functional studies. Therefore, we deduce that the function of FAMA might be ancestral in the bHLH Ia subgroup. In addition, the gymnosperm "SPCH" genes may represent an ancestral state and have a dual function of SPCH and MUTE, two genes that could have originated from a duplication event in the common ancestor of angiosperms. Moreover, in angiosperms, SPCHs have experienced more duplications and harbor more copies than MUTEs and FAMAs, which, together with variation of the stomatal development in the entry division, implies that SPCH might have contributed greatly to the diversity of stomatal development. Based on the above, we proposed a model for the correlation between the evolution of stomatal development and the genes involved in this developmental process in land plants.
Directory of Open Access Journals (Sweden)
Andrei Zinovyev
2013-04-01
Full Text Available Systematic analysis of synthetic lethality (SL constitutes a critical tool for systems biology to decipher molecular pathways. The most accepted mechanistic explanation of SL is that the two genes function in parallel, mutually compensatory pathways, known as between-pathway SL. However, recent genome-wide analyses in yeast identified a significant number of within-pathway negative genetic interactions. The molecular mechanisms leading to within-pathway SL are not fully understood. Here, we propose a novel mechanism leading to within-pathway SL involving two genes functioning in a single non-essential pathway. This type of SL termed within-reversible-pathway SL involves reversible pathway steps, catalyzed by different enzymes in the forward and backward directions, and kinetic trapping of a potentially toxic intermediate. Experimental data with recombinational DNA repair genes validate the concept. Mathematical modeling recapitulates the possibility of kinetic trapping and revealed the potential contributions of synthetic, dosage-lethal interactions in such a genetic system as well as the possibility of within-pathway positive masking interactions. Analysis of yeast gene interaction and pathway data suggests broad applicability of this novel concept. These observations extend the canonical interpretation of synthetic-lethal or synthetic-sick interactions with direct implications to reconstruct molecular pathways and improve therapeutic approaches to diseases such as cancer.
Li, Zhi-Jian; Njateng, Guy S S; He, Wen-Jia; Zhang, Hong-Xia; Gu, Jian-Long; Chen, Shan-Na; Du, Zhi-Zhi
2013-11-01
The essential oil obtained by hydrodistillation from the aerial parts of Aristolochia delavayi Franch. (Aristolochiaceae), a unique edible aromatic plant consumed by the Nakhi (Naxi) people in Yunnan, China, was investigated using GC/MS analysis. In total, 95 components, representing more than 95% of the oil composition, were identified, and the main constituents found were (E)-dec-2-enal (52.0%), (E)-dodec-2-enal (6.8%), dodecanal (3.35%), heptanal (2.88%), and decanal (2.63%). The essential oil showed strong inhibitory activity (96% reduction) of the production of bacterial volatile sulfide compounds (VSC) by Klebsiella pneumoniae, an effect that was comparable with that of the reference compound citral (91% reduction). Moreover, the antimicrobial activity of the essential oil and the isolated major compound against eight bacterial and six fungal strains were evaluated. The essential oil showed significant antibacterial activity against Providencia stuartii and Escherichia coli, with minimal inhibitory concentrations (MIC) ranging from 3.9 to 62.5 μg/ml. The oil also showed strong inhibitory activity against the fungal strains Trichophyton ajelloi, Trichophyton terrestre, Candida glabrata, Candida guilliermondii, and Cryptococcus neoformans, with MIC values ranging from 3.9 to 31.25 μg/ml, while (E)-dec-2-enal presented a lower antifungal activity than the essential oil. Copyright © 2013 Verlag Helvetica Chimica Acta AG, Zürich.
New challenges in plant aquaporin biotechnology.
Martinez-Ballesta, Maria del Carmen; Carvajal, Micaela
2014-03-01
Recent advances concerning genetic manipulation provide new perspectives regarding the improvement of the physiological responses in herbaceous and woody plants to abiotic stresses. The beneficial or negative effects of these manipulations on plant physiology are discussed, underlining the role of aquaporin isoforms as representative markers of water uptake and whole plant water status. Increasing water use efficiency and the promotion of plant water retention seem to be critical goals in the improvement of plant tolerance to abiotic stress. However, newly uncovered mechanisms, such as aquaporin functions and regulation, may be essential for the beneficial effects seen in plants overexpressing aquaporin genes. Under distinct stress conditions, differences in the phenotype of transgenic plants where aquaporins were manipulated need to be analyzed. In the development of nano-technologies for agricultural practices, multiple-walled carbon nanotubes promoted plant germination and cell growth. Their effects on aquaporins need further investigation. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
International Nuclear Information System (INIS)
Rangwala, Shamina M.; Li, Xiaoyan; Lindsley, Loren; Wang, Xiaomei; Shaughnessy, Stacey; Daniels, Thomas G.; Szustakowski, Joseph; Nirmala, N.R.; Wu, Zhidan; Stevenson, Susan C.
2007-01-01
Estrogen-related receptor α (ERRα) is an important mediator of mitochondrial biogenesis and function. To investigate the transcriptional network controlling these phenomena, we investigated mitochondrial gene expression in embryonic fibroblasts isolated from ERRα null mice. Peroxisome proliferator-activated receptor γ coactivator-1α (PGC-1α) stimulated mitochondrial gene expression program in control cells, but not in the ERRα null cells. Interestingly, the induction of levels of mitochondrial oxidative stress protection genes in response to increased PGC-1α levels was dependent on ERRα. Furthermore, we found that the PGC-1α-mediated induction of estrogen-related receptor γ and nuclear respiratory factor 2 (NRF-2), was dependent on the presence of ERRα. Basal levels of NRF-2 were decreased in the absence of ERRα. The absence of ERRα resulted in a decrease in citrate synthase enzyme activity in response to PGC-1α overexpression. Our results indicate an essential role for ERRα as a key regulator of oxidative metabolism
Broddrick, Jared T.; Rubin, Benjamin E.; Welkie, David G.; Du, Niu; Mih, Nathan; Diamond, Spencer; Lee, Jenny J.; Golden, Susan S.; Palsson, Bernhard O.
2016-01-01
The model cyanobacterium, Synechococcus elongatus PCC 7942, is a genetically tractable obligate phototroph that is being developed for the bioproduction of high-value chemicals. Genome-scale models (GEMs) have been successfully used to assess and engineer cellular metabolism; however, GEMs of phototrophic metabolism have been limited by the lack of experimental datasets for model validation and the challenges of incorporating photon uptake. Here, we develop a GEM of metabolism in S. elongatus using random barcode transposon site sequencing (RB-TnSeq) essential gene and physiological data specific to photoautotrophic metabolism. The model explicitly describes photon absorption and accounts for shading, resulting in the characteristic linear growth curve of photoautotrophs. GEM predictions of gene essentiality were compared with data obtained from recent dense-transposon mutagenesis experiments. This dataset allowed major improvements to the accuracy of the model. Furthermore, discrepancies between GEM predictions and the in vivo dataset revealed biological characteristics, such as the importance of a truncated, linear TCA pathway, low flux toward amino acid synthesis from photorespiration, and knowledge gaps within nucleotide metabolism. Coupling of strong experimental support and photoautotrophic modeling methods thus resulted in a highly accurate model of S. elongatus metabolism that highlights previously unknown areas of S. elongatus biology. PMID:27911809
Reference Gene Selection in the Desert Plant Eremosparton songoricum
Directory of Open Access Journals (Sweden)
Dao-Yuan Zhang
2012-06-01
Full Text Available Eremosparton songoricum (Litv. Vass. (E. songoricum is a rare and extremely drought-tolerant desert plant that holds promise as a model organism for the identification of genes associated with water deficit stress. Here, we cloned and evaluated the expression of eight candidate reference genes using quantitative real-time reverse transcriptase polymerase chain reactions. The expression of these candidate reference genes was analyzed in a diverse set of 20 samples including various E. songoricum plant tissues exposed to multiple environmental stresses. GeNorm analysis indicated that expression stability varied between the reference genes in the different experimental conditions, but the two most stable reference genes were sufficient for normalization in most conditions. EsEF and Esα-TUB were sufficient for various stress conditions, EsEF and EsACT were suitable for samples of differing germination stages, and EsGAPDHand EsUBQ were most stable across multiple adult tissue samples. The Es18S gene was unsuitable as a reference gene in our analysis. In addition, the expression level of the drought-stress related transcription factor EsDREB2 verified the utility of E. songoricum reference genes and indicated that no single gene was adequate for normalization on its own. This is the first systematic report on the selection of reference genes in E. songoricum, and these data will facilitate future work on gene expression in this species.
Directory of Open Access Journals (Sweden)
Marium M. Shamaa
2016-09-01
Full Text Available The pathogenesis of essential hypertension (EH is affected by genetic and environmental factors. Mutations in hypertension-related genes can affect blood pressure (BP via alteration of salt and water reabsorption by the nephron. The genes of the renin-angiotensin system (RAS have been extensively studied because of the well documented role of this system in the control of BP. It has been previously shown that Angiotensin II type 1 receptor (ATR1 gene polymorphism could be associated with increased risk of EH. So, in the current study, we evaluated the frequency of ATR1 (A1166C polymorphism in relation to EH in a group of Egyptian population. The study population included 83 hypertensive patients and 60 age and sex matched healthy control subjects. Restriction fragment length polymorphism – Polymerase chain reaction (RFLP – PCR was used for the analysis of A1166C polymorphism of ATR1 genes in peripheral blood samples of all patients and controls. The results revealed that there was a positive risk of developing EH when having the T allele whether in homozygous or heterozygous state. From this work, it was concluded that there was an association between ATR1 (A1166C gene polymorphism and the risk of developing EH.
Zhou, Jia-Yu; Li, Xia; Zhao, Dan; Deng-Wang, Meng-Yao; Dai, Chuan-Chao
2016-09-01
Pseudomonas fluorescens induces gibberellin and ethylene signaling via hydrogen peroxide in planta . Ethylene activates abscisic acid signaling. Hormones increase sesquiterpenoid biosynthesis gene expression and enzyme activity, inducing essential oil accumulation. Atractylodes lancea is a famous Chinese medicinal plant, whose main active components are essential oils. Wild A. lancea has become endangered due to habitat destruction and over-exploitation. Although cultivation can ensure production of the medicinal material, the essential oil content in cultivated A. lancea is significantly lower than that in the wild herb. The application of microbes as elicitors has become an effective strategy to increase essential oil accumulation in cultivated A. lancea. Our previous study identified an endophytic bacterium, Pseudomonas fluorescens ALEB7B, which can increase essential oil accumulation in A. lancea more efficiently than other endophytes; however, the underlying mechanisms remain unknown (Physiol Plantarum 153:30-42, 2015; Appl Environ Microb 82:1577-1585, 2016). This study demonstrates that P. fluorescens ALEB7B firstly induces hydrogen peroxide (H2O2) signaling in A. lancea, which then simultaneously activates gibberellin (GA) and ethylene (ET) signaling. Subsequently, ET activates abscisic acid (ABA) signaling. GA and ABA signaling increase expression of HMGR and DXR, which encode key enzymes involved in sesquiterpenoid biosynthesis, leading to increased levels of the corresponding enzymes and then an accumulation of essential oils. Specific reactive oxygen species and hormone signaling cascades induced by P. fluorescens ALEB7B may contribute to high-efficiency essential oil accumulation in A. lancea. Illustrating the regulation mechanisms underlying P. fluorescens ALEB7B-induced essential oil accumulation not only provides the theoretical basis for the inducible synthesis of terpenoids in many medicinal plants, but also further reveals the complex and diverse
Yoshizumi, Takeshi; Oikawa, Kazusato; Chuah, Jo-Ann; Kodama, Yutaka; Numata, Keiji
2018-05-14
Selective gene delivery into organellar genomes (mitochondrial and plastid genomes) has been limited because of a lack of appropriate platform technology, even though these organelles are essential for metabolite and energy production. Techniques for selective organellar modification are needed to functionally improve organelles and produce transplastomic/transmitochondrial plants. However, no method for mitochondrial genome modification has yet been established for multicellular organisms including plants. Likewise, modification of plastid genomes has been limited to a few plant species and algae. In the present study, we developed ionic complexes of fusion peptides containing organellar targeting signal and plasmid DNA for selective delivery of exogenous DNA into the plastid and mitochondrial genomes of intact plants. This is the first report of exogenous DNA being integrated into the mitochondrial genomes of not only plants, but also multicellular organisms in general. This fusion peptide-mediated gene delivery system is a breakthrough platform for both plant organellar biotechnology and gene therapy for mitochondrial diseases in animals.
Genome information of Methylobacterium oryzae, a plant-probiotic methylotroph in the phyllosphere.
Kwak, Min-Jung; Jeong, Haeyoung; Madhaiyan, Munusamy; Lee, Yi; Sa, Tong-Min; Oh, Tae Kwang; Kim, Jihyun F
2014-01-01
Pink-pigmented facultative methylotrophs in the Rhizobiales are widespread in the environment, and many Methylobacterium species associated with plants produce plant growth-promoting substances. To gain insights into the life style at the phyllosphere and the genetic bases of plant growth promotion, we determined and analyzed the complete genome sequence of Methylobacterium oryzae CBMB20T, a strain isolated from rice stem. The genome consists of a 6.29-Mb chromosome and four plasmids, designated as pMOC1 to pMOC4. Among the 6,274 coding sequences in the chromosome, the bacterium has, besides most of the genes for the central metabolism, all of the essential genes for the assimilation and dissimilation of methanol that are either located in methylotrophy islands or dispersed. M. oryzae is equipped with several kinds of genes for adaptation to plant surfaces such as defense against UV radiation, oxidative stress, desiccation, or nutrient deficiency, as well as high proportion of genes related to motility and signaling. Moreover, it has an array of genes involved in metabolic pathways that may contribute to promotion of plant growth; they include auxin biosynthesis, cytokine biosynthesis, vitamin B12 biosynthesis, urea metabolism, biosorption of heavy metals or decrease of metal toxicity, pyrroloquinoline quinone biosynthesis, 1-aminocyclopropane-1-carboxylate deamination, phosphate solubilization, and thiosulfate oxidation. Through the genome analysis of M. oryzae, we provide information on the full gene complement of M. oryzae that resides in the aerial parts of plants and enhances plant growth. The plant-associated lifestyle of M. oryzae pertaining to methylotrophy and plant growth promotion, and its potential as a candidate for a bioinoculant targeted to the phyllosphere and focused on phytostimulation are illuminated.
Phukerd, Ubol; Soonwera, Mayura
2014-09-01
Repellent activity of essential oils derived from 10 Thai native plants, belonging to three families were evaluated against female Aedes aegypti and Culex quinquefasciatus and to compare them with a commercial chemical repellents (DEET; N,N-diethyl-3-methylbenzamide 20% w/w; Sketolene Shield). Each test repellent was applied at 1, 5, and 10% concentrations for testing by arm in cage method. The results showed significant differences in repellency among the repellents by mosquito species. The protection time of the essential oils against Ae. aegypti ranged from 3 to 30 min. According to the Culex mosquito, it showed the protection time ranged from 3 to 260 min. 10 % Boesenbergia rotunda essential oil provided the best efficiency, in which protection time was 4.3 h as equal as DEET. The essential oils which exhibited protection time more than 2 h were those of 10% Zingiber zerumbet, Litsea petiolata, Curcuma zedoaria, and Zingiber cassumunar essential oils (3.1, 2.8, 2.6, and 2.3 h, respectively). The biting percentage ranged from 0.9 to 18.0% and 0.8 to 3.6% against Ae. aegypti and Cx. quinquefasciatus, respectively. The results revealed that the potential of essential oil extracted from B. rotunda, Z. zerumbet, L. petiolata, C. zedoaria, and Z. cassumunar had attributes of good repellent and deterred biting. We recommend the five essential oils for further study to develop as commercial repellents.
Wang, Jun; Tao, Feng; Marowsky, Nicholas C.; Fan, Chuanzhu
2016-01-01
Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella. Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. PMID:27485883
Bianchini, Ange; Santoni, François; Paolini, Julien; Bernardini, Antoine-François; Mouillot, David; Costa, Jean
2009-07-01
Composition of Helichrysum italicum subsp. italicum essential oil showed chemical variability according to vegetation cycle, environment, and geographic origins. In the present work, 48 individuals of this plant at different development stages and the corresponding root soils were sampled: i) 28 volatile components were identified and measured in essential oil by using GC and GC/MS; ii) ten elements from plants and soils have been estimated using colorimetry in continuous flux, flame atomic absorption spectrometry, or emission spectrometry (FAAS/FAES); iii) texture and acidity (real and potential) of soil samples were also reported. Relationships between the essential-oil composition, the inorganic plant composition, and the soil characteristics (inorganic composition, texture, and acidity) have been established using multivariate analysis such as Principal Component Analysis (PCA) and partial Redundancy Analysis (RDA). This study demonstrates a high level of intraspecific differences in oil composition due to environmental factors and, more particularly, soil characteristics.
Danchin, Etienne G.J.; Perfus-Barbeoch, Laetitia; Rancurel, Corinne; Thorpe, Peter; Rocha, Da Martine; Bajew, Simon; Neilson, Roy; Sokolova, Elena; Silva, Da Corinne; Guy, Julie; Labadie, Karine; Esmenjaud, Daniel; Helder, Hans; Jones, John T.; Eves-van den Akker, Sebastian
2017-01-01
Nematodes have evolved the ability to parasitize plants on at least four independent occasions, with plant parasites present in Clades 1, 2, 10 and 12 of the phylum. In the case of Clades 10 and 12, horizontal gene transfer of plant cell wall degrading enzymes from bacteria and fungi has been
García, María J; Romera, Francisco J; Stacey, Minviluz G; Stacey, Gary; Villar, Eduardo; Alcántara, Esteban; Pérez-Vicente, Rafael
2013-01-01
Previous research showed that auxin, ethylene, and nitric oxide (NO) can activate the expression of iron (Fe)-acquisition genes in the roots of Strategy I plants grown with low levels of Fe, but not in plants grown with high levels of Fe. However, it is still an open question as to how Fe acts as an inhibitor and which pool of Fe (e.g., root, phloem, etc.) in the plant acts as the key regulator for gene expression control. To further clarify this, we studied the effect of the foliar application of Fe on the expression of Fe-acquisition genes in several Strategy I plants, including wild-type cultivars of Arabidopsis [Arabidopsis thaliana (L.) Heynh], pea [Pisum sativum L.], tomato [Solanum lycopersicon Mill.], and cucumber [Cucumis sativus L.], as well as mutants showing constitutive expression of Fe-acquisition genes when grown under Fe-sufficient conditions [Arabidopsis opt3-2 and frd3-3, pea dgl and brz, and tomato chln (chloronerva)]. The results showed that the foliar application of Fe blocked the expression of Fe-acquisition genes in the wild-type cultivars and in the frd3-3, brz, and chln mutants, but not in the opt3-2 and dgl mutants, probably affected in the transport of a Fe-related repressive signal in the phloem. Moreover, the addition of either ACC (ethylene precursor) or GSNO (NO donor) to Fe-deficient plants up-regulated the expression of Fe-acquisition genes, but this effect did not occur in Fe-deficient plants sprayed with foliar Fe, again suggesting the existence of a Fe-related repressive signal moving from leaves to roots.
Satoh, Kouji; Saji, Shoko; Ito, Shoko; Shimizu, Hideyuki; Saji, Hikaru; Kikuchi, Shoshi
2014-01-01
Throughout Asia, including Japan, rice plants are cultivated in a wide range of areas from lowlands to highlands and are frequently exposed to fog, including acid fog. Some physiological studies have shown that acid fog can be a stress factor for plants. We analyzed the gene expression profiles of rice plants treated with artificially prepared simulated acid fog (SiAF) or simulated neutral fog (SiNF) for 1 or 7 days. Microarray analysis results suggested that both the SiAF and the SiNF treatments induced the expression of genes involved in the defense and stress responses in rice plants. Induction of such genes was detected in plants treated with SiAF for 1 day, and the number of induced genes increased in plants treated with SiAF for 7 days. The genes for defense and stress responses were also induced by SiNF for 7 days, although they were not induced by SiNF for 1 day. The gene expression profiles of the SiAF-treated and the SiNF-treated plants were compared to those of plants treated with other stress factors. The comparison revealed that both SiAF and SiNF treatments have similar effects to biotic stresses and ozone stress. The genes encoding NADPH oxidase and germin, which function in apoplasts, were also induced by SiAF, SiNF and biotic stresses. These findings suggest that both the SiAF and the SiNF treatments may result in oxidative stress through the apoplastic production of reactive oxygen species.
Directory of Open Access Journals (Sweden)
Tatsuya eKon
2014-11-01
Full Text Available Apple latent spherical virus (ALSV is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the CaMV 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation 0 plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification.
Fritsche, Steffi; Wang, Xingxing; Jung, Christian
2017-01-01
Tocopherols, together with tocotrienols and plastochromanols belong to a group of lipophilic compounds also called tocochromanols or vitamin E. Considered to be one of the most powerful antioxidants, tocochromanols are solely synthesized by photosynthetic organisms including plants, algae, and cyanobacteria and, therefore, are an essential component in the human diet. Tocochromanols potent antioxidative properties are due to their ability to interact with polyunsaturated acyl groups and scavenge lipid peroxyl radicals and quench reactive oxygen species (ROS), thus protecting fatty acids from lipid peroxidation. In the plant model species Arabidopsis thaliana, the required genes for tocopherol biosynthesis and functional roles of tocopherols were elucidated in mutant and transgenic plants. Recent research efforts have led to new outcomes for the vitamin E biosynthetic and related pathways, and new possible alternatives for the biofortification of important crops have been suggested. Here, we review 30 years of research on tocopherols in model and crop species, with emphasis on the improvement of vitamin E content using transgenic approaches and classical breeding. We will discuss future prospects to further improve the nutritional value of our food. PMID:29194404
A new hemoglobin gene from soybean: a role for hemoglobin in all plants
DEFF Research Database (Denmark)
Anderson, C R; Jensen, E O; LLewellyn, D J
1996-01-01
We have isolated a new hemoglobin gene from soybean. It is expressed in cotyledons, stems of seedlings, roots, young leaves, and in some cells in the nodules that are associated with the nitrogen-fixing Bradyrhizobium symbiont. This contrasts with the expression of the leghemoglobins, which...... are active only in the infected cells of the nodules. The deduced protein sequence of the new gene shows only 58% similarity to one of the soybean leghemoglobins, but 85-87% similarity to hemoglobins from the nonlegumes Parasponia, Casuarina, and barley. The pattern of expression and the gene sequence...... indicate that this new gene is a nonsymbiotic legume hemoglobin. The finding of this gene in legumes and similar genes in other species strengthens our previous suggestion that genomes of all plants contain hemoglobin genes. The specialized leghemoglobin gene family may have arisen from a preexisting...
Wang, Zhi; Ke, Qingbo; Kim, Myoung Duck; Kim, Sun Ha; Ji, Chang Yoon; Jeong, Jae Cheol; Lee, Haeng-Soon; Park, Woo Sung; Ahn, Mi-Jeong; Li, Hongbing; Xu, Bingcheng; Deng, Xiping; Lee, Sang-Hoon; Lim, Yong Pyo; Kwak, Sang-Soo
2015-01-01
Alfalfa (Medicago sativa L.), a perennial forage crop with high nutritional content, is widely distributed in various environments worldwide. We recently demonstrated that the sweetpotato Orange gene (IbOr) is involved in increasing carotenoid accumulation and enhancing resistance to multiple abiotic stresses. In this study, in an effort to improve the nutritional quality and environmental stress tolerance of alfalfa, we transferred the IbOr gene into alfalfa (cv. Xinjiang Daye) under the control of an oxidative stress-inducible peroxidase (SWPA2) promoter through Agrobacterium tumefaciens-mediated transformation. Among the 11 transgenic alfalfa lines (referred to as SOR plants), three lines (SOR2, SOR3, and SOR8) selected based on their IbOr transcript levels were examined for their tolerance to methyl viologen (MV)-induced oxidative stress in a leaf disc assay. The SOR plants exhibited less damage in response to MV-mediated oxidative stress and salt stress than non-transgenic plants. The SOR plants also exhibited enhanced tolerance to drought stress, along with higher total carotenoid levels. The results suggest that SOR alfalfa plants would be useful as forage crops with improved nutritional value and increased tolerance to multiple abiotic stresses, which would enhance the development of sustainable agriculture on marginal lands. PMID:25946429
Ethical perception of cross-species gene transfer in plant | Amin ...
African Journals Online (AJOL)
Plants can be genetically modified through a variety of methods in the hope that it will be improved in some way to increase the yield and quality of a crop, or to add nutritional value or shelf life. The development of genetically modified (GM) rice to enrich its nutritional value, such as Vitamin C might involve gene transfer ...
Pandey, Sonika; Patel, Manish Kumar; Mishra, Avinash; Jha, Bhavanath
2016-01-01
Cumin is an annual, herbaceous, medicinal, aromatic, spice glycophyte that contains diverse applications as a food and flavoring additive, and therapeutic agents. An efficient, less time consuming, Agrobacterium-mediated, a tissue culture-independent in planta genetic transformation method was established for the first time using cumin seeds. The SbNHX1 gene, cloned from an extreme halophyte Salicornia brachiata was transformed in cumin using optimized in planta transformation method. The SbNHX1 gene encodes a vacuolar Na+/H+ antiporter and is involved in the compartmentalization of excess Na+ ions into the vacuole and maintenance of ion homeostasis Transgenic cumin plants were confirmed by PCR using gene (SbNHX1, uidA and hptII) specific primers. The single gene integration event and overexpression of the gene were confirmed by Southern hybridization and competitive RT-PCR, respectively. Transgenic lines L3 and L13 showed high expression of the SbNHX1 gene compared to L6 whereas moderate expression was detected in L5 and L10 transgenic lines. Transgenic lines (L3, L5, L10 and L13), overexpressing the SbNHX1 gene, showed higher photosynthetic pigments (chlorophyll a, b and carotenoid), and lower electrolytic leakage, lipid peroxidation (MDA content) and proline content as compared to wild type plants under salinity stress. Though transgenic lines were also affected by salinity stress but performed better compared to WT plants. The ectopic expression of the SbNHX1 gene confirmed enhanced salinity stress tolerance in cumin as compared to wild type plants under stress condition. The present study is the first report of engineering salt tolerance in cumin, so far and the plant may be utilized for the cultivation in saline areas.
Directory of Open Access Journals (Sweden)
Sonika Pandey
Full Text Available Cumin is an annual, herbaceous, medicinal, aromatic, spice glycophyte that contains diverse applications as a food and flavoring additive, and therapeutic agents. An efficient, less time consuming, Agrobacterium-mediated, a tissue culture-independent in planta genetic transformation method was established for the first time using cumin seeds. The SbNHX1 gene, cloned from an extreme halophyte Salicornia brachiata was transformed in cumin using optimized in planta transformation method. The SbNHX1 gene encodes a vacuolar Na+/H+ antiporter and is involved in the compartmentalization of excess Na+ ions into the vacuole and maintenance of ion homeostasis Transgenic cumin plants were confirmed by PCR using gene (SbNHX1, uidA and hptII specific primers. The single gene integration event and overexpression of the gene were confirmed by Southern hybridization and competitive RT-PCR, respectively. Transgenic lines L3 and L13 showed high expression of the SbNHX1 gene compared to L6 whereas moderate expression was detected in L5 and L10 transgenic lines. Transgenic lines (L3, L5, L10 and L13, overexpressing the SbNHX1 gene, showed higher photosynthetic pigments (chlorophyll a, b and carotenoid, and lower electrolytic leakage, lipid peroxidation (MDA content and proline content as compared to wild type plants under salinity stress. Though transgenic lines were also affected by salinity stress but performed better compared to WT plants. The ectopic expression of the SbNHX1 gene confirmed enhanced salinity stress tolerance in cumin as compared to wild type plants under stress condition. The present study is the first report of engineering salt tolerance in cumin, so far and the plant may be utilized for the cultivation in saline areas.
Ayadi, M; Hanana, M; Kharrat, N; Merchaoui, H; Marzoug, R Ben; Lauvergeat, V; Rebaï, A; Mzid, R
2016-10-01
WRKY transcription factors belong to a large family of plant transcriptional regulators whose members have been reported to be involved in a wide range of biological roles including plant development, adaptation to environmental constraints and response to several diseases. However, little or poor information is available about WRKY's in Citrus. The recent release of completely assembled genomes sequences of Citrus sinensis and Citrus clementina and the availability of ESTs sequences from other citrus species allowed us to perform a genome survey for Citrus WRKY proteins. In the present study, we identified 100 WRKY members from C. sinensis (51), C. clementina (48) and Citrus unshiu (1), and analyzed their chromosomal distribution, gene structure, gene duplication, syntenic relation and phylogenetic analysis. A phylogenetic tree of 100 Citrus WRKY sequences with their orthologs from Arabidopsis has distinguished seven groups. The CsWRKY genes were distributed across all ten sweet orange chromosomes. A comprehensive approach and an integrative analysis of Citrus WRKY gene expression revealed variable profiles of expression within tissues and stress conditions indicating functional diversification. Thus, candidate Citrus WRKY genes have been proposed as potentially involved in fruit acidification, essential oil biosynthesis and abiotic/biotic stress tolerance. Our results provided essential prerequisites for further WRKY genes cloning and functional analysis with an aim of citrus crop improvement.
[Genome-wide identification and bioinformatic analysis of PPR gene family in tomato].
Ding, Anming; Li, Ling; Qu, Xu; Sun, Tingting; Chen, Yaqiong; Zong, Peng; Li, Zunqiang; Gong, Daping; Sun, Yuhe
2014-01-01
Pentatricopeptide repeats (PPRs) genes constitute one of the largest gene families in plants, which play a broad and essential role in plant growth and development. In this study, the protein sequences annotated by the tomato (S. lycopersicum L.) genome project were screened with the Pfam PPR sequences. A total of 471 putative PPR-encoding genes were identified. Based on the motifs defined in A. thaliana L., protein structure and conserved sequences for each tomato motif were analyzed. We also analyzed phylogenetic relationship, subcellular localization, expression and GO analysis of the identified gene sequences. Our results demonstrate that tomato PPR gene family contains two subfamilies, P and PLS, each accounting for half of the family. PLS subfamily can be divided into four subclasses i.e., PLS, E, E+ and DYW. Each subclass of sequences forms a clade in the phylogenetic tree. The PPR motifs were found highly conserved among plants. The tomato PPR genes were distributed over 12 chromosomes and most of them lack introns. The majority of PPR proteins harbor mitochondrial or chloroplast localization sequences, whereas GO analysis showed that most PPR proteins participate in RNA-related biological processes.
Hackenberg, C.; Kern, R.; Hüge, J; Stal, L.J.; Tsuji, Y.; Kopka, J.; Shiraiwa, Y.; Bauwe, H.; Hagemann, M.
2011-01-01
Glycolate oxidase (GOX) is an essential enzyme involved in photorespiratory metabolism in plants. In cyanobacteria and green algae, the corresponding reaction is catalyzed by glycolate dehydrogenases (GlcD). The genomes of N2-fixing cyanobacteria, such as Nostoc PCC 7120 and green algae, appear to
Hackenberg, C.; Kern, R.; Hüge, J.; Stal, L.J.; Tsuji, Y.; Kopka, J.; Shiraiwa, Y.; Bauwe, H.; Hagemann, M.
2011-01-01
Glycolate oxidase (GOX) is an essential enzyme involved in photorespiratory metabolism in plants. In cyanobacteria and green algae, the corresponding reaction is catalyzed by glycolate dehydrogenases (GlcD). The genomes of N2-fixing cyanobacteria, such as Nostoc PCC 7120 and green algae, appear to
Manikandan, R; Balakrishnan, N; Sudhakar, D; Udayasuriyan, V
2016-06-01
Bacillus thuringiensis is a major source of insecticidal genes imparting insect resistance in transgenic plants. Level of expression of transgenes in transgenic plants is important to achieve desirable level of resistance against target insects. In order to achieve desirable level of expression, rice chloroplast transit peptide sequence was fused with synthetic cry2AX1 gene to target its protein in chloroplasts. Sixteen PCR positive lines of rice were generated by Agrobacterium mediated transformation using immature embryos. Southern blot hybridization analysis of T 0 transgenic plants confirmed the integration of cry2AX1 gene in two to five locations of rice genome and ELISA demonstrated its expression. Concentration of Cry2AX1 in transgenic rice events ranged 5.0-120 ng/g of fresh leaf tissue. Insect bioassay of T 0 transgenic rice plants against neonate larvae of rice leaffolder showed larval mortality ranging between 20 and 80 % in comparison to control plant. Stable inheritance and expression of cry2AX1 gene was demonstrated in T 1 progenies through Southern and ELISA. In T 1 progenies, the highest concentration of Cry2AX1 and mortality of rice leaffolder larvae were recorded as 150 ng/g of fresh leaf tissue and 80 %, respectively. The Cry2AX1 expression even at a very low concentration (120-150 ng/g) in transgenic rice plants was found effective against rice leaffolder larvae.
Applications of recombinant antibodies in plant pathology.
Ziegler, Angelika; Torrance, Lesley
2002-09-01
Summary Advances in molecular biology have made it possible to produce antibody fragments comprising the binding domains of antibody molecules in diverse heterologous systems, such as Escherichia coli, insect cells, or plants. Antibody fragments specific for a wide range of antigens, including plant pathogens, have been obtained by cloning V-genes from lymphoid tissue, or by selection from large naive phage display libraries, thus avoiding the need for immunization. The antibody fragments have been expressed as fusion proteins to create different functional molecules, and fully recombinant assays have been devised to detect plant viruses. The defined binding properties and unlimited cheap supply of antibody fusion proteins make them useful components of standardized immunoassays. The expression of antibody fragments in plants was shown to confer resistance to several plant pathogens. However, the antibodies usually only slowed the progress of infection and durable 'plantibody' resistance has yet to be demonstrated. In future, it is anticipated that antibody fragments from large libraries will be essential tools in high-throughput approaches to post-genomics research, such as the assignment of gene function, characterization of spatio-temporal patterns of protein expression, and elucidation of protein-protein interactions.
Directory of Open Access Journals (Sweden)
Igor Pottosin
2018-03-01
Full Text Available Oxidative stress signaling is essential for plant adaptation to hostile environments. Previous studies revealed the essentiality of hydroxyl radicals (HO•-induced activation of massive K+ efflux and a smaller Ca2+ influx as an important component of plant adaptation to a broad range of abiotic stresses. Such activation would modify membrane potential making it more negative. Contrary to these expectations, here, we provide experimental evidence that HO• induces a strong depolarization, from −130 to −70 mV, which could only be explained by a substantial HO•-induced efflux of intracellular anions. Application of Gd3+ and NPPB, non-specific blockers of cation and anion conductance, respectively, reduced HO•-induced ion fluxes instantaneously, implying a direct block of the dual conductance. The selectivity of an early instantaneous HO•-induced whole cell current fluctuated from more anionic to more cationic and vice versa, developing a higher cation selectivity at later times. The parallel electroneutral efflux of K+ and anions should underlie a substantial leak of the cellular electrolyte, which may affect the cell’s turgor and metabolic status. The physiological implications of these findings are discussed in the context of cell fate determination, and ROS and cytosolic K+ signaling.
Andria, V.; Yousaf, S.; Reichenauer, T. G.; Smalla, K.; Sessitsch, A.
2009-04-01
Among twenty-six different plant species, Italian ryegrass (Lolium multiflorum var. Taurus), Birdsfoot trefoil (Lotus corniculatus var. Leo), and the combination of both plants performed well in a petroleum oil contaminated soil. Hydrocarbon degrading bacteria were isolated from the rhizosphere, root interior and shoot interior and subjected to the analysis of 16S rRNA, the 16S and 23S rRNA intergenic spacer region and alkane hydroxylase genes. Higher numbers of culturable, degrading bacteria were associated with Italian ryegrass, which were also characterized by a higher diversity, particularly in the plant interior. Only half of the isolated bacteria hosted known alkane hydroxylase genes (alkB and cytochrome P153-like). Our results indicated that alkB genes have spread through horizontal gene transfer, particularly in the Italian ryegrass rhizosphere, and suggested mobility of catabolic genes between Gram-negative and Gram-positive bacteria. We furthermore studied the colonization behaviour of selected hydrocarbon-degrading strains (comprising an endopyhte and a rhizosphere strain) as well as the expression of their alkane monooxygenase genes in association with Italian ryegrass. Results showed that the endophyte strain better colonized the plant, particularly the plant interior, and also showed higher expression of alkB genes suggesting a more efficient degradation of the pollutant. Furthermore, plants inoculated with the endophyte were better able to grow in the presence of diesel. The rhizosphere strain colonized primarily the rhizosphere and showed low alkB gene expression in the plant interior.
Directory of Open Access Journals (Sweden)
Saito Shigeru
2010-05-01
Full Text Available Abstract Background Plant circadian clocks regulate many photoperiodic and diurnal responses that are conserved among plant species. The plant circadian clock system has been uncovered in the model plant, Arabidopsis thaliana, using genetics and systems biology approaches. However, it is still not clear how the clock system had been organized in the evolutionary history of plants. We recently revealed the molecular phylogeny of LHY/CCA1 genes, one of the essential components of the clock system. The aims of this study are to reconstruct the phylogenetic relationships of angiosperm clock-associated PRR genes, the partner of the LHY/CCA1 genes, and to clarify the evolutionary history of the plant clock system in angiosperm lineages. Results In the present study, to investigate the molecular phylogeny of PRR genes, we performed two approaches: reconstruction of phylogenetic trees and examination of syntenic relationships. Phylogenetic analyses revealed that PRR genes had diverged into three clades prior to the speciation of monocots and eudicots. Furthermore, copy numbers of PRR genes have been independently increased in monocots and eudicots as a result of ancient chromosomal duplication events. Conclusions Based on the molecular phylogenies of both PRR genes and LHY/CCA1 genes, we inferred the evolutionary process of the plant clock system in angiosperms. This scenario provides evolutionary information that a common ancestor of monocots and eudicots had retained the basic components required for reconstructing a clock system and that the plant circadian clock may have become a more elaborate mechanism after the speciation of monocots and eudicots because of the gene expansion that resulted from polyploidy events.
Directory of Open Access Journals (Sweden)
James Timothy Y
2009-06-01
Full Text Available Abstract Background Many fungi are obligate biotrophs of plants, growing in live plant tissues, gaining direct access to recently photosynthesized carbon. Photosynthate within plants is transported from source to sink tissues as sucrose, which is hydrolyzed by plant glycosyl hydrolase family 32 enzymes (GH32 into its constituent monosaccharides to meet plant cellular demands. A number of plant pathogenic fungi also use GH32 enzymes to access plant-derived sucrose, but less is known about the sucrose utilization ability of mutualistic and commensal plant biotrophic fungi, such as mycorrhizal and endophytic fungi. The aim of this study was to explore the distribution and abundance of GH32 genes in fungi to understand how sucrose utilization is structured within and among major ecological guilds and evolutionary lineages. Using bioinformatic and PCR-based analyses, we tested for GH32 gene presence in all available fungal genomes and an additional 149 species representing a broad phylogenetic and ecological range of biotrophic fungi. Results We detected 9 lineages of GH32 genes in fungi, 4 of which we describe for the first time. GH32 gene number in fungal genomes ranged from 0–12. Ancestral state reconstruction of GH32 gene abundance showed a strong correlation with nutritional mode, and gene family expansion was observed in several clades of pathogenic filamentous Ascomycota species. GH32 gene number was negatively correlated with animal pathogenicity and positively correlated with plant biotrophy, with the notable exception of mycorrhizal taxa. Few mycorrhizal species were found to have GH32 genes as compared to other guilds of plant-associated fungi, such as pathogens, endophytes and lichen-forming fungi. GH32 genes were also more prevalent in the Ascomycota than in the Basidiomycota. Conclusion We found a strong signature of both ecological strategy and phylogeny on GH32 gene number in fungi. These data suggest that plant biotrophic fungi
Yilamujiang, Ayufu; Reichelt, Michael; Mithöfer, Axel
2016-08-01
Carnivorous Nepenthes plants use modified leaves forming pitfall traps to capture and digest prey, mainly insects, for additional nutrient supply. These traps, so called pitchers, contain a plant-derived fluid composed of many hydrolytic enzymes and defence-related proteins. In this study, the prey-induced induction of corresponding genes of those proteins and a role for phytohormones in this process was analysed. Tissue from insect prey-fed, chitin- and phytohormone-challenged pitchers was harvested and analysed for selected gene expressions by a quantitative PCR technique. Phytohormone levels were determined by LC-MS/MS. Nepenthesin proteolytic activities were measured in the digestive fluid using a fluorescence substrate. Insect prey in the pitchers induced the accumulation of phytohormones such as jasmonates as well as the transcription of studied genes encoding a chitinase 3 and a protease (nepenthesin I), whereas a defence-related protein (PR-1) gene was not induced. Treatment with chitin as a component of the insects' exoskeleton triggered the accumulation of jasmonates, the expression of nepenthesin I and chitinase 3 genes similar to jasmonic acid treatment, and induced protease activity in the fluid. All detectable responses were slowly induced. The results suggest that upon insect prey catch a sequence of signals is initiated: (1) insect-derived chitin, (2) jasmonate as endogenous phytohormone signal, (3) the induction of digestive gene expression and (4) protein expression. This resembles a similar hierarchy of events as described from plant pathogen/herbivore interactions, supporting the idea that carnivory evolved from plant defences. © The Author 2016. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Gaoyi Cao
Full Text Available A key enzyme in the shikimate pathway, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS is the primary target of the broad-spectrum herbicide glyphosate. Identification of new aroA genes coding for EPSPS with a high level of glyphosate tolerance is essential for the development of glyphosate-tolerant crops. In the present study, the glyphosate tolerance of five bacterial aroA genes was evaluated in the E. coli aroA-defective strain ER2799 and in transgenic tobacco plants. All five aroA genes could complement the aroA-defective strain ER2799, and AM79 aroA showed the highest glyphosate tolerance. Although glyphosate treatment inhibited the growth of both WT and transgenic tobacco plants, transgenic plants expressing AM79 aroA tolerated higher concentration of glyphosate and had a higher fresh weight and survival rate than plants expressing other aroA genes. When treated with high concentration of glyphosate, lower shikimate content was detected in the leaves of transgenic plants expressing AM79 aroA than transgenic plants expressing other aroA genes. These results suggest that AM79 aroA could be a good candidate for the development of transgenic glyphosate-tolerant crops.
Li, Xiao-Jie; Li, Mo; Zhou, Ying; Hu, Shan; Hu, Rong; Chen, Yun; Li, Xue-Bao
2015-01-01
RAV (related to ABI3/VP1) protein containing an AP2 domain in the N-terminal region and a B3 domain in the C-terminal region, which belongs to AP2 transcription factor family, is unique in higher plants. In this study, a gene (GhRAV1) encoding a RAV protein of 357 amino acids was identified in cotton (Gossypium hirsutum). Transient expression analysis of the eGFP:GhRAV1 fusion genes in tobacco (Nicotiana tabacum) epidermal cells revealed that GhRAV1 protein was localized in the cell nucleus. Quantitative RT-PCR analysis indicated that expression of GhRAV1 in cotton is induced by abscisic acid (ABA), NaCl and polyethylene glycol (PEG). Overexpression of GhRAV1 in Arabidopsis resulted in plant sensitive to ABA, NaCl and PEG. With abscisic acid (ABA) treatment, seed germination and green seedling rates of the GhRAV1 transgenic plants were remarkably lower than those of wild type. In the presence of NaCl, the seed germination and seedling growth of the GhRAV1 transgenic lines were inhibited greater than those of wild type. And chlorophyll content and maximum photochemical efficiency of the transgenic plants were significantly lower than those of wild type. Under drought stress, the GhRAV1 transgenic plants displayed more severe wilting than wild type. Furthermore, expressions of the stress-related genes were altered in the GhRAV1 transgenic Arabidopsis plants under high salinity and drought stresses. Collectively, our data suggested that GhRAV1 may be involved in response to high salinity and drought stresses through regulating expressions of the stress-related genes during cotton development.
Aguado, Ana; Capote, Nieves; Romero, Fernando; Dodd, Ian C; Colmenero-Flores, José M
2014-10-01
To investigate effects of soil moisture heterogeneity on plant physiology and gene expression in roots and leaves, three treatments were implemented in sunflower plants growing with roots split between two compartments: a control (C) treatment supplying 100% of plant evapotranspiration, and two treatments receiving 50% of plant evapotranspiration, either evenly distributed to both compartments (deficit irrigation - DI) or unevenly distributed to ensure distinct wet and dry compartments (partial rootzone drying - PRD). Plants receiving the same amount of water responded differently under the two irrigation systems. After 3 days, evapotranspiration was similar in C and DI, but 20% less in PRD, concomitant with decreased leaf water potential (Ψleaf) and increased leaf xylem ABA concentration. Six water-stress responsive genes were highly induced in roots growing in the drying soil compartment of PRD plants, and their expression was best correlated with local soil water content. On the other hand, foliar gene expression differed significantly from that of the root and correlated better with xylem ABA concentration and Ψleaf. While the PRD irrigation strategy triggered stronger physiological and molecular responses, suggesting a more intense and systemic stress reaction due to local dehydration of the dry compartment of PRD plants, the DI strategy resulted in similar water savings without strongly inducing these responses. Correlating physiological and molecular responses in PRD/DI plants may provide insights into the severity and location of water deficits and may enable a better understanding of long-distance signalling mechanisms. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Gao, Xuan; Walworth, Aaron E; Mackie, Charity; Song, Guo-Qing
2016-01-01
Flowering locus T ( FT ) is a primary integrator in the regulation of plant flowering. Overexpressing a blueberry ( Vaccinium corymbosum L.) FT gene ( VcFT ) (herein VcFT -OX) resulted in early flowering and dwarfing in 'Aurora' plants (herein 'VcFT-Aurora'). In this study, we found that VcFT -OX reduced shoot regeneration from leaf explants. To investigate the potential roles of the phytohormone pathway genes associated with VcFT -OX, differentially expressed ( DE ) genes in leaf tissues of 'VcFT-Aurora' plants were annotated and analyzed using non-transgenic 'Aurora' plants as a control. Three DE floral genes, including the blueberry SUPPRESSOR of Overexpression of constans 1 ( VcSOC1 ) (gibberellin related), Abscisic acid responsive elements-binding factor 2 ( VcABF2 ) and protein related to ABI3/VP1 ( VcABI3/VP1 ) (ethylene-related), are present under both the phytohormone-responsive and the dwarfing-related Gene Ontology terms. The gene networks of the DE genes overall showed the molecular basis of the multifunctional aspects of VcFT overexpression beyond flowering promotion and suggested that phytohormone changes could be signaling molecules with important roles in the phenotypic changes driven by VcFT -OX.
DEFF Research Database (Denmark)
Lopez, Javiera; Essus, Karen; Kim, Il-Kwon
2015-01-01
cells. The additional integration of the carotenoid cleavage dioxygenase gene from the plant Petunia hybrida (PhCCD1) let to the production of low amounts of beta-ionone (0.073 ± 0.01 mg/g DCW) and changed the color of the strain from orange to yellow. The expression of the crtYB gene from a high copy......, the carotenogenic crtYB, crtI genes and the plant PhCCD1 gene-the highest β-ionone concentration reported to date by a cell factory was achieved. This microbial cell factory represents a starting point for flavor production by a sustainable and efficient process that could replace current methods.......Background: Apocarotenoids, like the C13-norisoprenoids, are natural compounds that contribute to the flavor and/or aroma of flowers and foods. They are produced in aromatic plants-like raspberries and roses-by the enzymatic cleavage of carotenes. Due to their pleasant aroma and flavour...
Exploring Plant Co-Expression and Gene-Gene Interactions with CORNET 3.0.
Van Bel, Michiel; Coppens, Frederik
2017-01-01
Selecting and filtering a reference expression and interaction dataset when studying specific pathways and regulatory interactions can be a very time-consuming and error-prone task. In order to reduce the duplicated efforts required to amass such datasets, we have created the CORNET (CORrelation NETworks) platform which allows for easy access to a wide variety of data types: coexpression data, protein-protein interactions, regulatory interactions, and functional annotations. The CORNET platform outputs its results in either text format or through the Cytoscape framework, which is automatically launched by the CORNET website.CORNET 3.0 is the third iteration of the web platform designed for the user exploration of the coexpression space of plant genomes, with a focus on the model species Arabidopsis thaliana. Here we describe the platform: the tools, data, and best practices when using the platform. We indicate how the platform can be used to infer networks from a set of input genes, such as upregulated genes from an expression experiment. By exploring the network, new target and regulator genes can be discovered, allowing for follow-up experiments and more in-depth study. We also indicate how to avoid common pitfalls when evaluating the networks and how to avoid over interpretation of the results.All CORNET versions are available at http://bioinformatics.psb.ugent.be/cornet/ .
Ji, Jing; Wang, Gang; Wang, Jiehua; Wang, Ping
2009-02-01
Carotenoids are red, yellow and orange pigments, which are widely distributed in nature and are especially abundant in yellow-orange fruits and vegetables and dark green leafy vegetables. Carotenoids are essential for photosynthesis and photoprotection in plant life and also have different beneficial effects in humans and animals (van den Berg et al. 2000). For example, beta-carotene plays an essential role as the main dietary source of vitamin A. To obtain further insight into beta-carotene biosynthesis in two important economic plant species, Lycium barbarum and Gentiana lutea L., and to investigate and prioritize potential genetic engineering targets in the pathway, the effects of five carotenogenic genes from these two species, encoding proteins including geranylgeranyl diphosphate synthase, phytoene synthase and delta-carotene desaturase gene, lycopene beta-cyclase, lycopene epsilon-cyclase were functionally analyzed in transgenic tobacco (Nicotiana tabacum) plants. All transgenic tobacco plants constitutively expressing these genes showed enhanced beta-carotene contents in their leaves and flowers to different extents. The addictive effects of co-ordinate expression of double transgenes have also been investigated.
Genome-wide identification and evolution of the PIN-FORMED (PIN) gene family in Glycine max.
Liu, Yuan; Wei, Haichao
2017-07-01
Soybean (Glycine max) is one of the most important crop plants. Wild and cultivated soybean varieties have significant differences worth further investigation, such as plant morphology, seed size, and seed coat development; these characters may be related to auxin biology. The PIN gene family encodes essential transport proteins in cell-to-cell auxin transport, but little research on soybean PIN genes (GmPIN genes) has been done, especially with respect to the evolution and differences between wild and cultivated soybean. In this study, we retrieved 23 GmPIN genes from the latest updated G. max genome database; six GmPIN protein sequences were changed compared with the previous database. Based on the Plant Genome Duplication Database, 18 GmPIN genes have been involved in segment duplication. Three pairs of GmPIN genes arose after the second soybean genome duplication, and six occurred after the first genome duplication. The duplicated GmPIN genes retained similar expression patterns. All the duplicated GmPIN genes experienced purifying selection (K a /K s genome sequence of 17 wild and 14 cultivated soybean varieties. Our research provides useful and comprehensive basic information for understanding GmPIN genes.
Yang, Guangxiao; Komatsu, Setsuko
2016-01-01
Brassinosteroid (BR) and gibberellin (GA) are two groups of plant growth regulators essential for normal plant growth and development. To gain insight into the molecular mechanism by which BR and GA regulate the growth and development of plants, especially the monocot plant rice, it is necessary to identify and analyze more genes and proteins that are regulated by them. With the availability of draft sequences of two major types, japonica and indica rice, it has become possible to analyze exp...
DEFF Research Database (Denmark)
Makarova, Olga; MacLean, Allyson M.; Nicolaisen, Mogens
2015-01-01
a role in host adaptation. 74 genes were up-regulated in insects and included genes involved in stress response, phospholipid synthesis, malate and pyruvate metabolism, hemolysin and transporter genes, multiple copies of thymidylate kinase, sigma factor and Zn-proteases genes. In plants, 34 genes...... encoding an immune dominant membrane protein, membrane-associated proteins, and multidrug resistance ABC-type transporters, were up-regulated. Differential regulation of gene expression thus appears to play an important role in host adaptation of phytoplasmas....